Associations of the Interleukin-1 Gene Locus Polymorphisms with Risk to Hip and Knee Osteoarthritis:...

Associations of the Interleukin-1 Gene LocusPolymorphisms with Risk to Hip and KneeOsteoarthritis: Gender and Subpopulation Differences

M. H. Kaarvatn*†, Z. Jotanovic‡, R. Mihelic‡, G. E. Etokebe*, B. Mulac-Jericevic§, T. Tijanic§,S. Balen¶, B. Sestan‡ & Z. Dembic*

*Department of Oral Biology, Faculty of

Dentistry, Molecular Genetics Laboratory,

University of Oslo, Oslo, Norway; †School ofMedicine, University of Oslo, Oslo, Norway;

‡Clinic For Orthopaedic Surgery Lovran, School

of Medicine, University of Rijeka, Rijeka, Croatia;

§Department of Physiology and Immunology,

School of Medicine, University of Rijeka, Rijeka,

Croatia; and ¶Clinical Institute for Transfusion

Medicine, Universal Hospital Center Rijeka,

School of Medicine, University of Rijeka, Rijeka,

Croatia

Received 18 October 2012; Accepted in revisedform 25 November 2012

Correspondence to: Z. Dembic, Department of

Oral Biology, Sognsvannsveien 10, PB 1052

Blindern, 0316 Oslo, Norway. E-mail: zlatkod@

odont.uio.no

Abstract

Genetic predisposition to the complex hereditary disease like osteoarthritis (OA)of the large joints (hip and knee) includes the interleukin-1 gene (IL-1) cluster onchromosome 2. Using a case–control study with 500 OA patients (240 knee and260 hip OA patients, all with joint replacement), we analysed frequencies of IL-1gene cluster polymorphisms in Croatian Caucasian population. The controlsamples came from 531 healthy individuals including blood donors. Wegenotyped two single nucleotide polymorphisms in the IL-1 gene locus at IL-1A(�889, C>T, rs1800587) and IL-1B (+3594, C>T, rs1143634) and comparedtheir frequencies between patients and controls. We predicted haplotypes bycombining current data with our previous results on gene polymorphisms (IL-1B, rs16944 and the IL-1 receptor antagonist gene [IL-1RN] variable numbertandem repeat [VNTR]) for the same population. Haplotype analyses revealedgender disparities and showed that women carriers of the 1-2-1-1 haplotype [IL-1A(rs1800587) – IL-1B(rs1143634) – IL-1B(rs16944) – IL-1RN(VNTR)] hadsixfold lower risk to develop knee OA. However, carriers of the 1-1-1-2haplotype of both sexes had over twofold higher predisposition to hip OA. Ourresults differ from some earlier studies in Caucasian subpopulations, which maybe due to the fact that this is the first study to separate genders in assessing theIL-1-locus genetic risk of OA. The results suggest that inflammatory mediatorslike IL-1 might be implicated in the pathogenesis of primary OA in large jointsand that as yet unidentified gender-specific factors exist in a Croatian Caucasianpopulation.

Introduction

Osteoarthritis (OA) is a chronic, incapacitating andprogressive disease of the joints resulting in a substantialmedical, social and economic burden. It has a highincidence and prevalence in middle- and older-agedpersons. There is thus a need for research identifyingaetiological and predictive factors that may ultimately leadto novel treatments of the disease. OA has two main types:(1) primary, with the late onset, and (2) secondary, which isdistinguished by the early onset with largely known causeslike developmental abnormalities and trauma. However,the reasons for developing the primary disease have notbeen completely understood. Many factors are thought toinfluence the risk of OA, and they include gender, age,behaviour, obesity, and occupation alongside ethnicity andother genetic components [1, 2]. Genetic linkage and

family studies have suggested that complex geneticinheritance plays a major role in susceptibility to primaryOA [3–11]. Furthermore, there are differences in risks atdifferent large joints, and men have 45% lower incidentrisk of knee OA (KOA) and 36% reduced risk of hip OA(HOA) than women [12].

One of the genetic loci that might contribute to risk isthe interleukin-1 gene (IL-1) cluster on chromosome 2 (ntposition 113 531 492–113 891 593; 2q13–2q14.1). Itcomprises nine genes: IL-1A, IL-1B, IL-1 receptor antag-onist (IL-1RN, encoding IL-1RA cytokine), and six IL-1-like factor genes (IL-1F5- IL-1F10) [13]. Recently, exceptfor the IL-1F10 gene, the IL-1-like group was renamed(Fig. 1). They became the IL-36 family (encoding IL-36c,a and b and IL-36 receptor antagonist cytokines) and theIL-37 genes [14]. The interleukin-1 (IL-1) family ofmolecules (IL-1a, IL-1b and IL-1RA) together with other

� 2012 The Authors.

Scandinavian Journal of Immunology © 2012 Blackwell Publishing Ltd. 151

HUMAN IMMUNO LOG Y doi: 10.1111/sji.12016..................................................................................................................................................................

pro-inflammatory cytokines (TNFa and IL-6) all play a rolein joint destruction, probably through production ofnumerous proteases that can degrade cartilage extracellularmatrix proteins [5]. The IL-36 family and the IL-37cytokines share basic structural features of the IL-1cytokine family. Recent studies of the IL-36 cytokinespoint to important roles in inflammatory skin diseases likepsoriasis [14]. IL-36a exerts pro-inflammatory effectsin lungs of mice without the contribution of IL-1a orIL-1b [15].

In the recent decade, case–control studies regardinggenetic susceptibility to HOA and KOA producedcontradictory results in different populations [13, 16,17]. Smith et al. (UK) showed that HOA might bedifferent from the KOA using polymorphic markerswithin the IL-1 gene cluster and combining them into‘extended-risk haplotypes’ [18, 19] (Fig. 1). Similarly, a

study by Moxely et al. (USA) demonstrated that theextended-risk IL-1 gene cluster haplotype conferred ahigher risk to the development of hand OA [20]. Recentmeta-analysis of the IL-1B and IL-1RN loci added tocontroversy on the influence of IL-1 cytokine in developingHOA and KOA [21, 22].

Complex hereditary diseases, such as primary OA oflarge joints, tend to have variations in genetic risk factorsin diverse subpopulations. The aim of this case–controlstudy was to analyse IL-1 gene locus polymorphisms inCroatian knee and hip OA patients and compare them withresults in other populations. We have published recently apart of this study regarding two polymorphisms in the IL-1B and IL-1RN genes [23, 24]. Here, we extend it byanalysing associations of four-marker extended-risk IL-1gene locus haplotypes with hip and knee OA and focusedon gender differences.

Figure 1 Osteoarthritis of hip and knee and the IL-1 gene locus extended-risk haplotypes: comparison between various case–control studies. Haplotypes

are represented as parallelograms encompassing SNP and VNTR alleles. Ctrl, controls; THR, total hip replacement; TKR, total knee replacement; ROA,

radiographic osteoarthritis. 1M>m, major (M) and minor (m) SNP alleles (below, 1 represents M and 2 is m allele for all SNP loci; designated VNTR

alleles have 1 – four repeats, 2 – two repeats, 3 – five repeats and 4 – three repeats). 2In the paper by Attur et al. [42], ROA of the knee was analysed only

in cases without healthy controls by comparing two groups: one with the Kellgren–Lawrence score 1–2 (KL-1/2) to the other one with score 3–4 (KL-3/4).3Alleles in brackets denote additional SNP adjacent to the one depicted above, but not positioned on the map due to lack of space. In the row starting with

reference Chapman [41], an adjacent SNP allele was depicted instead of the IL-1RN VNTR, due to a tight linkage disequilibrium between them. Thus,

such marker for IL-1RN VNTR allele 2 was denoted as (2). The odds ratio (OR) is to the right of haplotype or loci parallelograms indicating a possible

association with either susceptibility (if above 1) or protection (if below 1). To help distinguish these, susceptibility to OA is depicted by the light-shaded

parallelograms, protective haplotypes by the dark-shaded ones and haplotypes (or loci) in between these extremes represent not significantly different ones.

Next to the OR, 95% confidence interval (95% CI) was used to better illustrate our present and published work. Asterisk in brackets (*) indicates that95% CI was not specified; and ‘n’ - denotes the number of individuals in the studies.

Scandinavian Journal of Immunology, 2013, 77, 151–161

152 Gender Differences in IL-1 Gene Locus Polymorphisms in Hip and Knee OA M. H. Kaarvatn et al...................................................................................................................................................................

Methods

Participants

The study included a total of 500 Croatian OA patientstreated in the ‘Clinic for Orthopaedic Surgery Lovran’,School of Medicine, University of Rijeka. There were 240KOA patients that comprised 174 female (72.3%) and 66male persons of average age (�standard deviation) 69.7(�7.24), with a range from 47 to 86 years. Of 260 HOApatients, 175 were women (67.5%) and 85 men with amean age of 67.8 years (�9.61) and a range between 31and 90 years. The criterion for admission of patients inthe study was clinically and radiologically confirmeddiagnosis of the OA and informed consent to donate bloodfor research purposes after surgery. The clinical criteriawere guidelines for the classification of OA in knee andhip by the American College of Rheumatology [25, 26]and Western Ontario and McMaster Universities’ Osteo-arthritis index [27] to assess pain, joint stiffness andphysical function in OA patients. Radiological criteria forthe assessment of the KOA and HOA were Kellgren–Lawrence grading scale [28]. For KOA patients, criteria fortotal joint replacement (TKR) were according to theNational Institutes of Health Consensus Statement thatincluded joint pain, functional limitation (average grade,62; range, 51–72) and radiographic evidence of jointdamage (average K/L score >2; 90% of patients scored 3 or4) [29]. Conditions for partial (unicondylar) knee replace-ment (PKR) were as follows: age over 55, body mass indexup to 25, radiographic evidence of unicondylar KOAwithout significant degenerative changes in other com-partments (medial, lateral or patellofemoral) of the knee,intact anterior cruciate ligament, varus deformity less than15°, valgus deformity less than 20°, flexion contractureless than 15° and flexion of the knee up to 110° [30].Criteria for total hip replacement (THR) also followed theNational Institutes of Health Consensus Statement thatinclude joint pain, functional limitation (average grade,66; range, 55–75) and radiographic evidence of jointdamage (K/L score >2; 90% of patients scored 3 or 4) [31].We excluded from the study patients with secondaryforms of KOA and HOA and patients with rheumatoidarthritis.

Control individuals were 531 healthy individualsincluding blood donors (mean age: 42.3 � 11.9, range:19–91, 25% women) without clinical manifestation ofOA. Blood samples were collected in the ‘Clinical Institutefor Transfusion Medicine’, University Hospital CenterRijeka.

The ethnicity was established by patient or individualinterview and by consulting the admission documentationat the hospitals.

For gender and best-fit age-matched case–controlanalyses, we selected 480 OA (233 KOA and 247 HOA)

patients and 130 controls of previously analysed groupswith all samples. The resulting percentage of women inKOA and HOA cases was 69.4%, and in the control group70.4%. The mean age for cases and controls was 68.3(�7.99) and 51.4 (�9.5) years, respectively (a non-significant difference). The average body mass index(BMI) between cases and controls was similar: the caseshad 29.4 (�4.5) and the controls 28.1 (�4.2).

The study was approved by the Medical ethicscommittees of the Clinic for Orthopaedic Surgery Lovran,School of Medicine, University of Rijeka, and ClinicalHospital Center Rijeka, Croatia.

DNA isolation

The blood was taken from OA patients during PKR, TKRor THR surgery and genomic DNA extracted as reportedpreviously [23, 24]. In detail, for the extraction of genomicDNA, 200 ll of whole blood was mixed with 400 ll ofsucrose buffer (0.32 M sucrose, 10 mM Tris-HCl pH 7.5,5 mM MgCl2, 1% v/v Triton X-100) and incubated for1 min at room temperature. To collect white cell nuclei,samples were centrifuged 2 min at 5000 g. Precipitatednuclei were washed twice with 800 ll of sucrose buffer andcentrifuged (2 min at 5000 g). After the second wash, thenuclei were suspended in 400 ll DNAzol (InvitrogenCorporation, Carlsbad, CA, USA) and incubated at roomtemperature for 5 min. Genomic DNA was then precip-itated with 200 ll of 100% ethanol and pelleted bycentrifugation (2 min at 5000 g). The precipitate waswashed twice with 1 ml of 75% ethanol and centrifuged(1 min at 5000 g). Genomic DNA was dissolved in 100 llof 8 mM NaOH and allowed to solubilize for 15 min atroom temperature. HEPES buffer (16 mM HEPES in 8 mM

NaOH, pH 7.5) was used to adjust the pH 7.0–8.4. Theaverage concentration of genomic DNA was 30 lg/mlwith 260/280 OD ratio higher than 1.7. Genomic DNAfrom healthy individuals and blood donors was isolated bythe salting-out procedure using commercially available kit(Qiagen GmbH, Hilden, Germany) as reported earlier [32].

SNP analyses

Allele discrimination assays were performed by the Taq-Man PCR method (Applied Biosystems, San Jose, CA,USA) using real-time qPCR machine MX3005P with itssoftware (Agilent, Stratagene, CA, USA). The alleles of theIL-1A SNP at �889 (C>T, rs1800587) and IL-1B SNP at+3954 (C>T, rs1143634) were detected using primers andprobes reported previously [20] (Table S1) that weresynthesized (Biochemistry department, Oslo ResearchPark, University of Oslo) for this purpose. Probes werelabelled at the 5′ end with fluorescent dyes FAM for Cs andHEX for Ts of both rs1800587 and rs1143634 SNPs, andat the 3′ end with the non-fluorescent (zero) quencher. The


Scandinavian Journal of Immunology © 2012 Blackwell Publishing Ltd.

M. H. Kaarvatn et al. Gender Differences in IL-1 Gene Locus Polymorphisms in Hip and Knee OA 153..................................................................................................................................................................

IL-1B (�511, rs16944) SNP was analysed as describedpreviously [23, 24]. The IL-1RN VNTR polymorphism,published previously in refs [19, 20] (Table S1), waschecked by using a primer combination Fw: 5′-CCCCTCAGCAACACTCCTAT-3′ and Rv: 5′-GGTCAGAAGGGCAGAGA-3′. The Fw primer included three extranucleotides 5′ to a F1 primer (ctcagcaacactcctat) reportedpreviously [33, 34]. The Rv primer is different thanpreviously published by others [33, 35] and had only a partof the R2 primer (gtcagaagggcagagaggtctcatc) describedpreviously by Tseng et al. [34]. The Fw/Rv pair of primersdetected 2, 3, 4 or more 86-bp repeats in the intron 2 ofthe IL-1RN gene, similarly as reported previously [33], butavoiding a SNP in the R1 primer that might have causedmistyping (Tseng). PCRs were performed in total volumeof 10 ll containing 10 mM Tris-HCl (pH 8.3), 50 mM

KCl, 2 lM primers (each), 1,2 mM MgCl2, 0,2 mM deoxy-ribonucleotides, 0.25 units of Taq DNA Polymerase(Fermentas, Thermo Fisher Scientific, Waltham, MA,USA) and the template. The PCR amplification conditionsconsisted of 40 cycles of denaturation at 95 °C for 10 s,annealing at 59 °C for 20 s and elongation at 72 °C for90 s after initial preheating at 95 °C for 1 min. The PCRproducts were detected by 2% agarose gel electrophoresisstained with ethidium bromide, using a 100-bp DNAladder (GeneRulere, Fermentas, Fisher Scientific, Pitts-burg, PA, USA) as a marker for fragment length. Theretyping corroborated and extended our previous results(Table S2). However, not all samples were typed for thesefour markers and hence the variability in the number ofalleles, haplotypes and genotypes given in tables.

Statistical analyses

We used contingency table analysis and chi-square method(STATCALC program, ACASTAT software; and web-based javaprogram at www.statpages.org/ctab 2x2.html) for compar-ing genetic data between cases and controls. For age andgender differences, we used Mann–Whitney U-test. Fortrend analysis, we used Cochran–Armitage test by PLINK

software [36]. The prediction of haplotypes for the IL-1gene cluster was done by the command-line program‘Phase’ [37, 38]. The linkage disequilibrium and Hardy–Weinberg equilibrium were analysed by the ARLEQUIN

software v3.5 (Genetics and Biometry Laboratory, Univer-sity of Geneva, Switzerland). Strong linkage disequilib-rium (LD) was found between adjacent loci within IL-1Aand IL-1B. Regarding correction for multiple comparisons,testing one marker (in linkage disequilibrium withanother) would be the same as testing the other. Thus, insingle-locus allelic analyses, we used correction for multi-ple comparisons (Bonferroni) by multiplying the P-valuesby two, as there was no linkage disequilibrium betweentwo non-adjacent loci, IL-1B and IL-1RN. For haplotypeanalyses, a more stringent (conservative) Bonferroni correc-

tion was applied as there were 12 predicted haplotypes andsuch prediction assumes that there are no linkage disequi-libriums between the studied four loci. Thus, all P-valuesin Tables 2–6 were corrected by a multiple of 4. However,such highly stringent correction is speculative as wehypothesize the non-existence of LD, which is actually notthe case. Thus, such correction is addressed in the text ashighly conservative. All loci were in Hardy–Weinbergequilibrium.

Results

Single allele and genotype frequencies

To analyse extended-risk haplotypes of the IL-1 gene locusin Croatian Caucasian population, we determined allelicand genotypic frequencies of the four IL-1-genetic-regionpolymorphic markers in 500 osteoarthritis patients (240KOA and 260 HOA), who had undergone partial or totaljoint replacements and then compared them with 508healthy individuals including blood donors. The polymor-phisms comprised three SNPs at the IL-1A and IL-1Bgenes, and a VNTR at the IL-1 receptor antagonist gene(IL-1RN). We compared here the IL-1A (�889) and IL-1B(+3954) SNP frequencies, which are presented in Table 1,as the other two polymorphisms (IL-1B -511 and IL-1RNVNTR) were reported previously [23, 24]. Allelic fre-quency analysis revealed that frequencies of the IL-1A(�889) and IL-1B (+3954) SNPs were not statisticallydifferent between patients and controls (Table 1). We haveretyped IL-1RN VNTR polymorphisms of cases andcontrols (Table S2). We extended previously publishedresults [23, 24]; however, the differences between allelicand genotypic frequencies remained unchanged from thepublished ones, which were slight and not significant.These typings were then used as the basis for haplotypepredictions in the following step.

Haplotype analysis

We predicted the IL-1 gene locus haplotypes by combiningIL-1A (�889) and IL-1B (+3954) SNPs (Table 1) with theIL-1B (�511) polymorphism reported previously [23, 24]and the IL-1RN VNTR polymorphism (Table S2). Thesefour markers encompass 345.2 kbp of DNA on chromo-some 2 that contains nine genes. Thus, a particularhaplotype might provide a signature of an influence of anyof the alleles present. We compared frequencies of four-marker IL-1 gene locus haplotypes between KOA andHOA patients with controls (Tables 2 and 3, respectively).Knee OA patients (n = 238, Table 2A) carried lessfrequently the haplotype 1-2-1-1 compared with controls.This difference is statistically significant (Pcorr < 0.05) andsuggests that 1-2-1-1 haplotype is associated with approx-imately threefold lower risk to KOA (OR: 0.31; 95% CI:



0.11–0.84). Interestingly, this difference became highlysignificant (Pcorr < 0.001) in more stringently gender andbest-fit age-matched comparison further halving the risk toa sixfold protection in (up to 6%) healthy individuals(Table 2B).

Hip OA patients (n = 259, Table 3A) showed higherfrequency of the haplotype 1-1-1-2 than the controls. Thisdifference was significant (Pcorr < 0.028; OR: 1.75, 95%CI: 1.13-2.7) and suggests that this haplotype might beassociated with 75% higher susceptibility to HOA.However, in sex- and (our best fit) age-matched analysis(Table 3B), this difference appeared not significant(Pcorr < 0.13, OR: 2.02, 95% CI: 1.01–4.12). In addition,the gender and best-fit age-matched analysis showed apossible association of the 1-2-1-1 haplotype with approx-imately threefold lower risk to hip OA (Table 3B) that wassignificant after a stringent multiple-testing correction(Pcorr < 0.044; OR: 0.37, 95% CI: 0.16–0.87).

Furthermore, when gender differences were fully takeninto consideration (Table 4), women (but not men) hadsixfold lower risk (Pcorr < 0.004; OR: 0.14, 95% CI: 0.03–0.54) to develop KOA, if they carried 1-2-1-1 haplotype.Women had also over two-and-half times higher risk todevelop HOA (OR: 2.56, 95% CI: 1.10–6.19) providedthey had 1-1-1-2 haplotype, but the difference was notsignificant (Pcorr < 0.08) due to highly stringent multiple-testing correction. In addition, women had two differences

between controls and HOA patients in frequencies of 1-1-2-1 and 1-2-1-1 haplotypes (Table 4), but the P-valuesbecame not significant after Bonferroni corrections.

On the other hand, men had no differences in haplotypeanalyses with both KOA and HOA (Table 4) except for the2-1-1-1 haplotype that appeared to be significantlyassociated with 3.6-fold increased risk of KOA(P = 0.011; Pcorr = 0.044). However, the frequency ofthis haplotype was irreproducible. Namely, the Phaseprogram predicted two different outcomes for the samecontrol population, which mainly affected analyses in malesubgroups. The 2-1-1-1 haplotype had a predictedfrequency of 1.3% in the control group of men analysedtogether with KOA patients. However, when analysedwith HOA (instead of KOA) patients, the predictedfrequency more than doubled (2.9%). Because of thisinconsistency, we deemed the difference in frequencies ofthe 2-1-1-1 haplotype between male KOA patients andmale controls insignificant.

Genotype analysis

The overall number of possible genotypes was different inHOA and KOA, as the Phase program varied its predic-tions of haplotypes. In the HOA–control paired group, theestimation produced 28 haplotypes, whereas in the KOA–control pair, the program predicted 25 haplotypes. In

Table 1 Association analysis of IL-1A and IL-1B SNPs in patients (Pt) with hip and knee osteoarthritis (OA) in the Croatian population.

HOA Pt KOA Pt C P (HOA Pt vs C) OR (95% CI) P (KOA Pt vs C) OR (95% CI)

Allele frequencya

IL-1Ab SNP �889

rs1800587

N = 520 N = 470 N = 1048

1 C 0.700 (364) 0.662 (311) 0.705 (739) 0.83 0.98 (0.77–1.24) 0.09 0.82 (0.64–1.04)2 T 0.300 (156) 0.338 (159) 0.295 (309) 0.83 1.02 (0.81–1.30) 0.09 1.22 (0.96–1.55)

IL-1Bb SNP 3954

rs1143634

N = 518 N = 480 N = 1062

1 C 0.757 (392) 0.760 (365) 0.741 (787) 0.5 1.09 (0.85–1.40) 0.42 1.11 (0.86–1.44)2 T 0.243 (126) 0.240 (115) 0.259 (275) 0.5 0.92 (0.72–1.18) 0.42 0.90 (0.70–1.17)

Genotype frequencya

IL-1Ac SNP �889

rs1800587

n = 260 n = 235 n = 524

1/1 C/C 0.485 (126) 0.430 (101) 0.513 (269) 0.45 0.89 (0.65–1.21) 0.033d 0.71 (0.52–0.99)1/2 C/T 0.431 (112) 0.464 (109) 0.384 (201) 0.2 1.22 (0.89–1.66) 0.038e 1.39 (1.01–1.92)2/2 T/T 0.085 (22) 0.101 (25) 0.103 (54) 0.41 0.80 (0.46–1.39) 0.89 1.04 (0.61–1.76)

IL-1Bb SNP 3954

rs1143634

n = 259 n = 240 n = 531

1/1 C/C 0.568 (147) 0.575 (138) 0.550 (292) 0.64 1.07 (0.79–1.47) 0.52 1.11 (0.80–1.52)1/2 C/T 0.378 (98) 0.371 (89) 0.382 (203) 0.92 0.98 (0.72–1.35) 0.76 0.95 (0.69–1.32)2/2 T/T 0.054 (14) 0.054 (13) 0.068 (36) 0.46 0.79 (0.40–1.54) 0.47 0.79 (0.39–1.57)

C, Controls; HOA Pt, hip OA patients; KOA Pt, knee OA patients; n, numbers of individuals; N, number of alleles.aFrequency (number).bAllele designation (1 – major allele, 2 – minor allele).cGenotype designations.dPcorr < 0.07.ePcorr < 0.08.




Tables 2 and 3, we listed 12 haplotypes with frequenciesabove 0.015 from each group. We have analysed allpossible genotype–haplotype combinations, but we onlylisted those with a P-value below 0.25 (Tables 5 and 6).We have also grouped genotypes by focusing on a singlehaplotype and then analysed such groups’ association withdiseases.

Genotype analysis of KOA (Table 5) showed that a setof the genotypes that include 1-2-1-1 haplotype wassignificantly associated with a lower risk of disease(Pcorr = 0.032, OR: 0.30 (95% CI: 0.10–0.81). Thus, theIL-1 gene locus extended haplotype 1-2-1-1 (foundprotective with KOA in women, Table 4) has been foundassociated with protection to KOA at both haplotype andgenotype levels.

In contrast, concerning hip OA, genotype analysis(Table 6) showed that a set of genotypes that include 1-1-

1-2 haplotype was not significantly associated with ahigher risk of disease, despite a higher odds ratio(Pcorr < 0.08, OR: 1.70, 95% CI: 1.06–2.72). On theother hand, the analysis revealed one statistically signifi-cant genotype associated with susceptibility to HOA(Pcorr < 0.008; 1-1-1-1/2-1-1-1) (Table 6).

Discussion

It is known that the overexpression of IL-1b cytokine isassociated with development of arthritis, as it can destructjoint tissue in vitro [39] and induce arthritis in a rabbitarthritis model [40]. Because IL-1a and IL-1b cytokinesare functionally indistinguishable and can be modulatedby the IL-1 receptor antagonist, several studies haveinvestigated polymorphisms in the IL-1 gene locus inassociation with osteoarthritis [3–11]. These studies

Table 2 (A) Estimated haplotype frequencies in patients with knee osteoarthritis (OA) in Croatian population. (B) Best-fit age- and sex-correlated case–control study with knee osteoarthritis (OA): number of estimated haplotypes.

Haplotype designationsa Controls (n = 1008) Knee OA (n = 476)

P OR (95% CI)

Knee OA

AssociationNumericb Otherc Number Frequency Number Frequency

(A)

1-1-1-1 C-C-G-4 327 0.324 140 0.294 0.36

1-1-1-2 C-C-G-2 52 0.052 35 0.074 0.14 1.39 (0.87–2.22)1-1-1-3 C-C-G-5 16 0.016 8 0.017 0.79

1-1-2-1 C-C-A-4 108 0.107 48 0.101 0.74

1-1-2-2 C-C-A-2 167 0.166 80 0.168 0.9

1-2-1-1 C-T-G-4 34 0.034 5 0.011 0.011 0.31 (0.11–0.84) Protectiond

2-1-1-1 T-C-G-4 16 0.016 12 0.025 0.39

2-1-2-1 T-C-A-4 34 0.034 22 0.046 0.44

2-1-2-2 T-C-A-2 19 0.019 15 0.032 0.04 1.96 (0.97–3.94)2-2-1-1 T-T-G-4 186 0.185 93 0.195 0.51

2-2-1-2 T-T-G-2 13 0.013 7 0.015 0.85

2-2-2-1 T-T-A-4 17 0.017 6 0.013 0.75

Haplotype designationsa Controls (n = 260)

Knee OA patients

(n = 460)

P OR (95% CI)

Knee OA


(B)

1-1-1-1 C-C-G-4 83 0.319 135 0.293 0.47

1-1-1-2 C-C-G-2 12 0.046 34 0.074 0.14

1-1-1-3 C-C-G-5 3 0.012 8 0.017 0.75

1-1-2-1 C-C-A-4 30 0.115 44 0.096 0.40

1-1-2-2 C-C-A-2 42 0.162 80 0.174 0.67

1-2-1-1 C-T-G-4 15 0.058 4 0.009 0.00007 0.14 (0.04–0.47) Protectiond

2-1-1-1 T-C-G-4 4 0.015 12 0.026 0.44

2-1-2-1 T-C-A-4 7 0.027 20 0.043 0.26

2-1-2-2 T-C-A-2 3 0.012 14 0.030 0.13

2-2-1-1 T-T-G-4 51 0.196 91 0.198 0.96

2-2-1-2 T-T-G-2 2 0.008 7 0.015 0.50

2-2-2-1 T-T-A-4 4 0.015 6 0.013 0.75

aHaplotypes are listed in the same order in both tables.bIL-1A(�889)-IL-1B(3954)-IL-1B(�511)-IL-1RN(VNTR) common haplotype designation.cNucleotide designations of listed SNP alleles2 and VNTR copy numbers.dHaplotype 1-2-1-1; P with conservative Bonferroni correction (x4): in 2A P < 0.05, in 2B P < 0.001.



demonstrated that differences in genotype and allelefrequencies of the IL-1 gene locus polymorphisms werecomplex, as they depended upon aspects such as locationof the disease and ethnicity.

In the current work, we studied correlation between theIL-1 gene locus polymorphisms and susceptibility toosteoarthritis of large joints in Croatian Caucasian popu-lation. We compared allele, haplotype and genotypefrequencies of four polymorphisms within the locus (inthe IL-1A, IL-1B and IL-1RN genes) between knee and hipOA patients and controls. Our previous reports (analyses ofIL-1B rs16944 and IL-1RN VNTR polymorphisms, andtwo-marker IL-1-gene-locus haplotypes) showed no signif-icant associations with either form of OA [23, 24]. Here,we extended our analyses to four polymorphisms: IL-1A

(rs1800587) – IL-1B (rs1143634) – IL-1B (rs16944) – IL-1RN (VNTR) and also analysed gender differences.Interestingly, we found a clear association that onlyaffected women. It is a novel haplotype 1-2-1-1 associatedwith the sixfold lower risk to knee OA. This findingimplicates a novel gender-specific issue to considerregarding OA susceptibility.

Confounding factors to be considered in our study arethe suboptimal age- and gender-matched control popula-tion and perhaps a relatively small number of participants.However, our study is one of the largest yet published inthe world (excluding meta-analyses). To illustrate this, inFig. 1, we compared the number of persons (n) amongpublished studies on genetic influence of the IL-1 locus indeveloping OA.

Table 3 (A) Estimated haplotype frequencies in patients with hip osteoarthritis (OA) in Croatian population. (B) Best-fit age- and gender-correlated case–control study with hip osteoarthritis (OA): number of estimated haplotypes.

Haplotype designationsa Controls (n = 1008) Hip OA (n = 518)

P OR (95% CI)

(Possible)

Hip OA


(A)

1-1-1-1 C-C-G-4 315 0.313 157 0.303 0.7

1-1-1-2 C-C-G-2 52 0.052 45 0.087 0.007 1.75 (1.13–2.7) Susceptibilityd

1-1-1-3 C-C-G-5 15 0.015 8 0.015 0.9

1-1-2-1 C-C-A-4 108 0.107 44 0.085 0.2

1-1-2-2 C-C-A-2 179 0.178 90 0.174 0.8

1-2-1-1 C-T-G-4 33 0.033 11 0.021 0.2

2-1-1-1 T-C-G-4 28 0.028 26 0.050 0.025 1.85 (1.04–3.29)2-1-2-1 T-C-A-4 34 0.034 14 0.027 0.5

2-1-2-2 T-C-A-2 7 0.007 4 0.008 1

2-2-1-1 T-T-G-4 188 0.187 97 0.187 1

2-2-1-2 T-T-G-2 13 0.013 4 0.008 0.4

2-2-2-1 T-T-A-4 15 0.015 8 0.015 0.9

Haplotype designationsa Controls (n = 260)

Hip OA patients

(n = 494)

P OR (95% CI)

(Possible)

Hip OA


(B)

1-1-1-1 C-C-G-4 80 0.308 152 0.308 1

1-1-1-2 C-C-G-2 12 0.046 44 0.089 0.033 2.02 (1.01–4.12) (Susceptibility)e

1-1-1-3 C-C-G-5 3 0.012 8 0.016 0.76

1-1-2-1 C-C-A-4 30 0.115 41 0.083 0.15

1-1-2-2 C-C-A-2 45 0.173 85 0.172 1

1-2-1-1 C-T-G-4 15 0.058 11 0.022 0.011 0.37 (0.16-0.87) Protectionf

2-1-1-1 T-C-G-4 7 0.027 24 0.049 0.16

2-1-2-1 T-C-A-4 7 0.027 14 0.028 0.91

2-1-2-2 T-C-A-2 0 0.000 4 0.008 0.30

2-2-1-1 T-T-G-4 51 0.196 92 0.186 0.74

2-2-1-2 T-T-G-2 2 0.008 4 0.008 1

2-2-2-1 T-T-A-4 4 0.015 6 0.012 0.74

aHaplotypes are listed in the same order in both tables (A and B).bIL-1A(�889)-IL-1B(3954)-IL-1B(�511)-IL-1RN(VNTR) haplotype designation.cNucleotide designations of listed SNP alleles2 and VNTR copy numbers.dHaplotype 1-1-1-2, P (conservative Bonferroni correction) = 0.028.eHaplotype 1-1-1-2, P (conservative Bonferroni correction) = 0.13.fHaplotype 1-2-1-1, P (conservative Bonferroni correction) = 0.044.




Concerning the risk to HOA, our results corroborate thepublished research for IL-1RN VNTR in a Germanpopulation [16], and they seem to be also in agreementwith a Dutch study by Meulenbelt et al. [17] and UKstudy by Smith et al. [18, 19] in which haplotype 1-1-1-2has been found to be associated with susceptibility toHOA. Our study contradicts a later UK study [41], whichreported a lack of association with susceptibility to HOAin persons with 1-1-1-2 haplotype (Fig. 1). The level ofincreased risk to HOA (as measured by the OR) conferredby the 1-1-1-2 haplotype in our study was relatively mild(1.75–2.56) compared with previously published reports

for other Caucasian populations (Fig. 1). In the study withonly women, highly conservative multiple-testing correc-tion of the P-value rendered such difference not significant(Table 4). Perhaps, had we analysed 7–8 markers inhaplotype analysis, we may have found an association withhigher risk [19]. In support of this, Smith et al. have founda 23-fold increased risk of HOA in extended-risk haplotypeanalysis with eight markers for haplotype 2-1-1-1-1-2-2-1(identical to our 1-1-1-2) [18, 19]. However, this differencemight also be a consequence of dissimilarities between thestudies regarding ethnicity and perhaps gender and age ofcontrols.

Table 4 Gender differences in IL-1 gene locus haplotypes in hip OA (HOA) and knee OA (KOA).

Haplotype

designationsa

Women KOA

P OR (95% CI)

Men KOA

P OR (95% CI)

Controls

(n = 224)

Patients

(n = 344)

Controls

(n = 690)

Patients

(n = 132)

Numeric Other Nb Fc N F N F N F

1-1-1-2 C-C-G-2 8 0.036 22 0.064 0.14 38 0.055 13 0.098 0.06

1-1-2-1 C-C-A-4 31 0.138 37 0.108 0.27 73 0.106 11 0.083 0.43

1-2-1-1 C-T-G-4 13 0.058 3 0.009 0.001d 0.14 (0.03–0.54) 20 0.029 2 0.015 0.56

2-1-1-1 T-C-G-4 4 0.018 6 0.017 1 9 0.013 6 0.045 0.011 3.6 (1.12–11.3)

Women HOA Men HOA

Controls

(n = 224)

Patients

(n = 346)

Controls

(n = 690)

Patients

(n = 166)

1-1-1-2 C-C-G-2 8 0.036 30 0.087 0.017 2.56 (1.10–6.19) 38 0.055 15 0.090 0.09

1-1-2-1 C-C-A-4 31 0.138 28 0.081 0.028 0.55 (0.31–0.97) 73 0.106 16 0.096 0.72

1-2-1-1 C-T-G-4 13 0.058 9 0.026 0.053 0.43 (0.17–1.11) 19 0.028 2 0.012 0.40

2-1-1-1 T-C-G-4 5 0.022 20 0.058 0.06 20 0.029 5 0.030 1

aIL-1A(-889)-IL-1B(3954)-IL-1B(-511)-IL-1RN(VNTR) common haplotype designation.bN – Number.cF – Frequency.dHaplotype 1-2-1-1; P with conservative Bonferroni correction: P = 0.004.

Table 5 Genotype association analysis of the IL-1 gene locus with knee osteoarthritis (OA)a.

Genotype designationsControls

N = 504

Knee OA pt

N = 238 P OR (95% CI)

(Possible)

Knee OA AssociationNumericb Otherc

1-1-1-1/1-1-2-1 C-C-G-4/C-C-A-4 48 11 0.021 0.46 (0.22–0.94) (Protection)d

1-1-1-1/1-2-1-1 C-C-G-4/C-T-G-4 11 0 0.022 0.09 (0.00–1.20)1-1-1-2/2-1-2-2 C-C-G-2/T-C-A-2 0 2 0.03 11.1 (0.6–7 9 10e6)

1-1-2-2/1-2-1-1 C-C-A-2/C-T-G-4 9 0 0.035 0.11 (0.00–1.42)1-1-2-2/2-2-1-1 T-C-A-4/T-T-A-2 32 24 0.07

2-2-1-1/2-2-1-1 T-T-G-4/T-T-G-4 10 8 0.25

2-2-1-1/2-2-2-2 T-T-G-4/T-T-A-2 5 0 0.18

1-1-1-2/all C-C-G-2/all 49 33 0.09

1-2-1-1/all C-T-G-4/all 34 5 0.008 0.30 (0.10–0.81) Protectione

aOnly genotypes with P � 0.2 are listed.bIL-1A(-889)-IL-1B(3954)-IL-1B(-511)-IL-1RN(VNTR).cNucleotide designations of listed SNP alleles2 and VNTR copy numbers.dP (conservative Bonferroni correction) = 0.084.eP (conservative Bonferroni correction) = 0.032.



Regarding susceptibility to KOA, our results are inagreement with a Dutch study [17] that also found noassociation, whereas our data contradict the UK [13, 18,19] and German [16] studies that found IL-1-gene locuslinked predisposition to KOA (Fig. 1). The UK study bySmith et al. [18, 19] observed a two- to four-fold increasedrisk of developing KOA in persons carrying a haplotype 2-1-1-1-1-1-1-1 (identical to our 1-1-1-1; Fig. 1).

Considering the lower risk to KOA, the protective 1-2-1-1 haplotype in our present study has not been observedpreviously. Smith et al. reported a haplotype 1-2-2-1-1-1(identical to our X-1-2-1) that conferred protection toKOA [19], and Attur et al. reported similar result incarriers of two different polymorphisms around the IL-1RN gene (Fig. 1) [42].

How can we reconcile contradictory outcomes of theseassociation studies with OA (Fig. 1)? Firstly (1), thevariations between our current study and the publishedstudies [13, 16–19] possibly reflect differences in complexinheritance variability and environmental exposures indiverse populations. Secondly (2), an unrelated (to IL-1)risk factor might contribute to susceptibility to OA eitherin the IL-1 gene cluster or in its vicinity, as, for example,in other genes (IL-36G, IL-36A, IL-36B, IL-36RN, IL-1F10 and IL-37), microRNAs or CpG methylation sites(Fig. 1). Thirdly (3), the genetic risk to OA mightinvolve multiple traits within or outside the IL-1 genelocus, including a combination of the two explanationsstated previously.

What are the arguments for and against the above-mentioned possibilities? Regarding the first explanation,variation of genes in isolated populations or genetic driftcan make common polymorphisms rare. Such geneticmarkers might be hard to identify, as a conservativeassessment of a genetic risk requires a documented

significant association of a particular marker in one ethnicpopulation and a confirmation of such outcome in anotherunrelated population. Such a requirement might excludepotentially useful information especially for complexinheritance diseases. It is a similar problem withgenome-wide studies that can only reveal genetic factorsthat confer very high (or low) risk of a particular disease.Likewise, meta-analyses may be prone to a similarweakness. A recent large meta-analysis of hip and kneeOA case–control studies only added to existing uncertain-ties [22] and may unfortunately have excluded some low-risk associations. Namely, the method balances outpopulation differences revealing only common polymor-phisms that might be either rare or non-existent. Whywould they be non-existent? Let us consider first ahypothesis that low genetic risk of OA might bedistributed across particular functional groups. Factorscausing inflammation constitute such a group, includingIL-1 cytokine. The action of IL-1 depends on genes thatencode agonists, antagonists, receptors, signal transducersand proteins regulating biology of the IL-1 cytokine as wellas non-protein epigenetic regulators (like microRNA, CpGislands). All of them might have allelic variants that couldpose a risk to OA. The alleles might be distributed amongdiverse human populations such that each subpopulationpossesses only a single risk factor (or, at best, a few ofthem). Consequently, one might rarely (or perhaps not atall) identify the same risk factor in more than onesubpopulation. Therefore, to assess all genetic factors thatpredispose to OA, it is important to document geneticrisks in as many human subpopulations as possible in thefuture.

Regarding the second interpretation, it is unlikely thata risk to OA is linked with another gene or genetic elementin the neighbourhood of the IL-1 gene locus, as there are no

Table 6 Genotype association analysis of the IL-1 gene locus with hip osteoarthritis (OA)a.

Genotype designationsControls

N = 504

Hip OA pt

N = 259 P OR (95% CI)

(Possible)

Hip OA AssociationNumericb Otherc

1-1-1-1/1-1-2-1 C-C-G-4/C-C-A-4 48 12 0.017 0.46 (0.23–0.92) (Protection)d

1-1-1-1/2-1-1-1 C-C-G-4/T-C-G-4 3 10 0.002 6.71 (1.69–30.98) Susceptibilitye

1-1-1-2/1-1-1-2 C-C-G-2/C-C-G-2 3 5 0.13

1-1-1-2/2-1-1-1 C-C-G-2/T-C-G-4 2 4 0.19

1-1-1-2/2-1-2-2 C-C-G-2/T-C-A-2 0 3 0.013 13.77 (0.84–8 9 10e6)

1-1-2-2/1-1-2-2 C-C-A-2/C-C-A-2 17 4 0.17

1-1-2-2/1-1-2-1 C-C-A-2/C-C-A-4 8 8 0.17

1-1-2-2/1-2-1-1 C-C-A-2/C-T-G-4 9 1 0.18

2-2-1-1/2-2-2-2 T-T-G-4/T-T-A-2 5 0 0.17

1-1-1-2/all C-C-G-2/all 49 40 0.020 1.70 (1.06–2.72) (susceptibility) d

1-2-1-1/all C-T-G-4/all 33 11 0.20

aOnly genotypes with P � 0.2 are listed.bIL-1A(�889)-IL-1B(3954)-IL-1B(�511)-IL-1RN(VNTR).cNucleotide designations of listed SNP alleles2 and VNTR copy numbers.dP (conservative Bonferroni correction) < 0.08/<0.07.eP (conservative Bonferroni correction) = 0.008.




microRNAs in the IL-1 gene locus (the nearest ones areflanking it by about 1 Mb) according to the miRBase 19database (at www.mirbase.org). Thus, theoretically, it isstill possible that there are allelic influences of either notyet identified miRNAs or CpG islands.

We consider the third suggestion also less likely anexplanation for the same reason: a lack of evidence.Nevertheless, multiple risk factors closely linked to theIL-1 locus might better clarify controversy about OA riskin diverse subpopulations. Let us suppose that there are tworisk factors linked in a particular IL-1 locus haplotype. Thefirst factor is a hypothetical microRNA that predisposes toOA by regulating a (target) gene on another chromosome,and the second one is a putative factor that can mediate riskthrough inflammation (located within the IL-1-gene locus).The microRNA would then show association with diseaseonly if particular chromosomes were present (carrying allelethat predisposes to OA) in the patient’s genome. This or asimilar scenario would show up in analyses as population-dependent variations in association with various haplotypesand genotypes with susceptibility to disease. This mayexplain why we found additional significant associations ofsome genotypes with HOA in the current (Table 6) andprevious work [23].

Our findings report for the first time the importance ofgender in combination with pro-inflammatory cytokineson decreasing genetic risk of osteoarthritis. Namely, wefound a novel association of the IL-1 gene locus haplotype1-2-1-1 with protection against KOA in women in thestudied population. In addition, we corroborated thefinding that the IL-1 gene locus haplotype 1-1-1-2 mightbe associated with susceptibility to HOA (which was,interestingly, lost in gender analyses). Thus, we concludethat different factors might affect the pathogenesis ofprimary osteoarthritis of large joints. Although we cannotexclude other genetic or epigenetic factors contributing tothe above-mentioned correlations, factors such as inflam-matory IL-1 cytokine in concert with unknown gender-specific influences might be implicated in osteoarthritis ofthe knee.

Acknowledgment

The authors would like to thank and are grateful for thegrants from the Faculty of Dentistry, University of Oslo.We are also grateful for the help by dr Eshrat Babaie(Biotechnology center in Oslo, University of Oslo) forsynthesis of PCR primers and TaqMan probes.

References

1 D’Ambrosia RD. Epidemiology of osteoarthritis. Orthopedics 2005;28:

s201–5.2 Richette P, Corvol M, Bardin T. Estrogens, cartilage, and osteoar-

thritis. Joint Bone Spine 2003;70:257–62.

3 Felson DT. An update on the pathogenesis and epidemiology of

osteoarthritis. Radiol Clin North Am 2004;42:1–9, v.4 Lally EV. Genetic aspects of osteoarthritis. Med Health R I

2004;87:210–2.5 Peach CA, Carr AJ, Loughlin J. Recent advances in the genetic

investigation of osteoarthritis. Trends Mol Med 2005;11:186–91.6 Spector TD, MacGregor AJ. Risk factors for osteoarthritis: genetics.

Osteoarthr Cartil 2004;12 (Suppl A):S39–44.7 Loughlin J. Osteoarthritis linkage scan: more loci for the geneticists

to investigate. Ann Rheum Dis 2006;65:1265–6.8 Williams CJ. The genetics of osteoarthritis. Expert Rev Clin Immunol

2007;3:503–16.9 Valdes AM, Spector TD. The contribution of genes to osteoarthritis.

Rheum Dis Clin North Am 2008;34:581–603.10 Valdes AM, Spector TD. Genetic epidemiology of hip and knee

osteoarthritis. Nat Rev Rheumatol 2011;7:23–32.11 Sandell LJ. Etiology of osteoarthritis: genetics and synovial joint

development. Nat Rev Rheumatol 2012;8:77–89.12 Srikanth VK, Fryer JL, Zhai G, Winzenberg TM, Hosmer D, Jones G.

A meta-analysis of sex differences prevalence, incidence and severity of

osteoarthritis. Osteoarthr Cartil 2005;13:769–81.13 Loughlin J, Dowling B, Mustafa Z, Chapman K. Association of the

interleukin-1 gene cluster on chromosome 2q13 with knee osteoar-

thritis. Arthritis Rheum 2002;46:1519–27.14 Johnston A, Xing X, Guzman AM et al. IL-1F5, -F6, -F8, and -F9: a

novel IL-1 family signaling system that is active in psoriasis and

promotes keratinocyte antimicrobial peptide expression. J Immunol2011;186:2613–22.

15 Ramadas RA, Ewart SL, Iwakura Y, Medoff BD, Levine AM. IL-

36alpha exerts pro-inflammatory effects in the lungs of mice. PLoSONE 2012;7:e45784.

16 Moos V, Rudwaleit M, Herzog V, Hohlig K, Sieper J, Muller B.

Association of genotypes affecting the expression of interleukin-1beta

or interleukin-1 receptor antagonist with osteoarthritis. ArthritisRheum 2000;43:2417–22.

17 Meulenbelt I, Seymour AB, Nieuwland M, Huizinga TW, van Duijn

CM, Slagboom PE. Association of the interleukin-1 gene cluster with

radiographic signs of osteoarthritis of the hip. Arthritis Rheum2004;50:1179–86.

18 Smith AJ, Keen LJ, Billingham MJ et al. Extended haplotypes and

linkage disequilibrium in the IL1R1-IL1A-IL1B-IL1RN gene cluster:

association with knee osteoarthritis. Genes Immun 2004;5:451–60.19 Smith AJ, Elson CJ, Perry MJ, Bidwell JL. Accuracy of haplotype

association studies is enhanced by increasing number of polymorphic

loci examined: comment on the article by Meulenbelt et al. ArthritisRheum 2005;52:675; author reply -6.

20 Moxley G, Han J, Stern AG, Riley BP. Potential influence of IL1B

haplotype and IL1A-IL1B-IL1RN extended haplotype on hand

osteoarthritis risk. Osteoarthr Cartil 2007;15:1106–12.21 Moxley G, Meulenbelt I, Chapman K et al. Interleukin-1 region

meta-analysis with osteoarthritis phenotypes. Osteoarthr Cartil

2010;18:200–7.22 Kerkhof HJ, Doherty M, Arden NK et al. Large-scale meta-analysis of

interleukin-1 beta and interleukin-1 receptor antagonist polymor-

phisms on risk of radiographic hip and knee osteoarthritis and severity

of knee osteoarthritis. Osteoarthr Cartil 2011;19:265–71.23 Jotanovic Z, Etokebe GE, Mihelic R, et al. Hip osteoarthritis

susceptibility is associated with IL1B -511(G>A) and IL1 RN

(VNTR) genotypic polymorphisms in Croatian Caucasian population.

J Orthop Res 2011;29:1137–44.24 Jotanovic Z, Etokebe GE, Mihelic R, et al. IL1B -511(G>A) and IL1RN

(VNTR) allelic polymorphisms and susceptibility to knee osteoarthritis

in Croatian population. Rheumatol Int 2012;32:2135–41.25 Altman R, Asch E, Bloch D et al. Development of criteria for the

classification and reporting of osteoarthritis. Classification of osteo-



arthritis of the knee. Diagnostic and Therapeutic Criteria Committee

of the American Rheumatism Association. Arthritis Rheum 1986;

29:1039–49.26 Altman R, Alarcon G, Appelrouth D et al. The American College of

Rheumatology criteria for the classification and reporting of osteo-

arthritis of the hip. Arthritis Rheum 1991;34:505–14.27 Bellamy N. WOMAC: a 20-year experiential review of a patient-

centered self-reported health status questionnaire. J Rheumatol2002;29:2473–6.

28 Kellgren JH, Lawrence JS. Radiological assessment of osteo-arthrosis.

Ann Rheum Dis 1957;16:494–502.29 Statement NC. NIH Consensus Statement on total knee replacement.

NIH Consens State Sci Statements 2003;20:1–34.30 Crockarell JR, Guyton JL. Arthroplasty of the knee. In: Canale ST,

Beatty JH, eds. Campbell’s Operative Orthopaedics, 11th edn. Philadel-

phia, PA: Mosby Elsevier, 2007:261.31 Conference NC. NIH consensus conference: Total hip replacement.

NIH Consensus Development Panel on Total Hip Replacement.

JAMA 1995;273:1950–6.32 Fraser DA, Bulat-Kardum L, Knezevic J et al. Interferon-gamma

receptor-1 gene polymorphism in tuberculosis patients from Croatia.

Scand J Immunol 2003;57:480–4.33 Tarlow JK, Blakemore AI, Lennard A et al. Polymorphism in human

IL-1 receptor antagonist gene intron 2 is caused by variable numbers

of an 86-bp tandem repeat. Hum Genet 1993;91:403–4.34 Tseng LH, Chen PJ, Lin MT et al. Single nucleotide polymorphisms

in intron 2 of the human interleukin-1 receptor antagonist (IL-1Ra)

gene: further definition of the IL-1 beta and IL-1Ra polymorphisms in

North American Caucasians and Taiwanese Chinese. Tissue Antigens

2001;57:318–24.35 Stern AG, de Carvalho MR, Buck GA et al. Association of erosive

hand osteoarthritis with a single nucleotide polymorphism on the

gene encoding interleukin-1 beta. Osteoarthr Cartil 2003;11:394–402.

36 Purcell S, Neale B, Todd-Brown K et al. PLINK: a tool set for whole-

genome association and population-based linkage analyses. Am J Hum

Genet 2007;81:559–75.37 Stephens M, Donnelly P. A comparison of bayesian methods for

haplotype reconstruction from population genotype data. Am J HumGenet 2003;73:1162–9.

38 Stephens M, Smith NJ, Donnelly P. A new statistical method for

haplotype reconstruction from population data. Am J Hum Genet2001;68:978–89.

39 Westacott CI, Sharif M. Cytokines in osteoarthritis: mediators or

markers of joint destruction? Semin Arthritis Rheum 1996;25:254–72.40 Henderson B, Pettipher ER. Arthritogenic actions of recombinant IL-

1 and tumour necrosis factor alpha in the rabbit: evidence for

synergistic interactions between cytokines in vivo. Clin Exp Immunol

1989;75:306–10.41 Chapman K, Loughlin J. Association of the interleukin-1 gene cluster

with osteoarthritis of the hip: comment on the article by Meulenbelt

et al. and the letter by Smith et al. Arthritis Rheum 2006;54:3722–3.42 Attur M, Wang HY, Kraus VB et al. Radiographic severity of knee

osteoarthritis is conditional on interleukin 1 receptor antagonist gene

variations. Ann Rheum Dis 2010;69:856–61.

Supporting Information

Additional supporting information may be found in theonline version of this article:

Table S1. The sequences for all PCR primers andprobes used in study.

Table S2. Association analysis of IL-1RN VNTR withknee and hip OA in the Croatian population.




Associations of the Interleukin-1 Gene Locus Polymorphisms with Risk to Hip and Knee Osteoarthritis:...

Documents

Transcript of Associations of the Interleukin-1 Gene Locus Polymorphisms with Risk to Hip and Knee Osteoarthritis:...