Role of OmpA in the MDR-phenotype of Acinetobacter baumannii 1 2 Running title: OmpA-mediated resistance 3 4 Authors: Younes Smani1, Anna Fàbrega2, Ignasi Roca2, Viviana Sanchez-Encinales1, Jordi 5 Vila2, Jerónimo Pachón1 6 7 1Instituto de Biomedicina de Sevilla (IBiS), Hospital Universitario Virgen del 8 Rocío/CSIC/Universidad de Sevilla. Clinic Unit of Infectious Diseases, Microbiology and 9 Preventive Medicine. 10 2Department of Clinical Microbiology, School of Medicine, IDIBAPS and Barcelona Centre 11 for International Health Research, (CRESIB, Hospital Clínic-Universitat de Barcelona), 12 Barcelona, Spain. 13 Corresponding author: Dr Y. Smani, Clinic Unit of Infectious Diseases, Microbiology and 14 Preventive Medicine, Institute of Biomedicine of Seville (IBiS), University Hospital Virgen 15 del Rocío, Av. Manuel Siurot s/n, 41013, Sevilla Spain E-mails: ysmani-ibis@us.es; 16 y_smani@hotmail.com 17 18

AAC Accepts, published online ahead of print on 30 December 2013Antimicrob. Agents Chemother. doi:10.1128/AAC.02101-13Copyright © 2013, American Society for Microbiology. All Rights Reserved.

on June 2, 2016 by guesthttp://aac.asm

.org/D

ownloaded from

19 Abstract 20 Acinetobacter baumannii has emerged as a nosocomial pathogen with increased prevalence of 21 multidrug resistant strains. The role of the outer membrane protein A (OmpA) in 22 antimicrobial resistance remains poorly understood. In this report, disruption of the ompA 23 gene led to decreased MICs of chloramphenicol, aztreonam and nalidixic acid. We have 24 characterized, for the first time, the contribution of OmpA in the antimicrobial resistance 25 phenotype of A. baumannii. 26 27

on June 2, 2016 by guesthttp://aac.asm

.org/D

ownloaded from

Acinetobacter baumannii is one of the most important species associated with nosocomial 28 infections, such as ventilator-associated pneumonia, bacteremia, urinary tract infections, skin 29 and wound infections and meningitis (1). During the last decade, this pathogen has become 30 increasingly resistant to most antimicrobials, including broad-spectrum cephalosporins, 31 penicillins, carbapenems, fluoroquinolones and aminoglycosides. Several resistance 32 mechanisms contribute to the MDR phenotype in A. baumannii: decreased outer membrane 33 protein permeability, overexpression of efflux pumps, and acquisition of genetic elements 34 carrying resistance determinants, such as plasmids, integrons, transposons and resistance 35 islands. 36 Gram negative bacteria typically display diverse porins in their outer membrane that 37 participate in the modulation of cellular permeability, being outer membrane protein A 38 (OmpA) one of the most abundant. OmpA is a β-barrel porin highly conserved among 39 bacterial species and in A. baumannii has been associated with a variety of interesting 40 biological properties in in vitro model systems (2). OmpA has been shown to bind host 41 epithelia, target mitochondria, translocate to the nucleus, induce cell death and can also bind 42 factor H, which may allow A. baumannii to develop serum-resistance (3-6). Furthermore, 43 OmpA has also been associated with antimicrobial resistance in related pathogens (7) 44 although only one study has showed the involvement of OmpA as slow channels for β-45 lactams (8). A clear role for OmpA in antimicrobial resistance, however, has not yet been 46 fully demonstrated. 47 To evaluate the involvement of OmpA in antimicrobial resistance, an internal fragment of the 48 ompA gene (578 bp) from A. baumannii strain ATCC 17978 was amplified by PCR using the 49 primers given in table 1 and cloned into the pGEM-T Easy (Promega) vector by A/T cloning 50 (9). The resulting construct was transformed in Escherichia coli strain DH5α, plasmid was 51 then extracted and electroporated into A. baumannii strain ATCC 17978 in order to knock out 52

on June 2, 2016 by guesthttp://aac.asm

.org/D

ownloaded from

its ompA gene by insertional mutagenesis. Transformants were selected on LB agar plates 53 containing 80 µg/ml ticarcillin. ompA gene disruption within the resulting strain, designated 54 JPAB01, was verified by PCR using a combination of primers matching the upstream region 55 of ompA and the pGEM-T Easy vector as well as analyzing the OMPs profile by SDS-PAGE 56 and western blot with OmpA-specific antibodies (Figure 1). 57 PCR, SDS-PAGE and western blot analysis confirmed the disruption of the ompA 58 gene and the absence of OmpA expression in JPAB01 (data not shown). E-test susceptibility 59 of the wild-type and mutant strains to quinolones (ciprofloxacin and nalidixic acid), 60 chloramphenicol, tetracycline, tigecycline, aztreonam, imipenem, erythromycin, 61 trimothoprim, kanamycin, and ceftazidime was performed in duplicates. JPAB01 strain was 62 more susceptible than ATCC 17978 strain to chloramphenicol (>8-fold), aztreonam (8-fold) 63 and nalidixic acid (3-fold) (Table 2), all of which are substrates of efflux pumps. 64 To demonstrate that the increased chloramphenicol, aztreonam and nalidixic acid 65 susceptibilities observed for the JPAB01 strain were due to the lack of a functional OmpA 66 protein, the complementation of JPAB01 has been performed. The ompA gene was amplified 67 with the OmpA-EcoRI F and OmpA-EcoRI R primers (Table 1) from the ATCC 17978 wt 68 genome and cloned into the EcoRI restriction site of the pWH1266 vector (10) yielding the 69 pWH1266-OmpA plasmid called pJPAB01. pJPAB01 was transformed into DH5α and 70 electroporated into JPAB01. Transformants were selected on LB agar plates containing 25 71 µg/mL tetracycline. The complementation of OmpA in JPAB01 strain restored the MICs of 72 chloramphenicol, aztreonam and nalidixic up to > 256, 16 and 16 μg/ml, respectively, 73 demonstrating that OmpA was indeed involved in the chloramphenicol, aztreonam and 74 nalidixic acid-resistant phenotypes. Moreover, the presence of efflux pump inhibitor phenyl-75 arginine-β-naphthylamide (PAβN) reduced the MICs of chloramphenicol, aztreonam and 76

on June 2, 2016 by guesthttp://aac.asm

.org/D

ownloaded from

nalidixic acid MICs at least >8-, 4- and 8- fold in the wild-type strain, and the complemented 77 strain. 78 A similar reduction on the MICs of aztreonam and nalidixic acid, but not of chloramphenicol 79 were observed for the mutant JPAB01 strain in the presence of the inhibitor (Table 2). These 80 results suggest the presence of additional mechanisms contributing to the reduced 81 susceptibility to these antibiotics, likely related to the expression of efflux pumps. 82 This is the first description of the involvement of OmpA in antimicrobial resistance in A. 83 baumannii. The exact mechanism of action is not clear but it is possible that OmpA 84 participates in the extrusion of compounds from the periplasmic space through the outer 85 membrane and couples with inner membrane efflux systems, such as MFS efflux pumps or 86 RND systems lacking the OMP component. A similar situation has been described for the 87 MexXY system in Pseudomonas aeruginosa, which, despite lacking a gene coding for an 88 outer membrane porin, can associate with OprM and likely other OMPs such as OpmB, 89 OpmG or OpmH to form a functional tripartite efflux system (11,12). A. baumannii contains 90 several RND tripartite systems, such as AdeABC, AdeIJK and AdeFGH. In AdeABC, the 91 presence of AdeC is not required for antimicrobial resistance suggesting that AdeAB can 92 utilize another outer membrane constituent such as AdeK (13). Analysis of the genome of the 93 ATCC 17978 strain suggests that the adeC gene is missing and thus, other OMPs have to 94 compensate for the lack of adeC. Interestingly, a knock-out mutant of the CraA MFS pump in 95 A. baumannii displays a similar decrease in the MIC of chloramphenicol than that observed 96 for JPAB01 (14) and no further effect is observed in the presence of efflux inhibitors. 97 In E. coli and Citrobacter freundii, increased expression of OmpA homologues have been 98 associated with decreased susceptibility to tetracycline (7) and carbapenems (15), 99 respectively. Taking into account that OmpA is the major outer membrane protein in A. 100 baumannii, we cannot rule out the possibility that its absence in the knock-out mutant disturbs 101

on June 2, 2016 by guesthttp://aac.asm

.org/D

ownloaded from

membrane processes including the transport of antimicrobial agents. To our knowledge, there 102 are no studies regarding the overall modification of gene expression upon OmpA loss in A. 103 baumannii and this matter should be further investigated. In our study, only three non-related 104 antimicrobials have shown a reduced MIC in the knock-out strain and, thus, we do not believe 105 such disturbance to be a major issue. 106 It is clear that additional studies are needed to evaluate the clinical relevance of OmpA 107 expression in MDR but we have shown the participation of OmpA in the antimicrobial 108 resistance phenotype of A. baumannii. 109 110 Acknowledgements 111 Financial support: Dr Y. Smani is funded by the Ministerio de Ciencia e Innovación, Instituto 112 de Salud Carlos III – co-financed by the European Development Regional Fund ‘A way to 113 achieve Europe’ ERDF, Spanish Network for the Research in Infectious Diseases (REIPI 114 RD06/0008).This study was support by Consejería de Innovación, Ciencia y Empresa (CTS 115 6317/10). 116 117

on June 2, 2016 by guesthttp://aac.asm

.org/D

ownloaded from

118 References 119

1. Dijkshoorn L, Nemec A, Seifert H. 2007. An increasing threat in hospitals: multidrug-120 resistant Acinetobacter baumannii. Nat. Rev.Microbiol. 5: 939-951. 121

2. Smith SG, Mahon V, Lambert MA, Fagan RP. 2007. A molecular Swiss army knife: 122 OmpA structure, function and expression. FEMS Microbiol. Lett. 273: 1-11. 123

3. Choi CH, Hyun SH, Lee JY, Lee JS, Lee YS, Kim SA, Chae JP, Yoo SM, Lee JC. 124 2008. Acinetobacter baumannii outer membrane protein A targets the nucleus and 125 induces cytotoxicity. Cell. Microbiol. 10: 309-319. 126

4. Choi CH, Lee EY, Lee Y, Park T, Kim H, Hyun S, Kim S, Lee S, Lee J. 2005. Outer 127 membrane protein 38 of Acinetobacter baumannii localizes to the mitochondria and 128 induces apoptosis of epithelial cells. Cell. Microbiol. 7: 1127-1138. 129

5. Gadddy JA, Tomaras AP, Actis LA. 2009. The Acinetobacter baumannii 19606 OmpA 130 protein plays a role in biofilm formation on abiotic surfaces and in the interaction of this 131 pathogen with eukaryotic cells. Infect. Immun. 77: 3150-3160. 132

6. Kim SW, Moon DC, Jin JS, Lee JH, Shin JH, Kim JM, Lee YC, Seol SY, Cho DT, 133 Lee JC. 2009. Serum resistance of Acinetobacter baumannii through the binding of 134 factor H to outer membrane proteins. FEMS Microbiol. Lett. 301: 224-231. 135

7. Vivieros M, Dupont M, Rodrigues L, Couto I, Davin-Regli A, Martins M, Pagès JM, 136 Amaral L. 2007. Antibiotic stress, genetic response and altered permeability of 137 Escherichia coli. PLoS ONE 2: e365. 138

8. Nitzan Y, Deutsch EB, Pechatnikov I. 2002. Diffusion of beta-lactam antibiotics 139 through oligomeric or monomeric porin channels of some gram-negative bacteria, Curr. 140 Microbiol. 45: 446-455. 141

9. Roca I, Espinal P, Martí S, Vila J. 2011. First identification and characterization of an 142

on June 2, 2016 by guesthttp://aac.asm

.org/D

ownloaded from

AdeABC-like efflux pump in Acinetobacter genomospecies 13TU. Antimicrob. Agents 143 Chemother. 55: 1285-1286. 144

10. Hunger M, Schmucker R, Kishan V, Hillen W. 1990. Analysis and nucleotide 145 sequence of an origin of DNA replication in Acinetobacter calcoaceticus and its use for 146 Escherichia coli shuttle plasmids. Gene 87:45-51 147

11. Chuanchuen R, Murata T, Gotoh N, Schweizer HP. 2005. Substrate-dependent 148 utilization of OprM or OpmH by the Pseudomonas aeruginosa MexJK efflux pump. 149 Antimicrob Agents Chemother. 49: 2133-2136. 150

12. Murata T, Gotoh N, Nishino T. 2002. Characterization of outer membrane efflux 151 proteins OpmE, OpmD and OpmB of Pseudomonas aeruginosa: molecular cloning and 152 development of specific antisera. FEMS Microbiol. Lett. 217: 57-83. 153

13. Marchand I, Damier-Piolle L, Courvalin P, Lambert T. 2004. Expression of the 154 RND-type efflux pump AdeABC in Acinetobacter baumannii is regulated by the AdeRS 155 two-component system. Antimicrob. Agents Chemoth. 48: 3298-3304. 156

14. Roca I, Marti S, Espinal P, Martínez P, Gibert I, Vila J. 2009. CraA, a major 157 facilitator superfamily efflux pump associated with chloramphenicol resistance in 158 Acinetobacter baumannii. Antimicrob Agents Chemother 53: 4013-4. 159

15. Zhang R, Yang L, Cai JC, Zhou HW, Chen GX. 2008. High-level carbapenem 160 resistance in a Citrobacter freundii clinical isolate is due to a combination of KPC-2 161 production and decreased porin expression. J. Med. Microbiol. 57: 332-337. 162 163

on June 2, 2016 by guesthttp://aac.asm

.org/D

ownloaded from

Table 1. Primers used in this study 164 Primer Nucleotide sequences (5’-3’)

OmpAint up GTTAAAGGCGACGTAGACG

OmpAint lw CCAGTGTTATCTGTGTGACC

OmpAext up GGAATGGCTATAACTGACATAATC

OmpAext lw GAATCAGGAGATTTACAAATGACC

OmpA-EcoRI F GACTAGGAATTCGGAATGGCTATAACTGACATAATC

OmpA-EcoRI R GACTAGGAATTCGAATCAGGAGATTTACAAATGACC

M13-Fa GTAAAACGACGGCCAGT

M13-Ra CAGGAAACAGCTATGAC

aPrimer designed in pGEM-T 165 166

on June 2, 2016 by guesthttp://aac.asm

.org/D

ownloaded from

Figure 1. OMPs profile and immunodetection of OmpA of A. baumannii strains. OMPs were 167 extracted from the outer membrane of ATCC 17978 wt, JPAB01, and JPAB01+pJPAB01 168 strains and stained with Simply Blue SafeStain (SDS-PAGE) or electrotransferred onto 169 nitrocellulose membrane (Western blot). OMPs were probed with mouse anti-OMPA and 170 horseradish peroxidase-conjugated goat anti-mouse IgG. Molecular mass standards (kDa) are 171 shown on the right. 172

SDS-PAGE

kDa

37

Western blot

kDa

37

173 174

on June 2, 2016 by guesthttp://aac.asm

.org/D

ownloaded from

Table 2. Determination of MICs to different antimicrobial agents for A. baumannii 175 strains used in this study (mean values of duplicated assays) 176

Antimicrobial agent

MIC (µg/ml)

Difference in susceptibility (fold)

ATCC

17978 wt

JPAB01 JPAB01 +

pJPAB01

ATCC 17978

wt vs. JPAB01

ATCC 17978 wt vs.

JPAB01+ pJPAB01

Ceftazidime 2 3 4 0.67 0.5

Imipenem 0.5 0.38 0.38 1.31 1.31

Ciprofloxacin 0.25 0.38 0.25 0.66 1

Kanamycin 3 1.5 2 2 1.5

Tetracycline 6 4 32 1.5 0.19

Erythromycin 12 6 ND 2 ND

Trimotheprim 32 32 ND 1 ND

Tigecycline 1 0.5 0.5 2 2

Colistin 0.5 0.25 1 2 0.5

Aztreonam 16 2 16 8 1

Aztreonam + PAβN 4 0.5 2 8 2

Nalidixic acid 16 6 16 2.67 1

Nalidixic acid + PAβN 2 2 2 1 1

Chloramphenicol >256 32 >256 >8 >1

Chloramphenicol + PAβN 32 32 32 1 1

ND: not determined. 177

on June 2, 2016 by guesthttp://aac.asm

.org/D

ownloaded from