Are water vole resistant to anticoagulant rodenticides followingfield treatments?

Julie Vein • Agnes Grandemange •

Jean-Francois Cosson • Etienne Benoit •

Philippe J. Berny

Accepted: 3 May 2011

� Springer Science+Business Media, LLC 2011

Abstract The anti-vitamin Ks (AVKs) are widely used

to control rodent populations. They inhibit Vitamin K

regeneration by the Vitamin K Epoxide Reductase (VKOR)

and cause a fatal hemorrhagic syndrome. Because of

repeated use, some populations of commensal rodents have

expressed resistance to these compounds. In Franche-

Comte (France), the water vole exhibits cyclic population

outbreaks. A second generation AVK, bromadiolone, has

been used for the last 20 years to control vole populations.

The aim of this study is to determine whether these repe-

ated treatments could have led to the development of

resistance to AVKs in water vole populations. We con-

ducted enzymatic and genetic studies on water voles trap-

ped in treated and non treated plot. The results indicate that

voles from the most heavily treated area exhibit enzymatic

changes in VKOR activity hence arguing for resistance to

AVKs and that an intronic haplotype on the vkorc1 gene

seems to be associated with these enzymatic changes.

Keywords Anticoagulant resistance � VKOR � Arvicola

terrestris scherman � Enzymology � vkorc1 gene

Introduction

The fossorial water vole (Arvicola terrestris scherman) is a

field rodent, which lives in the permanent grassland of

medium-altitude mountains between 400 and 1200 m. In

France it can be found in the Jura Mountains but also in the

Pre-Alps and in the Massif Central. It digs burrows formed

by a complex network of galleries, nests and storage cav-

ities. The earth from the burrows is pushed outside the

galleries and forms tumuli which are signs of its presence

in a field. This vole exhibits cyclic population outbreaks at

a regional scale in the Jura Mountains. Every 6 years a

wave of high population density (200–1000 ind/ha) spreads

from the medium-altitude plateau to the higher plateaus

and valleys at a speed faster than 10 km per year. High

densities are maintained locally for 1–3 years (Giraudoux

et al. 1997). During these high-density periods, grass pro-

duction is critically impaired (up 2–3 tons of fodder/ha)

and also damaged qualitatively (presence of earth in fodder

for example). Moreover, these outbreaks are a public health

issue because the water vole is one of the intermediate

hosts of Echinococcus multilocularis, the agent of a lethal

parasitic zoonose. It has been proved that the distribution

pattern of alveolar echinococcosis is related to the popu-

lation levels of the water vole and the common vole

(Microtus arvalis) in France (Houin et al. 1982; Rausch

1995; Raoul et al. 2003; Viel et al. 1999).

Consequently, a policy for the control of water vole

populations has been developed at the end of the 70s.

Different possibilities were explored: physical control by

trapping, chemical control with bromadiolone and more

recently, biological control with predators. The physical

and biological methods are insufficient alone and, more-

over, trapping is too much time consuming. So the

collective control is based on bromadiolone baits, a

J. Vein � A. Grandemange � E. Benoit � P. J. Berny (&)

UMR 1233 INRA, VetAgro Sup, VetAgro Sup Campus

Veterinaire de Lyon 1 Avenue Bourgelat, 69280 Marcy L’Etoile,

France

e-mail: p.berny@vetagro-sup.fr

J.-F. Cosson

INRA-EFPA, UMR Centre de Biologie et de Gestion des

Populations (INRA/IRD/Cirad/Montpellier SupAgro),

Campus International de Baillarguet, CS 30016, 34988

Montferrier-sur-Lez cedex, France

123

Ecotoxicology

DOI 10.1007/s10646-011-0700-7

second-generation anticoagulant rodenticide. First applied

were carrot-baits until 1998 then replaced by wheat-baits to

reduce the bromadiolone quantity in the environment

(Truchetet et al. 2005; Giraudoux et al. 2006). However,

massive mortalities of non-target fauna, especially preda-

tors’ species such as the red fox (Vulpes vulpes) or the

common buzzard (Buteo buteo), due to secondary poison-

ing were reported after large-scale field treatment with both

types of bait (Berny et al. 1997; Raoul et al. 2003). Fur-

thermore, a recent study has proved that the bromadiolone

is more persistent in wheat baits than estimated originally.

So it could be at the origin of secondary poisoning several

months after treatment (Sage et al. 2007).

The anti-vitamin K rodenticides (AVK) have been

widely used for rodent populations control since the 50s.

These compounds are inhibitors of the Vitamin K cycle and

so prevent the c-carboxylation of Vitamin K-dependent

clotting factors II, VII, IX and X (Fig. 1). AVKs are non

competitive inhibitors of the Vitamin K Epoxide Reductase

(VKOR) which enables the Vitamin K recycling from

the Vitamin K epoxide (Vitamin K [ O). Because of the

inhibition, the clotting factors are not activated and thus the

AVKs provoke lethal bleeding (Sadler 2004). Moreover,

the massive use of first generation AVKs is known to select

resistance in commensal rodent populations. In brief,

resistance towards Warfarin (the first AVK used) was first

discovered in Scotland in a Norway rat (Rattus norvegicus)

population (Boyle 1960) and it was rapidly proved in

domestic mouse (Mus musculus domesticus) and in roof rat

(Rattus rattus) populations (for a review see Pelz et al.

2005). After that, second generation AVK rodenticides,

such as bromadiolone, were developed, but resistant pop-

ulations to these compounds were quickly selected.

Resistance to AVKs in commensal rodent populations is

nowadays documented in most of the European countries,

North America, Asia and Australia (Pelz et al. 2005; Ish-

izuka et al. 2008). First researches on resistance were about

the transmission mechanism through a rodent population

and it has been established that resistance to Warfarin in

rats is due to a single autosomal gene on chromosome 1

(Greaves and Ayres 1967; Kohn and Pelz 1999). Finally, in

2004, the gene encoding one of the subunit of the VKOR

enzymatic complex (vkorc1) has been cloned and

sequenced in human and rat (Rost et al. 2004; Li et al.

2004). Nevertheless, other mechanisms probably metabo-

lism based resistance are described or suspected (Ishizuka

et al. 2008; Markussen et al. 2008).

The study of Lasseur et al. (2005) on a strain of resistant

Norway rat has shown that AVKs remain non competitive

inhibitors of the VKOR but with a highly increased Ki

(inhibitory constant) and that this resistant strain has a

reduced VKOR activity in comparison to a wild-type

strain.

Our study was designed to determine if the use of bro-

madiolone for more than 20 years in Franche-Comte led to

the development of resistance to AVKs in the water vole

population. First we compared the enzymatic and inhibition

parameters of VKOR in water vole originated from three

areas with different treatment patterns, then we tried to

identify and sequence the water vole vkorc1 gene and

finally we looked for potential mutations on this gene that

could potentially be related to the enzymatic results.

Materials and methods

Animal sampling

Three trapping areas were chosen: a control plot, without

bromadiolone treatment for the last 20 years, in By (Doubs

French department); and two regularly treated fields in

Vescles (Jura) and Morteau (Doubs). The bromadiolone

treatment was performed in the Vescles plot in spring 2002,

April and December 2003, November 2004, February 2005

and April 2006 and in the Morteau plot in October 2003,

July, August and October 2005 and May 2006.

As the enzymatic analyses require trapping live animals,

Scherman� cage-traps were used. Then the voles were

humanely killed just before freezing at -20�C at Franche-

Comte University. They were later transported in an icebox

to the Veterinary College of Lyon (ENVL) and then frozen

at -80�C. The sampling sessions were performed on 18

and 19th October 2006 in Morteau, 24 and 25th October

2006 in Vescles and 1st November 2006 in By. Each vole

was identified by a unique number.

For RNA isolation, five voles were trapped in another

non treated area, dissected just after euthanasia and their

liver put immediately at -80�C.

Tissue preparation

Voles were dissected when already frozen and liver and

one kidney were excised. The kidney was directly placed in

a tube and stored at -80�C before DNA sequencing.

Microsomes were prepared from thawed liver by dif-

ferential centrifugation as described in Lasseur et al.

(2007). Protein concentration was determined by the

method of Bradford (1976) using bovine serum albumin as

a standard. Microsomes were stored at -80�C until use.

Bromadiolone analysis

The bromadiolone analyses were performed at the ENVL

Toxicology Laboratory using high performance liquid

chromatography (HPLC) according to a method adapted

from Berny et al. (2006). The internal standard was

J. Vein et al.

123

difenacoum at 2.5 lg/ml and all the reagents were of

HPLC grade. Briefly, 0.2 g of vole liver was grinded in

10 ml of acetone with 200 ll of internal standard, the

solution was centrifugated 10 min at 30009g and 2 ml of

the supernatant was evaporated under N2. The dried residue

was diluted in 200 ll of mobile phase (70% methanol, 30%

phosphate buffer Na?/K? 0.24 M pH 6.5) and the obtained

solution was used for analysis. The HPLC system was

composed by an isocratic pump L-2130, an autosampler

L-2200 and a fluorimetric detector L-2480. The data

acquisition was performed by using the EZ ChromElite

3.1.3 software (Elite LaChrom, Merck Hitachi, Nogent-sur-

Marne, France). Fifty microliters of sample were injected

in a LichroCART Nucleodur C18 EC column (100–5 lm,

250 9 4.6 mm Macherey–Nagel, Strasbourg, France) ran

at 1 ml/min in a phosphate buffer: methanol solution

(30% : 70%, v/v).

The limit of detection (mean of noise level ? 3 standard

deviations) for this method was 0.17 lg bromadiolone/g of

liver and the limit of quantification (mean of noise level

?10 standard deviations) was 0.28 lg bromadiolone/g of

liver on 10 samples. Linearity was determined on standards

and spiked liver samples between 0.3 and 1.5 mg.kg-1

(r2 [ 0.99%). Percentage of recovery varied between 82.8

and 92.2% for bromadiolone (CV \ 10%) on three repli-

cate spiked liver samples between 0.3 and 1.5 mg/kg.

Measure of VKOR activity in water vole liver

microsomes

The incubation conditions for the water vole were validated

on a mix of microsomes from individuals of the non treated

area. Each measure was performed in duplicate. The line-

arity of the reaction was tested on three parameters:

quantity of proteins as 1, 2 or 3 mg, the maximal Vitamin

K Epoxide (Vitamin K [ O) concentration as 100 or

200 lM and the incubation time as 20, 30 or 40 min.

The VKOR microsomial activity was assayed as

described by Lasseur et al. (2007) with some modifications.

The reaction solution contained 2 mM of DTT (dithio-

threitol), buffer solution was 200 mM Tris–HCl/0.15 M

KCl (pH 7.4) and 1.5 mg of total protein was added. The

reaction was started by added Vitamin K [ O in 1% Triton

X-100 solution for a final volume of 1 ml. The incubation

time was 20 min at 37�C and the reaction was stopped by

adding 4 ml of iced isopropanol/hexane (1:1, v/v) solution.

Vitamin D3 at 10 mM was added as an internal standard.

After centrifugation (50009g, 5 min), the hexane layer

was dried under nitrogen and the dry residue was dissolved

in 200 ll of isopropanol. This solution was immediately

analysed by HPLC for Vitamin K and Vitamin D3 mea-

surement. The HPLC system consisted in an autosampler

AS-2000A, an isocratic pump L-6200A, and UV- VIS

Activated clotting factors

VKOR

Vitamin K reductase

γ- carboxylase

OH

OH

CH3

R

Reduced Vitamin K

O

O

CH3

R

O

O

O

CH3

R

Vitamin K

Inactive clotting factor

AVK

Vitamin K Epoxide

Fig. 1 Vitamin K cycle

Field treatments

123

detector L-4520 (Merck, Nogent-sur-Marne, France), an

interface SS 420x (Scientific Software Inc., Lincolnwood,

Illinois, USA) and the EZ Start software (Merck, Nogent-

sur-Marne, France). 50 ll of each sample were injected in

a Purospher RP-18, 5 lm, 125 9 4 mm column (Merck,

Nogent-sur-Marne, France) ran at 1.5 ml/min in a tetra-

hydrofuran:methanol (1:10, v/v) solution and maintained at

40�C. The linearity of the HPLC method for Vitamin K had

been tested between 0 and 5 nmol of Vitamin K and for

concentration between 0 and 100 lmol/L (R2 in each cases

[0.99). Each calibration curve was performed in triplicate

and the coefficient of variation was always under 10%.

Study of VKOR kinetic parameters in the water vole

Individual screening

An individual screening was performed on 37 animals (9

from By, 15 from Vescles and 13 from Morteau). The

VKOR activity was assayed for three Vitamin K [ O

concentrations (25, 50 and 200 lM) without inhibitor and

two Warfarin concentrations (0.5 and 5 lM) at 200 lM

Vitamin K [ O. Each measure was performed in triplicate.

The results were expressed as the apparent reaction activ-

ity, i.e. the amount of Vitamin K produced per milligram of

total protein per minute and as the percentage of inhibition

for 0.5 lM of Warfarin (P):

P ¼ V � Vinhibeð ÞV

� 100

Where V is the apparent reaction activity for an individual

with 200 lM Vitamin K [ O and Vinhibe is the apparent

reaction activity for the same individual with 200 lM

Vitamin K [ and 0.5 lM Warfarin. Warfarin was chosen

as a model for different reasons. First it is the reference

AVK and the one used in most international publications

on resistance in rodents. Then it is a first generation AVK

and it is known in resistant rats that Ki are more modified

with first generation than second generation AVK (Lasseur

et al. 2007). So as we didn’t know if a resistance did exist

in our vole populations, we chose to perform our experi-

ments in the more favourable situation to demonstrate the

phenomenon if it actually exists.

Kinetic parameters evaluation on two groups of animals

With the results of individual screening, two groups of

animals were defined and their liver microsomes were

mixed in two samples. These were used to evaluate the

VKOR kinetics parameters. In order to determine apparent

Km (reaction constant), Vmax (maximal apparent activity)

and Ki (inhibitory constant), the reaction was performed

with four Vitamin K [ O concentrations from 25 to

200 lM and for each Vitamin K [ O concentration we

used five Warfarin concentrations from 0 to 3 lM. Each

measure was performed in duplicate.

Statistical analyses

The means of apparent reaction activity and of the per-

centage of inhibition were compared between the three

areas using the non parametric Kruskal–Wallis rank sum

test for mean comparisons and for pair-wise comparisons

the Wilcoxon rank sum test with the Bonferroni adjustment

method. The means of apparent reaction activity between

the mutated and the wild type group were compared using

the non parametric Mann–Whiney–Wilcoxon rank sum

test. All the statistical analyses were performed by using

the R.2.4.1 software (R Development Core Team 2010).

The model applied for the VKOR enzymatic parameters

estimate was the Michaelis–Menten model with a non-

competitive inhibition (Lasseur et al. 2005, Walsh et al.

2007):

V ¼ Vmax �S½ �

1þ I½ �Ki

� �� Km þ S½ �ð Þ

0@

1A

Where V is apparent reaction activity, Vmax is maximal

activity, [S] is Vitamin K [ O concentration, [I] is War-

farin concentration, Km is VKOR activity constant and Ki is

VKOR inhibitory constant for Warfarin.

This model gives a global estimate of the apparent

reaction activity by two control parameters (Vitamin

K [ O concentration and Warfarin concentration). Fitting

the model to the data was performed by nonlinear regres-

sion by using the least square criterion. Estimates of

parameters were obtained by minimizing the residual sum

of squares (RSS).

RSS ¼Xn

i¼1

yi � yið Þ2

Where yi is the square root of observed activity,yi its fitted

value and n the number of data points. The square root of

the observed activity was used to normalize the model

residuals. The nonlinear regression was computed with the

Nonlinear Least Square (nls) function of R software. The

precision of each parameter estimate was expressed in term

of asymptotic marginal confidence interval at 95%.

Water vole vkorc1 gene study

Gene reconstruction

The cDNA was obtained by RT-PCR from RNA of vole

liver. RNA extraction was performed by using the SV Total

J. Vein et al.

123

RNA Isolation System (Promega, Charbonnieres les Bains,

France). Genomic DNA was extracted from kidney sam-

ples by using Wizard Genomic DNA Purification Kit

(Promega, Charbonnieres les Bains, France).

The first step was a cDNA reconstruction using the 30

SMART-RACE� procedure (Clonetech Laboratories Inc.,

St Quentin les Yvelines, France) with a specific primer

from the Norway rat (Rattus norvegicus) at the end of Exon

2. It gave us the sequence for the water vole of the end of

Exon 2 and the total Exon 3. A 50 SMART-RACE� pro-

cedure had been tried but had failed.

The second step was therefore a genome reconstruction

using different sense primers designed from Norway rat far

upstream the start codon and a specific reverse primer for

the water vole sequence (At-AS1) downstream from the

stop codon. One of these sense primers (At-S1) matched

with the water vole genomic DNA. The product was

sequenced with internal primers and we obtained a con-

sensus sequence of ca. 2800 bps for the water vole vkorc1

gene (GenBank Access number FJ986204 for the DNA

sequence).

The primer pair (At-S1 and At-AS1) was used to obtain

the complete coding sequence of the cDNA for vkorc1

(GenBank Access number FJ986205 for the mRNA). The

primers sequences At-S1 and At-AS1 are summarized in

Table 1.

VKORC1 sequencing

Each 27 samples from By and Vescles were amplified by

PCR using the primers At-S1 and At-AS1 and each of the

three exons were sequenced for vkorc1 gene internal spe-

cific primers.

Chemicals

The Vitamin K epoxide was produced from Vitamin K

phylloquinone with a method adapted from Thierry-Palmer

(1984). The Vitamin K, DTT, Tris buffer, Vitamin D3,

Na2HPO4, KH2PO4, KCl, glycerol, EDTA, Triton X-100,

BSA were purchased from Sigma-Aldrich (Saint-Quentin

Fallavier, France). Isopropanol, n-Hexane, Tetrahydrofu-

ran, Methanol, and Acetone were from VWR International

(Strasbourg, France). Warfarin and Bromadiolone were

supplied by LiphaTech (Pont du Casse, France) and Dife-

nacoum by CIL (Sainte Foy la Grande, France). All

reagents used were of the highest purity available and all

solvents of HPLC grade.

Results

Bromadiolone dosing in the vole liver

One of the 40 samples (M14) contained bromadiolone

residues. It was then excluded from future experiments to

avoid interferences with VKOR activity measurement. All

the other samples were below the detection limits of our

HPLC method.

Assessment of the VKOR Assay conditions for water

vole liver microsomes

We tested the reaction linearity for three parameters: pro-

tein quantity, Vitamin K [ O concentration and incubation

time. The reaction was linear up to 2 mg of total protein

and 20 min incubation and plateaued for 200 lM Vitamin

K [ O (data not shown). For our experiments we then

chose to work with 1.5 mg total protein, a Vitamin K [ O

concentration range from 0 to 200 lM and an incubation

time of 20 min.

During the individual screenings the measurements were

performed in triplicates. Concerning the incubation with

200 lM Warfarin, the coefficient of variation of the

activity ranged from 0.8 to 12.3% in the 37 samples tested

with a mean of 5.7% for all the individuals.

VKOR activity comparison between the three areas

We compared the apparent reaction activity with 200 lM

Vitamin K [ O and 0 or 0.5 lM Warfarin. Without War-

farin, the global comparison (Fig. 2) exhibits a significant

difference (p = 0.02) but the pair-wise comparisons are

not significant. We can also note that the results for the

Vescles area are more heterogeneous than those for the

other areas. Concerning the results with 0.5 lM Warfarin

(Fig. 3a) there is a significant difference in the global

comparison (p = 1 9 10-4) and in pair-wise comparisons

between By and Vescles areas (p = 4 9 10-4) and Mor-

teau and Vescles areas (p = 3 9 10-3). There is also a

greater heterogeneity in the results from Vescles than from

the other areas. We also compared the percentages of

inhibition for 0.5 lM of Warfarin (Fig. 3b). The global

comparison exhibits a significant difference (p = 0.02) and

the pair-wise comparison a significant difference between

the areas of By and Vescles (p = 0.03). Further compari-

son were performed between By and Vescles areas only for

two reasons: first they are the two areas where the pair-wise

comparisons were always significant, then Vescles was the

Table 1 Primers used to sequence water vole vkorc1 gene

Primer name 50–30 sequence

At-S1 GTCGACATGGGCACCACCTGCAG

At-AS1 AGAGCACAAAGAACAGGACCCAGGC

Field treatments

123

area where the treatments were applied the more regularly

and so the area where the probability of finding a resistance

phenomenon was greater.

Enzymatic parameters assessment

As the quantity of microsomes available from the whole

liver of a vole was limited, enzymatic assessment was

performed on pooled liver microsomes. Figure 4a, b pres-

ent the predicted activity for the different Warfarin con-

centrations adjusted to the values observed. Graphically,

we can observe that our model fits the data well. Moreover,

we checked the normality of the residuals.

Table 2 summarizes the estimated parameters and their

95% confidence intervals. It is interesting to note that the

Km values were similar from one group to the other while

the Vm and Ki seemed significantly different.

Water vole vkorc1 genetic study results

We have determined a consensus sequence for water vole

vkorc1. By sequencing each sample from By (10 animals) and

Vescles (17 animals), a sequence comprising the entire three

exons is obtained for each animal. After alignment of the 27

sequences, it is possible to notice two differences: a silent

mutation in Exon 2 and the presence of an intronic haplotype

composed by a 4 bps deletion and three heterozygotes

mutations in the second intron of five animals from Vescles.

We compare vkorc1 activity with 200 lM Vitamin

K [ O and 0.5 lM Warfarin for the individuals presenting

the haplotype and wild-type (i.e. without haplotype) ani-

mals. Unfortunately, two individuals from Vescles area and

one from By area were not fully tested because we lacked

materials and so were not included in the analysis. Thus the

comparison was performed between the five animals from

By (n=9) Morteau (n=13) Vescles (n=15)

0.06

0.08

0.10

0.12

0.14

Area

VK

OR

enz

ymat

ic a

ctiv

ity

*

*

*

Fig. 2 Reaction activity in the three areas in presence of 200 lM

Vitamin K [ O. *Global comparison with significant difference

between the three areas (p = 0.02) (Reaction activity is expressed in

nmol Vitamin K produced/mg of total protein/min, n is number of

samples in each group)

By (n=9) Morteau (n=13) Vescles (n=15)

0.02

0.03

0.04

0.05

0.06

0.07

Area

VK

OR

enz

ymat

ic a

ctiv

ity

*,§*,#

*,§,#

By (n=9) Morteau (n=13) Vescles (n=15)

4050

6070

Area

Per

cent

age

of in

hibi

tion

with

0.5

µM

of W

arfa

rin *,#

*

*,#

(a)

(b)

Fig. 3 a Reaction activity in the three areas in presence of 200 lM

Vitamin K [ O and 0.5 lM Warfarin. *Global comparison with

significant difference between the three areas (p = 1 9 10-4).

Pairwise comparisons: §significant difference between By and

Vescles areas (p = 4 9 10-4) and #significant difference between

Morteau and Vescles areas (p = 3 9 10-3) (Reaction activity is

expressed in nmol Vitamin K produced/mg of total protein/min, n is

number of samples in each group). b Percentage of inhibition in the

three areas in presence of 200 lM Vitamin K [ O and 0.5 lM

Warfarin. *Global comparison with significant differences between

the three areas (p = 0.02). Pairwise comparisons: #significant differ-

ence between By and Vescles areas (p = 0.03) (n is the number of

samples in each group)

J. Vein et al.

123

Vescles with the haplotype and 19 wild-type animals. It

showed a significant difference (p = 0.03) (Fig. 5).

Discussion

Resistance to AVKs is defined as an inefficiency of AVK

treatments when correctly applied. Thus in resistant ani-

mal, the coagulation is not impaired by usual dose of

AVKs. This trait should be genetically heritable (Greaves

1994). As it is difficult to control correct application in the

field, some standardized methods were developed to con-

trol the resistance status of an animal. These methods are

based on the administration of a controlled dose of AVKs

orally or intraperitoneally and the measurement of the

efficacy of coagulation after 24 h. The coagulation can be

estimated by some coagulation times or by the Interna-

tional Normalized Ratio (INR). In case of a group of sus-

ceptible animals, the INR should be over 5 in 50% of the

animals, whereas it is much lower in a resistant group

(Anonymous 2003). Resistance to AVKs is a heritable trait,

thus it should have a genetic background. It is a biological

advantage when a selection pressure (i.e. the use of AVKs)

is applied. A major selection pressure leads to a rapid and

‘efficient’ selection of resistant populations if some allele

coding for resistance existed beforehand.

(a)

(b)

Fig. 4 a Reaction activity for different Vitamin K [ O and Warfarin

concentrations in the By area (Concentrations are expressed in lmol/

L and reaction activity in nmol Vitamin K produced/mg of total

protein/min). b Reaction activity for different Vitamin K [ O and

Warfarin concentrations in the Vescles area (Concentrations are

expressed in lmol/l and reaction activity in nmol Vitamin K

produced/mg of total protein/min)

Table 2 Enzymatic parameters for the two groups of animals and

their 95% confidence interval

Group Km Vm Ki

By 29.14

[24.00–35.19]

0.064

[0.059–0.070]

0.42 [0.38–0.48]

Vescles 30.42

[26.70–34.57]

0.091

[0.086–0.097]

0.70 [0.63–0.77]

Km is the activity constant expressed in lM of Vitamin K [ O, Vm is

the apparent maximal reaction activity expressed in nmol of Vitamin

K produced/mg of total protein/min and Ki is the inhibitory constant

for warfarin expressed in lM of warfarin

Haplotype (n=5) Wild type (n=19)

0.02

0.03

0.04

0.05

0.06

0.07

Genotype

VK

OR

enz

ymat

ic a

ctiv

ity

*

*

Fig. 5 Comparison of the reaction activity at 200 lM Vitamin

K [ O and 0.5 lM Warfarin between the ‘‘haplotype’’ group and the

‘‘control’’ group. *Significant difference between the two groups

(p = 0.03) (Haplotype haplotype group, Wild type control group,

n number of individuals per group, Reaction activity expressed in

nmol Vitamin K produced/mg of total protein/min)

Field treatments

123

In Franche-Comte, the water vole population cyclic

outbreaks are controlled with bromadiolone treatments in

the field. The importance of treatments depends on the

area: in certain areas, where treatments have been applied

every year for around 20 years, the selection pressure has

been particularly important. The most regularly treated

areas are the most infested areas and the areas where vole

populations are the most important and that could be a hint

of the inefficacy of the treatments. The Vescles area is a

field where the treatments were intensive and thus the

selective pressure important, whereas the By area is a non

treated field and served as our negative control plot. Our

hypothesis was that the Vescles area was a plot where the

treatments were less efficient because resistance to AVKs

had been selected. However it was not possible to test

resistance in vivo because it was technically impossible to

maintain live water vole in our laboratory. Consequently,

we decided to look for indirect (i.e. in vitro) arguments in

favour of resistance to AVKs in this population.

Resistance to AVKs is characterized by two major

mechanisms. The first involves mutations in vkorc1 gene

which encodes the target of AVKs, the Vitamin K Epoxide

Reductase (VKOR). This mechanism is predominant in the

Norway rat in Western Europe. The second mechanism is

VKOR independent and appears to be based on differences

in the metabolism of AVKs and on cytochrome P450

dependent activities. This has been the subject of more

studies and is probably predominant in the roof rat (Sugano

et al. 2001; Ishizuka et al. 2007) and appears also important

in the house mouse. A recent study has proved that resis-

tance in the Norway rat could also be related in certain

strains, but to a limited extent, to the cytochrome pathway

(Markussen et al. 2008).

In our study, we decided to test the VKOR part of

resistance as a first step. We therefore tried to detect a

variation on VKOR activity and on VKOR response to

inhibition by Warfarin in water vole populations subjected

to repeated treatment in comparison with a non treated

population. The measurement of VKOR activity and inhi-

bition parameters has already been used as a tool to dis-

criminate between phenotypically resistant and sensitive

strains in the Norway rat and the house mouse (Lasseur

et al. 2005, 2006).

This study proves that VKOR activity depends on the

area where the voles were trapped (Fig. 2). Moreover, it is

in the Vescles area, the most heavily and regularly treated,

that the average enzymatic activity, either with or without

Warfarin, is the highest and that we can note a substantial

heterogeneity. Regarding this point we can postulate the

existence of two subpopulations in Vescles, which will

have different VKOR activities and thus different statuses

towards AVKs. The difference of VKOR activity between

the three areas could be attributed to different factors. We

found that sex and weight had no significant effect (data

not shown) and the three trapped populations were mostly

composed of mature adults. The differences in VKOR

activity could also have been explained by a divergence of

the populations due to the distance between the three areas

(at least 100 kms) but we chose three plots whose floristic

composition was as similar as possible. It is noteworthy

that, in spite of the importance that these biological factors

could have on resistance to AVKs, we found that treatment

history of the plot seems to have a great influence on dif-

ferences in VKOR activity. Actually, the area where bro-

madiolone was used on the more regular basis (at least one

treatment per year), is where the VKOR average activity

was the most important and the greatest heterogeneity in

VKOR activity was observed. It suggests an adaptation to

the presence of bromadiolone in the environment in the

Vescles area.

The VKOR microsomal hepatic activity was also tested

in the three areas in presence of 0.5 lM of Warfarin. The

median of the percentage of inhibition was 66% in the By

area and 51% in the Vescles area. As the inhibition in the

population of the Vescles area is less important in com-

parison to the population of By, the differences between

the remaining VKOR activities are increased (Fig. 3). This

could be considered as a biological advantage for the ani-

mals in case of a bromadiolone treatment and thus, could

be an argument in favour of a resistance to AVKs in the

population of the Vescles area.

For the precise evaluation of enzymatic parameters, we

have focused on the most different areas, By and Vescles.

It is important to note, first, that all our study was based on

animals trapped at random in the field and not on animals

selected on a known genetic background. However, we can

observe some differences in the Vmax and the Ki for War-

farin between the two sets of samples whereas the Km is

similar (Table 2). The increased Ki in the Vescles group of

animals means that their VKOR is less sensitive to the

inhibition by Warfarin than VKOR of the animals trapped

in the By area. So it is a hint that there is a resistance

phenomenon in the Vescles population.

Consequently, we decided to look for a potential genetic

background of this resistance. As the vkorc1 gene was not

known for the water vole, we had to elucidate the specific

sequence of the gene in this species. We showed that the

protein sequence was very similar to the one of R. nor-

vegicus. The sequencing of all individuals from the two

areas showed few differences but a silent mutation in Exon

2 and an intronic haplotype. The silent mutation in the

second Exon seems to discriminate between the two areas

and could indicate a spatial segregation between the two

populations. On the contrary, the intronic haplotype is

present only in five animals in the Vescles area. It consists

in the deletion of 4 bps and three heterozygotes mutations

J. Vein et al.

123

in the second intron. To test the meaning of the haplotype

in term of resistance, we have studied the relation between

the genotype (mutated/wild type) and the VKOR activity.

The VKOR activity was significantly more resistant to

Warfarin in the mutated group. It seemed thus, that this

haplotype could be associated with resistance towards

AVKs in the water vole.

It could also be interesting to compare our results to

previous results in the Norway rat. In the resistant rat

Y139F, Lasseur et al. (2005) demonstrated that Km and

Vmax are decreased so that the enzymatic efficiency (Vmax/

Km) remained constant while the Ki for Warfarin was

highly increased. In the present study, Km is constant

whereas Vmax is increased, so the efficiency is also

increased, and the Ki for Warfarin is slightly increased. In

the water vole, the enzymatic mechanism is easily under-

standable. Indeed, the increase of Vmax and thus of the

enzymatic efficiency in case of resistance leads to a

potential VKOR activity more important when the animal

ingests some AVKs and, consequently, to a more limited

impact of AVKs on this animal. Such a situation in the

water vole can also be compared to what is known in

humans. A mutation on the VKORC1 gene promoter, in

linkage with an intronic mutation on the first intron,

explains 37% of the variation in the response to oral anti-

coagulants used as treatments in the thromboembolic dis-

eases (Bodin et al. 2005). In our case, we can hypothesize

that a mutation on the promoter of the vkorc1 gene of the

water vole could explain the raise of the enzymatic effi-

ciency and that this might be in linkage with the intronic

haplotype we have discussed above.

Conclusion

Our study has pointed out the existence of resistance in

water vole populations submitted to intensive treatments

with bromadiolone in their environment. However, our

study only dealt with the VKOR part of resistance to AVKs

and it is well known in human or in other rodents that the

resistance could also be due to differences in AVKs’

metabolism by the cytochrom P450 complex. It could also

be interesting to investigate further this part of resistance

towards AVKs in this species or to perform in vivo studies.

Nevertheless, it seems important to us to consider resis-

tance in further studies on the water vole population

dynamics, especially in areas where AVKs are used to

control vole populations.

Acknowledgments We thank M.L. Delignette-Muller for aid in

statistical analysis and the FREDON Franche-Comte team for the

help in field work. We thank C. Longin-Sauvageon for her technical

help.

References

Anonymous (2003) A reappraisal of Blood Clotting Response tests

for anticoagulant resistance and a proposal for a standardised

BCR test methodology. Rodenticide Resistance Action Com-

mittee of CropLife International, Technical Monograph. http://

www.croplife.org/files/documentspublished/1/en-us/PUB-TM/

306_PUB-TM_2006_02_03_Technical_Monograph_-_February_

2003.pdf. Accessed 15 Dec 2010

Berny PJ, Buronfonsse T, Buronfosse F, Lamarque F, Lorgue G

(1997) Field evidence of secondary poisoning of foxes (Vulpesvulpes) and buzzards (Buteo Buteo) by bromadiolone, a 4-year

survey. Chemosphere 35:1817–1829

Berny PJ, Alves de Oliveira L, Videmann B, Rossi S (2006)

Assessment of ruminal degradation, oral bioavailability and

toxic effects of anticoagulant rodenticides in sheep. Am J Vet

Res 67:363–371

Bodin L, Verstuyft C, Tregouet D-A, Robert A, Dubert L, Funck-

Brentano C, Jaillon P, Beaune P, Laurent-Puig P, Becquemont L,

Loriot M-A (2005) Cytochrome P450 2C9 (CYP2C9) and

vitamin K epoxide reductase (VKORC1) genotypes as determi-

nants of acenocoumarol sensitivity. Blood 106:135–140

Boyle CM (1960) Case of apparent resistance of Rattus norvegicusBerkenhout to anticoagulant poisons. Nature 188:517

Bradford MM (1976) A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the

principle of protein–dye binding. Anal Biochem 72:248–254

Giraudoux P, Delattre P, Habert M, Quere JP, Deblay S, Defaut R,

Duhamel R, Moissenet MF, Salvi D, Truchetet D (1997)

Population dynamics of fossorial water vole (Arvicola terrestrisscherman): a land use and landscape perspective. Agric Ecosyst

Environ 66:47–60

Giraudoux P, Tremollieres C, Barbier B, Dufaut R, Rieffel D, Bernard

N, Lucot E, Berny P (2006) Persistence of bromadiolone

anticoagulant rodenticide in Arvicola terrestris populations after

field control. Environ Res 102:291–298

Greaves J (1994) Resistance to anticoagulant rodenticides. In: Buckle

AP, Smith RH (eds) Rodent pests and their control. CAB

International, Wallingford, pp 194–217

Greaves JH, Ayres P (1967) Heritable resistance to warfarin in rats.

Nature 215:877–878

Houin R, Deniau M, Liance M, Puel F (1982) Arvicola terrestris an

intermediate host of Echinoccocus multilocularis in France:

epidemiological consequences. Int J Parasitol 12:593–600

Ishizuka M, Okajima F, Tanikawa T, Min H, Tanaka KD, Sakamoto

KQ, Fujita S (2007) Elevated warfarin metabolism in warfarin-

resistant roof rats (Rattus rattus) in Tokyo. Drug Metab Dispos

35:62–66

Ishizuka M, Tanikawa T, Tanaka KD, Heewon M, Okajima F,

Sakamoto KQ, Fujita S (2008) Pesticide resistance in wild

mammals. Mechanisms of anticoagulant resistance in wild

rodents. J Toxicol Sci 33:283–291

Kohn MH, Pelz H-J (1999) Genomic assignment of the warfarin

resistance locus, Rw, in the rat. Mamm Genome 10:696–698

Lasseur R, Longin-Sauvageon C, Videmann B, Billeret M, Berny P,

Benoit E (2005) Warfarin resistance in a French strain of rats.

J Biochem Mol Toxicol 19:379–385

Lasseur R, Grandemange A, Longin-Sauvageon C, Berny P, Benoit E

(2006) Heterogeneity of the coumarin anticoagulant targeted

vitamin K epoxide reduction system. Study of kinetic parameters

in susceptible and resistant mice (Mus musculus domesticus).

J Biochem Mol Toxicol 20:221–229

Lasseur R, Grandemange A, Longin-Sauvageon C, Berny P, Benoit E

(2007) Comparison of the inhibition effect of different

Field treatments

123

anticoagulants on vitamin K epoxide reductase activity from

Warfarin-susceptible and resistant rat. Pestic Biochem Physiol

88:203–208

Li T, Chang C-Y, Jin D-Y, Lin P-J, Khvorova A, Stafford DW (2004)

Identification of the gene for vitamin K epoxide reductase.

Nature 427:541–544

Markussen MD, Heiberg AC, Fredholm M, Kristensen M (2008)

Differential expression of cytochrome P450 genes between

bromadiolone-resistant and anticoagulant-susceptible Norway

rats: a possible role for pharmacokinetics in bromadiolone

resistance. Pest Manag Sci 64:239–248

Pelz H-J, Rost S, Hunerberg M, Fregin A, Heiberg AC, Baert K,

MacNicoll AD, Prescott CV, Walker A-S, Oldenburg J, Muller

CR (2005) The genetic basis of resistance to anticoagulants in

rodents. Genetics 170:1839–1847

Raoul F, Michelat D, Ordinaire M, Decote Y, Aubert M, Delattre P,

Deplazes P, Giraudoux P (2003) Echinoccocus multilocularis:

secondary poisoning of fox population during a vole outbreak

reduces environmental contamination in high endemicity area.

Int J Parasitol 33:945–954

Rausch RL (1995) Life cycle patterns and geographic distribution of

Echinoccocus species. In: Thompson RCA, Lymbery AJ (eds)

Echinoccocus and hydatic disease. CAB International, Walling-

ford, pp 89–134

R Development Core Team (2010) R: a language and environment for

statistical computing. R Foundation for Statistical Computing,

Vienna, Austria. ISBN 3-900051-07-0. http://www.R-project.org.

Accessed 15 Dec 2010

Rost S, Fregin A, Ivaskevicius V, Conzelmann E, Hortnagel K, Pelz

H-J, Lappegard K, Seifried E, Scharrer I, Tuddenham EGD,

Muller CR, Strom TM, Oldenburg J (2004) Mutations in

VKORC1 cause warfarin resistance and multiple coagulation

factor deficiency type 2. Nature 427:537–541

Sadler JE (2004) K is for koagulation. Nature 427:493–494

Sage M, Coeurdassier M, Defaut R, Lucot E, Barbier B, Rieffel D,

Berny P, Giraudoux P (2007) How environment and vole

behaviour may impact rodenticide bromadiolone persistence in

wheat baits after field controls of Arvicola terrestris. Environ

Pollut 148:372–379

Sugano S, Kobayashi T, Tanikawa T, Kawakami Y, Kojima H,

Nakamura K, Uchida A, Morishima N, Tamai Y (2001)

Suppression of CYP3A2 mRNA expression in the Warfarin-

resistant roof rat, Rattus rattus: possible involvement of cyto-

chrome P450 in the warfarin resistance mechanism. Xenobiotica

31:399–407

Thierry-Palmer M (1984) Synthesis of vitamin K epoxide: an under-

graduate biochemistry experiment. J Chem Educ 61:179–180

Truchetet D, Ruant J, Bedekovic P, Perreal D, Defaut R, Delattre P

(2005) Lutte contre le campagnol terrestre. Bilan et perspectives.

Phytoma 580:24–28. ISSN 1164-6993 French professional

review

Viel J-F, Giraudoux P, Abrial V, Bresson-Hadni S (1999) Water vole

(Arvicola terrestris schermann) density as risk factor for human

alveolar echinococcosis. Am J Trop Med Hyg 61:559–565

Walsh R, Martin E, Darvesh S (2007) A versatile equation to describe

reversible enzyme inhibition and activation kinetics: modeling

b-galactosidase and butyrylcholinesterase. Biochim Biophys

Acta 1770:733–746

J. Vein et al.

123