CROP SCIENCE, VOL. 49, MARCH–APRIL 2009 381

RESEARCH

Common bean (Phaseolus vulgaris L.) is one of the major sources of dietary protein in Latin America and Africa with close to

23 million tons produced around the world in 2007 (FAOSTAT, 2008). While the crop has long been studied in terms of agronomic traits, genetic tools that are genome-based are not as advanced as those for cereals crops, although there is a great deal of interest in using molecular markers for bean breeding (Miklas et al., 2006) and genetic analysis (Gepts et al., 2008), especially those based on polymerase chain reaction (PCR) amplifi cation. Polymerase chain reaction–based genetic markers for the crop include a range of multiple-locus markers and, more recently, single-locus mark-ers such as microsatellites (Blair et al., 2003). Additional markers for common bean are needed in this latter category and should be well distributed and plentiful, and ideally be diagnostic for genes of agronomic interest.

One possible marker system for increasing the number of sin-gle-locus markers in common bean is based on single nucleotide

CEL I Nuclease Digestion for SNP Discovery and Marker Development in Common Bean (Phaseolus vulgaris L.)

Carlos H. Galeano, Marcela Gomez, Lina M. Rodriguez, and Matthew W. Blair*

ABSTRACT

Single nucleotide polymorphisms (SNPs) are

the most common sequence difference found in

plant genomes, yet they have not been widely

exploited for producing molecular markers

in common bean (Phaseolus vulgaris L.). The

objective of this study was to develop a SNP

assay based on a type of heteroduplex mis-

match cleavage called EcoTILLING for molec-

ular marker development in this important

legume, and apply the assay (i) to the conver-

sion of a sequence-characterized amplifi ed

region (SCAR) marker useful for selecting virus

resistance (SR2) and (ii) to the screening of SNP

polymorphisms in newly developed expressed

sequence tag (EST)–based markers. The SNP

assay involved heteroduplex mismatch cleav-

age by a single-strand specifi c nuclease ‘CEL

I’ which was used to uncover two SNPs in the

SR2 fragment and 22 SNPs in 37 candidate

ESTs, some of which were used in segrega-

tion analysis. While developing the SNP tech-

niques we tested several platforms, including

LI-COR, nondenaturing polyacrylamide, and

agarose gel detection. The agarose gel system

was used for SNP genetic mapping in two com-

mon bean mapping populations, showing that

heteroduplex cleavage is a useful technique

for increasing molecular marker number for the

crop. Examples are given of mapped SNP mark-

ers for the phytic acid pathway gene for myo-

inositol-1-phosphate synthase and a drought

tolerance–related gene, S-adenosylmethionine

decarboxylase.

C. H. Galeano, M. Gomez, L. M. Rodriguez, and M. W. Blair, CIAT-

International Center for Tropical Agriculture, A.A. 6713, Cali, Colom-

bia, South America. Received 14 July 2008. *Corresponding author

(m.blair@cgiar.org).

Abbreviations: ARMS, amplifi cation refractory mutation system;

BGYMV, bean golden yellow mosaic virus; CAPS, cleaved amplifi ed poly-

morphic sequence; COS, conserved ortholog set; dHPLC, denaturing

high performance liquid chromatography; EST, expressed sequence tag;

SCAR; sequence-characterized amplifi ed region; SNP, single nucle-

otide polymorphism; SSCP, single strand conformational polymor-

phism; RIL, recombinant inbred line; TILLING, target induced local

lesion in genomes.

Published in Crop Sci. 49:381–394 (2009).doi: 10.2135/cropsci2008.07.0413© Crop Science Society of America677 S. Segoe Rd., Madison, WI 53711 USA

All rights reserved. No part of this periodical may be reproduced or transmitted in any form or by any means, electronic or mechanical, including photocopying, recording, or any information storage and retrieval system, without permission in writing from the publisher. Permission for printing and for reprinting the material contained herein has been obtained by the publisher.

Published March, 2009

382 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MARCH–APRIL 2009

polymorphisms (SNPs) that have been developed for indus-trially important crop species such as soybean [Glycine max (L.) Merr.] (Zhu et al., 2003) and maize (Zea mays L.) (Ching et al., 2002) but that to date have remained untapped as a source of markers for common bean. Loci corresponding to individual SNPs are distributed across the bean genome, although generally they are more prevalent in noncoding than in coding regions of the genome. In maize, the fre-quency of polymorphisms in U.S. elite inbred lines is one SNP per 85 bp in noncoding regions, and one SNP per 124 bp in coding regions (Ching et al., 2002). In soybean progenitors to North American populations (Zhu et al., 2003) and mapping population parents (Van et al., 2005), SNPs are found less frequently, ranging from one SNP every 200 bp to one SNP every 2000 bp. In common bean, expressed sequence tag (EST) analysis by Ramirez et al. (2005) identifi ed 529 SNPs in 214 kb of contigs, giving one SNP every 387 bp, 138 of which were confi rmed by two or more sequences in Andean (G19833) and Mesoamerican (P. vulgaris cv. Negro Jamapa) genotypes evaluated. Given these frequencies, SNPs can be useful for high resolution genetic mapping of traits in common bean and other legumes, and also for association studies that are based on candidate genes or whole genome analysis.

While discovery of SNPs usually involves alignment of sequences obtained from EST collections (Yamanaka et al., 2004; Ramirez et al., 2005) or from resequencing of PCR fragments (Zhu et al., 2003), SNP discovery can also be performed using a variety of experimental meth-ods that do not require sequence information, including restriction enzyme analyses or cleaved amplifi ed poly-morphic sequence (CAPS) analysis (Thiel et al., 2004); amplifi cation refractory mutation system (ARMS) anal-ysis (Tondelli et al., 2006); single strand conformational polymorphism (SSCP) analysis (Bertin et al., 2005); and denaturing high-performance liquid chromatography (dHPLC) (Lai et al., 2005). All these methods are use-ful for subsequent analysis of SNPs as genetic markers but have varying degrees of effi ciency. Additional methods are available for SNP analysis but require prior sequence information for SNP marker design (Soleimani et al., 2003; Nasu et al., 2002; Shirasawa et al., 2006).

Meanwhile, heteroduplex mismatch cleavage, often termed EcoTILLING, is an alternative method of SNP dis-covery that is cost eff ective for analyzing SNPs (Comai et al., 2004), and is receiving attention from geneticists inter-ested in genome analysis, especially in laboratories that do not have expensive or specialized equipment (Rungis et al., 2005). Several nucleases have been proposed for use in mismatch cleavage. However, a single-strand specifi c (sss) nuclease found in extracts of celery (Apium graveolens L.) and named CEL I has been found to be easy to isolate and is inexpensive, making it ideal for EcoTILLING (Till et al., 2004; Comai et al., 2004). CEL I is similar to the

S1 family of sss nucleases, and works with a variety of cofactors to digest heteroduplex DNA immediately 3′ of mismatch sites, or at short regions of insertion or dele-tion that can be confi rmed by the resequencing of alleles (Oleykowski et al., 1998).

CEL I digestion was originally proposed as a simple method to assay induced mutations in genomes, a process known as Targeting Induced Local Lesions in Genomes (TILLING). This method has given rise to an additional procedure referred to as EcoTILLING (Comai et al., 2004; Till et al., 2003). These two techniques diff er in that the latter assays natural mutations in defi ned populations while the former evaluates induced mutations in mutagenized populations. CEL I nuclease has been used to perform high throughput screening and TILLING in various crops (Comai and Henikoff , 2006). While EcoTILLING was fi rst applied to Arabidopsis thaliana (Comai et al., 2004), it has been adapted for genetic polymorphism surveys in poplar, Populus trichocarpa (Gilchrist et al., 2006) and SNP mapping in spruces, Picea spp. (Rungis et al., 2005). Some researchers have simplifi ed EcoTILLING and TILLING protocols by detecting CEL I cleaved products on agarose gels, avoid-ing the need for labeled primers, polyacrylamide gels, and DNA sequencers used in earlier versions of these methods (Qiu et al., 2004; Raghavan et al., 2007).

The objectives of this study were to apply EcoTILL-ING protocols to marker development in common bean specifi cally (i) for the development of a sequence-char-acterized amplifi ed region (SCAR) marker useful for selecting virus resistance (SR2) and (ii) for the screening of polymorphism in a set of EST-based markers that we developed for this purpose. The SR2 marker was used since it has a known set of SNPs that determine its gene-pool specifi city according to Blair et al. (2007), and is linked to the bgm-1 gene for resistance to Bean golden yellow mosaic virus (BGYMV), making it agronomically impor-tant. The target ESTs for heteroduplex cleavage analysis were selected on the basis of the in silico SNP analysis of Ramirez et al. (2005), and were used to further test the application of the CEL I assay for SNP discovery and genetic mapping.

MATERIALS AND METHODS

CEL I ExtractionCEL I was extracted from celery with salting out and dial-ysis steps as described in Till et al. (2004) with slight mod-ifi cations. Five kilograms of green tissues were cleaned, air dried, ground in a blender, and the juice fi ltered through a sterile Miracloth fi lter into a 1-L fl ask that was placed on ice. A solution consisting of Tris (1 M, pH 7.7) and phenylmethylsulfonyl fl uoride (PMSF) (0.1 M) was then added to the extract to reach a fi nal concentration of 0.1 M Tris and 100 μM PMSF in 1 L of solution. This mixture

CROP SCIENCE, VOL. 49, MARCH–APRIL 2009 WWW.CROPS.ORG 383

genomic DNA (25 ng of each parental genotype mixed together). A total of 5 μL of this specifi c PCR product was run on a 1% agarose gel to evaluate whether amplifi -cation was successful. After confi rmation of PCR ampli-fi cation, the PCR product was subjected to heteroduplex formation and CEL I digestion as described above, and the cleavage products were resolved by each of three diff erent methods described below.

SNP Detection MethodsThe fi rst detection method used was evaluation of the digests on a 4% agarose gel, where 15 μL of each of the digestion products was combined with 5 μL of loading buff er (30% glycerol and 0.25% bromophenol blue) and run in 0.5X TBE buff er on a HORIZON 20:25 gel sys-tem (Gibco BRL Life Technology Inc., Gaithersburg, MD). Ethidium bromide had been added to the gel at fi nal concentration of 0.5 μg/mL for visualization of the DNA bands on an ultraviolet transilluminator Gel-Doc 2000 (Bio-Rad Laboratories, Richmond, CA), and the images were edited using Quantity One 4.0.3 software (Bio-Rad Laboratories, Richmond, CA).

The second system used for the evaluation of digests was a nondenaturing polyacrylamide gel, where 7 μL of each of the digestion products was combined with 5 μL of loading buff er (98% formamide, 10 mM EDTA, 0.05% xylene cyanol, and 0.05% bromophenol blue) and run in 1X TBE buff er on an 8% acrylamide/bisacrylamide (19:1) gel at 100 V constant power for 1 h using a Mini-PRO-TEAN 3 Cell System (Bio-Rad Laboratories, Richmond, CA). The nondenaturing gel was stained for 5 min in a 200-mL plastic tray with an ethidium bromide solution at 1 μg/mL, and the image capture and edition were per-formed as described above.

The third system used for evaluation of digests was detection on a LI-COR 4200 automated DNA sequencer (LI-COR Biosciences, Lincoln, NE). Because this detec-tion system relies on fl uorescent primers that are incorpo-rated into the PCR product, a separate PCR reaction was performed for this technique. In this case, the PCR reac-tion included 0.2 μM of primer mix (3:2 ratio of IRD700-labeled to unlabeled reverse primers and 4:1 ratio of IRD800-labeled to unlabeled forward primers) and was performed in 10 μL fi nal volume with 25 ng of DNA of each genotype, 0.8 mM of total dNTPs, 2.5 mM MgCl2, and 1 unit of Taq polymerase in 1X PCR buff er (10 mM Tris-HCl, pH 8.8, 50 mM KCl, 0.1% TritonX-100, and 0.1 mg/mL BSA).

The PCR heteroduplex formation and CEL I diges-tion for the LI-COR analysis were the same as for the agarose and nondenaturing gel detection methods. How-ever, in this case, a total of 5 μL loading buff er (98% formamide, 10 mM EDTA, 0.05% xylene cyanol, and 0.05% bromophenol blue) was added to each sample after

was centrifuged in balanced 250-mL bottles for 20 min at 2600 g, and then ammonium sulfate was added to the supernatant to reach a concentration of 1 M (25%) and mixed gently for 30 min. The mixture was centrifuged for 40 min at 13,000 g and the supernatant removed to a new fl ask, where it was adjusted to 3 M (80%) ammonium sulfate. After gentle mixing for 30 min the solution was centrifuged at 13,000 g for 1.5 h. The next supernatant was then removed, and the pellet resuspended in 50 mL of buff er A (0.1 M Tris-HCl, pH 7.7, 100 mM PMSF) and transferred to a dialysis tube. The extract was dialyzed against a total of 4 L of buff er A changed each hour for 4 h, followed by an overnight dialysis. Finally, to remove tissue debris and precipitates, the CEL I extract was centri-fuged at 13,000 g for 30 min, and the resulting supernatant divided into aliquots and stored at −20°C. A fi nal yield of 200 mL of celery juice extract (CJE) was obtained.

CEL I DigestionTo evaluate the activity and effi ciency of our enzyme, we did a series of experiments comparing the digestion of our CJE/CEL I with that of a nuclease included in the Surveyor Mutation Discovery kit (Transgenomic, Inc., Omaha, NE). The 632 bp PCR product included in the kit was also used for the enzyme evaluation phase. Het-eroduplexes were formed on a PTC 100 thermocycler (MJ Research, Waltham MA) by denaturing the PCR product at 95°C for 2 min, then quickly lowering the temperature 2°C/cycle during 5 cycles until 85°C, then slowly lower-ing the temperature by 0.1°C per cycle from 85 to 25°C across 600 cycles. CEL I digestion was performed with 10 μL of the denatured PCR product and 2 μL of 10X digestion buff er (10 mM Hepes, pH 7.5, 10 mM MgSO4, 0.002% Triton X-100, and 20 ng/mL of bovine serum albumin) along with varying amounts of CEL I in fi nal volumes of 20 μL to determine appropriate enzyme con-centration. The digestion was performed at 45°C for 35 min and the reaction was stopped with 5 μL of 0.15 M EDTA. The digested product was run on a 2% agarose gel and stained with ethidium bromide.

SCAR Amplifi cationThe PCR marker SR2 developed originally for the bgm-1 resistance gene was amplifi ed as described in Blair et al. (2007) with the parents of two recombinant inbred line (RIL) populations (DOR364 × G19833 or BAT93 × JALO EEP558), with some modifi cations. The main change to the method was that prior to the PCR reaction, DNAs from test genotypes were mixed to assay hetero-duplex formation. For example, in the case of evaluat-ing polymorphism for the mapping population parents, DNAs representing the Andean and Mesoamerican alleles for the populations were combined. PCR reactions were performed in 20 μL reaction volumes containing 50 ng of

384 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MARCH–APRIL 2009

digestion, followed by concentration to 1.5 μL at 85°C on a hotplate. The mixture was then loaded onto a 6.5% polyacrylamide:bisacrylamide (19:1) gel containing 7 M urea. Gels were run in 1X TBE buff er at 1500 V (40 mA; 40 W) for 4 h as recommended by Till et al. (2003), and the images were analyzed with MS Photo Editor (Micro-soft Corp., Redmond, WA).

SCAR Sequence and Segregation AnalysesTo confi rm if CEL I digestion had uncovered SNPs within the SR2 marker, the PCR products amplifi ed from six parental genotypes of the populations used in Blair et al. (2007), namely DOR364, G19833, BAT93, Jalo EEP558, DOR476, and SEL1309, were purifi ed using either polyeth-ylene glycol (PEG) precipitation (Lis et al., 1980) or Exonu-clease I/Shrimp Alkaline Phosphatase (Exo/SAP) treatment (Nordstrom et al., 2000) and sequenced by Macrogen cus-tom sequencing service (Macrogen, Inc., Seoul, Korea). Base calling was performed using Phred 4.25 (Ewing et al., 1998), and the sequences were aligned and edited using Sequencher 4.1.2 (Gene Codes Corp., Ann Arbor, MI). Genetic mapping of the SR2 fragment digested with CEL I was performed using the DOR364 × G19833 and BAT93 × Jalo EEP558 recombinant inbred populations and condi-tions as described in Blair et al. (2007).

EST Marker DevelopmentA total of 37 primers pairs (Table 1) were designed for 72 EST contigs that exhibited single SNPs between the Andean (G19833) and Mesoamerican (Negro Jamapa) genotypes analyzed by Ramirez et al. (2005), with a minimum of four ESTs per contig. Primer design was performed using PRIMER 3.0 software (Rozen and Skaletsky, 2000) and the following conditions: average length of 20 nucleotides, melting temperatures of 58 or 60°C, and theoretical PCR amplicons of 100 to 500 bp. The amplifi cation, CEL I digestion, and agarose analysis were as described above for the SCAR marker, except that in addition to the parents DOR364, G19833, BAT93, and Jalo EEP558, Negro Jamapa was also used in the parental survey. Moreover, annealing temperatures varied accord-ing to the specifi c primer pairs shown in Table 1. The same polymorphisms detected by CEL I digestion of SNPs in this parental survey were used to genetically map the ESTs and used the DOR364 × G19833 mapping popu-lation and MAPMAKER software v. 3.1 (Lander et al., 1987) at a minimum likelihood of odds score of 3.0.

RESULTS

Enzyme Digestion

Modifying the original CEL I extraction protocol (Till et al., 2003) by adding a fi nal centrifugation step to remove unwanted protein precipitates produced a fully active

enzyme that digested DNA heteroduplexes as well as or better than nonpurifi ed enzyme. CEL I from CJE also proved as effi cient as the commercial CEL I enzyme, Surveyor, when digestion products and 0.5, 1, or 2 μL of enzyme were run on agarose gels. Using 0.5 μL of the cen-trifuged CJE/CEL I, we were able to completely digest a 632-bp PCR product included as a control reaction in the Surveyor kit, detecting two fragments of approximately 200 and 400 bp (the correct sizes predicted for such frag-ments, based on the SNP position respective to right and left ends of this PCR product) (Fig. 1, Panel A, Lanes 5 and 9). These fragments are the same size as those for diges-tion of the product with Surveyor nuclease, which served as a control enzyme, as seen in Fig. 1, Panel A, Lane 13, confi rming that our CEL I extraction is able to identify SNP mismatches as well as the commercial enzyme.

SR2 Marker EvaluationTo evaluate the diff erent CEL I enzymes described above for the detection of SNPs in common bean DNA, we used the PCR marker SR2, given the similar size of SR2 with the test fragment described above. The SR2 diges-tion was evaluated with diff erent enzyme concentrations by multiplexing the parental genotypes to form hetero-duplexes, digesting with both CEL I enzymes, and run-ning digestion products on agarose gels (Fig. 1, Panel A). When the SR2 amplifi cation products from the Andean and Mesoamerican parental template DNA were mixed, the SNPs between their sequences formed a mismatch that was digested by CEL I. Both purifi ed CEL I from CJE and commercial Surveyor CEL I produced the same digestion pattern on agarose gels, with two bands at approximately 290 and 248 bp. In terms of concentration, 0.5 μL of CEL I proved to be suffi cient for SNP detection in SR2. In the parental genotypes, the SNP at the 248-bp position was the same as the one uncovered by HaeIII digestion with the CAPS marker developed for SR2 by Blair et al. (2007). However, the sum of the band weights was smaller than the full size for SR2 (570 bp) suggesting that other SNPs could be present on SR2, but would require a higher reso-lution gel to resolve these smaller fragments.

In a subsequent experiment with nondenaturing poly-acrylamide gels (Fig. 1, Panel B), we improved the resolu-tion of the CEL I digested products from the SR2 marker and were able to clearly identify three bands, one of which was not previously visible on the agarose gels. In addition to the same 290- and 248-bp bands observed on agarose gels, polyacrylamide gels resolved the 290-bp band into two bands, one of 290 bp and the other of 324 bp. These results confi rm the full size of the PCR product for SR2 and suggest the existence of a second SNP within the frag-ment. Furthermore, we found that with the higher resolu-tion system we could evaluate heteroduplexes with as little as 0.1 μL of CJE/CEL I. In addition, when the amount of

CROP SCIENCE, VOL. 49, MARCH–APRIL 2009 WWW.CROPS.ORG 385

Table 1. Common bean (Phaseolus vulgaris L.) single nucleotide polymorphism (SNP) markers and primer pairs developed for

CEL I digestion assay, based on contig identifi cation (ID) and BLASTX homology as described in Ramirez et al. (2005).

MarkerContig

IDPrimers BLASTX homology Temp.†

Ann Temp.‡ SNP§

— °C —

BSNP 1 1326 For: CGTCAAACGATGCTGGATGAAC No BLASTX hit to UniRef100 56.6 60 +

Rev: CCACCAACTTCAGGAATACGTCA 56.9

BSNP 2 2125 For: GTGTTGAAGTTGCAGGGAGAA Hypothetical protein At5g48390 [Arabidopsis thaliana] 55.4 60 +

Rev: TGAATCCGTGTCTTCCATAGC 54.6

BSNP 3 2294 For: TGCGAGTATTTGGGACCTTTGC Steroid 5-alpha reductase [Cicer arietinum] 57.9 60 +

Rev: GGTGAGGTTGCATGGCTGAAG 58.8

BSNP 4 2348 For: GACCGTGGAGAACACGCTGAAC S-adenosyl-L-methionine Mg-protoporphyrin IX

methyltranserase [Nicotiana tabacum]

60.3 60 +

Rev: CAACACAGGGGCAGATCCATTT 57.9

BSNP 5 2391 For: CTGTGAGGTACGGCAATTCTGG ATP synthase delta chain, chloroplast precursor

[Pisum sativum]

57.9 55 +

Rev: GGGTTATACGGCGAGTGTGAGA 58.5

BSNP 6 2402 For: CTGTGTTGGTGGATTTCCTTGT Myo-inositol-1-phosphate synthase [Glycine max] 55.6 60 +

Rev: GATGTTCGCCAGGTTCATAGAG 55.4

BSNP 7 2453 For: CAAAAACAACCGCCGAAAAG ARG10 [Phaseolus aureus] 53.4 52 –

Rev: TGGTGTGTGTAAGCCAACTGC 58.1

BSNP 8 2493 For: CCGGAGAACGCTGTTTATGA Serine hydroxymethyltransferase [Arabidopsis thaliana] 54.9 53 +

Rev: CTTCACCTGCTTGGCGTATG 56.3

BSNP 9 2511 For: TCTCTTCCTTTCCATGTTCCTC ADR11 protein [Glycine max] 54.2 52 –

Rev: CACAATGACTGGTGGCTTAACA 55.5

BSNP 10 2513 For: GACTGGAGCTTTGCTTCTTG Type I (26 kDa) CP29 polypeptide [Lycopersicon esculentum] 54.0 60 –

Rev: GAGTTGGAACCCTCTCAGC 55.3

BSNP 11 2532 For: CACTCCCTGGAATCTATGACC Myo-inositol-1-phosphate synthase [Glycine max] 54.5 60 +

Rev: ACAACCACCTTGTCCACTTTG 55.7

BSNP 12 2533 For: CAGATGCAGCCTATGGTGAAG Oxygen-evolving enhancer protein 2, chloroplast precursor

[Nicotiana tabacum]

55.7 60 +

Rev: CGACATTGCTGGTTGTATCG 54.0

BSNP 13 2539 For: GTGACTCCATGCCTGAGCTA Lipid transfer protein II [Vigna radiata] 56.6 55 +

Rev: GTGGTAGTGAAGCTGCGTTT 55.6

BSNP 14 2541 For: TTCCGTTACTTCCTGCTGTTTC 40S ribosomal protein S3 [Arabidopsis thaliana] 55.2 55 +

Rev: CTTGAGTTCTGGTGGCTCTGAT 56.7

BSNP 15 2545 For: CCTTTCCCTCTTTCTCGATCTC Ferritin, chloroplast precursor [Phaseolus vulgaris] 54.6 55 +

Rev: CAGAACAGGTTGGGTTTCTCAC 56.0

BSNP 16 2551 For: CTTTGCTGTGTCTCTTTGCTG Hypothetical protein At5g42050 [Arabidopsis thaliana] 54.5 55 +

Rev: TTGGTTATGTTCCACCCATC 52.5

BSNP 17 2553 For: TTTGAAGCAGGAGAAGATGGAC Aminotransferase 2 [Cucumis melo] 54.9 65 +

Rev: CCCAATCACTTTCCACAACATC 54.3

BSNP 18 2556 For: CTCCCACATCCAAACTTCCTA ATP synthase B’ chain, chloroplast precursor

[Spinacia oleracea]

54.1 55 +

Rev: GGGGGTGAACCATATCTTGTC 55.2

BSNP 19 2561 For: CGCAGTCAGCCCACTACTCA Photosystem I subunit XI [Nicotiana attenuata] 59.3 60 +

Rev: CGAAATGCCTCCGAAGAAGA 54.9

BSNP 20 2565 For: TTTTGGGGTTAGTTCAAGACTG Photosystem II 5 kDa protein, chloroplast precursor

[Gossypium hirsutum]

53.0 55 –

Rev: GATTTTCTTAGCTTCAGGAGTGC 53.9

BSNP 21 2570 For: GGATTTGGCTCTGCAAGAATG Hypothetical protein At4g26850 [Arabidopsis thaliana] 54.5 65 +

Rev: GATGGCAACAAAACTGGGAGA 55.6

BSNP 22 2574 For: TGACGAGAGTGAAGACGAGAAG Molecular chaperone Hsp90–2 [Nicotiana benthamiana] 55.9 60 +

Rev: GAACAGCAAGAGAACCAAATCC 54.2

BSNP 23 2580 For: CATGCAATGGAGGCTACAAAAG Omega-6 fatty acid desaturase, endoplasmic reticulum

isozyme 2 [Glycine max]

54.6 55 +

Rev: TCTGCAAACAAAACCGCTACAC 56.3

386 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MARCH–APRIL 2009

CJE/CEL I was increased, the intensity of the band rep-resenting the full length product was reduced, suggesting that the CEL I extract contains other nucleases that are competing with CEL I’s ability to cleave single base pair mismatches, and that these can degrade full-length PCR product DNA.

After the initial SNP confi rmation phase in agarose and nondenaturing polyacrylamide gels, we turned to an automated detection system using a LI-COR 4200 gel unit and denaturing polyacrylamide gels to further evalu-ate the SNPs found among the parental genotypes (Fig. 2). The results showed that digestion was successful and that both SNPs could be identifi ed, with the presence of per-fectly matched PCR products confi rming the expected size of the full length PCR product for SR2 of 570 bp. The gel analysis showed a total of two SNPs between the

Mesoamerican and Andean bean combinations DOR364 and G19833 or BAT93 and Jalo EEP558. These results confi rm the digestion pattern observed in agarose and nondenaturing gels, allowing us to separate the 283- and 290-bp bands that had previously been overlapping with each other and to easily score the strong 248-bp band and the weaker 324-bp band.

SR2 Sequence and Segregation AnalysisAll SR2 products from the parental genotypes were sequenced to confi rm the SNPs detected by CEL I nucle-ase digestion. The sequences obtained for DOR364, BAT93, G19833, and Jalo EEP558 were aligned to the sequences of DOR476 and SEL1309 as reported by Blair et al. (2007) and, like SEL1309, do not contain the dele-tion that is specifi c to DOR476, but do contain various

MarkerContig

IDPrimers BLASTX homology Temp.†

Ann Temp.‡ SNP§

BSNP 24 2583 For: TCAACACTACCACTCTCAACAATC Photosystem II 22 kDa protein, chloroplast

precursor [Spinacia oleracea]

54.7 57 –

Rev: GCTTTGACTTTGTAACCTTGGTC 54.5

BSNP 25 2587 For: CACCGCAACAGTATCAGCAG RNA binding protein 45 [Nicotiana plumbaginifolia] 56.2 60 +

Rev: GGCGTCTTTCACCAGCACTA 57.5

BSNP 26 2596 For: GACCTGGCATTCGCTTTTTC Glycolate oxidase [Cucurbita cv. Kurokawa Amakuri] 54.8 65 –

Rev: CCTTGTGTCCTCAGCAGTCAG 57.7

BSNP 27 2617 For: GAAGATGGAGGCTTTGAGGTAA Glutamine synthetase leaf isozyme, chloroplast

precursor [Phaseolus vulgaris]

54.5 60 –

Rev: TGTAAAAGGAAAGTGCGAGAGC 55.5

BSNP 28 2620 For: GCCTGGATAGAGAGAAAGCAC S-adenosyl-L-methionine decarboxylase [Phaseolus lunatus] 55.1 55 +

Rev: CAACAAAACCACCCATTCC 52.1

BSNP 29 2625 For: GAGATGAAGGTGGCAAGCAC Oxygen-evolving enhancer protein 2, chloroplast

precursor [Pisum sativum]

56.4 60 +

Rev: CAAGAGAGGAGGGCAAGTCC 57.4

BSNP 30 2630 For: CACGAGCACCAACCTCACTC Plastocyanin, chloroplast precursor [Pisum sativum] 58.2 67 –

Rev: AACACCAAAGAGCCGTCACC 58.0

BSNP 31 2634 For: CCTCTCGTTTGCTCTTCC Photosystem I reaction center subunit III [Phaseolus aureus] 52.9 60 –

Rev: GCGAAAAGGTTGAGATGC 51.9

BSNP 32 2650 For: GGGCTGTGACTCTACTTGGTCTG 10 kDa photosystem II polypeptide [Trifolium pratense] 59.1 60 –

Rev: GACAAACACATTCAACGAAGACG 54.7

BSNP 33 2655 For: TCTCTCACTCACACACTCACACTCA Oxygen-evolving enhancer protein 3 [Pisum sativum] 59.0 60 –

Rev: TAGATTTGGCATCAGCAAGAACAG 55.5

BSNP 34 2658 For: GTCAACCAAGACCCCATCT PSI light-harvesting antenna chlorophyll a/b-binding protein

[Pisum sativum]

54.5 55 –

Rev: GAAGGACACAGGCTTATCATC 53.0

BSNP 35 2659 For: GTGATCTTGATGGGTGCAGT LHCII type I chlorophyll a/b-binding protein [Phaseolus aureus] 55.1 66 –

Rev: TGGACTAAATAGAGAGGCGTGT 55.3

BSNP 36 2676 For: ACAAACTTCATCCAGGTGGTC Chlorophyll a-b binding protein CP26, chloroplast precursor

[Arabidopsis thaliana]

55.0 64 –

Rev: GAGGGCAGGCTCTACAAATG 55.7

BSNP 37 2678 For: GATTGTTGGAAGCAAAGGAAAG Transketolase 1 [Capsicum annuum] 52.7 55 –

Rev: CAGACAAAACTCAGAAGCCAAA 53.6

†Melting temperature of forward and reverse primer for each SNP marker.

‡Annealing temperature used in PCR amplifi cation of SNP marker.

§Presence or absence of SNP polymorphism as determined by CEL I digestion of the parents of the mapping population DOR364 × G19833.

Table 1. Continued.

CROP SCIENCE, VOL. 49, MARCH–APRIL 2009 WWW.CROPS.ORG 387

SNPs diff erentiating Andean and Mesoamerican geno-types as shown in Fig. 3. As predicted by heteroduplex digestion, the fi rst and second SNPs between the Andean and Mesoamerican genotypes were found 248 and 283 bp from the 5′ end of the SR2 sequence, respectively. The fi rst SNP is novel and would not be uncovered by any known restriction enzyme, while the second SNP cor-responds to the HaeIII restriction site originally used for CAPS analysis by Blair et al. (2007).

Subsequently, two Mesoamerican × Andean mapping populations, (DOR364 × G19833) and (BAT93 × Jalo EEP558), were used to evaluate the reliability of CJE/CEL I digestion for SNP detection in genetic mapping experi-ments. Figure 4 shows the digestion of the SR2 product on a subset of RILs from the second of these populations run on agarose gels. For genetic mapping, the DNAs of each parent were mixed with DNAs of each of the RILs prior to amplifi cation to create mixed products and facili-tate heteroduplex formation. Results from heteroduplex analysis of DNA from each line combined with one map-ping population parent were confi rmed with results from heteroduplex analysis of the same DNA of the individual line combined with the complementary mapping parent. This gave a double evaluation of whether the RIL was homozygous for either the Andean or the Mesoamerican allele or whether it was heterozygous. Genotype segrega-tion and map location of the genetic marker matched those of Blair et al. (2007) for these same populations using the SR2-HaeIII CAPS marker.

EST PolymorphismsPCR amplifi cation of EST fragments was found to be suc-cessful in all cases and produced single copy bands that are well suited for heteroduplex analysis. Digestion with CEL I showed that 22 of the 37 EST-based markers designed from sequences in Ramirez et al. (2005) gave digestion products suggesting the presence of SNP-based polymor-phisms when mixing the parents of the mapping popula-tion DOR364 × G19833 (Table 1). However, a total of 15 sequences predicted to have Mesoamerican versus Andean SNPs did not show heteroduplex digestion in the parents of this population. Among the PCR products showing polymorphism with CEL I digestion, eight were selected for further analysis based on even sized banding and intense PCR amplifi cation necessary for visualization on agarose gels, as shown for markers BSNP 1 and BSNP 28 (Fig. 5, Panel A). Segregation analysis based on multiplex-ing of each individual RIL with each parent was used to genetically map fi ve of the eight markers on the molecular map of DOR364 × G19833 (Fig. 5, Panel B). Table 1 shows the sequence homology of each of the ESTs used for SNP development determined by BLASTX searches against the UniRef100 database with a probability thresh-old of E < 10−4 as described in Ramirez et al. (2005). In

that analysis, all the EST contigs except for one (contig 1326) had homology to genes expressed in other plants, with six showing highest similarity to genes expressed in Phaseolus and 11 showing highest similarity to genes from other legumes.

DISCUSSIONIn the preliminary part of our study, we found that CEL I extracted directly from celery stalks could be used to digest heteroduplex mismatches and performed as effi ciently as a commercial version of the enzyme. The eff ectiveness of our enzyme agrees with fi ndings of Oleykowski et al. (1998), who showed that CEL I reliably cleaves mismatches, cut-ting DNA at the 3′ side of single base pair substitutions or at DNA distortions, and that celery stalks are a good source of the enzyme because they have a low level of pigments. Other enzymes for mismatch cleavage such as

Figure 1. Optimization of SNP detection in common bean

(Phaseolus vulgaris L.) using agarose and nondenaturing poly-

acrylamide gels. A sequence-characterized amplifi ed region

(SCAR) useful for selecting virus resistance (SR2) was digested by

different amounts of single-strand specifi c nuclease ‘CEL I’, using

a polymerase chain reaction (PCR) multiplex of Mesoamerican (B

= BAT93, D = DOR364) and/or Andean (G = G19833, J = Jalo

EEP558) parental genotypes. Panel A shows SR2 digestion

pattern with agarose gel electrophoresis and 0.5 or 1.0 μL of

CEL I from celery juice extract (CJE/CEL I) or 1 μL of Surveyor

CEL I enzyme. Arrows show the digested fragments for SR2,

while asterisks show the digested fragments for the 632 bp G/C

PCR product included in the Surveyor kit. Panel A, lane 1 is a

PstI/DNA standard. Panel B shows SR2 digestion pattern with

nondenaturing polyacrylamide gel electrophoresis and 0.1, 0.3, or

0.5 μL CJE/CEL I. Lanes marked G+J are the multiplex of Andean

genotypes, B+D a multiplex of Mesoamerican genotypes, and

B+J and D+G are the multiplex of parents of Mesoamerican and

Andean populations, respectively. Arrows show the digested

fragments for SR2. Panel B, lane 1 is a 50-kb ladder standard.

Both images are inverted in black and white.

388 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MARCH–APRIL 2009

Figure 2. Single nucleotide polymorphisms (SNPs) between parental genotypes for the sequence-characterized amplifi ed region (SCAR)

useful for selecting virus resistance (SR2) detected on LI-COR 4200 denaturing gels. Panel A shows that two SNPs were confi rmed by

the appearance of bands in both the IRD800 and IRD700 channels. The MW of the bands in either channel add to the full length product

for the SR2 marker (570 bp). Panel B shows schematically the position of the two SNPs within the SR2 marker.

CROP SCIENCE, VOL. 49, MARCH–APRIL 2009 WWW.CROPS.ORG 389

the S1 nucleases have been used; however, reaction con-ditions of these other enzymes, such as pH and enzyme specifi cities, have generally been unsuitable for cleaving single base pair mismatches, limiting their applicability for

use in heteroduplex analysis (Comai and Henikoff , 2006). Our results showing similar activity and effi ciency of CJE/CEL I and commercial Surveyor CEL I agree with fi ndings of Till et al. (2004), who demonstrated that simple salting

Figure 3. Sequence alignment of fragments of the sequence-characterized amplifi ed region (SCAR) useful for selecting virus resistance

(SR2) from DOR364, G19833, BAT93, Jalo EEP558, DOR476, and SEL1309. Single nucleotide polymorphisms (SNPs) are indicated

with arrows above the polymorphic nucleotide positions. The HaeIII restriction site is shown in the shaded box for the Mesoamerican

genotypes, while the insertion–deletion (InDel) between DOR364 and SEL1309 is identifi ed with dots. The polymerase chain reaction

(PCR) primers are indicated with right and left arrows above and below the 5′ and 3′ termini, respectively. DOR476 and SEL1309

sequences are equivalent to GenBank accession numbers BV681857 and BV681858, respectively.

390 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MARCH–APRIL 2009

out and dialysis steps are suffi cient to obtain an enzyme whose performance compares favorably with that of special enzyme preparations, thus obviating the need for special purifi cation steps like ConA-Sepharose chromatography or DEAE-Sephacel Chromatography and associated spe-cialized laboratory equipment (Till et al., 2003, Qiu et al., 2004; Oleykowski et al., 1998). Till et al. (2004) also found that a celery juice extract was similar in its effi ciency to commercial mung bean nuclease, Surveyor enzyme, and purifi ed CEL I and often worked better than highly puri-fi ed CEL I for heteroduplex mismatch applications.

In the second half of this study, we successfully applied heteroduplex analysis to two specifi c purposes: (i) to dis-cover SNPs for a SCAR marker important for the selection of virus resistance in common bean, and (ii), to genetically map new EST-based markers, thus showing that CEL I can be useful for marker development in common bean. In the case of the SCAR marker, CEL I digestion was suc-cessful at converting a monomorphic PCR fragment into a codominant polymorphic marker that could be useful in plant breeding applications, as was found by Vandemark and Miklas (2002) for another SCAR marker in common bean. This process was also shown to be very precise since we were able to identify the SNP polymorphism found at the HaeIII site in the SR2 marker from Blair et al. (2007), as well as to discover an additional SNP near the middle of the SR2 fragment not previously found with restriction enzyme analysis. Resequencing and alignment of vari-ous alleles showed that we detected both the same SNP as originally reported in Blair et al. (2007) and an addi-tional SNP between Mesoamerican and Andean parents, and identifi ed exactly the positions of both SNPs within the SR2 fragment. The additional SNP was located 40 bp from the original SNP detected with HaeIII. Moreover, no additional sequence diff erences were found between Mesoamerican and Andean alleles in the SR2 fragment. The CEL I digestion technique that we developed was also

useful for genetic mapping of the two SNPs we found in SR2, with the map location for the SR2 fragment deter-mined by CEL I analysis matching the map location based on CAPS analysis reported in Blair et al. (2007), showing that segregation analysis using CEL I digestion and aga-rose screening is accurate.

The SNPs detected in the SR2 locus and the previously described CAPS are important in practical terms, because this marker is associated with resistance to BGYMV as well as to two additional potyviruses, Bean common mosaic virus and Bean common mosaic necrosis virus, based on the presence of the bc-12 and bgm-1 genes at the SR2 locus (Miklas et al., 2000; Vandemark and Miklas, 2002; Blair et al., 2007). Moreover, the inexpensive nature of the CEL I diges-tion technique makes this a valuable alternative to HaeIII digestion in marker-assisted selection or in further analysis of this locus. Either of the SNPs uncovered by the research performed in this study could also lead to the develop-ment of other types of codominant assays that are based on quantitative PCR amplifi cation and Taqman diges-tion (Meksem et al., 2001; Vandemark and Miklas 2002), and dot-blot hybridization assays (Shirasawa et al., 2006). One potential disadvantage of our method is the lower level of multiplexing and lower throughput of the CEL I digestion method relative to that of other SNP detection methods being developed for genotyping in plants, such as oligonucleotide pool assays and high density microarrays. However, unlike these other methods, our CEL I method requires no proprietary and costly equipment or ingredi-ents, making its cost of 1.26 USD per genotype (Kadaru et al., 2006) highly competitive.

In the EST marker development process, meanwhile, we found the same high polymorphism detection and con-version effi ciency for putative Andean versus Mesoameri-can SNPs as described by Ramirez et al. (2005). Among the 37 EST-based markers developed in our research, 59% showed polymorphism between population parents, and of these, 36% showed good resolution on 4% agarose gels in the mapping exercise. Markers with SNP in the middle of the EST-based amplicon were ideal because they gave the clearest double digestion fragment signals on agarose gels. The polymorphism values we found are similar to those for EST marker development in soybean and sunfl ower (Helianthus annuus L.), where 18.6 to 51% of primers pairs designed for SNPs are polymorphic (Lai et al., 2005; Zhang et al., 2004). The lack of polymorphism for 15 markers in our study may have been due to SNP placement within the amplicon or to sequencing error in the SNP discovery pro-cess from Ramirez et al. (2005), although we did control for this by specifi cally evaluating contigs with more than four validating ESTs (two for each genepool).

The success of marker development could be improved by evaluating SNPs from contigs with a greater redun-dancy of ESTs across Andean and Mesoamerican source

Figure 4. CEL I from celery juice extract (CJE/CEL I) digestion of

the sequence-characterized amplifi ed region (SCAR) useful for

selecting virus resistance (SR2) for a subset of 25 recombinant

inbred lines (RILs) from the BAT93 × Jalo EEP558 population,

detected on agarose gels. Panels A and B show cleavage of

heteroduplexes formed from DNA of RILs with BAT93 and Jalo

EEP558 parental DNA, respectively. The top band in each panel

shows the full length polymerase chain reaction (PCR) product,

while the bottom bands represent digestion products. The letters

above the two panels represent the alleles determined, namely

(B) homozygous BAT93, (J) homozygous Jalo EEP 558 or (H)

heterozygous.

CROP SCIENCE, VOL. 49, MARCH–APRIL 2009 WWW.CROPS.ORG 391

Figure 5. Segregation analysis of expressed sequence tag (EST)–based markers. Panel A shows segregation patterns for BSNP 1 and

BSNP 28 for the DOR364 × G19833 mapping population. Cleavage of heteroduplexes formed from DNA of each recombinant inbred line

mixed with DOR364 (for BSNP 1) or G19833 (for BSNP 28) parental DNA, with parental genotypes indicated with the letters (D) DOR364

and (G) G19833. Panel B shows linkage groups where the EST-based markers (in bold) are located.

392 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MARCH–APRIL 2009

tissues, by comparing parents from even more polymor-phic crosses, by using primer pairs that target introns, or by implementing higher resolution gel assays of the CEL I digestions. Even without any improvements, however, CEL I assays to detect SNPs in ESTs appear to be at least as reliable (in terms of error rate) as sequencing parental alleles and off er a high throughput and inexpensive alter-native to resequencing (Yang et al., 2004). The ability of celery juice extract CEL I to detect a mismatch at one or more nucleotide positions without prior knowledge about this sequence was shown by Oleykowski et al. (1998) to provide a powerful method for polymorphism screening. This has been borne out by our results, as well as by sev-eral recent studies. For example, CEL I has proved useful for SNP discovery in tomato (Lycopersicon esculentum L.) (Yang et al., 2004), for SNP mapping in spruces (Run-gis et al., 2005), and for EcoTILLING in several species (Kadaru et al., 2006; Gilchrist et al., 2006).

The discovery and utilization of SNP-based polymor-phisms is an essential aspect of diverse areas of research within plant breeding and reverse genetics. Our results confi rm that SNP detection off ers the possibility to use candidate genes and ESTs for saturating molecular maps with functional markers as was found by Andersen and Lubberstedt (2003). For example, among the EST-based markers we mapped in our study, BSNP 6 for contig 2402 had high similarity to myo-inositol-1-phosphate synthase in soybean and was mapped to linkage group b02. This enzyme plays an important role in seed development, membrane traffi cking, and signaling pathways, as well as in phytic acid biosynthesis (Abreu and Aragao, 2006), where it could prove useful in future mapping or marker-assisted selection of phytic acid content, an important nutrient. Another potentially valuable marker is BSNP 28 for contig 2620, located on linkage group b03, which shows similarity to S-adenosylmethionine decarboxylase in lima bean (Phaseolus lunatus L.). This enzyme partici-pates in gene regulation at both the transcriptional and post-transcriptional levels, enabling plants to sense envi-ronmental changes such as increased water stress (Hu et al., 2005; Micheletto et al., 2007), and thus could be use-ful in genetic evaluations of drought stress tolerance.

Further analysis of the newly developed EST-based markers could also be useful for comparative genetic mapping between species in addition to their evaluation as candidate genes underlying agronomically important traits, although for genomewide SNP discovery, a larger scale evaluation than that employed in this study would be warranted. In particular, the SNP assay could be use-ful for polymorphism detection in conserved ortholog set (COS) markers (Choi et al., 2006), which are often monomorphic in size but variable in sequence, and many of which have yet to be mapped in common bean. Vari-ous SNP-based technologies have been used for mapping

regulatory genes for drought stress tolerance and inte-grating linkage group in barley, (Hordeum vulgare L.) (Tondelli et al., 2006; Rostoks et al., 2005), for COS mapping in cassava, (Manihot esculenta L.) (Castelblanco and Fregene, 2006), for mapping seed quality genes in soybean (Kim et al., 2004), for analyzing the waxy gene in rice (Oryza sativa L.) (Yamanaka et al., 2004), and for analyzing linkage disequilibrium across the genome of soybean (Zhu et al., 2003).

Another practical result of our study has been to adapt several detection platforms to the evaluation of CEL I digestion products such as those for EST or SR2 markers. We found the agarose gel system to be useful for enzyme evaluation and for detection of SNPs that occur singly within test fragments, as in the ESTs that we evaluated, while nondenaturing and denaturing polyacrylamide gel systems were more sensitive for a fragment that contained two SNPs together, the SR2 marker. We also found aga-rose gels to be useful for the genetic mapping of ESTs as well as the SR2 marker, based on heteroduplex formation during multiplex PCR amplifi cation, a novel approach that saves time and mixing steps prior to CEL I digestion. Other laboratories have also applied CEL I-based SNP detection to a simplifi ed gel system. For example, Kadaru et al. (2006) combined unlabeled primers and nondenatur-ing polyacrylamide gels with single strand-specifi c nucle-ase digestion to evaluate SNPs in the alk and waxy genes among a large diverse group of rice accessions. Raghavan et al. (2007) developed a method for detection of SNPs in stress-related genes in rice using CEL I and agarose gels and found a perfect correspondence between results from agarose- and LI-COR-based analyses.

In conclusion, endonuclease digestion of heteroduplex mismatches as described here with CEL I provides a useful genetic tool for SNP analysis which can be valuable for a variety of genetic marker studies. In addition, during the course of this study we were able to make two important modifi cations to CEL I digestion and mismatch detec-tion cleavage protocols that make this technique useful for marker-assisted selection and genetic mapping of SNP polymorphisms in common bean or other crops. These are (i) obviating the need for commercial enzyme and (ii) adopting a simple detection platform. With this research, we proved that CEL I digestion is effi cient for conversion of both SCARs and ESTs representing genes of interest into easily mappable genetic markers.

AcknowledgmentsWe wish to thank M. Lorieux for help with LI-COR analy-

sis, J. Mejia and A. Arenas for their support in nondenaturing

polyacrylamide gel electrophoresis, and B. Till and F. Davis

for helpful advice. This project was funded by the Generation

Challenge Program and CIAT.

CROP SCIENCE, VOL. 49, MARCH–APRIL 2009 WWW.CROPS.ORG 393

ReferencesAbreu, E.F.M., and F.J.L. Aragao. 2007. Isolation and character-

ization of a myo-inositol-1-phosphate synthase gene from

yellow passion fruit (Passifl ora edulis f. fl avicarpa) expressed

during seed development and environmental stress. Ann. Bot.

(Lond.) 99:285–292.

Andersen, J.R., and T. Lubberstedt. 2003. Functional markers in

plants. Trends Plant Sci. 8:554–560.

Bertin, I., J. Zhu, and M. Gale. 2005. SSCP–SNP in pearl millet:

A new marker system for comparative genetics. Theor. Appl.

Genet. 110:1467–1472.

Blair, M.W., F. Pedraza, H.F. Buendia, E. Gaitán-Solís, S.E. Beebe,

P. Gepts, and J. Tohme. 2003. Development of a genome-

wide anchored microsatellite map for common bean (Phaseo-

lus vulgaris L.). Theor. Appl. Genet. 107:1362–1374.

Blair, M.W., L. Rodriguez, F. Pedraza, F. Morales, and S. Beebe.

2007. Genetic mapping of the bean golden yellow mosaic

geminivirus resistance gene bgm-1 and linkage with potyvi-

rus resistance in common bean (Phaseolus vulgaris L.). Theor.

Appl. Genet. 114:261–271.

Castelblanco, W., and M. Fregene. 2006. SSCP–SNP-based conserved

ortholog set (COS) markers for comparative genomics in cassava

(Manihot esculenta Crantz). Plant Mol. Biol. Rep. 24:229–236.

Ching, A., K. Caldwell, M. Jung, M. Dolan, O. Smith, S. Tingey,

M. Morgante, and A. Rafalski. 2002. SNP frequency, hap-

lotype structure and linkage disequilibrium in elite maize

inbred lines. BMC Genet. 3:19.

Choi, H.-K., M. Luckow, J. Doyle, and D. Cook. 2006. Develop-

ment of nuclear gene-derived molecular markers linked to

legume genetic maps. Mol. Genet. Genomics 276:56–70.

Comai, L., and S. Henikoff . 2006. TILLING: Practical single-

nucleotide mutation discovery. Plant J. 45:684–694.

Comai, L., K. Young, B.J. Till, S.H. Reynolds, E.A. Greene,

C.A. Codomo, L.C. Enns, J.E. Johnson, C. Burtner, A.R.

Odden, and S. Henikoff . 2004. Effi cient discovery of DNA

polymorphisms in natural populations by EcoTILLING. Plant

J. 37:778–786.

Ewing, B., L. Hillier, M.C. Wendl, and P. Green. 1998. Base-call-

ing of automated sequencer traces using Phred: I. Accuracy

assessment. Genome Res. 8:175–185.

FAOSTAT. 2008. FAO statistical databases. Available at http://

faostat.fao.org/ (verifi ed 19 January 2009). FAO, Rome.

Gepts, P., F.J.L. Aragão, E.D. Barros, M.W. Blair, R. Brondani, W.

Broughton, I. Galasso, G. Hernández, J. Kami, P. Lariguet,

P. McClean, M. Melotto, P. Miklas, P. Pauls, A. Pedrosa-

Harand, T. Porch, F. Sánchez, F. Sparvoli, and K. Yu. 2008.

Genomics of Phaseolus beans, a major source of dietary protein

and micronutrients in the tropics, p. 113–143. In P. H. Moore

and R. Ming (ed.) Genomics of tropical crop plants. Springer-

Verlag, New York.

Gilchrist, E.J., G.W. Haughn, C.C. Ying, S.P. Otto, J.U.N. Zhuang,

D. Cheung, B. Hamberger, F. Aboutorabi, T. Kalynyak,

L.E.E. Johnson, J. Bohlmann, B.E. Ellis, C.J. Douglas, and

Q.C.B. Cronk. 2006. Use of EcoTILLING as an effi cient SNP

discovery tool to survey genetic variation in wild populations

of Populus trichocarpa. Mol. Ecol. 15:1367–1378.

Hu, W.-W., H. Gong, and E.C. Pua. 2005. The pivotal roles of

the plant S-adenosylmethionine decarboxylase 5′ untrans-

lated leader sequence in regulation of gene expression at the

transcriptional and posttranscriptional levels. Plant Physiol.

138:276–286.

Kadaru, S., A. Yadav, R. Fjellstrom, and J. Oard. 2006. Alter-

native EcoTILLING protocol for rapid, cost-eff ective single-

nucleotide polymorphism discovery and genotyping in rice

(Oryza sativa L.). Plant Mol. Biol. Rep. 24:3–22.

Kim, M., B.-K. Ha, T.-H. Jun, E.-Y. Hwang, K. Van, Y. Kuk, and

S.-H. Lee. 2004. Single nucleotide polymorphism discovery

and linkage mapping of lipoxygenase-2 gene (Lx2) in soy-

bean. Euphytica 135:169–177.

Lai, Z., K. Livingstone, Y. Zou, S. Church, S. Knapp, J. Andrews,

and L. Rieseberg. 2005. Identifi cation and mapping of SNPs

from ESTs in sunfl ower. Theor. Appl. Genet. 111:1532–1544.

Lander, E.S., P. Green, J. Abrahamson, A. Barlow, M.J. Daly, S.E.

Lincoln, and L. Newburg. 1987. MAPMAKER: An interac-

tive computer package for constructing primary genetic link-

age maps of experimental and natural populations. Genomics

1:174–181.

Lis, J.T., G. Lawrence, and M. Kivie. 1980. Fractionation of DNA

fragments by polyethylene glycol induced precipitation.

Methods Enzymol. 65:347–353.

Meksem, K., E. Ruben, D.L. Hyten, M.E. Schmidt, and D.A.

Lightfoot. 2001. High-throughput genotyping for a polymor-

phism linked to soybean cyst nematode resistance gene Rhg4

by using TaqmanTM probes. Mol. Breed. 7:63–71.

Micheletto, S., L. Rodriguez-Uribe, R. Hernandez, R.D. Richins,

J. Curry, and M.A. O’Connell. 2007. Comparative transcript

profi ling in roots of Phaseolus acutifolius and P. vulgaris under

water defi cit stress. Plant Sci. 173:510–520.

Miklas, P., J. Kelly, S. Beebe, and M.W. Blair. 2006. Common

bean breeding for resistance against biotic and abiotic stresses:

From classical to MAS breeding. Euphytica 147:105–131.

Miklas, P., R. Larsen, R. Riley, and J. Kelly. 2000. Potential

marker-assisted selection for bc-12 resistance to bean common

mosaic potyvirus in common bean. Euphytica 116:211–219.

Nasu, S., J. Suzuki, R. Ohta, K. Hasegawa, R. Yui, N. Kitazawa,

L. Monna, and Y. Minobe. 2002. Search for and analysis of

single nucleotide polymorphisms (SNPs) in rice (Oryza sativa,

Oryza rufi pogon) and establishment of SNP markers. DNA

Res. 9:163–171.

Nordstrom, T., K. Nourizad, M. Ronaghi, and P. Nyren. 2000.

Method enabling pyrosequencing on double-stranded DNA.

Anal. Biochem. 282:186–193.

Oleykowski, C.A., C.R. Bronson Mullins, A.K. Godwin, and

A.T. Yeung. 1998. Mutation detection using a novel plant

endonuclease. Nucleic Acids Res. 26:4597–4602.

Qiu, P., H. Shandilya, J. D’Alessio, K. O’Connor, J. Durocher, and

F. Gerard. 2004. Mutation detection using Surveyor nuclease.

Biotechniques 36:702–707.

Raghavan, C., M. Naredo, H. Wang, G. Atienza, B. Liu, F. Qiu,

K. McNally, and H. Leung. 2007. Rapid method for detect-

ing SNPs on agarose gels and its application in candidate gene

mapping. Mol. Breed. 19:87–101.

Ramirez, M., M.A. Graham, L. Blanco-Lopez, S. Silvente, A.

Medrano-Soto, M.W. Blair, G. Hernandez, C.P. Vance, and

M. Lara. 2005. Sequencing and analysis of common bean

ESTs. Building a foundation for functional genomics. Plant

Physiol. 137:1211–1227.

Rozen, S., and H.J. Skaletsky. 2000. PRIMER 3 on the WWW

for general users and for biologist programmers. p. 365–386.

In S. Krawetz and S. Misener (ed.) Bioinformatics methods

and protocols: Methods in molecular biology. Humana Press,

Totowa, NJ.

394 WWW.CROPS.ORG CROP SCIENCE, VOL. 49, MARCH–APRIL 2009

Rungis, D., B. Hamberger, Y. Bérubé, J. Wilkin, J. Bohlmann,

and K. Ritland. 2005. Effi cient genetic mapping of single

nucleotide polymorphisms based upon DNA mismatch diges-

tion. Mol. Breed. 16:261–270.

Shirasawa, K., S. Shiokai, M. Yamaguchi, S. Kishitani, and T. Nishio.

2006. Dot-blot-SNP analysis for practical plant breeding and

cultivar identifi cation in rice. Theor. Appl. Genet. 113:147–155.

Soleimani, V., B. Baum, and D. Johnson. 2003. Effi cient validation

of single nucleotide polymorphisms in plants by allele-specifi c

PCR, with an example from barley. Plant Mol. Biol. Rep.

21:281–288.

Thiel, T., R. Kota, I. Grosse, N. Stein, and A. Graner. 2004.

SNP2CAPS: A SNP and INDEL analysis tool for CAPS

marker development. Nucleic Acids Res. 32:e5.

Till, B.J., C. Burtner, L. Comai, and S. Henikoff . 2004. Mismatch

cleavage by single-strand specifi c nucleases. Nucleic Acids

Res. 32:2632–2641.

Till, B.J., T. Colbert, R. Tompa, L. Enns, C. Codomo, J. Johnson,

S.H. Reynolds, J.G. Henikoff , E.A. Greene, M.N. Steine, L.

Comai, and S. Henikoff . 2003. High-throughput TILLING

for functional genomics. p. 205–220. In E. Grotewald (ed.)

Plant functional genomics: Methods and protocols. Humana

Press, Totowa, NJ.

Tondelli, A., E. Francia, D. Barabaschi, A. Aprile, J. Skinner, E.

Stockinger, A. Stanca, and N. Pecchioni. 2006. Mapping reg-

ulatory genes as candidates for cold and drought stress toler-

ance in barley. Theor. Appl. Genet. 112:445–454.

Van, K., E.Y. Hwang, M.Y. Kim, H.J. Park, S.H. Lee, and P.B.

Cregan. 2005. Discovery of SNPs in soybean genotypes fre-

quently used as the parents of mapping populations in the

United States and Korea. J. Hered. 96:529–535.

Vandemark, G.J., and P.N. Miklas. 2002. A fl uorescent PCR

assay for the codominant interpretation of a dominant SCAR

marker linked to the virus resistance allele bc-12 in common

bean. Mol. Breed. 10:193–201.

Yamanaka, S., I. Nakamura, K. Watanabe, and Y.-I. Sato. 2004.

Identifi cation of SNPs in the waxy gene among glutinous

rice cultivars and their evolutionary signifi cance dur-

ing the domestication process of rice. Theor. Appl. Genet.

108:1200–1204.

Yang, W., X. Bai, E. Kabelka, C. Eaton, S. Kamoun, E. van der

Knaap, and F. David. 2004. Discovery of single nucleotide

polymorphisms in Lycopersicon esculentum by computer aided

analysis of expressed sequence tags. Mol. Breed. 14:21–34.

Zhang, W.K., Y.J. Wang, G.Z. Luo, J.S. Zhang, C.Y. He, X.L.

Wu, J.Y. Gai, and S.Y. Chen. 2004. QTL mapping of ten

agronomic traits on the soybean (Glycine max L. Merr.) genetic

map and their association with EST markers. Theor. Appl.

Genet. 108:1131–1139.

Zhu, Y.L., Q.J. Song, D.L. Hyten, C.P. Van Tassell, L.K. Matuku-

malli, D.R. Grimm, S.M. Hyatt, E.W. Fickus, N.D. Young,

and P.B. Cregan. 2003. Single-nucleotide polymorphisms in

soybean. Genetics 163:1123–1134.