Research ArticleCharacterization of the algC Gene Expression Pattern inthe Multidrug Resistant Acinetobacter baumannii AIIMS 7 andCorrelation with Biofilm Development on Abiotic Surface

Praveen K Sahu12 Pavithra S Iyer1 Sagar H Barage3

Kailas D Sonawane4 and Balu A Chopade15

1 Institute of Bioinformatics and Biotechnology University of Pune Pune 411 007 India2Ispat General Hospital SAIL Rourkela 769 005 India3Department of Biotechnology Shivaji University Kolhapur 416 004 India4Structural Bioinformatics Unit Department of Biochemistry Shivaji University Kolhapur 416 004 India5Dr Babasaheb Ambedkar Marathwada University Aurangabad 431 001 India

Correspondence should be addressed to Praveen K Sahu praveenkishoresahugmailcom

Received 30 July 2014 Revised 10 November 2014 Accepted 10 November 2014 Published 3 December 2014

Academic Editor Jose Correa Basurto

Copyright copy 2014 Praveen K Sahu et alThis is an open access article distributed under theCreativeCommonsAttribution Licensewhich permits unrestricted use distribution and reproduction in any medium provided the original work is properly cited

Relative quantification of algC gene expression was evaluated in the multidrug resistant strain Acinetobacter baumannii AIIMS7 biofilm (3 to 96 h on polystyrene surface) compared to the planktonic counterparts Comparison revealed differential algCexpression pattern with maximum 8159-fold increase in biofilm cells versus 324-fold in planktonic cells (119875 lt 005) Expressionlevels strongly correlatedwith specific biofilm stages (scale of 3 to 96 h) coincidingmaximumat initial surface attachment stage (9 h)and biofilmmaturation stage (48 h) Cloning heterologous expression and bioinformatics analyses indicated algC gene product asthe bifunctional enzyme phosphomannomutasephosphoglucomutase (PMMPGM) of sim53 kDa size which augmented biofilmssignificantly in algC clones compared to controls (lacking algC gene) further localized by scanning electronmicroscopy Moreovermolecular dynamics analysis on the three-dimensional structure of PMMPGM(simulated up to 10 ns) revealed enzyme structure asstable and similar to that in P aeruginosa (synthesis of alginate and lipopolysaccharide core) and involved in constitution of biofilmEPS (extracellular polymeric substances) Our observation on differential expression pattern of algC having strong correlationwith important biofilm stages scanning electron-microscopic evidence of biofilm augmentation taken together with predictiveenzyme functions via molecular dynamic (MD) simulation proposes a new basis of A baumannii AIIMS 7 biofilm developmenton inanimate surfaces

1 Introduction

In recent years Acinetobacter baumannii has been listed asone of the most important nosocomial pathogens [1ndash3] Thepathogen has become a universal challenge to treatmentowing to its multidrug resistant (MDR) nature and a plethoraof virulence attributes [2 4 5] Associated mortality upto 30 is seen with A baumannii infections [6] such asventilator-associated pneumonia bacteraemia urinary tractinfections burn wound infections endocarditis secondarymeningitis and septicemia especially in intensive care units[1] A baumannii infection and colonization often involve

biofilm formation [7] on either abiotic [8 9] or biotic surfaces[10 11] Biofilm formation is a virulence trait in A baumanniiwhich is ofmultifactorial nature [4 12]Theprocess of biofilmdevelopment in A baumannii is a highly regulated processand could be the interplay of several genetic determinants[13] The extracellular matrices of bacterial biofilm compriseof proteins nucleic acids and polysaccharides [14] which areoften considered as ideal start-points to further investiga-tion towards effective treatment measures against biofilm-associated pathogens such as MDR A baumannii

Acinetobacter spp and Pseudomonas aeruginosa togetherare known to be responsible for a significant proportion of

Hindawi Publishing Corporatione Scientific World JournalVolume 2014 Article ID 593546 14 pageshttpdxdoiorg1011552014593546

2 The Scientific World Journal

nosocomial infections [15] with crude mortality rates of 30to 75 in case of nosocomial pneumonia only [16] In patientswith cystic fibrosis alginate production by P aeruginosa isfound to be associated with highmorbidity andmortality [1718] Production of alginate an exopolysaccharide is respon-sible for development of mucoid bacterial phenotype [17 19]which is associated with biofilm formation in P aeruginosaunder iron limiting conditions [20] although proportions ofalginate in the extracellular polysaccharidepolymeric sub-stances (EPS) of biofilm could vary significantly in strains likePA14 and PA01 of P aeruginosa [21] It acts as an intercellularmaterial in complex biofilm structures and facilitates non-specific attachment of bacteria to surfaces thus increasingcohesion [22] Biosynthesis of alginate is well characterizedin P aeruginosa [23 24] and Escherichia coli [25] The genealgC in P aeruginosa codes for a crucial bifunctional enzymephosphomannomutasephosphoglucomutase (PMMPGM)belonging to the 120572-D-hexomutase superfamily synthesizingalginate and lipopolysaccharide (LPS) core respectively [2426 27] The genetic regulation of algC gene in P aeruginosa[23 24 28] could be dependent on surface attachment andother important factors

Earlier study shows biofilm formation by clinical strainsA baumannii on abiotic surface (urinary catheters) as amajorreason for device-related infections [29] To explore the basisof persistence on such clinically important (abiotic) surfaceswe characterized the role of extracellularmacromolecules likeextracellularDNA (eDNA) amajor component of the biofilmEPS matrix and evaluated its role in biofilm formation [9]Besides eDNA other extracellular macromolecules such asexopolysaccharides also play significant role in the consti-tution of the biofilm EPS Recent findings on the EPS of Abaumannii indicate it as a universal protector from antibioticslike tobramycin [30] and one of its capsular polysaccharides(K1) being highly immunogenic and a potential therapeutictarget via passive immunization [31] The synthesis of spe-cific exopolysaccharides like alginate and LPS core is wellcharacterized in P aeruginosa along with their involvementin biofilm formation as mentioned earlier however remainsunclear in A baumannii which is a close relative and aglobally important nosocomial pathogen Presumably thegenetic basis of the association of exopolysaccharides such asalginate and LPS core with biofilm formation may exacerbateA baumannii infections on clinically important surfacewhich can multiply the intrinsic antibiotic resistance andworsen the treatment scenario However there are no reportsas yet which describe the genetic association of algC withbiofilm formation inA baumanniiTherefore in this study weset out to characterize theA baumannii algC gene expressionpattern during biofilm formation and its association with thebiofilmdevelopment which could further paveway for futureresearch on potential drug target(s) for biofilm-associatedinfections caused by MDR A baumannii

In the current study we identified the algC gene inthe MDR strain of A baumannii AIIMS 7 genome andcharacterized its quantitative gene expression patterns ingrowing biofilm cells compared to the planktonic cells usingthe relative quantification (ΔΔCt method) in real-time PCRGene expression pattern was correlated with specific stages of

biofilm development Molecular dynamics (MD) simulationwas performed on the three dimensional (3D) structure of thegene product (enzyme PMMPGM) to confirm the stabilityand to compare with that of P aeruginosa besides phylo-genetic analysis Subsequently biofilm augmentation due toalgC gene was evaluated using cloning and heterologousexpression studies followed by scanning electronmicroscopy

2 Materials and Methods

21 Bacterial Strains and Culture Conditions Multidrugresistant clinical isolate of Acinetobacter baumannii (strainAIIMS 7) was used in this study as described previously[9] The bacterium was grown on CLED (cysteine-lactoseelectrolyte-deficient) agar and Luria Bertani (LB) broth(HiMedia India) E coli DH5120572 was used for the cloning andheterologous expression experiments Clones were main-tained on Luria agar plates containing 100mgL ampicillin

22 Nucleic Acids Purification and PCR Genomic DNA waspurified using a DNA isolation kit (Sigma Aldrich USA)Total RNA and plasmid purification was done using Trizolreagent (Invitrogen USA) and GenElute plasmid extractionkit (Sigma Aldrich USA) respectively according to manu-facturerrsquos instructions Concentration and purity criteria ofthe nucleic acids were quantified in a BioPhotometer Plus(Eppendorf Germany) Primers used for amplification ofdirect PCR for algC and RT-PCR of internal regions of algCare listed in Table 1 Primers were designed using PrimerQuest (IDT USA) and synthesized (Sigma Aldrich USA)For amplification of the 1781 bp fragment algC from genomicDNA PCR conditions usedwere initial denaturation of 5minat 94∘C followed by 30 cycles of 30 sec at 94∘C 20 secondsat 545∘C and 45 seconds at 72∘C with final extension of 5minutes at 72∘C Amplification of algC was also verified withnative plasmids as PCR template PCR assays were performedin an ep-gradient PCR (Eppendorf Germany) products wereseparated on agarose gels stained with ethidium bromide anddocumented in a gel documentation system (Alpha ImagerHP Alpha Innotech USA) DNase- RNase- Protease-freewater was used as negative control All PCR chemicals andreagents were purchased from Sigma unless stated otherwise

23 Confirmation of Internal Regions of cDNA and DNASequencing To confirm the transcription of algC two inter-nal regions of algC cDNA (1360 bp and 463 bp) were ampli-fied using upstream primer 363F and CD1701R and inter-nal nested primers 1260 nest1F and CD1701R respectively(Table 1) Total RNA samples were treated with DNase I andthen used in RT-PCR which was performed using a single-step Reverse Transcription kit (Promega USA) To test possi-ble DNA contamination in RNA samples direct PCR of totalRNA without reverse transcription was performed DNase- RNase- Protease-free water was used as negative controlRT-PCR was performed with one120583L of cDNA template and100 pm of primers cDNA from E coli DH5120572 with pGEM-3Zf (+) plasmid as empty vector (Applied Biosystem USA)served as negative control DNA sequencing was performed

The Scientific World Journal 3

Table 1 Oligosprobes used for PCR RT-PCR and real-time PCR analysis

Gene Primer 51015840-31015840 Nucleotide sequence

algC 118 F TTAGAACCGGGTGAGCGTTTAGCA1897 R AGATGCTGATCTTGTGGCATTGCG

119886119897119892119862120595

ALGC1 F GCTGTGAAGTCATTGCTTTACGTALGC1 R TGAAGGGTCTGGTGCATGATC

ALGC1 MFAM 6FAM-CAAATGGTGAGTTCCC-TAMRA

algC cDNA int region 1 CD363F CCGTGCTTACGATATTAGAGGCAACD1701R AATTTGCGGATAACGCTCTTGC

algC cDNA int region 2 1260nest1 CTTCCTCCGCGCGTATTTATCCD1701R AATTTGCGGATAACGCTCTTGC

16SrRNA 16B-F TGGCTCAGATTGAACGCTGGCGGC16B-R TACCTTGTTACGACTTCACCCCA

16119878119903119877119873119860120595

16SRR F TGTCGTGAGATGTTGGGTTAAGTC16SRR R CCGAAATGCTGGCAAGTAAGGA

16SRR MFAM 6FAM-ACGAGCGCAACCCTTT-TAMRA120595Primers for real-time PCR assays

in the Applied Biosystems 3730 DNA Analyzer platformSequences were analyzed by sequence analysis software v511(Applied Biosystems USA) and assembled using softwareContigExpress (Vector NTI Advance v1150 Invitrogen)Promoter and the ribosome binding sites of algC were pre-dicted using online toolNeuralNetwork Promoter Predictionprogram (httpwwwfruitflyorgseq toolspromoterhtml)

24 Total RNA Extraction and cDNA Synthesis from Biofilmand Planktonic A baumannii Cells To compare gene expres-sion pattern of algC in biofilm versus planktonic A bauman-nii AIIMS 7 total RNA was extracted from cells growing inbiofilm and planktonic mode and then real-time quantitativeRT-PCR was performed Biofilms were allowed to form in 6-well polystyrene plates (Tarsons India) beginning at 3 hoursup to 96 hoursA baumanniiAIIMS 7 cultures (106 CFUmLovernight grown) were inoculated onto the wells and dilutedinitially with sterile distilled water (without LB broth) at adilution of 1 40 After incubation for 3 hours at 37∘C understatic conditions the supernatant was discarded and freshsterile nutrient medium (Luria broth) was added at a finaldilution of 1 40 and then incubated under similar conditionsto allow biofilm formation After appropriate incubation(s)plates were taken out nonadherent cells were aspirated anddiscarded after brief sonication Plates containing biofilmswere washed twice with phosphate buffer saline (PBS)Surface-attached bacteria (biofilm forming) were scraped offand total RNA was purified using Trizol reagent (InvitrogenUSA) as permanufacturerrsquos instructions Similarly total RNAwas purified from planktonic cell culture at the correspond-ing time points (3ndash96 h) RNA samples were treated withDNase I (Sigma USA) To test possible DNA contaminationin RNA samples direct PCR of total RNA without reversetranscription was done cDNA was synthesized using VersocDNA synthesis kit (Thermo USA) as per manufacturerrsquosinstructions cDNA concentrations were determined usingBioPhotometer Plus (Eppendorf Germany)

25 Relative Quantification of algC Expression Pattern by Real-Time PCR Specific primers and probes for algC gene alongwith 16SrRNA gene (endogenous control) were designedand synthesized as ldquoassay-by-designrdquo from Applied Biosys-tems as listed in Table 1 Prior to proceeding with relativequantification the cDNA template of 24 hour old biofilmsamples with 10-fold serial dilutions was used to analyze thestandard curves of both algC and 16srRNA gene Real-timePCR was performed in 10 120583L reactions in 96-well PCR platesusing 100 ng cDNA 2X TaqMan gene expression master mix(Applied Biosystems USA) and 20X algC assay mix (20X16SrRNA assay mix in case of controls) in a 7500 fast real-time PCR system (Applied Biosystems USA) The relativenumber of algCmRNA was determined using ΔΔCt-method(comparative threshold cycle) by normalizing Ct values ofalgC mRNA with that of 16srRNA in biofilm and planktonicsamples at various time points from 3 to 96 hours Relativequantification (RQ) represented in ldquofold over increaserdquo wasdetermined according to methods described elsewhere [32]and the formula used for calculation was RQ = 2minusΔΔCt CutoffCt was kept 35 with an automatic threshold of 02 and base-line from cycle 3ndash15 with 95 confidence level The 24-hourbiofilm sample was set as the calibrator for this comparativegene expression analysis Statistical comparison of RQ values(between biofilm and planktonic samples) was performedusing Studentrsquos 119905-test and 119875 value lt005 was considered to bestatistically significant

26 Biofilm Development Assay Biofilm development assayswere performed to assess the pattern of biofilm formation ofA baumanniiAIIMS 7 on polystyrene surface and for furthercorrelation with gene expression plot over the same time lineBeginning at 3 h up to 96 h quantitative biofilm assay wasperformed on 96-well microtitre plates according to earliermethods [10] with appropriate modifications Briefly AbaumanniiAIIMS 7 cultures (106 CFUmL overnight grown)

4 The Scientific World Journal

were inoculated onto polystyrenemicrotitre wells of a 96-wellplate (Tarsons India) and diluted initially with sterile distilledwater (no nutrient broth) at a dilution of 1 40 After a staticincubation of 3 hours at 37∘C the supernatants were aspiratedand then sterile LB broth was added to the wells with a finaldilution of 1 40 with sterile LB broth For all time points (3ndash96 h) this was repeated in order to allow A baumannii cellsto attach onto polystyrene initially but not to grow and thento substitute it with addition of fresh Luria broth to facilitateadherent and micro-aggregated cells to develop biofilms Allplates were incubated at 37∘C under static conditions forbiofilm development including negative controls (no cellsonly nutrientmedium) for each test samples in the plate Afterappropriate incubation period(s) plates were taken out andnonadherent and dead cells were removed by brief sonicationand aspiration carefully The wells were washed thrice withsterile PBS dried and stained with 01 Gentian Violet(HiMedia India) Excessive stain was removed by sub-merging the plate in a water trough and then dried inlaminar air flow followed by addition 200120583L of 100 ethanolfor solubilizing the stained biofilm matrices To measurethe absorbance plates were read in a Multi-Plate Reader(Molecular Devices USA) at 570 nm before being shaken at1020 rpm for 10 seconds All biofilm development assays wereperformed in replicate of 12 and repeated Absorbance valueswere termed as biofilm growth index after normalizationwithLB control and values were plotted in Excel spreadsheets(Microsoft USA) for further analysis

27 Statistical Correlation of Biofilm Formation with algCGene Expression To find the concurrence of algC geneexpression pattern with biofilm formation RQ values (foldover increase in algC gene expression) in biofilm mode werecorrelated linearly with the biofilm indices at correspondingtime points and correlation coefficientswere determined usingExcel spreadsheet (Microsoft USA) Correlation statisticswas restricted to three major stages that is initial attachment(3ndash9 hours) consolidation of the surface-attached micro-aggregation (12ndash24 hours) and maturation of biofilm (36ndash48 hours) 24-hour biofilm gene expression data (calibratorsample) was excluded from the correlation 119875 value of lt005was considered to be statistically significant

28 Microscopic Examination of A baumannii Biofilm Devel-opment To localize the stages of biofilm growth over atemporal scale (3ndash96 h) biofilms were formed on sterilepolystyrene culture dish 55mm times 15mm (Tarsons India)and incubated at 37∘C under similar culture conditions asdescribed above After appropriate incubation periods plateswere taken out supernatants were aspirated followed bywashing three times with phosphate buffer saline for removalof nonadherent cells and fixed with 1mL of methanol air-dried and observed without staining under a modular brightfield microscope (Axioscope A1 Zeiss Germany) with brightfield settings at magnification of 100x

29 Bioinformatics and Phylogenetic Analysis Nucleotideand protein sequence comparisons were performed usingBLASTn (National Center for Biotechnology Information

USA) Amino acid sequences were translated using Translatetool of the Expert Protein Analysis System (ExPASy SwissInstitute of Bioinformatics) Protein sequences retrieved fromNCBI were aligned using CLUSTALW [33] and phylogenetictree was constructed with the help of analysis softwareMEGA v50 [34] Bootstrapping was performed with 1000replicates for checking relative support for the branchesin the phylogenetic tree Comparison was restricted tosequences of close organisms for example Pseudomonasaeruginosa Pseudomonas putida Pseudomonas syringae andpreviously predicted PMM sequence from whole genomesequence of Acinetobacter baumannii strain AYE Acineto-bacter haemolyticus and Acinetobacter calcoaceticus Highereukaryote sequences for example Oryctolagus cuniculusPGM isoform 1 and PMM from Homo sapiens were alsoincluded for comparison

210 Cloning and Heterologous Expression Upstream primer(alg 118F) and downstream primer (alg 1897R) were used ina PCR program with an additional 15min final extension forproducing poly-A tails in the PCR products to aid while TAcloning Amplified algC was purified using gel purificationkit (Bangalore GeNei India) and ligated into pGEMT-Easyvector (Promega USA) to produce resultant recombinantplasmid pGEalgCA7 The plasmid was transformed intochemically competent E coli DH5120572 Colonies were pickedand direct PCR was performed to confirm presence of algCgene

211 Assessment of AlgC (PMMPGM) Protein ExpressionMid-log phase grown (with 100mgL ampicillin in Luriabroth under shaking conditions) E coli DH5120572-pGEalgCA7and E coli DH5120572-pGEM-3Zf(+) at OD 600 = 08 were usedto prepare whole cell extractsThe cell extracts were analyzedby SDS-PAGE (125) andprotein bandswere documented ina gel documentation system (Alpha Innotech) after stainingwith 02 Coomassie brilliant blue (Himedia)

212 Assessment of BiofilmAugmentation Biofilm augmenta-tion was visualized by scanning electron microscopy Brieflyovernight grown cells (3 times 109 cells) were inoculated on (1 times1 cm) sterile glass slides inside 12-well culture plates (TarsonsIndia) and incubated at 37∘C static After 24 h of incubationculture supernatant was removed slides were immediatelyflooded with 25 glutaraldehyde in PBS and incubated atroom temperature for 2 hours followed by rinsing withsterile distilled water and serially dehydrated with an ethanolgradient (25ndash100) CO

2-critical point dried and coated

with platinum in an Auto Fine Coater (JFC-1600 JEOLJapan) The slides were then observed in a scanning electronmicroscope (Vega Tescan USA) with 30KV input voltageFor quantitative biofilm augmentation in the algC clonesbiofilms were formed in microtitre plates and quantified asper methods described earlier [10]

213 Sequence Alignment and Building Model for PMMPGMPMMPGM sequence ofA baumanniiAIIMS 7 (AEC46864)was used as a target sequence in BLASTp program to identifypossible template structures available in Protein Data Bank

The Scientific World Journal 5

The selected templates having good alignment score with thetarget sequence were aligned using CLUSTALW Templateprotein structure 1K2Ypdb (P aeruginosa PMMPGM S108Amutant) having maximum sequence alignment score (32)with target sequence was used as the final template to buildhomology model of PMMPGM Three-dimensional modelof PMMPGM was constructed using MODELLER 9 v7 [35]by considering 1K2Ypdb as a template structureThe stabilityof the model was tested by using 10 ns molecular dynamics(MD) simulation

214 Molecular Dynamics (MD) Simulation MD simulationswere performed on the homology model of PMMPGMfrom A baumannii AIIMS 7 in a HP workstation with thehelp of GROMACS 404 program using the GROMOS9645a3 force field [36] The structure was fully solvatedwith water (SPC) and system was neutralized with 9Na+ions The solvated structure was minimized by steepestdescent method for 1000 steps at 300K temperature andconstant pressure The LINCS algorithm with 80 A cutoffswas used for energy minimization of PMMPGM whereasPME algorithm with 80 A nonbonded cutoffs was utilizedsimilarly as used in an earlier MD simulation study [37]After equilibration period production MD was run for 10 nsat 300K temperature pressure and constant volume ensem-ble Solvent accessible surface (SA Richardsrsquo surface) andmolecular surface (MS Connollyrsquos surface) areas were cal-culated using CASTp analysis [38] Structural comparisonafter molecular dynamics simulation of initial structure withfinal structure was done using PDBeFOLD software [39]The MD simulation trajectory was then visualized usingthe VMD (visual molecular dynamics) package [40] Three-dimensional images of enzyme PMMPGM after MD simu-lation run were generated using the UCSF-Chimera tool [41]and Pymol (httppymolsourceforgenet)

215 Nucleotide Sequence Accession The GenBank accessionnumber for A baumannii AIIMS 7 algC gene sequenceis JF701279 and AEC46864 for the protein (PMMPGM)sequence

3 Results

31 Identification of algCGene inA baumannii AIIMS 7 PCRwith genomic DNA yielded a fragment of 1781 bp (Supple-mentary Figure S1 in the Supplementary Material availableonline at httpdxdoiorg1011552014593546) PCR ampli-fications with plasmids were unsuccessful confirming thatthe gene is not plasmid-borne Reverse transcription PCRusing total RNA showed amplification of internal codingregions 1 (1360 bp) and 2 (463 bp) which confirmed the activetranscription of the algC ORF (Supplementary Figure S2)DNA sequence of the gene was analyzed to predict regulatoryregions such as promoter ribosomal binding site transla-tion start and end which were identified and annotated(Supplementary Figure S3)

32 Elevated Levels of algC Gene Transcription during BiofilmMode of Growth Quantitative real-time PCR experiment

0102030405060708090

3 6 9 12 18 24 36 48 72 96

RQ (f

old

over

incr

ease

)

Time (hours)

PlanktonicBiofilm

Figure 1 Comparison of algC gene expression pattern in biofilmand planktonic A baumannii AIIMS 7 Real-time quantitative PCRresults showing relative quantification of algC gene expression levels(calculated according to ΔΔCt-method and represented as ldquofoldover increaserdquo) at corresponding time points Expression levels werenormalized with indigenous control (16SrRNA gene expression)in both biofilm and planktonic cells (calibrator 24-hour biofilmsample fold over increase = 1)

showed significant variation in the threshold cycle (Ct) valuesin biofilm and planktonic mode of growth of A baumanniiwhich described differential expressional patterns of the twomodes of growth (Figure 1) Number of copies of algCmRNAwere calculated using 16SrRNA gene as internal control ateach time point (ΔCt) To evaluate the relative gene expres-sion in biofilm and planktonic modes of growth over thetemporal scale of 3 to 96 hours the 24-hour biofilm samplewas used as calibrator (ΔΔCt) Relative quantification (RQ)plot for gene expression at various time points from 3 to96 hours showed low basal (almost linear) expression ofalgC in planktonic mode (maximum of 324-fold 48 hours)whereas highly variable and elevated algC expression wasseen in biofilm mode (maximum 8159-fold 48 hours) anddisplaying a definite pattern The initial attachment stage (9hours) and maturation stage (48 hours) of biofilm showedmaximal expression of algC which was in contrast and couldbe seen as steadily low expression at almost all time pointsin planktonic mode of growth (Figure 1) This observationaffirms that the algC gene is highly up-regulated (at the tran-scription level) while theA baumannii cells grow in a biofilmmode (ie attached to an abiotic surface) and follows apattern as depicted (Figure 1) however in planktonic (freeform in a suspension unattached to surface) the algC geneis transcribed at a basal rate

33 Biofilm Growth Pattern Correlates with Quantitative algCGene Expression Biofilm growth pattern A baumannii onpolystyrene surface can be seen in Figure 2 which can beexplained in three distinct stages First an exponential rateof increase was observed at 3 to 9 hours which definedthe initial attachment and micro-colony aggregation stage(Figure 2) After 9 hour till 36 hours it showed steady level of

6 The Scientific World Journal

0

05

1

15

2

25

3

3 6 9 12 18 24 36 48 72 96

Biofi

lm in

dex

Time (hours)

Figure 2 Pattern of biofilm growth of A baumannii AIIMS 7Graph showing corresponding biofilm indices of biofilms formed onpolystyrene microtitre surface calculated after normalization withcontrol and plotted versus representative time points (three to 96 h)

increase in biofilm indices indicating the consolidation stageof the attached micro-colonies and approaching maturationof biofilm Third maximum production of biofilm matrixcould be seen at 36 to 48 hours marking the maturationstage Lastly as like the plateau phase in the planktonicgrowth curve of A baumannii AIIMS 7 (data not shown)the biofilm growth pattern also exhibited a steady stateand persistent nature after maturation (after 48 hour till96 hours) To find the association of algC gene expressionpattern at transcription level (as revealed from real-time PCRanalysis) with that of biofilm growth correlation coefficientswere determined using the RQ values in biofilm samples andbiofilm indices at corresponding time points High corre-lation was observed at all three major stages of biofilmCorrelation coefficients were 0902 0925 and 0983 (119875 lt005) corresponding to initial attachment consolidation ofthe surface-attached micro-aggregation and maturation ofbiofilm stages Correlation was found to be maximum (0983119875 lt 005) at stageswhere biofilmswerematureThis indicateda strong possibility that transcription of algC could be in closeassociation with biofilm formation especially the maturationstage (36ndash48 hours) and also the initial attachment stage (3ndash9hours)

34 Microscopic Visualization of Biofilm DevelopmentTo visualize the growth pattern of biofilm bright-field microscopy was performed on biofilms growingon polystyrene surface which showed varied biofilmmorphology at gradual time points (Figure 3) with a strongconcurrence with quantitative evaluation of biofilm growthpattern (Figure 2 as described above) At initial attachmentstages planktonic cells were seen scantily aggregated(Figures 3(a) and 3(b)) but gradually the micro-aggregationon the surface increased subsequently making completelyattached micro-colonies at 9 h which could be seen clearly(Figure 3(c)) Further stages of growth (12 18 and 24 h)showed consolidation of micro-colonies leading to stablestructures of biofilm (Figures 3(d)ndash3(f)) At 36ndash48 h fullymature biofilm communities of A baumannii were seenenriched with thick EPS matrices (Figures 3(g) and 3(h))

followed by appearance of robust three-dimensional biofilmstructures which were found persistent till 72 and 96 h(Figures 3(i) and 3(j)) Overall visualization of biofilmgrowth at developing stages was in tandem with the patternsof biofilm growth as well as algC gene expression

35 In Silico Analysis of Protein Reveals Highly ConservedIdentity To compare and evaluate the relatedness of A bau-mannii AIIMS 7 algC encoded PMMPGM in silico analyseswere performed BLASTn results showed 100 similaritywith the predicted PMMPGM sequence in whole genomesequences of A baumannii available in NCBI databaseAlignment results also displayed significant similarity withPMMPGMnucleotide sequences of other genera 472 aminoacid residues could be theoretically translated in one frame(51015840ndash31015840) of the DNA sequence BLASTp showed similar resultsas in BLASTn alignmentThemolecular weight of the proteinwas predicted to be 5294 kDa with isoelectric point (pI)of 567 CLUSTALW alignment with selected bacterial andeukaryotic PMMPGM sequences showed conserved regionsin the protein as shown in Figure 4(a) (active site Mg2+binding site and sugar binding site marked as coloredrectangles) in the protein as shown Figure 4(b) shows thephylogenetic tree indicating relatedness between PMMPGMenzymes from pseudomonads and higher eukaryotes (rabbitand human) PMMPGM sequence from A baumannii hadless than 25 identity with rabbit muscle PGM isoform1 whereas it had a mere 10 identity with human PMM(Figure 4(b))

36 Assessment of Protein To demonstrate the synthesis ofPMMPGM protein whole cell extracts of cloned E coliDH5120572 with resultant recombinant plasmid pGEalgCA7 cellswere used in SDS-PAGE analysis which showed a clearlyoverexpressed protein of sim53 kDa suggesting the PMMPGMprotein in question (Figure 5) Control E coli DH5120572 (withempty vector pGEM-3Zf+ lacking an algC gene) did not showany PMMPGM protein band

37 Biofilm Augmentation by algC after 24 h Electron micro-graphs of biofilm formed by the algC clones (Figure 6)showed significant increase in biofilm formation comparedto controls probably indicative of the overexpression of thePMMPGM protein and the resultant exopolysaccharidesThicker biofilms could be seen in the algC clones havingclear dense matrices (Figures 6(a) 6(c) and 6(e)) with aintracellular cementing material clearly visible (Figures 6(a)and 6(e)) indicative of the biofilm EPS Overall SEM analysisat a gradient of magnifications and concurrent comparisonswith control clones (lacking functional copy of algC) sug-gested substantially that there is significant facilitation of theoverall biofilm formation emphasizing the enrichment of thebiofilm matrices which could be due to the cohesive activityof EPS including alginate and LPS cores The quantitativebiofilm assay concurred with the microscopic analysis withaugmentation of biofilm up to 387-fold in the algC clonescompared to the control cells lacking algC gene (119875 lt 002data not shown)

The Scientific World Journal 7

(a) (b) (c)

(d) (e) (f)

(g) (h) (i)

(j)

Figure 3 (a)ndash(j) Microscopic visualization of A baumannii AIIMS 7 biofilms Representative bright field micrographs depicting staticbiofilms formed on polystyrene microtitre surface at respective time points (3 6 9 12 18 24 36 48 72 96 h) (magnification 100x)

38 Molecular Dynamics Simulation Study of PMMPGMTo predict the functional association between PMMPGMenzyme (encoded by algC gene) resulting in alginateLPScore mediated biofilm formation in A baumannii molec-ular dynamics (MD) simulations up to 10 ns were carriedout on homology model of PMMPGM of A baumanniiAIIMS 7 using GROMACS v404 program The generatedPMMPGMmodel of A baumannii AIIMS 7 contained fourdomains of equal size arranged in ldquoheart shapedrdquo manner(Figure 7(a)) which form a compact structure similar to Paeruginosa [42] The polypeptide chain proceeds through

each domain sequentially (Figure 7(a)) forming heart shapedgeometry Sequence alignments (Supplementary Figure S4)and model building study showed that the active site waslocated at the centre of the two domains (domains 1 and2) in a deep cleft formed by Ser104 Asp244 Asp246 andAsp248 PMMPGM sequence of A baumannii AIIMS 7showed conserved sequence motif in domain 3 from residues327-331 (GEYAGH) which would act as a sugar binding siteA cluster of positively charged conserved residues found indomain 3 (Lys287) and domain 4 (Arg427 Arg438) couldbe involved in phosphate binding The cleft showed solvent

8 The Scientific World Journal

----------mavtaqAarrrerVlclfDvdGtL---------------------tpaRQ----mEegPlplltirtapYhdqkpgtsglRkKt-yyfedkpcylenFiqsiffsidlKd-------------mnIkhkFPlNIFRAYDIRGKL-TnLTptiiRsIavA----LAAQYtE-------------mnVrhsFPkSIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-----------mstakAptlPaSIFRAYDIRGvvGdtLTAETAywIGrA----igSEsla---------mnspasVApnlPeTIFRAYDIRGvvGdtLnAETAywIGrA----igSEsla--------mndmahlVpaalPdSIFRAYDIRGvvGktLhAETAywIGrA----igAQsla

kidPEva--------------aflQkLr----SrvqI---GvVggsdyckIAeqLGdGDerqgssLVvGgDGRyfnkSaietIlQmaaanGigrlvIgqnGilsTPavscIiRkIkaigGagQkQiVIGYDaRLtSPtyAniIqQifehqGleVinI---GCcsTPMMYYIARdya-GNGvkQtQLVIGYDaRLtSPAyAylIeeiLiEqGlNVTnI---GCcssPMMYYIARdfG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGrgEPcvavGrDGRLSgPeLvkqliQgLvDcGCqVSDv---GmVPTPVLYYaAnvLegkSGqnEPnvsvGrDGRLSgPeLvqqliQgLhDsGCHVSDv---GlVPTPaLYYaAnvLagktGqgEPQvsvGrDGRLSgPmLveqlikgLvDsGCHVSDv---GlVPTPaLYYaAnvLagkSG

Viekfdyvfaen----GtvqykhGrlLSkqtIQnh-------LgEellq--d--------iilTASHNPggpNgdfGiKFnIsnggpaPEAItdkifqisktieEyAic--PDlkvdlgviMVTASHNPKSdN---GiKWILkGEPpSPEAIQQ--------vglyAegftdqiieiqnliMVTASHNPKSdN---GiKWILkGEPpSPEmIQQ--------vgEeAqtYVPNhsisvleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleVMlTgSHNPpdYN---GFKiVvaGEtLanEqIQa--------LrEriek--nDl--asgvVMlTgSHNPKdYN---GFKiVIaGDtLanEqIQa--------LhErikt--nNl--tsqkVMlTgSHNPsdYN---GFKiVIaGDtLanEqIQa--------Lltrlkt--nDl--tlaq

----li--nFClsY---------------------------mallRLpkkrgtfIefrNGlgkqQF--DlenKfkpftveivdsveayatmlrnifdfnAlkellsgpnrLKIrIDamhGdqlhkiipqYClQY-----------------------qQAllSDIhLskPLKIVLDglhGlTlpQFkAeFCqQY-----------------------qQAIfkDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGgSveQv--DilpRY-----------------------fkqIrDDIamakPmKVVvDCgNGgSitQv--DileRY-----------------------fQqIkNDIvmaRkLKVVvDCgNGgrvekv--DilgRY-----------------------fQqIvgDvKLakkLKVVvDCgNG

mlni-------spiGrs------CtLEeri-----efSeldkkEkireKfvE---DlktevvGpyvKKiLcEeLGapanSavnCvpledFggHHPDP-nltyaaDLvetmKsgehDfGaASAGrCAKsvL-EkLGCdVIALr-CEanGhFPdHaPDPSHAehLKqLqqaIisenADlGIASAGhCsKliL-EkmGCEVIALr-tnpnGeFPdHaPDPSHAAhLisLrkaVvEqqADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIAvAGviApQLi-EALGCsVIpLy-CEVDGNFPNHHPDPgkpeNLKDLiAKVKaenADlGLAAAGviApQLi-EALGCEVISLf-aEVDGNFPNHHPDPgkleNLQDLiAKVKEtGADlGLAAAGvvApQLi-EALGCEVIpLf-CEVDGNFPNHHPDPgkpeNLEDLiAKVKEtGADIGLA

FaGkG--------------------------LrfSrGgmIsFDV----------------FDGDGDRnmIlgkhGffVnPsdsvaviAaNIfsip-----yFqqtgvRgfarsmptsGallDGDGDRVvlldEqahIIsPDRLLsLFAQmcLQQHPhkEIVFDVKCSRmVadtVEQlnGQlDGDGDRVvlVdEkaqIltaDRLLsLFAQmcLEQHPeqEIVFDVKCSRmVqetVEKlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKFDGDGDRVGVVTntGtIIYPDRLLMLFAKDVvsRNPGADIIFDVKCtRrlialIsgyGGRFDGDGDRVGVVTnaGnVVYPDRLLMLFAlDVLKRNPGADIIFDVKCtRrltplIsehGGRFDGDGDRVGVVTntGsIVYPDRLLMLFAQDVLsRNPGAEIIFDVKCtRrltplIEQhGGR

-------------fpeGwd-----------------------krYclds-----lDqdsfdrvanatkialyetpTGwkFfgnlmdaSk--lsLcGEeSfgtGsdhiRE------kDGLwakM----------iRTGsSFLrSyLSQSnGNAvfgGEya---GHYvFndGRgFGyDDGLYakM----------iRTGsSFLrAyLSQSnGrAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPvM----------WKTGHSlIKkKmketG--AlLAGEMS---GHvFFKE-RWFGFDDGiYPvM----------WKTGHSlIKkEmkkSG--AlLAGEMS---GHiFFKE-RWFGFDDGiYalM----------WKTGHSlIKkKmkQtG--slLAGEMS---GHiFiKE-RWyGFDDGiY

dtihffgneTspggnd-fEiFAd-----Prtv----------------------------AvlawLsILatrKqsv-eDilkdhwhkFgrnffTrydYeeVeaegatkmmKdLeAlmfdrAAlRvmEyLgQsEArclSELlAa----FPEryCTedIYIsthnasPqqVlnni-----EiAAlRvmEyfTQssATtISELFAp----YPErCCTedtYIgtyQsDPkyVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EisAARLLEILsQdQrds-ehvFSa----FPsdisTPEInItVtEdskfaIIEaL-----qrsAARLLEILsQesAna-eDLFet----FPndisTPEInIkVtDvtkfsIIKaL-----EtsAARLLEILsktEqsa-enLFAa----FPndisTPEInIdVtDegkfsIIdaL-----qr

---------------------------------------------GhsVV----------sfvgkqfsandkvytvekadnfeyhdpvdg-sVSKnqGlRLiFaDGsrIIfrlsgtgsAgi-----------------------SHrlaA-RlSKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASd-----------------------Aqwgeg-nIttlDGVRvDypkGwGlV-------RASd-----------------------AqwgdA-KlttIDGVRvDypkGwGlV-------RASd-----------------------AdwgeA-nlttIDGVRvDyanGwGlV-------RAS------------spqdtvQRcrEiF----------------fPEtAhEa---aTirlYIdsyEkDNakinQdpQvmlaplisialkvsqLQErtgrtAptvit-NTgeyFtvRFdADhPdrLveIrQKF---------isMLQDqyPQIAqElaQSNTgeyFtvRFdADNPlrLkeIQQKF---------vDMLQEhyPQIAqElsEANTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElmslNTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElsEANTTPVlVLRFEADteeeLERIktvF---------rNqLkavdssLpvpF--- NTTPVlVLRFEAeteaeLQRIkdvF---------haeLkKvaPdLdlpF---NTTPVlVLRFEADsdaeLQRIkdvF---------rtqLlrvePELqlpF---

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYEAB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

(a)

Figure 4 Continued

The Scientific World Journal 9

05

92

94

92

76

36

39

A baumannii AIIMS 7 AlgC PMMA baumannii AYE PMMA calcoaceticus PMM

A haemolyticus PMM

P aeruginosa PAO1 PMM

P syringae PMMH sapiens PMM

P putida PMMPGM

O cuniculus PGM isoform 1

(b)

Figure 4 (a)-(b)Multiple sequence alignment and phylogenetic relationship of PMMPGM (a) CLUSTALWanalyses of PMMPGMproteinsequences displaying representative color of box which highlights conserved regions that is active site (red) Mg2+ binding site (green) andsubstrate binding site (blue) (b) Bootstrap consensus tree for PMMPGM enzymes constructed by MEGA v50 using the neighbor-joining(NJ) method (based on 1000 replicates) Numbers on the nodes are bootstrap values and the bar represents scale of estimated evolutionarydistance (20 substitutions at any amino acid position per 100 amino acid positions)

943

21

660

440

290

AlgC

M

Figure 5 SDS-PAGE analysis of AlgC (PMMPGM) protein Lane 1whole cell extract of control E coliDH5120572 (lacking algC gene) lane 2whole cell extract of E coli DH5120572 with algC gene showing the AlgCprotein band sim53 kDa lane M standard protein molecular weightmarker (kDa)

accessible surface (SA Richardsrsquo surface) and molecularsurface (MS Connollyrsquos surface) areas as calculated by alphashape method The enzyme showed a total cavity of 36415 Aand spherical central cavity of 187813 Awhere substrate couldbind as shown in Figure 7(b) To compare the 3D struc-tures obtained before and after MD simulations structuralsuperpositionsweremade using PDBeFOLD results ofwhichshowed root mean square deviation (RMSD) of two alignedstructures within the range of 251 A (Figure 7(c)) Metal ionMg2+ interacts with Asp244 Asp246 Asp248 and Ser104

residues (Figure 7(d) Supplementary Table S1) The metalion Mg2+ is required for enzymatic activity of PMMPGMof A baumannii AIIMS 7 (Figure 7(d)) rather than Mn2+andZn2+ Specific interactions betweenmetal ion (Mg2+) andprotein water-mediated H-bonds (so-called water bridges)and hydrophobic (Lennard-Jones) interactions have beenidentified and are listed (Supplementary Table S1)

39 Stability of Phosphomannomutase during Simulation Toverify the simulation stability and to measure structure anddynamics of PMMPGM model of A baumannii AIIMS 7standard structural parameters like RMSD root mean squarefluctuation (RMSF) and radius of gyration (RG) were calcu-lated and represented in Figures 8(a)ndash8(c) During moleculardynamics simulation period of 10 ns the average RMSD valuewas 03 nm as depicted (Figure 8(a)) Steady RMSD resultshowed for the atoms in the four domains of PMMPGMmodel indicated that the catalytic activity is relatively stableduring the simulation The result for radius of gyration (RG)also indicated the stability ofmodel over thewhole simulationperiod (Figure 8(b)) Minor fluctuations in C-alpha atoms(RMSF) of helical and sheet structural elements could beseen whereas loop region showed variability to some extent(Figure 8(c)) Overall these results of RMSD RMSF andRG strongly indicated the stability of system over the entiresimulation period

4 Discussion

Biofilm formation substantially aids to the spectrum ofmultidrug resistance displayed by A baumannii and is oftenattributed as the major cause for antibiotic treatment fail-ure [3 5] The process of bacterial biofilm development isbelieved to be a complex interplay of the biofilm EPS matrixcomponents that is a plethora of proteins and extracellularmacromolecules for example DNAand polysaccharidesThesynthesis of specific exopolysaccharides such as alginate and

10 The Scientific World Journal

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

Figure 6 (a)ndash(h) Visualization of biofilm augmentation by scanning electron microscopy Electron micrographs (a c e g) showing biofilmsformed by algC clones after 24 h at a gradient of magnifications (Bar = 2 120583m 5 120583m 10120583m and 20 120583m absolute magnifications indicated asKx in the very picture) as observed under a scanning electronmicroscope algC clones can be seen clearly producing dense and robust biofilmas suggested by the thickness and integrity of the biofilm matrices compared to the control biofilms by E coli DH5120572 (lacking A baumanniialgC gene) at corresponding comparable magnifications (b d f h)

LPS core has been described in various bacterial systems[25 43 44] in particular P aeruginosa with its contributionin biofilm formation [20 22] However algC gene functionand its expression pattern have not been elucidated in Abaumannii in order to understand the genetic basis of itsassociation with biofilm formation Herein an initial geneticcharacterization of the algC gene and its association withbiofilm formation is reported in the MDR strain AIIMS 7 ofA baumannii which depicts differential expression of algCgene during the biofilm development Besides MD simula-tion was performed on the three-dimensional (3D) struc-ture of the gene product (enzyme PMMPGM) to comparewith that of P aeruginosa followed by its cloning heterol-ogous expression and phylogenetic analysis Finally biofilmaugmentation by algC gene was evaluated quantitatively andconfirmed by SEM

Analysis of the algC gene expression pattern in thetemporal scale (up to 96 hours) reveals that surface-attachedbacteria have significantly higher rate of transcription levelsthan nonadherent or shaking cultures The attachment orldquosurface sensingrdquo could be the trigger for the activation ofalgC promoter as a result of which the algC expression couldbe seen consistently higher (maximum 8159-fold 119875 lt 005)in biofilm formingA baumannii cultures than the planktoniccounterparts (maximum 324-fold) as revealed by real timePCR analysis (Figure 1) This observation is in accordancewith an earlier study in P aeruginosa [45] which shows algC

reporter gene activity in continuous biofilm culture cells to be19-fold increased than planktonic cells Earlier Davies et al[46] have shown that expression of P aeruginosa algC isupregulated after initial attachment of cells to teflon orglass substrata where cells that failed to upregulate alginatebiosynthesis typically detached from the surface As reviewedearlier by Gacesa [47] it is presumed that exopolysaccharidealginate plays a role in consolidation of the biofilm ratherthan in the initial adhesion event and hence higher rate ofalgC transcription was not a prerequisite to surface attach-ment by P aeruginosa indicating alginate biosynthesis notnecessary for its attachment to glass surface In contrast ourdata in support of the relative quantification of algC tran-scription by real-time PCR and biofilm augmentation byalgC as visualized by SEM is indicative of the possibleinvolvement of algC expression in probably both the eventsthat is initial attachment and consolidation of biofilmsformed by A baumannii Furthermore the upregulation ofalgC transcription at the maturation stages (36ndash48 hours)explains that it is strongly associated with maturation ofbiofilms as the correlation of algC expression with biofilmformation during the very stage was significantly higher thanthe initial events (0983 compared to 0902119875 lt 005) Duringplanktonic mode of growth low levels of algC transcriptionwere observed as compared to biofilm formingA baumanniiwhich should be ideally due to lack of surface attachment (lesspromoter activity) and variations in the oxygen tension in

The Scientific World Journal 11

(a) (b)

(c) (d)

Figure 7 (a)ndash(d) Molecular modeling of PMMPGM from A baumanniiAIIMS 7 (a) Four sequential domains of enzyme PMMPGM afterMD simulation (b) central spherical cavity showing solvent accessible surface area (orange) (c) Superimposed structures before MD (cyan)and after MD simulation (magenta) (d) Mg2+ interacting residues of PMMPGM enzyme

shaking and static cultures Regulation of the algC gene couldbe dependent on diverse parameters as seen in P aeruginosawhere it was shown to be in coordination with the algCpromoter activity [23] Besides according to other studiesvariations in oxygen tension [48] nitrogen limitation [49]and ethanol induced membrane perturbation [50] can alsoinfluence the alginate production in P aeruginosa In Abaumannii we demonstrate differential algC transcription tobe dependent upon abiotic (polystyrene) surface attachmentand thus further investigation would be required to portraya comprehensive profile of algC genetic regulation

The 3D structure of PMMPGM bifunctional enzyme asdetermined by homology modeling which is the gene prod-uct of algC from A baumannii strain AIIMS 7 shows 32overall similarity Furthermore high sequence identity of thecatalytic domain was observed with that of experimentallydetermined structure of PMMPGM of P aeruginosa [42]Each of the four domains contained residues essential forcatalysis andor substrate recognition While the catalytic

phosphoserine residue (Ser104) of domain 1 could be useful totransfer phosphoryl group to and from the bisphosphorylatedreaction intermediate domain 2 was found to contain ametal binding loop (Asp244 Asp246 Asp248) that couldcoordinate theMg2+ ion required for the PMMPGM activity(Figure 7(d)) Domain 3 of PMMPGM of A baumannii alsocontains sugar binding loop (Glu327 Ala329 His331) similarto that in PMMPGM of P aeruginosa This sugar bindingloop has key residues which could enable the enzyme torecognize the two different binding orientations of its 1- and6-phospho sugar substrates Domains 3 and 4 provide mostof the residues that create a phosphate binding site (Lys287 ofdomain 3 and Arg427 Arg438 of domain 4) that determinesthe orientation of the incoming phosphor-sugar substratesIn context with previous studies in P aeruginosa PMMPGM[27 51] our investigation predicts that PMMPGMofA bau-mannii requires Mg2+ and activator glucose 16-biphosphatefor its catalytic activity Other physical properties of the pro-tein analyzed in silicowere also found to be similar to those of

12 The Scientific World Journal

0005

01015

02025

03035

04045

038

677

211

5815

4419

3023

1627

0230

8834

7438

6042

4646

3250

1854

0457

9061

7665

6269

4873

3477

2081

0684

9288

7892

6496

50

RMSD

(nm

)

Time (ps)

(a)

22225

23235

24245

25

038

276

411

4615

2819

1022

9226

7430

5634

3838

2042

0245

8449

6653

4857

3061

1264

9468

7672

5876

4080

2284

0487

8691

6895

5099

32

Radi

us o

f gyr

atio

n (n

m)

Time (ps)

(b)

0005

01015

02025

03035

04045

1 19 37 55 73 91 109

127

145

163

181

199

217

235

253

271

289

307

325

343

361

379

397

415

433

451

469

RMSF

(nm

)

Residue number

(c)

Figure 8 (a)ndash(c) Results from 10 ns molecular dynamics simulation performed on PMMPGM model (a) Root mean square deviation(RMSD) (b) radius of gyration (c) root mean square fluctuation (RMSF)

PMMPGM enzyme from P aeruginosa [42] This indicateda similar function of the enzyme that is a bifunctional rolewhich would be responsible for conversion of mannose-6-phosphate to mannose-1-phosphate or glucose-6-phosphateto glucose-1-phosphate as in P aeruginosa [28]

The active site residues predicted in the PMMPGMenzyme 3D structure were determined by multiple sequencealignments and however needs to be validated by experi-mental analysis In context of sugar binding loop PMMPGMofA baumanniimay also have equal specificity for glucose aswell as mannose because mannose and glucose are epimersat C-2 The active site residues of characterized PMMPGMcomplexes are known to change conformation based on theidentity of the bound ligand andor change the type of contactinwhich they participate [28 52]However a direct structuralcharacterization of multiple enzyme-substrate complexeswould likely be necessary for a full understanding of substratespecificity in this enzyme superfamily Nevertheless the MDsimulation results in this research reveal several regions ofthe PMMPGM enzyme to be highly conserved and clearlyimportant for function in all organisms supporting theproposal that all of these enzymes use a commonmechanismThe algC gene of A baumannii AIIMS 7 characterized in thisstudy is an ortholog of algC gene from P aeruginosa ThePMMPGM protein plays a central role in the productionof three P aeruginosa virulence-associated traits alginaterhamnolipids and LPS although the production of thesecompounds is subjected to a completely different genetic andenvironmental regulation [23 45] The PGM activity of theprotein is involved in synthesis of the LPS core of biofilmswhile PMM activity is responsible for alginate biosynthesisBoth of these (PMMPGM) enzymatic functions either singly

or in combination could be attributed for the biofilm forma-tion in A baumannii AIIMS 7 and augmentation of biofilmsin heterologous clones as observed by SEM It is also con-ceivable therefore that the cloned and overexpressed PGMenzyme (of A baumannii AIIMS 7) might have used up themachinery for cellular LPS core biosynthesis in E coli [25]and could be the possible mechanism behind the overallaugmentation of biofilms in the heterologous algC clones(E coli DH5120572 a relatively weak biofilm former than Abaumannii) as evident from the SEM image analysis Never-theless due to the central role of PMMPGM in biosyntheticpathways the enzyme has potential to serve as a novelmarkerfor A baumannii infection or as pharmaceutical targets forinhibition Such inhibitors would be specific and not affectthe essential homolog in human due to lack of conservationin active site sugar and metal binding site

The mechanism of PMMPGM is believed to be closelyparallel to that of related proteins from other pseudomonadsincluding close relatives like P aeruginosa Our observationson the similarity of the protein sequences and 3D modelsindicate that the PMMPGM protein of A baumanniiAIIMS7 could have a similar biological role in biofilms as seen in Paeruginosa Therefore the dual roles of PMMPGM in algi-nate and LPS biosynthesis enhancing the biofilm formationin A baumannii propose the enzyme as an attractive targetfor inhibitor design

5 Conclusion

This study presents an initial genetic characterization ofalgC gene in an MDR strain A baumannii AIIMS 7 which

The Scientific World Journal 13

demonstrates a quantitative differential expression patternin biofilm cells compared to planktonic counterparts cellsover a temporal scale of 96 h Molecular dynamics (MD)simulation studies indicate that the 3D structure of enzyme(PMMPGM) has functions similar to P aeruginosa whichmight result in significant biofilm augmentation in heterol-ogous algC clones as evident from SEM analysis Theseexperimental lines of evidence collectively suggest that thedifferential algC gene transcription in A baumannii stronglycorrelates with the initial attachment (9 h) and maturationstages (36 h) during the biofilm development however maynot be the only attribute contributing to biofilm formationand could be associated with other factors The PMMPGMenzyme can be a potential drug target for biofilm-associatedinfections of A baumannii as revealed by the 3D structuralsimulation studies

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Dr S Gosavi and Mr A Shinde Depart-ment of Physics University of Pune India for providingthe SEM facility Kailas D Sonawane gratefully acknowledgesUniversity Grants Commission New Delhi Government ofIndia for computational facility support under the schemeUGC SAP DRS-I sanctioned to Department of Biochem-istry Shivaji University Kolhapur India Praveen K Sahuacknowledges University of Pune University with Potentialfor Excellence (UPE Phase-1) for providing a senior researchfellowship

References

[1] M-L Joly-Guillou ldquoClinical impact and pathogenicity ofAcine-tobacterrdquo Clinical Microbiology and Infection vol 11 no 11 pp868ndash873 2005

[2] A Y Peleg H Seifert and D L Paterson ldquoAcinetobacterbaumannii emergence of a successful pathogenrdquoClinicalMicro-biology Reviews vol 21 no 3 pp 538ndash582 2008

[3] L C S Antunes P Visca and K J Towner ldquoAcinetobacter bau-mannii evolution of a global pathogenrdquo Pathogens and Diseasevol 71 no 3 pp 292ndash301 2014

[4] A Y Peleg A deBreijMDAdams et al ldquoThe success ofAcine-tobacter species genetic metabolic and virulence attributesrdquoPLoS ONE vol 7 no 10 Article ID e46984 2012

[5] M J McConnell L Actis and J Pachon ldquoAcinetobacter bau-mannii human infections factors contributing to pathogenesisand animal modelsrdquo FEMS Microbiology Reviews vol 37 no 2pp 130ndash155 2013

[6] S J Wilson C J Knipe M J Zieger et al ldquoDirect costs ofmultidrug-resistant Acinetobacter baumannii in the burn unitof a public teaching hospitalrdquo American Journal of InfectionControl vol 32 no 6 pp 342ndash344 2004

[7] M V Villegas and A I Hartstein ldquoAcinetobacter outbreaks1977ndash2000rdquo Infection Control and Hospital Epidemiology vol24 no 4 pp 284ndash295 2003

[8] A P Tomaras C W Dorsey R E Edelmann and L A ActisldquoAttachment to and biofilm formation on abiotic surfaces byAcinetobacter baumannii involvement of a novel chaperone-usher pili assembly systemrdquo Microbiology vol 149 no 12 pp3473ndash3484 2003

[9] P K Sahu P S Iyer A M Oak K R Pardesi and B AChopade ldquoCharacterization of eDNA from the clinical strainAcinetobacter baumanniiAIIMS 7 and its role in biofilm forma-tionrdquoThe Scientific World Journal vol 2012 Article ID 97343610 pages 2012

[10] H-W Lee Y M Koh J Kim et al ldquoCapacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to formbiofilm and adhere to epithelial cell surfacesrdquo Clinical Micro-biology and Infection vol 14 no 1 pp 49ndash54 2008

[11] A de Breij L Dijkshoorn E Lagendijk et al ldquoDo biofilmformation and interactions with human cells explain the clinicalsuccess of Acinetobacter baumanniirdquo PLoS ONE vol 5 no 5Article ID e10732 2010

[12] L C S Antunes F Imperi A Carattoli and P Visca ldquoDeci-phering the multifactorial nature of Acinetobacter baumanniipathogenicityrdquo PLoS ONE vol 6 no 8 Article ID e22674 2011

[13] J A Gaddy and L A Actis ldquoRegulation of Acinetobacter bau-mannii biofilm formationrdquo FutureMicrobiology vol 4 no 3 pp273ndash278 2009

[14] J W Costerton P S Stewart and E P Greenberg ldquoBacterialbiofilms a common cause of persistent infectionsrdquo Science vol284 no 5418 pp 1318ndash1322 1999

[15] M S Favero R P Gaynes T C Horan et al ldquoNational nosoco-mial infections surveillance (NNIS) report data summary fromOctober 1986-April 1996 issuedMay 1996rdquoAmerican Journal ofInfection Control vol 24 no 5 pp 380ndash388 1996

[16] J Chastre and J-L Trouillet ldquoProblem pathogens (Pseu-domonas aerugınosa and Acınetobacter)rdquo Seminars in Respira-tory Infections vol 15 no 4 pp 287ndash298 2000

[17] S Favre-Bonte J C Pache J Robert D Blanc J C Pechere andC van Delden ldquoDetection of Pseudomonas aeruginosa cell-to-cell signals in lung tissue of cystic fibrosis patientsrdquo MicrobialPathogenesis vol 32 no 3 pp 143ndash147 2002

[18] J G Leid C J Willson M E Shirtliff D J Hassett MR Parsek and A K Jeffers ldquoThe exopolysaccharide alginateprotects Pseudomonas aeruginosa biofilm bacteria from IFN-120574-mediated macrophage killingrdquoThe Journal of Immunology vol175 no 11 pp 7512ndash7518 2005

[19] G W Sundin S Shankar S A Chugani B A Chopade AKavanaugh-Black and AM Chakrabarty ldquoNucleoside diphos-phate kinase from Pseudomonas aeruginosa characterization ofthe gene and its role in cellular growth and exopolysaccharidealginate synthesisrdquo Molecular Microbiology vol 20 no 5 pp965ndash979 1996

[20] J R Wiens A I Vasil M J Schurr and M L Vasil ldquoIron-regulated expression of alginate production mucoid pheno-type and biofilm formation by Pseudomonas aeruginosardquoMBiovol 5 no 1 pp e01010ndashe01013 2014

[21] D J Wozniak T J O Wyckoff M Starkey et al ldquoAlginate isnot a significant component of the extracellular polysaccharidematrix of PA14 and PAO1 Pseudomonas aeruginosa biofilmsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 13 pp 7907ndash7912 2003

[22] D ENivens D EOhman JWilliams andM J Franklin ldquoRoleof alginate and its O acetylation in formation of Pseudomonasaeruginosamicrocolonies and biofilmsrdquo Journal of Bacteriologyvol 183 no 3 pp 1047ndash1057 2001

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

The Scientific World Journal 3

Table 1 Oligosprobes used for PCR RT-PCR and real-time PCR analysis

Gene Primer 51015840-31015840 Nucleotide sequence

algC 118 F TTAGAACCGGGTGAGCGTTTAGCA1897 R AGATGCTGATCTTGTGGCATTGCG

119886119897119892119862120595

ALGC1 F GCTGTGAAGTCATTGCTTTACGTALGC1 R TGAAGGGTCTGGTGCATGATC

ALGC1 MFAM 6FAM-CAAATGGTGAGTTCCC-TAMRA

algC cDNA int region 1 CD363F CCGTGCTTACGATATTAGAGGCAACD1701R AATTTGCGGATAACGCTCTTGC

algC cDNA int region 2 1260nest1 CTTCCTCCGCGCGTATTTATCCD1701R AATTTGCGGATAACGCTCTTGC

16SrRNA 16B-F TGGCTCAGATTGAACGCTGGCGGC16B-R TACCTTGTTACGACTTCACCCCA

16119878119903119877119873119860120595

16SRR F TGTCGTGAGATGTTGGGTTAAGTC16SRR R CCGAAATGCTGGCAAGTAAGGA

16SRR MFAM 6FAM-ACGAGCGCAACCCTTT-TAMRA120595Primers for real-time PCR assays

in the Applied Biosystems 3730 DNA Analyzer platformSequences were analyzed by sequence analysis software v511(Applied Biosystems USA) and assembled using softwareContigExpress (Vector NTI Advance v1150 Invitrogen)Promoter and the ribosome binding sites of algC were pre-dicted using online toolNeuralNetwork Promoter Predictionprogram (httpwwwfruitflyorgseq toolspromoterhtml)

24 Total RNA Extraction and cDNA Synthesis from Biofilmand Planktonic A baumannii Cells To compare gene expres-sion pattern of algC in biofilm versus planktonic A bauman-nii AIIMS 7 total RNA was extracted from cells growing inbiofilm and planktonic mode and then real-time quantitativeRT-PCR was performed Biofilms were allowed to form in 6-well polystyrene plates (Tarsons India) beginning at 3 hoursup to 96 hoursA baumanniiAIIMS 7 cultures (106 CFUmLovernight grown) were inoculated onto the wells and dilutedinitially with sterile distilled water (without LB broth) at adilution of 1 40 After incubation for 3 hours at 37∘C understatic conditions the supernatant was discarded and freshsterile nutrient medium (Luria broth) was added at a finaldilution of 1 40 and then incubated under similar conditionsto allow biofilm formation After appropriate incubation(s)plates were taken out nonadherent cells were aspirated anddiscarded after brief sonication Plates containing biofilmswere washed twice with phosphate buffer saline (PBS)Surface-attached bacteria (biofilm forming) were scraped offand total RNA was purified using Trizol reagent (InvitrogenUSA) as permanufacturerrsquos instructions Similarly total RNAwas purified from planktonic cell culture at the correspond-ing time points (3ndash96 h) RNA samples were treated withDNase I (Sigma USA) To test possible DNA contaminationin RNA samples direct PCR of total RNA without reversetranscription was done cDNA was synthesized using VersocDNA synthesis kit (Thermo USA) as per manufacturerrsquosinstructions cDNA concentrations were determined usingBioPhotometer Plus (Eppendorf Germany)

25 Relative Quantification of algC Expression Pattern by Real-Time PCR Specific primers and probes for algC gene alongwith 16SrRNA gene (endogenous control) were designedand synthesized as ldquoassay-by-designrdquo from Applied Biosys-tems as listed in Table 1 Prior to proceeding with relativequantification the cDNA template of 24 hour old biofilmsamples with 10-fold serial dilutions was used to analyze thestandard curves of both algC and 16srRNA gene Real-timePCR was performed in 10 120583L reactions in 96-well PCR platesusing 100 ng cDNA 2X TaqMan gene expression master mix(Applied Biosystems USA) and 20X algC assay mix (20X16SrRNA assay mix in case of controls) in a 7500 fast real-time PCR system (Applied Biosystems USA) The relativenumber of algCmRNA was determined using ΔΔCt-method(comparative threshold cycle) by normalizing Ct values ofalgC mRNA with that of 16srRNA in biofilm and planktonicsamples at various time points from 3 to 96 hours Relativequantification (RQ) represented in ldquofold over increaserdquo wasdetermined according to methods described elsewhere [32]and the formula used for calculation was RQ = 2minusΔΔCt CutoffCt was kept 35 with an automatic threshold of 02 and base-line from cycle 3ndash15 with 95 confidence level The 24-hourbiofilm sample was set as the calibrator for this comparativegene expression analysis Statistical comparison of RQ values(between biofilm and planktonic samples) was performedusing Studentrsquos 119905-test and 119875 value lt005 was considered to bestatistically significant

26 Biofilm Development Assay Biofilm development assayswere performed to assess the pattern of biofilm formation ofA baumanniiAIIMS 7 on polystyrene surface and for furthercorrelation with gene expression plot over the same time lineBeginning at 3 h up to 96 h quantitative biofilm assay wasperformed on 96-well microtitre plates according to earliermethods [10] with appropriate modifications Briefly AbaumanniiAIIMS 7 cultures (106 CFUmL overnight grown)

4 The Scientific World Journal

were inoculated onto polystyrenemicrotitre wells of a 96-wellplate (Tarsons India) and diluted initially with sterile distilledwater (no nutrient broth) at a dilution of 1 40 After a staticincubation of 3 hours at 37∘C the supernatants were aspiratedand then sterile LB broth was added to the wells with a finaldilution of 1 40 with sterile LB broth For all time points (3ndash96 h) this was repeated in order to allow A baumannii cellsto attach onto polystyrene initially but not to grow and thento substitute it with addition of fresh Luria broth to facilitateadherent and micro-aggregated cells to develop biofilms Allplates were incubated at 37∘C under static conditions forbiofilm development including negative controls (no cellsonly nutrientmedium) for each test samples in the plate Afterappropriate incubation period(s) plates were taken out andnonadherent and dead cells were removed by brief sonicationand aspiration carefully The wells were washed thrice withsterile PBS dried and stained with 01 Gentian Violet(HiMedia India) Excessive stain was removed by sub-merging the plate in a water trough and then dried inlaminar air flow followed by addition 200120583L of 100 ethanolfor solubilizing the stained biofilm matrices To measurethe absorbance plates were read in a Multi-Plate Reader(Molecular Devices USA) at 570 nm before being shaken at1020 rpm for 10 seconds All biofilm development assays wereperformed in replicate of 12 and repeated Absorbance valueswere termed as biofilm growth index after normalizationwithLB control and values were plotted in Excel spreadsheets(Microsoft USA) for further analysis

27 Statistical Correlation of Biofilm Formation with algCGene Expression To find the concurrence of algC geneexpression pattern with biofilm formation RQ values (foldover increase in algC gene expression) in biofilm mode werecorrelated linearly with the biofilm indices at correspondingtime points and correlation coefficientswere determined usingExcel spreadsheet (Microsoft USA) Correlation statisticswas restricted to three major stages that is initial attachment(3ndash9 hours) consolidation of the surface-attached micro-aggregation (12ndash24 hours) and maturation of biofilm (36ndash48 hours) 24-hour biofilm gene expression data (calibratorsample) was excluded from the correlation 119875 value of lt005was considered to be statistically significant

28 Microscopic Examination of A baumannii Biofilm Devel-opment To localize the stages of biofilm growth over atemporal scale (3ndash96 h) biofilms were formed on sterilepolystyrene culture dish 55mm times 15mm (Tarsons India)and incubated at 37∘C under similar culture conditions asdescribed above After appropriate incubation periods plateswere taken out supernatants were aspirated followed bywashing three times with phosphate buffer saline for removalof nonadherent cells and fixed with 1mL of methanol air-dried and observed without staining under a modular brightfield microscope (Axioscope A1 Zeiss Germany) with brightfield settings at magnification of 100x

29 Bioinformatics and Phylogenetic Analysis Nucleotideand protein sequence comparisons were performed usingBLASTn (National Center for Biotechnology Information

USA) Amino acid sequences were translated using Translatetool of the Expert Protein Analysis System (ExPASy SwissInstitute of Bioinformatics) Protein sequences retrieved fromNCBI were aligned using CLUSTALW [33] and phylogenetictree was constructed with the help of analysis softwareMEGA v50 [34] Bootstrapping was performed with 1000replicates for checking relative support for the branchesin the phylogenetic tree Comparison was restricted tosequences of close organisms for example Pseudomonasaeruginosa Pseudomonas putida Pseudomonas syringae andpreviously predicted PMM sequence from whole genomesequence of Acinetobacter baumannii strain AYE Acineto-bacter haemolyticus and Acinetobacter calcoaceticus Highereukaryote sequences for example Oryctolagus cuniculusPGM isoform 1 and PMM from Homo sapiens were alsoincluded for comparison

210 Cloning and Heterologous Expression Upstream primer(alg 118F) and downstream primer (alg 1897R) were used ina PCR program with an additional 15min final extension forproducing poly-A tails in the PCR products to aid while TAcloning Amplified algC was purified using gel purificationkit (Bangalore GeNei India) and ligated into pGEMT-Easyvector (Promega USA) to produce resultant recombinantplasmid pGEalgCA7 The plasmid was transformed intochemically competent E coli DH5120572 Colonies were pickedand direct PCR was performed to confirm presence of algCgene

211 Assessment of AlgC (PMMPGM) Protein ExpressionMid-log phase grown (with 100mgL ampicillin in Luriabroth under shaking conditions) E coli DH5120572-pGEalgCA7and E coli DH5120572-pGEM-3Zf(+) at OD 600 = 08 were usedto prepare whole cell extractsThe cell extracts were analyzedby SDS-PAGE (125) andprotein bandswere documented ina gel documentation system (Alpha Innotech) after stainingwith 02 Coomassie brilliant blue (Himedia)

212 Assessment of BiofilmAugmentation Biofilm augmenta-tion was visualized by scanning electron microscopy Brieflyovernight grown cells (3 times 109 cells) were inoculated on (1 times1 cm) sterile glass slides inside 12-well culture plates (TarsonsIndia) and incubated at 37∘C static After 24 h of incubationculture supernatant was removed slides were immediatelyflooded with 25 glutaraldehyde in PBS and incubated atroom temperature for 2 hours followed by rinsing withsterile distilled water and serially dehydrated with an ethanolgradient (25ndash100) CO

2-critical point dried and coated

with platinum in an Auto Fine Coater (JFC-1600 JEOLJapan) The slides were then observed in a scanning electronmicroscope (Vega Tescan USA) with 30KV input voltageFor quantitative biofilm augmentation in the algC clonesbiofilms were formed in microtitre plates and quantified asper methods described earlier [10]

213 Sequence Alignment and Building Model for PMMPGMPMMPGM sequence ofA baumanniiAIIMS 7 (AEC46864)was used as a target sequence in BLASTp program to identifypossible template structures available in Protein Data Bank

The Scientific World Journal 5

The selected templates having good alignment score with thetarget sequence were aligned using CLUSTALW Templateprotein structure 1K2Ypdb (P aeruginosa PMMPGM S108Amutant) having maximum sequence alignment score (32)with target sequence was used as the final template to buildhomology model of PMMPGM Three-dimensional modelof PMMPGM was constructed using MODELLER 9 v7 [35]by considering 1K2Ypdb as a template structureThe stabilityof the model was tested by using 10 ns molecular dynamics(MD) simulation

214 Molecular Dynamics (MD) Simulation MD simulationswere performed on the homology model of PMMPGMfrom A baumannii AIIMS 7 in a HP workstation with thehelp of GROMACS 404 program using the GROMOS9645a3 force field [36] The structure was fully solvatedwith water (SPC) and system was neutralized with 9Na+ions The solvated structure was minimized by steepestdescent method for 1000 steps at 300K temperature andconstant pressure The LINCS algorithm with 80 A cutoffswas used for energy minimization of PMMPGM whereasPME algorithm with 80 A nonbonded cutoffs was utilizedsimilarly as used in an earlier MD simulation study [37]After equilibration period production MD was run for 10 nsat 300K temperature pressure and constant volume ensem-ble Solvent accessible surface (SA Richardsrsquo surface) andmolecular surface (MS Connollyrsquos surface) areas were cal-culated using CASTp analysis [38] Structural comparisonafter molecular dynamics simulation of initial structure withfinal structure was done using PDBeFOLD software [39]The MD simulation trajectory was then visualized usingthe VMD (visual molecular dynamics) package [40] Three-dimensional images of enzyme PMMPGM after MD simu-lation run were generated using the UCSF-Chimera tool [41]and Pymol (httppymolsourceforgenet)

215 Nucleotide Sequence Accession The GenBank accessionnumber for A baumannii AIIMS 7 algC gene sequenceis JF701279 and AEC46864 for the protein (PMMPGM)sequence

3 Results

31 Identification of algCGene inA baumannii AIIMS 7 PCRwith genomic DNA yielded a fragment of 1781 bp (Supple-mentary Figure S1 in the Supplementary Material availableonline at httpdxdoiorg1011552014593546) PCR ampli-fications with plasmids were unsuccessful confirming thatthe gene is not plasmid-borne Reverse transcription PCRusing total RNA showed amplification of internal codingregions 1 (1360 bp) and 2 (463 bp) which confirmed the activetranscription of the algC ORF (Supplementary Figure S2)DNA sequence of the gene was analyzed to predict regulatoryregions such as promoter ribosomal binding site transla-tion start and end which were identified and annotated(Supplementary Figure S3)

32 Elevated Levels of algC Gene Transcription during BiofilmMode of Growth Quantitative real-time PCR experiment

0102030405060708090

3 6 9 12 18 24 36 48 72 96

RQ (f

old

over

incr

ease

)

Time (hours)

PlanktonicBiofilm

Figure 1 Comparison of algC gene expression pattern in biofilmand planktonic A baumannii AIIMS 7 Real-time quantitative PCRresults showing relative quantification of algC gene expression levels(calculated according to ΔΔCt-method and represented as ldquofoldover increaserdquo) at corresponding time points Expression levels werenormalized with indigenous control (16SrRNA gene expression)in both biofilm and planktonic cells (calibrator 24-hour biofilmsample fold over increase = 1)

showed significant variation in the threshold cycle (Ct) valuesin biofilm and planktonic mode of growth of A baumanniiwhich described differential expressional patterns of the twomodes of growth (Figure 1) Number of copies of algCmRNAwere calculated using 16SrRNA gene as internal control ateach time point (ΔCt) To evaluate the relative gene expres-sion in biofilm and planktonic modes of growth over thetemporal scale of 3 to 96 hours the 24-hour biofilm samplewas used as calibrator (ΔΔCt) Relative quantification (RQ)plot for gene expression at various time points from 3 to96 hours showed low basal (almost linear) expression ofalgC in planktonic mode (maximum of 324-fold 48 hours)whereas highly variable and elevated algC expression wasseen in biofilm mode (maximum 8159-fold 48 hours) anddisplaying a definite pattern The initial attachment stage (9hours) and maturation stage (48 hours) of biofilm showedmaximal expression of algC which was in contrast and couldbe seen as steadily low expression at almost all time pointsin planktonic mode of growth (Figure 1) This observationaffirms that the algC gene is highly up-regulated (at the tran-scription level) while theA baumannii cells grow in a biofilmmode (ie attached to an abiotic surface) and follows apattern as depicted (Figure 1) however in planktonic (freeform in a suspension unattached to surface) the algC geneis transcribed at a basal rate

33 Biofilm Growth Pattern Correlates with Quantitative algCGene Expression Biofilm growth pattern A baumannii onpolystyrene surface can be seen in Figure 2 which can beexplained in three distinct stages First an exponential rateof increase was observed at 3 to 9 hours which definedthe initial attachment and micro-colony aggregation stage(Figure 2) After 9 hour till 36 hours it showed steady level of

6 The Scientific World Journal

0

05

1

15

2

25

3

3 6 9 12 18 24 36 48 72 96

Biofi

lm in

dex

Time (hours)

Figure 2 Pattern of biofilm growth of A baumannii AIIMS 7Graph showing corresponding biofilm indices of biofilms formed onpolystyrene microtitre surface calculated after normalization withcontrol and plotted versus representative time points (three to 96 h)

increase in biofilm indices indicating the consolidation stageof the attached micro-colonies and approaching maturationof biofilm Third maximum production of biofilm matrixcould be seen at 36 to 48 hours marking the maturationstage Lastly as like the plateau phase in the planktonicgrowth curve of A baumannii AIIMS 7 (data not shown)the biofilm growth pattern also exhibited a steady stateand persistent nature after maturation (after 48 hour till96 hours) To find the association of algC gene expressionpattern at transcription level (as revealed from real-time PCRanalysis) with that of biofilm growth correlation coefficientswere determined using the RQ values in biofilm samples andbiofilm indices at corresponding time points High corre-lation was observed at all three major stages of biofilmCorrelation coefficients were 0902 0925 and 0983 (119875 lt005) corresponding to initial attachment consolidation ofthe surface-attached micro-aggregation and maturation ofbiofilm stages Correlation was found to be maximum (0983119875 lt 005) at stageswhere biofilmswerematureThis indicateda strong possibility that transcription of algC could be in closeassociation with biofilm formation especially the maturationstage (36ndash48 hours) and also the initial attachment stage (3ndash9hours)

34 Microscopic Visualization of Biofilm DevelopmentTo visualize the growth pattern of biofilm bright-field microscopy was performed on biofilms growingon polystyrene surface which showed varied biofilmmorphology at gradual time points (Figure 3) with a strongconcurrence with quantitative evaluation of biofilm growthpattern (Figure 2 as described above) At initial attachmentstages planktonic cells were seen scantily aggregated(Figures 3(a) and 3(b)) but gradually the micro-aggregationon the surface increased subsequently making completelyattached micro-colonies at 9 h which could be seen clearly(Figure 3(c)) Further stages of growth (12 18 and 24 h)showed consolidation of micro-colonies leading to stablestructures of biofilm (Figures 3(d)ndash3(f)) At 36ndash48 h fullymature biofilm communities of A baumannii were seenenriched with thick EPS matrices (Figures 3(g) and 3(h))

followed by appearance of robust three-dimensional biofilmstructures which were found persistent till 72 and 96 h(Figures 3(i) and 3(j)) Overall visualization of biofilmgrowth at developing stages was in tandem with the patternsof biofilm growth as well as algC gene expression

35 In Silico Analysis of Protein Reveals Highly ConservedIdentity To compare and evaluate the relatedness of A bau-mannii AIIMS 7 algC encoded PMMPGM in silico analyseswere performed BLASTn results showed 100 similaritywith the predicted PMMPGM sequence in whole genomesequences of A baumannii available in NCBI databaseAlignment results also displayed significant similarity withPMMPGMnucleotide sequences of other genera 472 aminoacid residues could be theoretically translated in one frame(51015840ndash31015840) of the DNA sequence BLASTp showed similar resultsas in BLASTn alignmentThemolecular weight of the proteinwas predicted to be 5294 kDa with isoelectric point (pI)of 567 CLUSTALW alignment with selected bacterial andeukaryotic PMMPGM sequences showed conserved regionsin the protein as shown in Figure 4(a) (active site Mg2+binding site and sugar binding site marked as coloredrectangles) in the protein as shown Figure 4(b) shows thephylogenetic tree indicating relatedness between PMMPGMenzymes from pseudomonads and higher eukaryotes (rabbitand human) PMMPGM sequence from A baumannii hadless than 25 identity with rabbit muscle PGM isoform1 whereas it had a mere 10 identity with human PMM(Figure 4(b))

36 Assessment of Protein To demonstrate the synthesis ofPMMPGM protein whole cell extracts of cloned E coliDH5120572 with resultant recombinant plasmid pGEalgCA7 cellswere used in SDS-PAGE analysis which showed a clearlyoverexpressed protein of sim53 kDa suggesting the PMMPGMprotein in question (Figure 5) Control E coli DH5120572 (withempty vector pGEM-3Zf+ lacking an algC gene) did not showany PMMPGM protein band

37 Biofilm Augmentation by algC after 24 h Electron micro-graphs of biofilm formed by the algC clones (Figure 6)showed significant increase in biofilm formation comparedto controls probably indicative of the overexpression of thePMMPGM protein and the resultant exopolysaccharidesThicker biofilms could be seen in the algC clones havingclear dense matrices (Figures 6(a) 6(c) and 6(e)) with aintracellular cementing material clearly visible (Figures 6(a)and 6(e)) indicative of the biofilm EPS Overall SEM analysisat a gradient of magnifications and concurrent comparisonswith control clones (lacking functional copy of algC) sug-gested substantially that there is significant facilitation of theoverall biofilm formation emphasizing the enrichment of thebiofilm matrices which could be due to the cohesive activityof EPS including alginate and LPS cores The quantitativebiofilm assay concurred with the microscopic analysis withaugmentation of biofilm up to 387-fold in the algC clonescompared to the control cells lacking algC gene (119875 lt 002data not shown)

The Scientific World Journal 7

(a) (b) (c)

(d) (e) (f)

(g) (h) (i)

(j)

Figure 3 (a)ndash(j) Microscopic visualization of A baumannii AIIMS 7 biofilms Representative bright field micrographs depicting staticbiofilms formed on polystyrene microtitre surface at respective time points (3 6 9 12 18 24 36 48 72 96 h) (magnification 100x)

38 Molecular Dynamics Simulation Study of PMMPGMTo predict the functional association between PMMPGMenzyme (encoded by algC gene) resulting in alginateLPScore mediated biofilm formation in A baumannii molec-ular dynamics (MD) simulations up to 10 ns were carriedout on homology model of PMMPGM of A baumanniiAIIMS 7 using GROMACS v404 program The generatedPMMPGMmodel of A baumannii AIIMS 7 contained fourdomains of equal size arranged in ldquoheart shapedrdquo manner(Figure 7(a)) which form a compact structure similar to Paeruginosa [42] The polypeptide chain proceeds through

each domain sequentially (Figure 7(a)) forming heart shapedgeometry Sequence alignments (Supplementary Figure S4)and model building study showed that the active site waslocated at the centre of the two domains (domains 1 and2) in a deep cleft formed by Ser104 Asp244 Asp246 andAsp248 PMMPGM sequence of A baumannii AIIMS 7showed conserved sequence motif in domain 3 from residues327-331 (GEYAGH) which would act as a sugar binding siteA cluster of positively charged conserved residues found indomain 3 (Lys287) and domain 4 (Arg427 Arg438) couldbe involved in phosphate binding The cleft showed solvent

8 The Scientific World Journal

----------mavtaqAarrrerVlclfDvdGtL---------------------tpaRQ----mEegPlplltirtapYhdqkpgtsglRkKt-yyfedkpcylenFiqsiffsidlKd-------------mnIkhkFPlNIFRAYDIRGKL-TnLTptiiRsIavA----LAAQYtE-------------mnVrhsFPkSIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-----------mstakAptlPaSIFRAYDIRGvvGdtLTAETAywIGrA----igSEsla---------mnspasVApnlPeTIFRAYDIRGvvGdtLnAETAywIGrA----igSEsla--------mndmahlVpaalPdSIFRAYDIRGvvGktLhAETAywIGrA----igAQsla

kidPEva--------------aflQkLr----SrvqI---GvVggsdyckIAeqLGdGDerqgssLVvGgDGRyfnkSaietIlQmaaanGigrlvIgqnGilsTPavscIiRkIkaigGagQkQiVIGYDaRLtSPtyAniIqQifehqGleVinI---GCcsTPMMYYIARdya-GNGvkQtQLVIGYDaRLtSPAyAylIeeiLiEqGlNVTnI---GCcssPMMYYIARdfG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGrgEPcvavGrDGRLSgPeLvkqliQgLvDcGCqVSDv---GmVPTPVLYYaAnvLegkSGqnEPnvsvGrDGRLSgPeLvqqliQgLhDsGCHVSDv---GlVPTPaLYYaAnvLagktGqgEPQvsvGrDGRLSgPmLveqlikgLvDsGCHVSDv---GlVPTPaLYYaAnvLagkSG

Viekfdyvfaen----GtvqykhGrlLSkqtIQnh-------LgEellq--d--------iilTASHNPggpNgdfGiKFnIsnggpaPEAItdkifqisktieEyAic--PDlkvdlgviMVTASHNPKSdN---GiKWILkGEPpSPEAIQQ--------vglyAegftdqiieiqnliMVTASHNPKSdN---GiKWILkGEPpSPEmIQQ--------vgEeAqtYVPNhsisvleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleVMlTgSHNPpdYN---GFKiVvaGEtLanEqIQa--------LrEriek--nDl--asgvVMlTgSHNPKdYN---GFKiVIaGDtLanEqIQa--------LhErikt--nNl--tsqkVMlTgSHNPsdYN---GFKiVIaGDtLanEqIQa--------Lltrlkt--nDl--tlaq

----li--nFClsY---------------------------mallRLpkkrgtfIefrNGlgkqQF--DlenKfkpftveivdsveayatmlrnifdfnAlkellsgpnrLKIrIDamhGdqlhkiipqYClQY-----------------------qQAllSDIhLskPLKIVLDglhGlTlpQFkAeFCqQY-----------------------qQAIfkDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGgSveQv--DilpRY-----------------------fkqIrDDIamakPmKVVvDCgNGgSitQv--DileRY-----------------------fQqIkNDIvmaRkLKVVvDCgNGgrvekv--DilgRY-----------------------fQqIvgDvKLakkLKVVvDCgNG

mlni-------spiGrs------CtLEeri-----efSeldkkEkireKfvE---DlktevvGpyvKKiLcEeLGapanSavnCvpledFggHHPDP-nltyaaDLvetmKsgehDfGaASAGrCAKsvL-EkLGCdVIALr-CEanGhFPdHaPDPSHAehLKqLqqaIisenADlGIASAGhCsKliL-EkmGCEVIALr-tnpnGeFPdHaPDPSHAAhLisLrkaVvEqqADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIAvAGviApQLi-EALGCsVIpLy-CEVDGNFPNHHPDPgkpeNLKDLiAKVKaenADlGLAAAGviApQLi-EALGCEVISLf-aEVDGNFPNHHPDPgkleNLQDLiAKVKEtGADlGLAAAGvvApQLi-EALGCEVIpLf-CEVDGNFPNHHPDPgkpeNLEDLiAKVKEtGADIGLA

FaGkG--------------------------LrfSrGgmIsFDV----------------FDGDGDRnmIlgkhGffVnPsdsvaviAaNIfsip-----yFqqtgvRgfarsmptsGallDGDGDRVvlldEqahIIsPDRLLsLFAQmcLQQHPhkEIVFDVKCSRmVadtVEQlnGQlDGDGDRVvlVdEkaqIltaDRLLsLFAQmcLEQHPeqEIVFDVKCSRmVqetVEKlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKFDGDGDRVGVVTntGtIIYPDRLLMLFAKDVvsRNPGADIIFDVKCtRrlialIsgyGGRFDGDGDRVGVVTnaGnVVYPDRLLMLFAlDVLKRNPGADIIFDVKCtRrltplIsehGGRFDGDGDRVGVVTntGsIVYPDRLLMLFAQDVLsRNPGAEIIFDVKCtRrltplIEQhGGR

-------------fpeGwd-----------------------krYclds-----lDqdsfdrvanatkialyetpTGwkFfgnlmdaSk--lsLcGEeSfgtGsdhiRE------kDGLwakM----------iRTGsSFLrSyLSQSnGNAvfgGEya---GHYvFndGRgFGyDDGLYakM----------iRTGsSFLrAyLSQSnGrAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPvM----------WKTGHSlIKkKmketG--AlLAGEMS---GHvFFKE-RWFGFDDGiYPvM----------WKTGHSlIKkEmkkSG--AlLAGEMS---GHiFFKE-RWFGFDDGiYalM----------WKTGHSlIKkKmkQtG--slLAGEMS---GHiFiKE-RWyGFDDGiY

dtihffgneTspggnd-fEiFAd-----Prtv----------------------------AvlawLsILatrKqsv-eDilkdhwhkFgrnffTrydYeeVeaegatkmmKdLeAlmfdrAAlRvmEyLgQsEArclSELlAa----FPEryCTedIYIsthnasPqqVlnni-----EiAAlRvmEyfTQssATtISELFAp----YPErCCTedtYIgtyQsDPkyVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EisAARLLEILsQdQrds-ehvFSa----FPsdisTPEInItVtEdskfaIIEaL-----qrsAARLLEILsQesAna-eDLFet----FPndisTPEInIkVtDvtkfsIIKaL-----EtsAARLLEILsktEqsa-enLFAa----FPndisTPEInIdVtDegkfsIIdaL-----qr

---------------------------------------------GhsVV----------sfvgkqfsandkvytvekadnfeyhdpvdg-sVSKnqGlRLiFaDGsrIIfrlsgtgsAgi-----------------------SHrlaA-RlSKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASd-----------------------Aqwgeg-nIttlDGVRvDypkGwGlV-------RASd-----------------------AqwgdA-KlttIDGVRvDypkGwGlV-------RASd-----------------------AdwgeA-nlttIDGVRvDyanGwGlV-------RAS------------spqdtvQRcrEiF----------------fPEtAhEa---aTirlYIdsyEkDNakinQdpQvmlaplisialkvsqLQErtgrtAptvit-NTgeyFtvRFdADhPdrLveIrQKF---------isMLQDqyPQIAqElaQSNTgeyFtvRFdADNPlrLkeIQQKF---------vDMLQEhyPQIAqElsEANTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElmslNTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElsEANTTPVlVLRFEADteeeLERIktvF---------rNqLkavdssLpvpF--- NTTPVlVLRFEAeteaeLQRIkdvF---------haeLkKvaPdLdlpF---NTTPVlVLRFEADsdaeLQRIkdvF---------rtqLlrvePELqlpF---

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYEAB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

(a)

Figure 4 Continued

The Scientific World Journal 9

05

92

94

92

76

36

39

A baumannii AIIMS 7 AlgC PMMA baumannii AYE PMMA calcoaceticus PMM

A haemolyticus PMM

P aeruginosa PAO1 PMM

P syringae PMMH sapiens PMM

P putida PMMPGM

O cuniculus PGM isoform 1

(b)

Figure 4 (a)-(b)Multiple sequence alignment and phylogenetic relationship of PMMPGM (a) CLUSTALWanalyses of PMMPGMproteinsequences displaying representative color of box which highlights conserved regions that is active site (red) Mg2+ binding site (green) andsubstrate binding site (blue) (b) Bootstrap consensus tree for PMMPGM enzymes constructed by MEGA v50 using the neighbor-joining(NJ) method (based on 1000 replicates) Numbers on the nodes are bootstrap values and the bar represents scale of estimated evolutionarydistance (20 substitutions at any amino acid position per 100 amino acid positions)

943

21

660

440

290

AlgC

M

Figure 5 SDS-PAGE analysis of AlgC (PMMPGM) protein Lane 1whole cell extract of control E coliDH5120572 (lacking algC gene) lane 2whole cell extract of E coli DH5120572 with algC gene showing the AlgCprotein band sim53 kDa lane M standard protein molecular weightmarker (kDa)

accessible surface (SA Richardsrsquo surface) and molecularsurface (MS Connollyrsquos surface) areas as calculated by alphashape method The enzyme showed a total cavity of 36415 Aand spherical central cavity of 187813 Awhere substrate couldbind as shown in Figure 7(b) To compare the 3D struc-tures obtained before and after MD simulations structuralsuperpositionsweremade using PDBeFOLD results ofwhichshowed root mean square deviation (RMSD) of two alignedstructures within the range of 251 A (Figure 7(c)) Metal ionMg2+ interacts with Asp244 Asp246 Asp248 and Ser104

residues (Figure 7(d) Supplementary Table S1) The metalion Mg2+ is required for enzymatic activity of PMMPGMof A baumannii AIIMS 7 (Figure 7(d)) rather than Mn2+andZn2+ Specific interactions betweenmetal ion (Mg2+) andprotein water-mediated H-bonds (so-called water bridges)and hydrophobic (Lennard-Jones) interactions have beenidentified and are listed (Supplementary Table S1)

39 Stability of Phosphomannomutase during Simulation Toverify the simulation stability and to measure structure anddynamics of PMMPGM model of A baumannii AIIMS 7standard structural parameters like RMSD root mean squarefluctuation (RMSF) and radius of gyration (RG) were calcu-lated and represented in Figures 8(a)ndash8(c) During moleculardynamics simulation period of 10 ns the average RMSD valuewas 03 nm as depicted (Figure 8(a)) Steady RMSD resultshowed for the atoms in the four domains of PMMPGMmodel indicated that the catalytic activity is relatively stableduring the simulation The result for radius of gyration (RG)also indicated the stability ofmodel over thewhole simulationperiod (Figure 8(b)) Minor fluctuations in C-alpha atoms(RMSF) of helical and sheet structural elements could beseen whereas loop region showed variability to some extent(Figure 8(c)) Overall these results of RMSD RMSF andRG strongly indicated the stability of system over the entiresimulation period

4 Discussion

Biofilm formation substantially aids to the spectrum ofmultidrug resistance displayed by A baumannii and is oftenattributed as the major cause for antibiotic treatment fail-ure [3 5] The process of bacterial biofilm development isbelieved to be a complex interplay of the biofilm EPS matrixcomponents that is a plethora of proteins and extracellularmacromolecules for example DNAand polysaccharidesThesynthesis of specific exopolysaccharides such as alginate and

10 The Scientific World Journal

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

Figure 6 (a)ndash(h) Visualization of biofilm augmentation by scanning electron microscopy Electron micrographs (a c e g) showing biofilmsformed by algC clones after 24 h at a gradient of magnifications (Bar = 2 120583m 5 120583m 10120583m and 20 120583m absolute magnifications indicated asKx in the very picture) as observed under a scanning electronmicroscope algC clones can be seen clearly producing dense and robust biofilmas suggested by the thickness and integrity of the biofilm matrices compared to the control biofilms by E coli DH5120572 (lacking A baumanniialgC gene) at corresponding comparable magnifications (b d f h)

LPS core has been described in various bacterial systems[25 43 44] in particular P aeruginosa with its contributionin biofilm formation [20 22] However algC gene functionand its expression pattern have not been elucidated in Abaumannii in order to understand the genetic basis of itsassociation with biofilm formation Herein an initial geneticcharacterization of the algC gene and its association withbiofilm formation is reported in the MDR strain AIIMS 7 ofA baumannii which depicts differential expression of algCgene during the biofilm development Besides MD simula-tion was performed on the three-dimensional (3D) struc-ture of the gene product (enzyme PMMPGM) to comparewith that of P aeruginosa followed by its cloning heterol-ogous expression and phylogenetic analysis Finally biofilmaugmentation by algC gene was evaluated quantitatively andconfirmed by SEM

Analysis of the algC gene expression pattern in thetemporal scale (up to 96 hours) reveals that surface-attachedbacteria have significantly higher rate of transcription levelsthan nonadherent or shaking cultures The attachment orldquosurface sensingrdquo could be the trigger for the activation ofalgC promoter as a result of which the algC expression couldbe seen consistently higher (maximum 8159-fold 119875 lt 005)in biofilm formingA baumannii cultures than the planktoniccounterparts (maximum 324-fold) as revealed by real timePCR analysis (Figure 1) This observation is in accordancewith an earlier study in P aeruginosa [45] which shows algC

reporter gene activity in continuous biofilm culture cells to be19-fold increased than planktonic cells Earlier Davies et al[46] have shown that expression of P aeruginosa algC isupregulated after initial attachment of cells to teflon orglass substrata where cells that failed to upregulate alginatebiosynthesis typically detached from the surface As reviewedearlier by Gacesa [47] it is presumed that exopolysaccharidealginate plays a role in consolidation of the biofilm ratherthan in the initial adhesion event and hence higher rate ofalgC transcription was not a prerequisite to surface attach-ment by P aeruginosa indicating alginate biosynthesis notnecessary for its attachment to glass surface In contrast ourdata in support of the relative quantification of algC tran-scription by real-time PCR and biofilm augmentation byalgC as visualized by SEM is indicative of the possibleinvolvement of algC expression in probably both the eventsthat is initial attachment and consolidation of biofilmsformed by A baumannii Furthermore the upregulation ofalgC transcription at the maturation stages (36ndash48 hours)explains that it is strongly associated with maturation ofbiofilms as the correlation of algC expression with biofilmformation during the very stage was significantly higher thanthe initial events (0983 compared to 0902119875 lt 005) Duringplanktonic mode of growth low levels of algC transcriptionwere observed as compared to biofilm formingA baumanniiwhich should be ideally due to lack of surface attachment (lesspromoter activity) and variations in the oxygen tension in

The Scientific World Journal 11

(a) (b)

(c) (d)

Figure 7 (a)ndash(d) Molecular modeling of PMMPGM from A baumanniiAIIMS 7 (a) Four sequential domains of enzyme PMMPGM afterMD simulation (b) central spherical cavity showing solvent accessible surface area (orange) (c) Superimposed structures before MD (cyan)and after MD simulation (magenta) (d) Mg2+ interacting residues of PMMPGM enzyme

shaking and static cultures Regulation of the algC gene couldbe dependent on diverse parameters as seen in P aeruginosawhere it was shown to be in coordination with the algCpromoter activity [23] Besides according to other studiesvariations in oxygen tension [48] nitrogen limitation [49]and ethanol induced membrane perturbation [50] can alsoinfluence the alginate production in P aeruginosa In Abaumannii we demonstrate differential algC transcription tobe dependent upon abiotic (polystyrene) surface attachmentand thus further investigation would be required to portraya comprehensive profile of algC genetic regulation

The 3D structure of PMMPGM bifunctional enzyme asdetermined by homology modeling which is the gene prod-uct of algC from A baumannii strain AIIMS 7 shows 32overall similarity Furthermore high sequence identity of thecatalytic domain was observed with that of experimentallydetermined structure of PMMPGM of P aeruginosa [42]Each of the four domains contained residues essential forcatalysis andor substrate recognition While the catalytic

phosphoserine residue (Ser104) of domain 1 could be useful totransfer phosphoryl group to and from the bisphosphorylatedreaction intermediate domain 2 was found to contain ametal binding loop (Asp244 Asp246 Asp248) that couldcoordinate theMg2+ ion required for the PMMPGM activity(Figure 7(d)) Domain 3 of PMMPGM of A baumannii alsocontains sugar binding loop (Glu327 Ala329 His331) similarto that in PMMPGM of P aeruginosa This sugar bindingloop has key residues which could enable the enzyme torecognize the two different binding orientations of its 1- and6-phospho sugar substrates Domains 3 and 4 provide mostof the residues that create a phosphate binding site (Lys287 ofdomain 3 and Arg427 Arg438 of domain 4) that determinesthe orientation of the incoming phosphor-sugar substratesIn context with previous studies in P aeruginosa PMMPGM[27 51] our investigation predicts that PMMPGMofA bau-mannii requires Mg2+ and activator glucose 16-biphosphatefor its catalytic activity Other physical properties of the pro-tein analyzed in silicowere also found to be similar to those of

12 The Scientific World Journal

0005

01015

02025

03035

04045

038

677

211

5815

4419

3023

1627

0230

8834

7438

6042

4646

3250

1854

0457

9061

7665

6269

4873

3477

2081

0684

9288

7892

6496

50

RMSD

(nm

)

Time (ps)

(a)

22225

23235

24245

25

038

276

411

4615

2819

1022

9226

7430

5634

3838

2042

0245

8449

6653

4857

3061

1264

9468

7672

5876

4080

2284

0487

8691

6895

5099

32

Radi

us o

f gyr

atio

n (n

m)

Time (ps)

(b)

0005

01015

02025

03035

04045

1 19 37 55 73 91 109

127

145

163

181

199

217

235

253

271

289

307

325

343

361

379

397

415

433

451

469

RMSF

(nm

)

Residue number

(c)

Figure 8 (a)ndash(c) Results from 10 ns molecular dynamics simulation performed on PMMPGM model (a) Root mean square deviation(RMSD) (b) radius of gyration (c) root mean square fluctuation (RMSF)

PMMPGM enzyme from P aeruginosa [42] This indicateda similar function of the enzyme that is a bifunctional rolewhich would be responsible for conversion of mannose-6-phosphate to mannose-1-phosphate or glucose-6-phosphateto glucose-1-phosphate as in P aeruginosa [28]

The active site residues predicted in the PMMPGMenzyme 3D structure were determined by multiple sequencealignments and however needs to be validated by experi-mental analysis In context of sugar binding loop PMMPGMofA baumanniimay also have equal specificity for glucose aswell as mannose because mannose and glucose are epimersat C-2 The active site residues of characterized PMMPGMcomplexes are known to change conformation based on theidentity of the bound ligand andor change the type of contactinwhich they participate [28 52]However a direct structuralcharacterization of multiple enzyme-substrate complexeswould likely be necessary for a full understanding of substratespecificity in this enzyme superfamily Nevertheless the MDsimulation results in this research reveal several regions ofthe PMMPGM enzyme to be highly conserved and clearlyimportant for function in all organisms supporting theproposal that all of these enzymes use a commonmechanismThe algC gene of A baumannii AIIMS 7 characterized in thisstudy is an ortholog of algC gene from P aeruginosa ThePMMPGM protein plays a central role in the productionof three P aeruginosa virulence-associated traits alginaterhamnolipids and LPS although the production of thesecompounds is subjected to a completely different genetic andenvironmental regulation [23 45] The PGM activity of theprotein is involved in synthesis of the LPS core of biofilmswhile PMM activity is responsible for alginate biosynthesisBoth of these (PMMPGM) enzymatic functions either singly

or in combination could be attributed for the biofilm forma-tion in A baumannii AIIMS 7 and augmentation of biofilmsin heterologous clones as observed by SEM It is also con-ceivable therefore that the cloned and overexpressed PGMenzyme (of A baumannii AIIMS 7) might have used up themachinery for cellular LPS core biosynthesis in E coli [25]and could be the possible mechanism behind the overallaugmentation of biofilms in the heterologous algC clones(E coli DH5120572 a relatively weak biofilm former than Abaumannii) as evident from the SEM image analysis Never-theless due to the central role of PMMPGM in biosyntheticpathways the enzyme has potential to serve as a novelmarkerfor A baumannii infection or as pharmaceutical targets forinhibition Such inhibitors would be specific and not affectthe essential homolog in human due to lack of conservationin active site sugar and metal binding site

The mechanism of PMMPGM is believed to be closelyparallel to that of related proteins from other pseudomonadsincluding close relatives like P aeruginosa Our observationson the similarity of the protein sequences and 3D modelsindicate that the PMMPGM protein of A baumanniiAIIMS7 could have a similar biological role in biofilms as seen in Paeruginosa Therefore the dual roles of PMMPGM in algi-nate and LPS biosynthesis enhancing the biofilm formationin A baumannii propose the enzyme as an attractive targetfor inhibitor design

5 Conclusion

This study presents an initial genetic characterization ofalgC gene in an MDR strain A baumannii AIIMS 7 which

The Scientific World Journal 13

demonstrates a quantitative differential expression patternin biofilm cells compared to planktonic counterparts cellsover a temporal scale of 96 h Molecular dynamics (MD)simulation studies indicate that the 3D structure of enzyme(PMMPGM) has functions similar to P aeruginosa whichmight result in significant biofilm augmentation in heterol-ogous algC clones as evident from SEM analysis Theseexperimental lines of evidence collectively suggest that thedifferential algC gene transcription in A baumannii stronglycorrelates with the initial attachment (9 h) and maturationstages (36 h) during the biofilm development however maynot be the only attribute contributing to biofilm formationand could be associated with other factors The PMMPGMenzyme can be a potential drug target for biofilm-associatedinfections of A baumannii as revealed by the 3D structuralsimulation studies

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Dr S Gosavi and Mr A Shinde Depart-ment of Physics University of Pune India for providingthe SEM facility Kailas D Sonawane gratefully acknowledgesUniversity Grants Commission New Delhi Government ofIndia for computational facility support under the schemeUGC SAP DRS-I sanctioned to Department of Biochem-istry Shivaji University Kolhapur India Praveen K Sahuacknowledges University of Pune University with Potentialfor Excellence (UPE Phase-1) for providing a senior researchfellowship

References

[1] M-L Joly-Guillou ldquoClinical impact and pathogenicity ofAcine-tobacterrdquo Clinical Microbiology and Infection vol 11 no 11 pp868ndash873 2005

[2] A Y Peleg H Seifert and D L Paterson ldquoAcinetobacterbaumannii emergence of a successful pathogenrdquoClinicalMicro-biology Reviews vol 21 no 3 pp 538ndash582 2008

[3] L C S Antunes P Visca and K J Towner ldquoAcinetobacter bau-mannii evolution of a global pathogenrdquo Pathogens and Diseasevol 71 no 3 pp 292ndash301 2014

[4] A Y Peleg A deBreijMDAdams et al ldquoThe success ofAcine-tobacter species genetic metabolic and virulence attributesrdquoPLoS ONE vol 7 no 10 Article ID e46984 2012

[5] M J McConnell L Actis and J Pachon ldquoAcinetobacter bau-mannii human infections factors contributing to pathogenesisand animal modelsrdquo FEMS Microbiology Reviews vol 37 no 2pp 130ndash155 2013

[6] S J Wilson C J Knipe M J Zieger et al ldquoDirect costs ofmultidrug-resistant Acinetobacter baumannii in the burn unitof a public teaching hospitalrdquo American Journal of InfectionControl vol 32 no 6 pp 342ndash344 2004

[7] M V Villegas and A I Hartstein ldquoAcinetobacter outbreaks1977ndash2000rdquo Infection Control and Hospital Epidemiology vol24 no 4 pp 284ndash295 2003

[8] A P Tomaras C W Dorsey R E Edelmann and L A ActisldquoAttachment to and biofilm formation on abiotic surfaces byAcinetobacter baumannii involvement of a novel chaperone-usher pili assembly systemrdquo Microbiology vol 149 no 12 pp3473ndash3484 2003

[9] P K Sahu P S Iyer A M Oak K R Pardesi and B AChopade ldquoCharacterization of eDNA from the clinical strainAcinetobacter baumanniiAIIMS 7 and its role in biofilm forma-tionrdquoThe Scientific World Journal vol 2012 Article ID 97343610 pages 2012

[10] H-W Lee Y M Koh J Kim et al ldquoCapacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to formbiofilm and adhere to epithelial cell surfacesrdquo Clinical Micro-biology and Infection vol 14 no 1 pp 49ndash54 2008

[11] A de Breij L Dijkshoorn E Lagendijk et al ldquoDo biofilmformation and interactions with human cells explain the clinicalsuccess of Acinetobacter baumanniirdquo PLoS ONE vol 5 no 5Article ID e10732 2010

[12] L C S Antunes F Imperi A Carattoli and P Visca ldquoDeci-phering the multifactorial nature of Acinetobacter baumanniipathogenicityrdquo PLoS ONE vol 6 no 8 Article ID e22674 2011

[13] J A Gaddy and L A Actis ldquoRegulation of Acinetobacter bau-mannii biofilm formationrdquo FutureMicrobiology vol 4 no 3 pp273ndash278 2009

[14] J W Costerton P S Stewart and E P Greenberg ldquoBacterialbiofilms a common cause of persistent infectionsrdquo Science vol284 no 5418 pp 1318ndash1322 1999

[15] M S Favero R P Gaynes T C Horan et al ldquoNational nosoco-mial infections surveillance (NNIS) report data summary fromOctober 1986-April 1996 issuedMay 1996rdquoAmerican Journal ofInfection Control vol 24 no 5 pp 380ndash388 1996

[16] J Chastre and J-L Trouillet ldquoProblem pathogens (Pseu-domonas aerugınosa and Acınetobacter)rdquo Seminars in Respira-tory Infections vol 15 no 4 pp 287ndash298 2000

[17] S Favre-Bonte J C Pache J Robert D Blanc J C Pechere andC van Delden ldquoDetection of Pseudomonas aeruginosa cell-to-cell signals in lung tissue of cystic fibrosis patientsrdquo MicrobialPathogenesis vol 32 no 3 pp 143ndash147 2002

[18] J G Leid C J Willson M E Shirtliff D J Hassett MR Parsek and A K Jeffers ldquoThe exopolysaccharide alginateprotects Pseudomonas aeruginosa biofilm bacteria from IFN-120574-mediated macrophage killingrdquoThe Journal of Immunology vol175 no 11 pp 7512ndash7518 2005

[19] G W Sundin S Shankar S A Chugani B A Chopade AKavanaugh-Black and AM Chakrabarty ldquoNucleoside diphos-phate kinase from Pseudomonas aeruginosa characterization ofthe gene and its role in cellular growth and exopolysaccharidealginate synthesisrdquo Molecular Microbiology vol 20 no 5 pp965ndash979 1996

[20] J R Wiens A I Vasil M J Schurr and M L Vasil ldquoIron-regulated expression of alginate production mucoid pheno-type and biofilm formation by Pseudomonas aeruginosardquoMBiovol 5 no 1 pp e01010ndashe01013 2014

[21] D J Wozniak T J O Wyckoff M Starkey et al ldquoAlginate isnot a significant component of the extracellular polysaccharidematrix of PA14 and PAO1 Pseudomonas aeruginosa biofilmsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 13 pp 7907ndash7912 2003

[22] D ENivens D EOhman JWilliams andM J Franklin ldquoRoleof alginate and its O acetylation in formation of Pseudomonasaeruginosamicrocolonies and biofilmsrdquo Journal of Bacteriologyvol 183 no 3 pp 1047ndash1057 2001

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

4 The Scientific World Journal

were inoculated onto polystyrenemicrotitre wells of a 96-wellplate (Tarsons India) and diluted initially with sterile distilledwater (no nutrient broth) at a dilution of 1 40 After a staticincubation of 3 hours at 37∘C the supernatants were aspiratedand then sterile LB broth was added to the wells with a finaldilution of 1 40 with sterile LB broth For all time points (3ndash96 h) this was repeated in order to allow A baumannii cellsto attach onto polystyrene initially but not to grow and thento substitute it with addition of fresh Luria broth to facilitateadherent and micro-aggregated cells to develop biofilms Allplates were incubated at 37∘C under static conditions forbiofilm development including negative controls (no cellsonly nutrientmedium) for each test samples in the plate Afterappropriate incubation period(s) plates were taken out andnonadherent and dead cells were removed by brief sonicationand aspiration carefully The wells were washed thrice withsterile PBS dried and stained with 01 Gentian Violet(HiMedia India) Excessive stain was removed by sub-merging the plate in a water trough and then dried inlaminar air flow followed by addition 200120583L of 100 ethanolfor solubilizing the stained biofilm matrices To measurethe absorbance plates were read in a Multi-Plate Reader(Molecular Devices USA) at 570 nm before being shaken at1020 rpm for 10 seconds All biofilm development assays wereperformed in replicate of 12 and repeated Absorbance valueswere termed as biofilm growth index after normalizationwithLB control and values were plotted in Excel spreadsheets(Microsoft USA) for further analysis

27 Statistical Correlation of Biofilm Formation with algCGene Expression To find the concurrence of algC geneexpression pattern with biofilm formation RQ values (foldover increase in algC gene expression) in biofilm mode werecorrelated linearly with the biofilm indices at correspondingtime points and correlation coefficientswere determined usingExcel spreadsheet (Microsoft USA) Correlation statisticswas restricted to three major stages that is initial attachment(3ndash9 hours) consolidation of the surface-attached micro-aggregation (12ndash24 hours) and maturation of biofilm (36ndash48 hours) 24-hour biofilm gene expression data (calibratorsample) was excluded from the correlation 119875 value of lt005was considered to be statistically significant

28 Microscopic Examination of A baumannii Biofilm Devel-opment To localize the stages of biofilm growth over atemporal scale (3ndash96 h) biofilms were formed on sterilepolystyrene culture dish 55mm times 15mm (Tarsons India)and incubated at 37∘C under similar culture conditions asdescribed above After appropriate incubation periods plateswere taken out supernatants were aspirated followed bywashing three times with phosphate buffer saline for removalof nonadherent cells and fixed with 1mL of methanol air-dried and observed without staining under a modular brightfield microscope (Axioscope A1 Zeiss Germany) with brightfield settings at magnification of 100x

29 Bioinformatics and Phylogenetic Analysis Nucleotideand protein sequence comparisons were performed usingBLASTn (National Center for Biotechnology Information

USA) Amino acid sequences were translated using Translatetool of the Expert Protein Analysis System (ExPASy SwissInstitute of Bioinformatics) Protein sequences retrieved fromNCBI were aligned using CLUSTALW [33] and phylogenetictree was constructed with the help of analysis softwareMEGA v50 [34] Bootstrapping was performed with 1000replicates for checking relative support for the branchesin the phylogenetic tree Comparison was restricted tosequences of close organisms for example Pseudomonasaeruginosa Pseudomonas putida Pseudomonas syringae andpreviously predicted PMM sequence from whole genomesequence of Acinetobacter baumannii strain AYE Acineto-bacter haemolyticus and Acinetobacter calcoaceticus Highereukaryote sequences for example Oryctolagus cuniculusPGM isoform 1 and PMM from Homo sapiens were alsoincluded for comparison

210 Cloning and Heterologous Expression Upstream primer(alg 118F) and downstream primer (alg 1897R) were used ina PCR program with an additional 15min final extension forproducing poly-A tails in the PCR products to aid while TAcloning Amplified algC was purified using gel purificationkit (Bangalore GeNei India) and ligated into pGEMT-Easyvector (Promega USA) to produce resultant recombinantplasmid pGEalgCA7 The plasmid was transformed intochemically competent E coli DH5120572 Colonies were pickedand direct PCR was performed to confirm presence of algCgene

211 Assessment of AlgC (PMMPGM) Protein ExpressionMid-log phase grown (with 100mgL ampicillin in Luriabroth under shaking conditions) E coli DH5120572-pGEalgCA7and E coli DH5120572-pGEM-3Zf(+) at OD 600 = 08 were usedto prepare whole cell extractsThe cell extracts were analyzedby SDS-PAGE (125) andprotein bandswere documented ina gel documentation system (Alpha Innotech) after stainingwith 02 Coomassie brilliant blue (Himedia)

212 Assessment of BiofilmAugmentation Biofilm augmenta-tion was visualized by scanning electron microscopy Brieflyovernight grown cells (3 times 109 cells) were inoculated on (1 times1 cm) sterile glass slides inside 12-well culture plates (TarsonsIndia) and incubated at 37∘C static After 24 h of incubationculture supernatant was removed slides were immediatelyflooded with 25 glutaraldehyde in PBS and incubated atroom temperature for 2 hours followed by rinsing withsterile distilled water and serially dehydrated with an ethanolgradient (25ndash100) CO

2-critical point dried and coated

with platinum in an Auto Fine Coater (JFC-1600 JEOLJapan) The slides were then observed in a scanning electronmicroscope (Vega Tescan USA) with 30KV input voltageFor quantitative biofilm augmentation in the algC clonesbiofilms were formed in microtitre plates and quantified asper methods described earlier [10]

213 Sequence Alignment and Building Model for PMMPGMPMMPGM sequence ofA baumanniiAIIMS 7 (AEC46864)was used as a target sequence in BLASTp program to identifypossible template structures available in Protein Data Bank

The Scientific World Journal 5

The selected templates having good alignment score with thetarget sequence were aligned using CLUSTALW Templateprotein structure 1K2Ypdb (P aeruginosa PMMPGM S108Amutant) having maximum sequence alignment score (32)with target sequence was used as the final template to buildhomology model of PMMPGM Three-dimensional modelof PMMPGM was constructed using MODELLER 9 v7 [35]by considering 1K2Ypdb as a template structureThe stabilityof the model was tested by using 10 ns molecular dynamics(MD) simulation

214 Molecular Dynamics (MD) Simulation MD simulationswere performed on the homology model of PMMPGMfrom A baumannii AIIMS 7 in a HP workstation with thehelp of GROMACS 404 program using the GROMOS9645a3 force field [36] The structure was fully solvatedwith water (SPC) and system was neutralized with 9Na+ions The solvated structure was minimized by steepestdescent method for 1000 steps at 300K temperature andconstant pressure The LINCS algorithm with 80 A cutoffswas used for energy minimization of PMMPGM whereasPME algorithm with 80 A nonbonded cutoffs was utilizedsimilarly as used in an earlier MD simulation study [37]After equilibration period production MD was run for 10 nsat 300K temperature pressure and constant volume ensem-ble Solvent accessible surface (SA Richardsrsquo surface) andmolecular surface (MS Connollyrsquos surface) areas were cal-culated using CASTp analysis [38] Structural comparisonafter molecular dynamics simulation of initial structure withfinal structure was done using PDBeFOLD software [39]The MD simulation trajectory was then visualized usingthe VMD (visual molecular dynamics) package [40] Three-dimensional images of enzyme PMMPGM after MD simu-lation run were generated using the UCSF-Chimera tool [41]and Pymol (httppymolsourceforgenet)

215 Nucleotide Sequence Accession The GenBank accessionnumber for A baumannii AIIMS 7 algC gene sequenceis JF701279 and AEC46864 for the protein (PMMPGM)sequence

3 Results

31 Identification of algCGene inA baumannii AIIMS 7 PCRwith genomic DNA yielded a fragment of 1781 bp (Supple-mentary Figure S1 in the Supplementary Material availableonline at httpdxdoiorg1011552014593546) PCR ampli-fications with plasmids were unsuccessful confirming thatthe gene is not plasmid-borne Reverse transcription PCRusing total RNA showed amplification of internal codingregions 1 (1360 bp) and 2 (463 bp) which confirmed the activetranscription of the algC ORF (Supplementary Figure S2)DNA sequence of the gene was analyzed to predict regulatoryregions such as promoter ribosomal binding site transla-tion start and end which were identified and annotated(Supplementary Figure S3)

32 Elevated Levels of algC Gene Transcription during BiofilmMode of Growth Quantitative real-time PCR experiment

0102030405060708090

3 6 9 12 18 24 36 48 72 96

RQ (f

old

over

incr

ease

)

Time (hours)

PlanktonicBiofilm

Figure 1 Comparison of algC gene expression pattern in biofilmand planktonic A baumannii AIIMS 7 Real-time quantitative PCRresults showing relative quantification of algC gene expression levels(calculated according to ΔΔCt-method and represented as ldquofoldover increaserdquo) at corresponding time points Expression levels werenormalized with indigenous control (16SrRNA gene expression)in both biofilm and planktonic cells (calibrator 24-hour biofilmsample fold over increase = 1)

showed significant variation in the threshold cycle (Ct) valuesin biofilm and planktonic mode of growth of A baumanniiwhich described differential expressional patterns of the twomodes of growth (Figure 1) Number of copies of algCmRNAwere calculated using 16SrRNA gene as internal control ateach time point (ΔCt) To evaluate the relative gene expres-sion in biofilm and planktonic modes of growth over thetemporal scale of 3 to 96 hours the 24-hour biofilm samplewas used as calibrator (ΔΔCt) Relative quantification (RQ)plot for gene expression at various time points from 3 to96 hours showed low basal (almost linear) expression ofalgC in planktonic mode (maximum of 324-fold 48 hours)whereas highly variable and elevated algC expression wasseen in biofilm mode (maximum 8159-fold 48 hours) anddisplaying a definite pattern The initial attachment stage (9hours) and maturation stage (48 hours) of biofilm showedmaximal expression of algC which was in contrast and couldbe seen as steadily low expression at almost all time pointsin planktonic mode of growth (Figure 1) This observationaffirms that the algC gene is highly up-regulated (at the tran-scription level) while theA baumannii cells grow in a biofilmmode (ie attached to an abiotic surface) and follows apattern as depicted (Figure 1) however in planktonic (freeform in a suspension unattached to surface) the algC geneis transcribed at a basal rate

33 Biofilm Growth Pattern Correlates with Quantitative algCGene Expression Biofilm growth pattern A baumannii onpolystyrene surface can be seen in Figure 2 which can beexplained in three distinct stages First an exponential rateof increase was observed at 3 to 9 hours which definedthe initial attachment and micro-colony aggregation stage(Figure 2) After 9 hour till 36 hours it showed steady level of

6 The Scientific World Journal

0

05

1

15

2

25

3

3 6 9 12 18 24 36 48 72 96

Biofi

lm in

dex

Time (hours)

Figure 2 Pattern of biofilm growth of A baumannii AIIMS 7Graph showing corresponding biofilm indices of biofilms formed onpolystyrene microtitre surface calculated after normalization withcontrol and plotted versus representative time points (three to 96 h)

increase in biofilm indices indicating the consolidation stageof the attached micro-colonies and approaching maturationof biofilm Third maximum production of biofilm matrixcould be seen at 36 to 48 hours marking the maturationstage Lastly as like the plateau phase in the planktonicgrowth curve of A baumannii AIIMS 7 (data not shown)the biofilm growth pattern also exhibited a steady stateand persistent nature after maturation (after 48 hour till96 hours) To find the association of algC gene expressionpattern at transcription level (as revealed from real-time PCRanalysis) with that of biofilm growth correlation coefficientswere determined using the RQ values in biofilm samples andbiofilm indices at corresponding time points High corre-lation was observed at all three major stages of biofilmCorrelation coefficients were 0902 0925 and 0983 (119875 lt005) corresponding to initial attachment consolidation ofthe surface-attached micro-aggregation and maturation ofbiofilm stages Correlation was found to be maximum (0983119875 lt 005) at stageswhere biofilmswerematureThis indicateda strong possibility that transcription of algC could be in closeassociation with biofilm formation especially the maturationstage (36ndash48 hours) and also the initial attachment stage (3ndash9hours)

34 Microscopic Visualization of Biofilm DevelopmentTo visualize the growth pattern of biofilm bright-field microscopy was performed on biofilms growingon polystyrene surface which showed varied biofilmmorphology at gradual time points (Figure 3) with a strongconcurrence with quantitative evaluation of biofilm growthpattern (Figure 2 as described above) At initial attachmentstages planktonic cells were seen scantily aggregated(Figures 3(a) and 3(b)) but gradually the micro-aggregationon the surface increased subsequently making completelyattached micro-colonies at 9 h which could be seen clearly(Figure 3(c)) Further stages of growth (12 18 and 24 h)showed consolidation of micro-colonies leading to stablestructures of biofilm (Figures 3(d)ndash3(f)) At 36ndash48 h fullymature biofilm communities of A baumannii were seenenriched with thick EPS matrices (Figures 3(g) and 3(h))

followed by appearance of robust three-dimensional biofilmstructures which were found persistent till 72 and 96 h(Figures 3(i) and 3(j)) Overall visualization of biofilmgrowth at developing stages was in tandem with the patternsof biofilm growth as well as algC gene expression

35 In Silico Analysis of Protein Reveals Highly ConservedIdentity To compare and evaluate the relatedness of A bau-mannii AIIMS 7 algC encoded PMMPGM in silico analyseswere performed BLASTn results showed 100 similaritywith the predicted PMMPGM sequence in whole genomesequences of A baumannii available in NCBI databaseAlignment results also displayed significant similarity withPMMPGMnucleotide sequences of other genera 472 aminoacid residues could be theoretically translated in one frame(51015840ndash31015840) of the DNA sequence BLASTp showed similar resultsas in BLASTn alignmentThemolecular weight of the proteinwas predicted to be 5294 kDa with isoelectric point (pI)of 567 CLUSTALW alignment with selected bacterial andeukaryotic PMMPGM sequences showed conserved regionsin the protein as shown in Figure 4(a) (active site Mg2+binding site and sugar binding site marked as coloredrectangles) in the protein as shown Figure 4(b) shows thephylogenetic tree indicating relatedness between PMMPGMenzymes from pseudomonads and higher eukaryotes (rabbitand human) PMMPGM sequence from A baumannii hadless than 25 identity with rabbit muscle PGM isoform1 whereas it had a mere 10 identity with human PMM(Figure 4(b))

36 Assessment of Protein To demonstrate the synthesis ofPMMPGM protein whole cell extracts of cloned E coliDH5120572 with resultant recombinant plasmid pGEalgCA7 cellswere used in SDS-PAGE analysis which showed a clearlyoverexpressed protein of sim53 kDa suggesting the PMMPGMprotein in question (Figure 5) Control E coli DH5120572 (withempty vector pGEM-3Zf+ lacking an algC gene) did not showany PMMPGM protein band

37 Biofilm Augmentation by algC after 24 h Electron micro-graphs of biofilm formed by the algC clones (Figure 6)showed significant increase in biofilm formation comparedto controls probably indicative of the overexpression of thePMMPGM protein and the resultant exopolysaccharidesThicker biofilms could be seen in the algC clones havingclear dense matrices (Figures 6(a) 6(c) and 6(e)) with aintracellular cementing material clearly visible (Figures 6(a)and 6(e)) indicative of the biofilm EPS Overall SEM analysisat a gradient of magnifications and concurrent comparisonswith control clones (lacking functional copy of algC) sug-gested substantially that there is significant facilitation of theoverall biofilm formation emphasizing the enrichment of thebiofilm matrices which could be due to the cohesive activityof EPS including alginate and LPS cores The quantitativebiofilm assay concurred with the microscopic analysis withaugmentation of biofilm up to 387-fold in the algC clonescompared to the control cells lacking algC gene (119875 lt 002data not shown)

The Scientific World Journal 7

(a) (b) (c)

(d) (e) (f)

(g) (h) (i)

(j)

Figure 3 (a)ndash(j) Microscopic visualization of A baumannii AIIMS 7 biofilms Representative bright field micrographs depicting staticbiofilms formed on polystyrene microtitre surface at respective time points (3 6 9 12 18 24 36 48 72 96 h) (magnification 100x)

38 Molecular Dynamics Simulation Study of PMMPGMTo predict the functional association between PMMPGMenzyme (encoded by algC gene) resulting in alginateLPScore mediated biofilm formation in A baumannii molec-ular dynamics (MD) simulations up to 10 ns were carriedout on homology model of PMMPGM of A baumanniiAIIMS 7 using GROMACS v404 program The generatedPMMPGMmodel of A baumannii AIIMS 7 contained fourdomains of equal size arranged in ldquoheart shapedrdquo manner(Figure 7(a)) which form a compact structure similar to Paeruginosa [42] The polypeptide chain proceeds through

each domain sequentially (Figure 7(a)) forming heart shapedgeometry Sequence alignments (Supplementary Figure S4)and model building study showed that the active site waslocated at the centre of the two domains (domains 1 and2) in a deep cleft formed by Ser104 Asp244 Asp246 andAsp248 PMMPGM sequence of A baumannii AIIMS 7showed conserved sequence motif in domain 3 from residues327-331 (GEYAGH) which would act as a sugar binding siteA cluster of positively charged conserved residues found indomain 3 (Lys287) and domain 4 (Arg427 Arg438) couldbe involved in phosphate binding The cleft showed solvent

8 The Scientific World Journal

----------mavtaqAarrrerVlclfDvdGtL---------------------tpaRQ----mEegPlplltirtapYhdqkpgtsglRkKt-yyfedkpcylenFiqsiffsidlKd-------------mnIkhkFPlNIFRAYDIRGKL-TnLTptiiRsIavA----LAAQYtE-------------mnVrhsFPkSIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-----------mstakAptlPaSIFRAYDIRGvvGdtLTAETAywIGrA----igSEsla---------mnspasVApnlPeTIFRAYDIRGvvGdtLnAETAywIGrA----igSEsla--------mndmahlVpaalPdSIFRAYDIRGvvGktLhAETAywIGrA----igAQsla

kidPEva--------------aflQkLr----SrvqI---GvVggsdyckIAeqLGdGDerqgssLVvGgDGRyfnkSaietIlQmaaanGigrlvIgqnGilsTPavscIiRkIkaigGagQkQiVIGYDaRLtSPtyAniIqQifehqGleVinI---GCcsTPMMYYIARdya-GNGvkQtQLVIGYDaRLtSPAyAylIeeiLiEqGlNVTnI---GCcssPMMYYIARdfG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGrgEPcvavGrDGRLSgPeLvkqliQgLvDcGCqVSDv---GmVPTPVLYYaAnvLegkSGqnEPnvsvGrDGRLSgPeLvqqliQgLhDsGCHVSDv---GlVPTPaLYYaAnvLagktGqgEPQvsvGrDGRLSgPmLveqlikgLvDsGCHVSDv---GlVPTPaLYYaAnvLagkSG

Viekfdyvfaen----GtvqykhGrlLSkqtIQnh-------LgEellq--d--------iilTASHNPggpNgdfGiKFnIsnggpaPEAItdkifqisktieEyAic--PDlkvdlgviMVTASHNPKSdN---GiKWILkGEPpSPEAIQQ--------vglyAegftdqiieiqnliMVTASHNPKSdN---GiKWILkGEPpSPEmIQQ--------vgEeAqtYVPNhsisvleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleVMlTgSHNPpdYN---GFKiVvaGEtLanEqIQa--------LrEriek--nDl--asgvVMlTgSHNPKdYN---GFKiVIaGDtLanEqIQa--------LhErikt--nNl--tsqkVMlTgSHNPsdYN---GFKiVIaGDtLanEqIQa--------Lltrlkt--nDl--tlaq

----li--nFClsY---------------------------mallRLpkkrgtfIefrNGlgkqQF--DlenKfkpftveivdsveayatmlrnifdfnAlkellsgpnrLKIrIDamhGdqlhkiipqYClQY-----------------------qQAllSDIhLskPLKIVLDglhGlTlpQFkAeFCqQY-----------------------qQAIfkDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGgSveQv--DilpRY-----------------------fkqIrDDIamakPmKVVvDCgNGgSitQv--DileRY-----------------------fQqIkNDIvmaRkLKVVvDCgNGgrvekv--DilgRY-----------------------fQqIvgDvKLakkLKVVvDCgNG

mlni-------spiGrs------CtLEeri-----efSeldkkEkireKfvE---DlktevvGpyvKKiLcEeLGapanSavnCvpledFggHHPDP-nltyaaDLvetmKsgehDfGaASAGrCAKsvL-EkLGCdVIALr-CEanGhFPdHaPDPSHAehLKqLqqaIisenADlGIASAGhCsKliL-EkmGCEVIALr-tnpnGeFPdHaPDPSHAAhLisLrkaVvEqqADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIAvAGviApQLi-EALGCsVIpLy-CEVDGNFPNHHPDPgkpeNLKDLiAKVKaenADlGLAAAGviApQLi-EALGCEVISLf-aEVDGNFPNHHPDPgkleNLQDLiAKVKEtGADlGLAAAGvvApQLi-EALGCEVIpLf-CEVDGNFPNHHPDPgkpeNLEDLiAKVKEtGADIGLA

FaGkG--------------------------LrfSrGgmIsFDV----------------FDGDGDRnmIlgkhGffVnPsdsvaviAaNIfsip-----yFqqtgvRgfarsmptsGallDGDGDRVvlldEqahIIsPDRLLsLFAQmcLQQHPhkEIVFDVKCSRmVadtVEQlnGQlDGDGDRVvlVdEkaqIltaDRLLsLFAQmcLEQHPeqEIVFDVKCSRmVqetVEKlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKFDGDGDRVGVVTntGtIIYPDRLLMLFAKDVvsRNPGADIIFDVKCtRrlialIsgyGGRFDGDGDRVGVVTnaGnVVYPDRLLMLFAlDVLKRNPGADIIFDVKCtRrltplIsehGGRFDGDGDRVGVVTntGsIVYPDRLLMLFAQDVLsRNPGAEIIFDVKCtRrltplIEQhGGR

-------------fpeGwd-----------------------krYclds-----lDqdsfdrvanatkialyetpTGwkFfgnlmdaSk--lsLcGEeSfgtGsdhiRE------kDGLwakM----------iRTGsSFLrSyLSQSnGNAvfgGEya---GHYvFndGRgFGyDDGLYakM----------iRTGsSFLrAyLSQSnGrAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPvM----------WKTGHSlIKkKmketG--AlLAGEMS---GHvFFKE-RWFGFDDGiYPvM----------WKTGHSlIKkEmkkSG--AlLAGEMS---GHiFFKE-RWFGFDDGiYalM----------WKTGHSlIKkKmkQtG--slLAGEMS---GHiFiKE-RWyGFDDGiY

dtihffgneTspggnd-fEiFAd-----Prtv----------------------------AvlawLsILatrKqsv-eDilkdhwhkFgrnffTrydYeeVeaegatkmmKdLeAlmfdrAAlRvmEyLgQsEArclSELlAa----FPEryCTedIYIsthnasPqqVlnni-----EiAAlRvmEyfTQssATtISELFAp----YPErCCTedtYIgtyQsDPkyVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EisAARLLEILsQdQrds-ehvFSa----FPsdisTPEInItVtEdskfaIIEaL-----qrsAARLLEILsQesAna-eDLFet----FPndisTPEInIkVtDvtkfsIIKaL-----EtsAARLLEILsktEqsa-enLFAa----FPndisTPEInIdVtDegkfsIIdaL-----qr

---------------------------------------------GhsVV----------sfvgkqfsandkvytvekadnfeyhdpvdg-sVSKnqGlRLiFaDGsrIIfrlsgtgsAgi-----------------------SHrlaA-RlSKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASd-----------------------Aqwgeg-nIttlDGVRvDypkGwGlV-------RASd-----------------------AqwgdA-KlttIDGVRvDypkGwGlV-------RASd-----------------------AdwgeA-nlttIDGVRvDyanGwGlV-------RAS------------spqdtvQRcrEiF----------------fPEtAhEa---aTirlYIdsyEkDNakinQdpQvmlaplisialkvsqLQErtgrtAptvit-NTgeyFtvRFdADhPdrLveIrQKF---------isMLQDqyPQIAqElaQSNTgeyFtvRFdADNPlrLkeIQQKF---------vDMLQEhyPQIAqElsEANTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElmslNTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElsEANTTPVlVLRFEADteeeLERIktvF---------rNqLkavdssLpvpF--- NTTPVlVLRFEAeteaeLQRIkdvF---------haeLkKvaPdLdlpF---NTTPVlVLRFEADsdaeLQRIkdvF---------rtqLlrvePELqlpF---

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYEAB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

(a)

Figure 4 Continued

The Scientific World Journal 9

05

92

94

92

76

36

39

A baumannii AIIMS 7 AlgC PMMA baumannii AYE PMMA calcoaceticus PMM

A haemolyticus PMM

P aeruginosa PAO1 PMM

P syringae PMMH sapiens PMM

P putida PMMPGM

O cuniculus PGM isoform 1

(b)

Figure 4 (a)-(b)Multiple sequence alignment and phylogenetic relationship of PMMPGM (a) CLUSTALWanalyses of PMMPGMproteinsequences displaying representative color of box which highlights conserved regions that is active site (red) Mg2+ binding site (green) andsubstrate binding site (blue) (b) Bootstrap consensus tree for PMMPGM enzymes constructed by MEGA v50 using the neighbor-joining(NJ) method (based on 1000 replicates) Numbers on the nodes are bootstrap values and the bar represents scale of estimated evolutionarydistance (20 substitutions at any amino acid position per 100 amino acid positions)

943

21

660

440

290

AlgC

M

Figure 5 SDS-PAGE analysis of AlgC (PMMPGM) protein Lane 1whole cell extract of control E coliDH5120572 (lacking algC gene) lane 2whole cell extract of E coli DH5120572 with algC gene showing the AlgCprotein band sim53 kDa lane M standard protein molecular weightmarker (kDa)

accessible surface (SA Richardsrsquo surface) and molecularsurface (MS Connollyrsquos surface) areas as calculated by alphashape method The enzyme showed a total cavity of 36415 Aand spherical central cavity of 187813 Awhere substrate couldbind as shown in Figure 7(b) To compare the 3D struc-tures obtained before and after MD simulations structuralsuperpositionsweremade using PDBeFOLD results ofwhichshowed root mean square deviation (RMSD) of two alignedstructures within the range of 251 A (Figure 7(c)) Metal ionMg2+ interacts with Asp244 Asp246 Asp248 and Ser104

residues (Figure 7(d) Supplementary Table S1) The metalion Mg2+ is required for enzymatic activity of PMMPGMof A baumannii AIIMS 7 (Figure 7(d)) rather than Mn2+andZn2+ Specific interactions betweenmetal ion (Mg2+) andprotein water-mediated H-bonds (so-called water bridges)and hydrophobic (Lennard-Jones) interactions have beenidentified and are listed (Supplementary Table S1)

39 Stability of Phosphomannomutase during Simulation Toverify the simulation stability and to measure structure anddynamics of PMMPGM model of A baumannii AIIMS 7standard structural parameters like RMSD root mean squarefluctuation (RMSF) and radius of gyration (RG) were calcu-lated and represented in Figures 8(a)ndash8(c) During moleculardynamics simulation period of 10 ns the average RMSD valuewas 03 nm as depicted (Figure 8(a)) Steady RMSD resultshowed for the atoms in the four domains of PMMPGMmodel indicated that the catalytic activity is relatively stableduring the simulation The result for radius of gyration (RG)also indicated the stability ofmodel over thewhole simulationperiod (Figure 8(b)) Minor fluctuations in C-alpha atoms(RMSF) of helical and sheet structural elements could beseen whereas loop region showed variability to some extent(Figure 8(c)) Overall these results of RMSD RMSF andRG strongly indicated the stability of system over the entiresimulation period

4 Discussion

Biofilm formation substantially aids to the spectrum ofmultidrug resistance displayed by A baumannii and is oftenattributed as the major cause for antibiotic treatment fail-ure [3 5] The process of bacterial biofilm development isbelieved to be a complex interplay of the biofilm EPS matrixcomponents that is a plethora of proteins and extracellularmacromolecules for example DNAand polysaccharidesThesynthesis of specific exopolysaccharides such as alginate and

10 The Scientific World Journal

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

Figure 6 (a)ndash(h) Visualization of biofilm augmentation by scanning electron microscopy Electron micrographs (a c e g) showing biofilmsformed by algC clones after 24 h at a gradient of magnifications (Bar = 2 120583m 5 120583m 10120583m and 20 120583m absolute magnifications indicated asKx in the very picture) as observed under a scanning electronmicroscope algC clones can be seen clearly producing dense and robust biofilmas suggested by the thickness and integrity of the biofilm matrices compared to the control biofilms by E coli DH5120572 (lacking A baumanniialgC gene) at corresponding comparable magnifications (b d f h)

LPS core has been described in various bacterial systems[25 43 44] in particular P aeruginosa with its contributionin biofilm formation [20 22] However algC gene functionand its expression pattern have not been elucidated in Abaumannii in order to understand the genetic basis of itsassociation with biofilm formation Herein an initial geneticcharacterization of the algC gene and its association withbiofilm formation is reported in the MDR strain AIIMS 7 ofA baumannii which depicts differential expression of algCgene during the biofilm development Besides MD simula-tion was performed on the three-dimensional (3D) struc-ture of the gene product (enzyme PMMPGM) to comparewith that of P aeruginosa followed by its cloning heterol-ogous expression and phylogenetic analysis Finally biofilmaugmentation by algC gene was evaluated quantitatively andconfirmed by SEM

Analysis of the algC gene expression pattern in thetemporal scale (up to 96 hours) reveals that surface-attachedbacteria have significantly higher rate of transcription levelsthan nonadherent or shaking cultures The attachment orldquosurface sensingrdquo could be the trigger for the activation ofalgC promoter as a result of which the algC expression couldbe seen consistently higher (maximum 8159-fold 119875 lt 005)in biofilm formingA baumannii cultures than the planktoniccounterparts (maximum 324-fold) as revealed by real timePCR analysis (Figure 1) This observation is in accordancewith an earlier study in P aeruginosa [45] which shows algC

reporter gene activity in continuous biofilm culture cells to be19-fold increased than planktonic cells Earlier Davies et al[46] have shown that expression of P aeruginosa algC isupregulated after initial attachment of cells to teflon orglass substrata where cells that failed to upregulate alginatebiosynthesis typically detached from the surface As reviewedearlier by Gacesa [47] it is presumed that exopolysaccharidealginate plays a role in consolidation of the biofilm ratherthan in the initial adhesion event and hence higher rate ofalgC transcription was not a prerequisite to surface attach-ment by P aeruginosa indicating alginate biosynthesis notnecessary for its attachment to glass surface In contrast ourdata in support of the relative quantification of algC tran-scription by real-time PCR and biofilm augmentation byalgC as visualized by SEM is indicative of the possibleinvolvement of algC expression in probably both the eventsthat is initial attachment and consolidation of biofilmsformed by A baumannii Furthermore the upregulation ofalgC transcription at the maturation stages (36ndash48 hours)explains that it is strongly associated with maturation ofbiofilms as the correlation of algC expression with biofilmformation during the very stage was significantly higher thanthe initial events (0983 compared to 0902119875 lt 005) Duringplanktonic mode of growth low levels of algC transcriptionwere observed as compared to biofilm formingA baumanniiwhich should be ideally due to lack of surface attachment (lesspromoter activity) and variations in the oxygen tension in

The Scientific World Journal 11

(a) (b)

(c) (d)

Figure 7 (a)ndash(d) Molecular modeling of PMMPGM from A baumanniiAIIMS 7 (a) Four sequential domains of enzyme PMMPGM afterMD simulation (b) central spherical cavity showing solvent accessible surface area (orange) (c) Superimposed structures before MD (cyan)and after MD simulation (magenta) (d) Mg2+ interacting residues of PMMPGM enzyme

shaking and static cultures Regulation of the algC gene couldbe dependent on diverse parameters as seen in P aeruginosawhere it was shown to be in coordination with the algCpromoter activity [23] Besides according to other studiesvariations in oxygen tension [48] nitrogen limitation [49]and ethanol induced membrane perturbation [50] can alsoinfluence the alginate production in P aeruginosa In Abaumannii we demonstrate differential algC transcription tobe dependent upon abiotic (polystyrene) surface attachmentand thus further investigation would be required to portraya comprehensive profile of algC genetic regulation

The 3D structure of PMMPGM bifunctional enzyme asdetermined by homology modeling which is the gene prod-uct of algC from A baumannii strain AIIMS 7 shows 32overall similarity Furthermore high sequence identity of thecatalytic domain was observed with that of experimentallydetermined structure of PMMPGM of P aeruginosa [42]Each of the four domains contained residues essential forcatalysis andor substrate recognition While the catalytic

phosphoserine residue (Ser104) of domain 1 could be useful totransfer phosphoryl group to and from the bisphosphorylatedreaction intermediate domain 2 was found to contain ametal binding loop (Asp244 Asp246 Asp248) that couldcoordinate theMg2+ ion required for the PMMPGM activity(Figure 7(d)) Domain 3 of PMMPGM of A baumannii alsocontains sugar binding loop (Glu327 Ala329 His331) similarto that in PMMPGM of P aeruginosa This sugar bindingloop has key residues which could enable the enzyme torecognize the two different binding orientations of its 1- and6-phospho sugar substrates Domains 3 and 4 provide mostof the residues that create a phosphate binding site (Lys287 ofdomain 3 and Arg427 Arg438 of domain 4) that determinesthe orientation of the incoming phosphor-sugar substratesIn context with previous studies in P aeruginosa PMMPGM[27 51] our investigation predicts that PMMPGMofA bau-mannii requires Mg2+ and activator glucose 16-biphosphatefor its catalytic activity Other physical properties of the pro-tein analyzed in silicowere also found to be similar to those of

12 The Scientific World Journal

0005

01015

02025

03035

04045

038

677

211

5815

4419

3023

1627

0230

8834

7438

6042

4646

3250

1854

0457

9061

7665

6269

4873

3477

2081

0684

9288

7892

6496

50

RMSD

(nm

)

Time (ps)

(a)

22225

23235

24245

25

038

276

411

4615

2819

1022

9226

7430

5634

3838

2042

0245

8449

6653

4857

3061

1264

9468

7672

5876

4080

2284

0487

8691

6895

5099

32

Radi

us o

f gyr

atio

n (n

m)

Time (ps)

(b)

0005

01015

02025

03035

04045

1 19 37 55 73 91 109

127

145

163

181

199

217

235

253

271

289

307

325

343

361

379

397

415

433

451

469

RMSF

(nm

)

Residue number

(c)

Figure 8 (a)ndash(c) Results from 10 ns molecular dynamics simulation performed on PMMPGM model (a) Root mean square deviation(RMSD) (b) radius of gyration (c) root mean square fluctuation (RMSF)

PMMPGM enzyme from P aeruginosa [42] This indicateda similar function of the enzyme that is a bifunctional rolewhich would be responsible for conversion of mannose-6-phosphate to mannose-1-phosphate or glucose-6-phosphateto glucose-1-phosphate as in P aeruginosa [28]

The active site residues predicted in the PMMPGMenzyme 3D structure were determined by multiple sequencealignments and however needs to be validated by experi-mental analysis In context of sugar binding loop PMMPGMofA baumanniimay also have equal specificity for glucose aswell as mannose because mannose and glucose are epimersat C-2 The active site residues of characterized PMMPGMcomplexes are known to change conformation based on theidentity of the bound ligand andor change the type of contactinwhich they participate [28 52]However a direct structuralcharacterization of multiple enzyme-substrate complexeswould likely be necessary for a full understanding of substratespecificity in this enzyme superfamily Nevertheless the MDsimulation results in this research reveal several regions ofthe PMMPGM enzyme to be highly conserved and clearlyimportant for function in all organisms supporting theproposal that all of these enzymes use a commonmechanismThe algC gene of A baumannii AIIMS 7 characterized in thisstudy is an ortholog of algC gene from P aeruginosa ThePMMPGM protein plays a central role in the productionof three P aeruginosa virulence-associated traits alginaterhamnolipids and LPS although the production of thesecompounds is subjected to a completely different genetic andenvironmental regulation [23 45] The PGM activity of theprotein is involved in synthesis of the LPS core of biofilmswhile PMM activity is responsible for alginate biosynthesisBoth of these (PMMPGM) enzymatic functions either singly

or in combination could be attributed for the biofilm forma-tion in A baumannii AIIMS 7 and augmentation of biofilmsin heterologous clones as observed by SEM It is also con-ceivable therefore that the cloned and overexpressed PGMenzyme (of A baumannii AIIMS 7) might have used up themachinery for cellular LPS core biosynthesis in E coli [25]and could be the possible mechanism behind the overallaugmentation of biofilms in the heterologous algC clones(E coli DH5120572 a relatively weak biofilm former than Abaumannii) as evident from the SEM image analysis Never-theless due to the central role of PMMPGM in biosyntheticpathways the enzyme has potential to serve as a novelmarkerfor A baumannii infection or as pharmaceutical targets forinhibition Such inhibitors would be specific and not affectthe essential homolog in human due to lack of conservationin active site sugar and metal binding site

The mechanism of PMMPGM is believed to be closelyparallel to that of related proteins from other pseudomonadsincluding close relatives like P aeruginosa Our observationson the similarity of the protein sequences and 3D modelsindicate that the PMMPGM protein of A baumanniiAIIMS7 could have a similar biological role in biofilms as seen in Paeruginosa Therefore the dual roles of PMMPGM in algi-nate and LPS biosynthesis enhancing the biofilm formationin A baumannii propose the enzyme as an attractive targetfor inhibitor design

5 Conclusion

This study presents an initial genetic characterization ofalgC gene in an MDR strain A baumannii AIIMS 7 which

The Scientific World Journal 13

demonstrates a quantitative differential expression patternin biofilm cells compared to planktonic counterparts cellsover a temporal scale of 96 h Molecular dynamics (MD)simulation studies indicate that the 3D structure of enzyme(PMMPGM) has functions similar to P aeruginosa whichmight result in significant biofilm augmentation in heterol-ogous algC clones as evident from SEM analysis Theseexperimental lines of evidence collectively suggest that thedifferential algC gene transcription in A baumannii stronglycorrelates with the initial attachment (9 h) and maturationstages (36 h) during the biofilm development however maynot be the only attribute contributing to biofilm formationand could be associated with other factors The PMMPGMenzyme can be a potential drug target for biofilm-associatedinfections of A baumannii as revealed by the 3D structuralsimulation studies

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Dr S Gosavi and Mr A Shinde Depart-ment of Physics University of Pune India for providingthe SEM facility Kailas D Sonawane gratefully acknowledgesUniversity Grants Commission New Delhi Government ofIndia for computational facility support under the schemeUGC SAP DRS-I sanctioned to Department of Biochem-istry Shivaji University Kolhapur India Praveen K Sahuacknowledges University of Pune University with Potentialfor Excellence (UPE Phase-1) for providing a senior researchfellowship

References

[1] M-L Joly-Guillou ldquoClinical impact and pathogenicity ofAcine-tobacterrdquo Clinical Microbiology and Infection vol 11 no 11 pp868ndash873 2005

[2] A Y Peleg H Seifert and D L Paterson ldquoAcinetobacterbaumannii emergence of a successful pathogenrdquoClinicalMicro-biology Reviews vol 21 no 3 pp 538ndash582 2008

[3] L C S Antunes P Visca and K J Towner ldquoAcinetobacter bau-mannii evolution of a global pathogenrdquo Pathogens and Diseasevol 71 no 3 pp 292ndash301 2014

[4] A Y Peleg A deBreijMDAdams et al ldquoThe success ofAcine-tobacter species genetic metabolic and virulence attributesrdquoPLoS ONE vol 7 no 10 Article ID e46984 2012

[5] M J McConnell L Actis and J Pachon ldquoAcinetobacter bau-mannii human infections factors contributing to pathogenesisand animal modelsrdquo FEMS Microbiology Reviews vol 37 no 2pp 130ndash155 2013

[6] S J Wilson C J Knipe M J Zieger et al ldquoDirect costs ofmultidrug-resistant Acinetobacter baumannii in the burn unitof a public teaching hospitalrdquo American Journal of InfectionControl vol 32 no 6 pp 342ndash344 2004

[7] M V Villegas and A I Hartstein ldquoAcinetobacter outbreaks1977ndash2000rdquo Infection Control and Hospital Epidemiology vol24 no 4 pp 284ndash295 2003

[8] A P Tomaras C W Dorsey R E Edelmann and L A ActisldquoAttachment to and biofilm formation on abiotic surfaces byAcinetobacter baumannii involvement of a novel chaperone-usher pili assembly systemrdquo Microbiology vol 149 no 12 pp3473ndash3484 2003

[9] P K Sahu P S Iyer A M Oak K R Pardesi and B AChopade ldquoCharacterization of eDNA from the clinical strainAcinetobacter baumanniiAIIMS 7 and its role in biofilm forma-tionrdquoThe Scientific World Journal vol 2012 Article ID 97343610 pages 2012

[10] H-W Lee Y M Koh J Kim et al ldquoCapacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to formbiofilm and adhere to epithelial cell surfacesrdquo Clinical Micro-biology and Infection vol 14 no 1 pp 49ndash54 2008

[11] A de Breij L Dijkshoorn E Lagendijk et al ldquoDo biofilmformation and interactions with human cells explain the clinicalsuccess of Acinetobacter baumanniirdquo PLoS ONE vol 5 no 5Article ID e10732 2010

[12] L C S Antunes F Imperi A Carattoli and P Visca ldquoDeci-phering the multifactorial nature of Acinetobacter baumanniipathogenicityrdquo PLoS ONE vol 6 no 8 Article ID e22674 2011

[13] J A Gaddy and L A Actis ldquoRegulation of Acinetobacter bau-mannii biofilm formationrdquo FutureMicrobiology vol 4 no 3 pp273ndash278 2009

[14] J W Costerton P S Stewart and E P Greenberg ldquoBacterialbiofilms a common cause of persistent infectionsrdquo Science vol284 no 5418 pp 1318ndash1322 1999

[15] M S Favero R P Gaynes T C Horan et al ldquoNational nosoco-mial infections surveillance (NNIS) report data summary fromOctober 1986-April 1996 issuedMay 1996rdquoAmerican Journal ofInfection Control vol 24 no 5 pp 380ndash388 1996

[16] J Chastre and J-L Trouillet ldquoProblem pathogens (Pseu-domonas aerugınosa and Acınetobacter)rdquo Seminars in Respira-tory Infections vol 15 no 4 pp 287ndash298 2000

[17] S Favre-Bonte J C Pache J Robert D Blanc J C Pechere andC van Delden ldquoDetection of Pseudomonas aeruginosa cell-to-cell signals in lung tissue of cystic fibrosis patientsrdquo MicrobialPathogenesis vol 32 no 3 pp 143ndash147 2002

[18] J G Leid C J Willson M E Shirtliff D J Hassett MR Parsek and A K Jeffers ldquoThe exopolysaccharide alginateprotects Pseudomonas aeruginosa biofilm bacteria from IFN-120574-mediated macrophage killingrdquoThe Journal of Immunology vol175 no 11 pp 7512ndash7518 2005

[19] G W Sundin S Shankar S A Chugani B A Chopade AKavanaugh-Black and AM Chakrabarty ldquoNucleoside diphos-phate kinase from Pseudomonas aeruginosa characterization ofthe gene and its role in cellular growth and exopolysaccharidealginate synthesisrdquo Molecular Microbiology vol 20 no 5 pp965ndash979 1996

[20] J R Wiens A I Vasil M J Schurr and M L Vasil ldquoIron-regulated expression of alginate production mucoid pheno-type and biofilm formation by Pseudomonas aeruginosardquoMBiovol 5 no 1 pp e01010ndashe01013 2014

[21] D J Wozniak T J O Wyckoff M Starkey et al ldquoAlginate isnot a significant component of the extracellular polysaccharidematrix of PA14 and PAO1 Pseudomonas aeruginosa biofilmsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 13 pp 7907ndash7912 2003

[22] D ENivens D EOhman JWilliams andM J Franklin ldquoRoleof alginate and its O acetylation in formation of Pseudomonasaeruginosamicrocolonies and biofilmsrdquo Journal of Bacteriologyvol 183 no 3 pp 1047ndash1057 2001

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

The Scientific World Journal 5

The selected templates having good alignment score with thetarget sequence were aligned using CLUSTALW Templateprotein structure 1K2Ypdb (P aeruginosa PMMPGM S108Amutant) having maximum sequence alignment score (32)with target sequence was used as the final template to buildhomology model of PMMPGM Three-dimensional modelof PMMPGM was constructed using MODELLER 9 v7 [35]by considering 1K2Ypdb as a template structureThe stabilityof the model was tested by using 10 ns molecular dynamics(MD) simulation

214 Molecular Dynamics (MD) Simulation MD simulationswere performed on the homology model of PMMPGMfrom A baumannii AIIMS 7 in a HP workstation with thehelp of GROMACS 404 program using the GROMOS9645a3 force field [36] The structure was fully solvatedwith water (SPC) and system was neutralized with 9Na+ions The solvated structure was minimized by steepestdescent method for 1000 steps at 300K temperature andconstant pressure The LINCS algorithm with 80 A cutoffswas used for energy minimization of PMMPGM whereasPME algorithm with 80 A nonbonded cutoffs was utilizedsimilarly as used in an earlier MD simulation study [37]After equilibration period production MD was run for 10 nsat 300K temperature pressure and constant volume ensem-ble Solvent accessible surface (SA Richardsrsquo surface) andmolecular surface (MS Connollyrsquos surface) areas were cal-culated using CASTp analysis [38] Structural comparisonafter molecular dynamics simulation of initial structure withfinal structure was done using PDBeFOLD software [39]The MD simulation trajectory was then visualized usingthe VMD (visual molecular dynamics) package [40] Three-dimensional images of enzyme PMMPGM after MD simu-lation run were generated using the UCSF-Chimera tool [41]and Pymol (httppymolsourceforgenet)

215 Nucleotide Sequence Accession The GenBank accessionnumber for A baumannii AIIMS 7 algC gene sequenceis JF701279 and AEC46864 for the protein (PMMPGM)sequence

3 Results

31 Identification of algCGene inA baumannii AIIMS 7 PCRwith genomic DNA yielded a fragment of 1781 bp (Supple-mentary Figure S1 in the Supplementary Material availableonline at httpdxdoiorg1011552014593546) PCR ampli-fications with plasmids were unsuccessful confirming thatthe gene is not plasmid-borne Reverse transcription PCRusing total RNA showed amplification of internal codingregions 1 (1360 bp) and 2 (463 bp) which confirmed the activetranscription of the algC ORF (Supplementary Figure S2)DNA sequence of the gene was analyzed to predict regulatoryregions such as promoter ribosomal binding site transla-tion start and end which were identified and annotated(Supplementary Figure S3)

32 Elevated Levels of algC Gene Transcription during BiofilmMode of Growth Quantitative real-time PCR experiment

0102030405060708090

3 6 9 12 18 24 36 48 72 96

RQ (f

old

over

incr

ease

)

Time (hours)

PlanktonicBiofilm

Figure 1 Comparison of algC gene expression pattern in biofilmand planktonic A baumannii AIIMS 7 Real-time quantitative PCRresults showing relative quantification of algC gene expression levels(calculated according to ΔΔCt-method and represented as ldquofoldover increaserdquo) at corresponding time points Expression levels werenormalized with indigenous control (16SrRNA gene expression)in both biofilm and planktonic cells (calibrator 24-hour biofilmsample fold over increase = 1)

showed significant variation in the threshold cycle (Ct) valuesin biofilm and planktonic mode of growth of A baumanniiwhich described differential expressional patterns of the twomodes of growth (Figure 1) Number of copies of algCmRNAwere calculated using 16SrRNA gene as internal control ateach time point (ΔCt) To evaluate the relative gene expres-sion in biofilm and planktonic modes of growth over thetemporal scale of 3 to 96 hours the 24-hour biofilm samplewas used as calibrator (ΔΔCt) Relative quantification (RQ)plot for gene expression at various time points from 3 to96 hours showed low basal (almost linear) expression ofalgC in planktonic mode (maximum of 324-fold 48 hours)whereas highly variable and elevated algC expression wasseen in biofilm mode (maximum 8159-fold 48 hours) anddisplaying a definite pattern The initial attachment stage (9hours) and maturation stage (48 hours) of biofilm showedmaximal expression of algC which was in contrast and couldbe seen as steadily low expression at almost all time pointsin planktonic mode of growth (Figure 1) This observationaffirms that the algC gene is highly up-regulated (at the tran-scription level) while theA baumannii cells grow in a biofilmmode (ie attached to an abiotic surface) and follows apattern as depicted (Figure 1) however in planktonic (freeform in a suspension unattached to surface) the algC geneis transcribed at a basal rate

33 Biofilm Growth Pattern Correlates with Quantitative algCGene Expression Biofilm growth pattern A baumannii onpolystyrene surface can be seen in Figure 2 which can beexplained in three distinct stages First an exponential rateof increase was observed at 3 to 9 hours which definedthe initial attachment and micro-colony aggregation stage(Figure 2) After 9 hour till 36 hours it showed steady level of

6 The Scientific World Journal

0

05

1

15

2

25

3

3 6 9 12 18 24 36 48 72 96

Biofi

lm in

dex

Time (hours)

Figure 2 Pattern of biofilm growth of A baumannii AIIMS 7Graph showing corresponding biofilm indices of biofilms formed onpolystyrene microtitre surface calculated after normalization withcontrol and plotted versus representative time points (three to 96 h)

increase in biofilm indices indicating the consolidation stageof the attached micro-colonies and approaching maturationof biofilm Third maximum production of biofilm matrixcould be seen at 36 to 48 hours marking the maturationstage Lastly as like the plateau phase in the planktonicgrowth curve of A baumannii AIIMS 7 (data not shown)the biofilm growth pattern also exhibited a steady stateand persistent nature after maturation (after 48 hour till96 hours) To find the association of algC gene expressionpattern at transcription level (as revealed from real-time PCRanalysis) with that of biofilm growth correlation coefficientswere determined using the RQ values in biofilm samples andbiofilm indices at corresponding time points High corre-lation was observed at all three major stages of biofilmCorrelation coefficients were 0902 0925 and 0983 (119875 lt005) corresponding to initial attachment consolidation ofthe surface-attached micro-aggregation and maturation ofbiofilm stages Correlation was found to be maximum (0983119875 lt 005) at stageswhere biofilmswerematureThis indicateda strong possibility that transcription of algC could be in closeassociation with biofilm formation especially the maturationstage (36ndash48 hours) and also the initial attachment stage (3ndash9hours)

34 Microscopic Visualization of Biofilm DevelopmentTo visualize the growth pattern of biofilm bright-field microscopy was performed on biofilms growingon polystyrene surface which showed varied biofilmmorphology at gradual time points (Figure 3) with a strongconcurrence with quantitative evaluation of biofilm growthpattern (Figure 2 as described above) At initial attachmentstages planktonic cells were seen scantily aggregated(Figures 3(a) and 3(b)) but gradually the micro-aggregationon the surface increased subsequently making completelyattached micro-colonies at 9 h which could be seen clearly(Figure 3(c)) Further stages of growth (12 18 and 24 h)showed consolidation of micro-colonies leading to stablestructures of biofilm (Figures 3(d)ndash3(f)) At 36ndash48 h fullymature biofilm communities of A baumannii were seenenriched with thick EPS matrices (Figures 3(g) and 3(h))

followed by appearance of robust three-dimensional biofilmstructures which were found persistent till 72 and 96 h(Figures 3(i) and 3(j)) Overall visualization of biofilmgrowth at developing stages was in tandem with the patternsof biofilm growth as well as algC gene expression

35 In Silico Analysis of Protein Reveals Highly ConservedIdentity To compare and evaluate the relatedness of A bau-mannii AIIMS 7 algC encoded PMMPGM in silico analyseswere performed BLASTn results showed 100 similaritywith the predicted PMMPGM sequence in whole genomesequences of A baumannii available in NCBI databaseAlignment results also displayed significant similarity withPMMPGMnucleotide sequences of other genera 472 aminoacid residues could be theoretically translated in one frame(51015840ndash31015840) of the DNA sequence BLASTp showed similar resultsas in BLASTn alignmentThemolecular weight of the proteinwas predicted to be 5294 kDa with isoelectric point (pI)of 567 CLUSTALW alignment with selected bacterial andeukaryotic PMMPGM sequences showed conserved regionsin the protein as shown in Figure 4(a) (active site Mg2+binding site and sugar binding site marked as coloredrectangles) in the protein as shown Figure 4(b) shows thephylogenetic tree indicating relatedness between PMMPGMenzymes from pseudomonads and higher eukaryotes (rabbitand human) PMMPGM sequence from A baumannii hadless than 25 identity with rabbit muscle PGM isoform1 whereas it had a mere 10 identity with human PMM(Figure 4(b))

36 Assessment of Protein To demonstrate the synthesis ofPMMPGM protein whole cell extracts of cloned E coliDH5120572 with resultant recombinant plasmid pGEalgCA7 cellswere used in SDS-PAGE analysis which showed a clearlyoverexpressed protein of sim53 kDa suggesting the PMMPGMprotein in question (Figure 5) Control E coli DH5120572 (withempty vector pGEM-3Zf+ lacking an algC gene) did not showany PMMPGM protein band

37 Biofilm Augmentation by algC after 24 h Electron micro-graphs of biofilm formed by the algC clones (Figure 6)showed significant increase in biofilm formation comparedto controls probably indicative of the overexpression of thePMMPGM protein and the resultant exopolysaccharidesThicker biofilms could be seen in the algC clones havingclear dense matrices (Figures 6(a) 6(c) and 6(e)) with aintracellular cementing material clearly visible (Figures 6(a)and 6(e)) indicative of the biofilm EPS Overall SEM analysisat a gradient of magnifications and concurrent comparisonswith control clones (lacking functional copy of algC) sug-gested substantially that there is significant facilitation of theoverall biofilm formation emphasizing the enrichment of thebiofilm matrices which could be due to the cohesive activityof EPS including alginate and LPS cores The quantitativebiofilm assay concurred with the microscopic analysis withaugmentation of biofilm up to 387-fold in the algC clonescompared to the control cells lacking algC gene (119875 lt 002data not shown)

The Scientific World Journal 7

(a) (b) (c)

(d) (e) (f)

(g) (h) (i)

(j)

Figure 3 (a)ndash(j) Microscopic visualization of A baumannii AIIMS 7 biofilms Representative bright field micrographs depicting staticbiofilms formed on polystyrene microtitre surface at respective time points (3 6 9 12 18 24 36 48 72 96 h) (magnification 100x)

38 Molecular Dynamics Simulation Study of PMMPGMTo predict the functional association between PMMPGMenzyme (encoded by algC gene) resulting in alginateLPScore mediated biofilm formation in A baumannii molec-ular dynamics (MD) simulations up to 10 ns were carriedout on homology model of PMMPGM of A baumanniiAIIMS 7 using GROMACS v404 program The generatedPMMPGMmodel of A baumannii AIIMS 7 contained fourdomains of equal size arranged in ldquoheart shapedrdquo manner(Figure 7(a)) which form a compact structure similar to Paeruginosa [42] The polypeptide chain proceeds through

each domain sequentially (Figure 7(a)) forming heart shapedgeometry Sequence alignments (Supplementary Figure S4)and model building study showed that the active site waslocated at the centre of the two domains (domains 1 and2) in a deep cleft formed by Ser104 Asp244 Asp246 andAsp248 PMMPGM sequence of A baumannii AIIMS 7showed conserved sequence motif in domain 3 from residues327-331 (GEYAGH) which would act as a sugar binding siteA cluster of positively charged conserved residues found indomain 3 (Lys287) and domain 4 (Arg427 Arg438) couldbe involved in phosphate binding The cleft showed solvent

8 The Scientific World Journal

----------mavtaqAarrrerVlclfDvdGtL---------------------tpaRQ----mEegPlplltirtapYhdqkpgtsglRkKt-yyfedkpcylenFiqsiffsidlKd-------------mnIkhkFPlNIFRAYDIRGKL-TnLTptiiRsIavA----LAAQYtE-------------mnVrhsFPkSIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-----------mstakAptlPaSIFRAYDIRGvvGdtLTAETAywIGrA----igSEsla---------mnspasVApnlPeTIFRAYDIRGvvGdtLnAETAywIGrA----igSEsla--------mndmahlVpaalPdSIFRAYDIRGvvGktLhAETAywIGrA----igAQsla

kidPEva--------------aflQkLr----SrvqI---GvVggsdyckIAeqLGdGDerqgssLVvGgDGRyfnkSaietIlQmaaanGigrlvIgqnGilsTPavscIiRkIkaigGagQkQiVIGYDaRLtSPtyAniIqQifehqGleVinI---GCcsTPMMYYIARdya-GNGvkQtQLVIGYDaRLtSPAyAylIeeiLiEqGlNVTnI---GCcssPMMYYIARdfG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGrgEPcvavGrDGRLSgPeLvkqliQgLvDcGCqVSDv---GmVPTPVLYYaAnvLegkSGqnEPnvsvGrDGRLSgPeLvqqliQgLhDsGCHVSDv---GlVPTPaLYYaAnvLagktGqgEPQvsvGrDGRLSgPmLveqlikgLvDsGCHVSDv---GlVPTPaLYYaAnvLagkSG

Viekfdyvfaen----GtvqykhGrlLSkqtIQnh-------LgEellq--d--------iilTASHNPggpNgdfGiKFnIsnggpaPEAItdkifqisktieEyAic--PDlkvdlgviMVTASHNPKSdN---GiKWILkGEPpSPEAIQQ--------vglyAegftdqiieiqnliMVTASHNPKSdN---GiKWILkGEPpSPEmIQQ--------vgEeAqtYVPNhsisvleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleVMlTgSHNPpdYN---GFKiVvaGEtLanEqIQa--------LrEriek--nDl--asgvVMlTgSHNPKdYN---GFKiVIaGDtLanEqIQa--------LhErikt--nNl--tsqkVMlTgSHNPsdYN---GFKiVIaGDtLanEqIQa--------Lltrlkt--nDl--tlaq

----li--nFClsY---------------------------mallRLpkkrgtfIefrNGlgkqQF--DlenKfkpftveivdsveayatmlrnifdfnAlkellsgpnrLKIrIDamhGdqlhkiipqYClQY-----------------------qQAllSDIhLskPLKIVLDglhGlTlpQFkAeFCqQY-----------------------qQAIfkDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGgSveQv--DilpRY-----------------------fkqIrDDIamakPmKVVvDCgNGgSitQv--DileRY-----------------------fQqIkNDIvmaRkLKVVvDCgNGgrvekv--DilgRY-----------------------fQqIvgDvKLakkLKVVvDCgNG

mlni-------spiGrs------CtLEeri-----efSeldkkEkireKfvE---DlktevvGpyvKKiLcEeLGapanSavnCvpledFggHHPDP-nltyaaDLvetmKsgehDfGaASAGrCAKsvL-EkLGCdVIALr-CEanGhFPdHaPDPSHAehLKqLqqaIisenADlGIASAGhCsKliL-EkmGCEVIALr-tnpnGeFPdHaPDPSHAAhLisLrkaVvEqqADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIAvAGviApQLi-EALGCsVIpLy-CEVDGNFPNHHPDPgkpeNLKDLiAKVKaenADlGLAAAGviApQLi-EALGCEVISLf-aEVDGNFPNHHPDPgkleNLQDLiAKVKEtGADlGLAAAGvvApQLi-EALGCEVIpLf-CEVDGNFPNHHPDPgkpeNLEDLiAKVKEtGADIGLA

FaGkG--------------------------LrfSrGgmIsFDV----------------FDGDGDRnmIlgkhGffVnPsdsvaviAaNIfsip-----yFqqtgvRgfarsmptsGallDGDGDRVvlldEqahIIsPDRLLsLFAQmcLQQHPhkEIVFDVKCSRmVadtVEQlnGQlDGDGDRVvlVdEkaqIltaDRLLsLFAQmcLEQHPeqEIVFDVKCSRmVqetVEKlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKFDGDGDRVGVVTntGtIIYPDRLLMLFAKDVvsRNPGADIIFDVKCtRrlialIsgyGGRFDGDGDRVGVVTnaGnVVYPDRLLMLFAlDVLKRNPGADIIFDVKCtRrltplIsehGGRFDGDGDRVGVVTntGsIVYPDRLLMLFAQDVLsRNPGAEIIFDVKCtRrltplIEQhGGR

-------------fpeGwd-----------------------krYclds-----lDqdsfdrvanatkialyetpTGwkFfgnlmdaSk--lsLcGEeSfgtGsdhiRE------kDGLwakM----------iRTGsSFLrSyLSQSnGNAvfgGEya---GHYvFndGRgFGyDDGLYakM----------iRTGsSFLrAyLSQSnGrAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPvM----------WKTGHSlIKkKmketG--AlLAGEMS---GHvFFKE-RWFGFDDGiYPvM----------WKTGHSlIKkEmkkSG--AlLAGEMS---GHiFFKE-RWFGFDDGiYalM----------WKTGHSlIKkKmkQtG--slLAGEMS---GHiFiKE-RWyGFDDGiY

dtihffgneTspggnd-fEiFAd-----Prtv----------------------------AvlawLsILatrKqsv-eDilkdhwhkFgrnffTrydYeeVeaegatkmmKdLeAlmfdrAAlRvmEyLgQsEArclSELlAa----FPEryCTedIYIsthnasPqqVlnni-----EiAAlRvmEyfTQssATtISELFAp----YPErCCTedtYIgtyQsDPkyVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EisAARLLEILsQdQrds-ehvFSa----FPsdisTPEInItVtEdskfaIIEaL-----qrsAARLLEILsQesAna-eDLFet----FPndisTPEInIkVtDvtkfsIIKaL-----EtsAARLLEILsktEqsa-enLFAa----FPndisTPEInIdVtDegkfsIIdaL-----qr

---------------------------------------------GhsVV----------sfvgkqfsandkvytvekadnfeyhdpvdg-sVSKnqGlRLiFaDGsrIIfrlsgtgsAgi-----------------------SHrlaA-RlSKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASd-----------------------Aqwgeg-nIttlDGVRvDypkGwGlV-------RASd-----------------------AqwgdA-KlttIDGVRvDypkGwGlV-------RASd-----------------------AdwgeA-nlttIDGVRvDyanGwGlV-------RAS------------spqdtvQRcrEiF----------------fPEtAhEa---aTirlYIdsyEkDNakinQdpQvmlaplisialkvsqLQErtgrtAptvit-NTgeyFtvRFdADhPdrLveIrQKF---------isMLQDqyPQIAqElaQSNTgeyFtvRFdADNPlrLkeIQQKF---------vDMLQEhyPQIAqElsEANTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElmslNTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElsEANTTPVlVLRFEADteeeLERIktvF---------rNqLkavdssLpvpF--- NTTPVlVLRFEAeteaeLQRIkdvF---------haeLkKvaPdLdlpF---NTTPVlVLRFEADsdaeLQRIkdvF---------rtqLlrvePELqlpF---

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYEAB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

(a)

Figure 4 Continued

The Scientific World Journal 9

05

92

94

92

76

36

39

A baumannii AIIMS 7 AlgC PMMA baumannii AYE PMMA calcoaceticus PMM

A haemolyticus PMM

P aeruginosa PAO1 PMM

P syringae PMMH sapiens PMM

P putida PMMPGM

O cuniculus PGM isoform 1

(b)

Figure 4 (a)-(b)Multiple sequence alignment and phylogenetic relationship of PMMPGM (a) CLUSTALWanalyses of PMMPGMproteinsequences displaying representative color of box which highlights conserved regions that is active site (red) Mg2+ binding site (green) andsubstrate binding site (blue) (b) Bootstrap consensus tree for PMMPGM enzymes constructed by MEGA v50 using the neighbor-joining(NJ) method (based on 1000 replicates) Numbers on the nodes are bootstrap values and the bar represents scale of estimated evolutionarydistance (20 substitutions at any amino acid position per 100 amino acid positions)

943

21

660

440

290

AlgC

M

Figure 5 SDS-PAGE analysis of AlgC (PMMPGM) protein Lane 1whole cell extract of control E coliDH5120572 (lacking algC gene) lane 2whole cell extract of E coli DH5120572 with algC gene showing the AlgCprotein band sim53 kDa lane M standard protein molecular weightmarker (kDa)

accessible surface (SA Richardsrsquo surface) and molecularsurface (MS Connollyrsquos surface) areas as calculated by alphashape method The enzyme showed a total cavity of 36415 Aand spherical central cavity of 187813 Awhere substrate couldbind as shown in Figure 7(b) To compare the 3D struc-tures obtained before and after MD simulations structuralsuperpositionsweremade using PDBeFOLD results ofwhichshowed root mean square deviation (RMSD) of two alignedstructures within the range of 251 A (Figure 7(c)) Metal ionMg2+ interacts with Asp244 Asp246 Asp248 and Ser104

residues (Figure 7(d) Supplementary Table S1) The metalion Mg2+ is required for enzymatic activity of PMMPGMof A baumannii AIIMS 7 (Figure 7(d)) rather than Mn2+andZn2+ Specific interactions betweenmetal ion (Mg2+) andprotein water-mediated H-bonds (so-called water bridges)and hydrophobic (Lennard-Jones) interactions have beenidentified and are listed (Supplementary Table S1)

39 Stability of Phosphomannomutase during Simulation Toverify the simulation stability and to measure structure anddynamics of PMMPGM model of A baumannii AIIMS 7standard structural parameters like RMSD root mean squarefluctuation (RMSF) and radius of gyration (RG) were calcu-lated and represented in Figures 8(a)ndash8(c) During moleculardynamics simulation period of 10 ns the average RMSD valuewas 03 nm as depicted (Figure 8(a)) Steady RMSD resultshowed for the atoms in the four domains of PMMPGMmodel indicated that the catalytic activity is relatively stableduring the simulation The result for radius of gyration (RG)also indicated the stability ofmodel over thewhole simulationperiod (Figure 8(b)) Minor fluctuations in C-alpha atoms(RMSF) of helical and sheet structural elements could beseen whereas loop region showed variability to some extent(Figure 8(c)) Overall these results of RMSD RMSF andRG strongly indicated the stability of system over the entiresimulation period

4 Discussion

Biofilm formation substantially aids to the spectrum ofmultidrug resistance displayed by A baumannii and is oftenattributed as the major cause for antibiotic treatment fail-ure [3 5] The process of bacterial biofilm development isbelieved to be a complex interplay of the biofilm EPS matrixcomponents that is a plethora of proteins and extracellularmacromolecules for example DNAand polysaccharidesThesynthesis of specific exopolysaccharides such as alginate and

10 The Scientific World Journal

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

Figure 6 (a)ndash(h) Visualization of biofilm augmentation by scanning electron microscopy Electron micrographs (a c e g) showing biofilmsformed by algC clones after 24 h at a gradient of magnifications (Bar = 2 120583m 5 120583m 10120583m and 20 120583m absolute magnifications indicated asKx in the very picture) as observed under a scanning electronmicroscope algC clones can be seen clearly producing dense and robust biofilmas suggested by the thickness and integrity of the biofilm matrices compared to the control biofilms by E coli DH5120572 (lacking A baumanniialgC gene) at corresponding comparable magnifications (b d f h)

LPS core has been described in various bacterial systems[25 43 44] in particular P aeruginosa with its contributionin biofilm formation [20 22] However algC gene functionand its expression pattern have not been elucidated in Abaumannii in order to understand the genetic basis of itsassociation with biofilm formation Herein an initial geneticcharacterization of the algC gene and its association withbiofilm formation is reported in the MDR strain AIIMS 7 ofA baumannii which depicts differential expression of algCgene during the biofilm development Besides MD simula-tion was performed on the three-dimensional (3D) struc-ture of the gene product (enzyme PMMPGM) to comparewith that of P aeruginosa followed by its cloning heterol-ogous expression and phylogenetic analysis Finally biofilmaugmentation by algC gene was evaluated quantitatively andconfirmed by SEM

Analysis of the algC gene expression pattern in thetemporal scale (up to 96 hours) reveals that surface-attachedbacteria have significantly higher rate of transcription levelsthan nonadherent or shaking cultures The attachment orldquosurface sensingrdquo could be the trigger for the activation ofalgC promoter as a result of which the algC expression couldbe seen consistently higher (maximum 8159-fold 119875 lt 005)in biofilm formingA baumannii cultures than the planktoniccounterparts (maximum 324-fold) as revealed by real timePCR analysis (Figure 1) This observation is in accordancewith an earlier study in P aeruginosa [45] which shows algC

reporter gene activity in continuous biofilm culture cells to be19-fold increased than planktonic cells Earlier Davies et al[46] have shown that expression of P aeruginosa algC isupregulated after initial attachment of cells to teflon orglass substrata where cells that failed to upregulate alginatebiosynthesis typically detached from the surface As reviewedearlier by Gacesa [47] it is presumed that exopolysaccharidealginate plays a role in consolidation of the biofilm ratherthan in the initial adhesion event and hence higher rate ofalgC transcription was not a prerequisite to surface attach-ment by P aeruginosa indicating alginate biosynthesis notnecessary for its attachment to glass surface In contrast ourdata in support of the relative quantification of algC tran-scription by real-time PCR and biofilm augmentation byalgC as visualized by SEM is indicative of the possibleinvolvement of algC expression in probably both the eventsthat is initial attachment and consolidation of biofilmsformed by A baumannii Furthermore the upregulation ofalgC transcription at the maturation stages (36ndash48 hours)explains that it is strongly associated with maturation ofbiofilms as the correlation of algC expression with biofilmformation during the very stage was significantly higher thanthe initial events (0983 compared to 0902119875 lt 005) Duringplanktonic mode of growth low levels of algC transcriptionwere observed as compared to biofilm formingA baumanniiwhich should be ideally due to lack of surface attachment (lesspromoter activity) and variations in the oxygen tension in

The Scientific World Journal 11

(a) (b)

(c) (d)

Figure 7 (a)ndash(d) Molecular modeling of PMMPGM from A baumanniiAIIMS 7 (a) Four sequential domains of enzyme PMMPGM afterMD simulation (b) central spherical cavity showing solvent accessible surface area (orange) (c) Superimposed structures before MD (cyan)and after MD simulation (magenta) (d) Mg2+ interacting residues of PMMPGM enzyme

shaking and static cultures Regulation of the algC gene couldbe dependent on diverse parameters as seen in P aeruginosawhere it was shown to be in coordination with the algCpromoter activity [23] Besides according to other studiesvariations in oxygen tension [48] nitrogen limitation [49]and ethanol induced membrane perturbation [50] can alsoinfluence the alginate production in P aeruginosa In Abaumannii we demonstrate differential algC transcription tobe dependent upon abiotic (polystyrene) surface attachmentand thus further investigation would be required to portraya comprehensive profile of algC genetic regulation

The 3D structure of PMMPGM bifunctional enzyme asdetermined by homology modeling which is the gene prod-uct of algC from A baumannii strain AIIMS 7 shows 32overall similarity Furthermore high sequence identity of thecatalytic domain was observed with that of experimentallydetermined structure of PMMPGM of P aeruginosa [42]Each of the four domains contained residues essential forcatalysis andor substrate recognition While the catalytic

phosphoserine residue (Ser104) of domain 1 could be useful totransfer phosphoryl group to and from the bisphosphorylatedreaction intermediate domain 2 was found to contain ametal binding loop (Asp244 Asp246 Asp248) that couldcoordinate theMg2+ ion required for the PMMPGM activity(Figure 7(d)) Domain 3 of PMMPGM of A baumannii alsocontains sugar binding loop (Glu327 Ala329 His331) similarto that in PMMPGM of P aeruginosa This sugar bindingloop has key residues which could enable the enzyme torecognize the two different binding orientations of its 1- and6-phospho sugar substrates Domains 3 and 4 provide mostof the residues that create a phosphate binding site (Lys287 ofdomain 3 and Arg427 Arg438 of domain 4) that determinesthe orientation of the incoming phosphor-sugar substratesIn context with previous studies in P aeruginosa PMMPGM[27 51] our investigation predicts that PMMPGMofA bau-mannii requires Mg2+ and activator glucose 16-biphosphatefor its catalytic activity Other physical properties of the pro-tein analyzed in silicowere also found to be similar to those of

12 The Scientific World Journal

0005

01015

02025

03035

04045

038

677

211

5815

4419

3023

1627

0230

8834

7438

6042

4646

3250

1854

0457

9061

7665

6269

4873

3477

2081

0684

9288

7892

6496

50

RMSD

(nm

)

Time (ps)

(a)

22225

23235

24245

25

038

276

411

4615

2819

1022

9226

7430

5634

3838

2042

0245

8449

6653

4857

3061

1264

9468

7672

5876

4080

2284

0487

8691

6895

5099

32

Radi

us o

f gyr

atio

n (n

m)

Time (ps)

(b)

0005

01015

02025

03035

04045

1 19 37 55 73 91 109

127

145

163

181

199

217

235

253

271

289

307

325

343

361

379

397

415

433

451

469

RMSF

(nm

)

Residue number

(c)

Figure 8 (a)ndash(c) Results from 10 ns molecular dynamics simulation performed on PMMPGM model (a) Root mean square deviation(RMSD) (b) radius of gyration (c) root mean square fluctuation (RMSF)

PMMPGM enzyme from P aeruginosa [42] This indicateda similar function of the enzyme that is a bifunctional rolewhich would be responsible for conversion of mannose-6-phosphate to mannose-1-phosphate or glucose-6-phosphateto glucose-1-phosphate as in P aeruginosa [28]

The active site residues predicted in the PMMPGMenzyme 3D structure were determined by multiple sequencealignments and however needs to be validated by experi-mental analysis In context of sugar binding loop PMMPGMofA baumanniimay also have equal specificity for glucose aswell as mannose because mannose and glucose are epimersat C-2 The active site residues of characterized PMMPGMcomplexes are known to change conformation based on theidentity of the bound ligand andor change the type of contactinwhich they participate [28 52]However a direct structuralcharacterization of multiple enzyme-substrate complexeswould likely be necessary for a full understanding of substratespecificity in this enzyme superfamily Nevertheless the MDsimulation results in this research reveal several regions ofthe PMMPGM enzyme to be highly conserved and clearlyimportant for function in all organisms supporting theproposal that all of these enzymes use a commonmechanismThe algC gene of A baumannii AIIMS 7 characterized in thisstudy is an ortholog of algC gene from P aeruginosa ThePMMPGM protein plays a central role in the productionof three P aeruginosa virulence-associated traits alginaterhamnolipids and LPS although the production of thesecompounds is subjected to a completely different genetic andenvironmental regulation [23 45] The PGM activity of theprotein is involved in synthesis of the LPS core of biofilmswhile PMM activity is responsible for alginate biosynthesisBoth of these (PMMPGM) enzymatic functions either singly

or in combination could be attributed for the biofilm forma-tion in A baumannii AIIMS 7 and augmentation of biofilmsin heterologous clones as observed by SEM It is also con-ceivable therefore that the cloned and overexpressed PGMenzyme (of A baumannii AIIMS 7) might have used up themachinery for cellular LPS core biosynthesis in E coli [25]and could be the possible mechanism behind the overallaugmentation of biofilms in the heterologous algC clones(E coli DH5120572 a relatively weak biofilm former than Abaumannii) as evident from the SEM image analysis Never-theless due to the central role of PMMPGM in biosyntheticpathways the enzyme has potential to serve as a novelmarkerfor A baumannii infection or as pharmaceutical targets forinhibition Such inhibitors would be specific and not affectthe essential homolog in human due to lack of conservationin active site sugar and metal binding site

The mechanism of PMMPGM is believed to be closelyparallel to that of related proteins from other pseudomonadsincluding close relatives like P aeruginosa Our observationson the similarity of the protein sequences and 3D modelsindicate that the PMMPGM protein of A baumanniiAIIMS7 could have a similar biological role in biofilms as seen in Paeruginosa Therefore the dual roles of PMMPGM in algi-nate and LPS biosynthesis enhancing the biofilm formationin A baumannii propose the enzyme as an attractive targetfor inhibitor design

5 Conclusion

This study presents an initial genetic characterization ofalgC gene in an MDR strain A baumannii AIIMS 7 which

The Scientific World Journal 13

demonstrates a quantitative differential expression patternin biofilm cells compared to planktonic counterparts cellsover a temporal scale of 96 h Molecular dynamics (MD)simulation studies indicate that the 3D structure of enzyme(PMMPGM) has functions similar to P aeruginosa whichmight result in significant biofilm augmentation in heterol-ogous algC clones as evident from SEM analysis Theseexperimental lines of evidence collectively suggest that thedifferential algC gene transcription in A baumannii stronglycorrelates with the initial attachment (9 h) and maturationstages (36 h) during the biofilm development however maynot be the only attribute contributing to biofilm formationand could be associated with other factors The PMMPGMenzyme can be a potential drug target for biofilm-associatedinfections of A baumannii as revealed by the 3D structuralsimulation studies

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Dr S Gosavi and Mr A Shinde Depart-ment of Physics University of Pune India for providingthe SEM facility Kailas D Sonawane gratefully acknowledgesUniversity Grants Commission New Delhi Government ofIndia for computational facility support under the schemeUGC SAP DRS-I sanctioned to Department of Biochem-istry Shivaji University Kolhapur India Praveen K Sahuacknowledges University of Pune University with Potentialfor Excellence (UPE Phase-1) for providing a senior researchfellowship

References

[1] M-L Joly-Guillou ldquoClinical impact and pathogenicity ofAcine-tobacterrdquo Clinical Microbiology and Infection vol 11 no 11 pp868ndash873 2005

[2] A Y Peleg H Seifert and D L Paterson ldquoAcinetobacterbaumannii emergence of a successful pathogenrdquoClinicalMicro-biology Reviews vol 21 no 3 pp 538ndash582 2008

[3] L C S Antunes P Visca and K J Towner ldquoAcinetobacter bau-mannii evolution of a global pathogenrdquo Pathogens and Diseasevol 71 no 3 pp 292ndash301 2014

[4] A Y Peleg A deBreijMDAdams et al ldquoThe success ofAcine-tobacter species genetic metabolic and virulence attributesrdquoPLoS ONE vol 7 no 10 Article ID e46984 2012

[5] M J McConnell L Actis and J Pachon ldquoAcinetobacter bau-mannii human infections factors contributing to pathogenesisand animal modelsrdquo FEMS Microbiology Reviews vol 37 no 2pp 130ndash155 2013

[6] S J Wilson C J Knipe M J Zieger et al ldquoDirect costs ofmultidrug-resistant Acinetobacter baumannii in the burn unitof a public teaching hospitalrdquo American Journal of InfectionControl vol 32 no 6 pp 342ndash344 2004

[7] M V Villegas and A I Hartstein ldquoAcinetobacter outbreaks1977ndash2000rdquo Infection Control and Hospital Epidemiology vol24 no 4 pp 284ndash295 2003

[8] A P Tomaras C W Dorsey R E Edelmann and L A ActisldquoAttachment to and biofilm formation on abiotic surfaces byAcinetobacter baumannii involvement of a novel chaperone-usher pili assembly systemrdquo Microbiology vol 149 no 12 pp3473ndash3484 2003

[9] P K Sahu P S Iyer A M Oak K R Pardesi and B AChopade ldquoCharacterization of eDNA from the clinical strainAcinetobacter baumanniiAIIMS 7 and its role in biofilm forma-tionrdquoThe Scientific World Journal vol 2012 Article ID 97343610 pages 2012

[10] H-W Lee Y M Koh J Kim et al ldquoCapacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to formbiofilm and adhere to epithelial cell surfacesrdquo Clinical Micro-biology and Infection vol 14 no 1 pp 49ndash54 2008

[11] A de Breij L Dijkshoorn E Lagendijk et al ldquoDo biofilmformation and interactions with human cells explain the clinicalsuccess of Acinetobacter baumanniirdquo PLoS ONE vol 5 no 5Article ID e10732 2010

[12] L C S Antunes F Imperi A Carattoli and P Visca ldquoDeci-phering the multifactorial nature of Acinetobacter baumanniipathogenicityrdquo PLoS ONE vol 6 no 8 Article ID e22674 2011

[13] J A Gaddy and L A Actis ldquoRegulation of Acinetobacter bau-mannii biofilm formationrdquo FutureMicrobiology vol 4 no 3 pp273ndash278 2009

[14] J W Costerton P S Stewart and E P Greenberg ldquoBacterialbiofilms a common cause of persistent infectionsrdquo Science vol284 no 5418 pp 1318ndash1322 1999

[15] M S Favero R P Gaynes T C Horan et al ldquoNational nosoco-mial infections surveillance (NNIS) report data summary fromOctober 1986-April 1996 issuedMay 1996rdquoAmerican Journal ofInfection Control vol 24 no 5 pp 380ndash388 1996

[16] J Chastre and J-L Trouillet ldquoProblem pathogens (Pseu-domonas aerugınosa and Acınetobacter)rdquo Seminars in Respira-tory Infections vol 15 no 4 pp 287ndash298 2000

[17] S Favre-Bonte J C Pache J Robert D Blanc J C Pechere andC van Delden ldquoDetection of Pseudomonas aeruginosa cell-to-cell signals in lung tissue of cystic fibrosis patientsrdquo MicrobialPathogenesis vol 32 no 3 pp 143ndash147 2002

[18] J G Leid C J Willson M E Shirtliff D J Hassett MR Parsek and A K Jeffers ldquoThe exopolysaccharide alginateprotects Pseudomonas aeruginosa biofilm bacteria from IFN-120574-mediated macrophage killingrdquoThe Journal of Immunology vol175 no 11 pp 7512ndash7518 2005

[19] G W Sundin S Shankar S A Chugani B A Chopade AKavanaugh-Black and AM Chakrabarty ldquoNucleoside diphos-phate kinase from Pseudomonas aeruginosa characterization ofthe gene and its role in cellular growth and exopolysaccharidealginate synthesisrdquo Molecular Microbiology vol 20 no 5 pp965ndash979 1996

[20] J R Wiens A I Vasil M J Schurr and M L Vasil ldquoIron-regulated expression of alginate production mucoid pheno-type and biofilm formation by Pseudomonas aeruginosardquoMBiovol 5 no 1 pp e01010ndashe01013 2014

[21] D J Wozniak T J O Wyckoff M Starkey et al ldquoAlginate isnot a significant component of the extracellular polysaccharidematrix of PA14 and PAO1 Pseudomonas aeruginosa biofilmsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 13 pp 7907ndash7912 2003

[22] D ENivens D EOhman JWilliams andM J Franklin ldquoRoleof alginate and its O acetylation in formation of Pseudomonasaeruginosamicrocolonies and biofilmsrdquo Journal of Bacteriologyvol 183 no 3 pp 1047ndash1057 2001

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

6 The Scientific World Journal

0

05

1

15

2

25

3

3 6 9 12 18 24 36 48 72 96

Biofi

lm in

dex

Time (hours)

Figure 2 Pattern of biofilm growth of A baumannii AIIMS 7Graph showing corresponding biofilm indices of biofilms formed onpolystyrene microtitre surface calculated after normalization withcontrol and plotted versus representative time points (three to 96 h)

increase in biofilm indices indicating the consolidation stageof the attached micro-colonies and approaching maturationof biofilm Third maximum production of biofilm matrixcould be seen at 36 to 48 hours marking the maturationstage Lastly as like the plateau phase in the planktonicgrowth curve of A baumannii AIIMS 7 (data not shown)the biofilm growth pattern also exhibited a steady stateand persistent nature after maturation (after 48 hour till96 hours) To find the association of algC gene expressionpattern at transcription level (as revealed from real-time PCRanalysis) with that of biofilm growth correlation coefficientswere determined using the RQ values in biofilm samples andbiofilm indices at corresponding time points High corre-lation was observed at all three major stages of biofilmCorrelation coefficients were 0902 0925 and 0983 (119875 lt005) corresponding to initial attachment consolidation ofthe surface-attached micro-aggregation and maturation ofbiofilm stages Correlation was found to be maximum (0983119875 lt 005) at stageswhere biofilmswerematureThis indicateda strong possibility that transcription of algC could be in closeassociation with biofilm formation especially the maturationstage (36ndash48 hours) and also the initial attachment stage (3ndash9hours)

34 Microscopic Visualization of Biofilm DevelopmentTo visualize the growth pattern of biofilm bright-field microscopy was performed on biofilms growingon polystyrene surface which showed varied biofilmmorphology at gradual time points (Figure 3) with a strongconcurrence with quantitative evaluation of biofilm growthpattern (Figure 2 as described above) At initial attachmentstages planktonic cells were seen scantily aggregated(Figures 3(a) and 3(b)) but gradually the micro-aggregationon the surface increased subsequently making completelyattached micro-colonies at 9 h which could be seen clearly(Figure 3(c)) Further stages of growth (12 18 and 24 h)showed consolidation of micro-colonies leading to stablestructures of biofilm (Figures 3(d)ndash3(f)) At 36ndash48 h fullymature biofilm communities of A baumannii were seenenriched with thick EPS matrices (Figures 3(g) and 3(h))

followed by appearance of robust three-dimensional biofilmstructures which were found persistent till 72 and 96 h(Figures 3(i) and 3(j)) Overall visualization of biofilmgrowth at developing stages was in tandem with the patternsof biofilm growth as well as algC gene expression

35 In Silico Analysis of Protein Reveals Highly ConservedIdentity To compare and evaluate the relatedness of A bau-mannii AIIMS 7 algC encoded PMMPGM in silico analyseswere performed BLASTn results showed 100 similaritywith the predicted PMMPGM sequence in whole genomesequences of A baumannii available in NCBI databaseAlignment results also displayed significant similarity withPMMPGMnucleotide sequences of other genera 472 aminoacid residues could be theoretically translated in one frame(51015840ndash31015840) of the DNA sequence BLASTp showed similar resultsas in BLASTn alignmentThemolecular weight of the proteinwas predicted to be 5294 kDa with isoelectric point (pI)of 567 CLUSTALW alignment with selected bacterial andeukaryotic PMMPGM sequences showed conserved regionsin the protein as shown in Figure 4(a) (active site Mg2+binding site and sugar binding site marked as coloredrectangles) in the protein as shown Figure 4(b) shows thephylogenetic tree indicating relatedness between PMMPGMenzymes from pseudomonads and higher eukaryotes (rabbitand human) PMMPGM sequence from A baumannii hadless than 25 identity with rabbit muscle PGM isoform1 whereas it had a mere 10 identity with human PMM(Figure 4(b))

36 Assessment of Protein To demonstrate the synthesis ofPMMPGM protein whole cell extracts of cloned E coliDH5120572 with resultant recombinant plasmid pGEalgCA7 cellswere used in SDS-PAGE analysis which showed a clearlyoverexpressed protein of sim53 kDa suggesting the PMMPGMprotein in question (Figure 5) Control E coli DH5120572 (withempty vector pGEM-3Zf+ lacking an algC gene) did not showany PMMPGM protein band

37 Biofilm Augmentation by algC after 24 h Electron micro-graphs of biofilm formed by the algC clones (Figure 6)showed significant increase in biofilm formation comparedto controls probably indicative of the overexpression of thePMMPGM protein and the resultant exopolysaccharidesThicker biofilms could be seen in the algC clones havingclear dense matrices (Figures 6(a) 6(c) and 6(e)) with aintracellular cementing material clearly visible (Figures 6(a)and 6(e)) indicative of the biofilm EPS Overall SEM analysisat a gradient of magnifications and concurrent comparisonswith control clones (lacking functional copy of algC) sug-gested substantially that there is significant facilitation of theoverall biofilm formation emphasizing the enrichment of thebiofilm matrices which could be due to the cohesive activityof EPS including alginate and LPS cores The quantitativebiofilm assay concurred with the microscopic analysis withaugmentation of biofilm up to 387-fold in the algC clonescompared to the control cells lacking algC gene (119875 lt 002data not shown)

The Scientific World Journal 7

(a) (b) (c)

(d) (e) (f)

(g) (h) (i)

(j)

Figure 3 (a)ndash(j) Microscopic visualization of A baumannii AIIMS 7 biofilms Representative bright field micrographs depicting staticbiofilms formed on polystyrene microtitre surface at respective time points (3 6 9 12 18 24 36 48 72 96 h) (magnification 100x)

38 Molecular Dynamics Simulation Study of PMMPGMTo predict the functional association between PMMPGMenzyme (encoded by algC gene) resulting in alginateLPScore mediated biofilm formation in A baumannii molec-ular dynamics (MD) simulations up to 10 ns were carriedout on homology model of PMMPGM of A baumanniiAIIMS 7 using GROMACS v404 program The generatedPMMPGMmodel of A baumannii AIIMS 7 contained fourdomains of equal size arranged in ldquoheart shapedrdquo manner(Figure 7(a)) which form a compact structure similar to Paeruginosa [42] The polypeptide chain proceeds through

each domain sequentially (Figure 7(a)) forming heart shapedgeometry Sequence alignments (Supplementary Figure S4)and model building study showed that the active site waslocated at the centre of the two domains (domains 1 and2) in a deep cleft formed by Ser104 Asp244 Asp246 andAsp248 PMMPGM sequence of A baumannii AIIMS 7showed conserved sequence motif in domain 3 from residues327-331 (GEYAGH) which would act as a sugar binding siteA cluster of positively charged conserved residues found indomain 3 (Lys287) and domain 4 (Arg427 Arg438) couldbe involved in phosphate binding The cleft showed solvent

8 The Scientific World Journal

----------mavtaqAarrrerVlclfDvdGtL---------------------tpaRQ----mEegPlplltirtapYhdqkpgtsglRkKt-yyfedkpcylenFiqsiffsidlKd-------------mnIkhkFPlNIFRAYDIRGKL-TnLTptiiRsIavA----LAAQYtE-------------mnVrhsFPkSIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-----------mstakAptlPaSIFRAYDIRGvvGdtLTAETAywIGrA----igSEsla---------mnspasVApnlPeTIFRAYDIRGvvGdtLnAETAywIGrA----igSEsla--------mndmahlVpaalPdSIFRAYDIRGvvGktLhAETAywIGrA----igAQsla

kidPEva--------------aflQkLr----SrvqI---GvVggsdyckIAeqLGdGDerqgssLVvGgDGRyfnkSaietIlQmaaanGigrlvIgqnGilsTPavscIiRkIkaigGagQkQiVIGYDaRLtSPtyAniIqQifehqGleVinI---GCcsTPMMYYIARdya-GNGvkQtQLVIGYDaRLtSPAyAylIeeiLiEqGlNVTnI---GCcssPMMYYIARdfG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGrgEPcvavGrDGRLSgPeLvkqliQgLvDcGCqVSDv---GmVPTPVLYYaAnvLegkSGqnEPnvsvGrDGRLSgPeLvqqliQgLhDsGCHVSDv---GlVPTPaLYYaAnvLagktGqgEPQvsvGrDGRLSgPmLveqlikgLvDsGCHVSDv---GlVPTPaLYYaAnvLagkSG

Viekfdyvfaen----GtvqykhGrlLSkqtIQnh-------LgEellq--d--------iilTASHNPggpNgdfGiKFnIsnggpaPEAItdkifqisktieEyAic--PDlkvdlgviMVTASHNPKSdN---GiKWILkGEPpSPEAIQQ--------vglyAegftdqiieiqnliMVTASHNPKSdN---GiKWILkGEPpSPEmIQQ--------vgEeAqtYVPNhsisvleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleVMlTgSHNPpdYN---GFKiVvaGEtLanEqIQa--------LrEriek--nDl--asgvVMlTgSHNPKdYN---GFKiVIaGDtLanEqIQa--------LhErikt--nNl--tsqkVMlTgSHNPsdYN---GFKiVIaGDtLanEqIQa--------Lltrlkt--nDl--tlaq

----li--nFClsY---------------------------mallRLpkkrgtfIefrNGlgkqQF--DlenKfkpftveivdsveayatmlrnifdfnAlkellsgpnrLKIrIDamhGdqlhkiipqYClQY-----------------------qQAllSDIhLskPLKIVLDglhGlTlpQFkAeFCqQY-----------------------qQAIfkDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGgSveQv--DilpRY-----------------------fkqIrDDIamakPmKVVvDCgNGgSitQv--DileRY-----------------------fQqIkNDIvmaRkLKVVvDCgNGgrvekv--DilgRY-----------------------fQqIvgDvKLakkLKVVvDCgNG

mlni-------spiGrs------CtLEeri-----efSeldkkEkireKfvE---DlktevvGpyvKKiLcEeLGapanSavnCvpledFggHHPDP-nltyaaDLvetmKsgehDfGaASAGrCAKsvL-EkLGCdVIALr-CEanGhFPdHaPDPSHAehLKqLqqaIisenADlGIASAGhCsKliL-EkmGCEVIALr-tnpnGeFPdHaPDPSHAAhLisLrkaVvEqqADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIAvAGviApQLi-EALGCsVIpLy-CEVDGNFPNHHPDPgkpeNLKDLiAKVKaenADlGLAAAGviApQLi-EALGCEVISLf-aEVDGNFPNHHPDPgkleNLQDLiAKVKEtGADlGLAAAGvvApQLi-EALGCEVIpLf-CEVDGNFPNHHPDPgkpeNLEDLiAKVKEtGADIGLA

FaGkG--------------------------LrfSrGgmIsFDV----------------FDGDGDRnmIlgkhGffVnPsdsvaviAaNIfsip-----yFqqtgvRgfarsmptsGallDGDGDRVvlldEqahIIsPDRLLsLFAQmcLQQHPhkEIVFDVKCSRmVadtVEQlnGQlDGDGDRVvlVdEkaqIltaDRLLsLFAQmcLEQHPeqEIVFDVKCSRmVqetVEKlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKFDGDGDRVGVVTntGtIIYPDRLLMLFAKDVvsRNPGADIIFDVKCtRrlialIsgyGGRFDGDGDRVGVVTnaGnVVYPDRLLMLFAlDVLKRNPGADIIFDVKCtRrltplIsehGGRFDGDGDRVGVVTntGsIVYPDRLLMLFAQDVLsRNPGAEIIFDVKCtRrltplIEQhGGR

-------------fpeGwd-----------------------krYclds-----lDqdsfdrvanatkialyetpTGwkFfgnlmdaSk--lsLcGEeSfgtGsdhiRE------kDGLwakM----------iRTGsSFLrSyLSQSnGNAvfgGEya---GHYvFndGRgFGyDDGLYakM----------iRTGsSFLrAyLSQSnGrAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPvM----------WKTGHSlIKkKmketG--AlLAGEMS---GHvFFKE-RWFGFDDGiYPvM----------WKTGHSlIKkEmkkSG--AlLAGEMS---GHiFFKE-RWFGFDDGiYalM----------WKTGHSlIKkKmkQtG--slLAGEMS---GHiFiKE-RWyGFDDGiY

dtihffgneTspggnd-fEiFAd-----Prtv----------------------------AvlawLsILatrKqsv-eDilkdhwhkFgrnffTrydYeeVeaegatkmmKdLeAlmfdrAAlRvmEyLgQsEArclSELlAa----FPEryCTedIYIsthnasPqqVlnni-----EiAAlRvmEyfTQssATtISELFAp----YPErCCTedtYIgtyQsDPkyVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EisAARLLEILsQdQrds-ehvFSa----FPsdisTPEInItVtEdskfaIIEaL-----qrsAARLLEILsQesAna-eDLFet----FPndisTPEInIkVtDvtkfsIIKaL-----EtsAARLLEILsktEqsa-enLFAa----FPndisTPEInIdVtDegkfsIIdaL-----qr

---------------------------------------------GhsVV----------sfvgkqfsandkvytvekadnfeyhdpvdg-sVSKnqGlRLiFaDGsrIIfrlsgtgsAgi-----------------------SHrlaA-RlSKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASd-----------------------Aqwgeg-nIttlDGVRvDypkGwGlV-------RASd-----------------------AqwgdA-KlttIDGVRvDypkGwGlV-------RASd-----------------------AdwgeA-nlttIDGVRvDyanGwGlV-------RAS------------spqdtvQRcrEiF----------------fPEtAhEa---aTirlYIdsyEkDNakinQdpQvmlaplisialkvsqLQErtgrtAptvit-NTgeyFtvRFdADhPdrLveIrQKF---------isMLQDqyPQIAqElaQSNTgeyFtvRFdADNPlrLkeIQQKF---------vDMLQEhyPQIAqElsEANTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElmslNTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElsEANTTPVlVLRFEADteeeLERIktvF---------rNqLkavdssLpvpF--- NTTPVlVLRFEAeteaeLQRIkdvF---------haeLkKvaPdLdlpF---NTTPVlVLRFEADsdaeLQRIkdvF---------rtqLlrvePELqlpF---

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYEAB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

(a)

Figure 4 Continued

The Scientific World Journal 9

05

92

94

92

76

36

39

A baumannii AIIMS 7 AlgC PMMA baumannii AYE PMMA calcoaceticus PMM

A haemolyticus PMM

P aeruginosa PAO1 PMM

P syringae PMMH sapiens PMM

P putida PMMPGM

O cuniculus PGM isoform 1

(b)

Figure 4 (a)-(b)Multiple sequence alignment and phylogenetic relationship of PMMPGM (a) CLUSTALWanalyses of PMMPGMproteinsequences displaying representative color of box which highlights conserved regions that is active site (red) Mg2+ binding site (green) andsubstrate binding site (blue) (b) Bootstrap consensus tree for PMMPGM enzymes constructed by MEGA v50 using the neighbor-joining(NJ) method (based on 1000 replicates) Numbers on the nodes are bootstrap values and the bar represents scale of estimated evolutionarydistance (20 substitutions at any amino acid position per 100 amino acid positions)

943

21

660

440

290

AlgC

M

Figure 5 SDS-PAGE analysis of AlgC (PMMPGM) protein Lane 1whole cell extract of control E coliDH5120572 (lacking algC gene) lane 2whole cell extract of E coli DH5120572 with algC gene showing the AlgCprotein band sim53 kDa lane M standard protein molecular weightmarker (kDa)

accessible surface (SA Richardsrsquo surface) and molecularsurface (MS Connollyrsquos surface) areas as calculated by alphashape method The enzyme showed a total cavity of 36415 Aand spherical central cavity of 187813 Awhere substrate couldbind as shown in Figure 7(b) To compare the 3D struc-tures obtained before and after MD simulations structuralsuperpositionsweremade using PDBeFOLD results ofwhichshowed root mean square deviation (RMSD) of two alignedstructures within the range of 251 A (Figure 7(c)) Metal ionMg2+ interacts with Asp244 Asp246 Asp248 and Ser104

residues (Figure 7(d) Supplementary Table S1) The metalion Mg2+ is required for enzymatic activity of PMMPGMof A baumannii AIIMS 7 (Figure 7(d)) rather than Mn2+andZn2+ Specific interactions betweenmetal ion (Mg2+) andprotein water-mediated H-bonds (so-called water bridges)and hydrophobic (Lennard-Jones) interactions have beenidentified and are listed (Supplementary Table S1)

39 Stability of Phosphomannomutase during Simulation Toverify the simulation stability and to measure structure anddynamics of PMMPGM model of A baumannii AIIMS 7standard structural parameters like RMSD root mean squarefluctuation (RMSF) and radius of gyration (RG) were calcu-lated and represented in Figures 8(a)ndash8(c) During moleculardynamics simulation period of 10 ns the average RMSD valuewas 03 nm as depicted (Figure 8(a)) Steady RMSD resultshowed for the atoms in the four domains of PMMPGMmodel indicated that the catalytic activity is relatively stableduring the simulation The result for radius of gyration (RG)also indicated the stability ofmodel over thewhole simulationperiod (Figure 8(b)) Minor fluctuations in C-alpha atoms(RMSF) of helical and sheet structural elements could beseen whereas loop region showed variability to some extent(Figure 8(c)) Overall these results of RMSD RMSF andRG strongly indicated the stability of system over the entiresimulation period

4 Discussion

Biofilm formation substantially aids to the spectrum ofmultidrug resistance displayed by A baumannii and is oftenattributed as the major cause for antibiotic treatment fail-ure [3 5] The process of bacterial biofilm development isbelieved to be a complex interplay of the biofilm EPS matrixcomponents that is a plethora of proteins and extracellularmacromolecules for example DNAand polysaccharidesThesynthesis of specific exopolysaccharides such as alginate and

10 The Scientific World Journal

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

Figure 6 (a)ndash(h) Visualization of biofilm augmentation by scanning electron microscopy Electron micrographs (a c e g) showing biofilmsformed by algC clones after 24 h at a gradient of magnifications (Bar = 2 120583m 5 120583m 10120583m and 20 120583m absolute magnifications indicated asKx in the very picture) as observed under a scanning electronmicroscope algC clones can be seen clearly producing dense and robust biofilmas suggested by the thickness and integrity of the biofilm matrices compared to the control biofilms by E coli DH5120572 (lacking A baumanniialgC gene) at corresponding comparable magnifications (b d f h)

LPS core has been described in various bacterial systems[25 43 44] in particular P aeruginosa with its contributionin biofilm formation [20 22] However algC gene functionand its expression pattern have not been elucidated in Abaumannii in order to understand the genetic basis of itsassociation with biofilm formation Herein an initial geneticcharacterization of the algC gene and its association withbiofilm formation is reported in the MDR strain AIIMS 7 ofA baumannii which depicts differential expression of algCgene during the biofilm development Besides MD simula-tion was performed on the three-dimensional (3D) struc-ture of the gene product (enzyme PMMPGM) to comparewith that of P aeruginosa followed by its cloning heterol-ogous expression and phylogenetic analysis Finally biofilmaugmentation by algC gene was evaluated quantitatively andconfirmed by SEM

Analysis of the algC gene expression pattern in thetemporal scale (up to 96 hours) reveals that surface-attachedbacteria have significantly higher rate of transcription levelsthan nonadherent or shaking cultures The attachment orldquosurface sensingrdquo could be the trigger for the activation ofalgC promoter as a result of which the algC expression couldbe seen consistently higher (maximum 8159-fold 119875 lt 005)in biofilm formingA baumannii cultures than the planktoniccounterparts (maximum 324-fold) as revealed by real timePCR analysis (Figure 1) This observation is in accordancewith an earlier study in P aeruginosa [45] which shows algC

reporter gene activity in continuous biofilm culture cells to be19-fold increased than planktonic cells Earlier Davies et al[46] have shown that expression of P aeruginosa algC isupregulated after initial attachment of cells to teflon orglass substrata where cells that failed to upregulate alginatebiosynthesis typically detached from the surface As reviewedearlier by Gacesa [47] it is presumed that exopolysaccharidealginate plays a role in consolidation of the biofilm ratherthan in the initial adhesion event and hence higher rate ofalgC transcription was not a prerequisite to surface attach-ment by P aeruginosa indicating alginate biosynthesis notnecessary for its attachment to glass surface In contrast ourdata in support of the relative quantification of algC tran-scription by real-time PCR and biofilm augmentation byalgC as visualized by SEM is indicative of the possibleinvolvement of algC expression in probably both the eventsthat is initial attachment and consolidation of biofilmsformed by A baumannii Furthermore the upregulation ofalgC transcription at the maturation stages (36ndash48 hours)explains that it is strongly associated with maturation ofbiofilms as the correlation of algC expression with biofilmformation during the very stage was significantly higher thanthe initial events (0983 compared to 0902119875 lt 005) Duringplanktonic mode of growth low levels of algC transcriptionwere observed as compared to biofilm formingA baumanniiwhich should be ideally due to lack of surface attachment (lesspromoter activity) and variations in the oxygen tension in

The Scientific World Journal 11

(a) (b)

(c) (d)

Figure 7 (a)ndash(d) Molecular modeling of PMMPGM from A baumanniiAIIMS 7 (a) Four sequential domains of enzyme PMMPGM afterMD simulation (b) central spherical cavity showing solvent accessible surface area (orange) (c) Superimposed structures before MD (cyan)and after MD simulation (magenta) (d) Mg2+ interacting residues of PMMPGM enzyme

shaking and static cultures Regulation of the algC gene couldbe dependent on diverse parameters as seen in P aeruginosawhere it was shown to be in coordination with the algCpromoter activity [23] Besides according to other studiesvariations in oxygen tension [48] nitrogen limitation [49]and ethanol induced membrane perturbation [50] can alsoinfluence the alginate production in P aeruginosa In Abaumannii we demonstrate differential algC transcription tobe dependent upon abiotic (polystyrene) surface attachmentand thus further investigation would be required to portraya comprehensive profile of algC genetic regulation

The 3D structure of PMMPGM bifunctional enzyme asdetermined by homology modeling which is the gene prod-uct of algC from A baumannii strain AIIMS 7 shows 32overall similarity Furthermore high sequence identity of thecatalytic domain was observed with that of experimentallydetermined structure of PMMPGM of P aeruginosa [42]Each of the four domains contained residues essential forcatalysis andor substrate recognition While the catalytic

phosphoserine residue (Ser104) of domain 1 could be useful totransfer phosphoryl group to and from the bisphosphorylatedreaction intermediate domain 2 was found to contain ametal binding loop (Asp244 Asp246 Asp248) that couldcoordinate theMg2+ ion required for the PMMPGM activity(Figure 7(d)) Domain 3 of PMMPGM of A baumannii alsocontains sugar binding loop (Glu327 Ala329 His331) similarto that in PMMPGM of P aeruginosa This sugar bindingloop has key residues which could enable the enzyme torecognize the two different binding orientations of its 1- and6-phospho sugar substrates Domains 3 and 4 provide mostof the residues that create a phosphate binding site (Lys287 ofdomain 3 and Arg427 Arg438 of domain 4) that determinesthe orientation of the incoming phosphor-sugar substratesIn context with previous studies in P aeruginosa PMMPGM[27 51] our investigation predicts that PMMPGMofA bau-mannii requires Mg2+ and activator glucose 16-biphosphatefor its catalytic activity Other physical properties of the pro-tein analyzed in silicowere also found to be similar to those of

12 The Scientific World Journal

0005

01015

02025

03035

04045

038

677

211

5815

4419

3023

1627

0230

8834

7438

6042

4646

3250

1854

0457

9061

7665

6269

4873

3477

2081

0684

9288

7892

6496

50

RMSD

(nm

)

Time (ps)

(a)

22225

23235

24245

25

038

276

411

4615

2819

1022

9226

7430

5634

3838

2042

0245

8449

6653

4857

3061

1264

9468

7672

5876

4080

2284

0487

8691

6895

5099

32

Radi

us o

f gyr

atio

n (n

m)

Time (ps)

(b)

0005

01015

02025

03035

04045

1 19 37 55 73 91 109

127

145

163

181

199

217

235

253

271

289

307

325

343

361

379

397

415

433

451

469

RMSF

(nm

)

Residue number

(c)

Figure 8 (a)ndash(c) Results from 10 ns molecular dynamics simulation performed on PMMPGM model (a) Root mean square deviation(RMSD) (b) radius of gyration (c) root mean square fluctuation (RMSF)

PMMPGM enzyme from P aeruginosa [42] This indicateda similar function of the enzyme that is a bifunctional rolewhich would be responsible for conversion of mannose-6-phosphate to mannose-1-phosphate or glucose-6-phosphateto glucose-1-phosphate as in P aeruginosa [28]

The active site residues predicted in the PMMPGMenzyme 3D structure were determined by multiple sequencealignments and however needs to be validated by experi-mental analysis In context of sugar binding loop PMMPGMofA baumanniimay also have equal specificity for glucose aswell as mannose because mannose and glucose are epimersat C-2 The active site residues of characterized PMMPGMcomplexes are known to change conformation based on theidentity of the bound ligand andor change the type of contactinwhich they participate [28 52]However a direct structuralcharacterization of multiple enzyme-substrate complexeswould likely be necessary for a full understanding of substratespecificity in this enzyme superfamily Nevertheless the MDsimulation results in this research reveal several regions ofthe PMMPGM enzyme to be highly conserved and clearlyimportant for function in all organisms supporting theproposal that all of these enzymes use a commonmechanismThe algC gene of A baumannii AIIMS 7 characterized in thisstudy is an ortholog of algC gene from P aeruginosa ThePMMPGM protein plays a central role in the productionof three P aeruginosa virulence-associated traits alginaterhamnolipids and LPS although the production of thesecompounds is subjected to a completely different genetic andenvironmental regulation [23 45] The PGM activity of theprotein is involved in synthesis of the LPS core of biofilmswhile PMM activity is responsible for alginate biosynthesisBoth of these (PMMPGM) enzymatic functions either singly

or in combination could be attributed for the biofilm forma-tion in A baumannii AIIMS 7 and augmentation of biofilmsin heterologous clones as observed by SEM It is also con-ceivable therefore that the cloned and overexpressed PGMenzyme (of A baumannii AIIMS 7) might have used up themachinery for cellular LPS core biosynthesis in E coli [25]and could be the possible mechanism behind the overallaugmentation of biofilms in the heterologous algC clones(E coli DH5120572 a relatively weak biofilm former than Abaumannii) as evident from the SEM image analysis Never-theless due to the central role of PMMPGM in biosyntheticpathways the enzyme has potential to serve as a novelmarkerfor A baumannii infection or as pharmaceutical targets forinhibition Such inhibitors would be specific and not affectthe essential homolog in human due to lack of conservationin active site sugar and metal binding site

The mechanism of PMMPGM is believed to be closelyparallel to that of related proteins from other pseudomonadsincluding close relatives like P aeruginosa Our observationson the similarity of the protein sequences and 3D modelsindicate that the PMMPGM protein of A baumanniiAIIMS7 could have a similar biological role in biofilms as seen in Paeruginosa Therefore the dual roles of PMMPGM in algi-nate and LPS biosynthesis enhancing the biofilm formationin A baumannii propose the enzyme as an attractive targetfor inhibitor design

5 Conclusion

This study presents an initial genetic characterization ofalgC gene in an MDR strain A baumannii AIIMS 7 which

The Scientific World Journal 13

demonstrates a quantitative differential expression patternin biofilm cells compared to planktonic counterparts cellsover a temporal scale of 96 h Molecular dynamics (MD)simulation studies indicate that the 3D structure of enzyme(PMMPGM) has functions similar to P aeruginosa whichmight result in significant biofilm augmentation in heterol-ogous algC clones as evident from SEM analysis Theseexperimental lines of evidence collectively suggest that thedifferential algC gene transcription in A baumannii stronglycorrelates with the initial attachment (9 h) and maturationstages (36 h) during the biofilm development however maynot be the only attribute contributing to biofilm formationand could be associated with other factors The PMMPGMenzyme can be a potential drug target for biofilm-associatedinfections of A baumannii as revealed by the 3D structuralsimulation studies

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Dr S Gosavi and Mr A Shinde Depart-ment of Physics University of Pune India for providingthe SEM facility Kailas D Sonawane gratefully acknowledgesUniversity Grants Commission New Delhi Government ofIndia for computational facility support under the schemeUGC SAP DRS-I sanctioned to Department of Biochem-istry Shivaji University Kolhapur India Praveen K Sahuacknowledges University of Pune University with Potentialfor Excellence (UPE Phase-1) for providing a senior researchfellowship

References

[1] M-L Joly-Guillou ldquoClinical impact and pathogenicity ofAcine-tobacterrdquo Clinical Microbiology and Infection vol 11 no 11 pp868ndash873 2005

[2] A Y Peleg H Seifert and D L Paterson ldquoAcinetobacterbaumannii emergence of a successful pathogenrdquoClinicalMicro-biology Reviews vol 21 no 3 pp 538ndash582 2008

[3] L C S Antunes P Visca and K J Towner ldquoAcinetobacter bau-mannii evolution of a global pathogenrdquo Pathogens and Diseasevol 71 no 3 pp 292ndash301 2014

[4] A Y Peleg A deBreijMDAdams et al ldquoThe success ofAcine-tobacter species genetic metabolic and virulence attributesrdquoPLoS ONE vol 7 no 10 Article ID e46984 2012

[5] M J McConnell L Actis and J Pachon ldquoAcinetobacter bau-mannii human infections factors contributing to pathogenesisand animal modelsrdquo FEMS Microbiology Reviews vol 37 no 2pp 130ndash155 2013

[6] S J Wilson C J Knipe M J Zieger et al ldquoDirect costs ofmultidrug-resistant Acinetobacter baumannii in the burn unitof a public teaching hospitalrdquo American Journal of InfectionControl vol 32 no 6 pp 342ndash344 2004

[7] M V Villegas and A I Hartstein ldquoAcinetobacter outbreaks1977ndash2000rdquo Infection Control and Hospital Epidemiology vol24 no 4 pp 284ndash295 2003

[8] A P Tomaras C W Dorsey R E Edelmann and L A ActisldquoAttachment to and biofilm formation on abiotic surfaces byAcinetobacter baumannii involvement of a novel chaperone-usher pili assembly systemrdquo Microbiology vol 149 no 12 pp3473ndash3484 2003

[9] P K Sahu P S Iyer A M Oak K R Pardesi and B AChopade ldquoCharacterization of eDNA from the clinical strainAcinetobacter baumanniiAIIMS 7 and its role in biofilm forma-tionrdquoThe Scientific World Journal vol 2012 Article ID 97343610 pages 2012

[10] H-W Lee Y M Koh J Kim et al ldquoCapacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to formbiofilm and adhere to epithelial cell surfacesrdquo Clinical Micro-biology and Infection vol 14 no 1 pp 49ndash54 2008

[11] A de Breij L Dijkshoorn E Lagendijk et al ldquoDo biofilmformation and interactions with human cells explain the clinicalsuccess of Acinetobacter baumanniirdquo PLoS ONE vol 5 no 5Article ID e10732 2010

[12] L C S Antunes F Imperi A Carattoli and P Visca ldquoDeci-phering the multifactorial nature of Acinetobacter baumanniipathogenicityrdquo PLoS ONE vol 6 no 8 Article ID e22674 2011

[13] J A Gaddy and L A Actis ldquoRegulation of Acinetobacter bau-mannii biofilm formationrdquo FutureMicrobiology vol 4 no 3 pp273ndash278 2009

[14] J W Costerton P S Stewart and E P Greenberg ldquoBacterialbiofilms a common cause of persistent infectionsrdquo Science vol284 no 5418 pp 1318ndash1322 1999

[15] M S Favero R P Gaynes T C Horan et al ldquoNational nosoco-mial infections surveillance (NNIS) report data summary fromOctober 1986-April 1996 issuedMay 1996rdquoAmerican Journal ofInfection Control vol 24 no 5 pp 380ndash388 1996

[16] J Chastre and J-L Trouillet ldquoProblem pathogens (Pseu-domonas aerugınosa and Acınetobacter)rdquo Seminars in Respira-tory Infections vol 15 no 4 pp 287ndash298 2000

[17] S Favre-Bonte J C Pache J Robert D Blanc J C Pechere andC van Delden ldquoDetection of Pseudomonas aeruginosa cell-to-cell signals in lung tissue of cystic fibrosis patientsrdquo MicrobialPathogenesis vol 32 no 3 pp 143ndash147 2002

[18] J G Leid C J Willson M E Shirtliff D J Hassett MR Parsek and A K Jeffers ldquoThe exopolysaccharide alginateprotects Pseudomonas aeruginosa biofilm bacteria from IFN-120574-mediated macrophage killingrdquoThe Journal of Immunology vol175 no 11 pp 7512ndash7518 2005

[19] G W Sundin S Shankar S A Chugani B A Chopade AKavanaugh-Black and AM Chakrabarty ldquoNucleoside diphos-phate kinase from Pseudomonas aeruginosa characterization ofthe gene and its role in cellular growth and exopolysaccharidealginate synthesisrdquo Molecular Microbiology vol 20 no 5 pp965ndash979 1996

[20] J R Wiens A I Vasil M J Schurr and M L Vasil ldquoIron-regulated expression of alginate production mucoid pheno-type and biofilm formation by Pseudomonas aeruginosardquoMBiovol 5 no 1 pp e01010ndashe01013 2014

[21] D J Wozniak T J O Wyckoff M Starkey et al ldquoAlginate isnot a significant component of the extracellular polysaccharidematrix of PA14 and PAO1 Pseudomonas aeruginosa biofilmsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 13 pp 7907ndash7912 2003

[22] D ENivens D EOhman JWilliams andM J Franklin ldquoRoleof alginate and its O acetylation in formation of Pseudomonasaeruginosamicrocolonies and biofilmsrdquo Journal of Bacteriologyvol 183 no 3 pp 1047ndash1057 2001

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

The Scientific World Journal 7

(a) (b) (c)

(d) (e) (f)

(g) (h) (i)

(j)

Figure 3 (a)ndash(j) Microscopic visualization of A baumannii AIIMS 7 biofilms Representative bright field micrographs depicting staticbiofilms formed on polystyrene microtitre surface at respective time points (3 6 9 12 18 24 36 48 72 96 h) (magnification 100x)

38 Molecular Dynamics Simulation Study of PMMPGMTo predict the functional association between PMMPGMenzyme (encoded by algC gene) resulting in alginateLPScore mediated biofilm formation in A baumannii molec-ular dynamics (MD) simulations up to 10 ns were carriedout on homology model of PMMPGM of A baumanniiAIIMS 7 using GROMACS v404 program The generatedPMMPGMmodel of A baumannii AIIMS 7 contained fourdomains of equal size arranged in ldquoheart shapedrdquo manner(Figure 7(a)) which form a compact structure similar to Paeruginosa [42] The polypeptide chain proceeds through

each domain sequentially (Figure 7(a)) forming heart shapedgeometry Sequence alignments (Supplementary Figure S4)and model building study showed that the active site waslocated at the centre of the two domains (domains 1 and2) in a deep cleft formed by Ser104 Asp244 Asp246 andAsp248 PMMPGM sequence of A baumannii AIIMS 7showed conserved sequence motif in domain 3 from residues327-331 (GEYAGH) which would act as a sugar binding siteA cluster of positively charged conserved residues found indomain 3 (Lys287) and domain 4 (Arg427 Arg438) couldbe involved in phosphate binding The cleft showed solvent

8 The Scientific World Journal

----------mavtaqAarrrerVlclfDvdGtL---------------------tpaRQ----mEegPlplltirtapYhdqkpgtsglRkKt-yyfedkpcylenFiqsiffsidlKd-------------mnIkhkFPlNIFRAYDIRGKL-TnLTptiiRsIavA----LAAQYtE-------------mnVrhsFPkSIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-----------mstakAptlPaSIFRAYDIRGvvGdtLTAETAywIGrA----igSEsla---------mnspasVApnlPeTIFRAYDIRGvvGdtLnAETAywIGrA----igSEsla--------mndmahlVpaalPdSIFRAYDIRGvvGktLhAETAywIGrA----igAQsla

kidPEva--------------aflQkLr----SrvqI---GvVggsdyckIAeqLGdGDerqgssLVvGgDGRyfnkSaietIlQmaaanGigrlvIgqnGilsTPavscIiRkIkaigGagQkQiVIGYDaRLtSPtyAniIqQifehqGleVinI---GCcsTPMMYYIARdya-GNGvkQtQLVIGYDaRLtSPAyAylIeeiLiEqGlNVTnI---GCcssPMMYYIARdfG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGrgEPcvavGrDGRLSgPeLvkqliQgLvDcGCqVSDv---GmVPTPVLYYaAnvLegkSGqnEPnvsvGrDGRLSgPeLvqqliQgLhDsGCHVSDv---GlVPTPaLYYaAnvLagktGqgEPQvsvGrDGRLSgPmLveqlikgLvDsGCHVSDv---GlVPTPaLYYaAnvLagkSG

Viekfdyvfaen----GtvqykhGrlLSkqtIQnh-------LgEellq--d--------iilTASHNPggpNgdfGiKFnIsnggpaPEAItdkifqisktieEyAic--PDlkvdlgviMVTASHNPKSdN---GiKWILkGEPpSPEAIQQ--------vglyAegftdqiieiqnliMVTASHNPKSdN---GiKWILkGEPpSPEmIQQ--------vgEeAqtYVPNhsisvleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleVMlTgSHNPpdYN---GFKiVvaGEtLanEqIQa--------LrEriek--nDl--asgvVMlTgSHNPKdYN---GFKiVIaGDtLanEqIQa--------LhErikt--nNl--tsqkVMlTgSHNPsdYN---GFKiVIaGDtLanEqIQa--------Lltrlkt--nDl--tlaq

----li--nFClsY---------------------------mallRLpkkrgtfIefrNGlgkqQF--DlenKfkpftveivdsveayatmlrnifdfnAlkellsgpnrLKIrIDamhGdqlhkiipqYClQY-----------------------qQAllSDIhLskPLKIVLDglhGlTlpQFkAeFCqQY-----------------------qQAIfkDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGgSveQv--DilpRY-----------------------fkqIrDDIamakPmKVVvDCgNGgSitQv--DileRY-----------------------fQqIkNDIvmaRkLKVVvDCgNGgrvekv--DilgRY-----------------------fQqIvgDvKLakkLKVVvDCgNG

mlni-------spiGrs------CtLEeri-----efSeldkkEkireKfvE---DlktevvGpyvKKiLcEeLGapanSavnCvpledFggHHPDP-nltyaaDLvetmKsgehDfGaASAGrCAKsvL-EkLGCdVIALr-CEanGhFPdHaPDPSHAehLKqLqqaIisenADlGIASAGhCsKliL-EkmGCEVIALr-tnpnGeFPdHaPDPSHAAhLisLrkaVvEqqADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIAvAGviApQLi-EALGCsVIpLy-CEVDGNFPNHHPDPgkpeNLKDLiAKVKaenADlGLAAAGviApQLi-EALGCEVISLf-aEVDGNFPNHHPDPgkleNLQDLiAKVKEtGADlGLAAAGvvApQLi-EALGCEVIpLf-CEVDGNFPNHHPDPgkpeNLEDLiAKVKEtGADIGLA

FaGkG--------------------------LrfSrGgmIsFDV----------------FDGDGDRnmIlgkhGffVnPsdsvaviAaNIfsip-----yFqqtgvRgfarsmptsGallDGDGDRVvlldEqahIIsPDRLLsLFAQmcLQQHPhkEIVFDVKCSRmVadtVEQlnGQlDGDGDRVvlVdEkaqIltaDRLLsLFAQmcLEQHPeqEIVFDVKCSRmVqetVEKlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKFDGDGDRVGVVTntGtIIYPDRLLMLFAKDVvsRNPGADIIFDVKCtRrlialIsgyGGRFDGDGDRVGVVTnaGnVVYPDRLLMLFAlDVLKRNPGADIIFDVKCtRrltplIsehGGRFDGDGDRVGVVTntGsIVYPDRLLMLFAQDVLsRNPGAEIIFDVKCtRrltplIEQhGGR

-------------fpeGwd-----------------------krYclds-----lDqdsfdrvanatkialyetpTGwkFfgnlmdaSk--lsLcGEeSfgtGsdhiRE------kDGLwakM----------iRTGsSFLrSyLSQSnGNAvfgGEya---GHYvFndGRgFGyDDGLYakM----------iRTGsSFLrAyLSQSnGrAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPvM----------WKTGHSlIKkKmketG--AlLAGEMS---GHvFFKE-RWFGFDDGiYPvM----------WKTGHSlIKkEmkkSG--AlLAGEMS---GHiFFKE-RWFGFDDGiYalM----------WKTGHSlIKkKmkQtG--slLAGEMS---GHiFiKE-RWyGFDDGiY

dtihffgneTspggnd-fEiFAd-----Prtv----------------------------AvlawLsILatrKqsv-eDilkdhwhkFgrnffTrydYeeVeaegatkmmKdLeAlmfdrAAlRvmEyLgQsEArclSELlAa----FPEryCTedIYIsthnasPqqVlnni-----EiAAlRvmEyfTQssATtISELFAp----YPErCCTedtYIgtyQsDPkyVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EisAARLLEILsQdQrds-ehvFSa----FPsdisTPEInItVtEdskfaIIEaL-----qrsAARLLEILsQesAna-eDLFet----FPndisTPEInIkVtDvtkfsIIKaL-----EtsAARLLEILsktEqsa-enLFAa----FPndisTPEInIdVtDegkfsIIdaL-----qr

---------------------------------------------GhsVV----------sfvgkqfsandkvytvekadnfeyhdpvdg-sVSKnqGlRLiFaDGsrIIfrlsgtgsAgi-----------------------SHrlaA-RlSKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASd-----------------------Aqwgeg-nIttlDGVRvDypkGwGlV-------RASd-----------------------AqwgdA-KlttIDGVRvDypkGwGlV-------RASd-----------------------AdwgeA-nlttIDGVRvDyanGwGlV-------RAS------------spqdtvQRcrEiF----------------fPEtAhEa---aTirlYIdsyEkDNakinQdpQvmlaplisialkvsqLQErtgrtAptvit-NTgeyFtvRFdADhPdrLveIrQKF---------isMLQDqyPQIAqElaQSNTgeyFtvRFdADNPlrLkeIQQKF---------vDMLQEhyPQIAqElsEANTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElmslNTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElsEANTTPVlVLRFEADteeeLERIktvF---------rNqLkavdssLpvpF--- NTTPVlVLRFEAeteaeLQRIkdvF---------haeLkKvaPdLdlpF---NTTPVlVLRFEADsdaeLQRIkdvF---------rtqLlrvePELqlpF---

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYEAB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

(a)

Figure 4 Continued

The Scientific World Journal 9

05

92

94

92

76

36

39

A baumannii AIIMS 7 AlgC PMMA baumannii AYE PMMA calcoaceticus PMM

A haemolyticus PMM

P aeruginosa PAO1 PMM

P syringae PMMH sapiens PMM

P putida PMMPGM

O cuniculus PGM isoform 1

(b)

Figure 4 (a)-(b)Multiple sequence alignment and phylogenetic relationship of PMMPGM (a) CLUSTALWanalyses of PMMPGMproteinsequences displaying representative color of box which highlights conserved regions that is active site (red) Mg2+ binding site (green) andsubstrate binding site (blue) (b) Bootstrap consensus tree for PMMPGM enzymes constructed by MEGA v50 using the neighbor-joining(NJ) method (based on 1000 replicates) Numbers on the nodes are bootstrap values and the bar represents scale of estimated evolutionarydistance (20 substitutions at any amino acid position per 100 amino acid positions)

943

21

660

440

290

AlgC

M

Figure 5 SDS-PAGE analysis of AlgC (PMMPGM) protein Lane 1whole cell extract of control E coliDH5120572 (lacking algC gene) lane 2whole cell extract of E coli DH5120572 with algC gene showing the AlgCprotein band sim53 kDa lane M standard protein molecular weightmarker (kDa)

accessible surface (SA Richardsrsquo surface) and molecularsurface (MS Connollyrsquos surface) areas as calculated by alphashape method The enzyme showed a total cavity of 36415 Aand spherical central cavity of 187813 Awhere substrate couldbind as shown in Figure 7(b) To compare the 3D struc-tures obtained before and after MD simulations structuralsuperpositionsweremade using PDBeFOLD results ofwhichshowed root mean square deviation (RMSD) of two alignedstructures within the range of 251 A (Figure 7(c)) Metal ionMg2+ interacts with Asp244 Asp246 Asp248 and Ser104

residues (Figure 7(d) Supplementary Table S1) The metalion Mg2+ is required for enzymatic activity of PMMPGMof A baumannii AIIMS 7 (Figure 7(d)) rather than Mn2+andZn2+ Specific interactions betweenmetal ion (Mg2+) andprotein water-mediated H-bonds (so-called water bridges)and hydrophobic (Lennard-Jones) interactions have beenidentified and are listed (Supplementary Table S1)

39 Stability of Phosphomannomutase during Simulation Toverify the simulation stability and to measure structure anddynamics of PMMPGM model of A baumannii AIIMS 7standard structural parameters like RMSD root mean squarefluctuation (RMSF) and radius of gyration (RG) were calcu-lated and represented in Figures 8(a)ndash8(c) During moleculardynamics simulation period of 10 ns the average RMSD valuewas 03 nm as depicted (Figure 8(a)) Steady RMSD resultshowed for the atoms in the four domains of PMMPGMmodel indicated that the catalytic activity is relatively stableduring the simulation The result for radius of gyration (RG)also indicated the stability ofmodel over thewhole simulationperiod (Figure 8(b)) Minor fluctuations in C-alpha atoms(RMSF) of helical and sheet structural elements could beseen whereas loop region showed variability to some extent(Figure 8(c)) Overall these results of RMSD RMSF andRG strongly indicated the stability of system over the entiresimulation period

4 Discussion

Biofilm formation substantially aids to the spectrum ofmultidrug resistance displayed by A baumannii and is oftenattributed as the major cause for antibiotic treatment fail-ure [3 5] The process of bacterial biofilm development isbelieved to be a complex interplay of the biofilm EPS matrixcomponents that is a plethora of proteins and extracellularmacromolecules for example DNAand polysaccharidesThesynthesis of specific exopolysaccharides such as alginate and

10 The Scientific World Journal

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

Figure 6 (a)ndash(h) Visualization of biofilm augmentation by scanning electron microscopy Electron micrographs (a c e g) showing biofilmsformed by algC clones after 24 h at a gradient of magnifications (Bar = 2 120583m 5 120583m 10120583m and 20 120583m absolute magnifications indicated asKx in the very picture) as observed under a scanning electronmicroscope algC clones can be seen clearly producing dense and robust biofilmas suggested by the thickness and integrity of the biofilm matrices compared to the control biofilms by E coli DH5120572 (lacking A baumanniialgC gene) at corresponding comparable magnifications (b d f h)

LPS core has been described in various bacterial systems[25 43 44] in particular P aeruginosa with its contributionin biofilm formation [20 22] However algC gene functionand its expression pattern have not been elucidated in Abaumannii in order to understand the genetic basis of itsassociation with biofilm formation Herein an initial geneticcharacterization of the algC gene and its association withbiofilm formation is reported in the MDR strain AIIMS 7 ofA baumannii which depicts differential expression of algCgene during the biofilm development Besides MD simula-tion was performed on the three-dimensional (3D) struc-ture of the gene product (enzyme PMMPGM) to comparewith that of P aeruginosa followed by its cloning heterol-ogous expression and phylogenetic analysis Finally biofilmaugmentation by algC gene was evaluated quantitatively andconfirmed by SEM

Analysis of the algC gene expression pattern in thetemporal scale (up to 96 hours) reveals that surface-attachedbacteria have significantly higher rate of transcription levelsthan nonadherent or shaking cultures The attachment orldquosurface sensingrdquo could be the trigger for the activation ofalgC promoter as a result of which the algC expression couldbe seen consistently higher (maximum 8159-fold 119875 lt 005)in biofilm formingA baumannii cultures than the planktoniccounterparts (maximum 324-fold) as revealed by real timePCR analysis (Figure 1) This observation is in accordancewith an earlier study in P aeruginosa [45] which shows algC

reporter gene activity in continuous biofilm culture cells to be19-fold increased than planktonic cells Earlier Davies et al[46] have shown that expression of P aeruginosa algC isupregulated after initial attachment of cells to teflon orglass substrata where cells that failed to upregulate alginatebiosynthesis typically detached from the surface As reviewedearlier by Gacesa [47] it is presumed that exopolysaccharidealginate plays a role in consolidation of the biofilm ratherthan in the initial adhesion event and hence higher rate ofalgC transcription was not a prerequisite to surface attach-ment by P aeruginosa indicating alginate biosynthesis notnecessary for its attachment to glass surface In contrast ourdata in support of the relative quantification of algC tran-scription by real-time PCR and biofilm augmentation byalgC as visualized by SEM is indicative of the possibleinvolvement of algC expression in probably both the eventsthat is initial attachment and consolidation of biofilmsformed by A baumannii Furthermore the upregulation ofalgC transcription at the maturation stages (36ndash48 hours)explains that it is strongly associated with maturation ofbiofilms as the correlation of algC expression with biofilmformation during the very stage was significantly higher thanthe initial events (0983 compared to 0902119875 lt 005) Duringplanktonic mode of growth low levels of algC transcriptionwere observed as compared to biofilm formingA baumanniiwhich should be ideally due to lack of surface attachment (lesspromoter activity) and variations in the oxygen tension in

The Scientific World Journal 11

(a) (b)

(c) (d)

Figure 7 (a)ndash(d) Molecular modeling of PMMPGM from A baumanniiAIIMS 7 (a) Four sequential domains of enzyme PMMPGM afterMD simulation (b) central spherical cavity showing solvent accessible surface area (orange) (c) Superimposed structures before MD (cyan)and after MD simulation (magenta) (d) Mg2+ interacting residues of PMMPGM enzyme

shaking and static cultures Regulation of the algC gene couldbe dependent on diverse parameters as seen in P aeruginosawhere it was shown to be in coordination with the algCpromoter activity [23] Besides according to other studiesvariations in oxygen tension [48] nitrogen limitation [49]and ethanol induced membrane perturbation [50] can alsoinfluence the alginate production in P aeruginosa In Abaumannii we demonstrate differential algC transcription tobe dependent upon abiotic (polystyrene) surface attachmentand thus further investigation would be required to portraya comprehensive profile of algC genetic regulation

The 3D structure of PMMPGM bifunctional enzyme asdetermined by homology modeling which is the gene prod-uct of algC from A baumannii strain AIIMS 7 shows 32overall similarity Furthermore high sequence identity of thecatalytic domain was observed with that of experimentallydetermined structure of PMMPGM of P aeruginosa [42]Each of the four domains contained residues essential forcatalysis andor substrate recognition While the catalytic

phosphoserine residue (Ser104) of domain 1 could be useful totransfer phosphoryl group to and from the bisphosphorylatedreaction intermediate domain 2 was found to contain ametal binding loop (Asp244 Asp246 Asp248) that couldcoordinate theMg2+ ion required for the PMMPGM activity(Figure 7(d)) Domain 3 of PMMPGM of A baumannii alsocontains sugar binding loop (Glu327 Ala329 His331) similarto that in PMMPGM of P aeruginosa This sugar bindingloop has key residues which could enable the enzyme torecognize the two different binding orientations of its 1- and6-phospho sugar substrates Domains 3 and 4 provide mostof the residues that create a phosphate binding site (Lys287 ofdomain 3 and Arg427 Arg438 of domain 4) that determinesthe orientation of the incoming phosphor-sugar substratesIn context with previous studies in P aeruginosa PMMPGM[27 51] our investigation predicts that PMMPGMofA bau-mannii requires Mg2+ and activator glucose 16-biphosphatefor its catalytic activity Other physical properties of the pro-tein analyzed in silicowere also found to be similar to those of

12 The Scientific World Journal

0005

01015

02025

03035

04045

038

677

211

5815

4419

3023

1627

0230

8834

7438

6042

4646

3250

1854

0457

9061

7665

6269

4873

3477

2081

0684

9288

7892

6496

50

RMSD

(nm

)

Time (ps)

(a)

22225

23235

24245

25

038

276

411

4615

2819

1022

9226

7430

5634

3838

2042

0245

8449

6653

4857

3061

1264

9468

7672

5876

4080

2284

0487

8691

6895

5099

32

Radi

us o

f gyr

atio

n (n

m)

Time (ps)

(b)

0005

01015

02025

03035

04045

1 19 37 55 73 91 109

127

145

163

181

199

217

235

253

271

289

307

325

343

361

379

397

415

433

451

469

RMSF

(nm

)

Residue number

(c)

Figure 8 (a)ndash(c) Results from 10 ns molecular dynamics simulation performed on PMMPGM model (a) Root mean square deviation(RMSD) (b) radius of gyration (c) root mean square fluctuation (RMSF)

PMMPGM enzyme from P aeruginosa [42] This indicateda similar function of the enzyme that is a bifunctional rolewhich would be responsible for conversion of mannose-6-phosphate to mannose-1-phosphate or glucose-6-phosphateto glucose-1-phosphate as in P aeruginosa [28]

The active site residues predicted in the PMMPGMenzyme 3D structure were determined by multiple sequencealignments and however needs to be validated by experi-mental analysis In context of sugar binding loop PMMPGMofA baumanniimay also have equal specificity for glucose aswell as mannose because mannose and glucose are epimersat C-2 The active site residues of characterized PMMPGMcomplexes are known to change conformation based on theidentity of the bound ligand andor change the type of contactinwhich they participate [28 52]However a direct structuralcharacterization of multiple enzyme-substrate complexeswould likely be necessary for a full understanding of substratespecificity in this enzyme superfamily Nevertheless the MDsimulation results in this research reveal several regions ofthe PMMPGM enzyme to be highly conserved and clearlyimportant for function in all organisms supporting theproposal that all of these enzymes use a commonmechanismThe algC gene of A baumannii AIIMS 7 characterized in thisstudy is an ortholog of algC gene from P aeruginosa ThePMMPGM protein plays a central role in the productionof three P aeruginosa virulence-associated traits alginaterhamnolipids and LPS although the production of thesecompounds is subjected to a completely different genetic andenvironmental regulation [23 45] The PGM activity of theprotein is involved in synthesis of the LPS core of biofilmswhile PMM activity is responsible for alginate biosynthesisBoth of these (PMMPGM) enzymatic functions either singly

or in combination could be attributed for the biofilm forma-tion in A baumannii AIIMS 7 and augmentation of biofilmsin heterologous clones as observed by SEM It is also con-ceivable therefore that the cloned and overexpressed PGMenzyme (of A baumannii AIIMS 7) might have used up themachinery for cellular LPS core biosynthesis in E coli [25]and could be the possible mechanism behind the overallaugmentation of biofilms in the heterologous algC clones(E coli DH5120572 a relatively weak biofilm former than Abaumannii) as evident from the SEM image analysis Never-theless due to the central role of PMMPGM in biosyntheticpathways the enzyme has potential to serve as a novelmarkerfor A baumannii infection or as pharmaceutical targets forinhibition Such inhibitors would be specific and not affectthe essential homolog in human due to lack of conservationin active site sugar and metal binding site

The mechanism of PMMPGM is believed to be closelyparallel to that of related proteins from other pseudomonadsincluding close relatives like P aeruginosa Our observationson the similarity of the protein sequences and 3D modelsindicate that the PMMPGM protein of A baumanniiAIIMS7 could have a similar biological role in biofilms as seen in Paeruginosa Therefore the dual roles of PMMPGM in algi-nate and LPS biosynthesis enhancing the biofilm formationin A baumannii propose the enzyme as an attractive targetfor inhibitor design

5 Conclusion

This study presents an initial genetic characterization ofalgC gene in an MDR strain A baumannii AIIMS 7 which

The Scientific World Journal 13

demonstrates a quantitative differential expression patternin biofilm cells compared to planktonic counterparts cellsover a temporal scale of 96 h Molecular dynamics (MD)simulation studies indicate that the 3D structure of enzyme(PMMPGM) has functions similar to P aeruginosa whichmight result in significant biofilm augmentation in heterol-ogous algC clones as evident from SEM analysis Theseexperimental lines of evidence collectively suggest that thedifferential algC gene transcription in A baumannii stronglycorrelates with the initial attachment (9 h) and maturationstages (36 h) during the biofilm development however maynot be the only attribute contributing to biofilm formationand could be associated with other factors The PMMPGMenzyme can be a potential drug target for biofilm-associatedinfections of A baumannii as revealed by the 3D structuralsimulation studies

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Dr S Gosavi and Mr A Shinde Depart-ment of Physics University of Pune India for providingthe SEM facility Kailas D Sonawane gratefully acknowledgesUniversity Grants Commission New Delhi Government ofIndia for computational facility support under the schemeUGC SAP DRS-I sanctioned to Department of Biochem-istry Shivaji University Kolhapur India Praveen K Sahuacknowledges University of Pune University with Potentialfor Excellence (UPE Phase-1) for providing a senior researchfellowship

References

[1] M-L Joly-Guillou ldquoClinical impact and pathogenicity ofAcine-tobacterrdquo Clinical Microbiology and Infection vol 11 no 11 pp868ndash873 2005

[2] A Y Peleg H Seifert and D L Paterson ldquoAcinetobacterbaumannii emergence of a successful pathogenrdquoClinicalMicro-biology Reviews vol 21 no 3 pp 538ndash582 2008

[3] L C S Antunes P Visca and K J Towner ldquoAcinetobacter bau-mannii evolution of a global pathogenrdquo Pathogens and Diseasevol 71 no 3 pp 292ndash301 2014

[4] A Y Peleg A deBreijMDAdams et al ldquoThe success ofAcine-tobacter species genetic metabolic and virulence attributesrdquoPLoS ONE vol 7 no 10 Article ID e46984 2012

[5] M J McConnell L Actis and J Pachon ldquoAcinetobacter bau-mannii human infections factors contributing to pathogenesisand animal modelsrdquo FEMS Microbiology Reviews vol 37 no 2pp 130ndash155 2013

[6] S J Wilson C J Knipe M J Zieger et al ldquoDirect costs ofmultidrug-resistant Acinetobacter baumannii in the burn unitof a public teaching hospitalrdquo American Journal of InfectionControl vol 32 no 6 pp 342ndash344 2004

[7] M V Villegas and A I Hartstein ldquoAcinetobacter outbreaks1977ndash2000rdquo Infection Control and Hospital Epidemiology vol24 no 4 pp 284ndash295 2003

[8] A P Tomaras C W Dorsey R E Edelmann and L A ActisldquoAttachment to and biofilm formation on abiotic surfaces byAcinetobacter baumannii involvement of a novel chaperone-usher pili assembly systemrdquo Microbiology vol 149 no 12 pp3473ndash3484 2003

[9] P K Sahu P S Iyer A M Oak K R Pardesi and B AChopade ldquoCharacterization of eDNA from the clinical strainAcinetobacter baumanniiAIIMS 7 and its role in biofilm forma-tionrdquoThe Scientific World Journal vol 2012 Article ID 97343610 pages 2012

[10] H-W Lee Y M Koh J Kim et al ldquoCapacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to formbiofilm and adhere to epithelial cell surfacesrdquo Clinical Micro-biology and Infection vol 14 no 1 pp 49ndash54 2008

[11] A de Breij L Dijkshoorn E Lagendijk et al ldquoDo biofilmformation and interactions with human cells explain the clinicalsuccess of Acinetobacter baumanniirdquo PLoS ONE vol 5 no 5Article ID e10732 2010

[12] L C S Antunes F Imperi A Carattoli and P Visca ldquoDeci-phering the multifactorial nature of Acinetobacter baumanniipathogenicityrdquo PLoS ONE vol 6 no 8 Article ID e22674 2011

[13] J A Gaddy and L A Actis ldquoRegulation of Acinetobacter bau-mannii biofilm formationrdquo FutureMicrobiology vol 4 no 3 pp273ndash278 2009

[14] J W Costerton P S Stewart and E P Greenberg ldquoBacterialbiofilms a common cause of persistent infectionsrdquo Science vol284 no 5418 pp 1318ndash1322 1999

[15] M S Favero R P Gaynes T C Horan et al ldquoNational nosoco-mial infections surveillance (NNIS) report data summary fromOctober 1986-April 1996 issuedMay 1996rdquoAmerican Journal ofInfection Control vol 24 no 5 pp 380ndash388 1996

[16] J Chastre and J-L Trouillet ldquoProblem pathogens (Pseu-domonas aerugınosa and Acınetobacter)rdquo Seminars in Respira-tory Infections vol 15 no 4 pp 287ndash298 2000

[17] S Favre-Bonte J C Pache J Robert D Blanc J C Pechere andC van Delden ldquoDetection of Pseudomonas aeruginosa cell-to-cell signals in lung tissue of cystic fibrosis patientsrdquo MicrobialPathogenesis vol 32 no 3 pp 143ndash147 2002

[18] J G Leid C J Willson M E Shirtliff D J Hassett MR Parsek and A K Jeffers ldquoThe exopolysaccharide alginateprotects Pseudomonas aeruginosa biofilm bacteria from IFN-120574-mediated macrophage killingrdquoThe Journal of Immunology vol175 no 11 pp 7512ndash7518 2005

[19] G W Sundin S Shankar S A Chugani B A Chopade AKavanaugh-Black and AM Chakrabarty ldquoNucleoside diphos-phate kinase from Pseudomonas aeruginosa characterization ofthe gene and its role in cellular growth and exopolysaccharidealginate synthesisrdquo Molecular Microbiology vol 20 no 5 pp965ndash979 1996

[20] J R Wiens A I Vasil M J Schurr and M L Vasil ldquoIron-regulated expression of alginate production mucoid pheno-type and biofilm formation by Pseudomonas aeruginosardquoMBiovol 5 no 1 pp e01010ndashe01013 2014

[21] D J Wozniak T J O Wyckoff M Starkey et al ldquoAlginate isnot a significant component of the extracellular polysaccharidematrix of PA14 and PAO1 Pseudomonas aeruginosa biofilmsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 13 pp 7907ndash7912 2003

[22] D ENivens D EOhman JWilliams andM J Franklin ldquoRoleof alginate and its O acetylation in formation of Pseudomonasaeruginosamicrocolonies and biofilmsrdquo Journal of Bacteriologyvol 183 no 3 pp 1047ndash1057 2001

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

8 The Scientific World Journal

----------mavtaqAarrrerVlclfDvdGtL---------------------tpaRQ----mEegPlplltirtapYhdqkpgtsglRkKt-yyfedkpcylenFiqsiffsidlKd-------------mnIkhkFPlNIFRAYDIRGKL-TnLTptiiRsIavA----LAAQYtE-------------mnVrhsFPkSIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-------------mnVrhsFPkNIFRAYDIRGKL-SyLTtDvvRsIaYg----LAqQYKQ-----------mstakAptlPaSIFRAYDIRGvvGdtLTAETAywIGrA----igSEsla---------mnspasVApnlPeTIFRAYDIRGvvGdtLnAETAywIGrA----igSEsla--------mndmahlVpaalPdSIFRAYDIRGvvGktLhAETAywIGrA----igAQsla

kidPEva--------------aflQkLr----SrvqI---GvVggsdyckIAeqLGdGDerqgssLVvGgDGRyfnkSaietIlQmaaanGigrlvIgqnGilsTPavscIiRkIkaigGagQkQiVIGYDaRLtSPtyAniIqQifehqGleVinI---GCcsTPMMYYIARdya-GNGvkQtQLVIGYDaRLtSPAyAylIeeiLiEqGlNVTnI---GCcssPMMYYIARdfG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGaeQtQLIIGYDaRLtSPAyAhlIeeiLvEqGlNVTnI---GCcsTPMMYYIARefG-GNGrgEPcvavGrDGRLSgPeLvkqliQgLvDcGCqVSDv---GmVPTPVLYYaAnvLegkSGqnEPnvsvGrDGRLSgPeLvqqliQgLhDsGCHVSDv---GlVPTPaLYYaAnvLagktGqgEPQvsvGrDGRLSgPmLveqlikgLvDsGCHVSDv---GlVPTPaLYYaAnvLagkSG

Viekfdyvfaen----GtvqykhGrlLSkqtIQnh-------LgEellq--d--------iilTASHNPggpNgdfGiKFnIsnggpaPEAItdkifqisktieEyAic--PDlkvdlgviMVTASHNPKSdN---GiKWILkGEPpSPEAIQQ--------vglyAegftdqiieiqnliMVTASHNPKSdN---GiKWILkGEPpSPEmIQQ--------vgEeAqtYVPNhsisvleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleiMVTASHNPKSdN---GiKWILrGEPpSPEmIQQ--------vgEfAqtYVPthtislleVMlTgSHNPpdYN---GFKiVvaGEtLanEqIQa--------LrEriek--nDl--asgvVMlTgSHNPKdYN---GFKiVIaGDtLanEqIQa--------LhErikt--nNl--tsqkVMlTgSHNPsdYN---GFKiVIaGDtLanEqIQa--------Lltrlkt--nDl--tlaq

----li--nFClsY---------------------------mallRLpkkrgtfIefrNGlgkqQF--DlenKfkpftveivdsveayatmlrnifdfnAlkellsgpnrLKIrIDamhGdqlhkiipqYClQY-----------------------qQAllSDIhLskPLKIVLDglhGlTlpQFkAeFCqQY-----------------------qQAIfkDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGlStpQFnSeFCkKY-----------------------qQAIfNDIQLkRPLKVVLDglhGgSveQv--DilpRY-----------------------fkqIrDDIamakPmKVVvDCgNGgSitQv--DileRY-----------------------fQqIkNDIvmaRkLKVVvDCgNGgrvekv--DilgRY-----------------------fQqIvgDvKLakkLKVVvDCgNG

mlni-------spiGrs------CtLEeri-----efSeldkkEkireKfvE---DlktevvGpyvKKiLcEeLGapanSavnCvpledFggHHPDP-nltyaaDLvetmKsgehDfGaASAGrCAKsvL-EkLGCdVIALr-CEanGhFPdHaPDPSHAehLKqLqqaIisenADlGIASAGhCsKliL-EkmGCEVIALr-tnpnGeFPdHaPDPSHAAhLisLrkaVvEqqADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIASAGhCsKlvL-EkmGCEVIALr-ttpnGeFPdHaPDPSHAAhLKeLrktIiEqGADIGIAvAGviApQLi-EALGCsVIpLy-CEVDGNFPNHHPDPgkpeNLKDLiAKVKaenADlGLAAAGviApQLi-EALGCEVISLf-aEVDGNFPNHHPDPgkleNLQDLiAKVKEtGADlGLAAAGvvApQLi-EALGCEVIpLf-CEVDGNFPNHHPDPgkpeNLEDLiAKVKEtGADIGLA

FaGkG--------------------------LrfSrGgmIsFDV----------------FDGDGDRnmIlgkhGffVnPsdsvaviAaNIfsip-----yFqqtgvRgfarsmptsGallDGDGDRVvlldEqahIIsPDRLLsLFAQmcLQQHPhkEIVFDVKCSRmVadtVEQlnGQlDGDGDRVvlVdEkaqIltaDRLLsLFAQmcLEQHPeqEIVFDVKCSRmVqetVEKlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKlDGDGDRVvlldEkanIltaDRLLsLFAQmcLEQqPdkEIVFDVKCSlmVqrtVERlGGKFDGDGDRVGVVTntGtIIYPDRLLMLFAKDVvsRNPGADIIFDVKCtRrlialIsgyGGRFDGDGDRVGVVTnaGnVVYPDRLLMLFAlDVLKRNPGADIIFDVKCtRrltplIsehGGRFDGDGDRVGVVTntGsIVYPDRLLMLFAQDVLsRNPGAEIIFDVKCtRrltplIEQhGGR

-------------fpeGwd-----------------------krYclds-----lDqdsfdrvanatkialyetpTGwkFfgnlmdaSk--lsLcGEeSfgtGsdhiRE------kDGLwakM----------iRTGsSFLrSyLSQSnGNAvfgGEya---GHYvFndGRgFGyDDGLYakM----------iRTGsSFLrAyLSQSnGrAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPkM----------iRTGsSFLrAyLSQSnGNAifgGEya---GHYvFndGRgFGyDDGLYPvM----------WKTGHSlIKkKmketG--AlLAGEMS---GHvFFKE-RWFGFDDGiYPvM----------WKTGHSlIKkEmkkSG--AlLAGEMS---GHiFFKE-RWFGFDDGiYalM----------WKTGHSlIKkKmkQtG--slLAGEMS---GHiFiKE-RWyGFDDGiY

dtihffgneTspggnd-fEiFAd-----Prtv----------------------------AvlawLsILatrKqsv-eDilkdhwhkFgrnffTrydYeeVeaegatkmmKdLeAlmfdrAAlRvmEyLgQsEArclSELlAa----FPEryCTedIYIsthnasPqqVlnni-----EiAAlRvmEyfTQssATtISELFAp----YPErCCTedtYIgtyQsDPkyVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EiAAlRvmEyfTEssATtISDLFSn----YPErCCTedtYIgthQsDPkhVlQdi-----EisAARLLEILsQdQrds-ehvFSa----FPsdisTPEInItVtEdskfaIIEaL-----qrsAARLLEILsQesAna-eDLFet----FPndisTPEInIkVtDvtkfsIIKaL-----EtsAARLLEILsktEqsa-enLFAa----FPndisTPEInIdVtDegkfsIIdaL-----qr

---------------------------------------------GhsVV----------sfvgkqfsandkvytvekadnfeyhdpvdg-sVSKnqGlRLiFaDGsrIIfrlsgtgsAgi-----------------------SHrlaA-RlSKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASl-----------------------SHrlGA-RISKIDGVRLDFDDGFGII-------RASd-----------------------Aqwgeg-nIttlDGVRvDypkGwGlV-------RASd-----------------------AqwgdA-KlttIDGVRvDypkGwGlV-------RASd-----------------------AdwgeA-nlttIDGVRvDyanGwGlV-------RAS------------spqdtvQRcrEiF----------------fPEtAhEa---aTirlYIdsyEkDNakinQdpQvmlaplisialkvsqLQErtgrtAptvit-NTgeyFtvRFdADhPdrLveIrQKF---------isMLQDqyPQIAqElaQSNTgeyFtvRFdADNPlrLkeIQQKF---------vDMLQEhyPQIAqElsEANTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElmslNTgeyFtvRFdADNPlrLkeIQQKF---------iDMLQEryPQIAqElsEANTTPVlVLRFEADteeeLERIktvF---------rNqLkavdssLpvpF--- NTTPVlVLRFEAeteaeLQRIkdvF---------haeLkKvaPdLdlpF---NTTPVlVLRFEADsdaeLQRIkdvF---------rtqLlrvePELqlpF---

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

H sapiens

O cuniculus

A haemolyticus

A calcoaceticus

P aeruginosa

P syringae

P putida

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYE

AB AYEAB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

AB AIIMS 7

(a)

Figure 4 Continued

The Scientific World Journal 9

05

92

94

92

76

36

39

A baumannii AIIMS 7 AlgC PMMA baumannii AYE PMMA calcoaceticus PMM

A haemolyticus PMM

P aeruginosa PAO1 PMM

P syringae PMMH sapiens PMM

P putida PMMPGM

O cuniculus PGM isoform 1

(b)

Figure 4 (a)-(b)Multiple sequence alignment and phylogenetic relationship of PMMPGM (a) CLUSTALWanalyses of PMMPGMproteinsequences displaying representative color of box which highlights conserved regions that is active site (red) Mg2+ binding site (green) andsubstrate binding site (blue) (b) Bootstrap consensus tree for PMMPGM enzymes constructed by MEGA v50 using the neighbor-joining(NJ) method (based on 1000 replicates) Numbers on the nodes are bootstrap values and the bar represents scale of estimated evolutionarydistance (20 substitutions at any amino acid position per 100 amino acid positions)

943

21

660

440

290

AlgC

M

Figure 5 SDS-PAGE analysis of AlgC (PMMPGM) protein Lane 1whole cell extract of control E coliDH5120572 (lacking algC gene) lane 2whole cell extract of E coli DH5120572 with algC gene showing the AlgCprotein band sim53 kDa lane M standard protein molecular weightmarker (kDa)

accessible surface (SA Richardsrsquo surface) and molecularsurface (MS Connollyrsquos surface) areas as calculated by alphashape method The enzyme showed a total cavity of 36415 Aand spherical central cavity of 187813 Awhere substrate couldbind as shown in Figure 7(b) To compare the 3D struc-tures obtained before and after MD simulations structuralsuperpositionsweremade using PDBeFOLD results ofwhichshowed root mean square deviation (RMSD) of two alignedstructures within the range of 251 A (Figure 7(c)) Metal ionMg2+ interacts with Asp244 Asp246 Asp248 and Ser104

residues (Figure 7(d) Supplementary Table S1) The metalion Mg2+ is required for enzymatic activity of PMMPGMof A baumannii AIIMS 7 (Figure 7(d)) rather than Mn2+andZn2+ Specific interactions betweenmetal ion (Mg2+) andprotein water-mediated H-bonds (so-called water bridges)and hydrophobic (Lennard-Jones) interactions have beenidentified and are listed (Supplementary Table S1)

39 Stability of Phosphomannomutase during Simulation Toverify the simulation stability and to measure structure anddynamics of PMMPGM model of A baumannii AIIMS 7standard structural parameters like RMSD root mean squarefluctuation (RMSF) and radius of gyration (RG) were calcu-lated and represented in Figures 8(a)ndash8(c) During moleculardynamics simulation period of 10 ns the average RMSD valuewas 03 nm as depicted (Figure 8(a)) Steady RMSD resultshowed for the atoms in the four domains of PMMPGMmodel indicated that the catalytic activity is relatively stableduring the simulation The result for radius of gyration (RG)also indicated the stability ofmodel over thewhole simulationperiod (Figure 8(b)) Minor fluctuations in C-alpha atoms(RMSF) of helical and sheet structural elements could beseen whereas loop region showed variability to some extent(Figure 8(c)) Overall these results of RMSD RMSF andRG strongly indicated the stability of system over the entiresimulation period

4 Discussion

Biofilm formation substantially aids to the spectrum ofmultidrug resistance displayed by A baumannii and is oftenattributed as the major cause for antibiotic treatment fail-ure [3 5] The process of bacterial biofilm development isbelieved to be a complex interplay of the biofilm EPS matrixcomponents that is a plethora of proteins and extracellularmacromolecules for example DNAand polysaccharidesThesynthesis of specific exopolysaccharides such as alginate and

10 The Scientific World Journal

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

Figure 6 (a)ndash(h) Visualization of biofilm augmentation by scanning electron microscopy Electron micrographs (a c e g) showing biofilmsformed by algC clones after 24 h at a gradient of magnifications (Bar = 2 120583m 5 120583m 10120583m and 20 120583m absolute magnifications indicated asKx in the very picture) as observed under a scanning electronmicroscope algC clones can be seen clearly producing dense and robust biofilmas suggested by the thickness and integrity of the biofilm matrices compared to the control biofilms by E coli DH5120572 (lacking A baumanniialgC gene) at corresponding comparable magnifications (b d f h)

LPS core has been described in various bacterial systems[25 43 44] in particular P aeruginosa with its contributionin biofilm formation [20 22] However algC gene functionand its expression pattern have not been elucidated in Abaumannii in order to understand the genetic basis of itsassociation with biofilm formation Herein an initial geneticcharacterization of the algC gene and its association withbiofilm formation is reported in the MDR strain AIIMS 7 ofA baumannii which depicts differential expression of algCgene during the biofilm development Besides MD simula-tion was performed on the three-dimensional (3D) struc-ture of the gene product (enzyme PMMPGM) to comparewith that of P aeruginosa followed by its cloning heterol-ogous expression and phylogenetic analysis Finally biofilmaugmentation by algC gene was evaluated quantitatively andconfirmed by SEM

Analysis of the algC gene expression pattern in thetemporal scale (up to 96 hours) reveals that surface-attachedbacteria have significantly higher rate of transcription levelsthan nonadherent or shaking cultures The attachment orldquosurface sensingrdquo could be the trigger for the activation ofalgC promoter as a result of which the algC expression couldbe seen consistently higher (maximum 8159-fold 119875 lt 005)in biofilm formingA baumannii cultures than the planktoniccounterparts (maximum 324-fold) as revealed by real timePCR analysis (Figure 1) This observation is in accordancewith an earlier study in P aeruginosa [45] which shows algC

reporter gene activity in continuous biofilm culture cells to be19-fold increased than planktonic cells Earlier Davies et al[46] have shown that expression of P aeruginosa algC isupregulated after initial attachment of cells to teflon orglass substrata where cells that failed to upregulate alginatebiosynthesis typically detached from the surface As reviewedearlier by Gacesa [47] it is presumed that exopolysaccharidealginate plays a role in consolidation of the biofilm ratherthan in the initial adhesion event and hence higher rate ofalgC transcription was not a prerequisite to surface attach-ment by P aeruginosa indicating alginate biosynthesis notnecessary for its attachment to glass surface In contrast ourdata in support of the relative quantification of algC tran-scription by real-time PCR and biofilm augmentation byalgC as visualized by SEM is indicative of the possibleinvolvement of algC expression in probably both the eventsthat is initial attachment and consolidation of biofilmsformed by A baumannii Furthermore the upregulation ofalgC transcription at the maturation stages (36ndash48 hours)explains that it is strongly associated with maturation ofbiofilms as the correlation of algC expression with biofilmformation during the very stage was significantly higher thanthe initial events (0983 compared to 0902119875 lt 005) Duringplanktonic mode of growth low levels of algC transcriptionwere observed as compared to biofilm formingA baumanniiwhich should be ideally due to lack of surface attachment (lesspromoter activity) and variations in the oxygen tension in

The Scientific World Journal 11

(a) (b)

(c) (d)

Figure 7 (a)ndash(d) Molecular modeling of PMMPGM from A baumanniiAIIMS 7 (a) Four sequential domains of enzyme PMMPGM afterMD simulation (b) central spherical cavity showing solvent accessible surface area (orange) (c) Superimposed structures before MD (cyan)and after MD simulation (magenta) (d) Mg2+ interacting residues of PMMPGM enzyme

shaking and static cultures Regulation of the algC gene couldbe dependent on diverse parameters as seen in P aeruginosawhere it was shown to be in coordination with the algCpromoter activity [23] Besides according to other studiesvariations in oxygen tension [48] nitrogen limitation [49]and ethanol induced membrane perturbation [50] can alsoinfluence the alginate production in P aeruginosa In Abaumannii we demonstrate differential algC transcription tobe dependent upon abiotic (polystyrene) surface attachmentand thus further investigation would be required to portraya comprehensive profile of algC genetic regulation

The 3D structure of PMMPGM bifunctional enzyme asdetermined by homology modeling which is the gene prod-uct of algC from A baumannii strain AIIMS 7 shows 32overall similarity Furthermore high sequence identity of thecatalytic domain was observed with that of experimentallydetermined structure of PMMPGM of P aeruginosa [42]Each of the four domains contained residues essential forcatalysis andor substrate recognition While the catalytic

phosphoserine residue (Ser104) of domain 1 could be useful totransfer phosphoryl group to and from the bisphosphorylatedreaction intermediate domain 2 was found to contain ametal binding loop (Asp244 Asp246 Asp248) that couldcoordinate theMg2+ ion required for the PMMPGM activity(Figure 7(d)) Domain 3 of PMMPGM of A baumannii alsocontains sugar binding loop (Glu327 Ala329 His331) similarto that in PMMPGM of P aeruginosa This sugar bindingloop has key residues which could enable the enzyme torecognize the two different binding orientations of its 1- and6-phospho sugar substrates Domains 3 and 4 provide mostof the residues that create a phosphate binding site (Lys287 ofdomain 3 and Arg427 Arg438 of domain 4) that determinesthe orientation of the incoming phosphor-sugar substratesIn context with previous studies in P aeruginosa PMMPGM[27 51] our investigation predicts that PMMPGMofA bau-mannii requires Mg2+ and activator glucose 16-biphosphatefor its catalytic activity Other physical properties of the pro-tein analyzed in silicowere also found to be similar to those of

12 The Scientific World Journal

0005

01015

02025

03035

04045

038

677

211

5815

4419

3023

1627

0230

8834

7438

6042

4646

3250

1854

0457

9061

7665

6269

4873

3477

2081

0684

9288

7892

6496

50

RMSD

(nm

)

Time (ps)

(a)

22225

23235

24245

25

038

276

411

4615

2819

1022

9226

7430

5634

3838

2042

0245

8449

6653

4857

3061

1264

9468

7672

5876

4080

2284

0487

8691

6895

5099

32

Radi

us o

f gyr

atio

n (n

m)

Time (ps)

(b)

0005

01015

02025

03035

04045

1 19 37 55 73 91 109

127

145

163

181

199

217

235

253

271

289

307

325

343

361

379

397

415

433

451

469

RMSF

(nm

)

Residue number

(c)

Figure 8 (a)ndash(c) Results from 10 ns molecular dynamics simulation performed on PMMPGM model (a) Root mean square deviation(RMSD) (b) radius of gyration (c) root mean square fluctuation (RMSF)

PMMPGM enzyme from P aeruginosa [42] This indicateda similar function of the enzyme that is a bifunctional rolewhich would be responsible for conversion of mannose-6-phosphate to mannose-1-phosphate or glucose-6-phosphateto glucose-1-phosphate as in P aeruginosa [28]

The active site residues predicted in the PMMPGMenzyme 3D structure were determined by multiple sequencealignments and however needs to be validated by experi-mental analysis In context of sugar binding loop PMMPGMofA baumanniimay also have equal specificity for glucose aswell as mannose because mannose and glucose are epimersat C-2 The active site residues of characterized PMMPGMcomplexes are known to change conformation based on theidentity of the bound ligand andor change the type of contactinwhich they participate [28 52]However a direct structuralcharacterization of multiple enzyme-substrate complexeswould likely be necessary for a full understanding of substratespecificity in this enzyme superfamily Nevertheless the MDsimulation results in this research reveal several regions ofthe PMMPGM enzyme to be highly conserved and clearlyimportant for function in all organisms supporting theproposal that all of these enzymes use a commonmechanismThe algC gene of A baumannii AIIMS 7 characterized in thisstudy is an ortholog of algC gene from P aeruginosa ThePMMPGM protein plays a central role in the productionof three P aeruginosa virulence-associated traits alginaterhamnolipids and LPS although the production of thesecompounds is subjected to a completely different genetic andenvironmental regulation [23 45] The PGM activity of theprotein is involved in synthesis of the LPS core of biofilmswhile PMM activity is responsible for alginate biosynthesisBoth of these (PMMPGM) enzymatic functions either singly

or in combination could be attributed for the biofilm forma-tion in A baumannii AIIMS 7 and augmentation of biofilmsin heterologous clones as observed by SEM It is also con-ceivable therefore that the cloned and overexpressed PGMenzyme (of A baumannii AIIMS 7) might have used up themachinery for cellular LPS core biosynthesis in E coli [25]and could be the possible mechanism behind the overallaugmentation of biofilms in the heterologous algC clones(E coli DH5120572 a relatively weak biofilm former than Abaumannii) as evident from the SEM image analysis Never-theless due to the central role of PMMPGM in biosyntheticpathways the enzyme has potential to serve as a novelmarkerfor A baumannii infection or as pharmaceutical targets forinhibition Such inhibitors would be specific and not affectthe essential homolog in human due to lack of conservationin active site sugar and metal binding site

The mechanism of PMMPGM is believed to be closelyparallel to that of related proteins from other pseudomonadsincluding close relatives like P aeruginosa Our observationson the similarity of the protein sequences and 3D modelsindicate that the PMMPGM protein of A baumanniiAIIMS7 could have a similar biological role in biofilms as seen in Paeruginosa Therefore the dual roles of PMMPGM in algi-nate and LPS biosynthesis enhancing the biofilm formationin A baumannii propose the enzyme as an attractive targetfor inhibitor design

5 Conclusion

This study presents an initial genetic characterization ofalgC gene in an MDR strain A baumannii AIIMS 7 which

The Scientific World Journal 13

demonstrates a quantitative differential expression patternin biofilm cells compared to planktonic counterparts cellsover a temporal scale of 96 h Molecular dynamics (MD)simulation studies indicate that the 3D structure of enzyme(PMMPGM) has functions similar to P aeruginosa whichmight result in significant biofilm augmentation in heterol-ogous algC clones as evident from SEM analysis Theseexperimental lines of evidence collectively suggest that thedifferential algC gene transcription in A baumannii stronglycorrelates with the initial attachment (9 h) and maturationstages (36 h) during the biofilm development however maynot be the only attribute contributing to biofilm formationand could be associated with other factors The PMMPGMenzyme can be a potential drug target for biofilm-associatedinfections of A baumannii as revealed by the 3D structuralsimulation studies

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Dr S Gosavi and Mr A Shinde Depart-ment of Physics University of Pune India for providingthe SEM facility Kailas D Sonawane gratefully acknowledgesUniversity Grants Commission New Delhi Government ofIndia for computational facility support under the schemeUGC SAP DRS-I sanctioned to Department of Biochem-istry Shivaji University Kolhapur India Praveen K Sahuacknowledges University of Pune University with Potentialfor Excellence (UPE Phase-1) for providing a senior researchfellowship

References

[1] M-L Joly-Guillou ldquoClinical impact and pathogenicity ofAcine-tobacterrdquo Clinical Microbiology and Infection vol 11 no 11 pp868ndash873 2005

[2] A Y Peleg H Seifert and D L Paterson ldquoAcinetobacterbaumannii emergence of a successful pathogenrdquoClinicalMicro-biology Reviews vol 21 no 3 pp 538ndash582 2008

[3] L C S Antunes P Visca and K J Towner ldquoAcinetobacter bau-mannii evolution of a global pathogenrdquo Pathogens and Diseasevol 71 no 3 pp 292ndash301 2014

[4] A Y Peleg A deBreijMDAdams et al ldquoThe success ofAcine-tobacter species genetic metabolic and virulence attributesrdquoPLoS ONE vol 7 no 10 Article ID e46984 2012

[5] M J McConnell L Actis and J Pachon ldquoAcinetobacter bau-mannii human infections factors contributing to pathogenesisand animal modelsrdquo FEMS Microbiology Reviews vol 37 no 2pp 130ndash155 2013

[6] S J Wilson C J Knipe M J Zieger et al ldquoDirect costs ofmultidrug-resistant Acinetobacter baumannii in the burn unitof a public teaching hospitalrdquo American Journal of InfectionControl vol 32 no 6 pp 342ndash344 2004

[7] M V Villegas and A I Hartstein ldquoAcinetobacter outbreaks1977ndash2000rdquo Infection Control and Hospital Epidemiology vol24 no 4 pp 284ndash295 2003

[8] A P Tomaras C W Dorsey R E Edelmann and L A ActisldquoAttachment to and biofilm formation on abiotic surfaces byAcinetobacter baumannii involvement of a novel chaperone-usher pili assembly systemrdquo Microbiology vol 149 no 12 pp3473ndash3484 2003

[9] P K Sahu P S Iyer A M Oak K R Pardesi and B AChopade ldquoCharacterization of eDNA from the clinical strainAcinetobacter baumanniiAIIMS 7 and its role in biofilm forma-tionrdquoThe Scientific World Journal vol 2012 Article ID 97343610 pages 2012

[10] H-W Lee Y M Koh J Kim et al ldquoCapacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to formbiofilm and adhere to epithelial cell surfacesrdquo Clinical Micro-biology and Infection vol 14 no 1 pp 49ndash54 2008

[11] A de Breij L Dijkshoorn E Lagendijk et al ldquoDo biofilmformation and interactions with human cells explain the clinicalsuccess of Acinetobacter baumanniirdquo PLoS ONE vol 5 no 5Article ID e10732 2010

[12] L C S Antunes F Imperi A Carattoli and P Visca ldquoDeci-phering the multifactorial nature of Acinetobacter baumanniipathogenicityrdquo PLoS ONE vol 6 no 8 Article ID e22674 2011

[13] J A Gaddy and L A Actis ldquoRegulation of Acinetobacter bau-mannii biofilm formationrdquo FutureMicrobiology vol 4 no 3 pp273ndash278 2009

[14] J W Costerton P S Stewart and E P Greenberg ldquoBacterialbiofilms a common cause of persistent infectionsrdquo Science vol284 no 5418 pp 1318ndash1322 1999

[15] M S Favero R P Gaynes T C Horan et al ldquoNational nosoco-mial infections surveillance (NNIS) report data summary fromOctober 1986-April 1996 issuedMay 1996rdquoAmerican Journal ofInfection Control vol 24 no 5 pp 380ndash388 1996

[16] J Chastre and J-L Trouillet ldquoProblem pathogens (Pseu-domonas aerugınosa and Acınetobacter)rdquo Seminars in Respira-tory Infections vol 15 no 4 pp 287ndash298 2000

[17] S Favre-Bonte J C Pache J Robert D Blanc J C Pechere andC van Delden ldquoDetection of Pseudomonas aeruginosa cell-to-cell signals in lung tissue of cystic fibrosis patientsrdquo MicrobialPathogenesis vol 32 no 3 pp 143ndash147 2002

[18] J G Leid C J Willson M E Shirtliff D J Hassett MR Parsek and A K Jeffers ldquoThe exopolysaccharide alginateprotects Pseudomonas aeruginosa biofilm bacteria from IFN-120574-mediated macrophage killingrdquoThe Journal of Immunology vol175 no 11 pp 7512ndash7518 2005

[19] G W Sundin S Shankar S A Chugani B A Chopade AKavanaugh-Black and AM Chakrabarty ldquoNucleoside diphos-phate kinase from Pseudomonas aeruginosa characterization ofthe gene and its role in cellular growth and exopolysaccharidealginate synthesisrdquo Molecular Microbiology vol 20 no 5 pp965ndash979 1996

[20] J R Wiens A I Vasil M J Schurr and M L Vasil ldquoIron-regulated expression of alginate production mucoid pheno-type and biofilm formation by Pseudomonas aeruginosardquoMBiovol 5 no 1 pp e01010ndashe01013 2014

[21] D J Wozniak T J O Wyckoff M Starkey et al ldquoAlginate isnot a significant component of the extracellular polysaccharidematrix of PA14 and PAO1 Pseudomonas aeruginosa biofilmsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 13 pp 7907ndash7912 2003

[22] D ENivens D EOhman JWilliams andM J Franklin ldquoRoleof alginate and its O acetylation in formation of Pseudomonasaeruginosamicrocolonies and biofilmsrdquo Journal of Bacteriologyvol 183 no 3 pp 1047ndash1057 2001

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

The Scientific World Journal 9

05

92

94

92

76

36

39

A baumannii AIIMS 7 AlgC PMMA baumannii AYE PMMA calcoaceticus PMM

A haemolyticus PMM

P aeruginosa PAO1 PMM

P syringae PMMH sapiens PMM

P putida PMMPGM

O cuniculus PGM isoform 1

(b)

Figure 4 (a)-(b)Multiple sequence alignment and phylogenetic relationship of PMMPGM (a) CLUSTALWanalyses of PMMPGMproteinsequences displaying representative color of box which highlights conserved regions that is active site (red) Mg2+ binding site (green) andsubstrate binding site (blue) (b) Bootstrap consensus tree for PMMPGM enzymes constructed by MEGA v50 using the neighbor-joining(NJ) method (based on 1000 replicates) Numbers on the nodes are bootstrap values and the bar represents scale of estimated evolutionarydistance (20 substitutions at any amino acid position per 100 amino acid positions)

943

21

660

440

290

AlgC

M

Figure 5 SDS-PAGE analysis of AlgC (PMMPGM) protein Lane 1whole cell extract of control E coliDH5120572 (lacking algC gene) lane 2whole cell extract of E coli DH5120572 with algC gene showing the AlgCprotein band sim53 kDa lane M standard protein molecular weightmarker (kDa)

accessible surface (SA Richardsrsquo surface) and molecularsurface (MS Connollyrsquos surface) areas as calculated by alphashape method The enzyme showed a total cavity of 36415 Aand spherical central cavity of 187813 Awhere substrate couldbind as shown in Figure 7(b) To compare the 3D struc-tures obtained before and after MD simulations structuralsuperpositionsweremade using PDBeFOLD results ofwhichshowed root mean square deviation (RMSD) of two alignedstructures within the range of 251 A (Figure 7(c)) Metal ionMg2+ interacts with Asp244 Asp246 Asp248 and Ser104

residues (Figure 7(d) Supplementary Table S1) The metalion Mg2+ is required for enzymatic activity of PMMPGMof A baumannii AIIMS 7 (Figure 7(d)) rather than Mn2+andZn2+ Specific interactions betweenmetal ion (Mg2+) andprotein water-mediated H-bonds (so-called water bridges)and hydrophobic (Lennard-Jones) interactions have beenidentified and are listed (Supplementary Table S1)

39 Stability of Phosphomannomutase during Simulation Toverify the simulation stability and to measure structure anddynamics of PMMPGM model of A baumannii AIIMS 7standard structural parameters like RMSD root mean squarefluctuation (RMSF) and radius of gyration (RG) were calcu-lated and represented in Figures 8(a)ndash8(c) During moleculardynamics simulation period of 10 ns the average RMSD valuewas 03 nm as depicted (Figure 8(a)) Steady RMSD resultshowed for the atoms in the four domains of PMMPGMmodel indicated that the catalytic activity is relatively stableduring the simulation The result for radius of gyration (RG)also indicated the stability ofmodel over thewhole simulationperiod (Figure 8(b)) Minor fluctuations in C-alpha atoms(RMSF) of helical and sheet structural elements could beseen whereas loop region showed variability to some extent(Figure 8(c)) Overall these results of RMSD RMSF andRG strongly indicated the stability of system over the entiresimulation period

4 Discussion

Biofilm formation substantially aids to the spectrum ofmultidrug resistance displayed by A baumannii and is oftenattributed as the major cause for antibiotic treatment fail-ure [3 5] The process of bacterial biofilm development isbelieved to be a complex interplay of the biofilm EPS matrixcomponents that is a plethora of proteins and extracellularmacromolecules for example DNAand polysaccharidesThesynthesis of specific exopolysaccharides such as alginate and

10 The Scientific World Journal

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

Figure 6 (a)ndash(h) Visualization of biofilm augmentation by scanning electron microscopy Electron micrographs (a c e g) showing biofilmsformed by algC clones after 24 h at a gradient of magnifications (Bar = 2 120583m 5 120583m 10120583m and 20 120583m absolute magnifications indicated asKx in the very picture) as observed under a scanning electronmicroscope algC clones can be seen clearly producing dense and robust biofilmas suggested by the thickness and integrity of the biofilm matrices compared to the control biofilms by E coli DH5120572 (lacking A baumanniialgC gene) at corresponding comparable magnifications (b d f h)

LPS core has been described in various bacterial systems[25 43 44] in particular P aeruginosa with its contributionin biofilm formation [20 22] However algC gene functionand its expression pattern have not been elucidated in Abaumannii in order to understand the genetic basis of itsassociation with biofilm formation Herein an initial geneticcharacterization of the algC gene and its association withbiofilm formation is reported in the MDR strain AIIMS 7 ofA baumannii which depicts differential expression of algCgene during the biofilm development Besides MD simula-tion was performed on the three-dimensional (3D) struc-ture of the gene product (enzyme PMMPGM) to comparewith that of P aeruginosa followed by its cloning heterol-ogous expression and phylogenetic analysis Finally biofilmaugmentation by algC gene was evaluated quantitatively andconfirmed by SEM

Analysis of the algC gene expression pattern in thetemporal scale (up to 96 hours) reveals that surface-attachedbacteria have significantly higher rate of transcription levelsthan nonadherent or shaking cultures The attachment orldquosurface sensingrdquo could be the trigger for the activation ofalgC promoter as a result of which the algC expression couldbe seen consistently higher (maximum 8159-fold 119875 lt 005)in biofilm formingA baumannii cultures than the planktoniccounterparts (maximum 324-fold) as revealed by real timePCR analysis (Figure 1) This observation is in accordancewith an earlier study in P aeruginosa [45] which shows algC

reporter gene activity in continuous biofilm culture cells to be19-fold increased than planktonic cells Earlier Davies et al[46] have shown that expression of P aeruginosa algC isupregulated after initial attachment of cells to teflon orglass substrata where cells that failed to upregulate alginatebiosynthesis typically detached from the surface As reviewedearlier by Gacesa [47] it is presumed that exopolysaccharidealginate plays a role in consolidation of the biofilm ratherthan in the initial adhesion event and hence higher rate ofalgC transcription was not a prerequisite to surface attach-ment by P aeruginosa indicating alginate biosynthesis notnecessary for its attachment to glass surface In contrast ourdata in support of the relative quantification of algC tran-scription by real-time PCR and biofilm augmentation byalgC as visualized by SEM is indicative of the possibleinvolvement of algC expression in probably both the eventsthat is initial attachment and consolidation of biofilmsformed by A baumannii Furthermore the upregulation ofalgC transcription at the maturation stages (36ndash48 hours)explains that it is strongly associated with maturation ofbiofilms as the correlation of algC expression with biofilmformation during the very stage was significantly higher thanthe initial events (0983 compared to 0902119875 lt 005) Duringplanktonic mode of growth low levels of algC transcriptionwere observed as compared to biofilm formingA baumanniiwhich should be ideally due to lack of surface attachment (lesspromoter activity) and variations in the oxygen tension in

The Scientific World Journal 11

(a) (b)

(c) (d)

Figure 7 (a)ndash(d) Molecular modeling of PMMPGM from A baumanniiAIIMS 7 (a) Four sequential domains of enzyme PMMPGM afterMD simulation (b) central spherical cavity showing solvent accessible surface area (orange) (c) Superimposed structures before MD (cyan)and after MD simulation (magenta) (d) Mg2+ interacting residues of PMMPGM enzyme

shaking and static cultures Regulation of the algC gene couldbe dependent on diverse parameters as seen in P aeruginosawhere it was shown to be in coordination with the algCpromoter activity [23] Besides according to other studiesvariations in oxygen tension [48] nitrogen limitation [49]and ethanol induced membrane perturbation [50] can alsoinfluence the alginate production in P aeruginosa In Abaumannii we demonstrate differential algC transcription tobe dependent upon abiotic (polystyrene) surface attachmentand thus further investigation would be required to portraya comprehensive profile of algC genetic regulation

The 3D structure of PMMPGM bifunctional enzyme asdetermined by homology modeling which is the gene prod-uct of algC from A baumannii strain AIIMS 7 shows 32overall similarity Furthermore high sequence identity of thecatalytic domain was observed with that of experimentallydetermined structure of PMMPGM of P aeruginosa [42]Each of the four domains contained residues essential forcatalysis andor substrate recognition While the catalytic

phosphoserine residue (Ser104) of domain 1 could be useful totransfer phosphoryl group to and from the bisphosphorylatedreaction intermediate domain 2 was found to contain ametal binding loop (Asp244 Asp246 Asp248) that couldcoordinate theMg2+ ion required for the PMMPGM activity(Figure 7(d)) Domain 3 of PMMPGM of A baumannii alsocontains sugar binding loop (Glu327 Ala329 His331) similarto that in PMMPGM of P aeruginosa This sugar bindingloop has key residues which could enable the enzyme torecognize the two different binding orientations of its 1- and6-phospho sugar substrates Domains 3 and 4 provide mostof the residues that create a phosphate binding site (Lys287 ofdomain 3 and Arg427 Arg438 of domain 4) that determinesthe orientation of the incoming phosphor-sugar substratesIn context with previous studies in P aeruginosa PMMPGM[27 51] our investigation predicts that PMMPGMofA bau-mannii requires Mg2+ and activator glucose 16-biphosphatefor its catalytic activity Other physical properties of the pro-tein analyzed in silicowere also found to be similar to those of

12 The Scientific World Journal

0005

01015

02025

03035

04045

038

677

211

5815

4419

3023

1627

0230

8834

7438

6042

4646

3250

1854

0457

9061

7665

6269

4873

3477

2081

0684

9288

7892

6496

50

RMSD

(nm

)

Time (ps)

(a)

22225

23235

24245

25

038

276

411

4615

2819

1022

9226

7430

5634

3838

2042

0245

8449

6653

4857

3061

1264

9468

7672

5876

4080

2284

0487

8691

6895

5099

32

Radi

us o

f gyr

atio

n (n

m)

Time (ps)

(b)

0005

01015

02025

03035

04045

1 19 37 55 73 91 109

127

145

163

181

199

217

235

253

271

289

307

325

343

361

379

397

415

433

451

469

RMSF

(nm

)

Residue number

(c)

Figure 8 (a)ndash(c) Results from 10 ns molecular dynamics simulation performed on PMMPGM model (a) Root mean square deviation(RMSD) (b) radius of gyration (c) root mean square fluctuation (RMSF)

PMMPGM enzyme from P aeruginosa [42] This indicateda similar function of the enzyme that is a bifunctional rolewhich would be responsible for conversion of mannose-6-phosphate to mannose-1-phosphate or glucose-6-phosphateto glucose-1-phosphate as in P aeruginosa [28]

The active site residues predicted in the PMMPGMenzyme 3D structure were determined by multiple sequencealignments and however needs to be validated by experi-mental analysis In context of sugar binding loop PMMPGMofA baumanniimay also have equal specificity for glucose aswell as mannose because mannose and glucose are epimersat C-2 The active site residues of characterized PMMPGMcomplexes are known to change conformation based on theidentity of the bound ligand andor change the type of contactinwhich they participate [28 52]However a direct structuralcharacterization of multiple enzyme-substrate complexeswould likely be necessary for a full understanding of substratespecificity in this enzyme superfamily Nevertheless the MDsimulation results in this research reveal several regions ofthe PMMPGM enzyme to be highly conserved and clearlyimportant for function in all organisms supporting theproposal that all of these enzymes use a commonmechanismThe algC gene of A baumannii AIIMS 7 characterized in thisstudy is an ortholog of algC gene from P aeruginosa ThePMMPGM protein plays a central role in the productionof three P aeruginosa virulence-associated traits alginaterhamnolipids and LPS although the production of thesecompounds is subjected to a completely different genetic andenvironmental regulation [23 45] The PGM activity of theprotein is involved in synthesis of the LPS core of biofilmswhile PMM activity is responsible for alginate biosynthesisBoth of these (PMMPGM) enzymatic functions either singly

or in combination could be attributed for the biofilm forma-tion in A baumannii AIIMS 7 and augmentation of biofilmsin heterologous clones as observed by SEM It is also con-ceivable therefore that the cloned and overexpressed PGMenzyme (of A baumannii AIIMS 7) might have used up themachinery for cellular LPS core biosynthesis in E coli [25]and could be the possible mechanism behind the overallaugmentation of biofilms in the heterologous algC clones(E coli DH5120572 a relatively weak biofilm former than Abaumannii) as evident from the SEM image analysis Never-theless due to the central role of PMMPGM in biosyntheticpathways the enzyme has potential to serve as a novelmarkerfor A baumannii infection or as pharmaceutical targets forinhibition Such inhibitors would be specific and not affectthe essential homolog in human due to lack of conservationin active site sugar and metal binding site

The mechanism of PMMPGM is believed to be closelyparallel to that of related proteins from other pseudomonadsincluding close relatives like P aeruginosa Our observationson the similarity of the protein sequences and 3D modelsindicate that the PMMPGM protein of A baumanniiAIIMS7 could have a similar biological role in biofilms as seen in Paeruginosa Therefore the dual roles of PMMPGM in algi-nate and LPS biosynthesis enhancing the biofilm formationin A baumannii propose the enzyme as an attractive targetfor inhibitor design

5 Conclusion

This study presents an initial genetic characterization ofalgC gene in an MDR strain A baumannii AIIMS 7 which

The Scientific World Journal 13

demonstrates a quantitative differential expression patternin biofilm cells compared to planktonic counterparts cellsover a temporal scale of 96 h Molecular dynamics (MD)simulation studies indicate that the 3D structure of enzyme(PMMPGM) has functions similar to P aeruginosa whichmight result in significant biofilm augmentation in heterol-ogous algC clones as evident from SEM analysis Theseexperimental lines of evidence collectively suggest that thedifferential algC gene transcription in A baumannii stronglycorrelates with the initial attachment (9 h) and maturationstages (36 h) during the biofilm development however maynot be the only attribute contributing to biofilm formationand could be associated with other factors The PMMPGMenzyme can be a potential drug target for biofilm-associatedinfections of A baumannii as revealed by the 3D structuralsimulation studies

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Dr S Gosavi and Mr A Shinde Depart-ment of Physics University of Pune India for providingthe SEM facility Kailas D Sonawane gratefully acknowledgesUniversity Grants Commission New Delhi Government ofIndia for computational facility support under the schemeUGC SAP DRS-I sanctioned to Department of Biochem-istry Shivaji University Kolhapur India Praveen K Sahuacknowledges University of Pune University with Potentialfor Excellence (UPE Phase-1) for providing a senior researchfellowship

References

[1] M-L Joly-Guillou ldquoClinical impact and pathogenicity ofAcine-tobacterrdquo Clinical Microbiology and Infection vol 11 no 11 pp868ndash873 2005

[2] A Y Peleg H Seifert and D L Paterson ldquoAcinetobacterbaumannii emergence of a successful pathogenrdquoClinicalMicro-biology Reviews vol 21 no 3 pp 538ndash582 2008

[3] L C S Antunes P Visca and K J Towner ldquoAcinetobacter bau-mannii evolution of a global pathogenrdquo Pathogens and Diseasevol 71 no 3 pp 292ndash301 2014

[4] A Y Peleg A deBreijMDAdams et al ldquoThe success ofAcine-tobacter species genetic metabolic and virulence attributesrdquoPLoS ONE vol 7 no 10 Article ID e46984 2012

[5] M J McConnell L Actis and J Pachon ldquoAcinetobacter bau-mannii human infections factors contributing to pathogenesisand animal modelsrdquo FEMS Microbiology Reviews vol 37 no 2pp 130ndash155 2013

[6] S J Wilson C J Knipe M J Zieger et al ldquoDirect costs ofmultidrug-resistant Acinetobacter baumannii in the burn unitof a public teaching hospitalrdquo American Journal of InfectionControl vol 32 no 6 pp 342ndash344 2004

[7] M V Villegas and A I Hartstein ldquoAcinetobacter outbreaks1977ndash2000rdquo Infection Control and Hospital Epidemiology vol24 no 4 pp 284ndash295 2003

[8] A P Tomaras C W Dorsey R E Edelmann and L A ActisldquoAttachment to and biofilm formation on abiotic surfaces byAcinetobacter baumannii involvement of a novel chaperone-usher pili assembly systemrdquo Microbiology vol 149 no 12 pp3473ndash3484 2003

[9] P K Sahu P S Iyer A M Oak K R Pardesi and B AChopade ldquoCharacterization of eDNA from the clinical strainAcinetobacter baumanniiAIIMS 7 and its role in biofilm forma-tionrdquoThe Scientific World Journal vol 2012 Article ID 97343610 pages 2012

[10] H-W Lee Y M Koh J Kim et al ldquoCapacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to formbiofilm and adhere to epithelial cell surfacesrdquo Clinical Micro-biology and Infection vol 14 no 1 pp 49ndash54 2008

[11] A de Breij L Dijkshoorn E Lagendijk et al ldquoDo biofilmformation and interactions with human cells explain the clinicalsuccess of Acinetobacter baumanniirdquo PLoS ONE vol 5 no 5Article ID e10732 2010

[12] L C S Antunes F Imperi A Carattoli and P Visca ldquoDeci-phering the multifactorial nature of Acinetobacter baumanniipathogenicityrdquo PLoS ONE vol 6 no 8 Article ID e22674 2011

[13] J A Gaddy and L A Actis ldquoRegulation of Acinetobacter bau-mannii biofilm formationrdquo FutureMicrobiology vol 4 no 3 pp273ndash278 2009

[14] J W Costerton P S Stewart and E P Greenberg ldquoBacterialbiofilms a common cause of persistent infectionsrdquo Science vol284 no 5418 pp 1318ndash1322 1999

[15] M S Favero R P Gaynes T C Horan et al ldquoNational nosoco-mial infections surveillance (NNIS) report data summary fromOctober 1986-April 1996 issuedMay 1996rdquoAmerican Journal ofInfection Control vol 24 no 5 pp 380ndash388 1996

[16] J Chastre and J-L Trouillet ldquoProblem pathogens (Pseu-domonas aerugınosa and Acınetobacter)rdquo Seminars in Respira-tory Infections vol 15 no 4 pp 287ndash298 2000

[17] S Favre-Bonte J C Pache J Robert D Blanc J C Pechere andC van Delden ldquoDetection of Pseudomonas aeruginosa cell-to-cell signals in lung tissue of cystic fibrosis patientsrdquo MicrobialPathogenesis vol 32 no 3 pp 143ndash147 2002

[18] J G Leid C J Willson M E Shirtliff D J Hassett MR Parsek and A K Jeffers ldquoThe exopolysaccharide alginateprotects Pseudomonas aeruginosa biofilm bacteria from IFN-120574-mediated macrophage killingrdquoThe Journal of Immunology vol175 no 11 pp 7512ndash7518 2005

[19] G W Sundin S Shankar S A Chugani B A Chopade AKavanaugh-Black and AM Chakrabarty ldquoNucleoside diphos-phate kinase from Pseudomonas aeruginosa characterization ofthe gene and its role in cellular growth and exopolysaccharidealginate synthesisrdquo Molecular Microbiology vol 20 no 5 pp965ndash979 1996

[20] J R Wiens A I Vasil M J Schurr and M L Vasil ldquoIron-regulated expression of alginate production mucoid pheno-type and biofilm formation by Pseudomonas aeruginosardquoMBiovol 5 no 1 pp e01010ndashe01013 2014

[21] D J Wozniak T J O Wyckoff M Starkey et al ldquoAlginate isnot a significant component of the extracellular polysaccharidematrix of PA14 and PAO1 Pseudomonas aeruginosa biofilmsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 13 pp 7907ndash7912 2003

[22] D ENivens D EOhman JWilliams andM J Franklin ldquoRoleof alginate and its O acetylation in formation of Pseudomonasaeruginosamicrocolonies and biofilmsrdquo Journal of Bacteriologyvol 183 no 3 pp 1047ndash1057 2001

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

10 The Scientific World Journal

(a)

(b)

(c)

(d)

(e)

(f)

(g)

(h)

Figure 6 (a)ndash(h) Visualization of biofilm augmentation by scanning electron microscopy Electron micrographs (a c e g) showing biofilmsformed by algC clones after 24 h at a gradient of magnifications (Bar = 2 120583m 5 120583m 10120583m and 20 120583m absolute magnifications indicated asKx in the very picture) as observed under a scanning electronmicroscope algC clones can be seen clearly producing dense and robust biofilmas suggested by the thickness and integrity of the biofilm matrices compared to the control biofilms by E coli DH5120572 (lacking A baumanniialgC gene) at corresponding comparable magnifications (b d f h)

LPS core has been described in various bacterial systems[25 43 44] in particular P aeruginosa with its contributionin biofilm formation [20 22] However algC gene functionand its expression pattern have not been elucidated in Abaumannii in order to understand the genetic basis of itsassociation with biofilm formation Herein an initial geneticcharacterization of the algC gene and its association withbiofilm formation is reported in the MDR strain AIIMS 7 ofA baumannii which depicts differential expression of algCgene during the biofilm development Besides MD simula-tion was performed on the three-dimensional (3D) struc-ture of the gene product (enzyme PMMPGM) to comparewith that of P aeruginosa followed by its cloning heterol-ogous expression and phylogenetic analysis Finally biofilmaugmentation by algC gene was evaluated quantitatively andconfirmed by SEM

Analysis of the algC gene expression pattern in thetemporal scale (up to 96 hours) reveals that surface-attachedbacteria have significantly higher rate of transcription levelsthan nonadherent or shaking cultures The attachment orldquosurface sensingrdquo could be the trigger for the activation ofalgC promoter as a result of which the algC expression couldbe seen consistently higher (maximum 8159-fold 119875 lt 005)in biofilm formingA baumannii cultures than the planktoniccounterparts (maximum 324-fold) as revealed by real timePCR analysis (Figure 1) This observation is in accordancewith an earlier study in P aeruginosa [45] which shows algC

reporter gene activity in continuous biofilm culture cells to be19-fold increased than planktonic cells Earlier Davies et al[46] have shown that expression of P aeruginosa algC isupregulated after initial attachment of cells to teflon orglass substrata where cells that failed to upregulate alginatebiosynthesis typically detached from the surface As reviewedearlier by Gacesa [47] it is presumed that exopolysaccharidealginate plays a role in consolidation of the biofilm ratherthan in the initial adhesion event and hence higher rate ofalgC transcription was not a prerequisite to surface attach-ment by P aeruginosa indicating alginate biosynthesis notnecessary for its attachment to glass surface In contrast ourdata in support of the relative quantification of algC tran-scription by real-time PCR and biofilm augmentation byalgC as visualized by SEM is indicative of the possibleinvolvement of algC expression in probably both the eventsthat is initial attachment and consolidation of biofilmsformed by A baumannii Furthermore the upregulation ofalgC transcription at the maturation stages (36ndash48 hours)explains that it is strongly associated with maturation ofbiofilms as the correlation of algC expression with biofilmformation during the very stage was significantly higher thanthe initial events (0983 compared to 0902119875 lt 005) Duringplanktonic mode of growth low levels of algC transcriptionwere observed as compared to biofilm formingA baumanniiwhich should be ideally due to lack of surface attachment (lesspromoter activity) and variations in the oxygen tension in

The Scientific World Journal 11

(a) (b)

(c) (d)

Figure 7 (a)ndash(d) Molecular modeling of PMMPGM from A baumanniiAIIMS 7 (a) Four sequential domains of enzyme PMMPGM afterMD simulation (b) central spherical cavity showing solvent accessible surface area (orange) (c) Superimposed structures before MD (cyan)and after MD simulation (magenta) (d) Mg2+ interacting residues of PMMPGM enzyme

shaking and static cultures Regulation of the algC gene couldbe dependent on diverse parameters as seen in P aeruginosawhere it was shown to be in coordination with the algCpromoter activity [23] Besides according to other studiesvariations in oxygen tension [48] nitrogen limitation [49]and ethanol induced membrane perturbation [50] can alsoinfluence the alginate production in P aeruginosa In Abaumannii we demonstrate differential algC transcription tobe dependent upon abiotic (polystyrene) surface attachmentand thus further investigation would be required to portraya comprehensive profile of algC genetic regulation

The 3D structure of PMMPGM bifunctional enzyme asdetermined by homology modeling which is the gene prod-uct of algC from A baumannii strain AIIMS 7 shows 32overall similarity Furthermore high sequence identity of thecatalytic domain was observed with that of experimentallydetermined structure of PMMPGM of P aeruginosa [42]Each of the four domains contained residues essential forcatalysis andor substrate recognition While the catalytic

phosphoserine residue (Ser104) of domain 1 could be useful totransfer phosphoryl group to and from the bisphosphorylatedreaction intermediate domain 2 was found to contain ametal binding loop (Asp244 Asp246 Asp248) that couldcoordinate theMg2+ ion required for the PMMPGM activity(Figure 7(d)) Domain 3 of PMMPGM of A baumannii alsocontains sugar binding loop (Glu327 Ala329 His331) similarto that in PMMPGM of P aeruginosa This sugar bindingloop has key residues which could enable the enzyme torecognize the two different binding orientations of its 1- and6-phospho sugar substrates Domains 3 and 4 provide mostof the residues that create a phosphate binding site (Lys287 ofdomain 3 and Arg427 Arg438 of domain 4) that determinesthe orientation of the incoming phosphor-sugar substratesIn context with previous studies in P aeruginosa PMMPGM[27 51] our investigation predicts that PMMPGMofA bau-mannii requires Mg2+ and activator glucose 16-biphosphatefor its catalytic activity Other physical properties of the pro-tein analyzed in silicowere also found to be similar to those of

12 The Scientific World Journal

0005

01015

02025

03035

04045

038

677

211

5815

4419

3023

1627

0230

8834

7438

6042

4646

3250

1854

0457

9061

7665

6269

4873

3477

2081

0684

9288

7892

6496

50

RMSD

(nm

)

Time (ps)

(a)

22225

23235

24245

25

038

276

411

4615

2819

1022

9226

7430

5634

3838

2042

0245

8449

6653

4857

3061

1264

9468

7672

5876

4080

2284

0487

8691

6895

5099

32

Radi

us o

f gyr

atio

n (n

m)

Time (ps)

(b)

0005

01015

02025

03035

04045

1 19 37 55 73 91 109

127

145

163

181

199

217

235

253

271

289

307

325

343

361

379

397

415

433

451

469

RMSF

(nm

)

Residue number

(c)

Figure 8 (a)ndash(c) Results from 10 ns molecular dynamics simulation performed on PMMPGM model (a) Root mean square deviation(RMSD) (b) radius of gyration (c) root mean square fluctuation (RMSF)

PMMPGM enzyme from P aeruginosa [42] This indicateda similar function of the enzyme that is a bifunctional rolewhich would be responsible for conversion of mannose-6-phosphate to mannose-1-phosphate or glucose-6-phosphateto glucose-1-phosphate as in P aeruginosa [28]

The active site residues predicted in the PMMPGMenzyme 3D structure were determined by multiple sequencealignments and however needs to be validated by experi-mental analysis In context of sugar binding loop PMMPGMofA baumanniimay also have equal specificity for glucose aswell as mannose because mannose and glucose are epimersat C-2 The active site residues of characterized PMMPGMcomplexes are known to change conformation based on theidentity of the bound ligand andor change the type of contactinwhich they participate [28 52]However a direct structuralcharacterization of multiple enzyme-substrate complexeswould likely be necessary for a full understanding of substratespecificity in this enzyme superfamily Nevertheless the MDsimulation results in this research reveal several regions ofthe PMMPGM enzyme to be highly conserved and clearlyimportant for function in all organisms supporting theproposal that all of these enzymes use a commonmechanismThe algC gene of A baumannii AIIMS 7 characterized in thisstudy is an ortholog of algC gene from P aeruginosa ThePMMPGM protein plays a central role in the productionof three P aeruginosa virulence-associated traits alginaterhamnolipids and LPS although the production of thesecompounds is subjected to a completely different genetic andenvironmental regulation [23 45] The PGM activity of theprotein is involved in synthesis of the LPS core of biofilmswhile PMM activity is responsible for alginate biosynthesisBoth of these (PMMPGM) enzymatic functions either singly

or in combination could be attributed for the biofilm forma-tion in A baumannii AIIMS 7 and augmentation of biofilmsin heterologous clones as observed by SEM It is also con-ceivable therefore that the cloned and overexpressed PGMenzyme (of A baumannii AIIMS 7) might have used up themachinery for cellular LPS core biosynthesis in E coli [25]and could be the possible mechanism behind the overallaugmentation of biofilms in the heterologous algC clones(E coli DH5120572 a relatively weak biofilm former than Abaumannii) as evident from the SEM image analysis Never-theless due to the central role of PMMPGM in biosyntheticpathways the enzyme has potential to serve as a novelmarkerfor A baumannii infection or as pharmaceutical targets forinhibition Such inhibitors would be specific and not affectthe essential homolog in human due to lack of conservationin active site sugar and metal binding site

The mechanism of PMMPGM is believed to be closelyparallel to that of related proteins from other pseudomonadsincluding close relatives like P aeruginosa Our observationson the similarity of the protein sequences and 3D modelsindicate that the PMMPGM protein of A baumanniiAIIMS7 could have a similar biological role in biofilms as seen in Paeruginosa Therefore the dual roles of PMMPGM in algi-nate and LPS biosynthesis enhancing the biofilm formationin A baumannii propose the enzyme as an attractive targetfor inhibitor design

5 Conclusion

This study presents an initial genetic characterization ofalgC gene in an MDR strain A baumannii AIIMS 7 which

The Scientific World Journal 13

demonstrates a quantitative differential expression patternin biofilm cells compared to planktonic counterparts cellsover a temporal scale of 96 h Molecular dynamics (MD)simulation studies indicate that the 3D structure of enzyme(PMMPGM) has functions similar to P aeruginosa whichmight result in significant biofilm augmentation in heterol-ogous algC clones as evident from SEM analysis Theseexperimental lines of evidence collectively suggest that thedifferential algC gene transcription in A baumannii stronglycorrelates with the initial attachment (9 h) and maturationstages (36 h) during the biofilm development however maynot be the only attribute contributing to biofilm formationand could be associated with other factors The PMMPGMenzyme can be a potential drug target for biofilm-associatedinfections of A baumannii as revealed by the 3D structuralsimulation studies

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Dr S Gosavi and Mr A Shinde Depart-ment of Physics University of Pune India for providingthe SEM facility Kailas D Sonawane gratefully acknowledgesUniversity Grants Commission New Delhi Government ofIndia for computational facility support under the schemeUGC SAP DRS-I sanctioned to Department of Biochem-istry Shivaji University Kolhapur India Praveen K Sahuacknowledges University of Pune University with Potentialfor Excellence (UPE Phase-1) for providing a senior researchfellowship

References

[1] M-L Joly-Guillou ldquoClinical impact and pathogenicity ofAcine-tobacterrdquo Clinical Microbiology and Infection vol 11 no 11 pp868ndash873 2005

[2] A Y Peleg H Seifert and D L Paterson ldquoAcinetobacterbaumannii emergence of a successful pathogenrdquoClinicalMicro-biology Reviews vol 21 no 3 pp 538ndash582 2008

[3] L C S Antunes P Visca and K J Towner ldquoAcinetobacter bau-mannii evolution of a global pathogenrdquo Pathogens and Diseasevol 71 no 3 pp 292ndash301 2014

[4] A Y Peleg A deBreijMDAdams et al ldquoThe success ofAcine-tobacter species genetic metabolic and virulence attributesrdquoPLoS ONE vol 7 no 10 Article ID e46984 2012

[5] M J McConnell L Actis and J Pachon ldquoAcinetobacter bau-mannii human infections factors contributing to pathogenesisand animal modelsrdquo FEMS Microbiology Reviews vol 37 no 2pp 130ndash155 2013

[6] S J Wilson C J Knipe M J Zieger et al ldquoDirect costs ofmultidrug-resistant Acinetobacter baumannii in the burn unitof a public teaching hospitalrdquo American Journal of InfectionControl vol 32 no 6 pp 342ndash344 2004

[7] M V Villegas and A I Hartstein ldquoAcinetobacter outbreaks1977ndash2000rdquo Infection Control and Hospital Epidemiology vol24 no 4 pp 284ndash295 2003

[8] A P Tomaras C W Dorsey R E Edelmann and L A ActisldquoAttachment to and biofilm formation on abiotic surfaces byAcinetobacter baumannii involvement of a novel chaperone-usher pili assembly systemrdquo Microbiology vol 149 no 12 pp3473ndash3484 2003

[9] P K Sahu P S Iyer A M Oak K R Pardesi and B AChopade ldquoCharacterization of eDNA from the clinical strainAcinetobacter baumanniiAIIMS 7 and its role in biofilm forma-tionrdquoThe Scientific World Journal vol 2012 Article ID 97343610 pages 2012

[10] H-W Lee Y M Koh J Kim et al ldquoCapacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to formbiofilm and adhere to epithelial cell surfacesrdquo Clinical Micro-biology and Infection vol 14 no 1 pp 49ndash54 2008

[11] A de Breij L Dijkshoorn E Lagendijk et al ldquoDo biofilmformation and interactions with human cells explain the clinicalsuccess of Acinetobacter baumanniirdquo PLoS ONE vol 5 no 5Article ID e10732 2010

[12] L C S Antunes F Imperi A Carattoli and P Visca ldquoDeci-phering the multifactorial nature of Acinetobacter baumanniipathogenicityrdquo PLoS ONE vol 6 no 8 Article ID e22674 2011

[13] J A Gaddy and L A Actis ldquoRegulation of Acinetobacter bau-mannii biofilm formationrdquo FutureMicrobiology vol 4 no 3 pp273ndash278 2009

[14] J W Costerton P S Stewart and E P Greenberg ldquoBacterialbiofilms a common cause of persistent infectionsrdquo Science vol284 no 5418 pp 1318ndash1322 1999

[15] M S Favero R P Gaynes T C Horan et al ldquoNational nosoco-mial infections surveillance (NNIS) report data summary fromOctober 1986-April 1996 issuedMay 1996rdquoAmerican Journal ofInfection Control vol 24 no 5 pp 380ndash388 1996

[16] J Chastre and J-L Trouillet ldquoProblem pathogens (Pseu-domonas aerugınosa and Acınetobacter)rdquo Seminars in Respira-tory Infections vol 15 no 4 pp 287ndash298 2000

[17] S Favre-Bonte J C Pache J Robert D Blanc J C Pechere andC van Delden ldquoDetection of Pseudomonas aeruginosa cell-to-cell signals in lung tissue of cystic fibrosis patientsrdquo MicrobialPathogenesis vol 32 no 3 pp 143ndash147 2002

[18] J G Leid C J Willson M E Shirtliff D J Hassett MR Parsek and A K Jeffers ldquoThe exopolysaccharide alginateprotects Pseudomonas aeruginosa biofilm bacteria from IFN-120574-mediated macrophage killingrdquoThe Journal of Immunology vol175 no 11 pp 7512ndash7518 2005

[19] G W Sundin S Shankar S A Chugani B A Chopade AKavanaugh-Black and AM Chakrabarty ldquoNucleoside diphos-phate kinase from Pseudomonas aeruginosa characterization ofthe gene and its role in cellular growth and exopolysaccharidealginate synthesisrdquo Molecular Microbiology vol 20 no 5 pp965ndash979 1996

[20] J R Wiens A I Vasil M J Schurr and M L Vasil ldquoIron-regulated expression of alginate production mucoid pheno-type and biofilm formation by Pseudomonas aeruginosardquoMBiovol 5 no 1 pp e01010ndashe01013 2014

[21] D J Wozniak T J O Wyckoff M Starkey et al ldquoAlginate isnot a significant component of the extracellular polysaccharidematrix of PA14 and PAO1 Pseudomonas aeruginosa biofilmsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 13 pp 7907ndash7912 2003

[22] D ENivens D EOhman JWilliams andM J Franklin ldquoRoleof alginate and its O acetylation in formation of Pseudomonasaeruginosamicrocolonies and biofilmsrdquo Journal of Bacteriologyvol 183 no 3 pp 1047ndash1057 2001

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

The Scientific World Journal 11

(a) (b)

(c) (d)

Figure 7 (a)ndash(d) Molecular modeling of PMMPGM from A baumanniiAIIMS 7 (a) Four sequential domains of enzyme PMMPGM afterMD simulation (b) central spherical cavity showing solvent accessible surface area (orange) (c) Superimposed structures before MD (cyan)and after MD simulation (magenta) (d) Mg2+ interacting residues of PMMPGM enzyme

shaking and static cultures Regulation of the algC gene couldbe dependent on diverse parameters as seen in P aeruginosawhere it was shown to be in coordination with the algCpromoter activity [23] Besides according to other studiesvariations in oxygen tension [48] nitrogen limitation [49]and ethanol induced membrane perturbation [50] can alsoinfluence the alginate production in P aeruginosa In Abaumannii we demonstrate differential algC transcription tobe dependent upon abiotic (polystyrene) surface attachmentand thus further investigation would be required to portraya comprehensive profile of algC genetic regulation

The 3D structure of PMMPGM bifunctional enzyme asdetermined by homology modeling which is the gene prod-uct of algC from A baumannii strain AIIMS 7 shows 32overall similarity Furthermore high sequence identity of thecatalytic domain was observed with that of experimentallydetermined structure of PMMPGM of P aeruginosa [42]Each of the four domains contained residues essential forcatalysis andor substrate recognition While the catalytic

phosphoserine residue (Ser104) of domain 1 could be useful totransfer phosphoryl group to and from the bisphosphorylatedreaction intermediate domain 2 was found to contain ametal binding loop (Asp244 Asp246 Asp248) that couldcoordinate theMg2+ ion required for the PMMPGM activity(Figure 7(d)) Domain 3 of PMMPGM of A baumannii alsocontains sugar binding loop (Glu327 Ala329 His331) similarto that in PMMPGM of P aeruginosa This sugar bindingloop has key residues which could enable the enzyme torecognize the two different binding orientations of its 1- and6-phospho sugar substrates Domains 3 and 4 provide mostof the residues that create a phosphate binding site (Lys287 ofdomain 3 and Arg427 Arg438 of domain 4) that determinesthe orientation of the incoming phosphor-sugar substratesIn context with previous studies in P aeruginosa PMMPGM[27 51] our investigation predicts that PMMPGMofA bau-mannii requires Mg2+ and activator glucose 16-biphosphatefor its catalytic activity Other physical properties of the pro-tein analyzed in silicowere also found to be similar to those of

12 The Scientific World Journal

0005

01015

02025

03035

04045

038

677

211

5815

4419

3023

1627

0230

8834

7438

6042

4646

3250

1854

0457

9061

7665

6269

4873

3477

2081

0684

9288

7892

6496

50

RMSD

(nm

)

Time (ps)

(a)

22225

23235

24245

25

038

276

411

4615

2819

1022

9226

7430

5634

3838

2042

0245

8449

6653

4857

3061

1264

9468

7672

5876

4080

2284

0487

8691

6895

5099

32

Radi

us o

f gyr

atio

n (n

m)

Time (ps)

(b)

0005

01015

02025

03035

04045

1 19 37 55 73 91 109

127

145

163

181

199

217

235

253

271

289

307

325

343

361

379

397

415

433

451

469

RMSF

(nm

)

Residue number

(c)

Figure 8 (a)ndash(c) Results from 10 ns molecular dynamics simulation performed on PMMPGM model (a) Root mean square deviation(RMSD) (b) radius of gyration (c) root mean square fluctuation (RMSF)

PMMPGM enzyme from P aeruginosa [42] This indicateda similar function of the enzyme that is a bifunctional rolewhich would be responsible for conversion of mannose-6-phosphate to mannose-1-phosphate or glucose-6-phosphateto glucose-1-phosphate as in P aeruginosa [28]

The active site residues predicted in the PMMPGMenzyme 3D structure were determined by multiple sequencealignments and however needs to be validated by experi-mental analysis In context of sugar binding loop PMMPGMofA baumanniimay also have equal specificity for glucose aswell as mannose because mannose and glucose are epimersat C-2 The active site residues of characterized PMMPGMcomplexes are known to change conformation based on theidentity of the bound ligand andor change the type of contactinwhich they participate [28 52]However a direct structuralcharacterization of multiple enzyme-substrate complexeswould likely be necessary for a full understanding of substratespecificity in this enzyme superfamily Nevertheless the MDsimulation results in this research reveal several regions ofthe PMMPGM enzyme to be highly conserved and clearlyimportant for function in all organisms supporting theproposal that all of these enzymes use a commonmechanismThe algC gene of A baumannii AIIMS 7 characterized in thisstudy is an ortholog of algC gene from P aeruginosa ThePMMPGM protein plays a central role in the productionof three P aeruginosa virulence-associated traits alginaterhamnolipids and LPS although the production of thesecompounds is subjected to a completely different genetic andenvironmental regulation [23 45] The PGM activity of theprotein is involved in synthesis of the LPS core of biofilmswhile PMM activity is responsible for alginate biosynthesisBoth of these (PMMPGM) enzymatic functions either singly

or in combination could be attributed for the biofilm forma-tion in A baumannii AIIMS 7 and augmentation of biofilmsin heterologous clones as observed by SEM It is also con-ceivable therefore that the cloned and overexpressed PGMenzyme (of A baumannii AIIMS 7) might have used up themachinery for cellular LPS core biosynthesis in E coli [25]and could be the possible mechanism behind the overallaugmentation of biofilms in the heterologous algC clones(E coli DH5120572 a relatively weak biofilm former than Abaumannii) as evident from the SEM image analysis Never-theless due to the central role of PMMPGM in biosyntheticpathways the enzyme has potential to serve as a novelmarkerfor A baumannii infection or as pharmaceutical targets forinhibition Such inhibitors would be specific and not affectthe essential homolog in human due to lack of conservationin active site sugar and metal binding site

The mechanism of PMMPGM is believed to be closelyparallel to that of related proteins from other pseudomonadsincluding close relatives like P aeruginosa Our observationson the similarity of the protein sequences and 3D modelsindicate that the PMMPGM protein of A baumanniiAIIMS7 could have a similar biological role in biofilms as seen in Paeruginosa Therefore the dual roles of PMMPGM in algi-nate and LPS biosynthesis enhancing the biofilm formationin A baumannii propose the enzyme as an attractive targetfor inhibitor design

5 Conclusion

This study presents an initial genetic characterization ofalgC gene in an MDR strain A baumannii AIIMS 7 which

The Scientific World Journal 13

demonstrates a quantitative differential expression patternin biofilm cells compared to planktonic counterparts cellsover a temporal scale of 96 h Molecular dynamics (MD)simulation studies indicate that the 3D structure of enzyme(PMMPGM) has functions similar to P aeruginosa whichmight result in significant biofilm augmentation in heterol-ogous algC clones as evident from SEM analysis Theseexperimental lines of evidence collectively suggest that thedifferential algC gene transcription in A baumannii stronglycorrelates with the initial attachment (9 h) and maturationstages (36 h) during the biofilm development however maynot be the only attribute contributing to biofilm formationand could be associated with other factors The PMMPGMenzyme can be a potential drug target for biofilm-associatedinfections of A baumannii as revealed by the 3D structuralsimulation studies

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Dr S Gosavi and Mr A Shinde Depart-ment of Physics University of Pune India for providingthe SEM facility Kailas D Sonawane gratefully acknowledgesUniversity Grants Commission New Delhi Government ofIndia for computational facility support under the schemeUGC SAP DRS-I sanctioned to Department of Biochem-istry Shivaji University Kolhapur India Praveen K Sahuacknowledges University of Pune University with Potentialfor Excellence (UPE Phase-1) for providing a senior researchfellowship

References

[1] M-L Joly-Guillou ldquoClinical impact and pathogenicity ofAcine-tobacterrdquo Clinical Microbiology and Infection vol 11 no 11 pp868ndash873 2005

[2] A Y Peleg H Seifert and D L Paterson ldquoAcinetobacterbaumannii emergence of a successful pathogenrdquoClinicalMicro-biology Reviews vol 21 no 3 pp 538ndash582 2008

[3] L C S Antunes P Visca and K J Towner ldquoAcinetobacter bau-mannii evolution of a global pathogenrdquo Pathogens and Diseasevol 71 no 3 pp 292ndash301 2014

[4] A Y Peleg A deBreijMDAdams et al ldquoThe success ofAcine-tobacter species genetic metabolic and virulence attributesrdquoPLoS ONE vol 7 no 10 Article ID e46984 2012

[5] M J McConnell L Actis and J Pachon ldquoAcinetobacter bau-mannii human infections factors contributing to pathogenesisand animal modelsrdquo FEMS Microbiology Reviews vol 37 no 2pp 130ndash155 2013

[6] S J Wilson C J Knipe M J Zieger et al ldquoDirect costs ofmultidrug-resistant Acinetobacter baumannii in the burn unitof a public teaching hospitalrdquo American Journal of InfectionControl vol 32 no 6 pp 342ndash344 2004

[7] M V Villegas and A I Hartstein ldquoAcinetobacter outbreaks1977ndash2000rdquo Infection Control and Hospital Epidemiology vol24 no 4 pp 284ndash295 2003

[8] A P Tomaras C W Dorsey R E Edelmann and L A ActisldquoAttachment to and biofilm formation on abiotic surfaces byAcinetobacter baumannii involvement of a novel chaperone-usher pili assembly systemrdquo Microbiology vol 149 no 12 pp3473ndash3484 2003

[9] P K Sahu P S Iyer A M Oak K R Pardesi and B AChopade ldquoCharacterization of eDNA from the clinical strainAcinetobacter baumanniiAIIMS 7 and its role in biofilm forma-tionrdquoThe Scientific World Journal vol 2012 Article ID 97343610 pages 2012

[10] H-W Lee Y M Koh J Kim et al ldquoCapacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to formbiofilm and adhere to epithelial cell surfacesrdquo Clinical Micro-biology and Infection vol 14 no 1 pp 49ndash54 2008

[11] A de Breij L Dijkshoorn E Lagendijk et al ldquoDo biofilmformation and interactions with human cells explain the clinicalsuccess of Acinetobacter baumanniirdquo PLoS ONE vol 5 no 5Article ID e10732 2010

[12] L C S Antunes F Imperi A Carattoli and P Visca ldquoDeci-phering the multifactorial nature of Acinetobacter baumanniipathogenicityrdquo PLoS ONE vol 6 no 8 Article ID e22674 2011

[13] J A Gaddy and L A Actis ldquoRegulation of Acinetobacter bau-mannii biofilm formationrdquo FutureMicrobiology vol 4 no 3 pp273ndash278 2009

[14] J W Costerton P S Stewart and E P Greenberg ldquoBacterialbiofilms a common cause of persistent infectionsrdquo Science vol284 no 5418 pp 1318ndash1322 1999

[15] M S Favero R P Gaynes T C Horan et al ldquoNational nosoco-mial infections surveillance (NNIS) report data summary fromOctober 1986-April 1996 issuedMay 1996rdquoAmerican Journal ofInfection Control vol 24 no 5 pp 380ndash388 1996

[16] J Chastre and J-L Trouillet ldquoProblem pathogens (Pseu-domonas aerugınosa and Acınetobacter)rdquo Seminars in Respira-tory Infections vol 15 no 4 pp 287ndash298 2000

[17] S Favre-Bonte J C Pache J Robert D Blanc J C Pechere andC van Delden ldquoDetection of Pseudomonas aeruginosa cell-to-cell signals in lung tissue of cystic fibrosis patientsrdquo MicrobialPathogenesis vol 32 no 3 pp 143ndash147 2002

[18] J G Leid C J Willson M E Shirtliff D J Hassett MR Parsek and A K Jeffers ldquoThe exopolysaccharide alginateprotects Pseudomonas aeruginosa biofilm bacteria from IFN-120574-mediated macrophage killingrdquoThe Journal of Immunology vol175 no 11 pp 7512ndash7518 2005

[19] G W Sundin S Shankar S A Chugani B A Chopade AKavanaugh-Black and AM Chakrabarty ldquoNucleoside diphos-phate kinase from Pseudomonas aeruginosa characterization ofthe gene and its role in cellular growth and exopolysaccharidealginate synthesisrdquo Molecular Microbiology vol 20 no 5 pp965ndash979 1996

[20] J R Wiens A I Vasil M J Schurr and M L Vasil ldquoIron-regulated expression of alginate production mucoid pheno-type and biofilm formation by Pseudomonas aeruginosardquoMBiovol 5 no 1 pp e01010ndashe01013 2014

[21] D J Wozniak T J O Wyckoff M Starkey et al ldquoAlginate isnot a significant component of the extracellular polysaccharidematrix of PA14 and PAO1 Pseudomonas aeruginosa biofilmsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 13 pp 7907ndash7912 2003

[22] D ENivens D EOhman JWilliams andM J Franklin ldquoRoleof alginate and its O acetylation in formation of Pseudomonasaeruginosamicrocolonies and biofilmsrdquo Journal of Bacteriologyvol 183 no 3 pp 1047ndash1057 2001

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

12 The Scientific World Journal

0005

01015

02025

03035

04045

038

677

211

5815

4419

3023

1627

0230

8834

7438

6042

4646

3250

1854

0457

9061

7665

6269

4873

3477

2081

0684

9288

7892

6496

50

RMSD

(nm

)

Time (ps)

(a)

22225

23235

24245

25

038

276

411

4615

2819

1022

9226

7430

5634

3838

2042

0245

8449

6653

4857

3061

1264

9468

7672

5876

4080

2284

0487

8691

6895

5099

32

Radi

us o

f gyr

atio

n (n

m)

Time (ps)

(b)

0005

01015

02025

03035

04045

1 19 37 55 73 91 109

127

145

163

181

199

217

235

253

271

289

307

325

343

361

379

397

415

433

451

469

RMSF

(nm

)

Residue number

(c)

Figure 8 (a)ndash(c) Results from 10 ns molecular dynamics simulation performed on PMMPGM model (a) Root mean square deviation(RMSD) (b) radius of gyration (c) root mean square fluctuation (RMSF)

PMMPGM enzyme from P aeruginosa [42] This indicateda similar function of the enzyme that is a bifunctional rolewhich would be responsible for conversion of mannose-6-phosphate to mannose-1-phosphate or glucose-6-phosphateto glucose-1-phosphate as in P aeruginosa [28]

The active site residues predicted in the PMMPGMenzyme 3D structure were determined by multiple sequencealignments and however needs to be validated by experi-mental analysis In context of sugar binding loop PMMPGMofA baumanniimay also have equal specificity for glucose aswell as mannose because mannose and glucose are epimersat C-2 The active site residues of characterized PMMPGMcomplexes are known to change conformation based on theidentity of the bound ligand andor change the type of contactinwhich they participate [28 52]However a direct structuralcharacterization of multiple enzyme-substrate complexeswould likely be necessary for a full understanding of substratespecificity in this enzyme superfamily Nevertheless the MDsimulation results in this research reveal several regions ofthe PMMPGM enzyme to be highly conserved and clearlyimportant for function in all organisms supporting theproposal that all of these enzymes use a commonmechanismThe algC gene of A baumannii AIIMS 7 characterized in thisstudy is an ortholog of algC gene from P aeruginosa ThePMMPGM protein plays a central role in the productionof three P aeruginosa virulence-associated traits alginaterhamnolipids and LPS although the production of thesecompounds is subjected to a completely different genetic andenvironmental regulation [23 45] The PGM activity of theprotein is involved in synthesis of the LPS core of biofilmswhile PMM activity is responsible for alginate biosynthesisBoth of these (PMMPGM) enzymatic functions either singly

or in combination could be attributed for the biofilm forma-tion in A baumannii AIIMS 7 and augmentation of biofilmsin heterologous clones as observed by SEM It is also con-ceivable therefore that the cloned and overexpressed PGMenzyme (of A baumannii AIIMS 7) might have used up themachinery for cellular LPS core biosynthesis in E coli [25]and could be the possible mechanism behind the overallaugmentation of biofilms in the heterologous algC clones(E coli DH5120572 a relatively weak biofilm former than Abaumannii) as evident from the SEM image analysis Never-theless due to the central role of PMMPGM in biosyntheticpathways the enzyme has potential to serve as a novelmarkerfor A baumannii infection or as pharmaceutical targets forinhibition Such inhibitors would be specific and not affectthe essential homolog in human due to lack of conservationin active site sugar and metal binding site

The mechanism of PMMPGM is believed to be closelyparallel to that of related proteins from other pseudomonadsincluding close relatives like P aeruginosa Our observationson the similarity of the protein sequences and 3D modelsindicate that the PMMPGM protein of A baumanniiAIIMS7 could have a similar biological role in biofilms as seen in Paeruginosa Therefore the dual roles of PMMPGM in algi-nate and LPS biosynthesis enhancing the biofilm formationin A baumannii propose the enzyme as an attractive targetfor inhibitor design

5 Conclusion

This study presents an initial genetic characterization ofalgC gene in an MDR strain A baumannii AIIMS 7 which

The Scientific World Journal 13

demonstrates a quantitative differential expression patternin biofilm cells compared to planktonic counterparts cellsover a temporal scale of 96 h Molecular dynamics (MD)simulation studies indicate that the 3D structure of enzyme(PMMPGM) has functions similar to P aeruginosa whichmight result in significant biofilm augmentation in heterol-ogous algC clones as evident from SEM analysis Theseexperimental lines of evidence collectively suggest that thedifferential algC gene transcription in A baumannii stronglycorrelates with the initial attachment (9 h) and maturationstages (36 h) during the biofilm development however maynot be the only attribute contributing to biofilm formationand could be associated with other factors The PMMPGMenzyme can be a potential drug target for biofilm-associatedinfections of A baumannii as revealed by the 3D structuralsimulation studies

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Dr S Gosavi and Mr A Shinde Depart-ment of Physics University of Pune India for providingthe SEM facility Kailas D Sonawane gratefully acknowledgesUniversity Grants Commission New Delhi Government ofIndia for computational facility support under the schemeUGC SAP DRS-I sanctioned to Department of Biochem-istry Shivaji University Kolhapur India Praveen K Sahuacknowledges University of Pune University with Potentialfor Excellence (UPE Phase-1) for providing a senior researchfellowship

References

[1] M-L Joly-Guillou ldquoClinical impact and pathogenicity ofAcine-tobacterrdquo Clinical Microbiology and Infection vol 11 no 11 pp868ndash873 2005

[2] A Y Peleg H Seifert and D L Paterson ldquoAcinetobacterbaumannii emergence of a successful pathogenrdquoClinicalMicro-biology Reviews vol 21 no 3 pp 538ndash582 2008

[3] L C S Antunes P Visca and K J Towner ldquoAcinetobacter bau-mannii evolution of a global pathogenrdquo Pathogens and Diseasevol 71 no 3 pp 292ndash301 2014

[4] A Y Peleg A deBreijMDAdams et al ldquoThe success ofAcine-tobacter species genetic metabolic and virulence attributesrdquoPLoS ONE vol 7 no 10 Article ID e46984 2012

[5] M J McConnell L Actis and J Pachon ldquoAcinetobacter bau-mannii human infections factors contributing to pathogenesisand animal modelsrdquo FEMS Microbiology Reviews vol 37 no 2pp 130ndash155 2013

[6] S J Wilson C J Knipe M J Zieger et al ldquoDirect costs ofmultidrug-resistant Acinetobacter baumannii in the burn unitof a public teaching hospitalrdquo American Journal of InfectionControl vol 32 no 6 pp 342ndash344 2004

[7] M V Villegas and A I Hartstein ldquoAcinetobacter outbreaks1977ndash2000rdquo Infection Control and Hospital Epidemiology vol24 no 4 pp 284ndash295 2003

[8] A P Tomaras C W Dorsey R E Edelmann and L A ActisldquoAttachment to and biofilm formation on abiotic surfaces byAcinetobacter baumannii involvement of a novel chaperone-usher pili assembly systemrdquo Microbiology vol 149 no 12 pp3473ndash3484 2003

[9] P K Sahu P S Iyer A M Oak K R Pardesi and B AChopade ldquoCharacterization of eDNA from the clinical strainAcinetobacter baumanniiAIIMS 7 and its role in biofilm forma-tionrdquoThe Scientific World Journal vol 2012 Article ID 97343610 pages 2012

[10] H-W Lee Y M Koh J Kim et al ldquoCapacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to formbiofilm and adhere to epithelial cell surfacesrdquo Clinical Micro-biology and Infection vol 14 no 1 pp 49ndash54 2008

[11] A de Breij L Dijkshoorn E Lagendijk et al ldquoDo biofilmformation and interactions with human cells explain the clinicalsuccess of Acinetobacter baumanniirdquo PLoS ONE vol 5 no 5Article ID e10732 2010

[12] L C S Antunes F Imperi A Carattoli and P Visca ldquoDeci-phering the multifactorial nature of Acinetobacter baumanniipathogenicityrdquo PLoS ONE vol 6 no 8 Article ID e22674 2011

[13] J A Gaddy and L A Actis ldquoRegulation of Acinetobacter bau-mannii biofilm formationrdquo FutureMicrobiology vol 4 no 3 pp273ndash278 2009

[14] J W Costerton P S Stewart and E P Greenberg ldquoBacterialbiofilms a common cause of persistent infectionsrdquo Science vol284 no 5418 pp 1318ndash1322 1999

[15] M S Favero R P Gaynes T C Horan et al ldquoNational nosoco-mial infections surveillance (NNIS) report data summary fromOctober 1986-April 1996 issuedMay 1996rdquoAmerican Journal ofInfection Control vol 24 no 5 pp 380ndash388 1996

[16] J Chastre and J-L Trouillet ldquoProblem pathogens (Pseu-domonas aerugınosa and Acınetobacter)rdquo Seminars in Respira-tory Infections vol 15 no 4 pp 287ndash298 2000

[17] S Favre-Bonte J C Pache J Robert D Blanc J C Pechere andC van Delden ldquoDetection of Pseudomonas aeruginosa cell-to-cell signals in lung tissue of cystic fibrosis patientsrdquo MicrobialPathogenesis vol 32 no 3 pp 143ndash147 2002

[18] J G Leid C J Willson M E Shirtliff D J Hassett MR Parsek and A K Jeffers ldquoThe exopolysaccharide alginateprotects Pseudomonas aeruginosa biofilm bacteria from IFN-120574-mediated macrophage killingrdquoThe Journal of Immunology vol175 no 11 pp 7512ndash7518 2005

[19] G W Sundin S Shankar S A Chugani B A Chopade AKavanaugh-Black and AM Chakrabarty ldquoNucleoside diphos-phate kinase from Pseudomonas aeruginosa characterization ofthe gene and its role in cellular growth and exopolysaccharidealginate synthesisrdquo Molecular Microbiology vol 20 no 5 pp965ndash979 1996

[20] J R Wiens A I Vasil M J Schurr and M L Vasil ldquoIron-regulated expression of alginate production mucoid pheno-type and biofilm formation by Pseudomonas aeruginosardquoMBiovol 5 no 1 pp e01010ndashe01013 2014

[21] D J Wozniak T J O Wyckoff M Starkey et al ldquoAlginate isnot a significant component of the extracellular polysaccharidematrix of PA14 and PAO1 Pseudomonas aeruginosa biofilmsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 13 pp 7907ndash7912 2003

[22] D ENivens D EOhman JWilliams andM J Franklin ldquoRoleof alginate and its O acetylation in formation of Pseudomonasaeruginosamicrocolonies and biofilmsrdquo Journal of Bacteriologyvol 183 no 3 pp 1047ndash1057 2001

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

The Scientific World Journal 13

demonstrates a quantitative differential expression patternin biofilm cells compared to planktonic counterparts cellsover a temporal scale of 96 h Molecular dynamics (MD)simulation studies indicate that the 3D structure of enzyme(PMMPGM) has functions similar to P aeruginosa whichmight result in significant biofilm augmentation in heterol-ogous algC clones as evident from SEM analysis Theseexperimental lines of evidence collectively suggest that thedifferential algC gene transcription in A baumannii stronglycorrelates with the initial attachment (9 h) and maturationstages (36 h) during the biofilm development however maynot be the only attribute contributing to biofilm formationand could be associated with other factors The PMMPGMenzyme can be a potential drug target for biofilm-associatedinfections of A baumannii as revealed by the 3D structuralsimulation studies

Conflict of Interests

The authors declare that there is no conflict of interestsregarding the publication of this paper

Acknowledgments

The authors thank Dr S Gosavi and Mr A Shinde Depart-ment of Physics University of Pune India for providingthe SEM facility Kailas D Sonawane gratefully acknowledgesUniversity Grants Commission New Delhi Government ofIndia for computational facility support under the schemeUGC SAP DRS-I sanctioned to Department of Biochem-istry Shivaji University Kolhapur India Praveen K Sahuacknowledges University of Pune University with Potentialfor Excellence (UPE Phase-1) for providing a senior researchfellowship

References

[1] M-L Joly-Guillou ldquoClinical impact and pathogenicity ofAcine-tobacterrdquo Clinical Microbiology and Infection vol 11 no 11 pp868ndash873 2005

[2] A Y Peleg H Seifert and D L Paterson ldquoAcinetobacterbaumannii emergence of a successful pathogenrdquoClinicalMicro-biology Reviews vol 21 no 3 pp 538ndash582 2008

[3] L C S Antunes P Visca and K J Towner ldquoAcinetobacter bau-mannii evolution of a global pathogenrdquo Pathogens and Diseasevol 71 no 3 pp 292ndash301 2014

[4] A Y Peleg A deBreijMDAdams et al ldquoThe success ofAcine-tobacter species genetic metabolic and virulence attributesrdquoPLoS ONE vol 7 no 10 Article ID e46984 2012

[5] M J McConnell L Actis and J Pachon ldquoAcinetobacter bau-mannii human infections factors contributing to pathogenesisand animal modelsrdquo FEMS Microbiology Reviews vol 37 no 2pp 130ndash155 2013

[6] S J Wilson C J Knipe M J Zieger et al ldquoDirect costs ofmultidrug-resistant Acinetobacter baumannii in the burn unitof a public teaching hospitalrdquo American Journal of InfectionControl vol 32 no 6 pp 342ndash344 2004

[7] M V Villegas and A I Hartstein ldquoAcinetobacter outbreaks1977ndash2000rdquo Infection Control and Hospital Epidemiology vol24 no 4 pp 284ndash295 2003

[8] A P Tomaras C W Dorsey R E Edelmann and L A ActisldquoAttachment to and biofilm formation on abiotic surfaces byAcinetobacter baumannii involvement of a novel chaperone-usher pili assembly systemrdquo Microbiology vol 149 no 12 pp3473ndash3484 2003

[9] P K Sahu P S Iyer A M Oak K R Pardesi and B AChopade ldquoCharacterization of eDNA from the clinical strainAcinetobacter baumanniiAIIMS 7 and its role in biofilm forma-tionrdquoThe Scientific World Journal vol 2012 Article ID 97343610 pages 2012

[10] H-W Lee Y M Koh J Kim et al ldquoCapacity of multidrug-resistant clinical isolates of Acinetobacter baumannii to formbiofilm and adhere to epithelial cell surfacesrdquo Clinical Micro-biology and Infection vol 14 no 1 pp 49ndash54 2008

[11] A de Breij L Dijkshoorn E Lagendijk et al ldquoDo biofilmformation and interactions with human cells explain the clinicalsuccess of Acinetobacter baumanniirdquo PLoS ONE vol 5 no 5Article ID e10732 2010

[12] L C S Antunes F Imperi A Carattoli and P Visca ldquoDeci-phering the multifactorial nature of Acinetobacter baumanniipathogenicityrdquo PLoS ONE vol 6 no 8 Article ID e22674 2011

[13] J A Gaddy and L A Actis ldquoRegulation of Acinetobacter bau-mannii biofilm formationrdquo FutureMicrobiology vol 4 no 3 pp273ndash278 2009

[14] J W Costerton P S Stewart and E P Greenberg ldquoBacterialbiofilms a common cause of persistent infectionsrdquo Science vol284 no 5418 pp 1318ndash1322 1999

[15] M S Favero R P Gaynes T C Horan et al ldquoNational nosoco-mial infections surveillance (NNIS) report data summary fromOctober 1986-April 1996 issuedMay 1996rdquoAmerican Journal ofInfection Control vol 24 no 5 pp 380ndash388 1996

[16] J Chastre and J-L Trouillet ldquoProblem pathogens (Pseu-domonas aerugınosa and Acınetobacter)rdquo Seminars in Respira-tory Infections vol 15 no 4 pp 287ndash298 2000

[17] S Favre-Bonte J C Pache J Robert D Blanc J C Pechere andC van Delden ldquoDetection of Pseudomonas aeruginosa cell-to-cell signals in lung tissue of cystic fibrosis patientsrdquo MicrobialPathogenesis vol 32 no 3 pp 143ndash147 2002

[18] J G Leid C J Willson M E Shirtliff D J Hassett MR Parsek and A K Jeffers ldquoThe exopolysaccharide alginateprotects Pseudomonas aeruginosa biofilm bacteria from IFN-120574-mediated macrophage killingrdquoThe Journal of Immunology vol175 no 11 pp 7512ndash7518 2005

[19] G W Sundin S Shankar S A Chugani B A Chopade AKavanaugh-Black and AM Chakrabarty ldquoNucleoside diphos-phate kinase from Pseudomonas aeruginosa characterization ofthe gene and its role in cellular growth and exopolysaccharidealginate synthesisrdquo Molecular Microbiology vol 20 no 5 pp965ndash979 1996

[20] J R Wiens A I Vasil M J Schurr and M L Vasil ldquoIron-regulated expression of alginate production mucoid pheno-type and biofilm formation by Pseudomonas aeruginosardquoMBiovol 5 no 1 pp e01010ndashe01013 2014

[21] D J Wozniak T J O Wyckoff M Starkey et al ldquoAlginate isnot a significant component of the extracellular polysaccharidematrix of PA14 and PAO1 Pseudomonas aeruginosa biofilmsrdquoProceedings of the National Academy of Sciences of the UnitedStates of America vol 100 no 13 pp 7907ndash7912 2003

[22] D ENivens D EOhman JWilliams andM J Franklin ldquoRoleof alginate and its O acetylation in formation of Pseudomonasaeruginosamicrocolonies and biofilmsrdquo Journal of Bacteriologyvol 183 no 3 pp 1047ndash1057 2001

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

14 The Scientific World Journal

[23] N A Zielinski A M Chakrabarty and A Berry ldquoCharacteri-zation and regulation of the Pseudomonas aeruginosa algC geneencoding Phosphomannomutaserdquo The Journal of BiologicalChemistry vol 266 no 15 pp 9754ndash9763 1991

[24] M J Coyne Jr K S Russell C L Coyle and J B GoldbergldquoThe Pseudomonas aeruginosa algC gene encodes phosphoglu-comutase required for the synthesis of a complete lipopolysac-charide corerdquo Journal of Bacteriology vol 176 no 12 pp 3500ndash3507 1994

[25] M Lu and N Kleckner ldquoMolecular cloning and character-ization of the pgm gene encoding phosphoglucomutase ofEscherichia colirdquo Journal of Bacteriology vol 176 no 18 pp5847ndash5851 1994

[26] J B Goldberg K Hatano and G B Pier ldquoSynthesis oflipopolysaccharide O side chains by Pseudomonas aeruginosaPAO1 requires the enzyme phosphomannomutaserdquo Journal ofBacteriology vol 175 no 6 pp 1605ndash1611 1993

[27] G S Shackelford C A Regni and L J Beamer ldquoEvolutionarytrace analysis of the 120572-D-phosphohexomutase superfamilyrdquoProtein Science vol 13 no 8 pp 2130ndash2138 2004

[28] R W Ye N A Zielinski and A M ChakrabartyldquoPurification and characterization of phosphomannomutasephosphoglucomutase from Pseudomonas aeruginosa involvedin biosynthesis of both alginate and lipopolysacchariderdquo Jour-nal of Bacteriology vol 176 no 16 pp 4851ndash4857 1994

[29] N K Pour D H Dusane P K Dhakephalkar F R ZaminS S Zinjarde and B A Chopade ldquoBiofilm formation byAcinetobacter baumannii strains isolated from urinary tractinfection and urinary cathetersrdquo FEMS Immunology and Medi-cal Microbiology vol 62 no 3 pp 328ndash338 2011

[30] E K Davenport R C Douglas and H Beyenal ldquoDiffer-ential protection from tobramycin by extracellular polymericsubstances from Acinetobacter baumannii and Staphylococcusaureus biofilmsrdquo Antimicrobial Agents and Chemotherapy vol58 no 8 pp 4755ndash4761 2014

[31] T A Russo J M Beanan R Olson et al ldquoThe K1 capsularpolysaccharide from Acinetobacter baumannii Is a potentialtherapeutic target via passive immunizationrdquo Infection andImmunity vol 81 no 3 pp 915ndash922 2013

[32] M W Pfaffl ldquoA new mathematical model for relative quantifi-cation in real-time RT-PCRrdquoNucleic Acids Research vol 29 no9 article e45 2001

[33] M A Larkin G Blackshields N P Brown et al ldquoClustalW andClustal X version 20rdquo Bioinformatics vol 23 no 21 pp 2947ndash2948 2007

[34] K Tamura D Peterson N Peterson G Stecher M Nei andS Kumar ldquoMEGA5 molecular evolutionary genetics analysisusing maximum likelihood evolutionary distance and max-imum parsimony methodsrdquo Molecular Biology and Evolutionvol 28 no 10 pp 2731ndash2739 2011

[35] A Sali and T L Blundell ldquoComparative protein modelling bysatisfaction of spatial restraintsrdquo Journal of Molecular Biologyvol 234 no 3 pp 779ndash815 1993

[36] D Van Der Spoel E Lindahl B Hess G Groenhof A E Markand H J C Berendsen ldquoGROMACS fast flexible and freerdquoJournal of Computational Chemistry vol 26 no 16 pp 1701ndash1718 2005

[37] GN Tseng K D Sonawane Y V Korolkova et al ldquoProbing theouter mouth structure of the hERG channel with peptide toxinfootprinting and molecular modelingrdquo Biophysical Journal vol92 no 10 pp 3524ndash3540 2007

[38] J Dundas Z Ouyang J Tseng A Binkowski Y Turpaz andJ Liang ldquoCASTp computed atlas of surface topography ofproteins with structural and topographical mapping of func-tionally annotated residuesrdquo Nucleic Acids Research vol 34 ppW116ndashW118 2006

[39] E Krissinel and K Henrick ldquoSecondary-structure matching(SSM) a new tool for fast protein structure alignment in threedimensionsrdquo Acta Crystallographica Section D Biological Crys-tallography vol 60 no 12 pp 2256ndash2268 2004

[40] W Humphrey A Dalke and K Schulten ldquoVMD visual molec-ular dynamicsrdquo Journal of Molecular Graphics vol 14 no 1pp 33ndash38 1996

[41] E F Pettersen T D Goddard C C Huang et al ldquoUCSFChimeramdasha visualization system for exploratory research andanalysisrdquo Journal of Computational Chemistry vol 25 no 13pp 1605ndash1612 2004

[42] C Regni P A Tipton and L J Beamer ldquoCrystal structure ofPMMPGM an enzyme in the biosynthetic pathway of Paeruginosa virulence factorsrdquo Structure vol 10 no 2 pp 269ndash279 2002

[43] G Gaona C Nunez J B Goldberg et al ldquoCharacterization ofthe Azotobacter vinelandii algC gene involved in alginate andlipopolysaccharide productionrdquo FEMS Microbiology Lettersvol 238 no 1 pp 199ndash206 2004

[44] S-S Yoon S-H Park Y-C Kim M Shin C-K Chong and J-D Choi ldquoCloning and characterization of phosphoglucomutaseand phosphomannomutase derived from Sphingomonas chung-bukensis DJ77rdquo Journal of Biochemistry vol 144 no 4 pp 507ndash512 2008

[45] D G Davies and G G Geesey ldquoRegulation of the alginatebiosynthesis gene algC in Pseudomonas aeruginosa duringbiofilm development in continuous culturerdquo Applied and Envi-ronmental Microbiology vol 61 no 3 pp 860ndash867 1995

[46] D G Davies A M Chakrabarty and G G Geesey ldquoExopoly-saccharide production in biofilms substratum activation ofalginate gene expression by Pseudomonas aeruginosardquo Appliedand Environmental Microbiology vol 59 no 4 pp 1181ndash11861993

[47] P Gacesa ldquoBacterial alginate biosynthesismdashrecent progress andfuture prospectsrdquo Microbiology vol 144 no 5 pp 1133ndash11431998

[48] A S Bayer F Eftekhar J Tu C C Nast and D P SpeertldquoOxygen-dependent up-regulation of mucoid exopolysaccha-ride (alginate) production in Pseudomonas aeruginosardquo Infec-tion and Immunity vol 58 no 5 pp 1344ndash1349 1990

[49] J D DeVault A Berry T K Misra A Darzins and A MChakrabarty ldquoEnvironmental sensory signals and microbialpathogenesis Pseudomonas aeruginosa infection in cystic fibro-sisrdquo BioTechnology vol 7 no 4 pp 352ndash357 1989

[50] J D DeVault K Kimbara and A M Chakrabarty ldquoPulmonarydehydration and infection in cystic fibrosis evidence thatethanol activates alginate gene expression and induction ofmucoidy in Pseudomonas aeruginosardquo Molecular Microbiologyvol 4 no 5 pp 737ndash745 1990

[51] MM Harding ldquoGeometry of metal-ligand interactions in pro-teinsrdquo Acta Crystallographica Section D Biological Crystallogra-phy vol 57 no 3 pp 401ndash411 2001

[52] C Regni L Naught P A Tipton and L J Beamer ldquoStructuralbasis of diverse substrate recognition by the enzyme PMMPGM from P aeruginosardquo Structure vol 12 no 1 pp 55ndash632004

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology

Submit your manuscripts athttpwwwhindawicom

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Anatomy Research International

PeptidesInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporation httpwwwhindawicom

International Journal of

Volume 2014

Zoology

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Molecular Biology International

GenomicsInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

The Scientific World JournalHindawi Publishing Corporation httpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioinformaticsAdvances in

Marine BiologyJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Signal TransductionJournal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

BioMed Research International

Evolutionary BiologyInternational Journal of

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Biochemistry Research International

ArchaeaHindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Genetics Research International

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Advances in

Virolog y

Hindawi Publishing Corporationhttpwwwhindawicom

Nucleic AcidsJournal of

Volume 2014

Stem CellsInternational

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

Enzyme Research

Hindawi Publishing Corporationhttpwwwhindawicom Volume 2014

International Journal of

Microbiology