Characterization of spliced leader genes of Trypanosoma(Megatrypanum) theileri : phylogeographical analysis ofBrazilian isolates from cattle supports spatial clustering

of genotypes and parity with ribosomal markers

A. C. RODRIGUES1, H. A. GARCIA1, J. S. BATISTA2, A. H. H. MINERVINO3,

G. GOES-CAVALCANTE4, F. MAIA DA SILVA1, R. C. FERREIRA1, M. CAMPANER1,

F. PAIVA5 and M. M. G. TEIXEIRA1*

1Departamento de Parasitologia, Universidade de Sao Paulo, Sao Paulo, SP, 05508-900, Brasil2Departamento de Ciencias Animais, Laboratorio de Patologia Veterinaria, Universidade Federal Rural do Semi-Arido,RN, 59625-900, Brasil3Faculdade de Medicina Veterinaria e Zootecnia, Universidade de Sao Paulo, SP, 05508-900, Brasil4Central de Diagnostico Veterinario, Universidade Federal do Para, PA, 66080-000, Brasil5Departamento de Parasitologia Veterinaria, Universidade Federal do Mato Grosso do Sul, MS, 79070-900, Brasil

(Received 20 May 2009; revised 30 June 2009; accepted 1 July 2009; first published online 21 September 2009)

SUMMARY

Trypanosoma (Megatrypanum) theileri from cattle and trypanosomes of other artiodactyls form a clade of closely related

species in analyses using ribosomal sequences. Analysis of polymorphic sequences of a larger number of trypanosomes from

broader geographical origins is required to evaluate the clustering of isolates as suggested by previous studies. Here, we

determined the sequences of the spliced leader (SL) genes of 21 isolates from cattle and 2 from water buffalo from distant

regions of Brazil. Analysis of SL gene repeats revealed that the 5S rRNA gene is inserted within the intergenic region.

Phylogeographical patterns inferred using SL sequences showed at least 5 major genotypes of T. theileri distributed in

2 strongly divergent lineages. Lineage TthI comprises genotypes IA and IB from buffalo and cattle, respectively, from the

Southeast and Central regions, whereas genotype IC is restricted to cattle from the Southern region. Lineage TthII

includes cattle genotypes IIA, which is restricted to the North and Northeast, and IIB, found in the Centre, West, North

and Northeast. PCR-RFLP of SL genes revealed valuable markers for genotyping T. theileri. The results of this study

emphasize the genetic complexity and corroborate the geographical structuring of T. theileri genotypes found in cattle.

Key words: Trypanosoma theileri, spliced leader gene, ITS rDNA, phylogeny, evolution, phylogeography, bovids,

populational structure.

INTRODUCTION

Trypanosoma (Megatrypanum) theileri is a cosmo-

politan parasite of cattle with a high prevalence

on every continent except Antarctica. Tabanidae

(Diptera) are thought to be the most important

vectors of T. theileri; the parasites develop in their

digestive tract and are then transmitted by a con-

taminative route (Hoare, 1972; Bose and Heister,

1993). This species is not considered pathogenic,

despite the fact that it induces chronic infections and

is a potential factor in illness when associated with

concurrent diseases (Schafler, 1979; Doherty et al.

1993; Seifi, 1995). There are still many unclear

aspects of host and parasite interactions, including

immune response and evasion strategies, and the

multiplication of T. theileri in mammalian hosts.

Morphology is the traditional taxonomic criterion

for the classification of T. theileri and allied species,

which comprise trypanosomes that share large blood

trypomastigotes, restricted mammalian hosts, world-

wide distribution, lack of pathogenicity and con-

taminative transmission by tabanid or hippoboscid

flies (Hoare, 1972; Wells, 1976). We demonstrated

through phylogenetic analysis thatT. theileri of cattle

(Bos taurus) from distinct regions of America (Brazil

and USA), Europe (Scotland and Germany) and

Asia (Japan) were highly related phylogenetically

and tightly clustered into the T. theileri clade, a

homogeneous and strongly supported monophyletic

assemblage exclusive to artiodactyls whose position

is well resolved in the genus Trypanosoma (Rodrigues

et al. 2006). T. theileri from cattle grouped together

withT. theileri-like trypanosomes fromwater buffalo

* Corresponding author: Departamento de Parasitologia,Instituto de Ciencias Biomedicas, Universidade de SaoPaulo, Sao Paulo, SP, 05508-900, Brasil. Tel:+55 11 30917268. Fax: +55 11 3091 7417. E-mail : mmgteix@icb.usp.br

111

Parasitology (2010), 137, 111–122. f Cambridge University Press 2009

doi:10.1017/S0031182009991053 Printed in the United Kingdom

(Brazil), deer (Europe and Asia) and antelopes

(Africa), forming the T. theileri clade in phylogenies

inferred using SSU rRNA and gGAPDH genes. In

all analyses, this clade was positioned well apart from

species infecting orders other than Artiodactyla,

which were morphologically classified as T. (Mega-

trypanum) (Stevens et al. 1999; Rodrigues et al. 2006;

Hatama et al. 2007; Hamilton et al. 2007, 2009).

Discovery of a strongly supported monophyletic

assemblage formed by very closely phylogenetically

related and morphologically similar trypanosomes,

all from ruminant artiodactyls but from distinct

species and with widespread geographical distri-

bution (Rodrigues et al. 2006), allowed validation of

the subgenus T. (Megatrypanum) with T. theileri

as its type species, as established by Hoare (1972).

Experimental infections and positioning of tabanid-

infecting trypanosomes together with T. theileri in

phylogenetic analysis corroborated these flies as

vectors of T. theileri (Bose et al. 1987; Wells, 1976;

Rodrigues et al. 2006).

Phylogenies based on SSU and ITS1 rDNA se-

quences revealed a complex branching pattern within

the clade T. theileri, with separation of the isolates

into 5 lineages: (A) represented by genotypes found

in Brazilian water buffalo; (B) and (C) consisting

of 2 divergent genotypes found in Brazilian cattle

isolates; and (D) and (E), genotypes assigned to

European cattle and deer isolates, respectively

(Rodrigues et al. 2006). Recently, African T. theileri

trypanosomes of ‘antelopes’ were compared using

V7-V8 rDNA, and 1 isolate from sitatunga was

assigned to a new lineage F, whereas isolates from

duikers were assigned to lineages (C) or (E) despite

also showing unique genotypes (Hamilton et al.

2009). Description of species allied to T. theileri was

based on host restriction, which was experimentally

demonstrated for trypanosomes infecting cattle, sheep

and goats (Hoare, 1972; Wells, 1976). However, the

existence of separate species and/or lineages restric-

ted to host species and/or geographical origin has

not been corroborated by SSU rRNA phylogenies,

which support the polyphyly of cattle isolates and

close relationships among isolates from distinct host

species from distinct continents (Rodrigues et al.

2003, 2006; Hamilton et al. 2007, 2009).

Analysis of genes that are more polymorphic than

SSU rRNA of a larger number of trypanosomes of

the T. theileri clade, from broader host species and

geographical origins, can help to evaluate genotype

diversity and lineage segregation associated with host

and/or geographical origin. Previous analysis using

the more variable ITS rDNA sequences already

distinguished cryptic genotypes that had remained

undiscovered using conserved SSU rDNA genes in

T. theileri (Rodrigues et al. 2006),T. rangeli (Maia da

Silva et al. 2007) and T. vivax (Cortez et al. 2006).

Although the full phylogenetic range is unknown,

trans-splicing in Euglenozoa has been described as a

mechanism for the generation of mature messenger

RNAs (mRNAs): the 5k ends of precursor mRNAs

are replaced by a short spliced leader (SL) exon from

a small SL RNA. SL RNA repeats are organized as

large multicopy tandem arrays and have been used as

taxonomic markers for trypanosomatids of several

genera (Fernandes et al. 1997; Serrano et al. 1999a, b ;

Podlipaev et al. 2004; Westenberger et al. 2004;

Thomas et al. 2005; Maslov et al. 2007). Moreover,

SL sequences have been valuable for genotyping and

analysis of genetic relatedness and populational

structure of T. cruzi (Souto et al. 1996; Fernandes

et al. 2001; Brisse et al. 2001; Westenberger et al.

2006; Herrera et al. 2007; Mejıa-Jaramillo et al.

2009; Falla et al. 2009), T. rangeli (Urrea et al. 2005;

Maia da Silva et al. 2007, 2009) and T. vivax

(Ventura et al. 2001) isolates. The potential for using

the SL gene as a marker for phylogenetic analysis of

the genus Trypanosoma was assessed in a previous

study in which comparison of 27 trypanosomes re-

vealed the SL intergenic region to be far too variable

for informative comparison of any but the most

closely related trypanosomes (Gibson et al. 2000).

At present, available sequences (GenBank) of

whole repeats of the SL genes of trypanosomes from

mammals are restricted to T. cruzi, T. rangeli,

T. brucei, T. congolense, T. vivax, T. conorhini and

T. lewisi, while data from other species are limited to

the small transcript regions, which are only available

for European T. theileri from cattle and deer, and

consist of y200 bp from a whole SL repeat of

y900 bp (Gibson et al. 2000). Analysis of entire SL

repeats of T. theileri and related species are essential

to elucidate the organization of the SL repeats, and

intergenic regions of the SL gene are valuable for the

assessment of the genetic variability of trypanosomes

from different hosts and geographical regions. Here,

we characterized whole SL repeats of Brazilian iso-

lates of T. theileri, including 21 isolates from cattle

and 2 from water buffalo, from a wide range of

geographical origins, with the aim of investigating:

(a) genotype diversity; (b) phylogeographical pat-

terns; and (c) the congruence of phylogenetic analy-

ses and parity of taxonomic markers based on SL and

ribosomal genes.

MATERIALS AND METHODS

Origin and growth of T. theileri isolates

In this study, we characterized SL genes from a total

of 23 cultures of Brazilian T. theileri isolates.

Thirteen new isolates in this study were obtained

from cattle : 8 were from cross-bred dairy cattle from

the Northeast states of Paraıba (PB) and Rio Grande

do Norte (RN), 3 were from zebuine beef cattle, and

2 were from cross-bred dairy cattle from the state of

Para (PA). New isolates were obtained by haemo-

culture as previously described (Rodrigues et al.

A. C. Rodrigues and others 112

2003). We also included in this study 8 T. theileri

isolates from a previous study (Rodrigues et al.

2003, 2006), which were obtained from taurine beef

cattle from the Southern (states of Rio Grande do

Sul – RS, and Parana – PR) and Southeastern (Sao

Paulo – SP) regions, cross-bred beef cattle from the

Northwest (Rondonia – RO) and zebuine beef cattle

from the Central (Mato Grosso do Sul – MS) region.

We also characterized SL genes from 2 isolates from

water buffalo (Bubalus bubalis) from MS (Pantanal)

and SP (Vale do Ribeira), also from our previous

studies (Rodrigues et al. 2003, 2006) (Fig. 1;

Table 1). Additional cattle and buffalo isolates were

tested by genotyping methods based on SL and ITS

rDNA sequences (Table 1).

PCR amplification of SL and ribosomal sequences

Trypanosome DNA used as template for PCR am-

plification was obtained from cultured trypanosomes

by the classical method of phenol-chloroform ex-

traction. The location of the oligonucleotides em-

ployed as primers for PCR amplification of the SL

gene is depicted in Fig. 2C. Amplification of whole

SL gene repeats (y900 bp) was performed using

LSL1 (TTCTGTACTTCATGGTATG) and

LSL2 (CCAATGAAGTACAGAAACTG) primers

with 2.0 mM of each primer in 50 ml reaction mixtures

containing 50 ng of DNA, 200 mM of each dNTP

and 2.5 units of Taq DNA polymerase. PCR

amplification of partial SL sequences (y400 bp),

Fig. 1. Phylogeographical analysis of Brazilian Trypanosoma theileri isolates. (A) Geographical origin of 32 isolates from

cattle and water buffalo used in this study. (B) Neighbour-joining tree of the most divergent SL sequences (49

sequences from 23 isolates) showing geographical structuring of T. theileri population clustered in lineages TthI and

TthII comprising genotypes TthIA-C and TthIIA-B. Symbols correspond to T. theileri genotypes TthIA (1), TthIB

(&), TthIC (m), TthIIA (#) and TthIIB ($). The codes used for SL sequences indicate the number of T. theileri

isolates from cattle (Tthc) or buffalo (Tthb) in the Trypanosomatid Culture Collection, followed by the number of

cloned and sequenced SL gene repeats. *Indicates 2 mixed cultures showing sequences from both genotypes IIA and

IIB. The numbers at the nodes correspond to the percentage bootstrap support values derived from 100 replicates

respectively for NJ and ML analyses.

Phylogeography of T. theileri trypanosomes 113

Table 1. Trypanosoma theileri trypanosomes used in this study and genotypes (TthIA-C and TthIIA-B) defined based on SL and ribosomal (SSU rDNA and

ITS rDNA) sequences

T. theileriisolatesa TryCC

Hostorigin Geographical origin

Genotypingb based onribosomal and SL genes

V7V8rDNA SL

PCR-RFLP GenBank Accession number

ITSrDNA SL SL ITS SSU

Tthb4 162 buffalo Southeast (SP, Registro) A — IA IA Nd AY773701 AY773675Tthb6 165 buffalo Southeast (SP, Jacupiranga) A IA IA IA GQ162117-GQ162119* AY773699 AY773676Tthb13 — buffalo Central (MS, Dourados) A IA IA IA GQ162120-GQ162121* AY773703 AY773678Tthb12 — buffalo Central (MS, Dourados) A — IA IA Nd AY773702 AY773677Tthc22 — cattle Southeast (SP, Aracatuba) B2 — IB IB Nd Nd AY773688Tthc2 171 cattle Southeast (SP, Jacupiranga) B2 — IB IB Nd AY773707 AY773679Tthc3 161 cattle Southeast (SP, Eldorado) B2 IB IB IB GQ162125-GQ162127* AY773698 AY773681Tthc15 301 cattle Central (MS, Miranda) B2 IB IB IB GQ162122-GQ162124* Nd AY773686Tthc16 302 cattle Central (MS, Miranda) B2 — IB IB Nd AY773708 AY773687Tthc17 296 cattle Central (MS, Miranda) B2 — IB IB Nd Nd AY773693Tthc8 — cattle Southern (RS, Porto Alegre) B1 — IC IC Nd AY773704 AY773682Tthc9 — cattle Southern (PR, Londrina) B1 IC IC IC GQ162130-GQ162132* AY773705 AY773683Tthc10 — cattle Southern (PR, Londrina) B1 IC IC IC GQ162128-GQ162129* AY773706 AY773684

Tthc30 1460 cattle Northeast (RN, Mossoro) C IIA IIA IIA GQ162133-GQ162134* GQ176146* GQ176157*Tthc32 1462 cattle Northeast (RN, Mossoro) C IIA IIA IIA GQ162135-GQ162137* GQ176147* GQ176158*Tthc37 1787 cattle North (PA, Castanhal) C IIA IIA IIA GQ162138-GQ162140* GQ176148* GQ176159*Tthc5 — cattle Central (MS, Dourados) C IIB IIB IIB GQ162143* AY773711 AY773689Tthc12 298 cattle Central (MS, Miranda) C — IIB IIB Nd AY773712 AY773690Tthc14 299 cattle Central (MS, Miranda) C IIB IIB IIB GQ162144* AY773709 AY773692Tthc18 359 cattle West (RO, Monte Negro) C IIB IIB IIB GQ162145-GQ162146* AY773713 AY773694Tthc19 360 cattle West (RO, Monte Negro) C IIB IIB IIB GQ162147-GQ162148* AY773710 AY773695Tthc23 796 cattle Northeast (PB, Sao Mamede) — IIB IIB IIB GQ162149-GQ162151* Nd NdTthc24 797 cattle Northeast (PB, Sao Mamede) C IIB IIB IIB GQ162152-GQ162153* Nd GQ176152*Tthc25 798 cattle Northeast (PB, Patos) C IIB IIB IIB GQ162154* Nd GQ176154*Tthc26 799 cattle Northeast (PB, Catole-Rocha) C — IIB IIB Nd Nd GQ176153*Tthc27 1091 cattle Northeast (PB, Catole-Rocha) — IIB IIB IIB GQ162158-GQ162159* Nd NdTthc28 1458 cattle Northeast (RN, Mossoro) C IIB IIB IIB GQ162155* Nd GQ176155*Tthc29 1459 cattle Northeast (RN, Mossoro) C IIB IIB IIB GQ162156-GQ162157* Nd GQ176156*Tthc38 1788 cattle North (PA, Castanhal) C IIB IIB IIB GQ162141-GQ162142* GQ176149* GQ176160*Tthc39 — cattle North (PA, Santarem) — IIB IIB IIB GQ162160-GQ162162* GQ176150* NdTthc40 — cattle North (PA, Santarem) — IIB IIB IIB GQ162163-GQ162164* Nd NdTthc41 — cattle North (PA, Santarem) — IIB IIB IIB GQ162165-GQ162166* GQ176151* Nd

TryCC, code number at Trypanosomatid Culture Collection from the Department of Parasitology, University of Sao Paulo, ICBII, Brazil.a, Tthc, isolates from cattle; Tthb, isolates from water buffalo.b, Genotypes of T. theileri lineages TthI (IA-C) and TthII (IIA-B).Nd, sequences not determined, isolates were genotyped using one or more sequences from the different molecular markers used in this study: SL or V7V8 or ITSrDNA genes.* Sequences determined in the present study.

A.C.Rodrigu

esandoth

ers114

corresponding to the transcript region of SL plus

y270 bp of a contiguous intergenic region between

the intron and the 5S rDNA sequences, was carried

out using LSL1 and TthSLR (GGCAAAA(A/G)

T(G/C)ACCAA(A/C)AC) primers. PCR conditions

were the same for both reactions and consisted of 30

cycles as follows: 1 min at 94 xC, 2 min at 50 xC and

2 min at 72 xC (with an initial cycle of 3 min at 94 xC

and a final cycle of 10 min at 72 xC). PCR products

were eletrophoresed in a 2% agarose gel and stained

with ethidium bromide. PCR-amplification of V7-

V8 SSU rDNA and ITS rDNA of the newT. theileri

isolates were performed as previously described

(Rodrigues et al. 2006).

Sequencing and data analyses

PCR-amplified fragments of whole SL repeats from

cattle and buffalo isolates were purified (Spin-X,

Costar) from agarose gels and cloned, and 3–7 clones

from each isolate were sequenced using the internal

primersTthSLR (GGCAAAA(A/G)T(G/C)ACCAA

(A/C)AC) and TthSLF (GGGT(G/T)TTGGT

(G/C)AC(G/T)TTTTGCC). The sequences ob-

tained were aligned with sequences from GenBank

using ClustalX (Thompson et al. 1997). The result-

ing alignments were manually refined. Poly(A) tails

of SL transcripts were removed from final SL gene

alignments. Sequences of V7-V8 SSU rDNA and

Fig. 2. (A) Alignment of SL transcript sequences from 5 main genotypes Trypanosoma theileri trypanosomes. The 39 nt

corresponding to the exon sequences are in bold type within a grey box. Within the intron sequences, the conserved

CUUCC motif is boxed, and the GG motifs demarcating stem–loop II and the Sm binding sites are underlined. Dots

indicate identical nucleotides. (B) SL RNA structure of isolate Tthb6 from water buffalo with the splice donor site

indicated by an arrow. (C) Schematic diagram of the SL gene showing the exon, intron and intergenic regions, and

annealing sequences for oligonucleotides used as primers for PCRs. (D) Alignment of 5S rDNA sequences inserted

within the intergenic regions of SL repeats of T. theileri trypanosomes.

Phylogeography of T. theileri trypanosomes 115

ITS rDNAwere determined as previously described

(Rodrigues et al. 2006). Six alignments were created:

(1) whole SL (wSL) sequences; (2) exon and intron

(SL transcript) sequences; (3) SL transcript plus

intergenic sequence between intron and 5S rRNA;

(4) ITS1 rDNA sequences; (5) V7V8 SSU rDNA

sequences from 30 T. theileri trypanosomes from

distinct host species; and (6) concatenated alignment

generated by SL transcripts plus 5S and ITS1 rDNA

data sets. Accession numbers of the GenBank se-

quences, including those determined in this study,

are listed in Table 1.

Phylogenetic inferences were carried out by

the parsimony (P) and maximum likelihood (ML)

methods, and cluster analysis was performed using

neighbour-joining (NJ) distances. TheNJ trees were

estimated for alignments 1 and 3 using the Kimura 2

Parameter algorithm in Mega 4 software, and nodal

support was estimated with 500 bootstrap replicates.

Parsimony and bootstrap analyses were employed for

all alignments and carried out using PAUP* 4.0b10

(Swofford, 2002) with 100 replicates of a random

addition sequence followed by branch swapping

(RAS-TBR), as previously described (Ferreira et al.

2007). ML analyses were performed for alignments

1, 4, 5 and 6 using RAxML v.7.0.4 (Stamatakis,

2006), as previously shown (Ferreira et al. 2007).

Tree searches used the general time reversible (GTR)

model of nucleotide substitution with proportion

of invariable sites and gamma distribution, with 500

maximum parsimony starting trees. Model par-

ameters were estimated in RAxML over the duration

of the tree search and nodal support was estimated

with 300 bootstrap replicates. RNA structures were

predicted using the RNAdraw program (Matzura

and Wennborg, 1996).

Restriction analysis of PCR-amplified SL repeat and

ITS rDNA (PCR-RFLP)

Polymorphisms on the aligned whole SL gene se-

quences of T. theileri trypanosomes were investi-

gated using the software Webcutter 2.0 (Heiman,

1997) to detect restriction enzyme sites that gener-

ated DNA fragments of different length according

to clades/lineages. For restriction analysis, amplified

DNA corresponding to whole repeats of SL and

entire ITS rDNA genes were both digested with

BshI 1236 enzyme (Fermentas) ; the resulting DNA

fragments were analysed on 2.5% agarose gels stained

with ethidium bromide, as previously described

(Rodrigues et al. 2006).

RESULTS

Structural and sequence characterization of SL

repeats from T. theileri trypanosomes

Full-length SL unit repeats were PCR-amplified

from DNA of Brazilian T. theileri trypanosomes

from cattle (21 isolates) and water buffalo (2 isolates),

including isolates representative of lineages A, B

and C previously defined by ribosomal markers

(Rodrigues et al. 2006). SL repeats (y900 bp) of

similar lengths were observed for all T. theileri

trypanosomes in agarose gels, as was previously

shown for European T. theileri from cattle and re-

latedT. theileri-like trypanosomes fromdeer (Gibson

et al. 2000). However, sequences showed significant

length variability among previously defined ribo-

somal lineages (Rodrigues et al. 2006), enabling the

identification of the 5 genotypes defined in the

present study according to polymorphism on the

SL gene. The SL repeats of the various genotypes

ranged from 855 to 940 bp. SL repeats of y860 bp

were found for the genotypes TthIA/B, which cor-

respond to previously defined ribosomal lineages A

and B2; 927 bp for TthIC, formerly lineage B1;

855 bp for TthIIB, comprising isolates assigned to

ribosomal lineage C; and 940 bp for TthIIA isolates,

not included in our previous study using ribosomal

genes (Rodrigues et al. 2006) but also assigned to

ribosomal lineage C in the present study (Table 1).

We determined a total of 98 sequences of whole SL

genes, 3–5 from each of the 23 isolates examined, and

76 sequences were found to be unique. Comparison

of SL repeats revealed an identical exon (39 nucleo-

tides) shared by T. theileri from cattle and allied

species fromwater buffalo and fallow deer. However,

the intron sequences varied from 94 bp (TthI) to

98 bp (TthII). The intron and exon sequences

together account for 133 to 137 bp of the whole SL

transcripts of T. theileri lineages TthI and TthII,

respectively. T. theileri-like trypanosomes from deer

(Cervus dama) also had an SL intron of 94 bp

(Gibson et al. 2000). Sequence divergence in the

intergenic regions among different copies of SL re-

peats from the same isolate was due mostly to long

segments of variable numbers ofA andTnucleotides.

Simple sequence repeats such as AC3-8, GT3-8, CA3-5,

TG3-4 and three repeats each of TCG, TTC, CCA

and CAC were found in sequences from all isolates,

whereas long repeats, such as AAG>5, ACACCC>3,

CCCCT4 and GGGAG3 were exclusive to the TthII

lineage. The existence of various microsatellites in

the intergenic regions is also responsible for length

and sequence variability among the SL genes of other

trypanosomes (Gibson et al. 2000; Ventura et al.

2001; Maia da Silva et al. 2007, 2009).

Despite differences in length and sequence among

SL transcripts of T. theileri trypanosomes, isolates

from cattle, water buffalo and deer shared identical

secondary structures for the SL genes, with 3

stem–loop folded structures as reported forT. theileri

K127 and other trypanosomes (Gibson et al. 2000).

T. theileri from cattle and buffalo presented a second

stem–loop varying from 50 to 54 nucleotides and the

conserved motif GG(C/T)AAAUUUUGG of the

Sm binding site with C or T in the third position for

A. C. Rodrigues and others 116

TthI or TthII, respectively. The third stem–loop

exhibited a conserved UUCG motif and 21 nucleo-

tides for all T. theileri isolates. The secondary

structure of the SL transcript from T. theileri from

buffalo is represented in Fig. 2B.

Determination of whole sequences of SL repeats of

T. theileri trypanosomes revealed a copy of the 5S

ribosomal RNA (5S rRNA) gene inserted in the 3kend of the intergenic region of all isolates, in the same

orientation as the SL gene (Fig. 2D). Comparison

of 5S rDNA sequences of isolates from different

T. theileri genotypes revealed variable length of 121

(IA/B), 116 (IC) or 114 (IIA/B) bp. There was large

divergence in the 5S rDNA sequences between

lineages ThI and TthII. Identical 5S rDNA se-

quenceswereobservedforgenotypeswithintheTthII

contrasting to more divergent sequences from TthI

genotypes (Fig. 2D).

Phylogenetic analysis of SL sequences from

T. theileri isolates

Phylogenetic analysis of wSL (exon, intron and

intergenic region) sequences from trypanosomes

found in cultures from 21 isolates from cattle and 2

from buffalo corroborated data on length and se-

quence polymorphism of SL repeats, providing

evidence for 2 major lineages and 5 main genotypes

among Brazilian T. theileri trypanosomes. Although

different copies of the SL gene from a single isolate

might diverge in their intron and intergenic se-

quences, the sequenceswere similar enough to cluster

together individual repeats from the same isolate in

the same genotype, separated from the repeats from

isolates of other genotypes. According to the den-

drograms derived from wSL sequences, sequences

from all genotypes were nested in 2 major clades,

lineages TthI and TthII, separated by y33% di-

vergence (Fig. 1B). Dendrograms showing the same

topologies were constructed using the whole set of

76 unique wSL sequences from 23 isolates (data not

shown) or restricted to 49 sequences representing the

most divergent wSL sequences (Fig. 1B).

Lineage TthI includes 3 subclades: IA, exclus-

ively found in buffalo, and IB and IC, which

comprise genotypes restricted to cattle. Genotype IA

formed a very homogeneous clade (y0.4% diver-

gence) closest (y6.0%) to the genotype IB (y0.5%).

Genotypes IA and IB were found respectively in

buffalo and cattle from neighbouring regions in

the Central and Southeastern states of MS and SP.

Genotype IC harbours more heterogeneous se-

quences (y2.0% divergence) than cattle isolates from

the Southern region (states of RS and PR). Geno-

types IB and IC were separated by y26% diver-

gence, whereas IA diverged by y25% from IC.

The second assemblage within the cladeT. theileri,

lineage TthII, comprises 2 main genotypes found in

cattle. Lineage TthII showed lower overall internal

divergence (y5.0%) compared to TthI (y14%) but

more intra-genotype polymorphisms. One clade of

TthII contains sequences assigned to genotype IIA

(y4.0%), found in cattle from RN (Northeast) and

PA (North). Interestingly, sequences from primary

cultures (cattle isolates Tthc30 and Tthc40 from RN

and PA, respectively) were assigned to both IIA and

IIB, indicating the existence of mixed genotypes

(Fig. 1B). T. theileri of genotype IIB (y3.0%) were

from cattle from the Centre (MS), Northwest (RO),

North (PA) and Northeast (RN and PB). High intra-

genotype divergence in IIA and IIB suggests that

these genotypes may split into new subclades upon

analysis of more isolates from their regions of origin,

which are separated by large geographical distances.

Phylogenetic inferences using combined data set and

parity between taxonomic markers for T. theileri

lineages/genotypes based on SL and ITS1 rDNA

sequences

Phylogenetic analysis of wSL sequences confirmed 2

major lineages and resolved at least 5 main genotypes

(Fig. 1B). Parity analyses disclosed the same patterns

using wSL and ITS1 rDNA sequences (Fig. 3A,B).

Analyses using sequences more conserved than SL

repeats (5S rDNA and V7-V8 SSU rDNA) con-

firmed the 2 major lineages, but they were unable

to resolve the 5 main genotypes (data not shown).

Analysis restricted to conserved exon and intron

sequences (alignment 2) was unable to distinguish

TthIIA fromTthIIB (data not shown), but inclusion

of the whole (alignment 1, Fig. 1B) or partial inter-

genic sequence between the SL intron and 5S rRNA

(alignment 3, data not shown) resulted in dendro-

grams congruent with those from wSL sequences.

This finding dispensed the need of whole SL repeats

sequences demonstrating that partial sequences from

SL gene repeats, which are easily amplified and

sequenced, is enough for genotyping and phylogeo-

graphical analysis of T. theileri.

A combined data set of SL transcript plus 5S

and ITS1 rDNA sequences was employed to infer

phylogenetic trees aiming to corroborate the re-

lationships among T. theileri genotypes and to

improve support for all lineages/genotypes. All in-

ferences (P, ML and NJ) generated congruent

phylogenetic trees supporting both the 2 major

lineages and the 5 main genotypes. The phylogeo-

graphical pattern generated by the combined data set

was totally congruent with genotype relationships

and divergences based on independent sequences,

supporting the geographical structuring ofT. theileri

populations (Fig. 3C).

Parity of genotyping using PCR-RFLP of wSL and

ITS rDNA genes

Restriction patterns of PCR-amplified (PCR-RFLP)

wSL were evaluated for isolates representing all 5

Phylogeography of T. theileri trypanosomes 117

genotypes, with the aim of developing an easy tool for

genotyping T. theileri that dispenses with the need

for both established cultures and DNA sequencing.

Restriction patterns generated with BshI 1236 en-

zyme displayed 5 restriction profiles, each one

corresponding to one previously defined genotype.

The developed genotyping method separated even

the most closely related genotypes (Fig. 4A). Parity

analysis demonstrated that restriction analysis of

PCR-amplified ITS rDNA also displayed banding

patterns supporting the same 5 main genotypes de-

fined by the SL gene. However, genotypes within

TthII lineage were clearly distinguishable by SL

profiles, whereas they showed very similar patterns

of ITS rDNA PCR-RFLP (Fig. 4B). Both methods

proved to be useful for rapid genotyping ofT. theileri

and suitable for use with crude DNA templates from

easily obtained primary cultures (1–15 days), and

they are thus useful for field epidemiological surveys

of T. theileri populations.

DISCUSSION

Despite a broad geographical distribution around the

world and their ability to infect virtually all species

of domestic bovids (cattle, buffalo, goats, and sheep)

and wild species of cervids and antelopes, knowledge

about T. theileri and allied species is not sufficient

to make robust conclusions about the genetic varia-

bility and evolutionary relationships of these closely

Fig. 3. Phylogenetic trees inferred by maximum

parsimony showing total congruency among phylogenetic

relationships of Trypanosoma theileri isolates with parity

of all genotypes (TthIA-C and TthIIA-B) based on:

(A) whole SL sequences; (B) ITS1 rDNA sequences;

and (C) the combined data set of SL transcript, 5S

rDNA and ITS1 rDNA sequences. The numbers at the

nodes correspond to the percentage bootstrap support

values derived from 100 replicates for MP and ML

analyses.

Fig. 4. Agarose gels (2.5%) stained with ethidium

bromide (EtBr) showing DNA fragment profiles

resulting from restriction analyses of PCR-amplified

(PCR-RFLP) genes from Trypanosoma theileri isolates

selected to illustrate the 5 genotypes, TthIA-C and

TthIIA-B, described in this study. (A) PCR-RFLP of

whole SL gene repeats. (B) PCR-RFLP of ITS rDNA.

A. C. Rodrigues and others 118

related trypanosomes. Low genetic variability among

these trypanosomes, as revealed by conserved SSU

rRNA and gGAPDH genes in previous studies, is

insufficient to hypothesize about their distribution in

phylogenetic clades (lineages) (Rodrigues et al. 2006;

Hamilton et al. 2009). Data from these studies have

suggested that clades might not be strictly related

to either host species or geographical origin. How-

ever, data from zymodemes (Bose et al. 1993; Dirie

et al. 1990), RAPD patterns (Rodrigues et al. 2003),

and ribosomal sequences (Rodrigues et al. 2006;

Hamilton et al. 2007, 2009) have distinguished be-

tween trypanosomes from cattle, buffalo, cervids and

antelopes.

Understanding population structure and lineage

segregation within the clade T. theileri requires

genetic analysis of polymorphic genes of a larger

number of isolates from artiodactyls and vectors

from a broad geographical origin. Here, to further

evaluate genetic diversity, host association and geo-

graphical patterns within the clade T. theileri as

suggested in our previous studies (Rodrigues et al.

2006), and aiming for better-resolved intra-clade

phylogenetic relationships, we determined sequen-

ces of whole SL gene repeats. We characterized, for

the first time, whole SL repeats of T. theileri from

cattle (Bos taurus) and related trypanosomes from

water buffalo (Bubalus bubalis). Results showed that

the 5S rRNA gene is inserted within the intergenic

region of all isolates examined from cattle and

buffalo. This type of structural arrangement of 5S

rRNA in trypanosomes has thus far been reported

in SL repeats of T. rangeli, T. conorhini and T. vivax

(Aksoy et al. 1992; Roditi, 1992; Stevens et al. 1999;

Gibson et al. 2000; Ventura et al. 2001;Maia da Silva

et al. 2007). Contrasting to data from SSU rRNA

genes, divergence between 5S rDNA sequences was

found to be higher within the clade T. theileri com-

pared to lineages/genotypes of T. rangeli (Maia da

Silva et al. 2007) and T. cruzi (Westenberger et al.

2006). Although we also found the same organization

of 5S rRNA within the intergenic SL regions of

T. cyclops (data not shown), which is the species

closest to T. theileri in phylogenetic trees (Hamilton

et al. 2005, 2007), trypanosomes showing this

peculiar organization of 5S rRNA are not mono-

phyletic and were positioned in distant clades in the

phylogenetic tree of Trypanosoma. The nuclear 5S

rRNA genes are known to have moved in and out of

tandemly repeated eukaryotic gene families (rDNA,

SL and histones) during the evolution of fungus,

protist, nematode and arthropod species. To date,

these genes have been reported to be linked only to

the tandem repeats of SL genes in trypanosomatids

(Drouin and de Sa, 1995; Westenberger et al. 2004;

Thomas et al. 2005).

To assess the consistency of T. theileri lineages/

genotypes by comparing sequences showing differ-

ent evolutionary rates, we compared phylogenetic

analyses with SL and rDNA (SSU and ITS1) se-

quences. These genetic loci were analysed separately

as well as with a combined approach. The results

showed parity between phylogeographical patterns

based on SL and ITS1 rDNA sequences. Only

analyses including highly polymorphic sequences

from the intergenic region of SL and ITS1 rDNA

showed cryptic genotypes that were not found using

conserved SSU rDNA sequences (Rodrigues et al.

2006). T. theileri isolates showed relevant polymor-

phisms in the intergenic regions of SL gene repeats.

Phylogeographical analysis of 21T. theileri isolates

from Bos taurus from the North, South, West,

Southeast and Central regions of Brazil, plus 2 iso-

lates from Bubalus bubalis from the Southeast and

Central regions, was performed using phylogenetic

analysis of the SL gene. The phylogenies inferred

using either wSL (y900 bp) or partial SL repeat

(y400 bp) sequences were totally congruent, with a

total of 76 different sequences assigned to lineages

TthI and TthII, which comprise respectively 3 and

2 genotypes strongly supported in all analyses. TthI

comprises genotypes IA and IB from buffalo and

cattle, respectively, from the nearby Southeast and

Central regions, and IC, which is restricted to cattle

from the Southern region. TthII comprises geno-

types IIA, restricted to cattle from the North and

Northeast, and IIB, found in cattle from the Central,

West, North and Northeast regions. Besides the 5

main genotypes characterized in this study, analysis

of primary cultures from the North and Northeast

regions allowed the discovery of at least 3 sequences

that did not cluster with any of these genotypes,

indicating the existence of many more genotypes

(data not shown). Intra-array variation could affect

taxonomic interpretations made using a randomly

isolated repeats of the SL gene (Thomas et al. 2005;

Maslov et al. 2007). For this reason, we examined 3–7

cloned sequences from each culture. The polymor-

phisms found in different cloned SL sequences

from each established culture did not prevent their

clustering together. However, cattle harbouring

more than 1 genotype could be detected directly by

PCR of DNA from primary cultures, but not from

established lineages, thus demonstrating selection by

successive passages in culture. Parity of independent

molecular markers defining the same genotypes

indicated clonal propagation of T. theileri isolates.

Phylogeographical analysis reveals geographical

structuring of T. theileri genotypes found in cattle,

apparently, related to geographical distances and

livestock transit. Accordingly, genotypes restricted

to the Southern (IC) and Northern (IIA) regions,

which are too far from one another for normal live-

stock transportation, were separated by large genetic

distances and do not share the same area.

The states of MS and PA, together with adjacent

states in the Central and Northern (Amazonia) re-

gions, are the largest cattle production areas in

Phylogeography of T. theileri trypanosomes 119

Brazil, from which herds of cattle are sent to neigh-

bouring regions. The state of MS, in central Brazil,

was the only region showing cattle infected with both

TthI (IB) and ThII (IIB) lineages. The states of SP

and MS had both genotypes IB and IA, an expected

result since there is an intense transit of livestock

between these nearby regions. The states of PA, RN

and PB showed only TthII genotypes. The coexist-

ence of IIA and IIB genotypes in the Northeast and

North may be due to sporadic contact between cattle

from these regions. The constant high abundance of

tabanids in the Central (Pantanal), Southeasthern

(Vale do Ribeira) and Northern (Amazonia) regions

could play a role in the dispersion and heterogeneity

of T. theileri populations. The hypothesis that

hybridization events should occur in tabanids finds

support in the strong variability among sequences

of ribosomal genes amplified directly from isolates

parasitizing the gut of the same tabanid specimens

(Rodrigues et al. 2006). The species diversity and

amount of tabanids largely varied according to

geographical regions, probably determined by the

ecotopes and food availability. Therefore, different

genotypes could be at least partially related to dis-

tinct vector species. Further studies of T. theileri in

tabanid flies and other vectors are required to clarify

all these questions.

Buffalo isolates from SP and MS share one SL

genotype, so far exclusive to this host species.

Isolates from water buffalo clustered together in this

and in previous studies using ribosomal and RAPD

markers (Rodrigues et al. 2003, 2006). Clustering of

all buffalo genotypes in a homogeneous clade closest

to cattle genotype TthIB from the same regions

suggested both geographical and host species as-

sociation. However, elucidation of this question re-

quires further studies withmore buffalo isolates from

a broad range of geographical origins. Phylogenetic

studies using several genes showed that cattle isolates

of T. theileri are not monophyletic, and could

be closest to buffalo, cervid and antelope isolates.

However, isolates from distinct host species can be

differentiated by genetic polymorphisms detected

even in the conserved rRNA gene (Rodrigues et al.

2006; Hamilton et al. 2009). Findings from the

present study suggested that data from these pre-

vious studies using SSU rRNA and gGAPDH se-

quences might not reflect the real heterogeneity of

T. theileri populations from cattle and other artio-

dactyls around the world.

Altogether, data from the present study demon-

strate that the cladeT. theileri is composed of isolates

that can be genotyped into highly consistent phylo-

genetic lineages, defined by combinations of SL and

ribosomal markers. Overall, data demonstrated a

complex geographical clonal population structuring

of T. theileri found in cattle from distant geo-

graphical regions, independent of breed but appar-

ently shaped by geographical distance and livestock

transportation by man. SL sequences proved to be

excellent targets for understanding the populational

structure of T. theileri trypanosomes. The geno-

typing method that we have developed for T. theileri

lineages through PCR-RFLP of SL sequences,

which were totally congruent with the previously

described ITS rDNA-derived genotyping method

(Rodrigues et al. 2006), proved to be a valuable tool

for large studies of population structure of T. theileri

trypanosomes.

ACKNOWLEDGMENTS

We are indebted to several students and collaborators fromUSP, UNIFERSA, UFMS, and UFPA for their inesti-mable help in the fieldwork. We specially thank KedsonA. L.Neves, a recipient of scholarships fromFMVZ-USP,for his invaluable support in fieldwork in Santarem (PA).This work was supported by grants from the Brazilianagency CNPq within the UNIVERSAL program. A. C.Rodrigues and R. C. Ferreira are postdoctoral fellows ofPROTAX-CNPq and Maia da Silva F. from PNPD-CAPES. H. A. Garcia is a recipient of scholarships fromCDCH-UCV in Venezuela.

REFERENCES

Aksoy, S., Shay, G. L., Villanueva, M. S., Beard, C. B.

and Richards, F. F. (1992). Spliced leader RNA

sequences of Trypanosoma rangeli are organized within

the 5S rRNA-encoding genes. Gene 113, 239–243.

Bose, R. and Heister, N. C. (1993). Development of

Trypanosoma (Megatrypanum) theileri in tabanids.

The Journal of Eukaryotic Microbiology 40, 788–792.

doi:10.1111/j.1550-7408.1993.tb04475.x.

Bose, R., Petersen, K., Pospichal, H., Buchanan, N.

and Tait, A. (1993). Characterization of

Megatrypanum trypanosomes from European Cervidae.

Parasitology 107, 55–61. doi:10.1017/

S0031182000079403.

Bose, R., Friedhoff, K. T., Olbrich, S., Buscher, G. and

Domeyer, I. (1987). Transmission of Trypanosoma

theileri to cattle by Tabanidae. Parasitology Research 73,

421–424.

Brisse, S., Verhoef, J. and Tibayrenc, M. (2001).

Characterisation of large and small subunit rRNA and

mini-exon genes further supports the distinction of six

Trypanosoma cruzi lineages. International Journal

for Parasitology 31, 1218–1226. doi:10.1016/S0020-

7519(01)00238-7.

Cortez, A. P., Ventura, R. M., Rodrigues, A. C.,

Batista, J. S., Paiva, F., Anez, N., Machado, R. Z.,

Gibson, W. C. and Teixeira, M. M. G. (2006). The

taxonomic and phylogenetic relationships of

Trypanosoma vivax from South America and Africa.

Parasitology 133, 159–169. doi:10.1017/

S0031182006000254.

Dirie, M. F., Bornstein, S., Wallbanks, K. R., Stiles,

J. K. and Molyneux, D. H. (1990). Zymogram and

life-history studies on trypanosomes of the subgenus

Megatrypanum. Parasitology Research 76, 669–674.

Doherty, M. L., Windle, H., Voorheis, H. P., Larkin,

H., Casey, M., Clery, D. and Murray, M. (1993).

Clinical disease associated with Trypanosoma theileri

A. C. Rodrigues and others 120

infections in a calf in Ireland. Veterinary Record 26,

653–656.

Drouin, G. and de Sa, M. M. (1995). The concerted

evolution of 5S ribosomal genes linked to the repeat units

of other multigene families. Molecular Biology and

Evolution 12, 481–493.

Falla, A., Herrera, C., Fajardo, A., Montilla, M.,

Vallejo, G. A. and Guhl, F. (2009). Haplotype

identification within Trypanosoma cruzi I in Colombian

isolates from several reservoirs, vectors and humans.

Acta Tropica 110, 15–21. doi:10.1016/

j.actatropica.2008.12.003.

Fernandes, O., Santos, S. S., Cupolillo, E., Mendonca,

M. B. A., Junqueira, A., Santos, L. C., Derre, R.,

Sturm, N. R., Naiff, R. D., Barrett, T. V., Campbell,

D. A. and Coura, J. R. (2001). A mini-exon multiplex

polymerase chain reaction to distinguish the major

groups of Trypanosoma cruzi and T. rangeli in the

Brazilian Amazon. Transactions of the Royal Society of

Hygiene and Tropical Medicine 95, 97–99.

Fernandes, O., Teixeira, M. M. G., Sturm, N. R.,

Sousa, M. A., Camargo, E. P., Degrave, W. M. and

Campbell, D. A. (1997). Mini-exon gene sequence

define six groups within the genusCrithidia.The Journal

of Eukaryotic Microbiology 44, 535–539.

Ferreira, R. C., de Souza, A. A., Freitas, R. A.,

Campaner, M., Takata, C. S. A., Barrett, T. V.,

Shaw, J. J. and Teixeira, M. M. G. (2007). A

Phylogenetic lineage of closely related trypanosomes

(Trypanosomatidae, Kinetoplastida) of anurans and

sand flies (Psychodidae, Diptera) sharing the same

ecotopes in Brazilian Amazonia. The Journal

of Eukaryotic Microbiology 55, 427–435. doi:10.1111/

j.1550-7408.2008.00342.x.

Gibson, W., Bingle, L., Blendeman, W., Brown, J.,

Wood, J. and Stevens, J. (2000). Structure and

sequence variation of the trypanosome spliced leader

transcript. Molecular and Biochemical Parasitology 107,

269–277. doi:10.1016/S0166-6851(00)00193-6.

Hamilton, P. B., Adams, E. R., Njiokou, F., Gibson,

W. C., Cuny, G. and Herder, S. (2009). Phylogenetic

analysis reveals the presence of the Trypanosoma cruzi

clade in African terrestrial mammals. Infection, Genetics

and Evolution 9, 81–86. doi:10.1016/

j.meegid.2008.10.011.

Hamilton, P. B., Gibson, W. C. and Stevens, J. R.

(2007). Patterns of co-evolution between trypanosomes

and their hosts deduced from ribosomal RNA and

protein-coding gene phylogenies. Molecular

Phylogenetics and Evolution 44, 15–25. doi:10.1016/

j.ympev.2007.03.023.

Hamilton, P. B., Stevens, J. R., Gidley, J., Holz, P. and

Gibson, W. C. (2005). A new lineage of trypanosomes

from Australian vertebrates and terrestrial bloodsucking

leeches (Haemadipsidae). International Journal for

Parasitology 35, 431–443. doi:10.1016/

j.ijpara.2004.12.005.

Hatama, S., Shibahara, T., Suzuki, M., Kadota, K.,

Uchida, I. and Kanno, T. (2007). Isolation of a

Megatrypanum trypanosome from sika deer (Cervus

nippon yesoensis) in Japan. Veterinary Parasitology

149, 56–64. doi:10.1016/j.vetpar.2007.07.019.

Heiman, M. (1997). Webcutter 2.0. (http://

rna.lundberg.gu.se/cutter2/).

Herrera, C., Bargues, M. D., Fajardo, A., Montilla,

M., Triana, O., Vallejo, G. A. and Guhl, F. (2007).

Identifying four Trypanosoma cruzi I isolate haplotypes

from different geographic regions in Colombia. Infection

Genetic and Evolution 7, 535–539. doi:10.1016/

j.meegid.2006.12.003.

Hoare, C. A. (1972). Subgenus Megatrypanum. In The

Trypanosomes of Mammals: A Zoological Monograph

(ed. Hoare, C. A.), pp. 123–141. Blackwell Scientific

Publications, Oxford, UK.

Maia Da Silva, F., Junqueira, A. C., Campaner, M.,

Rodrigues, A. C., Crisante, G., Ramirez, L. E.,

Caballero, Z. C., Monteiro, F. A., Coura, J. R., Anez,

N. and Teixeira, M. M. G. (2007). Comparative

phylogeography of Trypanosoma rangeli and Rhodnius

(Hemiptera: Reduviidae) supports a long coexistence of

parasite lineages and their sympatric vectors. Molecular

Ecology 16, 3361–3373. doi:10.1111/j.1365-

294X.2007.03371.x.

Maia da Silva, F., Marcili, A., Lima, L., Cavazzana,

M Jr., Ortiz, P. A., Campaner, M., Takeda, G. F.,

Paiva, F., Nunes, V. L., Camargo, E. P. and

Teixeira, M. M. G. (2009). Trypanosoma rangeli

isolates of bats from Central Brazil : genotyping and

phylogenetic analysis enable description of a new lineage

using spliced-leader gene sequences. Acta Tropica 109,

199–207. doi:10.1016/j.actatropica.2008.11.005.

Maslov, D. A., Westenberger, S. J., Xu, X., Campbell,

D. A. and Sturm, N. R. (2007). Discovery and

barcoding by analysis of splice leader RNA gene

sequences of new isolates of Trypanosomatidae from

Heteroptera in Costa Rica and Ecuador. The Journal

of Eukaryotic Microbiology 54, 57–65. doi:10.1111/

j.1550-7408.2006.00150.x.

Matzura, O. and Wennborg, A. (1996). RNAdraw:

an Integrated Program for RNA Secondary Structure

Calculation and Analysis under 32-bit Microsoft

Windows.

Mejıa-Jaramillo, A. M., Arboleda-Sanchez, S.,

Rodrıguez, I. B., Cura, C., Salazar, A., del Mazo, J.,

Triana-Chavez, O. and Schijman, A. G. (2009).

Geographical clustering of Trypanosoma cruzi I groups

from Colombia revealed by low-stringency single

specific primer-PCR of the intergenic regions of

spliced-leader genes. Parasitology Research 104,

399–410. doi 10.1007/s00436-008-1212-0.

O’Connor, O., Bosseno, M-F., Barnabe, C., Douzery,

E. J. P. and Breniere, S. F. (2007). Genetic clustering

of Trypanosoma cruzi I lineage evidenced by intergenic

miniexon gene sequencing. Infection, Genetics and

Evolution 7, 587–593. doi:10.1016/

j.meegid.2007.05.003.

Podlipaev, S. A., Sturm, N. R., Fiala, I., Fernandes,

O., Westenberger, S. J., Dollet, M., Campbell, D. A.

and Lukes, J. (2004). Diversity of insect

trypanosomatids assessed from the spliced leader RNA

and 5S rRNA genes and intergenic regions. The Journal

of Eukaryotic Microbiology 51, 283–290. doi:10.1111/

j.1550-7408.2004.tb00568.x.

Roditi, I. (1992).Trypanosoma vivax : linkage ofmini-exon

(spliced leader) and 5S ribosomal RNA genes. Nucleic

Acids Research 20, 1995.

Rodrigues, A. C., Paiva, F., Campaner, M., Stevens,

J. R., Noyes, H. A. and Teixeira, M. M. G. (2006).

Phylogeography of T. theileri trypanosomes 121

Phylogeny of Trypanosoma (Megatrypanum) theileri and

related trypanosomes reveals lineages of isolates

associated with artiodactyl hosts diverging on SSU and

ITS ribosomal sequences. Parasitology 132, 215–224.

doi:10.1017/S0031182005008929.

Rodrigues, A., Campaner, M., Takata, C. S., Dell’

Porto, A., Milder, R. V., Takeda, G. F. and Teixeira,

M. M. G. (2003). Brazilian isolates of Trypanosoma

(Megatrypanum) theileri : diagnosis and differentiation of

isolates from cattle and water buffalo based on biological

characteristics and randomly amplified DNA sequences.

Veterinary Parasitology 116, 185–207. doi:10.1016/

S0304-4017(03)00236-X.

Schafler, D. H. (1979). Trypanosoma theileri : a literature

review and report of incidence in New York cattle.

Cornell Veterinarian 69, 411–425.

Seifi, H. A. (1995). Clinical trypanosomosis due to

Trypanosoma theileri in a cow in Iran. Tropical Animal

Health and Production 27, 93–94.

Serrano, M. G., Nunes, L. R., Campaner, M., Buck,

G. A., Camargo, E. P. and Teixeira, M. M. G.

(1999a). Trypanosomatidae: Phytomonas detection in

plants and phytophagous insects by PCR amplification

of a genus-specific sequence of the spliced leader gene.

Experimental Parasitology 91, 268–279. doi:10.1006/

expr.1998.4379.

Serrano, M. G., Campaner, M., Buck, G. A., Teixeira,

M. M. G. and Camargo, E. P. (1999b). PCR

amplification of the spliced leader gene for the diagnosis

of Trypanosomatid parasites of plants and insects in

methanol-fixed smears.FEMSMicrobiology Letters 176,

241–246.

Souto, R. P., Fernandes, O., Macedo, A. M.,

Campbell, D. and Zingales, B. (1996). DNA marker

define two major phylogenetic lineages of Trypanosoma

cruzi. Molecular and Biochemical Parasitology 83,

141–152. doi:10.1016/S0166-6851(96)02755-7.

Stamatakis, A. (2006). RAxML-VI-HPC: maximum

likelihood-based phylogenetic analyses with thousands

of taxa and mixed models.Bioinformatics 22, 2688–2690.

doi:10.1093/bioinformatics/btl446.

Stevens, J. R., Teixeira, M. M. G., Bingle, L. E. and

Gibson, W. C. (1999). The taxonomic position and

evolutionary relationships of Trypanosoma rangeli.

International Journal for Parasitology 29, 749–757.

doi:10.1016/S0020-7519(99)00016-8.

Swofford, D. L. (2002). PAUP* Phylogenetic Analysis

using Parsimony (*and other Methods) Version 4.0b10.

Sinauer Associates, Sunderland, MA, USA.

Thomas, S., Westenberger, S. J., Campbell, D. A. and

Sturm, N. R. (2005). Intragenomic spliced leader RNA

array analysis of kinetoplastids reveals unexpected

transcribed region diversity in Trypanosoma cruzi. Gene

352, 100–108. doi:10.1016/j.gene.2005.04.002.

Thompson, J. D., Gibson, T. J., Plewniak, F.,

Jeanmougin, F. and Higgins, D. G. (1997). The

CLUSTAL X windows interface: flexible strategies for

multiple sequence alignment aided by quality analysis

tools. Nucleic Acids Research 25, 4876–4882.

Urrea, D. A., Carranza, J. C., Cuba, C. A.,

Gurgel-Goncalves, R., Guhl, F., Schofield, C. J.,

Triana, O. and Vallejo, G. A. (2005). Molecular

characterisation of Trypanosoma rangeli strains isolated

from Rhodnius ecuadoriensis in Peru, R. colombiensis in

Colombia and R. pallescens in Panama, supports a

co-evolutionary association between parasites and

vectors. Infection Genetic and Evolution 5, 123–129.

doi:10.1016/j.meegid.2004.07.005.

Ventura, R. M., Paiva, F., Silva, R. M. S., Takeda,

G. F., Buck, G. A. and Teixeira, M. M. G. (2001).

Trypanosoma vivax : characterization of the spliced-

leader gene of a Brazilian stock and species-specific

detection by PCR amplification of an intergenic spacer

sequence. Experimental Parasitology 99, 37–48.

doi:10.1006/expr.2001.4641.

Wells, E. A. (1976). Subgenus Megatrypanum. In

Biology of the Kinetoplastida (ed. Lumsden, W. H. R.

and Evans, D. A.), pp. 257–275. Academic Press,

London, UK.

Westenberger, S. J., Sturm,N. R. andCampbell, D. A.

(2006). Trypanosoma cruzi 5S rRNA arrays define five

groups and indicate the geographic origins of an ancestor

of the heterozygous hybrids. International Journal for

Parasitology 36, 337–346. doi:10.1016/

j.ijpara.2005.11.002.

Westenberger, S. J., Sturm, N. R., Yanega, D.,

Podlipaev, S. A., Zeledon, R., Campbell, D. A.

and Maslov, D. A. (2004). Trypanosomatid

biodiversity in Costa Rica: genotyping of parasites

from Heteroptera using the spliced leader RNA gene.

Parasitology 129, 537–547. doi: 10.1017/

S003118200400592X.

A. C. Rodrigues and others 122