Capsular Transformation of a Multidrug‐Resistant Streptococcus pneumoniae In Vivo

707

Capsular Transformation of a Multidrug-Resistant Streptococcus pneumoniaeIn Vivo

Mirjana Nesin, Mario Ramirez, and Alexander Tomasz Laboratory of Microbiology, Rockefeller University, and PerinatologyCenter, Cornell University Medical College, New York, New York

Several multidrug-resistant (MDR) isolates of Streptococcus pneumoniae recovered from a varietyof clinical sources and expressing serotypes 9N, 14, 19F, and 3 could not be distinguished from thecapsular type 23 Spanish/USA epidemic clone in antibiotype, pulsed-field gel electrophoretic pattern,and restriction fragment length polymorphism types of their penicillin binding protein genes 1A,2X, and 2B. When tested in a mouse model of virulence, isolates expressing capsular type 3 werelethal for 100% of infected animals within 2 days after intraperitoneal injection of 102 cfu/mouse.In contrast, several capsular type 23F isolates belonging to the MDR Spanish/USA clone andrecovered from the same site were not lethal, even when injected at the dose of 107 cfu/mouse. Thesedata suggest that the pneumococcal isolates expressing serotypes 9N, 14, 19F, and 3 representproducts of in vivo capsular transformation events in which the MDR epidemic capsular type 23FSpanish/USA clone was the recipient.

The nasopharynx of young children, especially toddlers at- (PBP) genes, allows classification of penicillin-resistant pneu-mococci into clonal types. Isolates belonging to a clone astending day care centers, is frequently colonized by Streptococ-

cus pneumoniae [1, 2]. Invasive disease may develop in up to defined by these techniques usually share an identical serotype.When a strain with a familiar clone-specific DNA type but a15% of colonized persons [3]. The appearance and worldwide

spread of multidrug-resistant (MDR) isolates of S. pneumoniae new, unusual serotype is recovered from a clinical specimen,the most parsimonious explanation is that this strain has ac-[4–6] and low levels of antibodies against capsular polysaccha-

rides in young children [7, 8] make this pathogen increasingly quired from an outside source DNA encoding for the synthesisof the new capsule and that this DNA was introduced into thedifficult to treat. For reasons not fully understood, penicillin-

resistant clinical isolates of pneumococci most frequently ex- strain’s otherwise unaltered clone-specific genetic background[14, 15].press only a few serotypes (primarily serotypes 6, 14, 19, and

23) of the 90 different pneumococcal serotypes that have been Acquisition of a new capsule may provide the transformanta temporary in situ advantage against the immune system ofidentified [9]. This should provide an opportunity for the con-

struction of a conjugate vaccine effective in raising protective the host. In addition, in vivo capsular transformation may bea mechanism for spreading the antibiotic-resistant phenotypeantibodies against most penicillin-resistant strains [10].

The capacity of pneumococci for genetic transformation was to capsular types other than the currently dominant pediatricserotypes, and it may even change the clinical profile of disease.first described in transformation of capsular type [11]. A large

number of experiments have demonstrated transfer of a variety Herein we report use of molecular techniques to documentwhat appear to be spontaneously occurring capsular transfor-of different capsular genes through DNA-mediated genetic

transformation in the laboratory, and the occurrence of genetic mation events in which the MDR capsular type 23F Spanish/USA clone was the recipient of capsular genes 3, 9N, 14,transformation in vivo (including exchange of genetic material

between live pneumococcal strains) has also been demonstrated and 19F.by elegant experiments of Ottolenghi-Nightingale [12, 13]. Theavailability of molecular techniques to type strains, such as

Materials and Methodspulsed-field gel electrophoresis (PFGE) and restriction frag-ment length polymorphism of the penicillin binding protein Isolates. Sources of the S. pneumoniae isolates were as fol-

lows: Isolates K2, K5, K9, K14, K16, K22, K30, K33, K34, andK46 were provided by Y. Chong and K. Lee (Pediatric Hospitalof the University of Seoul, South Korea); isolates SV6, SV10,SV17, SV35, SV40, SV47, SV51, SV36, and SV45 were recovered

Received 11 July 1997; revised 6 October 1997.at the St. Vincent’s Medical Center of Richmond, New York (R.Financial support: NIH (AI-37275); Aaron Diamond Foundation. M.R. wasLeggiadro); isolates CRO and ESP originated in the New Yorksupported by a fellowship from the Gulbenkian Foundation and Fundacao Luso

Americana para o Desenvolvimento. Hospital Cornell University Medical Center (provided by RichardReprints or correspondence: Dr. Alexander Tomasz, Laboratory of Microbi- B. Roberts); 3 isolates, NC 195, NC 209-2, and NC 211, cultured

ology, Rockefeller University, 1230 York Ave., New York, NY 10021 (tomaszfrom the nasopharynx of a child attending the Frank Porter [email protected]).Child Development Center (Chapel Hill, NC), were obtained from

The Journal of Infectious Diseases 1998;177:707–13Frederick Henderson [14]; previously characterized isolates of theq 1998 by The University of Chicago. All rights reserved.

0022–1899/98/7703–0025$02.00 MDR capsular type 23F Spanish/USA clone of S. pneumoniae

/ 9d41$$mr36 01-09-98 19:37:25 jinfa UC: J Infect

by guest on July 13, 2011jid.oxfordjournals.org

Dow

nloaded from

http://jid.oxfordjournals.org/

708 Nesin et al. JID 1998;177 (March)

Figure 1. Pulsed-field gel electropho-resis (PFGE) profiles of S. pneumoniaeisolates expressing different capsulartypes. Numbers refer to serotype; geo-graphic origin is indicated by letter sym-bols: Cl, Cleveland; SV, St. Vincent’sHospital in New York City; NC, NorthCarolina; Ko, South Korea; NY, NewYork Hospital in New York City. PFGEprofiles of all MDR isolates are verysimilar: minimal differences in PFGEprofiles do not meet criteria to considerthem distinct clones. Prototype MDRserotype 23F isolate from Cleveland(CL2) is shown for comparison. Molec-ular size markers (M) were generatedfrom l phage DNA.

clone expressing capsule type 23F and a penicillin-susceptible lab- chains to the cell surface [22]. Synthetic oligonucleotide primerswere designed based on the published sequence of the orf1 geneoratory strain R6 were from the strain collection at Rockefeller

University. and neighboring area: CAP3-ORF1d (ACCGTAATCAGGGAGA-GAAGTCTGG) and CAP3-ORF1r (CCGGACGTTTCACAT-Isolates were cultured on tryptic soy agar plates supplemented

with 3% sterile sheep blood at 377C. a-hemolytic colonies were GAGTGTC).The second probe, Cap3-cap3B, represents a 495-bp fragmenttested for sensitivity to optochin and serotyped by the Quellung

reaction with Danish typing sera (Statens Seruminstitut, Copenha- of the cap3B/cps3C gene coding region (380–874 bp) (accessionnumber Z47210). This gene has high homology to several polysac-gen).

Antibiotic susceptibilities were determined by the agar dilution charide synthases, and in vitro assays suggest that Cps3S is thetype 3 capsule polysaccharide synthase [23]. Primers for this probemethod with inoculum sizes of 105 cfu/mL and breakpoints as

recommended by the National Committee for Clinical Laboratory were CAP3-CAP3Bd (CTATCCGCGTTGGGCTGG) and CAP3-CAP3Br (AACCTTCTGCCCACCTTAGTTGC). ChromosomalStandards [16].

PFGE. Chromosomal DNA fragments, generated by SmaI di- DNA from S. pneumoniae SIII (a transformant of strain R36Aexpressing serotype 3) was used as a template for the PCR ampli-gestion, were prepared and analyzed as described previously [17].

Hybridization with DNA probes specific for segments of serotype fications.Restriction patterns of the PBP 1A, 2X, and 2B genes. The3 gene cassette. The SmaI-generated restriction fragments of

chromosomal DNA from isolates expressing serotype 3 and 23F fragments of genes coding for PBPs 1A, 2X, and 2B were amplifiedfrom the chromosomal DNA via PCR. The following is a modifi-were separated by PFGE and transferred by use of the Vacuum

Gene System (Pharmacia LKB Biotech, Uppsala, Sweden) to nylon cation of the original protocol by Zhang et al. [24] as modified in[17]. Pneumococci were grown in a casein hydrolysate plus yeastmembranes (HybondN/; Amersham, Amersham, UK) according to

the manufacturer’s conditions. Two DNA probes encoding se- extract (C / Y) medium to an optical density of 0.7–0.9 at 600nm. Three microliters of cell culture was diluted in 147 mL ofquences present in the serotype 3 gene cassette were generated

by polymerase chain reaction (PCR) amplification, purified from water, and the cells were lysed by boiling for 2 min. Thirty-fivemicroliters of cell lysate was used directly in the PCR. The 2.2-agarose gels, and labeled (ECL Random Prime Labelling Kit; Am-

ersham). One probe, Cap3-orf1, represents a 453-bp fragment of kb fragment of PBP 1A gene was amplified by use of primersPn1A and Pn1a rev as described by McDougal et al. [25]. Thethe orf1 gene coding sequence (173–625 bp) (GenBank accession

number Z47210) [18–21]. The function of this gene is not known, 1.5-kb fragment of the PBP 2B gene was amplified with primersPn2Bup and Pn2Bdown as described by Dowson et al. [26]. Thebut it is virtually identical to cps19fC of serotype 19F, a gene

presumably involved in the translocation of the polysaccharide 2-kb PBP 2X gene fragment was amplified with primers Pn2Xup



Dow

nloaded from


709JID 1998;177 (March) Multidrug-Resistant S. pneumoniae

Figure 2. Polymorphism of PBP 2X and 2B genes from pneumococcal isolates expressing serotypes 9N, 14, and 19F: A, PBP 2X (digestionwith HinfI) from Korean MDR isolates of serotypes 23F and 19F; B, PBP 2X digested with HinfI and MseI / DdeI from isolates expressingserotypes 14 and serotype 23F recovered from throat of child in North Carolina [14], and PBP 2X digested with MseI / DdeI from serotype23F and 9N isolates from New York Hospital; C, restriction fragmentation profiles generated by StyI from PBP 2B of Korean serotype 19Fand 23F isolates; and D, profiles generated by restriction with StyI and HinfI of PBP 2B from isolates expressing serotypes 23F, 14, and 9N.Molecular size marker (M) is plasmid DNA pBR322 digested with MspI.

and Pn2Xdown as described by Munoz et al. [6]. The amplified amplified fragments of the PBP 2X gene were digested by HinfIand MseI / DdeI. Restriction fragments were end-labeled with a-fragments were purified by 5% polyacrylamide preparative gel

electrophoresis as described by Maxam and Gilbert [27]. 35S–labeled dCTP in the case of StyI-generated fragments andwith a-35S–labeled dATP in the case of HinfI- or MseI / DdeI–The amplified fragments of PBP 1A and PBP 2B genes from

each isolate were digested with HinfI and also with StyI. The generated fragments.



Dow

nloaded from



Figure 3. Restriction fragment lengthpolymorphism profiles of PBPs 1A, 2X, and2B from MDR pneumococcal isolates ex-pressing serotypes 3 and 23F, determined byuse of variety of restriction nucleases: A,HinfI for PBP 1A; B, StyI (top) and HinfI(bottom) for PBP 2B; and C, MseI / DdeI(top) and HinfI (bottom) for PBP 2X. Sero-types 23F or 3 are indicated; lanes withoutsuperscript (8 or 9) represent strain Cl2 (sero-type 23F isolate from Cleveland). M, molecu-lar size markers.

Plasmid DNA and pBR322 digested with MspI and labeled with Resultsa-35S–labeled dCTP were used as size markers. Fragment sizes

Figure 1 shows the PFGE profiles of the S. pneumoniaeof molecular markers were 622, 527, 404, 307, 242, Ç200, Ç180,isolates expressing different capsular serotypes 3, 9N, 14, andÇ160, Ç150, 120, 110, 90, 76, 67, and 34 bp from the bottom to19F, together with serotype 23F isolates representing the MDRthe top, respectively.Spanish/USA clone. Except for the serotype 14 penicillin-sus-Fragments were separated on an 8% nondenaturing polyacryl-ceptible isolate from North Carolina (figure 1, lanes 8 and 9),amide gel (25 1 20 cm). Samples were electrophoresed at 150 V

until a bromphenol blue marker dye reached 5 cm from the bottom all of the other isolates shown on the gel showed variations ofof the gel, transferred to filter paper, dried under vacuum, and a similar PFGE profile regardless of their serotype.autoradiographed. The composite figure 2 shows the patterns of PCR-amplified

Comparative virulence assays. A mouse peritoneal test was PBP 2X and PBP 2B genes generated by restriction digestionused to compare the virulence of MDR S. pneumoniae isolates of DNAs from the pneumococcal isolates expressing serotypesrecovered at the same clinical site but expressing either serotype 9N, 14, and 19F. The patterns generated from the MDR capsu-23F or serotype 3. Immunologically naive adult mice were infected lar type 23F isolates are also shown for comparison.intraperitoneally with 3 capsular type 23F pneumococcal isolates

Figure 3 shows similar profiles of PCR-amplified PBP 1A,(SV17, SV35, SV40) and 2 capsular type 3 MDR isolates (pre-

2X, and 2B genes generated by restriction digestion of DNAsumed serotype transformants; SV45, SV36).isolated from the multiresistant pneumococcal strains express-Bacteria were grown to mid-log phase in C / Y medium anding either serotype 3 or serotype 23F. The serotype 3 and 23Fdiluted serially with normal saline, and aliquots containing 10-foldstrains were also compared by Southern hybridization by useserial dilutions of the cultures in the concentration range of 102–of two DNA probes encoding sequences present in the serotype107 cfu/mouse were injected intraperitoneally into groups of 103 gene cassette but not part of the 23F capsular gene complexmice for each bacterial concentration. Survival was recorded for

all groups by daily observations over a period of 1 week. (figure 4; orf1, left, and cap3B/cps3S, right). Only isolates



Dow

nloaded from



resistance to five antibacterial agents (penicillin, tetracycline,chloramphenicol, trimethoprim-sulfamethoxazole, erythromy-cin); chromosomal PFGE pattern after SmaI digestion; and re-striction fragment length polymorphism of PCR-amplified PBPgenes. The simplest interpretation of the findings is that the sero-type 3, 9N, 14, and 19F isolates examined were products ofspontaneous capsular transformation events in which the capsulartype 23F MDR pneumococcal clone was the recipient of newcapsular determinants. In one of these capsular transformationevents, both the putative serotype 14 transformant and the hypo-thetical 23F capsular type recipient were recovered from thethroat of the same child, who was previously also colonized bya fully penicillin-susceptible capsular type 14 strain [14], a strainthat may have been the source of the capsular type 14 determi-

Figure 4. Southern blot hybridization of pulsed-field gel electro- nant. The coincidence of these strains in time in the nasopharynxphoresis of MDR isolates expressing type 3 or 23F capsular type. of the same host raises the possibility that, in this case, all compo-Membrane was hybridized with 0.5-kb fragment of orf1 (left) or cap3

nents of the putative in vivo transformation event, including the(right) gene coding sequence present in capsular type 3 gene cassette.donor of capsular type 14 genes, may have been identified. Never-theless, in this case, as well as in the case of the other serotypetransformants, the recombinational events occurred in vivo, and

SV45 and SV36 (i.e., the 2 isolates expressing capsular type therefore, the DNA donors providing the capsular genes cannot3) hybridized with the probe. be identified with certainty.

The capsular type 3 isolates SV45 and SV36 were also com- The sources of the bacterial isolates examined here werepared for their relative virulence with isolates SV17, SV35, day care centers, nursing homes, and hospitals. In these envi-and SV40 recovered at the same clinical site but expressing ronments, usually with history of frequent antibiotic use,capsular type 23F, by use of the mouse model of peritoneal colonized and infected persons often come in close contact.injection. All animals died within 2 days of injection with This enhances the chance that microorganisms carrying dif-suspensions of isolates SV45 and SV36, even at the low dose ferent genetic information may interact in recombinationalof 102 cfu/animal. In contrast, the 23F isolates caused no mor- events.tality at all in 1 week, even at the high inoculum of 107 cfu/ From our results and those published by Coffey et al. [15],animal (figure 5). it appears that the widely spread epidemic clone of 23F MDR

S. pneumoniae may be a frequent recipient in such geneticevents. The significance of these observations is not clear. ItDiscussionis conceivable that the high prevalence of the 23F MDR clone

The pneumococcal isolates described expressing serotypes 3, among the penicillin-resistant isolates at the clinical sources of9N, 14, and 19F were indistinguishable from the MDR serotype the isolates may play a role here; alternatively, there may be23F Spanish/USA clone of S. pneumoniae in all properties some other genetic advantage that promotes recombination in

these particular strains.examined except their capsular type. These properties include

Figure 5. Comparative virulenceof 1 serotype 23F and 1 serotype 3MDR isolate from St. Vincent’sMedical Center in New York. Adultimmunologically naive mice (groupsof 10/dose/strain) were injected in-traperitoneally with serial dilutionsof isolates expressing either type 3or type 23F capsule. Graph repre-sents % of surviving animals during1 week after injection.



Dow

nloaded from



2. Reicher M, Allphin AA, Breiman RF. The spread of multiply resistantCapsular transformation was first described during the 1920sStreptococcus pneumoniae in a day care center in Ohio. J Infect Disin experimental animals and has been abundantly documented1992;166:1346–53.

in the early literature [11–13, 28, 29]. In elegant experiments, 3. Gray BM, Converse GM, Dillon HC. Epidemiological studies of Strepto-Ottolenghi and Hotchkiss [30] have demonstrated the release coccus pneumoniae in infants: acquisition, carriage and infection during

the first 24 months of life. J Infect Dis 1980;142:923–33.of transforming DNA during growth of pneumococcal cultures,4. Munoz R, Musser JM, Crain M, et al. Geographic distribution of penicillin-and Ottolenghi and MacLeod [31] have demonstrated the emer-

resistant clones of Streptococcus pneumoniae: characterization by peni-gence of recombinant serotypes after inoculation of mice withcillin-binding protein profile, surface protein A typing, and multilocus

2 strains of live pneumococci, thus extending the validity of enzyme analysis. Clin Infect Dis 1992;15:112–8.the historic experiment of Griffith [11]. In the experiments 5. McDougal LK, Facklam R, Reeves M, et al. Analysis of multiply antimi-

crobial-resistant isolates of Streptococcus pneumoniae from the Uniteddescribed herein, as well as in several experiments describedStates. Antimicrob Agents Chemother 1992;36:2176–84.in the recent literature [14, 15, 32], the putative transformation

6. Munoz R, Coffey TJ, Daniels M, et al. Intercontinental spread of a multire-events have been identified by the use of appropriate molecularsistant clone of serotype 23F Streptococcus pneumoniae. J Infect Dis

probing methods without any intervention of the experimenter, 1991;164:302–6.thus confirming that spontaneous capsular transformation 7. Douglas RM, Paton JC, Duncan DJ, Hansman DJ. Antibody response to

pneumococcal vaccination in children younger than five years of age.events do indeed occur among pneumococcal strains in vivo.J Infect Dis 1983;148:131–7.The occurrence of capsular transformation events in vivo

8. Goldblatt D, Levinsky RJ, Turner MW. Role of cell wall polysaccharidehas significance in several respects. Since the nasopharynx ofin the assessment of IgG antibodies to capsular polysaccharides of Strep-

an individual may be simultaneously colonized by more than tococcus pneumoniae in childhood. J Infect Dis 1992;166:632–4.one serotype, capsular transformation may be a mechanism by 9. Henrichsen J. Six newly recognized types of Streptococcus pneumoniae.

J Clin Microbiol 1995;33:2759–62.which S. pneumoniae avoids serotype-specific opsonophago-10. Klein DL. Pneumococcal conjugate vaccines: review and update. Microbcytic antibodies during infection. This may have implications

Drug Resist 1995;1:49–58.for the construction of effective conjugate vaccines. It seems11. Griffith F. The significance of pneumococcal types. J Hyg 1928;27:113–

technically improbable that more than seven serotypes will 59.be represented in the conjugate vaccines [33]. Therefore, if 12. Ottolenghi-Nightingale E. Spontaneously occurring bacterial transforma-

tions in mice. J Bacteriol 1969;100:445–52.predominant serotypes keep changing, more than one vaccine13. Ottolenghi-Nightingale E. Competence of pneumococcal isolates and bac-may be necessary to achieve a protective immunity in a human

terial transformations in man. Infect Immun 1972;6:785–92.population.14. Barnes DM, Whittier S, Gilligan PH, Soares S, Tomasz A, Henderson

Another implication of the finding is related to the fact that FW. Transmission of multidrug-resistant serotype 23F Streptococcusin vivo capsular transformation events, involving as recipients pneumoniae in group day care: evidence suggesting capsular transfor-

mation of the resistant strain in vivo. J Infect Dis 1995;171:890–6.MDR epidemic clones, could effectively spread the multiresis-15. Coffey TJ, Dowson CG, Daniels M, et al. Horizontal transfer of multipletant phenotype to new serotypes different from the four to

penicillin-binding protein genes, and capsular biosynthetic genes, infive capsular types to which the overwhelming majority ofnatural populations of Streptococcus pneumoniae. Mol Microbiol 1991;

penicillin-resistant and multiresistant pneumococcal isolates 5:2255–60.have been restricted until now. 16. National Committee for Clinical and Laboratory Standards. Performance

standard for antimicrobial disk susceptibility tests (M2-T4). 4th ed.The role played by the polysaccharide capsule in pneumo-Vilanova, PA: NCCLS, 1988.coccal virulence has been well established, and the correlation

17. Soares S, Kristinsson KG, Musser JM, Tomasz A. Evidence for the intro-between capsular type and virulence has been greatly expandedduction of a multiresistant clone of serotype 6B Streptococcus pneumon-

through the recent cloning and molecular genetic analysis of iae from Spain to Iceland in late 1980s. J Infect Dis 1993;168:158–63.the capsular biosynthetic genes [34–36]. The result of the ex- 18. Guidolin A, Morona JK, Morona R, Hansman D, Paton JC. Nucleotide

sequence of genes essential for capsular polysaccharide biosynthesis inperiment demonstrating the tremendously increased virulenceStreptococcus pneumoniae type 19F. Infect Immun 1994;62:5384–96.of the serotype 3 multiresistant strain over that of the same

19. Dillard JP, Vandersea MW, Yother J. Characterization of the cassettepneumococcus expressing the 23F capsular type implies thatcontaining genes for type 3 capsular polysaccharide biosynthesis in

capsular transformation events may also equip multiresistant Streptococcus pneumoniae. J Exp Med 1995;181:973–83.strains with highly virulent blood invasive phenotypes, which 20. Arrecubieta C, Garcia E, Lopez R. Sequence and transcriptional analysis

of a DNA region involved in the production of capsular polysaccharidewould increase the seriousness of MDR infections. Such strainsin Streptococcus pneumoniae type 3. Gene 1995;167:1–7.may be able to cause serious infections (meningitis, sepsis)

21. Garcia E, Garcia P, Lopez R. Cloning and sequencing of a gene involvedrather than otitis or pneumonia, as has been the case with thein the synthesis of the capsular polysaccharide of Streptococcus pneu-

drug-resistant strains of pneumococci expressing the currently moniae type 3. Mol Gen Genet 1993;239:188–95.most frequent ‘‘pediatric’’ serotypes. 22. Garcia E, Arrecubieta C, Munoz R, Mollerach M, and Lopez R. A func-

tional analysis of the Streptococcus pneumoniae genes involved in thesynthesis of type 1 and type 3 capsular polysaccharides. Microb Drug

References Resist 1997;3:73–88.1. Boken DJ, Chartland SA, Goering RV, Kruger R, Harrison CJ. Coloniza- 23. Dillard JP, Vandersea MW, Yother J. Characterization of the cassette

tion with penicillin-resistant Streptococcus pneumoniae in a child-care containing genes for type 3 capsular polysaccharide biosynthesis inStreptococcus pneumoniae. J Exp Med 1995;181:973–83.center. Pediatr Infect Dis J 1995;14:879–84.



Dow

nloaded from



24. Zhang QY, Jones DM, Saez-Nieto JA, Perez-Trallero E, Spratt BG. Ge- 30. Ottolenghi E, Hotchkiss RD. Release of genetic transforming DNA fromnetic diversity of penicillin-binding protein 2 genes of penicillin-resis- pneumococcal cultures during growth and disintegration. J Exp Medtant strains of Neisseria meningitidis revealed by fingerprinting of ampli- 1962;116:491–519.fied DNA. Antimicrob Agents Chemother 1990;34:1523–8. 31. Ottolenghi E, MacLeod CM. Genetic transformation among living pneu-

25. McDougal LK, Rasheed JK, Biddle JW, Tenover FC. Identification of mococci in the mouse. Proc Natl Acad Sci USA 1963;50:417–19.multiple clones of extended-spectrum cephalosporin-resistant Strepto- 32. Kell CM, Jordens JZ, Daniels M. Molecular epidemiology of penicillin-coccus pneumoniae isolates in the United States. Antimicrob Agents resistant pneumococci isolated in Nairobi, Kenya. Infect Immun 1993;Chemother 1995;39:2282–8. 61:4382–91.

26. Dowson CG, Hutchinson A, Spratt BG. Extensive remodeling of the trans- 33. Lee CJ, Banks SD, Li JP. Virulence, immunity, and vaccine related topeptidase domain of penicillin-binding protein 2B of a penicillin-resis- Streptococcus pneumoniae. Crit Rev Microbiol 1991;18:89–114.tant South African isolate of Streptococcus pneumoniae. Mol Microbiol 34. Kelly T, Dillard JP, Yother J. Effect of genetic switching of capsular1989;3:95–102.

type on virulence of Streptococcus pneumoniae. Infect Immun 1994;27. Maxam AM, Gilbert W. Sequencing end-labeled DNA with base-specific

62:1813–9.chemical cleavages. Methods Enzymol 1980;65:499–560.

35. Rubens CE, Wessels MR, Heggen LM, Kasper DL. Transposon mutagene-28. Avery OT, MacLeod CM, McCarthy M. Studies on the chemical nature

sis of type III group B streptococcus: correlation of capsule expressionof the substance inducing transformation of pneumococcal types. Induc-with virulence. Proc Natl Acad Sci USA 1987;84:7208–12.tion of transformation by a deoxyribonucleic acid fraction isolated from

36. Briles DE, Crain MJ, Gray BM, Forman C, Yother J. Strong associationpneumococcus type III. J Exp Med 1944;79:137–57.between capsular type and virulence for mice among human isolates of29. Austrian R. Observations on the transformation of pneumococcus in vivo.S. pneumoniae. Infect Immun 1992;60:111–6.Bull Johns Hopkins Hosp 1952;91:189–95.



Dow

nloaded from


https://www.researchgate.net/publication/15030205_Effect_of_genetic_switching_of_capsular_type_on_virulence_of_Streptococcus_pneumoniae?el=1_x_8&enrichId=rgreq-abc648f3eaab6bf1e8ff38ca6f546f08-XXX&enrichSource=Y292ZXJQYWdlOzEzNzM0MjA3O0FTOjEwMzk4MzUzNjQxMDYzM0AxNDAxODAzMDE1OTk3




https://www.researchgate.net/publication/21426963_Strong_association_between_capsular_type_and_virulence_for_mice_among_human_isolates_of_Streptococcus_pneumoniae?el=1_x_8&enrichId=rgreq-abc648f3eaab6bf1e8ff38ca6f546f08-XXX&enrichSource=Y292ZXJQYWdlOzEzNzM0MjA3O0FTOjEwMzk4MzUzNjQxMDYzM0AxNDAxODAzMDE1OTk3






https://www.researchgate.net/publication/9487850_Genetic_transformation_among_living_pneumococci_in_the_mouse?el=1_x_8&enrichId=rgreq-abc648f3eaab6bf1e8ff38ca6f546f08-XXX&enrichSource=Y292ZXJQYWdlOzEzNzM0MjA3O0FTOjEwMzk4MzUzNjQxMDYzM0AxNDAxODAzMDE1OTk3

https://www.researchgate.net/publication/280965239_Sequencing_End-labeled_DNA_with_Base-specific_Chemical_Cleavages?el=1_x_8&enrichId=rgreq-abc648f3eaab6bf1e8ff38ca6f546f08-XXX&enrichSource=Y292ZXJQYWdlOzEzNzM0MjA3O0FTOjEwMzk4MzUzNjQxMDYzM0AxNDAxODAzMDE1OTk3



Capsular Transformation of a Multidrug‐Resistant Streptococcus pneumoniae In Vivo

Documents

Transcript of Capsular Transformation of a Multidrug‐Resistant Streptococcus pneumoniae In Vivo