Arab Hussain Zoology 2020 icp peshwar.pdf

EPIDEMIOLOGY AND MOLECULAR CHARACTERIZATION OF

TOXOPLASMA GONDII IN LIVESTOCK OF PESHAWAR VALLEY

Submitted by

ARAB HUSSAIN

REG.NO.2015/ICP-119

Supervised by

DR. MUHAMMAD ZAHID

DEPARTMENT OF ZOOLOGY

ISLAMIA COLLEGE PESHAWAR

KHYBER PAKHTUNKHWA, PAKISTAN

(2015-18)

EPIDEMIOLOGY AND MOLECULAR CHARACTERIZATION OF

TOXOPLASMA GONDII IN LIVESTOCK OF PESHAWAR VALLEY

Submitted by

ARAB HUSSAIN

REG.NO.2015/ICP-119

Supervised by

DR. MUHAMMAD ZAHID

Thesis submitted to the Department of Zoology Islamia College University Peshawar, for the

partial fulfillment of the requirement for the degree of

DOCTOR OF PHILOSOPY (Ph. D) IN ZOOLOGY

DEPARTMENT OF ZOOLOGY

ISLAMIA COLLEGE PESHAWAR

KHYBER PAKHTUNKHWA, PAKISTAN

(2015-18)

iv

DEDICATION

This work is dedicated

To

My parent’s

Teachers

And friends

v

TABLE OF CONTENTS

DEDICATION.............................................................................................................................. iv

TABLE OF CONTENTS ............................................................................................................. v

LIST OF TABLES ....................................................................................................................... ix

LIST OF FIGURES ..................................................................................................................... xi

LIST OF ABBREVIATIONS ................................................................................................... xiii

ACKNOWLEDGMENTS ......................................................................................................... xiv

ABSTRACT ................................................................................................................................. xv

INTRODUCTION......................................................................................................................... 1

1.1 History ................................................................................................................................................ 1

1.2 Distribution (Epidemiology) ............................................................................................................... 5

1.3 Morphology......................................................................................................................................... 7

1.3.1 Tachyzoite: ................................................................................................................................... 7

1.3.2 Bradyzoites (Tissue cysts): .......................................................................................................... 8

1.3.3 Oocyst .......................................................................................................................................... 9

1.4 Life Cycle.......................................................................................................................................... 10

1.5 Toxoplasmosis and animal world ..................................................................................................... 12

1.5.1 Goats and Sheep ......................................................................................................................... 12

1.5.2 Sheep .......................................................................................................................................... 13

1.5.3 Pigs (Sus scrofa) ........................................................................................................................ 15

1.5.4 Domestic ruminants (Cattle) ...................................................................................................... 17

1.5.5 Birds ........................................................................................................................................... 17

1.5.6 Poultry ........................................................................................................................................ 18

1.5.7 Cats ............................................................................................................................................ 18

1.5.8 Dogs ........................................................................................................................................... 19

1.5.9 Deer ............................................................................................................................................ 19

1.5.10 Horses ...................................................................................................................................... 19

1.5.11 Rabbits ..................................................................................................................................... 19

1.5.12 Other species ............................................................................................................................ 19

1.5.13 Marine mammals...................................................................................................................... 19

1.6 Food studies ...................................................................................................................................... 20

1.6.1 Survival in foods ........................................................................................................................ 20

vi

1.6.2 Unsporulated oocysts ................................................................................................................. 20

1.6.3 Sporulated oocysts ..................................................................................................................... 21

1.6.3 Tissue cysts ................................................................................................................................ 21

1.6.4 Tachyzoites ................................................................................................................................ 21

1.7 Toxoplasmosis in humans ................................................................................................................. 22

1.7.1 Prevalence of T. gondii in Pakistan ............................................................................................ 24

1.8 Genome of Toxoplasma gondii ..................................................................................................... 24

1.9. Genetic Variation of T. gondii ......................................................................................................... 25

1.9.1 Main Lineages ............................................................................................................................ 25

1.9.2 Atypical lineages ........................................................................................................................ 26

1.10. Transmission .................................................................................................................................. 27

1.11 Pathogenesis. ................................................................................................................................... 28

1.11.1 Pathogenesis and Clinical Signs of Toxoplasmosis in Animals .............................................. 28

1.11.2 Pathogenesis and Clinical Signs of Toxoplasmosis in Humans ............................................... 28

1.12 Diagnosis......................................................................................................................................... 30

1.12.1 DAT (Direct Agglutination Test). ............................................................................................ 30

1.12.2 ELISA (Enzyme Linked Immunosorbent Assay) .................................................................... 31

1.12.3 Serology Using Meat Juice ...................................................................................................... 31

1.12.4 Detection of Parasites............................................................................................................... 31

1.12.5 Examination of cat faeces ........................................................................................................ 31

1.12.6 ELISA to measure IgG titers .................................................................................................... 32

1.12.7 PCR for detection of T. gondii B1 gene in blood ..................................................................... 32

1.12.8 Techniques for T. gondii strain genotyping ............................................................................. 33

1.12.9 Latex Agglutination Test ......................................................................................................... 34

1.12.10 Vaccination strategies ............................................................................................................ 34

1.13 Symptoms ....................................................................................................................................... 36

1.14 Risk factors and Transmission ........................................................................................................ 36

1.14.1 Horizontal transmission ........................................................................................................... 37

1.14.2. Vertical transmission............................................................................................................... 38

1.15 Treatment of Toxoplasmosis ........................................................................................................... 39

1.16 Prevention and Control ................................................................................................................... 39

1.16.1 Preventive Measures in Pregnancy .......................................................................................... 40

1.17 Aims and Objectives ....................................................................................................................... 40

MATERIALS AND METHODS ............................................................................................... 41

vii

2.1 Study area.......................................................................................................................................... 41

2.1.1 District Charsadda ...................................................................................................................... 41

2.1.2 District Mardan .......................................................................................................................... 43

2.1.3 District Swabi ............................................................................................................................. 44

2.1.4 District Nowshera ...................................................................................................................... 45

2.1.5 District Peshawar ....................................................................................................................... 46

2.4 Serological Examination ................................................................................................................... 49

2.4.1 Sample preparation ........................................................................................................................ 49

2.4.2 Techniques ..................................................................................................................................... 49

2.4.3 Interpretation of results .................................................................................................................. 49

2.5 Collection of fecal samples from stray cats ...................................................................................... 49

2.5.1 Materials needed and sample collection .................................................................................... 49

2.5.2 Direct smear formation .............................................................................................................. 50

2.5.3 Sheather’s Sugar Floatation Technique ..................................................................................... 50

2.6 DNA extraction from blood .............................................................................................................. 50

2.7 Isolation of DNA from Stool ............................................................................................................ 51

2.7.1 Procedure ................................................................................................................................... 51

2.8 Amplification of DNA samples .................................................................................................... 53

2.11 Statistical analysis ........................................................................................................................... 54

RESULTS .................................................................................................................................... 64

3.1 Overall seroprevalence of Toxoplasmosis in Livestock of Peshawar Valley ................................... 64

3.2 Overall District wise seroprevalence of Toxoplasmosis in livestock of Peshawar Valley. ........... 65

3.3 Percentage distribution of sample animals. ....................................................................................... 66

3.4 Comparative seroprevalence of T. gondii in Livestock of Peshawar Valley .................................... 67

Table. 3.4 Comparative seroprevalence of T. gondii in Livestock of Peshawar Valley ......................... 67

3.5 Seroprevalence of T. gondii in Livestock of Charsadda. .................................................................. 68

3.6 Seroprevalence of T. gondii in Livestock of district Peshawar. ........................................................ 69

3.7 Seroprevalence of T. gondii in Livestock of district Mardan. ........................................................... 70

3.8 Seroprevalence of T. gondii in domestic animals of district Nowshera ............................................ 71

3.9 Seroprevalence of T. gondii in Livestock of District Swabi. ............................................................ 72

3.10 Overall sex-wise seroprevalence of T. gondii in Livestock of Peshawar Valley ............................ 73

3.11 Sex-wise seroprevalence of T. gondii in Livestock of district Charsadda. ..................................... 74

3.12 Sex-wise seroprevalence of T. gondii in Livestock of district Peshawar ........................................ 76

3.13 Sex-wise seroprevalence of T. gondii in Livestock of district Mardan ........................................... 78

viii

3.14 Sex-wise seroprevalence of T. gondii in livestock of district Nowshera ........................................ 80

3.15 Sex-wise seroprevalence of T. gondii in livestock of District Swabi.............................................. 82

3.16 Age-wise Seroprevalence of T. gondii in Cows of district Charsadda, Peshawar and Mardan ...... 84

3.17 Age-wise Seroprevalence of T. gondii in Goats of District Charsadda, Peshawar and Mardan ..... 86

3.18 Age-wise prevalence of T. gondii in Sheep of Charsadda, Peshawar and Mardan ......................... 87

3.19 Age-wise Seroprevalence of T. gondii in buffaloes of District Charsadda, Peshawar and Mardan 88

3.20 Agewise prevalence of T. gondii in cows of district Nowshera and Swabi .................................... 89

3.21 Age-wise Seroprevalence of T. gondii in Goats of District Nowshera and Swabi ......................... 90

3.22 Age-wise Seroprevalence of T. gondii in Sheep Nowshera and Swabi .......................................... 91

3.23. Age-wise Seroprevalence of T. gondii in buffaloes of District Nowshera and Swabi ................... 92

3.24 Seroprevalence of T. gondii in livestock on the bases of type of feeding. ...................................... 92

3.25 Seroprevalence of T. gondii in livestock on the bases of contact with cat. ..................................... 94

B. Molecular Results ................................................................................................................... 95

3.1. Molecular results .............................................................................................................................. 95

3.2 DNA Sequencing .............................................................................................................................. 96

3.2.1 Sequence of the Toxo B1 gene .................................................................................................. 96

DISCUSSION .............................................................................................................................. 97

4.1 Epidemiology .................................................................................................................................... 97

4.2 T. gondii oocysts in fecal samples of stray cats .............................................................................. 100

4.3. Molecular characterization of T. gondii ......................................................................................... 101

CONCLUSION ......................................................................................................................... 102

RECOMMENDATIONS .......................................................................................................... 103

REFERENCES .......................................................................................................................... 104

Annexure (Author Published Articles on Toxoplasma gondii) ............................................. 136

ix

LIST OF TABLES

Table

No. Title

Page

No.

1.1 Summary of landmarks in the history of Toxoplasma gondii 3-5

1.2 Mn-PCR-RFLP primers and Marker and T. gondii chromosome number. 33

2.1 Preparation of Real-Time PCR Reaction Mix for DNA template 53

2.2 Reaction conditions for DNA templates 54

2.3 Detail of Primer 54

3.1 Overall seroprevalence of Toxoplasma gondii in Livestock of Peshawar

Valley 64

3.2 Overall District wise seroprevalence of T. gondii in Livestock of Peshawar

Valley 65

3.3 Percentage distribution of tested animals 66

3.4 Comparative seroprevalence of T. gondii in Livestock of Peshawar Valley 67

3.5 Seroprevalence of T. gondii in livestock of district Charsadda 68

3.6 Seroprevalence of T. gondii in Livestock of district Peshawar 69

3.7 Seroprevalence of T. gondii in Livestock of district Mardan 70

3.8 Seroprevalence of T. gondii in Livestock of district Nowshera 71

3.9 Seroprevalence of T. gondii in Livestock of district Swabi. 72

3.10 Overall sex-wise seroprevalence of T. gondii in Livestock of Peshawar Valley. 73

3.11 Sex-wise seroprevalence of T. gondii in Livestock of district Charsadda 75

3.12 Sex-wise seroprevalence of T. gondii in Livestock of district Peshawar 77

3.13 Sex-wise seroprevalence of T. gondii in Livestock of district Mardan 79

3.14 Sex-wise seroprevalence of T. gondii in livestock of district Nowshera 81

3.15 Sex-wise seroprevalence of T. gondii in livestock of district Swabi 83

3.16 Age-wise Seroprevalence of T. gondii in Cows of district Charsadda,

Peshawar and Mardan. 85

x

3.17 Age-wise Seroprevalence of T. gondii in Goats of district Charsadda,

Peshawar and Mardan 86

3.18 Age-wise prevalence of T. gondii in Sheep of Charsadda, Peshawar and

Mardan 87

3.19 Age-wise Seroprevalence of T. gondii in buffaloes of district Charsadda,


3.20 Age wise prevalence of T. gondii in cows of district Nowshera and Swabi 89

3.21 Age-wise Seroprevalence of T. gondii in Goats of District Nowshera and

Swabi 90

3.22 Age-wise Seroprevalence of T. gondii in Sheep of Nowshera and Swabi 91

3.23 Age-wise Seroprevalence of T. gondii in buffaloes of District Nowshera and

Swabi 92

3.24 Seroprevalence of T. gondii in livestock on the bases of type of feeding. 93

3.25 Seroprevalence of T. gondii in livestock on the bases of contact with cat. 94

xi

LIST OF FIGURES

Figure

No. Title

Page

No.

1.1 Structure of T. gondii Tachyzoites 8

1.2 Schematic diagram showing Organelles of a Bradyzoite of T. gondii 9

1.3 Sporulated Oocyst of T. gondii 10

1.4 Life cycle of T. gondii. 12

1.5 Map showing worldwide seroprevalence of T. gondii. 22

1.6 Transmission of Toxoplasma gondii 38

2.1 Map of District Charsadda. 42

3.1 Overall seroprevalence of T. gondii in Livestock of Peshawar Valley. 64

3.2 Overall district wise seroprevalence of T. gondii in Livestock of Peshawar

Valley. 66

3.3 Percentage distribution of tested animals 67

3.4 Comparative seroprevalence of T. gondii in Livestock of Peshawar Valley 68

3.5 Seroprevalence of T. gondii in livestock of district Charsadda 69

3.6 Seroprevalence of T. gondii Livestock of district Peshawar. 70

3.7 Seroprevalence of T. gondii in Livestock of district Mardan. 71

3.8 Seroprevalence of T. gondii in Livestock of District Nowshera 72

3.9 Seroprevalence of T. gondii in Livestock of district Swabi 73

3.10 Prevalence of T. gondii in Male Livestock of Peshawar Valley 74

3.11 Prevalence of T. gondii in female Livestock of Peshawar Valley 74

3.12 Prevalence in male livestock of district Charsadda 75

3.13 Prevalence in female Livestock of district Charsadda 76

3.14 Prevalence in male livestock of district Peshawar 77

3.15 Prevalence in female livestock of district Peshawar 78

xii

3.16 Prevalence in male livestock of district Mardan 79

3.17 Prevalence in female livestock of district Mardan 80

3.18 Prevalence in male livestock of district Nowshera 81

3.19 Prevalence in female livestock of district Nowshera 82

3.20 Prevalence in male livestock of district Swabi 83

3.21 Prevalence in female livestock of district Swabi 84

3.22 Age-wise prevalence of T. gondii in Cows of Charsadda, Peshawar and

Mardan 85

3.23 Age-wise prevalence of T. gondii in Goats of Charsadda, Peshawar and

Mardan 86

3.24 Age-wise Seroprevalence of T. gondii in Sheep of district Charsadda,


3.25 Age-wise Seroprevalence of T. gondii in buffaloes of district Charsadda,


3.26 Age-wise Seroprevalence of T. gondii in Cows of district Nowshera and

Swabi 89

3.27 Age-wise Seroprevalence of T. gondii in Goats of district Nowshera and

Swabi 90

3.28 Age-wise Seroprevalence of T. gondii in Sheep of district Nowshera and

Swabi 91

3.29 Age-wise Seroprevalence of T. gondii in buffaloes of district Nowshera

and Swabi 93

3.30 Seroprevalence of T. gondii in livestock on the bases of type of feeding. 93

3.31 Seroprevalence of T. gondii in livestock on the bases of contact with cat. 94

3.32 Bands showing Toxo B1 gene (size of 420 bp) 95

3.33 Phylogenetic Tree of T. gondii 96

xiii

LIST OF ABBREVIATIONS

AIDS Acquired immunodeficiency syndrom

CFT Complement Fixation Test

CNS Central Nervous System

DSM Direct smear method

DT Dye Test

ELISA Enzyme Linked Immunosorbent Assay

HIV Human immunodeficiency virus

IFA Indirect Fluorescent antibody test

IgA Immunoglobulin antibody A

IgG Immunoglobulin antibody G

IgM Immunoglobulin antibody M

IHA Indirect Heamagglutination Test

LAT Latex Agglutination Test

MAT Modified Agglutination Test

PCR Polymerase Chain Reaction

SFDT Sabin-Feldman Dye Test

SOT Solid organ transplant

T. gondii Toxoplasma gondii

UK United Kingdom

US United States

xiv

ACKNOWLEDGMENTS

All praises to almighty “ALLAH” alone, the creator of heavens and earth, the most

merciful and most Compassionate, the most Benevolent, whose blessing and exaltations

flourished my thoughts and enabled me to improve my knowledge up to this stage. Who blessed

me to complete this task within specified time. I also offer the humble words of respect to the

Holy Prophet “MUHAMMAD” (Sallallaho Alaehe Wa Allehe Wasallam) the most perfect and

exalted among all the creatures born on surface of the earth and who is forever city of knowledge

for the whole humanity.

I wish to express my thanks and profound gratitude to my Supervisor Dr. Muhammad

Zahid, Associate Professor, Department of Zoology, Islamia College University, Peshawar, who

provided me very friendly environment during my stay at the Department and his continuous

encouragement, friendly approach and fatherly attitude, his meticulous approach and analytical

mind has always inspired me in dealing with problems instantly and with logical reasoning.

I would like to express my thanks and profound gratitude to Chairman, Professor Dr. Ali

Muhammad, Department of Zoology, Islamia College University, Peshawar, who provided me

very friendly environment during my stay at the Department.

I wish to extend my greatest gratitude to Mr. Mudassir Shah, and Mr Ahmad Yar for their

help during my field work.

Arab Hussain

xv

ABSTRACT

Toxoplasmosis is a zoonotic disease, caused by a protozoan coocidian unicellular parasite

Toxoplasma gondii which is cosmopolitan in distribution among the animals including domestic

animals and human beings. Very little information is available about the infection rate of

toxoplasmosis in livestock of Peshawar valley, Pakistan. Therefore, the study was carried in this

area with the aim to determine the infection rate in livestock and to aware the people about

adverse effects of the disease. A total of 2880 blood samples were collected from Cows,

Buffaloes, sheep and goats in which 1255 (43.6%) samples were positive. Out of 1058 (36.7%)

male 375 (35.4%) and out of 1822 (63.3%) females 880 (48.3%) were positive. The

seropositivity of the samples were determined by Latex agglutination test. In cows out of 261

males 106 (40.6%) were positive while in females out of 456 blood samples 254 (55.7%) were

seropositive. In goats out of 282 males 99 (35.1%) and in 549 females 287 (52.3%) were found

infective. Among sheep and buffaloes’ prevalence was found as 39.2% of 344 males and 56.3%

of 449 females, 20.5% of 171 males and 23.4% of 368 females respectively. Among cows high

prevalence 72.7% was found in age group 3-4 years while in goats high infection rate 61.8% was

detected in age group 2-3 years. Similarly, high prevalence 56% was found in sheep in age group

> 3 years and 27% in buffaloes of age group > 4 years. A high seroprevalence 54.8% was found

in those animals where cats were more frequent in their surrounding while a low prevalence

33.5% was found in those where contact with cats was not common. (P<0.05). Similarly, high

prevalence was found in grazing animals 53.5% as compared to non-grazing 34.6% (P<0.05).

Moreover, a total of 130 cat fecal samples were collected and observed for the detection of

oocysts through microscopy. Out of these 14(10.8 %) samples were found positive for T. gondii

oocysts whereas the prevalence rate in male was 7% as compared to female stray cats in which

the prevalence rate was 12.6%. The positive samples were then analyzed for further confirmation

through PCR and bands were visualized on 2% gel. The DNA of positive samples were further

processed for sequencing. This was the first ever study at molecular level in the area for the

detection of T. gondii. This study will provide an ample picture for controlling the disease in the

area.

1

CHAPTER 1

INTRODUCTION

Toxoplasmosis is a disease caused by an obligate intracellular coccidian protozoan

parasite, named Toxoplasma gondii, belongs to phylum Apicomplexa, widely spread

throughout the world. It has the ability of penetrating into many types of host cells (Levine,

1973). Its prevalence is based upon different elements like topographical conditions, social

activities, cultural aspects, age, food behavior, and interaction with native cats (Barbosa et

al., 2009). It is a protozoal parasite of warm-blooded animals and is capable of infecting

different species of vertebrates but cats are its main host (Daryani et al., 2010; Hamidinejat et

al., 2010; Edrisian et al., 2008). T. gondii occurs in brain cells, lungs, heart but mostly in

lymph nodes and is predominant in hot and humid environment. The parasite exists in

different forms tachyzoite, bradyzoite and oocyst (Evering and Weiss, 2006; Hegab and Al

Matawa, 2003; Lappalainen and Hedman, 2004; Suzuki et al., 2001). Due to its ability of

infecting all warm-blooded animals including human, it is considered one of the most

successful parasites. About half of the population suffer from toxoplasmosis all over the

world (Dubey, 2010; Romero et al., 2012). Toxoplasma gondii belongs to phylum

Apicomplexa, which also includes Neospora, Plasmodium and Sarcosystis. Apicomplexa is a

diverse and extremely large taxon of parasites which causes a variety of life-threatening

disease in humans and animals (Majumdar, 2010).

1.1 History

Toxoplasma gondii was first discovered by Charles Nicolle and Louis Manceaux in

1908 at Pasteur Institute in Tunis. They recognized it in the desert rodent with a common

name of “gundi” and scientific name Ctenodactylus gundi, and primarily presumed it as a

species of Leishmania. Later, in the same year Alfonso Splendore of Brazil discovered the

parasite in rabbit (Oryctolagus cuniculus) and again wrongly recognized it as a species of

Leishmania (Splendore, 1908). But in 1909 subsequent experimental infection and

microscopic analysis the parasite was retitled to Toxoplasma gondii as defined by Nicolle and

Manceaux (Nicolle and Manceaux, 1909) due to the bow shaped morphology of the

extracellular tachyzoite stage of the parasite; “Toxo” is derived from Greek for bow,

“plasma” meaning life and “gondii” after the original host it was reported in gundi

(Ctenodactylus gundi). In 1939 for the first-time congenital toxoplasmosis was reported in a

3-day old child with seizures (Wolf et al., 1939).

2

In 1939 the first identified case of congenital toxoplasmosis was reported from a 3-

day old child who had developed seizures (Wolf et al., 1939). The baby only survived for one

month and following post mortem cerebral calcification, retinochoroiditis, and hydrocephalus

were observed. This is now known as the classical triad of symptoms of congenital

toxoplasmosis (Sabin, 1942). In the 1950’s T. gondii parasites were discovered in enucleated

eyes (Wilder, 1952). It was not until 1970 that cats were identified as the definitive host for

the parasite, when the first description of the sexual development of T. gondii in the small

intestine of cats was published (Frenkel et al., 1970). Another important part in the history of

Toxoplasma was in the 1980’s when AIDS patients were found to develop clinical symptoms

of the parasite tunistic infection for these immunocompromised patients (Luft and

Remington, 1988). Either newly acquired Toxoplasmosis or recrudescence of latent infection

would frequently cause Toxoplasmic encephalitis (Luft and Remington, 1992).

The most possible effect of T. gondii on behaviour in both humans and animals was

also studied. In 2000 a study showed that rats, which were infectedwith the T. gondii, were

less fearful of cats (Berdoy et al., 2000) and further research has also showed that mice

infected with the T. gondii are attracted to cat urine (Ingram et al., 2013). These behavioural

changes are assumed to increase thechance of cat predation by cats, and hence complete the

parasite life cycle. Although the T. gondii in animal and human hosts link to T. gondii

infection and behavioural problems in humans is not fully understood, several reports have

linked infection to schizophrenia (Torrey & Yolken, 2003), increased risk taking road traffic

accidents (Flegr et al., 2009) and anincreased risk of suicide (Lester, 2012). Similarly, the

emergence of genetically differentstrains (atypical strains) of the T. gondii have been linked

to several fatal cases of acquired infection in immuno-competent individuals (Carme et al.,

2002; Carme et al., 2009b).

3

Table.1.1 Summary of landmarks in the history of Toxoplasma gondii (Dubey, 2008).

Finding Reference

Etiologic agent

Protozoan found in Tunisia in the rodent, Ctenodactylus gundi. Nicolle and Manceaux (1908)

Protozoan found in a rabbit in Brazil. Splendore (1908)

proposed name Toxoplasma gondii (taxon bow, plasma image). Nicolle and Manceaux (1909)

T. gondii First viable isolate obtained from an animal. Sabin and Olitsky (1937)

First isolate of T. gondii from human Wolf et al. (1939)

Animal and humanT. gondii proven identical Sabin (1941)

T. gondii pathogenesis, including hydrocephalus Frenkel and Friedlander (1951),

Frenkel (1953,1956)

Parasite morphology and life cycle

Tachyzoite (feeding form, trophozoite, proliferative form and

endodyozoite)

proposed term tachyzoite (tachy-fast, zoite- life) Frenkel (1973)

Described Endodyogeny Goldman et al. (1958)

Ultrastructure Gustafson, Agar, and Cramer (1954),

Sheffield and Melton (1968)

Tissue cyst, cystozoite, bradyzoite,

Cyst identified Levaditi, Schoen, and Sanchis Bayarri

(1928)

Cyst cytologically described

Frenkel and Friedlander (1951),

Frenkel (1956)

Wanko et al. (1962), Ferguson and

Hutchison (1987)

Proposed term bradyzoite (bradys slow, zoon animal) Frenkel (1973)

Term tissue cyst proposed Dubey and Beattie (1988)

Identification of bradyzoite resistance to digestive enzymes Jacobs et al. (1960a, b)

Tissue cysts and bradyzoites development described Dubey and Frenkel (1976)

Complete biology of bradyzoites and tissue cysts reviewed Dubey et al. (1998)

Entroepithelial stages Feline

Coccidian stages described

Frenkel, Dubey, and Miller (1970),

Hutchison et al. (1970), Dubey and

Frenkel (1972), Sheffield and Melton

(1970)

Morphology described Oocyst Dubey et al. (1970b)

4

Five asexual T. gondii types (A–E) described Dubey and Frenkel (1972)

Ultrastructure of coccidian stages described

Sheffield (1970), Piekarski, Pelster,

and Witte (1971), Ferguson et al.

(1974, 1975, 1979a, b), Christie,

Pappas, and Dubey (1978), Speer,

Clark, and Dubey (1998), Speer and

Dubey (2005)

Transmission

Congenital

Transmission described in human Wolf et al. (1939)

Repeated transmission in house mouse found Beverley (1959)

Congenital transmission demonstrated in a large wild-animal

species, i.e white tailed deer Dubey et al. (2008)

Carnivorism, transmission of T. gondii by meat of intermediate hosts

Suggested carnivorous transmission Weinman and Chandler (1954)

Transmission through meat found in humans Desmonts et al. (1965)

Fecal—oral

Transmission of T. gondii by a resistant fecal form Demonstrated Hutchison (1965)

Coccidian phase recognized

Hutchison et al. (1970, 1971), Frenkel

et al. (1970), Dubey et al. (1970a, b),

Sheffield and Melton (1970),

Overdulve (1970).

intermediate and definitive hosts defined, including oocysts

shedding only by felids

Frenkel et al. (1970), Miller et al.

(1972), Jewell et al. (1972)

Human toxoplasmosis, first oocyst-inhaled/ingested outbreak

described Teutsch et al. (1979)

Genetics and genetically different T. gondii strains

Genetic and recombinants crosses produced Pfefferkorn and Pfefferkorn (1980)

Different Isoenzyme used to differentiate T. gondii strains Darde´ et al. (1987), Tibayrene et al.

(1991)

Restriction fragment length polymorphism (RFLP) used to group

T. gondiistrains into 3 Types (I, II, III)

Sibley et al. (1992), Howe and Sibley

(1995)

Continental, national, intercontinental, and Pandemic T. gondii

strains distinguished Lehmann et al. (2006)

T. gondii genome anointed Khan et al. (2005)

Immunity and protection

T. gondii neutralizing antibody recognized Sabin and Ruchman (1942)

5

Identification of antibodies to kill extracellular but not intracellular

T. gondii Sabin and Feldman (1948)

Protection transferred by immune lymphoid cells but not by

antibodies Frenkel (1967)

The main cytokine Interferon g found for protection Suzuki et al. (1988)

Role of CD81 and CD41cells in protection defined Gazzinelli et al. (1991)

Toxoplasmosis in humans

Congenital

Congenital toxoplasmosis first proven case Described Wolf et al. (1939)

Typical tetrad clinical signs described (chorioretinitis ydrocephalus

or microcephalus, intracerebral calcification) Sabin (1942)

1.2 Distribution (Epidemiology)

The distribution of Toxoplasmosis is related with environment and weather condition

of an area where the oocysts survive (Dubey, 2004). The use of infected undercooked meat is

considered as an important source of Toxoplasmosis for human infection (Cook et al., 2000).

Prevalence of Toxoplasmosis varies in different parts of the world and this variation is related

to climatic conditions, life style, age, nutritional habits and other socio-cultural factors

(Spalding et al., 2005). Africa and South America have a bigger variety of haplogroups of T.

gondii than Europe and North America (Khan et al., 2007), which indicate that in these areas

sexual reproduction of T. gondii is higher than in any other part of the world.

As Toxoplasma gondii is cosmopolitan in distribution (Zhou et al., 2011). To evaluate

the comparative significance of wide causes of T. gondii infection in humans,

epidemiological survey remains the main important approach. There have been a wide range

of serological surveys conducted in different countries to determine the prevalence of

toxoplasmosis in farm animals and humans; from north and South America (Dubey et al.,

2005; Anderlini et al., 2011), Europe (Acici et al., 2008; Gilot-Fromont et al., 2009), Africa

(Beidi et al., 1989, Bisson et al., 2000), Asia (Yang et al., 2000; Huang et al., 2010).

According to Australian Centre for International Agricultural Research (ACIAR,

2007) T. gondii is extensively spread among farm animals and humans with variable

seroprevalence rates of 11 to 61% in goats, less than 10% in cows, and 35 to 73% in cats,

75% in dogs, 11 to 36% in pigs and 35 to 73% in humans. Use of different serological tests

for the detection of T. gondii in sheep has been demonstrated in several countries. Using

indirect Fluorescent Antibody Test (IFAT), the prevalence of T. gondii was 55% in Swedish

6

pregnant ewes (Uggla et al., 1983) and 33% in Australian lambs (Munday et al., 1987). Using

enzymes linked immunosorbent assay (ELISA), the prevalence of infection was 62.5% in the

USA (Malik et al., 1990) and 57% in sheep of northwest Spain (Pandero et al., 2010), while

by modified agglutination test (MAT), the prevalence of infection was 64% in 4 to 6 year old

age and 80% in ewes of 6 year of age in the USA (Dubey and Jones 2008), while 13.9 and

28.5% in sheep kept under an intensive and extensive management system respectively, in

Uruguay (Savio and Nieto, 1995). Using Sabin-Feldman test (SFT) the prevalence of

infection was 33.2% in 0 to 12 months old sheep and 47% in sheep older than one year in

turkey (Aktas et al., 2000).

The only documented study on T. gondii Seroprevalence in small ruminants in

Zimbabwe was by (Pandey and Van knapen (1992) who reported seroprevalence rates of

9.2% and 10% in adult sheep and goats respectively, using an indirect ELISA test. In Egypt

in farm animals, anti-Toxoplasma gondii antibodies were detected in 10.8% of the cattle sera

tested by enzyme linked immunosorbent assay (ELISA) based on truncated surface antigen

2(TgSAG2t) (Ibrahim et al., 2009), and in 43.7% or 41.7% of sheep sera, when a modified

agglutination test or ELISA was used, respectively (shaapan et al., 2008), and in 98.4% of

sheep and 41.7% of goats when an ELISA was used (Ghoneim et al., 2010). A high

seroprevalence of 65.6% was recorded in donkeys (El-ghaysh, 1998) and 48.1 % in horses

(Ghazy et al., 2007). Anti-Toxoplasma gondii antibodies were detected in 17.4% of 166

camels (Hilali et al., 1998). When poultry were tested, 47.2% of chickens, 59.5% of turkeys,

and 50% of ducks were positive for anti-Toxoplasma gondii antibodies (Hilali et al., 1998).

Publications are not available on the T. gondii in Sudanese cattle, sheep, and goats.

The first study of Toxoplasmosis in camels was done by El Din et al. (1985) who reported an

infection rate of 54% from slaughter-camels. Bornstein and Musa (1987) accounted 22.5% by

using Sabin-Feldman test. Abbas et al. (1987) reported 12% via indirect Heamagglutination

test. (Elamin et al., 1992) in Butana plains via LAT reported 67%. (Khalil et al., 2007) in

three ecologically different areas reported prevalence 22.2% by using LAT. Antibodies to T.

gondii have been found in sheep worldwide and seroprevalence rate ranges from 6.7% to

84.5% (Kamaniet al., 2010; Klunet al., 2006). The seroprevalence of T. gondii infection in

flocks of sheep in Brazil ranges from 7.0% to 54.6% (Moura et al., 2007; Ogawa et al.,

2003). The only study in Bahia state with sheep was carried out in the metropolitan region of

Salvador and Recôncavo, with Prevalence of 18.75% (Gondim et al., 1999).20-30% in USA,

Netherland and Italy 60%, Finland 50%, Japan 25%, Indonesia 58% (Konishi et al., 2000)

and in India the prevalence of infection reached to 54-70% in women during pregnancy

7

(Yasodhara et al., 2004). Infection rate was higher than 80% in some countries (Montoya and

Liesenfeld, 2004).

Seroprevalence study has been conducted on different animal species in different

parts of the world (Bisson et al., 2000; Sharif et al., 2006). There are relatively fever reports

on the prevalence of T. gondii in different parts of Pakistan (Ramzan et al., 2009). The

previous study recorded 42.28% and 44.13% toxoplasmosis infection in goats and sheep,

respectively in district Mardan, Khyber Pakhtunkhwa. However overall infection recorded in

district Mardan was 43.12% (Shah et al., 2013a). Similarly, Toxoplasmosis was recorded in

Federally Administered Tribal Area, in Mohamand Agency with 32.29% in farm animals

(Shah et al., 2013b). Recently the Seroprevalence of T. gondii recorded in human population

of the nearby district Mardan with 28.44% infection (Shah et al., 2014). Toxoplasma gondii

varies in different countries. 17.4% was found in young school children in Islamabad,

Pakistan (Sadaruddin et al., 1991). The prevalence rate in Dera Ghazi Khan, Pakistan was

detected to be 29.5% (Tasawar et al., 2011), 63% in Punjab 48% in Azad Kashmir and 38%

in Khyber Pakhtunkhwa (Tenter et al., 2000).

1.3 Morphology

Toxoplasma gondii exist in three infectious stages: (1) tachyzoites, (2) tissue cysts

contain bradyzoites (3) Oocysts contain sporozoites.

1.3.1 Tachyzoite: The tachyzoite form which in early infection is 5mm long and 2mm wide

approximately. The tachyzoite is the rapidly growing form of parasite found during the acute

phase of toxoplasmosis and it takes 06 to 08 hours to replicate inside a host cell. It is found in

central nervous system and muscle tissues (Black and Boothroyd, 2000).

Tachyzoite is the rapidly multiplying stage of the parasiteafter primary infection

found in intermediate hosts, such as humans. Tachyzoitesare responsible for congenital

infection and may also be involved in infections acquired f rom transplants, blood products

that are high in white cell fractions, or in laboratory accidents and these sources are involved

in horizontal transmission of Toxoplasmosis. Hence the presence of tachyzoites in donor

tissue is the usual source of infection in bone marrow transplant recipients. In recipients of

solid organ grafts, life-threatening toxoplasmosis is most often acquired through the

reactivation of viable tissue cysts from the donor organ in a recipient with no prior infection

with the parasite. Tachyzoites are also present in milk from intermediate hosts, lik esheep,

cattle, and goats. Human Toxoplasmosis have only been linked directly to ingestion of goats

milk (Esteban and Innes, 1997; Elsheikha, 2008).

8

Tachyzoites are usually destroyed by gastric digestion because these are sensitive to

proteolytic enzymes and can survive for up to 2 hours in acid pepsin solutions and oral use of

high doses of tachyzoites has been shown to produce infection in cats and mice. It has also

been suggested that tachyzoites may enter the host by penetration of the mucosal tissue thus

by passing the stomach, and this route of transmission has been suggested for a case of

acquisition by a breast-fed infant. Tachyzoites have been found in saliva, tears, sputum, urine

and semen, in raw eggs from experimentally but not naturally infected hens, most horizontal

transmission is thus acquired by consumption of tissue cysts in meat and offal, or of oocysts

shed by cats into soil or water bodies (Jacobs and Melton, 1962)

Figure 1.1 Structure of T. gondii Tachyzoites (James et al., 2001).

1.3.2 Bradyzoites (Tissue cysts): Tachyzoites change into bradyzoites (1.5-7mm) and form

tissue cysts that first appear 07 to 10 days post infection (Dubey, 2004). Frenkel in 1973, was

the first who used the word ‘‘bradyzoite” derived from Greek word (Brady - slow) (Dubey,

2008).

Tissue cysts can be found in muscles, brain, heart and viscera. They contain

bradyzoites which are released from infected animals after consumption of tissue cysts in

meat. Bradyzoites are less resistant to environmental conditions than oocysts but more

resistant to digestive enzymes than tachyzoites. Theyr emain infectious for up to three weeks

at 1-4°C. Bradyzoites are normally killed by freezing at minus 12°C. Similarly, they may

survive curing, depending on the conditions used. They are killed by temperatures ≥67°C and

by gamma irradiation (Dubey, 2008).

9

Figure 1.2 Schematic diagram showing Organelles of a Bradyzoite of T. gondii

1.3.3 Oocyst The third form is the oocyst. Size of oocyst range from 10 to 12 mm. Oocyst are

ovoid structures which posses two sporocysts, and each of sporocyst retain further four

sporozoites. Oocyst is surrounded by an outer multilayer protective covering which is tough

and resist unfavorable conditions and is viable in moist conditions up to more than a year

(Gangneux and Darde, 2012).

Oocysts are shed by cats during primary infection. In the epithelial cells of the small

intestine male and female gametes are produced and, after fertilization of the female gamete

by the male gamete, a protective wall is formed producing the oocyst. Oocysts are non-

infective at the time of shedding, but they sporulate within 1-5 days on exposure to air.

Sporulation of oocysts is inhibited by anaerobic conditions, by temperatures of 4°C or lower

and by heat at approximately 50°C. Sporulated oocysts are very resistant to environmental

conditions, particularly in moist soil or sand, where they retain infectivity for up to 18

months. They can remain viable in surface water for longer periods. Oocysts lose infectivity

during drying condition, remaining infective for at least 30 days at 100% relative humidity

but for less than 3 days at 0-37% relative humidity. They are relatively resistant to freezing

although some killing is observed at minus 21°C. They are killed within 1-2 minutes by

10

heating to 55-60°C. They are very resistant to disinfectants because they are highly

impermeable. The ingestion of contaminated soil or raw fruit and vegetables with oocysts in

the environment may cause direct infection in humans. They also cause infection in

herbivores and hence may lead to formation of tissue cysts in farm animals. Flies and other

insects have also been shown to transmit oocysts to food. (Jacobs and Melton, 1962)

Figure 1.3 Sporulated Oocyst of T. gondii (Pappas and Wordrop, 2004)

1.4 Life Cycle

The T. gondii life cycle is completed in two hosts, Cats are the definitive host, and

warm-blooded animals as intermediate hosts (Dubey and Beltsville, 2010). The life cycle of

T. gondii is complex in the way that infection can be maintained in populations of

intermediate hosts without the presence of a definitive host. Intermediate hosts become

infected when oocysts, tachyzoites, or tissue cysts in another intermediate host are ingested

(Dubey, 1983). T. gondii replication occurs both sexually and asexually, the former is only

possible in the intestines of the feline definitive host. During sexual reproduction, male

microgametes merge with female macrogametes and oocysts are produced within the

enterocytes. This occurs after infection with any of the three infectious stages of the parasite:

the sporozoite within oocysts, the tachyzoite within many different host cells (or free), the

bradyzoite within intracellular tissue cysts. Ingestion of tissue cysts is much more likely to

cause production of oocysts than is ingestion of oocysts or tachyzoites, and the prepatent

period is shorter, about three to ten days. After infection, millions of oocysts are passed in the

faeces, and after 1 to 3-day sporulation time (depending on the environmental conditions),

these oocysts become infectious (Dubey et al., 1970).

11

Intermediate hosts become infected when oocysts, tachyzoites, or tissue cysts are

ingested by an intermediate host (Dubey, 1983). Upon this event, sporozoites or bradyzoites

are released in the gut, transformed into rapidly multiplying tachyzoites and the acute stage of

the infection is initiated. Tachyzoites are subsequently dispersed throughout the body via

blood and lymph, likely exploiting the host’s immune cells as a Trojan horse (Lambert et al.,

2006). After a few intracellular multiplication cycles, the tachyzoites develop further into

slowly multiplying bradyzoites, which are sheltered from the surrounding host immune

system by an impenetrable tissue-cyst wall (Dubey et al., 1998). This stage of infection is

referred to as the latent stage and T. gondii infection is presumed to be lifelong in most

species (Tenter et al., 2000). Even though T. gondii has the ability to infect and replicate in

almost any nucleated cell type, neural and muscular tissues are the predilection sites

(Jurankova et al., 2014).

During acute infection, tachyzoites may also pass the placental barrier (vertical

transmission) to cause infection in the unborn foetus (Jungersen et al., 2001). The consensus

view is that congenital transmission only occurs following primary infection during

pregnancy. A previous infection is generally thought to confer lifelong immunity, which is

presumed to prevent tachyzoites from crossing the placenta in subsequent gestations (Benard

et al., 2008). When infection was reactivated due to immunosuppression, in human

transmission to the foetus from chronically infected mothers has been documented in rare

cases (Montoya and Remington, 2008).

12

Figure 1.4 Life cycle of T. gondii. (Hunter and Sibley, 2012)

1.5 Toxoplasmosis and animal world

Toxoplasma gondii is found in every kind and type of animals. Cats and other felines

act as definitive hosts while other vertebrates act as intermediate host for example birds and

mammals. Cats and sheep are mostly infected while horses and dogs bears low infection rate.

The main sources of infection are meat, other foods, water and the environment of animals is

considered.

1.5.1 Goats and Sheep

The seroprevalnce of Toxoplasma gondii in herbivorous and meat producing animals,

such as goats, sheep and horses has found the same infection all the time, because pastures

provide a main source for their infection,while in farmed sheep, the prevalence in Europe is

related with age, increasing from lambs (17-22%) to adult (65 -89%) (Halos et al., 2010).

Viable T. gondii have been detected in about 67% of sheep samples. In Southern European

13

countries infected meat of sheep is the main source of infection. T. gondii is the second most

commonly diagnosed cause of abortion and economic loss to the UK sheep industry. It is

estimated that over 0.5 million lambs are lost each year due to toxoplasmosis which costs the

UK sheep industry £12-24 million.Thirty six Licensed vaccines for Toxoplasma are available

in the UK to control abortion in sheep but ratio of vaccinated animals reported very low

6.2%.37 Tissue cysts are mostly found in brain and skeletal muscle of infected sheep. Sheep

get infection through ingestion of oocysts in pasture or feeding on food contaminated by cat

faeces. Vertical transmission from ewe to lamb may play a role in the maintenance of

toxoplasma in a flock (Duncanson et al., 2001). It has been estimated that fewer than 2% of

sheep become congenitally infected. Highest seroprevalence for Toxoplasmosis in sheep up

to 90% generally have in some European countries and a recent large-scale screening of

sheep farms has shown that 3.4% of sheep were shedding toxoplasma in their milk (Dubey,

2009).

Seroprevalance for goats varies from 4 to 77% (Dubey, 2011), while lower in horses

(Dubey, 2010). Seroprevalence in some European countries up to 90% is reported (Fusco et

al., 2007). The seroprevalence of this infection in sheep in Newzeland is reported to be 30-

90% and in UK 77% prevalence is reported in goats while 29% is reported in sheep (De

Bhur, 2008). Sheep are the most sensitive to T. gondii infection amongst food producing

animals which results in abortions and stillbirths (Cenci Goga et al., 2011). The milk of some

intermediate hosts, like sheep, goats and cows has also revealed presence of tachyzoites.

(Tenter, 2009). If the environment is heavily contaminated with oocysts, more than 90%

seroprevalence has reported (Tenter et al., 2000). It affects reproductive system of sheep thats

why T. gondii is one of the serious problems for the sheep (Stormoen et al., 2012).

Seroprevalence increases with age, reaching up to 95% seroprevalence in 6-year-old sheep in

some flocks, and most sheep get infection before 4 years of age. However, it has been

described that one-third ewes remain still unaffected in highly seropositive flocks (Dubey and

Kirkbride, 1989).

In Pakistan there are fewer reports on seroprevelance of T. gondii in sheep and goats

i.e. 52% in Multan (Lashari and Tasawar, 2010). Toxoplasmosis accounts for approximately

5-10% of abortions in goats in France. Toxoplasma has been detected in milk of naturally

infected dairy goats. Seroprevalence in goats can be as high as 77% (Dubey, 2011).

1.5.2 Sheep

As sheep are herbivores, horizontal infection with T. gondii is acquired from the

consumption of oocysts in the environment, either during grazing on contaminated pasture,

14

by drinking contaminated water, or from feed which has been contaminated with oocysts due

to the presence of cats in the area (Innes et al., 2009a; Skjerve et al., 1998; Vesco et al.,

2007). Once the animal is infected it develops an effective immune response to control the

parasite, despite being infected for life (as also described for all other intermediate hosts,

including humans). Approximately 14 – 21 days after infection IgG antibody specific for T.

gondii are detectable. Initial infection in sheep is generally asymptomatic, with little or no

clinical symptoms. In these animals vertical transmission of the parasite across the placenta

occurs and the parasite passes to the foetus. Infections usually results in abortion in the first

trimester while infection during the second trimester can lead to the birth of a stillborn or

very weaker lamb and when infection occurs during the third trimester the lamb may appear

healthy when it is born, but it is likely to be persistently infected (Buxton, 1990).

Another cause of congenital transmission which is from the reactivation of the

parasite from a persistently infected ewe during pregnancy (Morley et al., 2008; Williams et

al., 2005), this route of transmission is thought to be a very infrequent event, and therefore

does not pose a significant risk (Buxton et al., 2007a; Buxton et al., 2007b; Rodger et al.,

2006). It has also been reported that abortion caused by ovine Toxoplasmosis affects

approximately 1-2% of the UK’s national flock (Blewett and Trees, 1987), results in yearly

losses of an estimated 0.5 million lambs, costing approximately £12 million annually in Great

Britain alone (Nieuwhof and Bishop, 2005). Losses in other countries are also estimated to be

high, for example in Uruguay the cost is predicted to be between Toxoplasma gondii in

animal and human hosts US$1.4 - 4.7 million (Freyre et al., 1999). Although congenital

infection results in neonatal loss for the pregnant ewe, sheep which are infected can

potentially pass on the infection to humans, due to the consumption of undercooked or

unfrozen meat harbouring infective T. gondii tissue cysts (Halos et al., 2010).

Approximately 14 – 21 days after infection IgG antibodies specific for T. gondii are

detectable and are thought to remain so throughout the lifetime of the animal, as with other

species (Dubey and Jones, 2008). Detection of T. gondii specific IgG by ELISA is frequently

used to assess the seroprevalence of the parasite, although latex agglutination is also another

option to test for the presence or absence of IgG antibodies against the parasite. The results of

such studies can give an indication of levels of infection.

The prevalence of T. gondii in sheep can vary from both different countries and

regions, but infection rate increases with age in majority of cases. A study examining 125

Scottish sheep flocks (equating to 3333 sheep) found an overall prevalence of 56.6%

(1619/3333) where an increase in seropositivity was related to age. This was particularly

evident in sheep which were over six years of age, where 73.8% tested IgG positive (Katzer

15

et al., 2011), in Greece 53.71% animals were positive by ELISA (Anastasia et al., 2013).

Another study, which examined the prevalence of the parasite within sheep flocks in Great

Britain, found an overall mean seroprevalence of 74.0% and also described an increase in

prevalence with increasing age (Hutchinson et al., 2011). In the Netherlands the

seroprevalence of T. gondii in Dutch sheep at slaughter by ELISA estimated the overall

prevalence at 27.8%, this research also showed a higher seroprevalence (48.1%) in sheep that

were over one year of age (Opsteegh et al., 2010b). In Switzerland the prevalence of T.

gondii based on an ELISA from meat juice from sheep determined a prevalence of 61.6% out

of these 80.7% were adult sheep (Berger-Schoch et al., 2011). In all of the above reported

seroprevalence studies it appears to be a positive correlation between seropositivity and

increasing age of the animal, indicating high environmental contamination of T. gondii

oocysts, and hence the majority of infections are likely to be acquired postnatally (Katzer et

al., 2011). A licensed vaccine (Toxovax®) against ovine abortion is available in the UK,

New Zealand, Ireland and France from MSD Animal Health. This live vaccine is composed

of tachyzoites from the attenuated S48 strain of T. gondii, which was originally isolated from

an aborted lamb foetus in New Zealand (Buxton, 1993; O'Connell et al., 1988). Efficacy

trials of the vaccine showing that the vaccine was best administered 3 weeks before to mating

and that it was effective in protecting against T. gondii associated abortion for at least 18

months (Buxton and Innes, 1995). Although the S48 strain has the ability to produce a host

immune response whereby sheep produce a cellular and humoral immune response which

involves IFNγ, CD4 and CD8 T-cells (Innes., et al 2009b), there is no information as to

whether the vaccine prevents the formation of tissue cysts in sheep or indeed other livestock

species (AMCSF, 2012).

1.5.3 Pigs (Sus scrofa)

Pigs are an important source of food for humans and can acquire Toxoplasma

infection by ingestion of oocysts from the environment or by consumption of tissue cysts

from infected animals such as rodents. Although mortalities or other clinical due to

Toxoplasmosis in pigs is uncommon but outbreaks of severe disease have been reported. One

such reported outbreak occurred in China in 2010, where infection of T. gondii proved lethal

effects in pigs from the Gansu province (Li et al., 2010). Infection resulted in a morbidity of

57% with a mortality rate of 2% with pigs showing signs of depression, anorexia and above

average rectal temperatures (40-42oC). This T. gondii infection was due to ingestion of

contaminated feed, and cats were found to reside within the feed warehouse. Porcine abortion

due to T. gondii infection has also been reported. The foetuses aborted near term and upon

16

histopathological examination Toxoplasma cysts were found in the alveolar macrophages of

the lung and intracellular parasites morphologically similar to Toxoplasma, were also

identified in myocardial cells (Hunter, 1979). The farm described was known to have a rodent

problem which can T. gondii in animal and human hosts increase the transmission of T.

gondii to pigs (Kijlstra et al., 2008).

Infection of sows with Toxoplasma have also resulted in the birth of still born piglets

(Thiptara et al., 2006), like clinical signs observed in cases of ovine toxoplasmosis. A more

commonly observed symptom is a slight increase in rectal temperature during the initial

stages of infection, which may persist for 1-2 days. Presentation of more acute clinical

symptoms (although rare) are likely to be linked to age, immune status, and even breed of the

animal (Dubey, 2009). Clinical symptoms in pigs which have been experimentally infected

with T. gondii are similar to those described above but can prove fatal when pigs are

inoculated with large numbers of oocysts (≥ 4x104) (Dubey et al., 1998b; Garcia et al.,

2008).

To prevent or reduce the formation of T. gondii tissue cysts in pig species is to reduce

the number of parasites entering the human food chain and their consequent transmission.

The ability of the parasite to infect all warm-blooded mammals, combined with its cyst

forming nature, T. gondii is readily found within the muscles and organs of infected pigs

which are often used for human consumption (Bayarri et al., 2012; Dubey et al., 2005a;

Wang et al., 2012). By ingestion of T. gondii oocysts or bradyzoites, within 6-7 days

infective tissue cysts can develop in the host. The prevalence of T. gondii in pigs reared

indoors is likely to be lower than those animals which are outdoor reared, due to an increased

risk of exposure to environmental oocysts (Kijlstra et al., 2004; van der Giessen et al., 2007).

The infection of T. gondii in pigs increases with age (Dubey et al., 1995b), and this

seropositivity reflect the presence of infective tissue cysts within the animal (Dubey et al.,

1995a), it can be assumed that older pigs are more proven to infective tissues cysts.

The incidence of Toxoplasma in pigs has dropped in the past 30 years. This is most

likely due to a change in farming practices where intensive well managed indoor farming

methods have been introduced (Dubey, 2009; Edelhofer, 1994).

Transmission of T. gondii to pigs from the consumption of infected rodents has also

been shown to be a direct source of infection, particularly in animals reared outdoors (Kijlstra

et al., 2004), where outdoor reared and organically raised pigs have generally been shown to

have a higher prevalence of the parasite i.e Northern USA to be 90.9% (30/33), which is

significantly higher than reported for pigs raised in conventional indoor housing (2.7%) (Hill

et al., 2010a). Similarly, in Argentinean animals which had been bred indoors compared to

17

sows reared outdoors had a prevalence of 4.5% (4/88) and 40.2% (45/112) respectively

(Venturini et al., 2004).

The source of infection in pigs can either be via oocyst from contaminated soil or

feed, or from consumption of tissue cysts from infected rodents or other small mammals

harboring the tissue cysts stage of the parasite. Contamination of feed or soil with oocysts is

thought to be the main source of infection for pigs (Lehmann et al., 2003). However, outdoor

housing systems allow pigs to come into contact with rodents and other wildlife, and as pigs

are omnivores, they will consume rodents or rodent cadavers as well as other small mammals

and birds, which may be infected with T. gondii and harbour infective tissue cysts

(bradyzoites).

1.5.4 Domestic ruminants (Cattle)

Several epidemiological studies show that the use of raw or undercooked beef may be

responsible for T. gondii infection in humans (Cook et al., 2000), and bovines shows high

seroprevalence (up to 90%) (Tenter et al., 2009). In West Indies prevalence of 8.4%

(Chikweto et al., 2011), Brazil, 49.4% was recorded in cattle from a highly endemic area of

human toxoplasmosis (Frazao-Texeira and Oliveira, 2011). In Malaysia 7.9%

(Chandrawathani et al., 2008) and in Vietnam 10.5% seroprevalence was recorded in cattle

(Huong et al., 1998).

The seroprevalence of Toxoplasma infection in cattle ranges from 2 to 92% (Tenter et

al., 2000). High prevalence rates are found in calves during their first exposure to grazing,

which shows that calves become infected with T. gondii after exposure on pastures (Marty et

al., 1999). In dairy cows seroprevalence of 22.3% in Thailand, 3.2% in cattle in USA, 2.3%

in China (Yu et al., 2007), 6.6% in Ethopia (Bekele and Kasali, 1989), 9% in Indonesia was

reported (Matasuo and Husin, 1996).

1.5.5 Birds

T. gondii has been detected in tissues like spleen and lungs of dead pigeons (Johnson,

1943). Pigeons Infected with T. gondii were anorexic, dull, and having conjunctivitis (Carini,

1911). It has been shown that high infection rate of T. gondii oocysts was found with oral

infection (Biancifiori et al., 1986). Experimentally Sparrows indicated high resistant to T.

gondii but number of strains, and stage of T. gondii inoculated play an important role in

seroprevalence (Wallace, 1973; Literak et al., 1999). If numerous tachyzoites of mouse

virulence strain are injected in sparrows, they will die (Manwell et al., 1945; Drobeck et al.,

1953).

18

Severe toxoplasmosis with an unusual clinical symptoms (blindness) and in some

cases death has been reported in canaries (Serinus canarius) from Uruguay, Australia, Italy,

New Zealand, UK, and the US. Out of 18 birds 15 birds from a breeder house died within 15

days (Cassamagnaghi et al., 1952). While affected birds had lesions in the lungs and spleen,

enteritis, splenomegaly, necrotic, and hepatic degeneration (Parenti et al., 1986).

Toxoplasmosis has also been reported in 23 mynahs (Acridotheres spp.) imported from

Mexico. Lesions and parasites were seen in the liver, lungs, and spleen. Fatal toxoplasmosis

has been reported once in crows (Work et al., 2000).

1.5.6 Poultry

Toxoplasmosis in domestic chickens has been detected which indicated 65%

seropositivity and the presence of T. gondii in them could reach 81% of the seropositive

animals (Lehmann et al., 2006). Domestic chickens may be considered as an important

source of T. gondii infection to humans particularly in developing countries while in

developed countries seroprevalence of 1-10% have been reported. However, it can be

expected that high chance of poultry infection is possible when reared outside (Dubey et al.,

2008a). Antibodies to T. gondii reported in domestic chickens (Gallus domesticus), 12.5%

from Italy, 64% from Ghana, 30% from Poland, 24.4% in chickens from Indonesia, and

24.2% in chickens from Vietnam (Dubey et al., 2008a). In rural areas from Brazil, infection

higher than 50% reported in domestic chickens with T. gondii oocysts, indicating a

widespread contamination of rural environment (Oliveria et al., 2009). High susceptibility of

poultry species by oocysts is due to its feeding behavior and cysts are located mainly in heart

tissues and brain of poultry and rarely in muscles (Kijlstra and Jongert, 2008).

1.5.7 Cats

Cats which act as definitive host of the T. gondii may shed up to 10 million oocysts

per day for up to 14 days after primary infection. Shedding of oocyst depends on the source

of infection. Infected cats shed 30-50 of oocysts (Tenter et al., 2000). It is believed that about

1% of domestic cats excrete oocysts at any one time. Although shedding of oocysts is usually

suppressed by an active immune response, but this immunity may not be life-long, and cats

may shed further oocysts when again infected several years after primary infection (Innes et

al., 2009). The seroprevalence of T. gondii in cat’s ranges from 5% to 90% globally and is

more in wild and stray cats than domestic pets. Infection rate increases with age, although

due to immunity acquired after initial infection oocysts are excreted primarily by young

kittens (Dubey, 2008).

19

Cats which are the definitive host of T. gondii showed some extraordinary behavioral

characteristics of infection in old age like head pressing, teeth grinding, weakness in body

coordination, abnormal sounds and voice, circling and feelings uneasy, weak reflex actions

and paralysis were the signs of spinal cord. Granuloma formation and diarrhea indicated gut

infection. In Kittens respiratory system disorders were commonly observed and very little

cases have been reported of immature births and abortions. The ocular toxoplasmosis was

reported but fortunately very little damage was done to the nictitating membrane (Holzworth,

1987).

1.5.8 Dogs

Toxoplasmosis is also detected in dogs. Immune competent dogs remained generally

asymptomatic but immune compromised and old dogs, revealed symptoms of disease like

loss of canines, depression, and development of rigidity of the body especially pelvic

muscles. Younger dogs were found more seropositive than older ones. Acute stage was

usually associated with death occurred in most cases when symptoms like high temperature,

pain in abdomen, diarrhea, signs of CNS, lethargy, and vomiting, appeared (Aiello and Mays,

1998).

1.5.9 Deer

Toxoplasmosis in deer in Europe (involving 760 animals) indicated a seroprevalence

of 7.7% in Red deer compared to 34% in Roe deer (AFSSA, 2005).

1.5.10 Horses

T. gondii infection in horses in Europe suggested a prevalence of 1% by ELISA and

7.7% in Czech Republic by Sabin-Feldman dye test. Experimental studies have shown tissue

cysts persisting in horses for at least 15 months after inoculation (AFSSA, 2005).

1.5.11 Rabbits

Seroprevalence of T. gondii in wild rabbits vary greatly ranging from 5.9% in France

to 53% in the Czech Republic

1.5.12 Other species

Toxoplasmosis have also been detected in several other species examples include wild

boar 8-38%, and kangaroos 22% (Kijlstra and Jongert, 2008)

1.5.13 Marine mammals

Toxoplasmosis has been reported in a number of marine mammals’species, showing

that the organism has reached to the marine environment. According to several serological

20

studies carried out mainly in North America marine crustaceans and molluscs harbor the

parasite. Oocysts in soil or via domestic sewage are leached where they can survive and

sporulate. It has been proposed that marine mammals could act as sentinel species for T.

gomdii in the marine environment. In California a survey revealed toxoplasma infection in

52% of 305 freshly dead sea otters. Resistant oocysts concentrated in bivalve molluscs would

be most likely source of infection because sea otters do not feed on intermediate host

(Conrad, 2005).

1.6 Food studies

For detection of oocysts on or in food there is no standardised method, nor there is a

molecular method for detecting viable organisms in meats. Reports regarding the detection of

viable cysts are based mostly in vivo studies. T. gondii has been found in a variety of meat

from lambs, goats, pigs and game while beef appears less commonly contaminated, chicken

rarely contains viable cysts. The presence of cysts depends on time spent indoors, age farm

hygiene and the tissues concerned non-skeletal-muscle is more commonly infected than

skeletal muscle. PCR studiesin UK on a small number meat product indicated an overall

prevalence of 38%, including 25% of beef samples, 33% of pork samples and 67% of lamb

samples. Viable parasites were found in 1 sample (1.5%) out of 67 samples. 6/9 (66%)

samples of lamb meat from a butcher in Manchester tested positive for toxoplasma by PCR.

Bivalve molluscs are also a potential source of food borne T. gondii infection. (Aspinall et

al., 2002).

1.6.1 Survival in foods

There should be an understanding about the survival of infective stage of (oocysts,

tachyzoites and tissue cysts). Control strategies for food require an understanding of the

survival of the key infective stages of T. gondii (oocysts, tachyzoites and tissue cysts) under

different conditions. Generally, the principal hazard will be the tissue cysts in raw meats,

tachyzoites in milk, and oocysts may be a hazard on water and agriculture (Dubey, 2010).

1.6.2 Unsporulated oocysts

Sporulation of oocysts occurs within 1-5 days at ambient temperature and therefore

oocysts contaminating foods are most likely to be sporulated. Dubey reported that

unsporulated oocysts were killed by exposure to 37°C for 24 hours. Salt has not affected on

sporulation of oocysts with sporulation occurring in water at 1.5% and 3.2% NaCl.

Sporulation of oocysts appear to be inhibited by anaerobic conditions. (Dubey, 2010).

21

1.6.3 Sporulated oocysts

Sporulated oocysts show high resistant to adverse physico-chemical conditions.

Sporulated oocysts are less effected by low pH, in inorganic acids e.g. sulphuric acid (pH <1)

survive for over a year. Storage in alkali (sodium hydroxide, 6%, pH >/=12) inactivated a

suspension of oocysts in 24 hours and a 2-log reduction in infectivity was achieved after 1

hour (10% NaOH, pH>/= 12). In salt water oocysts survive for long periods (>6 months at

ambient temperature or at 4°C). Little or no effect on oocyst viability have been shown by

disinfectants for example chlorine of level 2, 20 and 200ppm had no effect on oocyst

viability. Ethanol (99%) for 24h kill oocysts, a 10% solution destroyeoocysts were by a 4-

dayexposure. (Dubey, 2010).

1.6.3 Tissue cysts

Tissue cysts can be inactivated by extremes in temperature because they are more

susceptible extreme temperature at low temperature they can survive for long period.

Relatively mild pasteurization is required to destroy tissue cysts and temperatures of 67°C

and above will reduce contaminated meat safe. Tissue cysts survival in the presence of salt

(sodium chloride) is variable and dependent on the salt concentration and storage

temperature. It has been found that concentrations of 6% salt is lethal to tissue cysts, although

at low temperatures (4°C) cysts shown survival, remaining viable in 0.85%, 2% and 3.3%

NaCl for 56 days, 49 days and 21 days respectively. Tissue cysts lost infectivity in pork

sausages made with 2% and 2.5% salt and stored under refrigeration for 48 hours but not

after 24 hours (Dubey, 2010).

Common curing salts can be effective at rendering tissue cysts non-infective based on

bioassays. When stored at 4°C, tissue cysts in pork became non infective in a number of

curing salt solutions including sodium tripolyphosphate (0.5%) sodium chloride (2%) (After

7, 28d and 45d), sodium chloride (1%) (After 45d but not after 7d or 28d) or sodium lactate

(2%) (After 7d, 28d and 45d). Infectivity of bradyzoites inside tissue cysts are lost after

storage at low pH (<1, HCl) for 2 hours (Dubey, 2010).

1.6.4 Tachyzoites

Limited information is available on the survival of tachyzoites although they are

reported to be susceptible to freezing and are destroyed by pasteurisation. Low pH (<1, HCl)

destroy tachyzoites after 25 minutes but survive for 7 days at 4°C in cow‟s milk (Dubey,

2010).

22

1.7 Toxoplasmosis in humans

Human Toxoplasmosis is a problem throughout world, with seroprevalence ranging

from 0 – 100% depending on the origin of the population studied, published the overall

global trends for the seroprevalence of T. gondii in women of child bearing age and pregnant

women for a period of ten years from January 1999 - December 2008. The seroprevalence of

T. gondii in human is shown in global map indicated by different colours (Tenter et al., 2000:

Pappas et al., 2009).

Figure 1.5 Map showing worldwide seroprevalence of T. gondii. Seroprevalence is

shown using the following different colours: Dark red above 60%, light red = 40 –60%,

yellow = 20 – 40%, blue = 10 – 20%, green = less than 20%, white = unknown. The map

shows a high prevalence in mainland Europe, South America and South East Asia

(Pappas et al., 2009).

The map shows high seroprevalence in humans in South American countries such as

Argentina and Brazil which is 53.4% and 77.5% respectively (Porto et al., 2008; Rickard et

al., 1999), while a lower prevalence was reported in most of European countries, such as

Denmark 27.8%, the United Kingdom 9.1% and the Czech Republic 19.8% (Kankova and

Flegr, 2007; Lebech et al., 1999; Nash et al., 2005). Seroprevalence of T. gondii infection in

Germany and France was higher 59.0% and 54.0% respectively compared to other European

countries (Fiedler et al., 1999; Tenter et al., 2000). Climatic condition, consumption of raw

meat and meat from animals or frozen meat may be factors that contribute to these variations.

23

Seroprevalance based on age have also been reported which shows variation in a number of

countries. For example, in the Netherlands at age 25 years it was found 20% and 60% at age

50 years. While in japan in age group 20-29 years lower seroprevalence was found as

compared to 40% in those over 70 years age. Similarly, seroprevalence in women of child

bearing age has also been detected which 10-22% in England as was compared to 50% in

above 50 years (Zadik et al., 1995).

In pregnant women the frequency of the parasite occurs differently, depend upon

geographic area (6.1 to 75.2), it was found as 21% in Pakistan and Bangladesh, 55% in

France, 31% in Ireland ,15% - 41% in Africa 46% in other European countries. Pregnant

women show 71% prevalence rate in France (Ancelle et al., 1996; jeannel et al., 1998) and

78% in Ibadan, Nigeria (Onadeko et al., 1992), and in people of Somalia it was 44, in south

delta Nigerian 83% was reported (Dubey and Beattie, 1988). In jimma (zemene et al., 2012)

central Ethiopia (Gebremedhin et al., 2013), Arba Minch. (Yohanes et al., 2014), womens at

child bearing age and HIV patients show prevalence of 83.6%, 81.4% and 88.2% (Zemene et

al., 2012). It was observed that in the past few years the prevalence of toxoplasmosis among

different countries including United Kingdom, France and Belgium goes on decreasing.

(Remingto et al., 2006; Montoya et al., 2004). Low level of seroprevalence in US as

compared to Western Europe also identified reduced seroprevalence in overall population

(Smith et al., 1996). Central America and South America, particularly in Costa Rica and

Brazil), have higher seroprevalence greater than 60% revealed by studies (Zapata et al.,

2005). Although it gained no importance as community health problem recommended in

Colombia (Gomezet al., 1995; Gomez 1997). In 1980, by means of indirect immune

fluorescence antibody test the Ministry of Public Health implemented serological study of

prevalence, it has concluded that 20% - 90% of world population exposed to toxoplasmosis

(Zemene et al., 2012).

Countries where usually uncooked food is used show high rate of prevalence (jeannel

et al., 1998; Ancelle et al., 1995) and also it was found in areas where cats are distributed

widely and environmental factors that supports existence of oocyst like in tropical areas of

Latin America and sub-Saharan Africa (Dubay and Beattie, 1998; Schwartzman, Maguire,

1999; Onadeko et al., 1992). Age wise its prevalence has been found to be 13% (6 years)

(Frenkal et al., 1995) and 90% (60 years) (Souse et al., 1998). Increase rate of seroprevalence

among children in panama where people used properly cooked food indicates their contact

with soil contain oocysts. (Souse et al., 1988). Rise in prevalence rate in different parts of the

world also associated with contaminated water (Ertug et al., 2005). T. gondii among pregnant

women is abundant in wet and hot areas. There is a higher risk of congenital toxoplasmosis in

24

people with anti-toxoplasma IgG antibodies between 25-80 percent, due to high flow of

parasite in blood and high ratio of sensitive pregnancy (Remington et al., 2006).

1.7.1 Prevalence of T. gondii in Pakistan

In district Dera Ghazi Khan (Pakistan), about 29.8% cases were reported (Tasawar et

al., 2011). Mostly human toxoplasmosis is without symptoms or show minor illness. Rise in

seroprevalence of infection noticed up to 100% in a population in last three years. (Flegr et

al., 2003). In Pakistan among pregnant womens, it has been found in Punjab, Kashmir and

Khyber Pahktunkhwa in the percentage of 63, 48, and 38 respectively. In district Kohat it has

been observed in pregnant women about 14.4%. Rural areas show higher percentage of

parasite then urban areas of district Kohat while 17% seroprevalence reported from

Islamabad and Rawalpindi.

1.8 Genome of Toxoplasma gondii

The genome of T. gondii is 65 Mega base pairs (Mbps) in size, which comprise of 14

chromosomes, the size of which ranges from 2 Mbp to 7.5 Mbps (Khan et al., 2005b). Its

genome is somewhat similar to that of Neospora caninum, which is another protozoan

parasite of the Apicomplexa group. It is assumed that the two parasites diverged from a

common ancestor about 28 million years ago. The reason for the divergence was the

speciation of the definitive hosts i.e. cats for T. gondii and dogs for N. caninum (Reid et al.,

2012). As compare to other Apicomplexan parasites for example Theileria parva and

Cyptosporidium parvum, the T. gondii genome is considerably larger, and have more introns,

has a lower gene density and has more predicted genes (Ajioka and Soldati, 2001). The

recommended reason for the difference in size of the genome compared to other

Apicomplexan parasites is the large number of secondary hosts which T. gondii can establish

within (Roos, 2005).

In 2005 a composite genome map was derived from the genetic crosses and analysis

of linkage in the three main archetypal lineages (I, II, III) of T. gondii (Khan et al., 2005b).

The results from this study helped the researchers engaged in mapping out of drug resistance

genes and aided the researchers that were studying the genes involved in infectivity and

transmission. The linkage map that was produced, identified 250 specific genetic markers, 12

of them are most commonly used for genotyping of the strain through PCR-RFLP. Some of

the markers are present on all the three archetypal strains.

The ToxoDB, an online genome database provides a more detailed information about

the structural and functional genomics of T. gondii. It also offers information about gene

expression genome sequence and proteomics data, that helps in supporting research on the

25

parasite (Gajria et al., 2008). The database also has data for genetic maps and single

nucleotide polymorphism, representing strains for three archetypal T. gondii lineages; GT-1

(Type-I), Me49 (Type-II) and VEG (Type-III). Identification of single nucleotide

polymorphism (SNPs) through PCR-RFLP are used to define the different strains of T. gondii

(Sibley et al., 1992; Ajioka et al., 1998).

1.9. Genetic Variation of T. gondii

1.9.1 Main Lineages

Three main lineages (Type I, II, III) were identified by the studies on the virulence of

of T. gondii in mice and molecular characterization of the parasite in humans and through

multilocus RFLP (Sibley and Boothroyd, 1992; Howe & Sibley, 1995). It has been

recognized by the research that type I isolates have limited genetic variability but have high

virulence in mice. The Type I lineage is isolated very rarely and only about 10 % of the

strains collected in USA and Europe. But this Type is related to the reactivation of the

parasite in immunocompromised persons (Khan et al., 2005a). Type II lineage isolate is

recognized as the predominant in human toxoplasmosis as well in sheep and pigs in Europe

and USA. However, it is less virulent in mice. Type III lineages isolates were initially

considered as non-virulent in mice. But new research studies reported that they are usually

more virulent than Type II isolates in mice (Darde, 2004). The Type III lineage is more

common in animal hosts and rare in humans. A research in chickens in North America

reported a higher prevalence of type III as compared to Type II (Dubey et al., 2003).

Although initial characterization of the parasite explored its virulence in mice (Sibley

and Boothroyd, 1992), the pathogenicity of the parasite can differ depending on its host

species. Most of infections in both humans and animals are without any symptoms, but some

of species of host can be vulnerable to initial infection, triggering clinical symptoms and even

death. For instance, Australian marsupials and lemurs are examples of vulnerable host

(Canfield et al., 1990; Dubey et al., 1988), and other animal species, such as lemurs, moved

into zoos or wildlife parks (Dubey et al., 2009; Hermosilla et al., 2010; Juan-Salles et al.,

2011). This susceptibility is supposed to occur due to susceptible animals being more

geographically isolated from the definitive host i.e. felids, where they have evolved in areas

where, until relatively recently, cats have been absent. Subsequently these animals could be

more sensitive to T. gondii oocysts, with the immune system incapable to deal with the

infection successfully (Innes, 1997).

26

1.9.2 Atypical lineages

Molecular characterization through multilocus RFLP has recognized strains which

have different unique genotypes as compared to three predominant lineages. At first most of

these atypical genotypes were isolated from exotic animals in geographically distant areas,

but more recently multilocus RFLP has emphasized the presence of atypical alleles in pigs

sheeps and poultry in Brazil (da Silva et al., 2011; Frazao-Teixeira et al., 2011). Initial

infection of these atypical strains in humans has been related to severe toxoplasmosis and eye

disease, with epidemics reported in Brazil, French Guiana and Suriname (Carme et al.,

2009a; Vaudaux et al., 2010).

The main features of atypical strains are that they comprise of novel alleles as well as

mixed combinations of alleles of three predominant lineages (Grigg and Suzuki, 2003).

Through molecular genotyping atypical strains shows great genetic diversity from those of

predominant lineages. For instance, atypical strains recognized in South America display a

greater genetic diversity as compared to the predominant lineages isolates found in North

America and Europe (Herrmann et al., 2010).

Other different strains that cannot be classified into the three main predominant

lineages also exist, which have been isolated on various occasions and seem to occur in

specific hosts or be associated to a specific geographical region. Type X is a genotype that

has been predominantly reported in Californian sea otters (Sundar et al., 2008). Microsatellite

genotyping of an immunocompromised toxoplasmosis patients in France recognized a new

genotype, which were later isolated from many patients. These genotypes were named Africa

I, Africa II and Caribbean I (Ajzenberg et al., 2009). Further research in Gabon has

recognized the similar African genotypes as well as an extra Africa III genotype (Mercier et

al., 2010)

Studies from North America has recognized a fourth clonal lineage, which was

initially classified as Type X and was first isolated from Californian sea otters (Sundar et al.,

2008). More lately the presence of this genotype has also been reported in wild animals and

in rare cases humans from North America, resulting in a definite, highly clonal, separate

lineage fitting in to haplogroup 12 (Khan et al., 2011). At the time of writing, T. gondii is

described to be composed of 15 different haplogroups, which defines six major clades this

definition is based on analysis of the genetic diversity of 950 T. gondii isolates which were

collected worldwide (Su et al., 2012).

The T. gondii strains which have endured sexual recombination to generate mixed

infections have also been reported by multilocus RFLP in both human and animal hosts

(Lindstrom et al., 2008). Sexual recombination can only occur in the gut of the felid host and

27

its development must be due to infection with two strains of the parasite at the same time. In

spite of the identification of atypical genotypes and mixed infections their occurrence is rare

compared to the identification of predominant lineages, but with the advancement of

molecular tools, the sensitivity of detection has increased and consequently the likelihood of

discovering these unusual strains is becoming more likely (Lindstrom et al., 2008).

1.10. Transmission

The infection of T. gondii follow various infection paths for felids and intermediate

hosts, including vertical and horizontal transmission routes. In humans the main concern is

the vertical route which involve congenital transmission from mother to fetus. (Dubey and

Beattie, 1988b). If a womanfor the first time is exposed to T. gondii during pregnancy,

complications in perinatal mortality or birth defectsmay result (Dubey and Beattie, 1988b).

Risk factors like contact with faeces of cat, cat ownership for human act for T. gondii

seropositivity (Hofhuis et al., 2011).

Possible reasons for transmission: When cats become infected byingesting oocysts in

the surroundingsor infected intermediate hosts for shedding oocysts to occur. 2) cats excrete

oocysts only for a short time after primary infection, 3) cats are usually resistant to re-

infection and protected against re-shedding of oocysts for several years after primary

infection, 4) Excreted oocysts takes 24 Hrs to sporulate to become infectious, faeces

deposited indoors is usually discarded before sporulation takes place, and 5) oocysts are

rarely found in the fur of cats (Dubey, 1995). Toxoplasmosis disease is horizontally

transmitted to humans by accidentally ingestion of raw or undercooked meat containing

tissue cysts, and ingestion of food or water contaminated with oocysts shed by cats. (Jones et

al., 2012). Transmission and spread of infection among humans is largely through inhalation

or ingestion of oocyst discharged in the faeces of infected cats, inoculation of trophozoites

through the skin, drinking raw cows milk or contaminated water, ingestion of birds’ eggs and

by eating raw or undercooked infected meat. (Sadaruddin et al., 1991). Among several

domestic animal’s cat is the definite host but pigs, cattle, sheep, goats and rodents may also

play role in its transmission. Rats and mice are thought to be persistent wildlife host

reservoirs of T. gondii. (Glazebrook et al., 1978; Webster, 1994). Properly cooked meat does

not involve a risk for infection, because T. gondii tissue cysts are killed at 65°C (Dubey et al.,

1990). Pet dogs are often regarded as closest faithful and intimate friends of humans. There

are also some reports of T. gondii oocysts shedding by dogs because oocysts ingested via

food and water in dogs can pass through intestinal tract and are excreted in the feces (Lindsay

et al., 1997). The presence of pet dog in household has been found to be a risk factor for T.

28

gondii infection in humans (Sroka et al., 2010). The oocyst stage of T. gondii has been found

in the environment, both in soil and in water, where they can survive for a long time,

depending on temperature and humidity. Contact with soil during gardening and consumption

of raw or poorly rinsed vegetables have been identified as significant risk factors for T. gondii

infection in Europe (Simon et al., 2013). Although beef is generally considered a less

important source of T. gondii infection because of relatively rare findings of viable parasites

in their tissues. It is unlikely that pork is a major source of human toxoplasmosis in countries

where the majority of fattening pigs are reared in intensive management systems. However,

pork from pigs reared in animal-friendly management systems is thought to be a significant

risk (Tenter et al., 2000).

1.11 Pathogenesis.

1.11.1 Pathogenesis and Clinical Signs of Toxoplasmosis in Animals

Feline toxoplasmosis is a multi-systemic disease which may cause clinical disease in

domestic and wild animals (Dubey, 2010). It is a major cause of abortion and mortality in

animals leading to economic losses as well as lowering the food basket with effects on family

health (Jadoon et al., 2009). In cats, which are the definitive hosts, toxoplasmosis is usually

asymptomatic (Darabus et al., 2011). In a study done in Iran on wild and domestic dogs, it

was found that dogs, unlike cats, are mechanical vectors and do not show specific clinical

signs (Shadfar et al., 2012). Toxoplasmosis has been known to be a major cause of abortion

and stillbirth in sheep and goats (Jadoon et al., 2009). Prevalence in herbivores has been seen

to be highest in spring while in autumn and winter the prevalence has been seen to be highest

in pigs (Darabus, et al., 2011). In swine, toxoplasmosis causes reproductive disorders such as

premature birth with pneumonia, myocarditis and encephalitis (EFSA, 2007). However, most

cases of Toxoplasmosis may be asymptomatic with mild non-specific symptoms such as

hyperthermia, anorexia and tachypnea (Dubey and Beattie, 1988). Infectivity rates of

toxoplasmosis in cattle are low with clinical signs not usually observed. In some rare

instances, however, T. gondii has been isolated in aborted fetuses (Dubey et al., 2012).

1.11.2 Pathogenesis and Clinical Signs of Toxoplasmosis in Humans

Globally, it infects a third of the total human population. However, local variations in

prevalence is a characteristic feature of T. gondii infection, and the seroprevalence varies

between 0% and 100% depending on the population investigated. The risk of encountering

the infection increases with time, and because it is a lifelong infection, the T. gondii

prevalence in a population is highly dependent on the age composition. (Tenter et al., 2000).

One of the first studies of T. gondii prevalence in Sweden was performed in 1951 by Zeipel

29

and Linder, who found a seroprevalence of 37% in 300 healthy blood donors. In 1953,

Hedqvist studied the frequency of T. gondii infection in different age groups in Eskilstuna, a

city located in the south-central part of Sweden. A difference in seroprevalence was found

between children 0-4 years old (0%) and adults 20-50 years old (40%). Thirty years later

(1982/1983), a similar overall seroprevalence of 40% was found in pregnant women in

Malmo (Ahlfors et al., 1989).

Human toxoplasmosis includes a broad spectrum of symptoms, usually grouped into:

1) mild and transient disease in immunocompetent individuals, 2) reactivation of latent

infection in immunocompromised patients, 3) congenital infection in newborns with

symptoms apparent either at birth or detected later in life, and 4) severe toxoplasmosis with

ocular, neurological, and generalised symptoms as a result of postnatally acquired infection in

immunocompetent persons (Montoya and Liesenfeld, 2004). In immunosuppressed patients,

such as those infected with human immunodeficiency virus (HIV), the cause of disease is

usually not a primary infection, but rather reactivation of a latent infection (Kodym et al.,

2015). It leads to abortions and neonatal problems in humans and exerts negative impact on

livestock production. Toxoplasma encephalitis has been reported as a cause of death in

immune-compromised individuals with AIDS (Dubey and Jones, 2008). During pregnancy T.

gondii leads to ocular and neurological impairment such as mental retardation, blindness,

epilepsy, seizures, microcephaly and hydrocephaly (Robert-Gangneux and Darde, 2012). T.

gondii has been associated with behavioural changes and psychiatric illness such as

schizophrenia, implying that latent toxoplasmosis may be a greater problem than previously

recognised (Sutterland et al., 2015).

More recently, the prevalence of HIV-associated toxoplasmosis has decreased

because of HAART (highly active antiretroviral therapy). However, other groups of

immunocompromised patients, such as organ or stem-cell transplant recipients and patients

undergoing cancer therapy, are at risk for reactivation of latent T. gondii infection (Hakko et

al., 2013). Approximately 90% of congenitally infected children are born asymptomatic, of

which many will develop clinical signs later in life (Guerina et al., 1994). A more recent

abortion outbreak occurred in Jeju Island, Korea, where pregnant woman showed clinical

signs which included: fever, anorexia, depression, recumbency, abortion and in a few cases,

death (Kim et al., 2009).

30

1.12 Diagnosis

Demonstration of anti-T. gondii antibodies is a useful indirect indication of T. gondii

infection, because the infection is assumed to be lifelong in most host species (Tenter et al.,

2000). The relationship between parasite abundance in muscles and specific antibodies in

blood seems to differ between species. For pigs, the two seem to correlate well, and it has

been shown that a higher antibody titre is associated with a higher probability of finding

viable parasites in tissues using bioassay (Dubey et al., 1995a).

Many different serological tests have been used for detection of T. gondii specific IgG

and/or IgM. Some of these are: the Sabin-Feldman dye test (DT), the indirect fluorescent

antibody test (IFAT), the direct agglutination test (DAT; also referred to as the modified

agglutination test, MAT), the enzyme-linked immunosorbent assay (ELISA), the latex

agglutination test (LAT), complement fixation (CF), and the indirect haemagglutination test

(IHAT). DAT and ELISA are widely used and have been evaluated for pig serum in many

studies (Hill et al., 2006).

1.12.1 DAT (Direct Agglutination Test).

In DAT, the antigen (whole killed T. gondii tachyzoites of the RH strain) coalesce into a

network in which the organisms are coupled by specific IgG, if present in the test serum. The

outcome of the test (the titre) is the highest dilution of the sample at which agglutination

occurs. The DAT for T. gondii was developed in 1959 by Fulton and Turk. Initially, a low

sensitivity (Se) and specificity (Sp) limited its use, until the test was further developed in

1980 (Desmonts and Remington, 1980). The Sp was improved by adding 2-mercaptoethanol

(2-ME) to denature interfering natural IgM antibodies and the Se was improved by modifying

the antigen production. Note that specific IgM activity is also inhibited by 2-ME, and

therefore, DAT only detects T. gondii specific IgG. DAT may thus result in false negative

results in recently infected individuals (Dubey et al., 1995b).

DAT is a simple and straightforward test; it does not require any specific equipment, and

results are read after 5-18 hours. Serum samples should be tested in at least two dilutions (one

dilution representing the decided cut-off and one higher dilution) to avoid false negative

results caused by a phenomenon known as the prozone effect (Seefeldt et al., 1989). This

effect is a result of excessive T. gondii specific IgG in the sample, which saturates binding

sites on the antigen and thus prevents cross-linking of the antigen (agglutination). A

disadvantage of DAT is that the results are read subjectively (Dubey et al., 1995b).

31

1.12.2 ELISA (Enzyme Linked Immunosorbent Assay)

In indirect ELISA tests, a solubilised antigen is absorbed to a plastic surface of high-

binding capacity. Test samples are added to allow specific antibody-antigen binding. If

present in the sample, specific antibodies are subsequently detected using an enzyme-linked

secondary antibody. As a final step, a substrate solution for the enzyme is added and the

interaction between the enzyme and the substrate generates a visible colour. The colour

intensity is quantified objectively using a spectrophotometer and the result is presented as an

optical density value (OD). Using a predefined cut-off value, samples are assigned as positive

or negative. ELISAs for T. gondii come in a variety of designs including different types of

antigens, conjugates and buffers etc., all of which affect the performance of the test.

1.12.3 Serology Using Meat Juice

Meat juice is a serological matrix extracted from muscle samples by freezing and

thawing (Nielsen et al., 1998). Although not very well characterised, meat juice consists of a

mixture of blood, lymph and extracellular and intracellular fluids. Therefore, meat juice

contains antibodies, originating in different amounts from the above-mentioned sources.

However, the relative contribution of these sources is not well defined. Because meat juice is

readily available from animals at slaughter and from hunted game, it has been used in several

serological assays to demonstrate antibodies directed at different pathogens (e.g., Trichinella,

Salmonella and T. gondii in pigs) (Felin et al., 2014).

1.12.4 Detection of Parasites

Other means than serology is necessary to directly determine if parasites are present

in the tissues of an animal. Investigations based on detection of parasite DNA (by the

polymerase chain reaction (PCR)) are common, but may underestimate disease prevalence

(Garcia et al., 2006a). T. gondii tissue cysts are distributed unevenly throughout the muscles

of the host, and very small amounts of tissue (a few milligrams) are usually used in the PCR

analysis. Thus, there is a risk that the sample does not contain tissue cysts. However, a

method to analyse larger samples (100 grams) by digestion followed by magnetic-capture

PCR – has recently been developed (Opsteegh et al., 2010a).

1.12.5 Examination of cat faeces

Collect fecal samples of cat from different localities in a particular period of time.

Examine cat faeces for the presence of T. gondii oocysts using sheather's sugar flotation as

described by (Dubey, 2009a). Briefly, (2-10 gm) faeces from each cat sample float in sucrose

solution (454 gm sugar, 355 ml water and 6 ml formalin; specific gravity, 1.203), filter

32

through gauze, and centrifuge at 1500 rpm for 10 min in a 15 ml tube. Now put a drop of the

float on glass slide and cover with cover slip and examine microscopically at 400X

magnification. Measure oocysts with an ocular micrometer. If oocyst size ranges from 9-12

μm, fecal floats are sediment in water and aerated in 2% sulfuric acid, for sporulation, on a

shaker at 22 ºC for 1 week and stored in a refrigerator at 4 ºC (Lindsay et al., 2002).

1.12.6 ELISA to measure IgG titers

ELISA is also used with little modifications for detection of Toxoplasmosis (Choi et

al., 1992). Briefly, out of 96-well micro titer plate each one is coated 200μl (TLA T. gondii

lysate antigen) (5 μg/ml) in 0.05 M carbonate-bicarbonate buffer with (pH 9.6). After

incubating plate at 4˚C plate is washed serum samples are reacted in each well and further

diluted 1:100 with 0.05% Tween 20. It is then incubated at 37˚C for one hour. After washing

for several times, o-phenylenediamine dihydrochloride which is freshly prepared is added. 8

N H2SO4 is added to stop the reaction. The IgG antibody titers at a density of 490 nm are

determined.

1.12.7 PCR for detection of T. gondii B1 gene in blood

Specific IgM and IgA antibodies of Toxoplasmosis can be diagnosed very

successfully in laboratory by using Polymerase Chain Reaction (PCR). It is an efficient and

important tool for diagnosis. Some infected cats may be asymptomatic but revealed large

amount of IgG antibodies in their bodies without excreting oocysts in faeces. Thus antibodies

(IgM) can be used to determine susceptibility of a healthy cat to T. gondii. After two weeks

of infection oocysts are shed by infected cats. The examination of faeces and presence of

oocysts in it is not a suitable technique for diagnosis of oocysts in faeces because oocysts of

T. gondii are similar to other pathogenic parasites. T. gondii B1 gene can be identified in

blood samples by PCR. To isolate DNA of T. gondii the DNeasy blood and tissue kit

(Qiagen, Hilden, Germany) is used. Primers like reverse Toxo-497 (5´-

CATGGTTTGCATTTTGTGG-3´) and forward Toxo-497 (5´-AGCAAACAC-

CGACGAACTCT-3´) are used to amplify the 497bp fragment of the gene, the smart 2X PCR

Pre-mix is used with the following conditions: 94 ˚C for 5 min, followed by 35 cycles of 94

˚C for 60 secs, 55 ˚C for 55 secs, and 72 ˚C for 60 sec. The conventional PCR products are

analyzed by 1% agarose gel electrophoresis and stained with ethidium bromide (Aldebert et

al., 2011).

33

1.12.8 Techniques for T. gondii strain genotyping

Different strains of T. gondii cause different clinical symptoms in both humans and

animals, there for genotyping is important to understand the epidemiology and population

genetics of the T. gondii (Grigg et al., 2001; Wang et al., 2013). To understand the virulence

and epidemiological impact, Identification and tracking of these strains is important. Initially

strain genotyping methodology was based on Multilocus Enzyme Electrophoresis (MLE)

(Darde et al., 1992). But current research has focused on two other typing methods; Multi-

locus Nested PCR-restriction fragment length polymorphism (Mn-PCR-RFLP) and

Microsatellite Sequence Typing (MLST), for epidemiological studies Mn-PCR-RFLP is most

commonly used. Currently the markers used for Mn-PCR-RFLP only identifies specific

regions of the T. gondii chromosome, therefore, using this technique alone there is possibility

of genetic diversity of the T. gondii. By using either of these methods directs equencing of

PCR products, will confirm the detection of SNP’s and will also identify deletions and

insertions which may provide additional information about genetic polymorphisms within an

isolate. However, these molecular technologies can be expensive and may not cost effective

option for large scale epidemiological studies (Sibley et al., 2009).

1.12.8.1 Mn-PCR-RFLP

Mn-PCR-RFLP is based on digestion of PCR products by specific restriction enzymes

which detect SNP’s. The digested PCR products are different in size according to the strain of

T. gondii and PCR marker used, result in bands of differentsizes which can be used to

identify a particular allele for the parasite. A series of 10 - 12 markers BTUB, GRA6, SAG2

5’, SAG2 3’, SAG3, SAG1, altSAG2, c22- 8, c29-2, L348, PK1, and Apico which

coverseight chromosomes and the plastid of T. gondii (see Table 1.2) are used to detect not

only clonal lineages (type I, II and III) atypical or mixed genotypes (Dubey et al., 2014; Pena

et al., 2013), but other studies shows the use of only five or six markers ,BTUB, GRA6,

SAG2 5’,SAG2 3’, SAG3 and Apico (Boughattas et al., 2010; Burrells et al., 2013; Khan et

al., 2005a).

Table 1.2 Mn-PCR-RFLP primers and Marker and T. gondii chromosome number.

SAG1, 5'SAG2, 5'SAG3, alt. SAG2 VIII

SAG3 XII

BTUBIX

GRA6X

c22-8Ib

c29-2III

L358 V

34

PK1 VI

Apico Plastid

1.12.8.2 MLST.

Genotyping by MLST is not as widely used as Mn-PCR-RFLP. The technique

identifies nucleotide polymorphisms, which differ between different T. gondii strains, and

generally incorporates five microsatellite markers (TUB2, W35, TgM-A, T. gondii in animal

and human hosts B18, and B17) across five different chromosomes of the parasite (Ajzenberg

et al., 2005). Primer pairs are used in a multiplex assay which incorporates fluorescent

labelling of the 5 ends with fluorescein. The PCR amplicons generated are accurately sized

using an automatic sequencer and Gene Scan analysis software (Fekkar et al., 2011).

1.12.9 Latex Agglutination Test

The latex reagent is a suspension of polystyrene particle which is sensitized with the

antigens of T. gondii. The distant agglutination pattern when observe after mixing the serum

will reflects formation of antigen-antibody complexes. When the organism has no infection,

then no agglutination will be observed. A greater than 4 IU/ml value is considered as standard

for positive result.

A Latex reagent is enough for the 50/ 100 tests. For ensuring homogeneity the latex

will be shaken. The positive control test will declare positive result indicates that the reagent

is functional, and the negative response of negative control will indicate that it is also

functional. The Pipette stirrer and re useable reaction slides are also used in the process.

Serological methods such as Sabin-Feldman Dye Test (SFDT), complement fixation test,

indirect and Modified Agglutination Test (MAT), intradermal skin test, are used for the

detection of toxoplasmosis (Goz et al., 2007). lymphoma and encephalitis techniques are

used as diagnostic procedures in immunocompromised patient (Gross et al., 2004).

ELISA is used for detection of IgG and IgM antibodies in human blood (Hasan,

2011). Latex Agglutination Test kit (LAT) is used for IgG antibodies commercially (Tasawar

et al., 2012).

1.12.10 Vaccination strategies

1.12.9.1 Cats

The definitive host cat shed oocysts which act as primary source of infection (Dubey

and Beattie, 1988), a vaccine which control oocysts shedding will prevent environmental

contamination with oocysts (Innes 2009), as a result of reduction in number of oocysts in

environment will reduce toxoplasmosis in humans and animals hosts. One of the most

successful vaccines T-263 shown successful results 84% (31/37) aginst oocysts shedding in

35

experimental cats (Frenkel et al., 1991). During a field trial with the same mutant strain (T-

263), results showed that vaccination of cats on 8 commercial swine farms resulted in an

overall reduction of the seroprevalence of the parasite in pigs (Mateus-Pinilla et al., 1999).

Despite the success of this vaccine it has not commercially been manufactured because it

requires a cold storage chain and bradyzoites which are used for vaccination are also infective

to humans, making administering the vaccine potentially hazardous. A more desirable

approach would be a vaccine which incorporates recombinant DNA, however studies using

this methodology are few in number and their success has been limited. For example,

research by (Mishima et al., 2002) using recombinant feline herpesvirus-1 expressing the

ROP2 antigen of T.gondii did not reduce oocyst shedding in cats noted partial protection

against oocyst shedding when cats were vaccinated intranasally with crude rhoptry proteins

of T. gondii combined with Quil- A as an adjuvant (Garcia et al,. 2007; Zulpo et al,. 2012)

1.12.10.2 Sheep

The main cause of ovine abortion in both UK and worldwide is ovine toxoplasmosis.

Toxovax is the only commercially available vaccine against toxoplasmosis which is licensed

by MSD Animal Health (Milton Keynes, UK). The vaccine S48 strain of T. gondii, consists

of the tachyzoite stage of which has lost the ability to differentiate into bradyzoites or

oocysts, and remains as the tachyzoite stage of the parasite (Buxton, 1993; O'Connell et al.,

1988).

1.12.10.3 Pigs

Various vaccination plans have been followed, but, as yet, no vaccine has been shown

to provide complete protection against tissue cyst formation in pigs however, following

mouse bioassay of porcine tissues, only partial protection from tissue cyst formation was

obtained (Dubey et al., 1994; Dubey et al., 1998b; Dubey et al., 1991; Pinckney et al., 1994).

In 2004, Kringel et al also used the RH strain of T. gondii for vaccinating pigs, two of the

dense granule proteins of T. gondii, GRA1 and GRA7, was shown to produce a strong

humoral and type I cellular immune response in pigs against T.gondii infection (Jongert et al.,

2008). A mouse bioassay on porcine heart tissue from the vaccinated pigs in this experiment

found two out of a total of three animalsto be tissue cyst free.

1.12.10.4 Humans

A vaccine for control of toxoplasmosis in humans is, as yet, unavailable. A vaccine in

risk groups like women, child bearing age and immune-comromised individuals would be

most beneficial.The only vaccine which is successful against toxoplasmosis is live

tachyzoites of the attenuated S48 strain of the parasite only in veterinary is now considered to

36

be beneficial in humans (Ivory and Chadee, 2004), however, these may not be as effective as

live vaccines (Innes et al., 2011).

From published research, it is clear that a vaccine which incorporates antigens from

the different stages of the life cycle is important. CD4+, CD8+ and IFNγ are involved in

protective immunity to T. gondii and if a greater number of antigens are present in a single

vaccine, it is more likely that they will be processed and presented to the immune system

(Innes et al., 2011).

1.13 Symptoms

Due to healthy immune system, 80 percent of primary toxoplasmosis show no

symptoms as determined by epidemological studies (Remington et al., 2006). Majority of

infected pregnant (more than 90%) women are asymptomatic (Boyer et al., 2005; Kravetz

and Federman, 2005). Only in few cases clinical symptoms are identified (De carlo et al.,

2008; Boyer et al., 2005). Appearance of clinical symptoms is same both in pregnant women

and non-pregnant women it includes flu like symptoms fever and enlargement of lymph

nodes, malaise (Jones et al., 2003; Boyer et al., 2005; Stray-pederson, 1993) and typically

around 2 % of people with good physical health show occular disorders (Holland, 2003).

Immunity developed against T. gondii in females are safe during pregnancy from congenital

toxoplasmosis, while females are in risk of congenital toxoplasmosis who lack such

immunity (Cunningham et al., 1997). Due to severe infection congenital infecion establish in

pregnant women and depends on period of infection. Symptoms of congenital infection may

be seen after few months of delievery or may be noted at birth time (Dubey et al., 1998;

Tenter et al., 2000). People with normal immune function in most cases of toxoplasmosis

show no symptoms (Kravetz and Federman, 2005), while immunocompromised inidividuals

show various disorders like fatal encephalitis, fever and lanphadenitis. (Shimelis et al., 2009).

It has been estimated that one-third cases of T. gondii during pregnancy leads to abortion,

loss of vision, accumulation of fluid in brain, microcephaly. (Dubey et al., 1998; Tenter etal.,

2000). Recrudescent infections happen as a result of bradyzoite dissemination, cyst rupture

and transformation into rapidly dividing tachyzoites. Clinical symptoms in cats involves

muscular hyper aesthesia, uveitis, dyspnoea, icterus, fever, diarrhoea, lethargy, nasal

secretions, weight loss and anorexia (Hartmann et al., 2013; Jokelainen et al., 2012).

1.14 Risk factors and Transmission

Various Studies have shown the causes of toxoplasmosis infection as keeping cats,

taking of raw meat, raw vegetables or raw fruits, unhygienic conditions like dirty hands (Baril

et al., 1999; Weigal et al., 1999; Kapperud et al., 1996; Cook et al., 2000), by having cats in

37

farming (Weigal et al., 1996). Unhygienic conditions like dirty hands, handling cat fecal

matter, using of unclean kitchen knifes,interaction with soil,low socio-economic status, low

education level, and Age are also some of the factors that increases the risk for infection

(Torgerson and Mastroiacovo, 2013; Pappas et al., 2009; Sroka et al., 2010).

Transmission may be horizontal or vertical. Horizontally it can be transmitted by

infected food, water, milk soil, cat litter boxes or different host species. Vertical transmission

involves congenital toxoplasmosis, transmit via blood (Dubey, 2010; Jones and Dubey,

2012).

1.14.1 Horizontal transmission

1.14.1 a. Tissue cyst transmission

Tissue cysts occur in the brain and muscles of the intermediate hosts. In Cats tissue

cysts transfer by consuming infected prey e.g rodents and birds. In cats sexual phase of

reproduction occurs and oocyst are formed during enteroepithelial cycle. (Dubeyet al., 1970).

Tissue cyst is considered as important infective source of transmission to humans, especially

in farm animals i.e. goat, sheep, pig and cattles (Tenter et al., 2000). Wild carnivorous

animals such as fox, bear, and raccon and can acquire toxoplasmosis by cosumption of tissue

cysts. Human can acquire the infection via ingestion of undercooked infected meat like lamb

or pork (Dubey et al., 2005; Hill et al., 2010). When a tissue cyst pass into stomach, the

proteolytic enzymes act on cyst wall and released bradyzoites, which initiates infection in

small intestine.

1.14.1.b Transmission by oocyst

The Infected cats sheds large number of oocysts in large numbers, up to 10 million

cysts during a single day. The sporulation of oocyst takes 1-5 days, which become virulent

and remain infective for more than a year in suitable condition like moist soil (Dubey et al.,

1998). Humans can acquire infection by consuming water and food, raw fruit and vegetables

containing oocysts (Dubey, 2010; Pereira et al., 2010). Oocyst can be carried byflies, such as

the common housefly Musca domestica and the oriental blowfly Chrysomya megacephala,

from cat faeces to food for one to two days (Wallace, 1971). Circumstantial evidence

recommends oocysts infection is more severe than tissue cysts (Dubey, 2010). The direct

interaction with cats with human is not consider as source of primary infection due to short

duration of releasing oocysts, shedding off non-infective oocyst (Elmoreet al., 2010). It has

been found that oocysts can survive in seawater for up to 6 months, suggesting that it could

be a source of infection in coastal marine environments by transport hosts (Lindsay and

Dubey, 2009). Recently it has been proved that oocysts can survive in filter feeders like

anchovies and sardines and cause infection inside their alimentary canal (Massie et al., 2010).

38

1.14.2. Vertical transmission

1.14.2. a Congenital transmission

Congenital toxoplasmosis occurs during acutephasein pregnant women when T.

gondii is able to cross placenta and cause infection to fetus (Duncanson et al., 2001).

Transmission through organ transplantation and blood transfusion is infrequent. The severity

and the transmission rate of congenital toxoplasmosis depends on the period of pregnancy in

which it is acquired. Transmission is comparatively lower (< 20%) in first trimester however

at the end of pregnancy it increases upto 80%. (Joneset al., 2003; Ortiz-Alegria et al., 2010).

Within first two trimester of pregnancy, T. gondii cause spontaneous abortion (Montoya and

Liesenfeld, 2004). In most inhabitants the overall frequency of congenital toxoplasmosis is

from 1 in 1000 to 1 in 10,000 live births (Tenteret al., 2000; Dubey and Jones, 2008). In

humans the vertical transmission rate of 19.8 was reported by using PCR at birth time (Hide

et al., 2007). In experimental mouse and sheeps it was found 75% and 65% respectively.

(Hide et al., 2009).

Figure 1.6 Transmission of Toxoplasma gondii

39

1.15 Treatment of Toxoplasmosis

In healthy individuals toxoplasmosis resolves without the need for drug intervention

(Muhie and Keskes, 2014). The need for possible treatment in immunocompetent individuals

with mild symptoms has not been demonstrated (EFSA, 2007). The treatment of choice in

immunocompromised individuals with toxoplasmosis is a combination of pyrmethamine and

Sulfadiazine (EFSA, 2007). This treatment should be given continually until there is

Improvement in their condition. For AIDS patients, the continuation of the medication for the

Rest of their life or while they are immunocompromised may be necessary (Nissapatorn et

al., 2004). Pyrimethamine and sulfadiazine are used after fetal infection has taken place.

These Drugs act as agents to produce a combined effect by blocking the pathway for cellular

Metabolism that involves p-aminobenzoic acid (Sulphonamides) and folic-folinic acid cycle

(Pyrimethamine) as reported (Caroline and Mark, 2013). However, Pyrimethamine and

sulphonamide therapy must not be administered during the first trimester of pregnancy due to

its potential teratogenicity (Montoya and Remington, 2008). Studies by Baron (1996)

reported that, development of Thrombocytopenia and/or leucopenia may occasionally occur

as a result of Sulphonamide or Pyrimethamine therapy. However, a combination therapy with

folic Acid reduces thrombocytopenia. Pregnant women, newborns and infants can be treated

with pyrmethamine and sulfadoxine although the infection is not eradicated completely

(Muhie and Keskes, 2014). Spiramycine (a Macrolide) is the antibiotic used for treatment of

toxoplasmosis for most pregnant women to Prevent infection to the unborn fetus (Overton

and Bennet, 2010). In latent infection, treatment is not effective as antibiotics are not able to

reach bradyzoites in sufficient concentrations (Muhie and Keskes, 2014; EFSA, 2007).

Atovaquone has been used for treatment against Toxoplasma Cysts in AIDS patients (Muhie

and Keskes, 2014).

1.16 Prevention and Control

Toxoplasmosis is a serious disease but treatable. Different methods are applied to

reduce T. gondii infection in human such as by keeping good hygienic condition. Stages of T.

gondii are sensitive to soap and water and easily destroyed with washing, so washing hands

with soap and water after contact with meat products reduce the chances of infection. Before

eating fruits and vegetables it should be washed thoroughly with water (Lopez et al., 2000).

Wash knifes and other kitchen tool that is used for handling and cutting meat. T. gondi

present in meat can be destroy by giving heat or cold T. gondii. Methods such as curing,

salting or microwave cooking, are not efficient to kill bradyzoites (Dubey, 2010), freezing

at -12 ˚Ϲ or lower for more than two days, acidity, high pressure and irradiation, high-

40

pressure are effective methods (Kijlstra and Jongert, 2008). Women in pregnancy should

avoid eating raw or undercooked meat, avoid interaction with cats , handling cat fecal matter

and with soil (Hill and Dubey, 2002; Lopez et al., 2000; Tenter et al., 2000). For blood

transfusion it has been recommended that individual with higher risk of toxoplasmosis like

immunocompetent and pregnant women to receive antibody-negative blood components.

Highly active and efficient antiviral drugs are given to individual with AIDS to minimize the

chances of T. gondii (Gagandeep and Sehgal, 2010). Pasteurization is the effective method of

destroying tachyzoites in milk (Dubey, 2010). On larger scale, the best wayto prevent human

toxoplasmosis is to keep animals (particularly domestic cats and livestock) free of T. gondii.

1.16.1 Preventive Measures in Pregnancy

Prevention is catergorized into primary, secondary and tertiary. Primary prevention

minimizes the firsttime infection up to 63%. Prevention of primary infection based on

educational and public health programs, avoiding them to eat raw food, handling of cat litter

boxes, when contact with soil use of gloves is also recommended (Foulon, 1992). Secondary

prevention involves early analysis of mother, foetus and newborn baby, preventing the

transmission of infection via placenta. Tertiary prevention consists of early analysis and of

specific IgA and IgM antibodies in blood of the newborn, to prevent or lower the risk of

sequels by therapeutic regime (Hall 1992).

1.17 Aims and Objectives

Prevalence of T. gondii in the livestock was poorly reported previously. The current

study was conducted to investigate the prevalence of toxoplasmosis. The association of

various risk factors with toxoplasmosis were also analyzed. Epidemiology and molecular

characterization were the main objectives of the present study in Peshawar valley KP

Pakistan.

41

CHAPTER 2

MATERIALS AND METHODS

2.1 Study area

Pakistan is geographically divided into three regions i.e. North, Northwestern and

Western high lands which cover nearly two third of the country. The Northern region is

divided into Himalayas, inner Himalayas and Trans Himalayas which is a vital source of

water for Indus River system (Khan, 1998). The research area Peshawar valley is located in

Khyber Pakhtunkhwa province of Pakistan. It is divided into five districts viz Charsadda,

Peshawar, Mardan Sawabi and Nowshera.

2.1.1 District Charsadda

The surrounding border of Charsadda is bounded by Mardan, Peshawar, Mohmand

Agency and Malakand Agency from all sides. Pushkalawati is the old name of Charsadda.

The word Pushkalawati means the city of lotus plants. It was the administrative district of

ghandara but Mahmoud Ghaznawi in 1026 A.D conquered this area. The name of Ghandara

disappeared and the name of Pushkalawati was given by Afghan commander owing to the

abundance of lotus plants in this area. The present name Charsadda was given by local people

due to the connections of four main routes entering to the area from Tangi, Nowshera,

Mardan and Peshawar. The historical and important tehsil of Charsadda is Tangi. The Tangi

name was given by the people of that area due to narrow ways and congested buildings.

Charsadda is located in the basin of Peshawar having distinctive geographical

characteristics. The valley is surrounded by mountains from all borders except the East,

which is an entrance way to Punjab province. The mountainous range of Malakand and Buner

lies to the North, Khyber and Mohmand hills to West, Khattak and Cherat ranges to the South

and South East. Besides the mountain series there are some important routes which link the

valey with surrounding areas and regions. These comprise Khyber Pass, Malakand Pass,

Lowari Pass and Kohat Pass which are used as a gate way to Afghanistan, Chitral, Swat, and

Kohat basin respectively (Coningham et al., 2007). The total area of Charsadda is about 996

square kilometers (243753 acres). Out of which 21055 acres is used for cultivation, whereas

180339 acres is used as irrigated area. There are three rivers flowing in Charsadda, the Kabul

River, the Swat River and River Jindi which are the core source of irrigation (SMEDA,

2009).

42

Figure 2.1 Map of District Charsadda.

2.1.1.1 Climate: Charsadda which is a part of valley of Peshawar, so it receives less rain

because of its relatively low laying location. The maximum rain fall is less than average as a

result it is considered as semiarid. Approximately 500 mm annual rain fall is recorded so far.

The area consists mainly of four seasons i.e. summer, winter, spring and autumn. Winter

interval is from December to March with 15 °C day time temperature, while the summer

season extends from July to September with an average day temperature of 40 °. Besides

from these, two more transitional periods also present one from April to June while the other

from September to November (Coningham et al., 2007).

2.1.1.2 Topography: The land of Charsadda is very fertile (SMEDA, 2009), so it hosts two

cropping seasons i.e. summer or Kharif and winter or Rabi.The summer crop is cultivated

from May to August and winter crop from October to January. About 95%of the people adopt

agriculture as a profession. Sugarcane is the chief cash crop. Gur is prepared from sugarcane

juice (Coningham et al., 2007).

2.1.1.3 Flora: Owing to its climatic condition flora consist of Acacia, mulberry, Olives,

shisham and Tamarisk (Coningham et al., 2007). Common crops of Charsadda are

43

Sugarcane, sugar beet, maize, wheat, and Rice while famous fruits include Orchards, Apricot,

Citrus, Musk, Strawberry, Mellon, Guava, peaches, plums and Pears (SMEDA, 2009).

2.1.1.4 Fauna: As a consequence of modern agriculture techniques most of the area which

provide a suitable habitat for wild animals is nowadays under cultivation which has adverse

effect on animal diversity. Presently few wild mammals have seen such as wild boar, jackal,

buffaloe, Porcupines, goats, humped cattle and sheep. Both wild boar and porcupine is pest

ofmaize and sugarcane respectively. About 75% farmers keep domestic animals.Among them

cattle and buffalo are specially kept for dragging cart and also fulfill the dairy products

requirmens. Chickens are kept in homes to accomplish meat requirement (Coningham et al.,

2007).

2.1.2 District Mardan

The literal meaning of Mardan is the land of courageous people. It lies from 34° 05' to

34° 32' latitudes in north, and 71" 48' to 72° 25' longitudes in east. On the north it is

surrounded by Buner district and protected area of Malakand Agency, on the east Swabi is

present, on south it is bounded by Nowshera district and on the West lies district Charsadda.

The area of the district Mardan is 1632 square km (Mardan district demographics, 2017).

2.1.2.1 Population According to 2017 consensus, the population of district Mardan is

2,373,061 (Pakistan tehsilwise census, 2017). The rural population of district Mardan in 1998

was 1,164,972 and urban population was 295,128. It was 357,455 in 1951 and in 1961, 1972,

1981, 1998 it was 481,297, 696,622, 881,465, 1,460,100 respectively (Censuses report,

2017).

2.1.2.2 Food Mostly people like to eat wheat flour bread while maize bread is also used as a

source of diet. People like spicy food commonly they use green leafy vegetables while people

are fond of beef 43 and meat cooked in different varieties. Black tea is used with milk where

green tea is also common in this area. The oranges are the popular fruit of this area grown in

this area. These are transported to other cities also. Here the roads are not properly

constructed mostly the roads are muddy.

2.1.2.3 Occupation Commonly the villagers are farmers as a profession with low

socioeconomic status. Now a day‟s Industrial labour has also increased due to some factories

established in the nearby areas whereas some people are also in Government service and

some are doing their business.

44

2.1.2.4 Physical features and topography: The district Mardan is mainly distributed into

two areas, north eastern hilly area and south western plain. The north side of the area is

covered by the hills. Whereas the southern part is covered by fertile plain area. This is

commonly known that once these plain areas where covered with lakes the river flowing from

the nearby hills gradually filled the lakes. Which ultimately steeps down to the river Kabul

(The Express tribune, 2017). The summer in this area is very severe the temperature rises

from May to September which shows quite high temperatures. In May and June at night dust

storm blows.in the month of June the temperature rises up to 43.5 °C (110.3 °F). Because of

high level of cultivation and artificial irrigation humidity is high and heat is oppressive.

However, the temperature changes from the month of October onwards. In the month of

December and January the temperature low down and reaches to 5 °C (32.9 °F). Which is the

minimum temperature recorded in the month of January. Commonly rainfall occurs in the

month of July, August, December and January. Maximum rainfall is recorded for the month

of August i.e. 12.8 mm. The relative humidity of this area is high in the whole year while

maximum humidity has been recorded in December i.e. 73.33% (Division, district and

tehsil/census district khyber Pakhtunkhwa province, 2017).

2.1.2.5 Administration The district Mardan has been divided into three tehsils. Takht Bhai

tehsil, Katlang tehsil and Mardan tehsil (www.pbscensus.gov.pk, 2017).

2.2 Study population

A total of 2880 blood samples from domestic animals (goat, cow,sheep and buffalo)

were randomly collected in sterilize collecting tubes having EDTA from September 2015 to

December 2017 in the study area.

2.1.3 District Swabi

Swabi district is one of the districtsin Khyber Pakhtunkhwa Province of Pakistan. It is

situated between the Kabul and Indus Rivers at 34° 7′ 0″ N, 72° 28′ 0″ E. Its inhabitants are

referred to as 'Swabiva'l. It is the fourth most populous district of the province. The

population of Swabi district, according to the 2017 census, is 1,624,616. It has a population

density of 1,100/km2 (2,700/sq mi) with Urban 275,925 and Rural 1,348,691. The

MandanrYusufzai subsection of the Yousafzai clan of the Pakhtunns form most of the district

population. Other clans include Razars/Rajars, Utman, Jadoon/Gadoon and Khattak. About

96% of the population have Pashto as their first language. Before raising to the level of

district in 1988, it was a tehsil within Mardan District. Swabi District is currently subdivided

into four Tehsils. Which are; Swabi Tehsil, Topi Tehsil, Lahor Tehsil and Razzar Tehsil.

45

With 56 union councils. It has a total area of 1,543 km2 (595.8 square miles) (Pakistan

Bureau of Statistics, 2018).

The climate of Swabi is warm and temperate. With mild winters and hot, humid

summers. Swabi characterizes a humid subtropical climate.The average temperature in

district Swabi is about 22.2 °C, while the precipitation annually averages 639 mm. August is

the wettest month with an average 137 mm of precipitation, while November is the driest

month with an average rainfall of 12 mm. June with an average temperature of 32.9 °C,

proves to be the hottest month of the year. While January appears to be the coldest month of

the year with an average temperature of 10.2 °C. (Wikipedia, "Climate: Swabi - Climate-

Data.org". Retrieved 18 March 2018.).

Swabi is home of many streams and two main rivers, the Indus and the Kabul. Both

these rivers meet at a place known as Kund, a major tourist attraction. The Indus river with its

remarkable blue colour and the Kabul river's muddy brown waters go side by side without

blending. There are several small streams in different locations of Swabi. A unique stream is

in village Maini. The water of the stream comes out in the centre of the village. Its water is

used for irrigation in the village. This stream is called china in local language which means

spring. The three villages namely Kotha, Topi and Maini are collectively called Utman. They

all have natural springs called china in Maini, chino in Kotha and bayin in Topi

(http://www.pakistan.web.pk/threads/swabi- district.2211).

2.1.4 District Nowshera

Nowshera is a district in the Psrovince Khyber Pakhtunkhwa of Pakistan. The capital

and district headquarter is Nowshera city. It is situated on the Eastern side of Peshawar with

coordinates of 34°N 71° 59°E. This district is surrounded by four other districts and two FR

Area, Namely, F.R.Peshawar to South West, Charsadda to North West, Mardan to North,

Swabi to East, Attockto South East and FR Kohat to South East side.Nowshera become tehsil

of District Peshawar in 1930 and remain as tehsil till 1988, after which it was raised to the

level of district.It was also a part of the Peshawar Division until the reforms of

The Government of Pakistan (The Nation. Retrieved 2017-12-20; Wikipedia)

Total area of Nowshera is 1,748 km². The population of Nowshera district, according

to the 2017 census, is 1,518,540 (Pakistan Tehsil Wise Census 2017]while the population,

according to the 1998 census, was 874,000. According to 1998 census the sex Ratio (males

per 100 females) was 108.8. the 26% of the population is urban while the rest 74.04% is

rural. The population density is 608 persons per square kilometre. The total agricultural area

https://en.wikipedia.org/wiki/Pakistan_Bureau_of_Statistics


https://en.climate-data.org/location/961106/


http://www.pakistan.web.pk/threads/swabi-%20district.2211

https://en.wikipedia.org/wiki/Peshawar_Division

https://en.wikipedia.org/wiki/Government_of_Pakistan

https://web.archive.org/web/20171107021641/http:/www.pbscensus.gov.pk/sites/default/files/PAKISTAN%20TEHSIL%20WISE%20FOR%20WEB%20CENSUS_2017.pdf

46

is 52,540 hectares. The main source of income of the region is agriculture. The district is

divided into 3 Tehsils, which are: Nowshera Tehsil, Jehangira Tehsil and Pabbi Tehsil.

Further the district is divided into 47 Union Councils. Based on area Nizampur is the largest

union council and Pabbi appears to the smallest union council in the district Nowshera

(www.pbscensus.gov.pk. Retrieved 24 November 2017).

The Topography of Nowshera is plan in its Northern half while its southern part is

hilly. There are two rivers running through this district i.e. River Kabul and River Bara. River

Kabul is the main River running through Nowshera. It flows through out District Nowshera

from west to east from village Garhi Momin to village Khairabad where it enters river Indus

at Attock bridge. It has 07 streams entering it from various parts and making it a potential

source of flood. In 2010 flood 45 % of the whole district has been submerged and caused

colossal damages. A very small range of mountains known as Khattak Mountain Range,

spreading from south west to south east separating areas of FR-Kohat and FR- Peshawar from

District Nowshera. In south west it has areas of Cherat from there its runs down to Manki

Sharif till Nizampur in South East.

Pashto is predominant first language, spoken natively by 91% of the population (PCO,

1998). The census of 1981 reported that in the tehsil of Nowshera, Pashto was the language

of 88% of households, while Punjabi accounted for 4.3%, Hindko 4.2%, and Urdu 2.9%. The

58% population of the district Nowshera belongs to Khattak tribe, 12% belongs

to Gumoriani tribe, 10% belongs to Kheshgi (Batakzai included) tribe, 09% belongs

to Kakakhel tribe, 7% belongs to Babar tribe, 3% belongs to Awan tribe, 1% belongs

to Paracha tribe, 1% belongs to Afridi tribe and 1% belongs to Taizi tribe (PCO, 1981).

The usual climate in Nowshera is known as a local steppe climate. During the year,

there is little rainfall in Nowshera. The temperature here averages 22.4 °C. The average

annual rainfall is 532 mm. The driest month is October. There is 13 mm of precipitation in

October. Most precipitation falls in August, with an average of 112 mm. With an average of

33.6 °C, June is the warmest month. In January, the average temperature is 10.1 °C. It is the

lowest average temperature of the whole year. The precipitation varies 99 mm between the

driest month and the wettest month. The average temperatures vary during the year by 23.5

°C. (https://en.climate-data.org/location/1240/).

2.1.5 District Peshawar

Peshawar is a district in Khyber Pakhtunkhwa province of Pakistan. It is located about

160 km west of the Pakistan's capital Islamabad. It is located in Geo-strategically important

https://en.wikipedia.org/wiki/First_language

https://en.wikipedia.org/wiki/Punjabi_language

https://en.wikipedia.org/wiki/Hindko

https://en.wikipedia.org/wiki/Urdu

https://en.wikipedia.org/wiki/Khattak

https://en.wikipedia.org/wiki/Gumoriani

https://en.wikipedia.org/wiki/Kheshgi

https://en.wikipedia.org/wiki/Kakakhel_(tribe)

https://en.wikipedia.org/wiki/Babar_(Pashtun_tribe)

https://en.wikipedia.org/wiki/Awan_(tribe)

https://en.wikipedia.org/wiki/Paracha

https://en.wikipedia.org/wiki/Afridi

https://en.wikipedia.org/wiki/Taizi


https://en.wikipedia.org/wiki/Khyber_Pakhtunkhwa

https://en.wikipedia.org/wiki/Pakistan

https://en.wikipedia.org/wiki/Islamabad

47

location and has an enriched history. This district and city have seen the rise and fall of many

civilisations. It was once the centre of Gandhara civilisation and has subsequently been ruled

by Persians, Greeks, Buddhists, Kushans, Afghans, Mughals, Sikhs and the British. The

original district of Peshawar was a district of the North-West Frontier Province of British

India (Imperial Gazetteer of India).

After independence in 1947, the old Peshawar District became Peshawar

Division containing the current districts of Peshawar District, Charsadda District and

Nowshera District. In July 1988, the former Charsadda tehsil was separated and

became Charsadda District while former Nowshera tehsil became Nowshera Districtin 1990.

(DCR, 1998). Under the latest revision of Pakistan's administrative structure, promulgated in

2001, Peshawar was also given the status of a city district.

The population of Peshawar district, according to the 2017 census, is 4,269,079. Area

of the Peshawar is 1,257 km2 (485 sq mi). There is only one tehsil in the district which is

named as Peshawar Tehsil. The district is divided into 4 towns, 279 mouzas (Revenue

Villages), out of which 236 are rural, 15 are urban and 28 mouzas are partly urban. There are

30 police stations in the district (Pakistan Bureau of Statistics, 2018)

Peshawar, the provincial capital of KP features a semi-arid climate. The city

experiences hot summers and relatively cold winters. There is not much rainfall in Peshawar

all year long. The temperature here averages 22.7 °C. Precipitation here averages 384 mm.

The least amount of rainfall occurs in June. The average in this month is 8 mm. In March, the

precipitation reaches its peak, with an average of 65 mm. The temperatures are highest on

average in June, at around 33.2 °C. At 10.7 °C on average, January is the coldest month of

the year. The variation in the precipitation between the driest and wettest months is 57 mm.

The variation in annual temperature is around 22.5°C(https://en.climate-

data.org/location/3624/).

https://en.wikipedia.org/wiki/North-West_Frontier_Province_(1901%E2%80%931955)

https://en.wikipedia.org/wiki/British_Raj

https://en.wikipedia.org/wiki/British_Raj



https://en.wikipedia.org/wiki/Charsadda_District,_Pakistan

https://en.wikipedia.org/wiki/Nowshera_District




48

2.2 Methodology

Flow chart

Sample collection

(Total blood samples: 2880, stool samples; 130)

Confirmatory tests (Serological tests and Light Microscopy)

DNA Extraction (QIAamp DNA Stool Mini Kit and geneAll blood kit)

Polymerase Chain Reaction (PCR)

Gel Electrophoresis

DNA Sequencing

BLAST

2.3 Blood sampling

A total of 2880 blood samples were collected. About five ml of blood was taken from

jugular vein of each animal i.e. Cattle, goats and sheep through disposable syringe. The blood

was then transferred to properly label collecting tubes containing anticoagulant (EDTA).

Collecting tubes were transferred to ice box. The blood samples within 24 hours were

transported to concerned laboratory. The blood samples were centrifuged at 3500 (rpm) for

ten minutes at room temperature to extract serum from blood. With the help of micro pipette,

the collected serum was transferred to eppendorff tubes and stored at -20 °C in refrigerator

for further processes.

49

2.4 Serological Examination

2.4.1 Sample preparation

Fresh serum was used, obtained from centrifugation of blood. The haemolysed or

contaminated sera were discarded.

2.4.2 Techniques

According to the company (Toxocell Latex- Spain) standard procedure the test

procedure was performed at room temperature. The samples were diluted insaline NaCl 0.9

% solution. 50ul or one drop of diluted sera was taken with the help of micropippete and

mixed with one drop (25ul) of chemical placed on special black-ground slide using pipe

stirrers supplied with kitthen rotating the slide slowly for 5 minutes and observe any visible

agglutination.The result was classified into positive or negative on a slide.

2.4.3 Interpretation of results

A clear positive reaction shows the presence of toxoplasma antibodies while a

negative reaction was the indication of the absence of T. gondii antibodies.

2.5 Collection of fecal samples from stray cats

A total of 130 fecal samples were collected from stray cats from different sampling

sites of Peshawar valley.

2.5.1 Materials needed and sample collection

Plastic pots for faecal sample collection coded with a blue coloured lid, disposable

plastic spoon, Plastic gloves, and plastic zip-lock bag. Each container was properly labelled

with locality, cat's gender and age of the cat. Faecal samples were collected and treated with

great care because it may contain several infectious microorganisms. For personal hygiene

disposable plastic gloves were used. First of all, it was confirmed that fecal sample was not

too old. Then a specific amount of faecal sample (full table spoon) was taken with the help of

disposable plastic spoon and 90% ethanol was added to faecal sample to preserve it for

further analysis for DNA extraction and then put it in the plastic pot and then the faecal pot

was placed inside the zip-lock plastic bag and sealed.

2.5.2 Light Microscopy of cat faecal samples

The cat faecal samples which were collected from various stray parts of sampling

region were observed under light microscope by using direct smear and Sheather’s sugar

floatation technique.

50

2.5.2 Direct smear formation

The faecal samples were put in centrifuge tubes and a drop of 0.9% sodium chloride

was added. To homogenize the sample, it was centrifuged. Then a small amount of the

sample was placed on a clean slide and covered with a cover slip of 18-mm X 18mm size.

Now it was examined under light microscope (Olympia electrical light microscope from

Japan) of magnification 400X for the detection of oocysts of T. gondii. The size of the oocyst

of T. gondii under 400X magnification was 10µ-12µ.

2.5.3 Sheather’s Sugar Floatation Technique

By using this technique approximately 5 g of faeces was taken and mixed with 45 ml

of sugar solution and then centrifugedfor 10 minutes at 1000×g (Sheather, 1923). Now the

suspension was taken and put on a slide and was examined under microscope (Olympia

electrical light microscope from Japan) of magnification400X for the presence of unstained

oocysts of T. gondii having a size of 10-12µm.

2.6 DNA extraction from blood

Product: GeneAll ExgeneTM Blood SV, 250 preps), Cat No: 105-152. Lot No:

10516811007mini. 2015 GeneAll Biotechnology, co, itcl.138-859, Sangpa-gu, Seoul,

SOUTH KOREA. www.geneall.com

1. 20 ul of proteinase K solution (20 mg/ml) was put into the bottom of a 1.5 µl tube

through pipet. The protease K amount may be increased if the sample volume is larger

than 200 µl.

2. Then 200 ul of sample was transferred to the tube.

3. After that 200 µl of Buffer BL was added to the tube. For thorough mixing the tube

was vortexed. It was then incubated at 56 °C for 10 minutes. For the removal of any

drop from inside of the lid, it was spun down briefly.

4. Then 200 µl of absolute ethanol was added to the sample and was again vortexed for

thorough mixing of the sample. For the removal of any drops from inside of the lid it

was spun down.

5. The mixture was carefully transferred to the SV column and was centrifuged for 1

minute at 6,000 xg above (> 8,000 rpm). After centrifugation the collection tubes

were replaced by new one (already provided).

6. Buffer BW of 600 ul was then added and was then centrifuged for 1 minute at 6,000

xg above (> 8, 000 rpm) and then the collection tubes were replaced with new one

(already provided).

51

7. Buffer TW of 700 µl was then applied and was again centrifuged for 1 minute at

6,000 xg above (> 8,000 rpm) the pass-through was discarded and the SV column was

back inserted into the collection tube.

8. For the removal of residual wash buffer, it was centrifuged at full speed for 1 minute.

After centrifugation the SV column was placed in a fresh 1.5 ml tube. Great care was

taken at this step for the elimination of carryover of buffer TW. It was again

centrifuged for one minute at full speed for the removal of any carryover of buffer

TW. Centrifugation was carried out at room temperature.

9. About 200 µl of buffer AE or sterilized water was then added. It was then incubated

for one minute at room temperature and was centrifuged at full speed for one minute.

The elution step was repeated with fresh 200 µl elution buffer for the increase DNA

yield upto significant level.

2.7 Isolation of DNA from Stool

2.7.1 Procedure

1. 180–220 mg stool was weighed in a 2 ml micro-centrifuge tube.

2. In second step 1.4 ml Buffer ASL was added to each stool sample. After adding

Buffer ASL, the samples were Vortexed for 1 min until the sample were homogenized

thoroughly so that maximum DNA can be collected in the final eluate

3. The suspension was placed in a water bath to heat for 5 min at 70°C, so that to kill

parasites and bacteria and also to maximize the total yield of DNA 3-5 times.

4. After heating it was again vortexed for 15 seconds. When samples were vortexed, it

was then centrifuged at full speed for 1 min to pellet stool particles.

5. From the supernatant 1.2 ml was pipetted into a new 2 ml microcentrifuge tube and

the pellet was discarded. The 2 ml tubes were wide enough for accommodation of an

InhibitEX tablet.

6. Each sample was loaded with 1 InhibitEX Tablet. For the complete suspension of the

tablet it was vortexed immediately and continuously for 1 min. Suspension was

incubated for 1 min at room temperature for the adsorption of inhibitors to the

InhibitEX matrix.

7. After incubation the sample was centrifuged at full speed for 3 min to pellet

inhibitors bound to InhibitEX matrix.

8. New 1.5 ml microcentrifuge tube was taken and all the supernatant was pippeted into

that new tube and the pellet was discarded. After that the sample was centrifuged at

52

full speed for 3 min. There was no effect on procedure by the transfer of small amount

of pelleted material from step 7.

9. A new 1.5 ml microcentrifuge tube was taken and 15 µl proteinase K was pippeted

into that new 1.5 ml tube.

10. A total of 200 µl supernatant from step 8 was pippeted into the 1.5 ml microcentrifuge

tube in which already proteinase K was present

11. Then 200 µl Buffer AL was added and was vortexed for 15 s.

After being vortexed it was Incubated at 70°C for 10 min. it was again centrifuged and

drops from the inside of the tube lid were removed. This centrifugational step was

optional.

12. A 200 µl of ethanol (96–100%) was added to the lysate, and was mixed by vortexing.

It was then centrifuged briefly for the removal of drops.

13. 13.The lid of a new QIAamp spin column was labelled and was placed in a 2 ml

collection tube. Complete lysate was carefully applied from step 13 to the QIAamp

spin column without moistening the rim. The cap was closed and was centrifuged at

full speed for 1 min. The QIAamp spin column was placed in a new 2 ml collection

tube, and the tube having the filtrate was discarded. Each spin column was closed so

that to not allow aerosol formation during centrifugation.

14. The QIAamp spin column were carefully opend and 500 µl Buffer AW1 was added to

the spin column. The cap was closed and was centrifuged at full speed for 1 min. The

QIAamp spin column was placed in a new 2 ml collection tube. The collection tube

was discarded which had filtrate.

15. 15.The QIAamp spin column were carefully opened and 500 µl Buffer AW2 was

added. The cap was closed and was centrifuged at full speed for 3 min. the collection

tube containing the filtrate was discarded.

16. 16.The QIAamp spin column was placed in a new 2 ml collection tube whereas the

old collection tube having the filtrate was discarded. It was then centrifuged at full

speed for 1 min to eliminate the chance of possible Buffer AW2 carryover.

17. A new 1.5 ml microcentrifuge tube was labelled and the QIAamp spin column was

transferred into these new tubes. The QIAamp spin column were carefully opened and

200 µl Buffer AE was pipetted directly onto the QIAamp membrane. The cap was

closed and was incubated for 1 min at room temperature, then it was centrifuged at

full speed for 1 min to elute DNA. A sample of the eluted DNA was verified on 1%

gel.

53

2.8 Amplification of DNA samples

The PCR tubes for samples and controls were properly labeled. In case of

quantification experiments, tubes were also labeled for standards. The PCR reagents were

thawed and PCR reaction mixture was prepared. A generalized recipe of the PCR is given in

the following table. The volume of total reaction mixture required for the whole batch

including samples, controls and standards were calculated.

Aliquot the reaction mixture in the individual PCR reaction tubes/wells. Add the

template i.e; sample/control/ standards in the appropriate labeled tube. The volume of

template varies according to the protocol in use. A 2 µl DNA templates were added to each

tube so that 20 µl total reaction volume was produced. The Real-Time PCR machine’s

software was opened and run parameters were edited e.g, sample IDs, sample volume,

detection wavelengths and cycling conditions according to desired protocol. A generalized

cycling protocol for TaqMan assay is given below.

Table:2.1 Preparation of Real-Time PCR Reaction Mix for DNA template

Reagent Volume per Reaction

DNA template 2 µl

2x PCR Master Mix 10 µl

Forward Primer (100 µM stock) 2 µl

Reverse Primer (100 µM stock) 2 µl

DEPC H2O 4 µl

Total 20 µl

54

Table: 2.2. Reaction conditions for DNA templates

Step Temperature Duration No. of cycles

Initial Denaturation 95 degree C 5 min 1

Denaturation 95 degree C 30 sec 35

Annealing 52 degree C 30 sec 35

Extension 72 degree C 30 sec 35

Final extension 72 degree C 10 min 1

Table: 2.3 Detail of Primer

No Primer Sequence

P1

P2

TGExF

TGExtR

GAACTGCATCCGTTCATGAGTAT

GTTCCCTCCTCTTCGCGAAAC

The sample tubes/strips/plates were placed in the thermal cycler, lid was closed, and

program was run. After completion of PCR, open the analysis module of Real-Time PCR

machine’s software and analyzed the run file. The base line and outliers may be adjusted

before analysis.

2.9 Agarose gel

The PCR product was run on 2% agarose gel. A band of about 420 bp wasobserved.

2.10 Sequencing

The PCR product was sequenced by Sanger Method

2.11 Statistical analysis

The data collected was properly arranged in the form of tables and graphs and basic statistics

was applied. All the data was expressed in percentages and X2 and P values were calculated.

P value less than 0.05 was considered significant.

55

RESULTS

PART-A

PUBLISHED

56

Int. J. Biosci. 2019

International Journal of Biosciences | IJB |

ISSN: 2220-6655 (Print) 2222-5234 (Online)

http://www.innspub.net

Vol. 14, No. 2, p. 515-521, 2019

RESEARCH PAPER OPEN ACCESS

Seroprevalence of Toxoplasma gondii Infection in Domestic

Animals of District Charsadda, Khyber Pakhtunkhwa, Pakistan

Arab Hussain1,2,, Muhammad Zahid*1

1Department of Zoology, Islamia College University, Peshawar, KP, Pakistan 2Department of Zoology, Government post Graduate College Charsadda, KP, Pakistan

Key words: Toxoplasmosis, District Charsadda, Latex agglutination test, Domestic animals

http://dx.doi.org/10.12692/ijb/14.2.515-521 Article published on February 28, 2019 Abstract This study was conducted in to find out the seroprevalence of toxoplasmosis in domestic animals of District

Charsadda. Toxoplasmosis is an infection caused by a unicellular parasite Toxoplasma gondii which is

cosmopolitan in distribution among the animals including domestic animals and human beings. Very little

information is available about the infection rate of toxoplasmosis in domestic animals of District Charsadda,

Pakistan. A total of 374 blood samples were collected from cows, buffaloes, sheep and goats and were tested by

Latex agglutination test, out of which (79.7%) were found seropositive. Out of 260 females, (82.69%) were found

infected while in 114 males (78.80%) were found infective. A high prevalence of (81.65%) was detected in age

group above one year. Individual sex wise prevalence also revealed that females were more positive as compared

to males. In male buffaloes, (76.92%) were positive while in females, (75.67%) were detected positive. In male

goats (72.41%) were positive while in case of females, (84.78%) were found infective. The infection rate was

higher in female sheep (91.42%) as compared to male sheep (84.78%). In male cows (69.23%) were detected

seropositive while in females cows the infection rate was (73.77%). This increased rate of infection may be due to

free access of cat to drinking water and other food sources as well as warm and humid conditions of the area.

* Corresponding Author: Muhammad Zahid

[email protected]

515 Hussain and Zahid

http://dx.doi.org/10.12692/ijb/14.2.515-521

mailto:[email protected]

57


Introduction Toxoplasma gondii which is an intracellular

parasitedistributed worldwide (Shah et al., 2013a)

and is responsible for toxoplasmosis disease (Aldebret

et al., 2011). The discovery of cats as definitive host

for T.gondii was done in 1960 (Innes, 2010). Life

cycle of T. gondii is completed in two stages, sexual

stage startsin definitive host, which include cats and

asexual stage is completed in warm blooded animals

(Afonso, 2008). Intermediate hosts are infected by

ingesting oocysts, which change into tachyzoites

through asexual reproduction and then change into

bradyzoites. Once again the felines are infected by

eating bradyzoites-infected meat (Webster, 2007).

About (33-60%) of the human worldwide population

have been infected by this parasite (Holliman, 1997;

Shah et al., 2014), but this rate changes according to

the geographical, climatic and nutritional factors,

socio- cultural habits and routes of transmission

(Shah et al., 2013b). Prevalence rate of T. gondii

varies in different countries.

The infection rate of (28.44%) was recorded in

Mohmand Agency, Pakistan (shah et al., 2014). The

seroprevelence of T. gondii was 63% in Punjab, 48%

in Azad Kashmir and 38% in Khyber Pukhtunkhwa

(Tenter et al., 2000). Prevalence rate of (17.4%) was

found in young school children in Islamabad,

Pakistan (Sadaruddin et al., 1991). The prevalence

rate in Dera Ghazi Khan, Pakistan was detected

(29.5%) (Tasawar et al., 2011), Infection rate has

declined recently due to awareness in people by not

using under cooked meat and advancement in animal

husbandry work (Shah et al., 2017). The

seroprevalence of T. gondii in domestic animals and

meat producing animals, such as goats, and sheep,

has found the same infection all the time. In District

Mardan (Pakistan) the prevalence rate of

toxoplasmosis in goats was recorded 42.28% whereas

in sheep the infection rate was 44.13% (Shah et al.,

2013b). In Mohmand Agency, Pakistan, the

prevalence rate of toxoplasmosis in goats was

recorded 53.84% while in sheep it was 36.00% (Shah

et al., 2013a). In farmed sheep, the prevalence

inEurope is related with age, increasing from lambs

(17-

22%) to adult (65 -89%) (Halos, 2010). Viable

T.gondii have been detected in about 67% of

sheepsamples. In Southern European countries

infected meat of Sheep is the main source of infection.

Seropositivity for goats varies from 4 to 77% (Dubey,

2011). The seroprevalence of this infection in sheep in

Newzeland was reported to be 30-90% and in UK 77%

prevalence was reported in goats while 29% was

reported in sheep (De Bhur, 2008). In Mohmand Agency, Pakistan, the seroprevalence of

toxoplasmosis reported in cows was 20% whereas

16% was recorded in buffaloes (Shah et al., 2013a).

T. gondii Infections show mild symptoms or

mostlywithout symptoms (Sarkar et al., 2012).

Immunocompetent individuals in acute infection are

generally asymptomatic or show some common

specific symptoms (Selseleh, 2012), often give flu-like

symptoms in the early acute stage (Menotti et al.,

2003). While in immunos up pressed patients

T.gondii causes encephalitis and leading illness

(jonesand Roberts, 2013) and infect brain, heart

which results in myocarditis, and infection of liver,

pancreas, bone marrow, bladder and lymph nodes,

kidneys, spleen, and skin (Arnold et al., 1997).

The placental barrier is very strong against the parasite

during the first three months of pregnancy, but

transmission rate increases as pregnancy proceeds which

results in abortions (Dunn, 1999). Congenital

toxoplasmosis also causes deafness, mental retardation,

micro cephalous, eye lesions, cataract, retinal necrosis

(Delair, 2011). Abortion or still birth are common during

first three months of pregnancy while Infection acquired

in later pregnancy the newborn is usually without

symptoms but may cause eye problems (shah et al.,

2014) Congenital toxoplasmosis leads to CNS damage,

blindness epilepsy and mental growth is retarded with

fetal death or spontaneous abortion in about 10% of

cases [23]. T. gondii causes abortions, stillbirth and

neonatal death in sheep and goats (Engeland et al.,

1998).

The distribution of T. gondii is related with weather

condition of an area and environment where the

oocysts survive (Dubey, 2004).


58


Prevalence of toxoplasmosis varies in different parts

of the world and this variation related to life style,

age, climatic conditions, nutritional habits and other

socio-cultural factors (shah et al., 2014). This study

was carried out in the study area with the aim to

determine the infection rate in domestic animals,

minimize the economic loss in domestic animals and

to aware the people about the adverse effects of

toxoplasmosis.

Materials and methods A total of 374 blood samples were collected from

domestic animals (cows, goats, sheep and buffaloes)

from District Charsadda, Pakistan. About five ml of

blood was collected from each animal. The samples

were centrifuged for extraction of serum.

Serological examination The latex regent is a suspension of polystyrene

particle which is sensitized with the antigens of

T.gondii. The distant agglutination pattern

whenobserved after mixing the serum reflects

formation of antigen-antibody complexes. When the

organism has no infection, then no agglutination is

observed. A greater than 4 IU/ml value was

considered as standard for positive result.

Test procedure According to the manufacturer standard protocol

(Toxocell Latex- Spain) the test procedure was

performed. The samples were diluted in NaCl 0.9%

saline solution. One drop or 50ul of diluted sera was

mixed with one drop (25ul) of chemical and mixed

well by sterile wood stick, then the slide was slowly

rotated for 5 minutes and visible agglutination was

observed. The result was classified into positive or

negative on a slide, using pip stirrers provided. A

negative reaction was the indication of the absence of

toxoplasma antibodies. A clear positive reaction

showed the presence of toxoplasma antibodies equal

or greater than 4 IU/ml which showed either an

evolving infection or a past infection.

Statistical analysis For simplification all the results were expressed in

percentages. The values between different sex and age

groups were recorded and relevantly expressed in

percentages. Microsoft Excel (version-10) was utilized

by windows-08, (Release 16.0 standard version).

Results A total of 374 blood samples were collected from

domestic animals of three Tehsils (Shabqadar, Tangi

and Charsadda) of District Charsadda and were tested

for the presence of T. gondii infection by using Latex

Agglutination Test. Out of these 374 blood samples,

298 (79.7%) were found positive for toxoplasmosis. A

total of 100 blood samples were collected from cows

in which 72 (72%) were found positive and 28 (28%)

were negative, out of 121 goats, 99 (81.8%) were

positive and 22 (18.2%) were negative. Similarly, 103

samples were collected from Sheep, out of which 89

(86.4%) were positive and 14(13.6%) were found

negative whereas out of 50 samples from buffalo,

38(76%) were found positive and 12(24%) were

detected negative (Table 1).

Table 1. Comparative seroprevalence ofT.

gondiiinfection in domestic animals.

Animals Samples Positive N Negative (N) (%) N (%) Cows 100 72 (72) 28 (28) Goats 121 99 (81.8) 22 (18.2) Sheep 103 89 (86.4) 14 (13.6) Buffaloes 50 38 (76) 12 (24)

Total 374 298 76

A total of 260 females and 114 males were tested for

T.gondii infection. Out of which 215 (82.69%) females

83(78.80%) males were found positive. This also

indicated that prevalence among the females was high

among these animals. Prevalence of toxoplasmosis was

also detected in different sex groups. The highest

prevalence of toxoplasmosis was found in females as

compared to males. Out of 13 male buffaloes, 10

(76.92%) were positive while out of 37 females, 28

(75.67%) were found positive. In goats out of 29 males,

21 (72.41%) were found infective whereas out of 92

females, 78 (84.78%) were positive. Out of 33 male sheep

25 (84.78%) were found seropositive and out of 70

female sheep (91.42%) were found infective. Out of 39

male cows, 27 (69.23%) were detected infective whereas

out of 61 females, 45 (73.77%) were found seropositive

(Table 2).


59


Table 2. Sex wise seroprevalence of toxoplasmosis among goats, sheep, cows and buffaloes.

Animals Samples Male Positive N (%) Female Positive N (%)

Buffaloes 50 13 10 (76.92) 37 28 (75.67)

Goats 121 29 21 (72.41) 92 78 (84.78)

Sheep 103 33 25 (84.78) 70 64 (91.42)

Cows 100 39 27 (69.23) 61 45 (73.77)

Total 374 114 87 260 215

Seroprevalence of toxoplasmosis was also detected in

different age groups. A total of 178 (81.7%) of age above

one year and 120 (76.9%) under one year were detected

seropositive. Seroprevalence of toxoplasmosis was higher

in age group above one year (Table 3).

Table 3. Age wise seroprevalence of

toxoplasmosisamong domestic animals.

Age Sample (N) Positive (%) Negative (%) > One year 218 178 (81.7) 40 (18.3) <One year 156 120 (76.9) 36 (23.1)

Total 374 298 76

Discussion Toxoplasmosis is a zoonotic disease arising from close

contact of human with felids (kravetz and federman,

2002). Domestic cats play a vital role in the spread of

toxoplasmosis because they are the definitive hosts

and play an important role in transmission of

T.gondii infection by shedding oocysts in their

faeces(Dubey, 1994).

It varies between, herds, countries and regions,

methods of diagnoses and even at different times in

the same herd. In our study, infection rate for

T.gondii in cattle, goats and sheep was extremely

high(79.7%) than 32.29% in domestic animals in

Mohmand Agency in Pakistan ((shah et al., 2013a)),

9.2% reported from Guangxi and 46.4% from

Xinjiang, China (Lv and Cui, 1994).

In present study 81.81% prevalence rate of T. gondii

was found in goats, which is higher than 51% in goat’s

population recorded in Saudi Arabia (Sanad and Al-

ghabban, 2007), in Brazil 28.9% (Bisson et al., 2000),

Thiland 27.9% (Jittapalapong et al., 2005), 25.4% in

Pakistan (Ramzan et al., 2009). Toxoplasmosis was

also detected in sheep population of Charsadda. The

present study, revealed that in sheep toxoplasmosis is

very high (86.40%) than reported from Brazil 46.2%

(Silva et al., 2013) and

Greece 48.6% (tzanidakis et al., 2012), 31% reported

in Turkey (oncel and Vural, 2006) and Northeastern

China 4.4% (Yang et al., 2013), 44.13% from Mardan.

Toxoplasma infection in cattle shows a high degree of

variation across the globe, ranging virtually from 0%

to 99% (Ivana et al., 2006). Seropositivity rate

recorded for T. gondii in the present study in cows is

extremely high (66%) as compared to 9% in Indonesia

(Matsuo and Husin, 1996), while seroprevalence for

T. gondii in Mohmand Agency, Pakistan was

found20% in cows and 16% in buffaloes (shah et al.,

2013a), which is lower than reported in the present

study but seroprevalence in present study (66%) is

lower than (76.3%) in cattle in Serbia (Ivana et al.,

2006).

The differences in prevalence reported by all these

studies could be accounted on host, age, breed, sex,

environmental conditions, farm size and number of

cats and management practices (Van Der et al.,

2000). During the present study, a high prevalence of

82.7% was reported in females as compared to males

(78%), indicating high prevalence among the females

as compared to 35.8% in female and 21.1% in male

sheep and goats (Ramzan et al., 2009; Van Der et al.,

2000). Different studies indicated that females are

more easily infected by protozoan parasites as

compared to males (Alexander and Stinson, 1998).

In female immunity can be broken due to various

factors e.g., nutrition, age, pregnancy and

environmental factors. Toxoplasmosis and age

relationship in the present study revealed that

seroprevalence is high in age group above one year

(81.65%) as compared to age group less than one year

(76.92%) which are in support with 77.7% in age

group of 60 to 75 months and lowest prevalence

39.3% in age group of 12 to 27 months (Jittapalapong

et al., 2005).


60

Int. J. Biosci.

Older goats were more seropositive as compared to

younger ones under one year old (Olivier et al., 2007).

The present work was an attempt to find out the

prevalence rate of toxoplasmosis in the study area.

The high prevalence rate of toxoplasmosis in the

study area may be due to warm and humid climatic

conditions of this area. The increased infection rate in

study area may also be due to unhygienic conditions

because T. gondii prevalence ranged from 0-100% in

different areas of the world and this variation is due

to the life styles of the inhabitant’s customs,

traditions, weather conditions, age of the animals and

husbandry practices (Olivier et al., 2007).

Acknowledgements We are thankful to the people who allowed us to

their animals for blood collection.

References Afonso E. 2008. Spatial distribution of

soilcontamination by T. gondii in relation tocat

defaecation behaviour in an urban area. International

Journal of Parasitology 38, 1017-1023. https://doi.

org/10.1016/j.ijpara. 2008.01.004.

Aldebret D, Hypolite M, Cavaillaes P, Touque

B, Flori P, Loeuillet C, Cesbron-Delauw MF. 2011. Development of High-Throughput methods to quantify cysts of T. gondii. Cytometry Part A 79(11), 952-958. https://doi.org/10.1002/cyto.a.21138.

Alexander J, Stinson WH. 1988. Sex hormones and the course of parasitic infection. Parasitology Today 4, 189-193. https://doi.org/10.1016/0169-4758(88)9

Arnold SJ, Kinney MC, Mccormick MS,

Dummer S, Scott MA. 1997.

Disseminatedtoxoplasmosis. Unusual presentations

in the immunocompromised host. Archives of

Pathology and Laboratory Medicine 12(8), 869-873.

Bisson A, Maley S, Rubaire-Akiiki CM,

Watling JM. 2000. The seroprevalence ofantibodies

to T. gondii in domestic goats in Uganda. Acta Tropica 76, 33-38.

2019

De Bhur K. 2008. T. gondii seroprevalence–

currentresults in German swine herds. Archive Für

Lebensmittelhygiene 59, 5-8.

Delair E. 2011. Clinical manifestations of ocular toxoplasmosis. Ocular Immunology and

Inflammation 19, 91-102.

Dubey JP. 1994. Toxoplasmosis. J.

AmericanVeterinary Medical Association 205, 1593-

1598.

Dubey JP. 2004. Toxoplasmosis–a

waterbornezoonosis. Veterinary Parasitology, 126,

57-72. https://doi.org/10.1016/j.vetpar.2004.09.005.

Dubey JP. 2011. High prevalence and genotypes

ofToxoplasma gondii isolated from goats, from a

retail meat store, destined for human consumption in

the USA. Internatinal Journal for Parasitology 41,

827-833. https ://doi.org/10.1016/j.

ijpara.2011.03.006.

Dunn D. 1999. Mother-to-child transmission of toxoplasmosis risk estimates for clinical counselling. Lancet 353, 1829-1833. https://doi.org/10.1016/S01.

Engeland IV, Waldeland H, Andresen O,

Løken T, Björkman C, Bjerkås I. 1998. Foetalloss

in dairy goats: an epidemiological study in 22 herds.

Small Ruminant Research 30, 37-48.

https://doi.org/10.1016/S0921-4488(98)00084-4.

Halos L. 2010. An innovative survey underlining

thesignificant level of contamination by T. gondii of

ovine meat consumed in France. International

Journal for Parasitology 40, 193-200. https://doi.

org/10.1016/j.ijpara.2009.06.009.

Holliman RE. 1997. Toxoplasmosis, behaviour

andpersonality. Journal of Infection 35, 105-110.

https://doi.org/10.1016/S0163-4453(97)91380-3.

Innes EA. 2010. A brief history and overview

ofT.gondii. Zoonoses and Public health 57, 1-7.

https://doi.org/10.1111/j.1863-2378.2009.01276.x


https://doi/

https://doi/

61


Ivana L, Olgica DD, Sofija KK, Aleksandra N. 2006. Cross sectional survey of T. gondii infection in

cattle, sheep and pigs in Serbia: seroprevalence and

risk factors. Veternary Parasitology 135, 121-131.

Jittapalapong S, Sangvaranond A,

Pinyopanuwat N, Chimnoi W, Khachaeram W, Koizumi S, Maruyama S. 2005. Seroprevalence of

T.gondii infection in domestic goats in Satun Province,

Thailand. Veternary Parasitology 127, 17-22.

Jones JL, Roberts JM. 2013.

Toxoplasmosishospitalizations in the United States.

2008, and Trends, 1993-2008. Clinical Infectious

Disease 54(7), e58-e61.

Khan SN, Khan S, Ayaz S, Jan AH, Jehangir S,

Attaullah S, Ali J, Shams S. 2011. Seroprevalance and risk factors of toxoplasmosis

among pregnant women in district Kohat, Khyber

Pakhtunkhwa Pakistan. World Applied Science

Journal 14(7),1032-1036.

Kravetz JD, Federman DG. 2002. Cat-

associatedzoonoses. Archives of international

Medicine 162, 1945-1952.

DOI: 10.1056/NEJMcpc059027.

Lilenbaum W. 2013.

Immunohistochemicalidentification of T. gondii in

tissues from Modified Agglutination Test positivesheep. Veterinary

Parasitology 191, 347-52.

Lv YC, Cui JZ. 1994. Survey of T. gondii infection

inpigs and cattle in Guangxi Province, China. Journal

of Animal Science and Veterinary Medicine 3, 26.

Matsuo K, Husin DA. 1996. Survey of T.

gondiiantibodies in goats and cattle in Lampung

Province, Indonesia.Southeast Asian. Journal of

Tropical Medicine and Public Health 27, 554-5.

Menotti, Gustavo Vilela, Stephane Romand,

Yves Jean-Francois Garin, Lionel Ades, Eliane

Gluckman, Francis Derouin, Patricia Ribaud. 2003. Comparison of PCR-Enzyme-linked

immunosorbent Assay and Real-Time PCR Assay for

diagnosis of an unusual case of cerebral

Toxoplasmosis in stem cell transplant recipient.

Journal of Clinical Microbiology 41, 5313-5316.

Olivier A, Herbert B, Sava B, Pierre C, John

DC, Aline DK. 2007. Surveillance and monitoring

ofToxoplasma in humans, food and animals: a

scientific opinion of the panel on biological hazards.

The European Food Safety Association Journal 583,

1-64.

Oncel, Vural T. 2006. Occurance of T.

gondiiantibodies in sheep in Istanbul, Turkey.

Veteninarski Arthiv 76, 547-557.

Ramzan M, Akhtar M, Muhammad F, Hussain I,

Hiszczyńska- Sawicka E, Haq AU, Mahmood MS,

Hafeez MA. 2009. Seroprevalence of T. gondii insheep

and goats in Rahim Yar Khan (Punjab), Pakistan.

Tropical.Animal Health and Production 41, 1225-9.

Sadaruddin A, Agha F, Anwar F, Ghafoor A. 1991. Seroepidemiology of T. gondii infection in

young school children in Islamabad. Journal of

Pakistan Medical Association 41, 131-134.

Sanad MM, Al-ghabban AJ. 2007.

Serologicalsurvey on toxoplasmosis among

slaughtered sheep and goats in Tabouk, Saudi Arabia.

Journal of Egyptian Society of Parasitology 37, 329-

340.

Sarkar MD, Anuradha B, Sharma N, Roy RN. 2012. Seropositivity of toxoplasmosis in antenatal

women with bad obstetric history in a tertiary-care

hospital of Andhra Pradesh, Indian Journal of Health

Population and Nutrition 30, 87-92.

Selseleh M, Modarressi MH, Ali MM, Shojaee S,

Eshragian MR, Selseleh M, Aziz E, Keshavarz H. 2012. Real-Time RT-PCR on SAG1 and BAG1 gene

expression during stage conversion in

immunosuppressed mice infected with T. gondii, Tehran.

Strain. Korean. Journal of Parasitology 3, 199-205.

https://dx.doi.org/10.3347%2Fkjp.2012.50.3.199.

Shah M, Zahid M, Asmat P, Sthanadar AA. 2013b. Seroprevalence of T. gondii in goats and sheep of district Mardan, Pakistan. International Journal of Bioscience 3, 90-97. http://dx.doi.org/10.12692/ ijb/3.7.90-97.


http://dx.doi.org/10.12692/

62


Shah M, Zahid M, Bibi B, Hussain A, Haroon

M, Ali B. 2017. Chromatographic

immunoassaybased detection of of human

toxoplasmosis in District Mardan, Khyber

Pakhtunkhawa, Pakistan. Pure and Applied Biology

6,1297-1305.

Shah M, Zahid M, Sthanadar AA, Ali PA.

2014.Seroprevalence of Toxoplasma gondii Infection

in Human Population of Mohmand Agency Khyber

Pakhtunkhwa, Pakistan. Pakistan Journal of Zoology

44, 1169-1172.

Shah M, Zahid M, Sthanadar AA, Pir A,

Kausar A, Jan AH. 2013a. Seroprevalence of

T.gondii infection in domestic animals of Mohmand

agency, Pakistan. Journal of Coastal Life Medicine 1,

70-73. DOI: 10.12980/JCLM.1.2013C254.

Silva AF, Oliveira FC, Leite JS, Mello MF,

Brandão FZ, Leite RI, Frazao-Teixeira E,

Tasawar Z, Nawaz S, Lashari MH, Aziz F,

Hayat CS. 2011. Seroprevalence of human Toxoplasmosis in Dera Ghazi Khan, Punjab. Gomal

Journal of Medical Sciences 9, 82-85.

Tenter AM, Heckeroth AR, Weiss LM. 2000.

T.gondii: from animals to humans. International

Journal of Parasitology 30, 1217-1258.

https://doi.org/10.1016/S0020-7519(00)00124-7.


Teshale S, Dumètre A, Dardé ML, Merga B,

Dorchies P. 2007. Serological survey of

caprinetoxoplasmosis in Ethiopia: prevalence and

risk factors. Parasite 14, 155-159.

https://doi.org/10.1051/ parasite/2007142155.

Tzanidakis N, Maksimov P, Conraths FJ,

Kiossis E, Brozos C, Sotiraki S, Schares G. 2012. T. gondii in sheep and goats: seroprevalence

and potential risk factors under dairy husbandry

practices. Veterinary Parasitology 190, 340-348.

https://doi.org/10.1016/j.vetpar.2012.07.020.

Van Der Puije Wna, Bosompem KM, Canacoo

EA, Wastling, Zakanmoribd JM. 2000.

Theprevalence of anti-T. gondii antibodies in

Ghanaiansheep and goats. Acta Tropica 76, 21-26.

https://doi.org/10.1016/S0001-706X(00)00084-X.

Webster JP. 2007. The effect of T. gondii on

animalbehavior: Playing cat and mouse.

Schizophrenia bulletin 33(3), 752-756.

Yang N, Li H, He J, Mu M, Yang S.

2013.Seroprevalence of T. gondii infection in

domestic sheep in Liaoning Province, northeastern

China. Journal of Parasitology 99, 174-5.

https://doi.org/10.1016/S0020-7519(00)00124-7

https://doi.org/10.1051/

63

RESULTS

PART-B

UNPUBLISHED

64

CHAPTER 3

RESULTS

3.1 Overall seroprevalence of Toxoplasmosis in Livestock of Peshawar Valley.

Antibodies against T. gondii were detected in all 2880 blood samples collected from

livestock in Peshawar valley. Out of these 43.6% (1255) animals were found seropositive and

56.6% (1625) were negative for T. gondii antibodies.

Table 3.1 Overall seroprevalence of Toxoplasma gondii in Livestock of Peshawar Valley.

Samples Positive N (%) Negative N (%)

2880 1255(43.6) 1625(56.4)

Fig: 3.1 Overall seroprevalence of T. gondii in Livestock of Peshawar Valley.

2880

1255

1625

0

500

1000

1500

2000

2500

3000

3500

samples Positive Negative

Series1

65

3.2 Overall District wise seroprevalence of Toxoplasmosis in livestock of

Peshawar Valley.

Samples were collected from livestock from different districts of Peshawar valley. A total

of 734 blood samples were collected from district Charsadda, out of which 344 were found

positive and 390 were negative for toxoplasmosis. From Peshawar 615 blood samples were

collected in which 266 were positive and 349 were negative while in district Mardan out 511

samples 236 were positive and 275 were seronegative. From district Nowshera 500 blood

samples were collected from livestock out of which 236 samples were positive and 275 were

negative while from district Swabi a total of 520 blood samples 221 were positive and 299 were

negative

Table 3.2 Overall District wise seroprevalence of T. gondii in Livestock of Peshawar Valley.

Tehsil Samples Positive N (%) Negative N (%)

Charsadda 734 344(46.9)

390(53.1)

Peshawar 615 266(43.3)

349(56.7)

Mardan 511 236(46.2)

275(53.8)

Nowshera 500 188(37.6)

312(62.4)

Swabi 520 221(42.5)

299(57.5)

Total 2880 1255(43.6)

1625(56.4)

P = 0.00

66

Fig. 3.2 Overall district wise seroprevalence of T. gondii in Livestock of Peshawar Valley.

3.3 Percentage distribution of sample animals.

A total of 2880 blood samples were collected from different animals which includes, 717

(24.9%) cows, 831 (28.9%) goats, 793 (27.5%) sheep and 539 (18.7%) buffalos (Table 3.2).

Table 3.3 Percentage distribution of tested animals

Animals Sample size(N) %age

Cow

717 24.9

Goat

831 28.9

Sheep

793 27.5

Buffaloes 539 18.7

Total 2880 100%

734

615

511 500 520

344

266236

188221

390349

275312 299

0

100

200

300

400

500

600

700

800

Charsadda Peshawar Mardan Nowshehra Sawabi

Samples Positive Negative

67

Fig. 3.3 Percentage distribution of tested animals

3.4 Comparative seroprevalence of T. gondii in Livestock of Peshawar Valley.

A total of 717blood samples collected from cows in which 361(50.3%) were found

positive and 356 (49.7%) were negative, 831 from goats in which 384 (46.2%) were positive and

447(53.8%) were negative. Similarly, 793 samples were collected from Sheep out of which 389

(49.1%) were positive and 404 (50.9%) were negative and 539 samples from buffalo in which

121 (22.4%) positive and 418(56.4%) were negative (Table 3.4).

Table. 3.4 Comparative seroprevalence of T. gondii in Livestock of Peshawar Valley.

Animals Samples (N) Positive (%) Negative (%)

Cow 717 361(50.3) 356(49.7)

Goat 831 384(46.2) 447(53.8)

Sheep 793 389(49.1) 404(50.9)

Buffaloes 539 121(22.4) 418(77.6)

Total 2880 1255(43.6) 1625(56.4)

P = 0.00

Cow25%

Goat29%

Sheep27%

Buffaloe19%

68

Fig. 3.4 Comparative seroprevalence of T. gondii in Livestock of Peshawar Valley

3.5 Seroprevalence of T. gondii in Livestock of Charsadda.

Seroprevalence of T. gondii in domestic animals of Tehsil Charsadda is high. Out of 734

animals 351(47.8) were found positive and 383(52.2%) were negative. Among cows out of 186

cows 104 were found positive while out of 210 goats 108(51.4%) were detected positive. Sheep

and buffaloes showed high prevalence rate 53.8% and 25.7% respectively.

Table. 3.5 Seroprevalence of T. gondii in livestock of district Charsadda

Animal Sample Size (N) Positive (%) Negative%

Cow 186 104(55.9) 82(44.1)

Goat 210 108(51.4) 102(48.6)

Sheep 186 100(53.8) 86(46.2)

Buffaloes 152 39(25.7) 113(74.3)

Total 734 351(47.8) 383(52.2)

361384 389

121

356

447

404418

0

50

100

150

200

250

300

350

400

450

500

Cow Goat Sheep Bufaloe

Positive Negative

69

Fig. 3.5 Seroprevalence of T. gondii in livestock of district Charsadda

3.6 Seroprevalence of T. gondii in Livestock of district Peshawar.

A total of 615 samples were collected from district Peshawar, out of these 285(46.3%)

were positive and 330(53.7%) were negative. Among cows out of 160 cows 100(62.5%) were

positive and 60(37.5%) were negative while out of 204 goats 78(38.2%) were positive and

126(61.8%) were negative. Among 139 sheep 84(60.4%) were found positive and 55(39.6%)

were negative while out of 112 buffaloes 23(20.5%) were positive and 89(79.5%) were negative

for T. gondii antibodies.

Table. 3.6 Seroprevalence of T. gondii in Livestock of district Peshawar.

Animal Sample Size (N) Positive (%) Negative (%)

Cow

160 100(62.5) 60(37.5)

Goat

204 78(38.2) 126(61.8)

Sheep

139 84(60.4) 55(39.6)

Buffaloes 112 23(20.5) 89(79.5)

Total 615 285(46.3) 330(53.7)

186

210

186

152

104 108100

39

82

10286

113

0

50

100

150

200

250

Cow Goat Sheep Buffaloes

Sample Size (N) Positive (%) Negative%

70

Fig. 3.6 Seroprevalence of T. gondii Livestock of district Peshawar.

3.7 Seroprevalence of T. gondii in Livestock of district Mardan.

From district Mardan 511 blood samples were collected from different domestic animals,

out of these 210(41.8%) were positive and 301(58.9%) were negative. Out of 132 cow samples

60(45.5%) were positive and 72(54.5%) were negative while out of 126 goats 66(52.4%) were

positive and 60(47.6%) samples were negative. The seroprevalence among 167 sheep was

detected as 64(38.3%) positive and 103(61.7%) negative while among 86 buffaloes 20(23.3%)

were positive and 66(76.7%) were negative.

Table 3.7 Seroprevalence of T. gondii in Livestock of district Mardan.


Cow 132 60(45.5) 72(54.5)

Goat 126 66(52.4) 60(47.6)

Sheep 167 64(38.3) 103(61.7)

Buffaloes 86 20(23.3) 66(76.7)

Total 511 210(41.1) 301(58.9)

100

7884

23

60

126

55

89

0

20

40

60

80

100

120

140

cow goat sheep buffaloe

positive negative

71

Fig. 3.7 Seroprevalence of T. gondii in Livestock of district Mardan.

3.8 Seroprevalence of T. gondii in domestic animals of district Nowshera

A total of 500 blood samples were collected from district Nowshera in which out of 120

cows 45 (37.5%) were positive and 75 (62.5%) were negative while in Goats out of 140 samples

59 (42.1%) were seropositive and 81 (57.9%) were negative. In sheep out of 145 samples 65

(44.8%) were infected and 80 (55.2%) were negative. Similarly, out of 95 buffaloes 19 (20%)

were seropositive and 76 (80%) were negative for toxoplasmosis.

Table. 3.8 Seroprevalence of T. gondii in Livestock of district Nowshera


Cow 120 45(37.5) 75(62.5)

Goat 140 59(42.1) 81(57.9)

Sheep 145 65(44.8) 80(55.2)

Buffaloes 95 19(20) 76(80)

Total 500 188(37.6) 312(62.4)

6066 64

20

72

60

103

66

0

20

40

60

80

100

120


positive negative

72

Fig. 3.8 Seroprevalence of T. gondii in Livestock of District Nowshera

3.9 Seroprevalence of T. gondii in Livestock of District Swabi.

Samples were collected from district Sawabi and tested for toxoplasmosis. 119 blood

samples of cows were tested in which 52(43.7%) were positive and 67(56.3%) were negative, in

Goats 72(47.7%) samples out of 151 were seropositive and 79(52.3%) were negative while in

sheep and buffaloes out of 156 and 94 blood samples 77(49.4%) and 20(21.3%) were found

positive respectively.

Table. 3.9 Seroprevalence of T. gondii in Livestock of district Swabi.


Cow 119 52(43.7) 67(56.3)

Goat 151 72(47.7) 79(52.3)

Sheep 156 77(49.4) 79(50.4)

Buffaloes 94 20(21.3) 74(78.8)

Total 520 221(42.5) 299(57.5)

45

5965

19

7581 80

76

0

10

20

30

40

50

60

70

80

90

Cow Goat Sheep Buffaloe

Positive Negative

73

Fig 3.9 Seroprevalence of T. gondii in Livestock of district Swabi.

3.10 Overall sex-wise seroprevalence of T. gondii in Livestock of Peshawar Valley

Sex wise seroprevalence for T. gondii antibodies was also detected in Livestock of

Peshawar Valley. Out of 2880 blood samples 1058 males 375(35.4%) and in females 880(48.3%)

out of 1822 samples were found positive. Among 717 cows 261 males 106(44.6%) and out of

456 females 254(55.7%) were positive while among 831 goats, out of 282 males 99(35.1%) and

out of 549 females 287(52.3%) were found positive. The seroprevalence in 793 samples of sheep

was 39.2% out of 344 males and 56.3% out of 449 females while among 549 buffaloes out 171

males 35(20.4%) and 86(23.4%) out of 368 females were positive.

Table. 3.10 Overall sex-wise seroprevalence of T. gondii in Livestock of Peshawar Valley.

Animal Type Gender Sample Size (N) Positive (%) Negative(%

Cow Male

Female

261

456

106(40.6)

254(55.7)

155(59.4)

202(44.3)

Goat

Male

Female

282

549

99(35.1)

287(52.3)

183(64.9)

262(47.7)

Sheep Male

Female

344

449

135(39.2)

253(56.3)

209(60.8)

196(43.6)

Buffaloe Male

Female

171

368

35(20.4%)

86(23.4%)

136(79.6%)

282(76.6%)

P= 0.00

52

7277

20

67

79 7974

0

20

40

60

80

100


Positive Negative

74

Fig. 3.10 Prevalence of T. gondii in Male Livestock of Peshawar Valley

Fig. 3.11 Prevalence of T. gondii in female Livestock of Peshawar Valley

3.11 Sex-wise seroprevalence of T. gondii in Livestock of district Charsadda.

In district Charsadda a total of 734 blood samples were tested for Toxoplasma gondii

antibodies. Among 186 cows out of 63 males 31(49.2%) and out of 123 females 73(59.3%) were

positive while in 210 goats out of 71 males 26(36.6%) and in 139 females 82(59%) were

seropositive. Among 186 sheep out of 84 males 32(38.1%) and out of 102 females 68(66.7%)

were positive. In 152 samples of buffaloes out of 44 males 9(20.5%) and out of 108 females

30(27.8%) were positive.

106 99

135

35

155

183

209

136

0

50

100

150

200

250


Positive Negative

254

287

253

86

202

262

196

282

0

50

100

150

200

250

300

350


Positive Negative

75

Table 3.11 Sex-wise seroprevalence of T. gondii in Livestock of district Charsadda

Type of

animal

Total

Sampes

Gender Samples No. Positive (%) Negative (%)

Cow 186 Male

Female

63

123

31(49.2)

73(59.3)

32(50.8)

50(40.7)

Goat 210 Male

Female

71

139

26(36.6)

82(59)

45(63.4)

57(41)

Sheep 186 Male

Female

84

102

32(38.1)

68(66.7)

52(61.9)

34(33.3)

Buffaloes 152 Male

Female

44

108

9(20.5)

30(27.8)

35(79.5)

78(72.2)

Total 734 Male

Female

262

472

98(37.4)

253(53.6)

164(62.6)

219(46.4)

Fig. 3.12 Prevalence in male livestock of district Charsadda

31

26

32

9

32

45

52

35

0

10

20

30

40

50

60


positive negative

76

Fig. 3.13 Prevalence in female Livestock of district Charsadda

3.12 Sex-wise seroprevalence of T. gondii in Livestock of district Peshawar

Antibodies against toxoplasmosis were also detected in livestock of district Peshawar.

Among 160 cows, out of 53 males 21(39.6%) and out of 107 females 79(73.8%) were found

positive while among 204 goats out of 70 males 18(25.7%) and out of 134 females 60(44.8%)

were found positive. In 1139 sheep out of 61 males 36(59%) and out of 78 females 48(61.5%)

were seropositive and in 112 buffaloes out of 39 males 9(23.1%) and out of 73 females

14(19.2%) were detected positive.

73

82

68

30

50

57

34

78

0

10

20

30

40

50

60

70

80

90


positive negative

77

Table.3.12 Sex-wise seroprevalence of T. gondii in Livestock of district Peshawar

Type of

Animal

Total

samples Gender

No. of

Samples Positive (%) Negative (%)

Cow 160 Male

Female

53

107

21(39.6)

79(73.8)

32(60.4)

28(26.2)

Goat 204 Male

Female

70

134

18(25.7)

60(44.8)

52(74.3)

74(55.2)

Sheep 139 Male

Female

61

78

36(59)

48(61.5)

25(41)

30(38.5)

Buffaloes 112 Male

Female

39

73

9(23.1)

14(19.2)

30(76.9)

59(80.2)

Total 615 Male

Female

223

392

84(37.7)

201(51.3)

139(62.3)

191(48.7)

Fig. 3.14 Prevalence in male livestock of district Peshawar

2118

36

9

32

52

25

30

0

10

20

30

40

50

60


animal negative

78

Fig 3.15 Prevalence in female livestock of district Peshawar

3.13 Sex-wise seroprevalence of T. gondii in Livestock of district Mardan

A total of 511 blood samples were collected from domestic animals. Among 132 cow

samples out of 56 males 25(44.6%) and out of 76 females 35(46%) were detected positive while

among 126 goats out of 31 males 11(35.5%) and in 95 females 56(58.9%) samples were positive.

In sheep and buffaloes 167 and 86 blood samples were tested for Toxoplasmosis respectively.

Out of 78 male sheep 26(33.3%) and out of 89 female sheep 46(51.7%) were seropositive while

among buffaloes out of 24 males 6(25%) and out of 66 females 14(22.6%) were detected

positive.

79

60

48

14

28

74

30

59

0

10

20

30

40

50

60

70

80

90


animal negative

79

Table 3.13 Sex-wise seroprevalence of T. gondii in Livestock of district Mardan

Type of

Animal

Total

Samples

Gender No. of samples Positive (%) Negative (%)

Cow

132

Male

Female

56

76

25(44.6)

35(46.1)

31(55.4)

41(53.9)

Goat

126

Male

Female

31

95

11(35.5)

56(58.9)

20(64.5)

39(41.1)

Sheep 167 Male

Female

78

89

26(33.3)

46(51.7)

52(66.7)

43(48.3)

Buffaloes 86 Male

Female

24

62

6(25)

14(22.6)

18(75)

48(77.4)

Fig. 3.16 Prevalence in male livestock of district Mardan

25

11

26

6

31

20

52

18

0

10

20

30

40

50

60


positive negative

80

Fig. 3.17 Prevalence in female livestock of district Mardan

3.14 Sex-wise seroprevalence of T. gondii in livestock of district Nowshera

Antibodies against toxoplasmosis were also detected in Livestock of district Nowshehra.

Among 120 cows, out of 49 males 15(30.6%) and out of 71 females 29(40.8%) were found

positive while among 140 goats out of 50 males 18(35.5%) and out of 90 females 43(47.8%)

were found positive. In 145 sheep out of 59 males 23(39%) and out of 86 females 41(47.7%)

were seropositive and in 95 buffaloes out of 34 males 6(17.6%) and out of 61 females 14(23%)

were detected positive.

35

56

4648

4139

43

48

0

10

20

30

40

50

60


positive negative

81

Table 3.14 Sex-wise seroprevalence of T. gondii in livestock of district Nowshera

Type of

animal

Total

Samples

Gender Total samples Positive (%) Negative (%)

Cow 120 Male

Female

49

71

15(30.6)

29(40.8)

34(69.4)

42(59.2)

Goat 140 Male

Female

50

90

18(35.5)

43(47.8)

32(64.5)

47(52.2)

Sheep 145 Male

Female

59

86

23(39)

41(47.7)

36(61)

45(52.3)

Buffaloes 95 Male

Female

34

61

6(17.6)

14(23)

28(82.4)

47(77)

Total 500 Male

Female

192

308

62(32.3)

127(41.2)

130(67.7)

181(58.8)

Fig. 3.18 Prevalence in male livestock of district Nowshera

15

18

23

6

34

32

36

28

0

5

10

15

20

25

30

35

40


Positive Negative

82

Fig. 3.19 Prevalence in female livestock of district Nowshera

3.15 Sex-wise seroprevalence of T. gondii in livestock of District Swabi

A total of 520 blood samples were collected from domestic animals. Among 119 cow

samples out of 40 males 14(35%) and out of 79 females 38(48.1%) were detected positive while

among 151 goats out of 60 males 26(43.3%) and in91 females 46(50.5%) samples were positive.

In sheep and buffaloes 156 and 94 blood samples were tested for Toxoplasmosis respectively.

Out of 63 male sheep 27(42.9%) and out of 93 female sheep 50(53.8%) were seropositive while

among buffaloes out of 28 males 5(17.9%) and out of 66 females 15(22.7%) were detected

positive.

29

4341

14

42

4745

47

0

5

10

15

20

25

30

35

40

45

50


Positive Negative

83

Table 3.15 Sex-wise seroprevalence of T. gondii in livestock of district Swabi

Type of

animal

Total

Samples Gender

No. of

samples Positive (%) Negative (%)

Cow 119 Male

Female

40

79

14(35)

38(48.1)

26(65)

41(51.9)

Goat 151 Male

Female

60

91

26(43.3)

46(50.5)

34(56.7)

45(49.5)

Sheep 156 Male

Female

63

93

27(42.9)

50(53.8)

36(57.1)

43(46.2)

Buffaloes 94 Male

Female

28

66

5(17.9)

15(22.7)

23(82.1)

51(77.3)

Total 520 Male

Female

191

329

72(37.7)

149(45.3)

119(62.3)

180(54.7)

Fig.3.20 Prevalence in male livestock of district Swabi

14

26 27

5

26

3436

23

0

5

10

15

20

25

30

35

40


Positive Negative

84

Fig.3.21 Prevalence in female livestock of district Swabi

3.16 Age-wise Seroprevalence of T. gondii in Cows of district Charsadda, Peshawar

and Mardan.

Age wise seroprevalence was also detected in cows of different age groups in three

District Peshawar Valley. In age group up to one year out of 48 samples 18(37.5%) and in age

group 1-2 years out of 68 samples 36(53%) were found positive while in age group 2-3 years in

118 samples 62(52.5%) and in age group 3-4 years out of 100 cow samples 80(80%) while in age

group 4-5 years out of 86 samples 44(51.2%)and in age group >5 years out of 58 24(41.4%)

were found positive. Highest prevalence 80% was detected in age group 2-3 years.

38

46

50

15

41

4543

51

0

10

20

30

40

50

60


Positive Negative

85

Table. 3.16 Age-wise Seroprevalence of T. gondii in Cows of district Charsadda, Peshawar

and Mardan.

Age group Sample

Size Positive %age Negative %age

Up to 1 year 48 18 37.5 30 62.5

1-2 years 68 36 53 32 47

2 to 3 years 118 62 52.5 56 47.5

3 to 4 years 100 80 80 20 20

4 to 5 years 86 44 51.2 42 48.8

Above 5 years 58 24 41.4 34 58.6

Total 478 264 55.2 214 44.8

Fig. 3.22 Age-wise prevalence of T. gondii in Cows of Charsadda, Peshawar and Mardan.

18

36

62

80

44

24

30 32

56

20

42

34

0

10

20

30

40

50

60

70

80

90

lees than oneyear

1-2 years 2-3 years 3-4 years 4-5 years Above 5 years

positive negative

86

3.17 Age-wise Seroprevalence of T. gondii in Goats of District Charsadda, Peshawar

and Mardan

Age wise seroprevalence was also detected goats in different age groups in above three

districts. In age group up to one year out of 118 samples 30(36.4%) and in age group 1-2 years

out of 130 samples 40(30.8%) were found positive while in age group 2-3 years in 152 samples

94(61.2%) and in age group >3 years out of 140 cow samples 76(80%) were found positive.

Highest prevalence 80% was detected in age group >3 years.

Table 3.17 Age-wise Seroprevalence of T. gondii in Goats of district Charsadda, Peshawar

and Mardan

Age ofAnimal Sample Size Positive %age Negative %age

Up to 1 year 118 43 36.4 75 63.6

1 to 2 years 130 40 30.8 90 69.2

2 to 3 years 152 94 61.8 58 38.2

>3 years 140 76 54.3 64 45.7

Total 540 253 46.9 287 53.1

Fig. 3.23 Age-wise prevalence of T. gondii in Goats of Charsadda, Peshawar and Mardan

4340

94

7675

90

5864

0

10

20

30

40

50

60

70

80

90

100

lees than one year 1-2 years 2-3 years > 3 years

positive negative

87

3.18 Age-wise prevalence of T. gondii in Sheep of Charsadda, Peshawar and Mardan

T. gondii antibodies were also detected in 492 blood samples collected from various age

groups of Sheep. In age group up to one year out of 104 samples 46(44.2%) and in age group 1-2

years out of 136 samples 65(47.8%) were found positive. Among140 samples of age group 2-3

years 71(50.7%) and in age group >3 years out of 112 samples 65(58%) were seropositive. The

highest seroprevalence rate for T. gondii (58%) was found among sheep of age group >3 years

Table 3.18 Age-wise prevalence of T. gondii in Sheep of Charsadda, Peshawar and Mardan

Age ofAnimal Sample Size Positive %age Negative %age

Up to 1 year 104 46 44.2% 58 55.8

1 to 2 years 136 65 47.8% 71 52.2

2 to 3 years 140 71 50.7% 69 49.3

> 3years 112 65 58.% 47 42

Total 492 247 50.2% 245 49.8

Fig. 3.24 Age-wise Seroprevalence of T. gondii in Sheep of district Charsadda, Peshawar

and Mardan

46

65

71

65

58

71 69

47

0

10

20

30

40

50

60

70

80

lees than one year 1-2 years 2-3 years >3 years

positive negative

88

3.19 Age-wise Seroprevalence of T. gondii in buffaloes of District Charsadda,

Peshawar and Mardan


groups of buffaloes. In age group up to one year out of 62 samples 12(19.4%) and in age group

1-2 years out of 72 samples 17(23.6%) were found positive. Among86 samples of age group 2-3

years 20(23.3%) and in age group 3-4 years out of 70 samples 16(22.9%) were seropositive.

Similarly, in age group >4 years out of 60 samples 17(28.3%) were found positive T. gondii

antibodies. The highest seroprevalence rate for T. gondii (28.3%) was found among buffaloes of

age group >4 years.

Table 3.19 Age-wise Seroprevalence of T. gondii in buffaloes of district Charsadda,

Peshawar and Mardan

Age of Animal Sample Size Positive %age Negative %age

Up to 1 year 62 12 19.4 50 80.6

1 to 2 years 72 17 23.6 55 76.4

2 to 3 years 86 20 23.3 66 76.7

3 to 4 years 70 16 22.9 54 77.1

Above 4 years 60 17 28.3 43 71.7

Total 350 82 23.4 268 76.6

Fig 3.25 Age-wise Seroprevalence of T. gondii in buffaloes of district Charsadda, Peshawar

and Mardan

1217 20

16 17

5055

66

54

43

0

10

20

30

40

50

60

70

lees than oneyear

1-2 years 2-3 years 3-4 years >4 years

positive negative

89

3.20 Agewise prevalence of T. gondii in cows of district Nowshera and Swabi

Age wise seroprevalence was also detected in cows of different age groups in District

Nowshera and Sawabi. In age group up to one year out of 24 samples 5(20.8%) and in age group

1-2 years out of 33 samples 11(33.3%) were found positive while in age group 2-3 years in 60

samples 26(43.3%) and in age group 3-4 years out of 50 cow samples 29(58%) while in age

group 4-5 years out of 43 samples 18(41.9%)and in age group >5 years out of 29 8(27.6%) were

found positive. Highest prevalence 58% was detected in age group 3-4years.

Table 3.20 Agewise prevalence of T. gondii in cows of district Nowshera and Swabi

Age group Sample Size positive %age Negative %age

Up to 1 year 24 5 20.8 19 79.2

1-2 years 33 11 33.3 22 66.7

2 to 3 years 60 26 43.3 34 56.7

3 to 4 years 50 29 58 21 42

4 to 5 years 43 18 41.9 25 58.1

Above 5 years 29 8 27.6 21 72.4

Total 239 97 40.6 142 59.4

Fig 3.26 Age-wise Seroprevalence of T. gondii in Cows of district Nowshera and Swabi

5

11

26

29

18

8

19

22

34

21

25

21

0

5

10

15

20

25

30

35

40

<1 year 1-2 years 2-3 years 3-4 years 4-5 years > 5 years

positive negative

90

3.21 Age-wise Seroprevalence of T. gondii in Goats of District Nowshera and Swabi

Age wise seroprevalence was also detected goats in different age groups in above two

districts. In age group up to one year out of 64 samples 20(31.2%) and in age group 1-2 years out

of 70 samples 21(30%) were found positive while in age group 2-3 years in 81 samples

50(61.7%) and in age group >3 years out of 76 cow samples 40(52.6%) were found positive.

Highest prevalence 61.7% was detected in age group 2-3 years.

Table 3.21 Age-wise Seroprevalence of T. gondii in Goats of District Nowshera and Swabi


Up to 1 year 64 20 31.2 44 68.8

1 to 2 years 70 21 30 49 70

2 to 3 years 81 50 61.7 31 38.3

>3 years 76 40 52.6 36 47.4

Total 291 131 45 160 55

Fig 3.27. Age-wise Seroprevalence of T. gondii in Goats of district Nowshera and Swabi

20 21

50

40

44

49

31

36

0

10

20

30

40

50

60

< 1 one year 1-2 years 2-3 years > 3 years

positive negative

91

3.22 Age-wise Seroprevalence of T. gondii in Sheep Nowshera and Swabi

Toxoplasma gondii antibodies were also detected in 301 blood samples collected from

various age groups of Sheep. In age group up to one year out of 64 samples 24(37.5%) and in

age group 1-2 years out of 83 samples 38(45.8%) were found positive. Among 86 samples of age

group 2-3 years 44(51.2%) and in age group >3 years out of 68 samples 36(52.9%) were

seropositive. The highest seroprevalence rate for Toxoplasma gondii (52%) was found among

sheep of age group >3 years.

Table.3.22. Age-wise Seroprevalence of T. gondii in Sheep of Nowshera and Swabi


Up to 1 year 64 24 37.5% 40 62.5

1 to 2 years 83 38 45.8 45 54.2

2 to 3 years 86 44 51.2 42 48.8

> 3 years 68 36 52.9 32 47.1

Total 301 142 47.2 159 52.8

Fig. 3.28. Age-wise Seroprevalence of T. gondii in Sheep of district Nowshera and Swabi

24

38

44

36

40

4542

32

0

5

10

15

20

25

30

35

40

45

50

< 1 one year 1-2 years 2-3 years > 3 years

positive negative

92

3.23. Age-wise Seroprevalence of T. gondii in buffaloes of District Nowshera and

Swabi


groups of buffaloes. In age group up to one year out of 35 samples 5(14.3%) and in age group 1-

2 years out of 39 samples 7(17.9%) were found positive. Among 46 samples of age group 2-3

years 10(21.7%) and in age group 3-4 years out of 37 samples 9(24.3%) were seropositive.

Similarly, in age group >4 years out of 32 samples 8(25%) were found positive for T. gondii

antibodies. The highest seroprevalence rate for T. gondii (25%) was found among buffaloes of

age group >4 years

Table.3.23. Age-wise Seroprevalence of T. gondii in buffaloes of District Nowshera and

Swabi

Age of animal Sample Size Positive %age Negative %age

up to 1 year 35 5 14.3 30 85.7

1 to 2 years 39 7 17.9 32 82.1

2 to 3 years 46 10 21.7 36 78.3

3 to 4 years 37 9 24.3 28 75.7

Above 4 years 32 8 25 24 75

Total 189 39 20.6 150 79.4

3.24 Seroprevalence of T. gondii in livestock on the bases of type of feeding.

On the bases of type of feeding out 1366 grazing animals 731(53.5%) were found

positive and 635(46.5%) were found negative while out of 1514 non grazing animals 524(34.6)

were seropositive and 990(65.4%) were seronegative. This shows a high rate of infection in

grazing animals.

93

Fig 3.29. Age-wise Seroprevalence of T. gondii in buffaloes of district Nowshera and Swabi

Table 3.24 Seroprevalence of T. gondii in livestock on the bases of type of feeding.

Type of feeding Sample Positive (%) Negative(%)

Grazing 1366 731 (53.5) 635 (46.5)

Non-Grazing 1514 524 (34.6) 990 (65.4)

Total 2880 1255 (43.6) 1625 (56.4)

P=0.00

Fig. 3.30 Seroprevalence of T. gondii in livestock on the bases of type of feeding.

57

10 9 8

3032

36

28

24

0

5

10

15

20

25

30

35

40

< 1 year 1-2 years 2-3 years 3-4 years >4 years

positive negative

1363

747

616

1517

508

1009

0

200

400

600

800

1000

1200

1400

1600

Sample Positive Negative

yes No

94

3.25 Seroprevalence of T. gondii in livestock on the bases of contact with cat.

On the bases of contact with cats out 136 animals contact with cats 747(54.8%) were

found positive and 616(45.2%) were found negative while out of 1517 non contact animals

508(33.5) were seropositive and 1009(66.5%) were seronegative. This shows a high rate of

infection in contact animals with cat.

Table 3.25 Seroprevalence of T. gondii in livestock on the bases of contact with cat.

Type of feeding Sample Positive (%) Negative (%)

Yes 1363 747 (54.8) 616 (45.2)

No 1517 508 (33.5) 1009 (66.5)

Total 2880 1255 (43.6) 1625 (56.4)

P=0.00

Fig. 3.31 Seroprevalence of T. gondii in livestock on the bases of contact with cat.

1363

747

616

1517

508

1009

0

200

400

600

800

1000

1200

1400

1600

Sample Positive Negative

yes No

95

B. Molecular Results

3.1. Molecular results

The DNA from positive samples were extracted by DNA extraction kit (GeneAll Exgene

Kit and QIAamp stool Kit). The DNA extracted was amplified by Polymerase Chain Reaction.

Forward primer of sequence GAACTGCATCCGTTCATGAGTAT and reverse primer of sequence

GTTCCCTCCTCTTCGCGAAACwas used. After amplification of DNA it was run on gel

electrophoresis (2% gel) and bands were visualized on the gel. The DNA ladder of 100 bp was

used. The amplified DNA was put in the wells and was left for 40 minutes in the gel

electrophoresis it was then placed under UV light visual observation. Those DNA samples whose

bands were of the size of 420 bp were sent to find out the sequence of the Toxo B1 gene.

1 2 3 4

Fig: 3.32 Bands showing Toxo B1 gene (size of 420 bp)

96

3.2 DNA Sequencing

Non-radioactive dideoxy chain termination sequencing was carried out to characterize

Toxo B1 gene.

3.2.1 Sequence of the Toxo B1 gene

>1st_BASE_3012426_1_Toxo_F

5TATTGTGGTTGTGGGATGAGAGACGCTATGTATTTGCATAGGTTGCAGTCACT

GACGAGCTCCCCTCTGCTGGCGAAAAGTGAAATTCATGAGTATCTGTGCAACTT

TGGTGTATTCGCAGATTGGTCGCCTGCAATCGATAGTTGACCACGAACGCTTTA

AAGAACAGGAGAAGAAGATCGTGAAAGAATACGAGAAGAGGTACACAGAGATA

GAAGTCGCTGCGGAGACAGCGAAGACTGCGGATGACTTCACTCCCGTCGCACC

AGCAGCAGAGGAGTGCCGGGCAAGAAAATGAGATGCCTAGAGGAGACACAGC

GTGTTATGAACAAATCTATTGAGGTTTCGCGAAGAGGAGGGAACAGC

AF179871.1 Toxoplasma gondii USA

KX270373.1 Toxoplasma gondii Mexico

Toxoplasma gondii Peshawar valley

AB703302.1 Toxoplasma Gondii Iran

Fig: 3.33 Phylogenetic tree of T. gondii

mailto:KX@&)373.1

97

CHAPTER 4

DISCUSSION

4.1 Epidemiology

Toxoplasmosis is a zoonotic disease arising from close contact of human with felids

(Kravetz and Federman, 2002). Toxoplasmosis in cats was reported 97.4% in Egypt (Al-

Kappany et al, 2010). That’s why domestic cats play a vital role in the spread of Toxoplasmosis

because they are the definitive hosts and play an important role in prevalence of T. gondii

through the faecal contamination of water, soil and food or by shedding oocysts in their faeces

(Dubey, 1994).

Toxoplasmosis in cattle, sheep and goats in different countries has been studied. It varies

between, herds, countriesand regions, methods of diagnoses and even at different times in the

same herd. The impact and prevalence of T. gondii on human health are highly variable

geographically. Depending on the differences in eating habits and culture, sources of infection

are different in human populations (Garcia, 2006; Gilot-Fromont, 2009). The source by which an

individual has become infected with T. gondii cannot be differentiated by diagnostic tests.

Several epidemiological studies in human shows a significant association between toxoplasmosis

and consumption of cattle meat (Baril et al., 1999). In Europe, up to 63% of human infections

are due to the consumption of undercooked or cured meat products (Cook et al., 2000). Several

studies have pinpointed uncooked meat as the most important risk factor for pregnant women.

(Baril et al., 1999; Cook et al., 2000, Kapperud, 1996). This stimulated me to conduct a survey

in livestock from Peshawar Valley to determine the seroprevalence of T. gondii infection in these

animal groups. Observation of cysts directly in tissues of live animals is not a suitable diagnostic

method and the fact that symptomatic toxoplasmosis is rare in cattle, the serological techniques

appear to be the methods of choice.

In our study the overall infection rate for T. gondii in live stock (cattle, goats and sheep)

was extremely high (43.6%) which is higher than 32.3% in domestic animals in Mohmand

Agency Pakistan (Shah et al., 2013.a), 9.2% reported from Guangxi China (Lv et al., 1994)

17% in Norway (Stormoen et al., 2012), 24% in Ethiopia (Negash et al., 2004), 25.1% and

28.9% in Brazil (Pita-Gondim et al., 1999; Cavalcante et al., 2008), 31% in Mexico (Alvarado-

Esquivel et al., 2011) and lower than 46.4% from Xinjiang, 52% in Pakistan (Tasawar et al.,

98

2011), 59.8% in Bulgaria (Prelezov et al., 2008), 66% in Czech Republic (Bartova and Sedlak,

2012), and 67.9% in Zimbabwe (Hove et al., 2005).

In present study 46.2% prevalence rate of T. gondii was found in goats of Peshawar

valley which is lower than 51% in goats population recorded in Saudi Arabia (Sanad and Al-

Ghaban, 2007) 67.9% level of infection found in Zimbabwe (Hove et al., 2005), 59.4% in Giza,

Egypt (Barakat et al., 2009), Romania 52.8 % (Iovu et al., 2012), Bangladesh 61.0 % (Rahman et

al., 2014) Pakistan 52 % (Zahida Tasawar et al., 2011), Stara Zagora Region 59.8 % (Prelezov et

al., 2008). In the present study, the seroprevalence in goats population is more than reported

from different parts of the world like in Brazil 28.9% (Bisson et al., 2000), in Satun Province,

Thailand 27.9 % (Jittapalapong et al., 2005), 25.4% in Pakistan (Ramzan et al., 2009), 35.5%

from Malaysia (Chandrawathani et al., 2008), Greece 30.7 % (Tzanidakis et al., 2012 ), Brazil

30.6 % (Neto et al., 2008), Mexico 31 % (Alvarado Esquival et al., 2011), Thailand 27.9 %

(Jittapalapong et al., 2005), Pakistan 14.32% (NisarAhmad et al., 2015) Egypt 28.7% (Ragab M.

Fereig et al., 2016), Bangladesh 32% (Shahiduzzaman et al., 2011), China 10% (HouqiangLuo et

al., 2017) China 14.1% (Guang-HuiZhao et al., 2011).

Sheep is a vital source of wool, milk and meat for humans in various countries, and

Toxoplsmosis causes abortion and great economic losses to sheep industry worldwide (Buxton et

al., 2007). Thus T. gondii play an important role in the epidemiology of toxoplasmosis through

infected meat to human especially in those parts of world where regularly goat meat and mutton

are eaten (Kijlstra and Jongert, 2008).

T. gondii was also detected in sheep population of Peshawar valley. Toxoplsmosis in

sheep is worldwide in distribution (Tenter et al., 2000). It is revealed by the present study, that in

sheep T. gondii infection is very high (49.1%) than reported from Brazil 46.2 % (Silva et al.,

2013), Greece 48.6 % (Tzanidakis et al., 2012), 31% reported in Turkey (Oncel et al., 2006) and

Northeastern China 4.4 % (Yang et al., 2013), but it is lower than 84.5% reported in sheep (Ivana

et al., 2006), 57.6% from Canada. In the present study seroprevalence of T. gondii antibodies in

sheep (49.1%) is higher than reported from other parts of Pakistan (Ramazan et al., 2009).

T. gondii infection in cattle shows a high degree of variation across the globe, ranging

virtually from 0% to 99% (Ivana et al., 2006).

Seropositivity in cows recorded for T. gondii in the present study is extremely high

(55.2%) as compared to 9% in Indonesia (Matsuo and Husin 1996), 10.5% in Vietnam (Huong et

al, 1998), 6.6%in Central Ethiopia (Bekele and Kasali, 1989), 2.3% in China (Yu et al, 2007). In

99

Montana 3.2% cattle were found seropositive for T. gondii antibodies (Dubey, 1985), in

Bangladesh, 16.1% (Samad et al., 1993) Bangladesh 27 % (Rahman et al., 2014), Iran 1.6 %

(Raeghi et al., 2011), Assam 26.66 % (Minakshi and Sarmah, 2015), Pakistan 19.75 % (Nisar

and Qayyum, 2014), While in Mohmand Agency, Pakistan seroprevalence for T. gondii was

found 20% in cows and 16% in buffalo (Shah et al., 2013) which is lower than reported in the

present study but seroprevalence in present study 55.2% is lower than 76.3% in cattle recorded in

Serbia (Ivana et al., 2006), Iran 71.3 % (Sanati et al., 2012), Brazil 83.40 % (da SilvaI et al.,

2015).

In present study seroprevalence of T. gondii in buffalo is 22.4%, which is less than

reported from southern Brazil 27.2% (Santose et al., 2013), but is Higher than reported from

Lahore Pakistan 22% (Choudhary et al., 2006) Trinidad 7.8% (Persad et al., 2011), from the

southern veitnam 3% (Huanga et al., 1998), from Bahia state Brazil 3.85% (Gondim et al.,

1999), from Punjab India 2.91% (Sharma et al., 2008), from south western china 11.14% (Zou et

al., 2015), and from Khoozestan province Iran 8.8% (Navidpoura et al., 1998).

During the present study, out of total 1058 male 375 (35.4%) were detected positive for

toxoplasmosis while out of 1822 females 880 (48.3%) were found seropositive, indicating high

prevalence among the females as compared to male and is higher than 35.8% in female and

21.1% in male sheep and goats (Ramzan et al., 2009; Van der Puije et al., 2000).

Different study indicates that females are more easily infected by protozoan parasites as

compared to males (Alexander and Stinson, 1988). Hormones play a vital role in males and

females response to parasitic infection. The immune system is directly affected by sex related

hormones (Roberts et al., 2001). It has also proved that production of antibodies can be enhanced

by estrogen (Da Silva, 1999), but in females immunity can be broken due to various factors e.g.,

nutrition, age, pregnancy and environmental factors. The high seroprevalence of Toxoplasmosis

in present study in females than males may be due to difference in hormonal activities in females

as compared to males and also because of large number of examined females as compared to

male.

Toxoplasmosis and age relationship in the present study revealed that seroprevalence is

high in age group above one year (45.8%) as compared to age group less than one year (33.3%).

Present results are in agreement with 77.7% in age group of 60 to 75 months and lowest

prevalence 39.3% in age group of 12 to 27 months (Jittapalapong et al., 2005; Ivana et al., 2006;

Sharif et al., 2006). The prevalence rate increases as the age of animal increases. Progressive

100

increase of T. gondii with age suggests regular exposure to the organism in the environment

(Sharif et al., 2010). Older goats were more seropositive as compared to younger ones under one

year old (Teshale et al., 2007). The older animals are less resistant to toxoplasmosis as compared

to younger animals because of the low immunity (Roberts et al., 2001).

In different age groups of goats and sheep, the prevalence of T. gondii infection found

different, ranging from 20-54.44 % and 13.33-66.66 %, respectively with the highest infection

rate of 54.44 % in goats and 66.66 % in sheep for the age of ≥ 2 years old. A positive correlation

between age and toxoplasmosis was observed as previously reported (Ramazan et al., 2009:

Kamani et al., 2010).

The differences in seroprevalence reported by all these studies could be accounted on the

basis of host, age, breed, sex, environmental conditions, farm size and number of cats and

management practices (Arko-Mensah et al., 2000; Van der Puije et al., 2000; Ghazaei, 2006).

The generally high prevalences in goats, sheep and other domestic animals are probably due to

overgrazing around households where there may be highest concentration of domestic cat faeces.

and also due to high humidity of the area because Toxoplasma oocysts only sporulate where

there is sufficient humidity (Dubey, 1986) and can only survive short periods of dehydration

(Frenkel, 2000).

The present work was an attempt to find out the prevalence rate of toxoplasmosis in the

study area. The high prevalence rate of toxoplasmosis in the study area may be due to warm and

humid climatic conditions of this area because toxoplasmosis is more common in those areas

where the environment is warm and humid as compared to dry and cold areas (Dubey, 2010).

The increased infection rate in study area may also be due to unhygienic conditions because T.

gondii prevalence ranged from 0-100 % in different areas of the world and this variation is due to

the life styles of the inhabitants customs, traditions, weather conditions, age of the animals and

husbandry practice (Olivier et al., 2007).

4.2 T. gondii oocysts in fecal samples of stray cats

Toxoplasma gondii infection is one of the most widespread infections in man and

animals. This may be considered first report on the prevalence of T. gondii in stray cats in

Peshawar valley and shows that 10.8% of the cats were infected in this area by T. gondii. These

results suggest that a considerable number of stray cats in Peshawar valley are infected. These

infected cats may play an important role in the transmission of T. gondii to other animals. The

climatic conditions in this area (warm and humid) appear to be suitable for the spread and

101

survival of the oocysts. A higher seroprevalence was observed in female stray than in male stray

cats.

A total of 130 cat fecal samples were collected and oocysts detected by microscopy. A

total of 14 (10.8%) were found positive for T. gondii oocysts whereas 114 (89.2%) were

observed negative for oocysts in its fecal material. There were 43 male cats in which the

prevalence rate was 03 (7%) whereas in 76 female stray cats the prevalence rate was 11 (12.6%).

There was a significant difference between the male and females. In a study carried out in

Malaysia out of total of 25 out 61 (40.98%) faecal samples were found positive for T. gondii by

modified Kato-katz and Sheather’s sugar methods. Similarly, in another study in Malaysia

toxoplasmosis in cats was found to be 14.55 (Chandarawathani et al., 2008) While a study

conducted in United States 6% of cats were shedding oocysts of T. gondii (Lily and Wortham,

2013)

In Pakistan a study conducted in Faisalabad, Pakistan revealed a higher seroprevalence of

toxoplasmosis (60%) in stray cats as compared to the present work. The present results showed a

higher prevalence rate in females which was also concluded from the study in Faisalabad in

which the prevalence rate in female cats was higher (70%) as compared to males (40% (Ahmad

et al., 2001)The prevalencerate in the present study was also lower (9.3%) than the overall

prevalence reported in other study in Pakistan in cats which was 26.43%. (Ahmad et al., 2014).

4.3. Molecular characterization of T. gondii

A total of 130 cat fecal samples were tested for oocysts of T. gondii. Only 14 samples

were found positive. DNA was extracted from the positive samples. The DNA was amplified

using the universal primers for Toxo B1 gene. Out of 14, only 4 were amplified by PCR

positively. The gene amplified was of 420 bp by size. The specified bands were purified from the

gel and were sequenced.

102

CONCLUSION

The seroprevalence of T. gondii infection in peshawar valley, Khyber Pakhtunkhwa

province of Pakistan revealed that the infection of T. gondii is very high among the livestock like

sheep, goats, cows and buffalo. Among these animals, goats and sheep showed high infection

rate of 46.2% and 49.1% as compared to cow and buffalo of 50.3% and 22.4% respectively. A

total of 1822 females and 1058 males were tested for T. gondii infection. Out of which 48.3%

females and 35.3% males were found positive. This also indicated that seroprevalence in females

was high among these animals. The infection rate was also detected in different age groups.

Among cows high prevalence 72.7% was found in age group 3-4 years while in goats high

infection rate 61.8% was detected in age group 2-3 years. Similarly, high prevalence 56% was

found in sheep in age group > 3 years and 27% in buffaloes of age group > 4 years. This study

indicated that livestock of Peshawar Valley, Pakistan are at high risk to toxoplasmosis.

Moreover, these animals are used by the people as a source of meat and milk and are also

transported to other parts of the country for the same purpose. Thus, these animals provide a

main source for the spread of infection in human population. Therefore, the government should

give due attention to this problem to minimize the spread of infection not only among the human

population but also in livestock where it causes severe damage to livestock. The infection is so

severe in this area because the people graze their animals in open places and provide drinking

water to their animals from rivers, streams, and ponds etc. which are usually contaminated with

oocysts directly or indirectly. Another reason for this high infection is the access of cats not only

to drinking water but also to other utensils used for the animals feeding. Therefore, Control and

prophylactic measures must be followed to enhance the rearing system and the implementation

of health improving programmes in a joint effort between veterinarians and sheep farmers

associations and to inform about the sources of spread of the infection and for a better

understanding of the disease.

103

RECOMMENDATIONS

In the light of the present study, the following recommendations are made:

o Proper seminars should be arranged to aware the people about toxoplasmosis.

o More anti- Toxoplasmosis drugs should be supply to the study area by the

government as soon as possible.

o Clean drinking watershould be provided to domestic animals .

o Keep cover the grasses and other food items to minimize free access of cat and its

oocysts

o Cat faeces should be disposed properly.

o Wash hands properly with soap and water after contact with domestic animals and

exposure to soil, sand and raw meat or unwashed vegetables.

o Cook meat completely to an internal temperature of 106oF.

o Cooking utensils shouldbe washed before cooking meal.

o Freeze meat for several days before cooking to reduce the chance of T. gondii

infection.

o All fruits and vegetables should be washed and/or peeled before eating them.

o Wear gloves when gardening or handling sand or soil wear gloves. Wash hands

well afterward. Keep sandboxes covered when not in use, to avoid contamination

by cats.

o Avoid drinking untreated water.

o Only immunocompetent, non-pregnant women should perform daily litter box

cleaning because infection is likely to be more severe in pregnant womenand

immunosuppressed individuals.

o Avoid keeping cats and dogs in homes to minimize the risk of infection.

o Contact with domestic animals with care is also recommended.

o Domestic animals should be kept outside the homes in separate place to reduce

the infection rate.

o The government should arrange proper education system in the study area about

Toxoplasmosis.

o The government should arrange the awareness programs through LHW (Lady

Health Workers).

104

REFERENCES

Acici, M., Babur, C., Kilic, S., Hokelek, M., & Kurt, M. (2008). Prevalence of antibodies to

Toxoplasma gondii infection in humans and domestic animals in Samsun province, Turkey.

Tropical animal health and production, 40(5), 311-315.

AFSSA. 2005. [Toxoplasmose: état des connaissances et evaluation du risque lié à

l’alimentation. agence francaise de securite sanitaire des aliments.] Available at

http://lesrapports.ladocumentationfrancaise.fr/BRP/064000311/0000.pdf

Ahlfors, K., Börjeson, M., Huldt, G., & Forsberg, E. (1989). Incidence of toxoplasmosis in

pregnant women in the city of Malmö, Sweden. Scandinavian journal of infectious

diseases, 21(3), 315-321.

Aiello, S. E., & Mays, A. (1998). The Merck Veterinary Manual, Whitehouse station, NJ, USA:

Merck & CO. Inc. and Merial Limited, 966-970.

Ajioka, J. W., Boothroyd, J. C., Brunk, B. P., Hehl, A., Hillier, L., Manger, I. D., & Waterston,

R. (1998). Gene discovery by EST sequencing in Toxoplasma gondii reveals sequences restricted

to the apicomplexa. Genome Research, 8(1), 18-28.

Ajzenberg, D., Dumètre, A., & Dardé, M. L. (2005). Multiplex PCR for typing strains of

Toxoplasma gondii. Journal of clinical microbiology, 43(4), 1940-1943.

Ajzenberg, D., Yera, H., Marty, P., Paris, L., Dalle, F., Menotti, J., ... & Pelloux, H. (2009).

Genotype of 88 Toxoplasma gondii isolates associated with toxoplasmosis in

immunocompromised patients and correlation with clinical findings. The Journal of infectious

diseases, 199(8), 1155-1167.

Aktaș, M., Babür, C., &Düzgün, A. (2000). Seroprevalence of Toxoplasma gondii in sheep in

Malatya and its vicinity. SağlıkBilimleriDergisi, FiratÜniversitesi, 14(1), 65-67.

Aldebert, D., Hypolite, M., Cavailles, P., Touquet, B., Flori, P., Loeuillet, C., &

Cesbron‐Delauw, M. F. (2011). Development of high‐throughput methods to quantify cysts of

Toxoplasma gondii. Cytometry Part A, 79(11), 952-958.

http://lesrapports.ladocumentationfrancaise.fr/BRP/064000311/0000.pdf

105

Anastasia, D., Elias, P., Nikolaos, P., Charilaos, K., & Nektarios, G. (2013). Toxoplasma gondii

and Neospora caninum seroprevalence in dairy sheep and goats mixed stock farming. Veterinary

parasitology, 198(3-4), 387-390.

Ancelle, T., Goulet, V., Tirard-Fleury, V., Baril, L., Du Mazaubrun, C., Thulliez, P. H., ... &

Carme, B. (1996). La Toxoplasmose chez la femme enceinte en France en 1995. Resultats d’une

enquete nationale perinatale. Bull Epidemiol Hebd, 51, 227-229.

Anderlini, G. A., Mota, R. A., Faria, E. B., Cavalcanti, E. F. T. S. F., Valença, R. M. B., Pinheiro

Júnior, J. W., ... & Souza Neto, O. L. D. (2011). Occurrence and risk factors associated with

infection by Toxoplasma gondii in goats in the State of Alagoas, Brazil. Revista da Sociedade

Brasileira de Medicina Tropical, 44(2), 157-162.

Aspinall, T. V., Marlee, D., Hyde, J. E., & Sims, P. F. (2002). Prevalence of Toxoplasma gondii

in commercial meat products as monitored by polymerase chain reaction–food for thought?.

International journal for parasitology, 32(9), 1193-1199.

Barbosa, P., Hines, J., Kaplan, I., Martinson, H., Szczepaniec, A., & Szendrei, Z. (2009).

Associational resistance and associational susceptibility: having right or wrong neighbors. annual

review of ecology, evolution, and systematics, 40, 1-20.

Baril, L., Ancelle, T., Goulet, V., Thulliez, P., Tirard-Fleury, V., & Carme, B. (1999). Risk

factors for Toxoplasma infection in pregnancy: a case-control study in France. Scandinavian

journal of infectious diseases, 31(3), 305-309.

Bayarri, S., Gracia, M. J., Perez-Arquillue, C., Lazaro, R., & Herrera, A. (2012). Toxoplasma

gondii in commercially available pork meat and cured ham: a contribution to risk assessment for

consumers. Journal of food Protection, 75(3), 597-600.

Bekele, T. and Kasali, O.B. (1989). Toxoplasmosis in sheep, goats and cattle in central Ethiopia.

Vet. Res.Communic., 13: 371-5.

Bénard, A., Petersen, E., Salamon, R., Chêne, G., Gilbert, R., Salmi, L. R., & European Toxo

Prevention Study Group. (2008). Survey of European programmes for the epidemiological

surveillance of congenital toxoplasmosis. Euro Surveillance, 13(15).

106

Berdoy, M., Webster, J.P. and Macdonald, D.W. (2000). Fatal attraction in rats infected with T.

gondii. Proc. Biol. Sci., 267(4): 1452-1591.

Berger-Schoch, A. E., Herrmann, D. C., Schares, G., Müller, N., Bernet, D., Gottstein, B., &

Frey, C. F. (2011). Prevalence and genotypes of Toxoplasma gondii in feline faeces (oocysts)

and meat from sheep, cattle and pigs in Switzerland. Veterinary parasitology, 177(3-4), 290-297.

Biancifiori, F., Rondini, C., Grelloni, V., & Frescura, T. (1986). Avian toxoplasmosis:

experimental infection of chicken and pigeon. Comparative Immunology, Microbiology and

Infectious Diseases, 9(4), 337-346.

Bisson, A., Maley, S., Rubaire-akiiki, C.M. and Watling, J.M. (2000). The seroprevalence of

antibodies to T. gondii in domestic goats in Uganda. Ac. Trop., 76: 33-38.

Black, M. W., & Boothroyd, J. C. (2000). Lytic cycle of Toxoplasma gondii. Microbiology and

Molecular Biology Reviews, 64(3), 607-623.

Blewett, D. A., & Trees, A. J. (1987). The epidemiology of ovine toxoplasmosis with especial

respect to control. British Veterinary Journal, 143(2), 128-135.

Bornstein, S., & Musa, B. E. (1987). Prevalence of antibodies to some viral pathogens, Brucella

abortus and Toxoplasma gondii in serum from camels (Camelus dromedarius) in Sudan. Journal

of Veterinary Medicine, Series B, 34(1‐10), 364-370.

Boughattas, S., Ben-Abdallah, R., Siala, E., Souissi, O., Aoun, K., & Bouratbine, A. (2010).

Direct genotypic characterization of Toxoplasma gondii strains associated with congenital

toxoplasmosis in Tunisia (North Africa). The American journal of tropical medicine and

hygiene, 82(6), 1041-1046.

Boughattas, S., Ben-Abdallah, R., Siala, E., Souissi, O., Aoun, K., & Bouratbine, A. (2010).

Direct genotypic characterization of Toxoplasma gondii strains associated with congenital

toxoplasmosis in Tunisia (North Africa). The American journal of tropical medicine and

hygiene, 82(6), 1041-1046.

Boyer, K. M., Holfels, E., Roizen, N., Swisher, C., Mack, D., Remington, J., ... & Toxoplasmosis

Study Group. (2005). Risk factors for Toxoplasma gondii infection in mothers of infants with

107

congenital toxoplasmosis: implications for prenatal management and screening. American

journal of obstetrics and gynecology, 192(2), 564-571.

Boyer, K.M. (2005). Risk factors for T. gondii infection in mothers of infants with congenital

toxoplasmosis: implications for prenatal management and screening. Am. J. Obstet. Gynecol.,

192: 564 –571.

Burrells, A., Bartley, P. M., Zimmer, I. A., Roy, S., Kitchener, A. C., Meredith, A., ... & Katzer,

F. (2013). Evidence of the three main clonal Toxoplasma gondii lineages from wild mammalian

carnivores in the UK. Parasitology, 140(14), 1768-1776.

Buxton, D. (1990). Ovine toxoplasmosis: a review. Journal of the Royal Society of Medicine,

83(8), 509-511.

Buxton, D. (1993). Toxoplasmosis: the first commercial vaccine. Parasitology today, 9(9), 335-

337.

Buxton, D. and Innes, E. A. (1995). A commercial vaccine for ovine toxoplasmosis.

Buxton, D., Maley, S. W., Wright, S. E., Rodger, S., Bartley, P., & Innes, E. A. (2007a).

Toxoplasma gondii and ovine toxoplasmosis: new aspects of an old story. Veterinary

parasitology, 149(1-2), 25-28.

Buxton, D., Maley, S. W., Wright, S. E., Rodger, S., Bartley, P., & Innes, E. A. (2007b). Ovine

toxoplasmosis: transmission, clinical outcome and control. Parassitologia, 49(4), 219-221.

Canfield, P. J., Hartley, W. J., & Dubey, J. P. (1990). Lesions of toxoplasmosis in Australian

marsupials. Journal of Comparative Pathology, 103(2), 159-167.

Carini, A. (1911). Infection spontanee du pigeon et du chien due au Toxoplasma cuniculi. Bull.

Soc. Pathol. Exot., 4: 518-519.

Carme, B., Bissuel, F., Ajzenberg, D., Bouyne, R., Aznar, C., Demar, M., ... & Neron, P. (2002).

Severe acquired toxoplasmosis in immunocompetent adult patients in French Guiana. Journal of

clinical microbiology, 40(11), 4037-4044.

108

Carme, B., Demar, M., Ajzenberg, D., & Dardé, M. L. (2009). Severe acquired toxoplasmosis

caused by wild cycle of Toxoplasma gondii, French Guiana. Emerging infectious diseases, 15(4),

656.

Cassamagnaghi, A., Bianchi Bazerque, A., Scelza, R., & Ferrando, H. (1952). La toxoplasmosis.

Su incorporación en la patologıa Uruguaya. Reconocimento de dos cepas en nuestras aves

domésticas. Su trasmisión y carácter infeccioso para los mamıferos. Boll. Ministerio de Agric. y

Ganaderia Montevideo, 33, 34-38.

Cenci-Goga, B. T., Rossitto, P. V., Sechi, P., McCrindle, C. M., & Cullor, J. S. (2011).

Toxoplasma in animals, food, and humans: an old parasite of new concern. Foodborne Pathogens

and Disease, 8(7), 751-762.

Chandrawathani, P., Nurulaini, R., Zanin, C., Premaalatha, B., Adnan, M., Jamnah, O., & Seah,

T. C. (2008). Research Note Seroprevalence of Toxoplasma gondii antibodies in pigs, goats,

cattle, dogs and cats in peninsular Malaysia. Trop Biomed, 25, 257-258.

Chikweto, A., Kumthekar, S., Tiwari, K., Nyack, B., Deokar, M. S., Stratton, G., ... & Dubey, J.

P. (2011). Seroprevalence of Toxoplasma gondii in pigs, sheep, goats, and cattle from Grenada

and Carriacou, West Indies. Journal of Parasitology, 97(5), 950-951.

Choi, W.Y., Nam, H.W., Youn, J.H., Kim, D.J., Kong, Y., Kang, S.Y., Cho, S.Y. 1992.

Detection of antibodies in serum and cerebrospinal fluid to Toxo¬plasma gondii by indirect latex

agglutination test and enzyme-linked immunosorbent assay. Korean J Parasitol., 30: 83-90.

Conrad, P. A., Miller, M. A., Kreuder, C., James, E. R., Mazet, J., Dabritz, H., ... & Grigg, M. E.

(2005). Transmission of Toxoplasma: clues from the study of sea otters as sentinels of

Toxoplasma gondii flow into the marine environment. International journal for

parasitology, 35(11-12), 1155-1168.

Cook, A. J. C., Holliman, R., Gilbert, R. E., Buffolano, W., Zufferey, J., Petersen, E., ... & Dunn,

D. T. (2000). Sources of toxoplasma infection in pregnant women: European multicentre case-

control studyCommentary: Congenital toxoplasmosis—further thought for food. Bmj,

321(7254), 142-147.

109

Cunningham Jr, E. T., & Margolis, T. P. (1998). Ocular manifestations of HIV infection. New

England Journal of Medicine, 339(4), 236-244.

da Silva, R. C., Langoni, H., Su, C., & da Silva, A. V. (2011). Genotypic characterization of

Toxoplasma gondii in sheep from Brazilian slaughterhouses: new atypical genotypes and the

clonal type II strain identified. Veterinary parasitology, 175(1-2), 173-177.

Dărăbuş, G., Afrenie, M., Olariu, R. T., Ilie, M. S., Balint, A., & Hotea, I. (2011).

Epidemiological remarks on Toxoplasma gondii infection in Timişoara Zoo. Ursus, 1(1), 100.

Dardé, M. L. (2004). Genetic analysis of the diversity in Toxoplasma gondii. Annali dell'Istituto

superiore di sanitÃ, 40(1), 57-63.

Daryani, A., Sharif, M., Hosseini, S. H., Karimi, S. A., & Gholami, S. (2010). Serological survey

of Toxoplasma gondii in schizophrenia patients referred to Psychiatric Hospital, Sari City,

Iran. Trop Biomed, 27(3), 476-482.

Daryani, A., Sharif, M., Hosseini, S. H., Karimi, S. A., & Gholami, S. (2010). Serological survey

of Toxoplasma gondii in schizophrenia patients referred to Psychiatric Hospital, Sari City, Iran.

Trop Biomed, 27(3), 476-482.

De Buhr, K., Ludewig, M., & FEHIHABER, K. (2008). Toxoplasma gondii-seroprevalence:

current results in German swine herds. Archiv für Lebensmittelhygiene, 59(1), 5-8.

De Oliveira, L. N., Costa Junior, L. M., De Melo, C. F., Ramos Silva, J. C., Bevilaqua, C. M. L.,

Azevedo, S. S. D., ... & Gennari, S. M. (2009). Toxoplasma gondii isolates from free-range

chickens from the northeast region of Brazil. Journal of Parasitology, 95(1), 235-237.

Delbac, F., Sänger, A., Neuhaus, E. M., Stratmann, R., Ajioka, J. W., Toursel, C., ... & Soldati,

D. (2001). Toxoplasma gondii myosins B/C: one gene, two tails, two localizations, and a role in

parasite division. The Journal of cell biology, 155(4), 613-624.

Desmonts, G. E. O. R. G. E. S., & Remington, J. S. (1980). Direct agglutination test for

diagnosis of Toxoplasma infection: method for increasing sensitivity and specificity. Journal of

clinical microbiology, 11(6), 562-568.

110

Di Carlo, P., Romano, A., Schimmenti, M. G., Mazzola, A., & Titone, L. (2008). Materno-fetal

Toxoplasma gondii infection: critical review of available diagnostic methods. Infez Med, 16(1),

28-32.

Drobeck, H. P., Manwell, E., Bernstein, B., & Dillon, E. (1953). Further studies of toxoplasmosis in

birds. American journal of hygiene, 58(3), 329-39.

Drobeck. H.P., Manwell. R.D., Bernstein. E. and Dillon, R.D. (1953). Further studies of

toxoplasmosis in birds. Americ. J. Hyg., 58: 329-339.

Dubey, J. P. (1983). Distribution of cysts and tachyczoites in calves and pregnant cows

inoculated with toxoplasma gondii oocysts. Veterinary Parasitology, 13(3), 199-211.

Dubey, J. P. (1995). Duration of immunity to shedding of Toxoplasma gondii oocysts by

cats. The Journal of parasitology, 410-415.

Dubey, J. P. (1995). Duration of immunity to shedding of Toxoplasma gondii oocysts by cats.

The Journal of parasitology, 410-415.

Dubey, J. P. (1998b). Toxoplasma gondii oocyst survival under defined temperatures. The

Journal of parasitology, 862-865.

Dubey, J. P. (2009). History of the discovery of the life cycle of Toxoplasma

gondii. International journal for parasitology, 39(8), 877-882.

Dubey, J. P. (2009). History of the discovery of the life cycle of Toxoplasma gondii.

International journal for parasitology, 39(8), 877-882.

Dubey, J. P. (2010). Toxoplasma gondii infections in chickens (Gallus domesticus): prevalence,

clinical disease, diagnosis and public health significance. Zoonoses and Public Health, 57(1), 60-

73.

Dubey, J. P., & Beattie, C. P. (1988). Toxoplasmosis of animals and man. CRC Press, Inc..

Dubey, J. P., & Jones, J. L. (2008). Toxoplasma gondii infection in humans and animals in the

United States. International journal for parasitology, 38(11), 1257-1278.

111

Dubey, J. P., & Jones, J. L. (2008). Toxoplasma gondii infection in humans and animals in the

United States. International journal for parasitology, 38(11), 1257-1278.

Dubey, J. P., Baker, D. G., Davis, S. W., Urban, J. J., & Shen, S. K. (1994). Persistence of

immunity to toxoplasmosis in pigs vaccinated with a nonpersistent strain of Toxoplasma

gondii. American journal of veterinary research, 55(7), 982-987.

Dubey, J. P., Davis, S. W., Speer, C. A., Bowman, D. D., De Lahunta, A., Granstrom, D. E., ... &

Suter, M. M. (1991). Sarcocystis neurona n. sp.(Protozoa: Apicomplexa), the etiologic agent of

equine protozoal myeloencephalitis. The Journal of parasitology, 212-218.

Dubey, J. P., Graham, D. H., Dahl, E., Hilali, M., El-Ghaysh, A., Sreekumar, C., ... & Lehmann,

T. (2003). Isolation and molecular characterization of Toxoplasma gondii from chickens and

ducks from Egypt. Veterinary parasitology, 114(2), 89-95.

Dubey, J. P., Hill, D. E., Jones, J. L., Hightower, A. W., Kirkland, E., Roberts, J. M., ... &

Sreekumar, C. (2005). Prevalence of viable Toxoplasma gondii in beef, chicken, and pork from

retail meat stores in the United States: risk assessment to consumers. Journal of

Parasitology, 91(5), 1082-1093.

Dubey, J. P., Hill, D. E., Jones, J. L., Hightower, A. W., Kirkland, E., Roberts, J. M., &

Sreekumar, C. (2005). Prevalence of viable Toxoplasma gondii in beef, chicken, and pork from

retail meat stores in the United States: risk assessment to consumers. Journal of Parasitology,

91(5), 1082-1093.

Dubey, J. P., Kotula, A. W., Sharar, A., Andrews, C. D., & Lindsay, D. S. (1990). Effect of high

temperature on infectivity of Toxoplasma gondii tissue cysts in pork. The Journal of

parasitology, 201-204.

Dubey, J. P., Lago, E. G., Gennari, S. M., Su, C., & Jones, J. L. (2012). Toxoplasmosis in

humans and animals in Brazil: high prevalence, high burden of disease, and epidemiology.

Parasitology, 139(11), 1375-1424.

Dubey, J. P., Lindsay, D. S., & Speer, C. A. (1998). Structures of Toxoplasma gondiitachyzoites,

bradyzoites, and sporozoites and biology and development of tissue cysts. Clinical microbiology

reviews, 11(2), 267-299.

112

Dubey, J. P., Lindsay, D. S., &Speer, C. A. (1998). Structures of Toxoplasma gondii tachyzoites,

bradyzoites, and sporozoites and biology and development of tissue cysts. Clinical microbiology

reviews, 11(2), 267-299.

Dubey, J. P., Miller, N. L., & Frenkel, J. K. (1970). Characterization of the new fecal form of

Toxoplasma gondii. The Journal of parasitology, 447-456.

Dubey, J. P., Ott-Joslin, J., Torgerson, R. W., Topper, M. J., & Sundberg, J. P. (1988).

Toxoplasmosis in black-faced kangaroos Macropus fuliginosus melanops. Veterinary

Parasitology, 30(2), 97-105.

Dubey, J. P., Speer, C. A., & Lindsay, D. S. (1998). Isolation of a third species of Sarcocystis in

immunodeficient mice fed feces from opossums (Didelphis virginiana) and its differentiation

from Sarcocystis falcatula and Sarcocystis neurona. The Journal of parasitology, 1158-1164.

Dubey, J. P., Sundar, N., Hill, D., Velmurugan, G. V., Bandini, L. A., Kwok, O. C. H., ... & Su,

C. (2008). High prevalence and abundant atypical genotypes of Toxoplasma gondii isolated from

lambs destined for human consumption in the USA. International journal for parasitology, 38(8-

9), 999-1006.

Dubey, J. P., Thulliez, P., & Powell, E. C. (1995). Toxoplasma gondii in Iowa sows: comparison

of antibody titers to isolation of T. gondii by bioassays in mice and cats. The Journal of

parasitology, 48-53.

Dubey, J. P., Van Why, K., Verma, S. K., Choudhary, S., Kwok, O. C. H., Khan, A., ... &

Weaver, M. (2014). Genotyping Toxoplasma gondii from wildlife in Pennsylvania and

identification of natural recombinants virulent to mice. Veterinary parasitology, 200(1-2), 74-84.

Dubey, J. P., Velmurugan, G. V., Alvarado-Esquivel, C., Alvarado-Esquivel, D., Rodríguez-

Peña, S., Martínez-García, S., ... & Su, C. (2009). Isolation of Toxoplasma gondii from animals

in Durango, Mexico. Journal of Parasitology, 95(2), 319-322.

Dubey, J.P, Kirkbride, C.A. 1989. Enzootic toxoplasmosis in sheep in North-Central United-

States. J. Parasitol., 75: 673-676.

Dubey, J.P. 2004. Toxoplasmosis – a waterborne zoonosis.Vet. Parasitol., 126:57–72.

113

Dubey, J.P. 2008. The history of T. gondii—The First 100 years. J. Euk. Microbiol., 55(6): 467–

475.

Dubey, J.P. 2009a. Toxoplasmosis of Animals andHumans. CRC Press Inc.,Boca Raton, New

York, 1-313.

Dubey, J.P. 2010. Toxoplasmosis of animals and humans, 2nd ed. CRC Press, Boca Raton, FL.

Dubey, J.P. 2011. High prevalence and genotypes of Toxoplasmagondii isolated from goats,

from a retail meat store, destined for humanconsumption in the USA. Int. J. Parasitol. 41: 827-

833.

Duncanson, P., Terry, R. S., Smith, J. E., & Hide, G. (2001). High levels of congenital

transmission of Toxoplasma gondii in a commercial sheep flock. International journal for

parasitology, 31(14), 1699-1703.

Edelhofer, R. (1994). Prevalence of antibodies againstToxoplasma gondii in pigs in Austria-an

evaluation of data from 1982 and 1992. Parasitology research, 80(8), 642-644.

Edrisian, G. H., Rezaeean, M., Ghorbani, M., Keshavarz, M., & Mohebali, M. (2008). Medical

protozoalogy. Tehran, Uni-versity of Sciences, First publication.

El Din, EA, Z. E., Elkhawad, S. E., & Kheir, H. S. M. (1985). A serological survey for

Toxoplasma antibodies in cattle, sheep, goats and camels (Camelus dromedarius) in the

Sudan. Revue d'élevage et de médecine vétérinaire des pays tropicaux, 38(3).

Elamin, E. A., Elias, S., Daugschies, A., & Rommel, M. (1992). Prevalence of Toxoplasma

gondii antibodies in pastoral camels (Camelus dromedarius) in the Butana plains, mid-Eastern

Sudan. Veterinary Parasitology, 43(3-4), 171-175.

Elamin, F. M., & Wilcox, C. J. (1992). Milk Composition of Majaheim Camels1. Journal of

dairy science, 75(11), 3155-3157.

El-Ghaysh, A. (1998). Seroprevalence of Toxoplasma gondii in Egyptian donkeys using ELISA.

Veterinary parasitology, 80(1), 71-73.

114

Elmore, S. A., Jones, J. L., Conrad, P. A., Patton, S., Lindsay, D. S., &Dubey, J. P. (2010).

Toxoplasma gondii: epidemiology, feline clinical aspects, and prevention. Trends in

parasitology, 26(4), 190-196.

Elsheikha, H. M. (2008). Congenital toxoplasmosis: priorities for further health promotion

action. Public health, 122(4), 335-353.

Ertug, S., Okyay, P., Turkmen, M., & Yuksel, H. (2005). Seroprevalence and risk factors for

toxoplasma infection among pregnant women in Aydin province, Turkey. BMC public health,

5(1), 66.

Esteban-Redondo, I., & Innes, E. A. (1997). Toxoplasma gondii infection in sheep and cattle.

Comparative immunology, microbiology and infectious diseases, 20(2), 191-196.

European Food Safety Authority (EFSA). (2007). Surveillance and monitoring of Toxoplasma in

humans, food and animals‐Scientific Opinion of the Panel on Biological Hazards. EFSA Journal,

5(12), 583.

Evering, T., & Weiss, L. M. (2006). The immunology of parasite infections in

immunocompromised hosts. Parasite immunology, 28(11), 549-565.

Fekkar, A., Ajzenberg, D., Bodaghi, B., Touafek, F., Le Hoang, P., Delmas, J., ... & Paris, L.

(2011). Direct genotyping of Toxoplasma gondii in ocular fluid samples from 20 patients with

ocular toxoplasmosis: predominance of type II in France. Journal of clinical microbiology, 49(4),

1513-1517.

Felin, E., Jukola, E., Raulo, S., & Fredriksson‐Ahomaa, M. (2015). Meat Juice Serology and

Improved Food Chain Information as Control Tools for Pork‐Related Public Health

Hazards. Zoonoses and public health, 62(6), 456-464.

Fiedler, K., Hülsse, C., Straube, W., & Briese, V. (1999). Toxoplasmosis-antibody

seroprevalence in Mecklenburg-Western Pomerania. Zentralblatt fur Gynakologie, 121(5), 239-

243.

Flegr, J., Klose, J., Novotná, M., Berenreitterová, M., & Havlíček, J. (2009). Increased incidence

of traffic accidents in Toxoplasma-infected military drivers and protective effect RhD molecule

revealed by a large-scale prospective cohort study. BMC infectious diseases, 9(1), 72.

115

Flegr, J., Preiss, M., Klose, J., Havlı́ček, J., Vitáková, M., & Kodym, P. (2003). Decreased level

of psychobiological factor novelty seeking and lower intelligence in men latently infected with

the protozoan parasite Toxoplasma gondii Dopamine, a missing link between schizophrenia and

toxoplasmosis?. Biological psychology, 63(3), 253-268.

Foulon, W. A. L. T. E. R. (1992). Congenital toxoplasmosis: is screening desirable. scandinavian

journal of infectious diseases supplement, 11-11.

Frazão-Teixeira, E., & de Oliveira, F. C. (2011). Anti–Toxoplasma gondii antibodies in cattle

and pigs in a highly endemic area for human toxoplasmosis in Brazil. The Journal of

parasitology, 97(1), 44-47.

Frazão-Teixeira, E., Sundar, N., Dubey, J. P., Grigg, M. E., & De Oliveira, F. C. R. (2011).

Multi-locus DNA sequencing of Toxoplasma gondii isolated from Brazilian pigs identifies

genetically divergent strains. Veterinary parasitology, 175(1-2), 33-39.

Frenkel, J. K. (1973). Toxoplasma in and around us. Bioscience, 23(6), 343-352.

Frenkel, J. K., Dubey, J. P., & Miller, N. L. (1970). Toxoplasma gondii in cats: fecal stages

identified as coccidian oocysts. Science, 167(3919), 893-896

Frenkel, J. K., Hassanein, K. M., Hassanein, R. S., Brown, E., Thulliez, P., & Quintero-Nunez,

R. (1995). Transmission of Toxoplasma gondii in Panama City, Panama: a five-year prospective

cohort study of children, cats, rodents, birds, and soil. The American journal of tropical medicine

and hygiene, 53(5), 458-468.

Fusco, G., Rinaldi, L., Guarino, A., Proroga, Y. T. R., Pesce, A., & Cringoli, G. (2007).

Toxoplasma gondii in sheep from the Campania region (Italy). Veterinary parasitology, 149(3-

4), 271-274.

Gajria, B., Bahl, A., Brestelli, J., Dommer, J., Fischer, S., Gao, X., ... & Pinney, D. F. (2007).

ToxoDB: an integrated Toxoplasma gondii database resource. Nucleic acids

research, 36(suppl_1), D553-D556.

Gangneux, F.R. and darde, M.L. 2012. Epidemiology of and diagnostic strategies for

toxoplasmosis. Clin. Microbiol. Rev., 25: 264-296.

116

Garcia, J. L., Gennari, S. M., Navarro, I. T., Machado, R. Z., Headley, S. A., Vidotto, O., ... &

Igarashi, M. (2008). Evaluation of IFA, MAT, ELISAs and immunoblotting for the detection of

anti-Toxoplasma gondii antibodies in paired serum and aqueous humour samples from

experimentally infected pigs. Research in veterinary science, 84(2), 237-242.

Gebremedhin, E. Z., Abebe, A. H., Tessema, T. S., Tullu, K. D., Medhin, G., Vitale, M., ... &

Dorny, P. (2013). Seroepidemiology of Toxoplasma gondii infection in women of child-bearing

age in central Ethiopia. BMC Infectious Diseases, 13(1), 101.

Ghazy, A. A., Shaapan, R. M., & Abdel-Rahman, E. H. (2007). Comparative serological

diagnosis of toxoplasmosis in horses using locally isolated Toxoplasma gondii. Veterinary


Ghoneim, N. H., Shalaby, S. I., Hassanain, N. A., Zeedan, G. S., Soliman, Y. A., & Abdalhamed,

A. M. (2010). Comparative study between serological and molecular methods for diagnosis of

toxoplasmosis in women and small ruminants in Egypt. Foodborne pathogens and disease, 7(1),

17-22.

Gilot-Fromont, E., Aubert, D., Belkilani, S., Hermitte, P., Gibout, O., Geers, R., &Villena, I.

(2009). Landscape, herd management and within-herd seroprevalence of Toxoplasma gondii in

beef cattle herds from Champagne-Ardenne, France. Veterinary parasitology, 161(1), 36-40.

Glazebrook, J. S., Campbell, R. S. F., Hutchinson, G. W., & Stallman, N. D. (1978). Rodent

zoonoses in North Queensland: the occurrence and distribution of zoonotic infections in North

Queensland rodents. Australian Journal of Experimental Biology and Medical Science, 56(2),

147-156.

Gomez-Marin, J. E., Montoya-de-Londono, M. T., & Castano-Osorio, J. C. (1997). A maternal

screening program for congenital toxoplasmosis in Quindio, Colombia and application of

mathematical models to estimate incidences using age-stratified data. The American journal of

tropical medicine and hygiene, 57(2), 180-186.

Gondim, L. P., Barbosa, H. V., Ribeiro Filho, C. H. A., & Saeki, H. (1999). Serological survey

of antibodies to Toxoplasma gondii in goats, sheep, cattle and water buffaloes in Bahia State,

Brazil. Veterinary parasitology, 82(4), 273-276.

117

Goz, Y., Babur, C., Aydin, A. and Kilic, S. 2007. Seroprevalence of toxoplasmosis, brucellosis

and lestriosis in horse in hakkari, eastern region of Turkey. Revue. Med. Vet., 158(11): 534-539.

Grigg, M. E., & Boothroyd, J. C. (2001). Rapid Identification of Virulent Type I Strains of the

Protozoan Pathogen Toxoplasma gondii by PCR-Restriction Fragment Length Polymorphism

Analysis at theB1 Gene. Journal of clinical microbiology, 39(1), 398-400.

Grigg, M. E., & Suzuki, Y. (2003). Sexual recombination and clonal evolution of virulence in

Toxoplasma. Microbes and infection, 5(7), 685-690.

Grigg, M. E., Bonnefoy, S., Hehl, A. B., Suzuki, Y., & Boothroyd, J. C. (2001). Success and

virulence in Toxoplasma as the result of sexual recombination between two distinct

ancestries. Science, 294(5540), 161-165.

Grigg, M. E., Ganatra, J., Boothroyd, J. C., & Margolis, T. P. (2001). Unusual abundance of

atypical strains associated with human ocular toxoplasmosis. The Journal of infectious

diseases, 184(5), 633-639.

Gross, U., Holpert, M. and Goebel, S. (2004). Impact of stage differentiation on diagnosis of

toxoplasmosis. Ann. Ist. Sup. Sanita, 40(1): 65-70.

Guerina, N. G., Hsu, H. W., Meissner, H. C., Maguire, J. H., Lynfield, R., Stechenberg, B., ... &

Grady, G. F. (1994). Neonatal serologic screening and early treatment for congenital

Toxoplasma gondii infection. New England Journal of Medicine, 330(26), 1858-1863.

Guerrant, R. L., Walker, D. H., & Weller, P. F. (2011). Tropical Infectious Diseases: Principles,

Pathogens and Practice E-Book. Elsevier Health Sciences.

Hakko, E., Ozkan, H. A., Karaman, K., & Gulbas, Z. (2013). Analysis of cerebral toxoplasmosis

in a series of 170 allogeneic hematopoietic stem cell transplant patients. Transplant Infectious

Disease, 15(6), 575-580.

Hall, S. M. (1992). Congenital toxoplasmosis. BMJ: British Medical Journal, 305(6848), 291.

Halos, L., Thébault, A., Aubert, D., Thomas, M., Perret, C., Geers, R., ... & Durand, B. (2010).

An innovative survey underlining the significant level of contamination by Toxoplasma gondii of

ovine meat consumed in France. International journal for parasitology, 40(2), 193-200.

118

Hamidinejat, H., Ghorbanpoor, M., Hosseini, H., Alavi, S. M., Nabavi, L., Jalali, M. H. R., ... &

Mohammadaligol, S. (2010). Toxoplasma gondii infection in first-episode and inpatient

individuals with schizophrenia. International journal of infectious diseases, 14(11), e978-e981.

Hartmann, S., Tousseyn, T., Döring, C., Flüchter, P., Hackstein, H., Herreman, A., ... & Küppers,

R. (2013). Macrophages in T cell/histiocyte rich large B cell lymphoma strongly express

metal‐binding proteins and show a bi‐activated phenotype. International journal of cancer,

133(11), 2609-2618.

Hassan, S.F. 2011. Seroprevalence of toxoplasmosis among comers to marriage in Kerbala

governorate. Ker. J. Pharmaceut. Sci., 2: 97-102.

Hegab, S. M., & Al-Mutawa, S. A. (2003). Immunopathogenesis of toxoplasmosis. Clinical and

experimental medicine, 3(2), 84-105.

Hermosilla, C., Pantchev, N., Gies, N., & Taubert, A. (2010). Presumptive acute neural

toxoplasmosis in a captive red-necked wallaby (Macropus rufogriseus). Veterinary medicine

international, 2010.

Herrmann, D. C., Pantchev, N., Vrhovec, M. G., Barutzki, D., Wilking, H., Fröhlich, A., ... &

Schares, G. (2010). Atypical Toxoplasma gondii genotypes identified in oocysts shed by cats in

Germany. International journal for parasitology, 40(3), 285-292.

Hide, G., Gerwash, O., Morley, E. K., Williams, R. H., Hughes, J. M., Thomasson, D., ... &

Smith, J. E. (2007). Does vertical transmission contribute to the prevalence of

toxoplasmosis?. Parassitologia, 49(4), 223-226.

Hide, G., Morley, E. K., Hughes, J. M., Gerwash, O., Elmahaishi, M. S., Elmahaishi, K. H., ... &

Smith, J. E. (2009). Evidence for high levels of vertical transmission in Toxoplasma gondii.

Parasitology, 136(14), 1877-1885.

Hilali, M., Romand, S., Thulliez, P., Kwok, O. C. H., & Dubey, J. P. (1998). Prevalence of

Neospora caninum and Toxoplasma gondii antibodies in sera from camels from Egypt.

Veterinary parasitology, 75(2-3), 269-271.

119

Hill, D. E., Chirukandoth, S., Dubey, J. P., Lunney, J. K., & Gamble, H. R. (2006). Comparison

of detection methods for Toxoplasma gondii in naturally and experimentally infected

swine. Veterinary parasitology, 141(1-2), 9-17.

Hill, D. E., Haley, C., Wagner, B., Gamble, H. R., & Dubey, J. P. (2010). Seroprevalence of and

risk factors for Toxoplasma gondii in the US swine herd using sera collected during the National

Animal Health Monitoring Survey (Swine 2006). Zoonoses and Public Health, 57(1), 53-59.

Hill, D., &Dubey, J. P. (2002). Toxoplasma gondii: transmission, diagnosis and prevention.

Clinical microbiology and infection, 8(10), 634-640.

Hofhuis, A., Van Pelt, W., Van Duynhoven, Y. T. H. P., Nijhuis, C. D. M., Mollema, L., Van der

Klis, F. R. M., ... & Kortbeek, L. M. (2011). Decreased prevalence and age-specific risk factors

for Toxoplasma gondii IgG antibodies in The Netherlands between 1995/1996 and 2006/2007.

Epidemiology & Infection, 139(4), 530-538.

Holland, G. N. (2003). Ocular toxoplasmosis: a global reassessment:. Part I: epidemiology and

course of disease. American journal of ophthalmology, 136(6), 973-988.

Holzworth, J. 1987. Diseases of the cat: toxoplasmosis. Philadelphia WB Saunders, 369-390.

Howe, D. K., & Sibley, L. D. (1995). Toxoplasma gondii comprises three clonal lineages:

correlation of parasite genotype with human disease. Journal of infectious diseases, 172(6),

1561-1566.

Huang, C. Q., Lin, Y. Y., Dai, A. L., Li, X. H., Yang, X. Y., Yuan, Z. G., & Zhu, X. Q. (2010).

Seroprevalence of Toxoplasma gondii infection in breeding sows in Western Fujian Province,

China. Tropical animal health and production, 42(1), 115.

Hughes, J. M., Colley, D. G., Lopez, A., Dietz, V. J., Wilson, M., Navin, T. R., & Jones, J. L.

(2000). Preventing congenital toxoplasmosis. Morbidity and Mortality Weekly Report:

Recommendations and Reports, 57-75.

Hunter, C. A., & Sibley, L. D. (2012). Modulation of innate immunity by Toxoplasma gondii

virulence effectors. Nature Reviews Microbiology, 10(11), 766.

120

Huong, L., Ljungstrom, T.T., Uggla, B.L.A. and Bjorkman, C. 1998. Prevalence of antibodies to

Neospora caninum and T. gondii in cattle and water buffaloes in Southern Vietnam. Vet

Parasitol., 75: 53-7

Hutchinson, J. P., Wear, A. R., Lambton, S. L., Smith, R. P., & Pritchard, G. C. (2011). Survey

to determine the seroprevalence of Toxoplasma gondii infection in British sheep

flocks. Veterinary Record, 169(22), 582-582.

Ingram, T., & Mahler, D. L. (2013). Surface: detecting convergent evolution from comparative

data by fitting Ornstein‐Uhlenbeck models with stepwise Akaike Information Criterion. Methods

in Ecology and Evolution, 4(5), 416-425.

Ingram, W. M., Goodrich, L. M., Robey, E. A., & Eisen, M. B. (2013). Mice infected with low-

virulence strains of Toxoplasma gondii lose their innate aversion to cat urine, even after

extensive parasite clearance. PloS one, 8(9), e75246.

Innes, E. A. (1997). Toxoplasmosis: comparative species susceptibility and host immune

response. Comparative immunology, microbiology and infectious diseases, 20(2), 131-138.

Innes, E. A., Bartley, P. M., Buxton, D., & Katzer, F. (2009). Ovine toxoplasmosis. Parasitology,

136(14), 1887-1894.

Innes, E. A., Bartley, P. M., Rocchi, M., Benavidas-Silvan, J., Burrells, A., Hotchkiss, E., ... &

Katzer, F. (2011). Developing vaccines to control protozoan parasites in ruminants: dead or

alive?. Veterinary parasitology, 180(1-2), 155-163.

Ivory, C., & Chadee, K. (2004). DNA vaccines: designing strategies against parasitic infections.

Genetic Vaccines and Therapy, 2(1), 17.

Jacobs, L., Melton, M. L., & Stanley, A. M. (1962). The isolation of Toxoplasma gondii from the

ovaries and oviducts of naturally infected hens. J. Parasitol, 48(2), 38.

Jadoon, A., Akhtar, T., Maqbool, A., Anjum, A. A., & Ajmal, A. (2009). Seroprevalence of

Toxoplasma gondii in Canines. Journal of Animal & Plant Sciences, 19(4), 179-181.

121

Jeannel, D., Fretz, C., Traore, Y., Kohdjo, N., Bigot, A., Jourdan, G., ... & Stuyver, L. (1998).

Evidence for high genetic diversity and long‐term endemicity of hepatitis C virus genotypes 1

and 2 in West Africa. Journal of medical virology, 55(2), 92-97.

Johnson, C.M. 1943. Immunological and epidemiological investigation. Annual Report of the

Gorgas Memorial Laboratory, 15-16.

Jokelainen, P., Simola, O., Rantanen, E., Näreaho, A., Lohi, H., & Sukura, A. (2012). Feline

toxoplasmosis in Finland: cross-sectional epidemiological study and case series study. Journal of

veterinary diagnostic investigation, 24(6), 1115-1124.

Jones-Brando, L., Torrey, E. F., & Yolken, R. (2003). Drugs used in the treatment of

schizophrenia and bipolar disorder inhibit the replication of Toxoplasma gondii. Schizophrenia

research, 62(3), 237-244.

Jongert, E., Melkebeek, V., De Craeye, S., Dewit, J., Verhelst, D., & Cox, E. (2008). An

enhanced GRA1–GRA7 cocktail DNA vaccine primes anti-Toxoplasma immune responses in

pigs. Vaccine, 26(8), 1025-1031.

Juan-Sallés, C., Mainez, M., Marco, A., & Malabia Sanchís, A. M. (2011). Localized

toxoplasmosis in a ring-tailed lemur (Lemur catta) causing placentitis, stillbirths, and

disseminated fetal infection. Journal of Veterinary Diagnostic Investigation, 23(5), 1041-1045.

Jungersen, G., Bille-Hansen, V., Jensen, L., & Lind, P. (2001). Transplacental transmission of

Toxoplasma gondii in minipigs infected with strains of different virulence. Journal of


Juránková, J., Basso, W., Neumayerová, H., Baláž, V., Jánová, E., Sidler, X., ... & Koudela, B.

(2014). Brain is the predilection site of Toxoplasma gondii in experimentally inoculated pigs as

revealed by magnetic capture and real-time PCR. Food microbiology, 38, 167-170.

Kamani, J., Mani, A.U., Egwu, G.O. (2010). Seroprevalence of T. gondii infection in domestic

sheep and goats in Borno state, Nigeria. Tropic. Ani. He. Pro. 42(4): 793-7.

Kaňková, Š., & Flegr, J. (2007). Longer pregnancy and slower fetal development in women with

latent" asymptomatic" toxoplasmosis. BMC infectious diseases, 7(1), 114.

122

Kapperud, G., Jenum, P. A., Stray-Pedersen, B., Melby, K. K., Eskild, A., & Eng, J. (1996). Risk

factors for Toxoplasma gondii infection in pregnancy: results of a prospective case-control study

in Norway. American journal of epidemiology, 144(4), 405-412.

Katzer, F., Brülisauer, F., Collantes-Fernández, E., Bartley, P. M., Burrells, A., Gunn, G., ... &

Innes, E. A. (2011). Increased Toxoplasma gondii positivity relative to age in 125 Scottish sheep

flocks; evidence of frequent acquired infection. Veterinary research, 42(1), 121.

Khalil, K. M., Gadir, A. E. A., Rahman, M. M. A., Yassir, Mohammed, O., Ahmed, A. A.,

&Elrayah, I. E. (2007). Prevalence of Toxoplasma gondii antibodies in camels andtheirherders in

three ecologically different areas in Sudan. Journal of Camel Practice andResearch, 14(1), 11-13.

Khan, A., Fux, B., Su, C., Dubey, J. P., Dardé, M. L., Ajioka, J. W., & Sibley, L. D. (2007).

Recent transcontinental sweep of Toxoplasma gondii driven by a single monomorphic

chromosome. Proceedings of the National Academy of Sciences, 104(37), 14872-14877.

Khan, S.N., Khan, S., Ayaz, S., Jan, A.H., Jehangir, S., Attaullah, S., Ali, J. & Shams, S. 2011.

Seroprevalance and risk factors of toxoplasmosis among pregnant women in district Kohat,

Khyber Pakhtunkhwa Pakistan. World. Appli. Sci. J., 14(7):1032-1036.

Kijlstra, A., & Jongert, E. (2008). Control of the risk of human toxoplasmosis transmitted by

meat. International journal for parasitology, 38(12), 1359-1370.

Kijlstra, A., Eissen, O. A., Cornelissen, J., Munniksma, K., Eijck, I., & Kortbeek, T. (2004).

Toxoplasma gondii infection in animal-friendly pig production systems. Investigative

ophthalmology & visual science, 45(9), 3165-3169.

Klun, I., Djurković-Djaković, O., Katić-Radivojević, S., &Nikolić, A. (2006). Cross-sectional

survey on Toxoplasma gondii infection in cattle, sheep and pigs in Serbia: seroprevalenceand

risk factors. Veterinary Parasitology, 135(2), 121-131.

Kodym, P., Malý, M., Beran, O., Jilich, D., Rozsypal, H., Machala, L., & Holub, M. (2015).

Incidence, immunological and clinical characteristics of reactivation of latent Toxoplasma gondii

infection in HIV-infected patients. Epidemiology & Infection, 143(3), 600-607.

Konishi, E., Houki, Y., Harano, K., Mibawani, R. S., Marsudi, D., Alibasah, S. & Dachlan, Y.

P. 2000. JPn. J. Infect. Dis., 53: 238.

123

Kravetz, J. D., & Federman, D. G. (2005). Toxoplasmosis in pregnancy. The American journal

of medicine, 118(3), 212-216.

Lambert, H., Hitziger, N., Dellacasa, I., Svensson, M., & Barragan, A. (2006). Induction of

dendritic cell migration upon Toxoplasma gondii infection potentiates parasite

dissemination. Cellular microbiology, 8(10), 1611-1623.

Lappalainen, M., & Hedman, K. (2004). Serodiagnosis of toxoplasmosis. The impact of

measurement of IgG avidity. Ann Ist Super Sanita, 40(1), 81-8.

Lashari, M.H. & Tasawar, Z. 2010. Seroprevalence of toxoplasmosis in sheep in southern

Punjab, Pakistan. Pak. Vet. J., 30(2): 91-94.

Lehmann, T., Graham, D. H., Dahl, E., Sreekumar, C., Launer, F., Corn, J. L., ... & Dubey, J. P.

(2003). Transmission dynamics of Toxoplasma gondii on a pig farm. Infection, Genetics and

Evolution, 3(2), 135-141.

Lehmann, T., Marcet, P.L., Graham, D.H., Dahl, E.R., Dubey, J.P. 2006. Globalization and the

population structure of Toxoplasma gondii. Proc. Natl. Acad. Sci. 103: 11423–11428.

Lester, D. (2012). Toxoplasma gondii and homicide. Psychological reports, 111(1), 196-197.

Levine, B. F. (1973). Bond-charge calculation of nonlinear optical susceptibilities for various

crystal structures. Physical Review B, 7(6), 2600.

Li, X., Wang, Y., Yu, F., Li, T., & Zhang, D. (2010). An outbreak of lethal toxoplasmosis in pigs

in the Gansu province of China. Journal of veterinary diagnostic investigation, 22(3), 442-444.

Lindsay, D. S., & Dubey, J. P. (2009). Long-term survival of Toxoplasma gondii sporulated

oocysts in seawater. Journal of Parasitology, 95(4), 1019-1020.

Lindsay, D. S., Dubey, J. P., Butler, J. M., & Blagburn, B. L. (1997). Mechanical transmission of

Toxoplasma gondii oocysts by dogs. Veterinary parasitology, 73(1-2), 27-33.

Lindsay, D.S., Blagburn, B.L., Dubey, J.P. 2002. Survival of nonsporulated Toxoplasma gondii

oocysts under refrigerator conditions. Vet. Parasitol., 103: 309-313.

124

Lindström, I., Sundar, N., Lindh, J., Kironde, F., Kabasa, J. D., Kwok, O. C. H., ... & Smith, J. E.

(2008). Isolation and genotyping of Toxoplasma gondii from Ugandan chickens reveals frequent

multiple infections. Parasitology, 135(1), 39-45.

Literak, I., Sedlak, K., Juricova, Z. & Pavlasek, I. 1999. Experimental toxoplasmosis in house

sparrows.Avian. Pathol., 28: 363-368.

Luft, B. J., & Remington, J. S. (1988). Toxoplasmic encephalitis. Journal of Infectious Diseases,

157(1), 1-6.

Luft, B. J., & Remington, J. S. (1992). Toxoplasmic encephalitis in AIDS. Clinical Infectious

Diseases, 15(2), 211-222.

Malik, M. A., Dreesen, D. W., & Cruz, A. (1990). Toxoplasmosis in sheep in northeastern

United States. Journal of the American Veterinary Medical Association, 196(2), 263-265.

Manwell, R.D., Coulston, F., Binckley, E.C. & Jones, V.P.1945. Mammalian and avian

toxoplasmosis. J. Infect. Dis., 76: 1-14.

Marty P, Reynes J, Le Fichoux Y. Study of toxoplasmosis in pregnant women in Cameroon. Bull

Soc Pathol Exot Filiales. 1985;78:623–8.

Massie, G. N., Ware, M. W., Villegas, E. N., & Black, M. W. (2010). Uptake and transmission

of Toxoplasma gondii oocysts by migratory, filter-feeding fish. Veterinary parasitology, 169(3-

4), 296-303.

Massie, G. N., Ware, M. W., Villegas, E. N., & Black, M. W. (2010). Uptake and transmission

of Toxoplasma gondii oocysts by migratory, filter-feeding fish. Veterinary parasitology, 169(3-

4), 296-303.

Mateus-Pinilla, N. E., Dubey, J. P., Choromanski, L., & Weigel, R. M. (1999). A field trial of the

effectiveness of a feline Toxoplasma gondii vaccine in reducing T. gondii exposure for swine.

The Journal of parasitology, 855-860.

Matsuo k, Husin, D. A. 1996.Survey of T. gondii antibodies in goats and cattle in Lampung

Province, Indonesia.Southeast Asian. J. Trop. Med. Pub. He., 27: 554-5.

125

Mercier, A., Devillard, S., Ngoubangoye, B., Bonnabau, H., Bañuls, A. L., Durand, P., & Dardé,

M. L. (2010). Additional haplogroups of Toxoplasma gondii out of Africa: population structure

and mouse-virulence of strains from Gabon. PLoS neglected tropical diseases, 4(11), e876.

Mishima, M., Kaitna, S., & Glotzer, M. (2002). Central spindle assembly and cytokinesis require

a kinesin-like protein/RhoGAP complex with microtubule bundling activity. Developmental cell,

2(1), 41-54.

Montoya, J. G., & Remington, J. S. (2008). Management of Toxoplasma gondii infection during

pregnancy. Clinical Infectious Diseases, 47(4), 554-566.

Montoya, J. G., Huffman, H. B., & Remington, J. S. (2004). Evaluation of the immunoglobulin

G avidity test for diagnosis of toxoplasmic lymphadenopathy. Journal of clinical

microbiology, 42(10), 4627-4631.

Montoya, J.G., Liesenfeld, O. 2004. Toxoplasmosis. Lancet., 363: 1965-1976.

Morley, E. K., Williams, R. H., Hughes, J. M., Thomasson, D., Terry, R. S., Duncanson, P., ... &

Hide, G. (2008). Evidence that primary infection of Charollais sheep with Toxoplasma gondii

may not prevent foetal infection and abortion in subsequent lambings. Parasitology, 135(2), 169-

173.

Moura, F. E., de Mesquita, J. R., Portes, S. A., Ramos, E. A., & Siqueira, M. M. (2007).

Antigenic and genomic characterization of adenovirus associated to respiratory infections in

children living in Northeast Brazil. Memórias do Instituto Oswaldo Cruz, 102(8), 937-941.

Muhie, Y., & Keskes, S. (2014). Toxoplasmosis: emerging and re-emerging zoonosis. Afr. J.

App. Microbiol. Res, 3(1), 1-11.

Munday, B. L., Obendorf, D. L., Handlinger, J. H., & Mason, R. W. (1987). Diagnosis of

congenital toxoplasmosis in ovine foetuses. Australian veterinary journal, 64(9), 292-292.

Nash, J. Q., Chissel, S., Jones, J., Warburton, F., &Verlander, N. Q. (2005). Risk factors for

toxoplasmosis in pregnant women in Kent, United Kingdom. Epidemiology &Infection,133(3),

475-483.

126

Nicolle, M. M. C, and L. Manceaux. 1909. Sur un protozoaire nouveau du gondi (Toxoplasma

ng). Arch. Inst. Pasteur Tunis, 2, 97-103.

Nielsen, B., Ekeroth, L., Bager, F., & Lind, P. (1998). Use of muscle fluid as a source of

antibodies for serologic detection of Salmonella infection in slaughter pig herds. Journal of

Veterinary Diagnostic Investigation, 10(2), 158-163.

Nieuwhof, G. J., & Bishop, S. C. (2005). Costs of the major endemic diseases of sheep in Great

Britain and the potential benefits of reduction in disease impact. Animal Science, 81(1), 23-29.

Nissapatorn, V., & Abdullah, K. A. (2004). Review on human toxoplasmosis in Malaysia: the

past, present and prospective future. Southeast Asian journal of tropical medicine and public

health, 35, 24-30.

O'Connell, J. F., Hawkes, K., & Jones, N. B. (1988). Hadza hunting, butchering, and bone

transport and their archaeological implications. Journal of Anthropological research, 44(2), 113-

161.

Ogawa, L., Navarro, I.T., Freire, R.L., Oliveira, R.C., Vidotto, O., 2003. Ocorrência de

anticorpos anti-Toxoplasma gondii em ovinos da região de Londrina no Estado do Paraná.

Semina: Ci. Agr. 24, 57–62.

Onadeko, M. O., Joynson, D. H., & Payne, R. A. (1992). The prevalence of Toxoplasma

infection among pregnant women in Ibadan, Nigeria. The Journal of tropical medicine and

hygiene, 95(2), 143-145.

Opsteegh, M., Langelaar, M., Sprong, H., Den Hartog, L., De Craeye, S., Bokken, G., ... & Van

Der Giessen, J. (2010). Direct detection and genotyping of Toxoplasma gondii in meat samples

using magnetic capture and PCR. International journal of food microbiology, 139(3), 193-201.

Opsteegh, M., Teunis, P., Mensink, M., Züchner, L., Titilincu, A., Langelaar, M., & van der

Giessen, J. (2010). Evaluation of ELISA test characteristics and estimation of Toxoplasma

gondii seroprevalence in Dutch sheep using mixture models. Preventive veterinary

medicine, 96(3-4), 232-240.

Ortiz-Alegría, L. B., Caballero-Ortega, H., Cañedo-Solares, I., Rico-Torres, C. P., Sahagún-Ruiz,

A., Medina-Escutia, M. E., & Correa, D. (2010). Congenital toxoplasmosis: candidate host

127

immune genes relevant for vertical transmission and pathogenesis. Genes and immunity, 11(5),

363.

Overton, T. & Bennet, P., 2010. Toxoplasmosis in Pregnancy. Fetal and Maternal Medicine

Review, 8: 11-18.

Panadero, R., Painceira, A., López, C., Vázquez, L., Paz, A., Díaz, P., ... & Díez-Baños, P.

(2010). Seroprevalence of Toxoplasma gondii and Neospora caninum in wild and domestic

ruminants sharing pastures in Galicia (Northwest Spain). Research in Veterinary Science, 88(1),

111-115.

Pandey, V. S., & Van Knapen, F. (1992). The seroprevalence of toxoplasmosis in sheep, goats

and pigs in Zimbabwe. Annals of Tropical Medicine & Parasitology, 86(3), 313-315.

Pappas, G., Roussos, N., & Falagas, M. E. (2009). Toxoplasmosis snapshots: global status of

Toxoplasma gondii seroprevalence and implications for pregnancy and congenital

toxoplasmosis. International journal for parasitology, 39(12), 1385-1394.

Pappas, P. W. and S. M. Wordrop. (2004). Toxoplasma gondii WWW. Google . com .

Paquet, C., Yudin, M. H., Allen, V. M., Bouchard, C., Boucher, M., Caddy, S., ... & van

Schalkwyk, J. (2013). Toxoplasmosis in pregnancy: prevention, screening, and

treatment. Journal of obstetrics and gynaecology Canada, 35(1), 78-79.

Parenti, E., Sola, S. C., Turilli, C., & Corazzola, S. (1986). Spontaneous toxoplasmosis in

canaries (Serinus canaria) and other small passerine cage birds. Avian Pathology, 15(2), 183-

197.

Pena, H. F. J., Vitaliano, S. N., Beltrame, M. A. V., Pereira, F. E. L., Gennari, S. M., & Soares,

R. M. (2013). PCR-RFLP genotyping of Toxoplasma gondii from chickens from Espirito Santo

state, Southeast region, Brazil: new genotypes and a new SAG3 marker allele. Veterinary

parasitology, 192(1-3), 111-117.

Pereira, K. S., Franco, R. M., & Leal, D. A. (2010). Transmission of toxoplasmosis (Toxoplasma

gondii) by foods. In Advances in food and nutrition research (Vol. 60, pp. 1-19). Academic

Press.

128

Petersen, E., Nielsen, H. V., Christiansen, L., & Spenter, J. (1998). Immunization with E. coli

produced recombinant T. gondii SAG1 with alum as adjuvant protect mice against lethal

infection with Toxoplasma gondii. Vaccine, 16(13), 1283-1289.

Pinckney, R. D., Lindsay, D. S., Blagburn, B. L., Boosinger, T. R., McLaughlin, S. A., & Dubey,

J. P. (1994). Evaluation of the safety and efficacy of vaccination of nursing pigs with living

tachyzoites of two strains of Toxoplasma gondii. The Journal of parasitology, 438-448.

Porto, A. M. F., Amorim, M. M. R. D., Coelho, I. C. N., & Santos, L. C. (2008). Serologic

profile of toxoplasmosis in pregnant women attended at a teaching-hospital in Recife. Revista da

Associação Médica Brasileira, 54(3), 242-248.

Ramzan, M., Akhtar, M., Muhammad, F., Hussain, I., Hiszczyńska- Sawicka, E., Haq, A.U.,

Mahmood, M.S & Hafeez, M.A. 2009. Seroprevalence of T. gondii in sheep and goats in Rahim

Yar Khan (Punjab), Pakistan. Trop.Ani. Hea. Prod., 41(7): 1225-9.

Reid, A. J., Vermont, S. J., Cotton, J. A., Harris, D., Hill-Cawthorne, G. A., Könen-Waisman, S.,

... & Sanders, M. (2012). Comparative genomics of the apicomplexan parasites Toxoplasma

gondii and Neospora caninum: Coccidia differing in host range and transmission strategy. PLoS

pathogens, 8(3), e1002567.

Remington J. S., McLeod R., Thulliez P., Desmonts G. (2006). “Toxoplasmosis,” inInfectious

Diseases of the Fetus and Newborn Infant, 6th Edn eds Remington J. S., Klein J. O., Wilson C.

B., Baker C. J., editors. (Philadelphia, PA: Elsevier Saunders; ) 947–1091 10.1016/B0-72-

160537-0/50033-5

Rickard, E., Costagliola, M., Outen, E., Cicero, M., Garcia, G., Dieguez, N., & Pendiveni, M.

(1999). Toxoplasmosis antibody prevalence in pregnancy in Buenos Aires Province,

Argentina. Clin Microbiol Infec, 5, 171-1721.

Robert-Gangneux, F., & Dardé, M. L. (2012). Epidemiology of and diagnostic strategies for

toxoplasmosis. Clinical microbiology reviews, 25(2), 264-296.

Robert-Gangneux, F., & Dardé, M. L. (2012). Epidemiology of and diagnostic strategies for

toxoplasmosis. Clinical microbiology reviews, 25(2), 264-296.

129

Robert-Gangneuxa, F. & Darde, M.L. 2012. Epidemiology of and Diagnostic Strategies for

Toxoplasmosis. Clini. Microbio. Rev., 25(02): 264-296. doi:10.1128/CMR. 05013-11.

Rodger, S. M., Maley, S. W., Wright, S. E., Mackellar, A., Wesley, F., Sales, J., & Buxton, D.

(2006). Role of endogenous transplacental transmission in toxoplasmosis in sheep. Veterinary

Record, 159(23), 768-771.

Romero, R., Nicolaides, K., Conde-Agudelo, A., Tabor, A., O'brien, J. M., Cetingoz, E., ... &

Soma-Pillay, P. (2012). Vaginal progesterone in women with an asymptomatic sonographic short

cervix in the midtrimester decreases preterm delivery and neonatal morbidity: a systematic

review and metaanalysis of individual patient data. American journal of obstetrics and

gynecology, 206(2), 124-e1.

Roos, D. S. (2005). Themes and variations in apicomplexan parasite biology. Science,

309(5731), 72-73.

Sabin, A. B., & Warren, J. (1942). Therapeutic effectiveness of certain sulfonamides on infection

by an intracellular protozoon (Toxoplasma). Proceedings of the Society for Experimental

Biology and Medicine, 51(1), 19-23.

Sadaruddin, A., Agha, F., Anwar, F. A. R. Z. A. L., & Ghafoor, A. (1991). Seroepidemiology of

Toxoplasma gondii infection in young school children in Islamabad. J Pak Med Assoc, 41(6),

131-134.

Savio, E., & Nieto, A. (1995). Ovine toxoplasmosis: seroconversion during pregnancy and lamb

birth rate in Uruguayan sheep flocks. Veterinary parasitology, 60(3-4), 241-247.

Schwartzman J. D.; Maguire J. H.Toxoplasmosis. In Tropical Infectious Diseases: Principles,

Pathogens and Practice, 3rd ed.; Guerrant R. L., Walker D. H., Weller P. F., Eds.; Elsevier:

Edinburgh, U.K., 2011; pp 722–728.

Seefeldt, S. L., Kirkbride, C. A., & Dubey, J. P. (1989). Comparison of enzyme-linked

immunosorbent assay, indirect fluorescent antibody test, and direct agglutination test for

detecting Toxoplasma gondii antibodies in naturally aborted ovine fetuses. Journal of Veterinary

Diagnostic Investigation, 1(2), 124-127.

130

Shaapan, R. M., El-Nawawi, F. A., & Tawfik, M. A. A. (2008). Sensitivity and specificity of

various serological tests for the detection of Toxoplasma gondii infection in naturally infected

sheep. Veterinary parasitology, 153(3-4), 359-362.

Shadfar, S., Shabestari, A., Zendeh, M. B., Gasemi, B., & Zamzam, S. H. (2012). Evaluation of

Toxoplasma Gondii IgG antibodies in stray and household dogs by ELISA. Global Veterinaria,

9(1), 117-22.

Shah, M., Zahid, M., Alam Sthanadar, A., & Asmat Ali, P. (2014). Seroprevalence of

Toxoplasma gondii Infection in Human Population of Mohmand Agency Khyber Pakhtunkhwa,

Pakistan. Pakistan Journal of Zoology, 46(4).

Shah, M., Zahid, M., Asmat, P., Alam, A., & Sthanadar, A. (2013b). Seroprevalence of

Toxoplasma gondii in goats and sheep of district Mardan, Pakistan. Int J Biosci, 7(7), 90-97.

Shah, M., Zahid, M., Asmat, P., Sthanadar, A.A. 2013b. Seroprevalence of T. gondii in goats and

sheep of district Mardan, Pakistan. Int. J. Biosci., 3: 90-97.

Shah, M., Zahid, M., Sthanadar, A. A., Asmat, P., Kausar, A., & Jan, A. H. (2013a).

Seroprevalence of Toxoplasma gondii infection in domestic animals of. Journal of Coastal Life

Medicine, 1(1), 70-73.

Sharif, M., Gholami, S., Ziaei, H., Daryani, A., Laktarashi, B., Ziapour, S. P., ...&Vahedi, M.

(2006). Seroprevalence of Toxoplasma gondii in Cattle, Sheep and Goats Slaughtered for Food

in Mazandaran Province, Iran, 2005. Journal of Animal and Veterinary Advances.

Shimelis, T., Tebeje, M., Tadesse, E., Tegbaru, B., & Terefe, A. (2009). Sero-prevalence of

latent Toxoplasma gondii infection among HIV-infected and HIV-uninfected people in Addis

Ababa, Ethiopia: A comparative cross-sectional study. BMC Research Notes, 2(1), 213.

Sibley, L. D., & Boothroyd, J. C. (1992). Construction of a molecular karyotype for Toxoplasma

gondii. Molecular and biochemical parasitology, 51(2), 291-300.

Sibley, L. D., & Boothroyd, J. C. (1992). Virulent strains of Toxoplasma gondii comprise a

single clonal lineage. Nature, 359(6390), 82.

131

Sibley, L. D., LeBlanc, A. J., Pfefferkorn, E. R., & Boothroyd, J. C. (1992). Generation of a

restriction fragment length polymorphism linkage map for Toxoplasma gondii. Genetics, 132(4),

1003-1015.

Sibley, L.D., Khan, A., Ajioka, J.W. & Rosenthal, B.M. 2009. Genetic diversity of T. gondii in

animals and humans. Phil. Trans. R. Soc. B., 364: 2749-2761.

Simon, A., Poulin, M. B., Rousseau, A. N., & Ogden, N. H. (2013). Fate and transport of

Toxoplasma gondii Oocysts in seasonally snow covered watersheds: A conceptual framework

from a melting snowpack to the Canadian Arctic coasts. International journal of environmental

research and public health, 10(3), 994-1005.

Singh, G., & Sehgal, R. (2010). Transfusion-transmitted parasitic infections. Asian journal of

transfusion science, 4(2), 73.

Skjerve, E., Waldeland, H., Nesbakken, T., & Kapperud, G. (1998). Risk factors for the presence

of antibodies to Toxoplasma gondii in Norwegian slaughter lambs. Preventive veterinary

medicine, 35(3), 219-227.

Smith, K. L., Wilson, M., Hightower, A. W., Kelley, P. W., Struewing, J. P., Juranek, D. D., &

McAuley, J. B. (1996). Prevalence of Toxoplasma gondii antibodies in US military recruits in

1989: comparison with data published in 1965. Clinical infectious diseases, 23(5), 1182-1183.

Spalding, S.M., Amendoeira, M.R., Klein, C.H. & Ribeiro, L.C. 2005. Serological screening

and toxoplasmosis exposure factors among pregnant women in South of Brazil. Rev. Soc. Bras.

Med. Trop., 38 (2): 173-177.

Splendore, A. (1908). il vírus mixomatoso dei conigli: nota preventiva. Rev Soc Scient S Paulo,

3, 13-5.

Sroka, J., Wójcik-Fatla, A., Szymanska, J., Dutkiewicz, J., Zajac, V., & Zwolinski, J. (2010).

The occurrence of Toxoplasma gondii infection in people and animals from rural environment of

Lublin region-estimate of potential role of water as a source of infection. Annals of Agricultural

and Environmental Medicine, 17(1), 125-132.

Stormoen, M., Tharaldsen, J., & Hopp, P. (2012). Seroprevalence of Toxoplasma gondii

infection in Norwegian dairy goats. Acta Veterinaria Scandinavica, 54(1), 75.

132

Stray-Pedersen, B. (1993). 5 Toxoplasmosis in pregnancy. Baillière's clinical obstetrics and

gynaecology, 7(1), 107-137.

Su, C., Khan, A., Zhou, P., Majumdar, D., Ajzenberg, D., Dardé, M. L., ... & Sibley, L. D.

(2012). Globally diverse Toxoplasma gondii isolates comprise six major clades originating from

a small number of distinct ancestral lineages. Proceedings of the National Academy of Sciences,

201203190.

Sundar, N., Cole, R. A., Thomas, N. J., Majumdar, D., Dubey, J. P., & Su, C. (2008). Genetic

diversity among sea otter isolates of Toxoplasma gondii. Veterinary parasitology, 151(2-4), 125-

132.

Sutterland, A. L., Fond, G., Kuin, A., Koeter, M. W. J., Lutter, R., Van Gool, T., ... & De Haan,

L. (2015). Beyond the association. Toxoplasma gondii in schizophrenia, bipolar disorder, and

addiction: systematic review and meta‐analysis. Acta Psychiatrica Scandinavica, 132(3), 161-

179.

Suzuki, L. A., Rocha, R. J., & Rossi, C. L. (2001). Evaluation of serological markers for the

immunodiagnosis of acute acquired toxoplasmosis. Journal of medical microbiology, 50(1), 62-

70.

Tasawar, Z., Aziz, F., Lashari, M. H., Shafi, S., Ahmad, M., Lal, V., & Hayat, C. S. (2012).

Seroprevalence of Human toxoplasmosis in southern Punjab, Pakistan. Pak J Life Soc Sci, 10,

48-52.

Tasawar, Z., Nawaz, S., Lashari, M. H., Aziz, F., & Hayat, S. (2011). Seroprevalence of human

Toxoplasmosis in Dera Ghazi Khan, Punjab. Gomal Journal of Medical Sciences, 9(1).

Tasawar, Z., Raza, A. A., Aziz, F., & Lashari, M. H. (2012). Prevalence of human

Toxoplasmosis in District Muzaffargarh, Punjab, Pakistan. Gomal Journal of Medical Sciences,

10(2).

Tenter, A. M. (2009). Toxoplasma gondii in animals used for human consumption. Memórias do

Instituto Oswaldo Cruz, 104(2), 364-369.

Tenter, A. M., Heckeroth, A. R., & Weiss, L. M. (2000). Toxoplasma gondii: from animals to

humans. International journal for parasitology, 30(12), 1217-1258.

133

Thiptara, A., Kongkaew, W., Bilmad, U., Bhumibhamon, T., & Anan, S. (2006). Toxoplasmosis

in piglets. Annals of the New York Academy of Sciences, 1081(1), 336-338.

Torgerson, P. R., & Mastroiacovo, P. (2013). The global burden of congenital toxoplasmosis: a

systematic review. Bulletin of the World Health Organization, 91, 501-508.

Torrey, E.F. & Yolken, R.H. 2003. T. gondii and schizophrenia. Emerg. Infect. Dis., 9(11):

1375-1380.

Uggla, A., Beskow, P., Schwan, O., Bergquist, N. R., & Waller, T. (1983). Ovine toxoplasmosis

in Sweden. Acta Veterinaria Scandinavica, 24(1), 113-119.

van der Giessen, J., Fonville, M., Bouwknegt, M., Langelaar, M., & Vollema, A. (2007).

Seroprevalence of Trichinella spiralis and Toxoplasma gondii in pigs from different housing

systems in The Netherlands. Veterinary parasitology, 148(3-4), 371-374.

Vaudaux, J. D., Muccioli, C., James, E. R., Silveira, C., Magargal, S. L., Jung, C., & Belfort Jr,

R. (2010). Identification of an atypical strain of Toxoplasma gondii as the cause of a waterborne

outbreak of toxoplasmosis in Santa Isabel do Ivai, Brazil. The Journal of infectious diseases,

202(8), 1226-1233.

Venturini, M. C., Bacigalupe, D., Venturini, L., Rambeaud, M., Basso, W., Unzaga, J. M., &

Perfumo, C. J. (2004). Seroprevalence of Toxoplasma gondii in sows from slaughterhouses and

in pigs from an indoor and an outdoor farm in Argentina. Veterinary parasitology, 124(3-4), 161-

165.

Vesco, G., Buffolano, W., La Chiusa, S., Mancuso, G., Caracappa, S., Chianca, A., ... &

Petersen, E. (2007). Toxoplasma gondii infections in sheep in Sicily, southern Italy. Veterinary


Wallace, G. D. (1971). Isolation of Toxoplasma gondii from the feces of naturally infected cats.

Journal of Infectious Diseases, 124(2), 227-228.

Wallace, G. D. (1973). The role of the cat in the natural history of Toxoplasma gondii. The

American journal of tropical medicine and hygiene, 22(3), 313-322.

134

Wallace, G.D. 1973. Intermediate and transport hosts in the natural history of Toxoplasma

gondii. Americ. J. Trop. Med. Hyg., 22: 456-464.

Wang, H., Wang, T., Luo, Q., Huo, X., Wang, L., Liu, T., ... & Yu, L. (2012). Prevalence and

genotypes of Toxoplasma gondii in pork from retail meat stores in Eastern China. International

journal of food microbiology, 157(3), 393-397.

Wang, H., Yang, H., Shivalila, C. S., Dawlaty, M. M., Cheng, A. W., Zhang, F., & Jaenisch, R.

(2013). One-step generation of mice carrying mutations in multiple genes by CRISPR/Cas-

mediated genome engineering. cell, 153(4), 910-918.

Webster, J. P. (1994). Prevalence and transmission of Toxoplasma gondii in wild brown rats,

Rattusnorvegicus. Parasitology, 108(4), 407-411.

Weigel, R. M., Dubey, J. P., Dyer, D., & Siegel, A. M. (1999). Risk factors for infection with

Toxoplasma gondii for residents and workers on swine farms in Illinois. The American journal of

tropical medicine and hygiene, 60(5), 793-798.

Weigel, R. M., Dubey, J. P., Siegel, A. M., Kitron, U. D., Mannelli, A., Mitchell, M. A., ... &

Todd, K. S. (1995). Risk factors for transmission of Toxoplasma gondii on swine farms in

Illinois. The Journal of parasitology, 736-741.

Wilder, H. C. (1952). Toxoplasma chorioretinitis in adults. AMA archives of ophthalmology,

48(2), 127-136.

Williams, R. H., Morley, E. K., Hughes, J. M., Duncanson, P., Terry, R. S., Smith, J. E., & Hide,

G. (2005). High levels of congenital transmission of Toxoplasma gondii in longitudinal and

cross-sectional studies on sheep farms provides evidence of vertical transmission in ovine hosts.


Wolf, A., Cowen, D., & Paige, B. (1939). Human toxoplasmosis: occurrence in infants as an

encephalomyelitis verification by transmission to animals. Science (Washington), 89(2306).

Work, T. M., Massey, J. G., Rideout, B. A., Gardiner, C. H., Ledig, D. B., Kwok, O. C. H., &

Dubey, J. P. (2000). Fatal toxoplasmosis in free-ranging endangered ‘Alala from Hawaii. Journal

of wildlife diseases, 36(2), 205-212.

135

Yang, H. J., Jin, K. N., Park, Y. K., Hong, S. C., Bae, J. M., Lee, S. H., ... & Nam, H. W. (2000).

Seroprevalence of toxoplasmosis in the residents of Cheju island, Korea. The Korean journal of

parasitology, 38(2), 91.

Yasodhara, P., Ramalakshmi, B. A., Lakshmi, V., & Krishna, T. P. (2004). Socioeconomic status

and prevalence of toxoplasmosis during pregnancy. Indian journal of medical microbiology,

22(4), 241.

Yohanes, T., Debalke, S., & Zemene, E. (2014). Latent Toxoplasma gondii infection and

associated risk factors among HIV-infected individuals at Arba Minch Hospital, South

Ethiopia. AIDS research and treatment, 2014.

Yu, J., Xia, Z., Liu, Q., Liu, J., Ding, J., & Zhang, W. (2007). Seroepidemiology of Neospora

caninum and Toxoplasma gondii in cattle and water buffaloes (Bubalus bubalis) in the People's

Republic of China. Veterinary Parasitology, 143(1), 79-85.

Zadik, P. M., Kudesia, G., & Siddons, A. D. (1995). Low incidence of primary infection with

toxoplasma among women in Sheffield: a seroconversion study. BJOG: An International Journal

of Obstetrics & Gynaecology, 102(8), 608-610.

Zapata, M., Reyes, L., & Holst, I. (2005). Disminución en la prevalencia de anticuerpos contra

Toxoplasma gondii en adultos del valle central de Costa Rica. Parasitología latinoamericana,

60(1-2), 32-37.

Zemene, E., Yewhalaw, D., Abera, S., Belay, T., Samuel, A., & Zeynudin, A. (2012).

Seroprevalence of Toxoplasma gondii and associated risk factors among pregnant women in

Jimma town, Southwestern Ethiopia. BMC Infectious Diseases, 12(1), 337.

Zhou, P., Chen, Z., Li, H. L., Zheng, H., He, S., Lin, R. Q., & Zhu, X. Q. (2011). Toxoplasma

gondii infection in humans in China. Parasites & vectors, 4(1), 165.

Zulpo, D. L., Headley, S. A., Biazzono, L., da Cunha, I. A. L., Igarashi, M., de Barros, L. D., ...

& Garcia, J. L. (2012). Oocyst shedding in cats vaccinated by the nasal and rectal routes with

crude rhoptry proteins of Toxoplasma gondii. Experimental parasitology, 131(2), 223-230.

136

Annexure (Author Published Articles on Toxoplasma gondii)

1. Chromatographic immunoassay-based detection of human toxoplasmosis in District

Mardan, Khyber Pakhtunkhawa, Pakistan.

2. Seroprevalence of Toxoplasma gondii Infection in Gallus domesticus ofDistrict Mardan,

Khyber Pakhtunkhwa, Pakistan.

3. Seroprevalence of toxoplasma gondii infection in cows and goats of district Charsadda,

Khyber Pakhtunkhwa, Pakistan

137

Pure Appl. Biol., 6(4):1297-1305, December, 2017 http://dx.doi.org/10.19045/bspab.2017.600138

Research Article

Chromatographic Immunoassay based

detection of human toxoplasmosis in

District Mardan, Khyber Pakhtunkhawa,

Pakistan

Mudassir Shah1,2

, Muhammad Zahid1*

, Basmina Bibi1, Arab

Hussain1,3

, Muhammad Haroon4 and Basit Ali

1

1 Department of Zoology, Islamia College Peshawar, Khyber Pakhtunkhwa (KPK)-Pakistan 2 Department of Zoology, Government Superior Science College Peshawar-Pakistan 3 Department of Zoology, Government Post Graduate College Charsadda-Pkistan 4 Khyber Teaching Hospital Khyber Pakhtunkhwa (KPK)-Pakistan

*Corresponding author’s email:[email protected] Citation Mudassir Shah, Muhammad Zahid, Basmina Bibi, Arab Hussain, Muhammad Haroon and Basit Ali. Chromatographic

immunoassay based detection of human toxoplasmosis in District Mardan, Khyber Pakhtunkhawa, Pakistan. Pure and

Applied Biology. Vol. 6, Issue 4, pp1297-1305. http://dx.doi.org/10.19045/bspab.2017.600138 Received: 30/06/2017 Revised: 05/10/2017 Accepted: 07/10/2017 Online First: 16/10/2017

Abstract This study was carried out to determine the sero-prevalence of human Toxoplasmosis in district Mardan, Pakistan. A total of 600 human blood samples were collected by random sampling method. Blood samples were analyzed for Toxoplasma gondii infection and anti-T. gondii IgM and IgG antibodies by using Latex agglutination test (LAT) and Chromatographic technique, respectively. Out of 600 individuals, 105 (17.5%) were sero-positive for T. gondii. Males showed slightly higher (18.4%) prevalence as compared to female (16%), but statistically the difference

was non-significant (X2= 0.394, P = 0.5302). Sero-prevalence was high (29.41%) in age group

31- 45 years and lowest (10%) in age group ≤1-15years. A non-significant difference (P > 0.05) of sero-positivity was observed between rural (18.06%) and urban (15.56%) areas. Sero-positivity for IgG was high (24%) in age group 31-45. IgM anti-body showed highest sero-positivity (14%) in age group 61-75. Of various risk factors, a significant association (P = 0.0001) was found between sero-positivity and no hand washing after contact with animal, soil or other contaminated objects. However, there was no significant relation between sero-positivity of T. gondii and educational status of subjects (p>0.05). Keywords: Chromatographic technique; Latex agglutination test; Human toxoplasmosis; Sero-prevalence; Mardan Introduction Toxoplasmosis is a widely prevalent,

zoonotic infection, caused by an obligate, intracellular protozoan parasite, commonly

cosmopolitan in its distribution across the

globe [1-3]. The disease condition is of considerable importance, particularly in hot

and humid climates [4, 5] infecting about one third of the human population at global

level [6, 7]. The sero-prevalence of

http://dx.doi.org/10.19045/bspab.2017.600138

mailto:[email protected]


138

toxoplasmosis in human populations is quite high high in developing world, ranging up to

80 as compared to developed world [8]. Felines or cats are the definitive hosts as it

has been shedding the oocysts of T. gondii

in its feces in a routine excretion. Other domestic animals like cattle, goats, sheep,

pigs, mice, rats and rodents are also known for transmitting toxoplasmosis to human [3,

9,10]. Placental transmission is also evidentfrom mother to fetus whereas blood

transfusion is the other possible cause [3,

11,12]. However, the major risk factor

forhuman toxoplasmosis is the consumption

of undercooked meat or food stuffs contacted by any intermediate host (sheep,

rabbit, cat, mice and goat) containing tissue cysts [13,14]. However, contact with animal,

gardening and under cooked food and vegetables are the risk factors for human

toxoplasmosis [1, 15, 16]. Above all, cats possess high risk of toxoplasmosis for

human [10, 17, 18]. Toxoplasmosis is

known for causing life threatening

infections, including pneumonia,

chorioretinitis, and encephalitis [19]. During pregnancy, mother infection leads to mental

retardation, epilepsy, blindness and maternal death [13] or spontaneous abortion of the

fetus [8, 20-22]. The present study aimed to record the sero-prevalence of toxoplasmosis

in human population of District Mardan,

Khyber Pakhtunkhwa, Pakistan. This investigation will further open new gates for

the molecular level approaches to T. gondii infection in the region and will help in

general awareness of the subjects about the detrimental health hazards of toxoplasmosis. Materials and methods The present study investigated the sero-prevalence of T. gondii antibodies in human

population of District Mardan, Khyber

Pakhtunkhwa Pakistan. A total of 600 blood samples were collected by random

samplingmethod. The study area was enough vast, that is why random sampling

method was the best choice for conducting such a human oriented study. Blood samples

were

collected from male and female hosts by

visiting different urban and rural areas of the

district. Data was collected on properly

designed questionnaire. For the study,

ethical certificate was obtained from Islamia

College University Peshawar. The data

collectionquestionnaire included information

like host name, sex, age, location, animal

contact, educational level, use of washed or

unwashed fruits and hand washing after

animal sanitation or contact with soil. A

total of 3 ml blood was drawn from vein of

each host’s arm with disposable sterilized

syringes. Blood samples were immediately

transferred to laboratory for serum

separation by centrifugation at 4000 rpm

(Revolution perminute) for 10 minutes.

After processing, serum was transferred by

micropipette into clear and labeled tubes.

Serological tests All test samples were analyzed for T. gondii

infection by using the Latex agglutination test (LAT). The kit was used according to

the manufacturer protocol (Rosario, Argentina). Positive samples were preceded

for detection of particular IgM and IgG

antibodiesbychromatographic immunoassay.

For this purpose, OnSite Toxo IgG/IgM Rapid Test kits (CTK Biotech, Inc. USA)

were used. Chromatographic immunoassay The OnSite Toxo IgG/IgM Rapid Test kit (CTK Biotech, Inc. USA) was used which is alateral flow chromatographic immunoassay

for the immediate detection and demarcation of IgM and IgG anti-Toxoplasma gondii in

humans’ serum. It is asimple, rapid, one step screening test and requires no special

precautions. Assay procedure 2-3 drops of serum were dispensed into the sample vail after removing air bubbles. Single drop sample diluent (Phosphate-Saline buffer) was added. After timer setting, results were read after 15 minutes.

1298

139


Positive results were noticeable in one minute. The manifestation of any reddish-purple color in the T bands, apart from intensity, was considered as presence of the band. Statistical analysis To consolidate the results and check its

statistical significance, chi square test was applied to calculate the P- value. The level

of significance was selected <0.05. Data was analyzed through computer software SPSS

(version 10.0-registered). Results Sex-wise prevalence There were 69 (18.40%) out of 375 infected in male and 36 (16.00%) out of 225 were found toxoplasma positive in female. Over

all sero-positivity for toxoplasmosis was high (18.40%) in male sex as compared to females (16.00 %) (Table 1). Chi square

(X2) value was 0.394 against P= 0.5302.

Although a difference was recorded in infection in both the sexes, but statistically the difference was non-significant. Male sex showed the highest sero-positivity for IgG 42 (61%) than IgM 21 (30%), and IgM than IgG+IgM 06 (09%). Female sero-positivity for IgG, IgM and IgG+IgM was 42%, 25% and 33%, respectively. Out of 600 tested samples for sero-prevalence of Toxoplasma gondii, 57 were IgG positive (10%), 30 were IgM positive (05%) and only 18(3%) were positive for both type of immunoglobulins.

Table 1. Gender wise T. gondii antibodies distribution in human population

Individual

Infected No; Percentage and Types

Gender

of Antibodies

Total Prevalence (%)

Examined

IgG IgM

IgG +Ig

Male 375 42(61%) 21(30%) 06(09%) 69 18.40%

Female 225 15(42%) 09(25%) 12(33%) 36 16.00%

Total% 600 57(9.5%) 30(05%) 18(03%) 105 17.5%

*P = 0.5302

**X2= 0.394

Level of significance= 0.05 Age-wise prevalence Sero-positivity of anti T. gondii IgG, IgM

and IgG+IgM was observed in relation to participant’s age. Individuals in age group,

01 to 15 years showed highest sero-positivity (05.00%) for IgM, 03.00% for IgG

and only 02.00% for IgG and IgM both.

Highest IgG sero-prevalence (24.00%) was

observed in 31-45 years old group. Whereas the highest sero-positivity of IgM

was 14.00% in the oldest group (61-75

years old) (Table 2). There was a difference in sero-positivity for IgG+IgM among

different age groups. However both age groups (31- 45 and 61-75 years) showed no

IgG+IgM positivity (Table 3).

Table 2. Age wise Sero-prevalence of human toxoplasmosis

Age group No of hosts Examined No of hosts infected Prevalence (%)

(years)

≤ 1-15 174 18 10.34

16-30 240 39 16.25

31-45 102 30 29.41

46-60 63 12 19.04

61-75 21 06 28.57

Total 600 105 17.5


140

Shah et al.

Table 3. Age wise Sero-prevalence of human toxoplasmosis by using IgG, IgM and IgG+Igm antibodies

Age Anti body IgG Anti body IgM Anti body IgG+ IgM Positive

groups

Negative Positive Negative Positive Negative Positive

≤ 1-15 168(97%) 6(3%) 165(95%) 9(5%) 171(98%) 3(2%) 174

16-30 222(92%) 18(8%) 231(96%) 9(4%) 228(95%) 12(5%) 240

31-45 78(76%) 24(24%) 96(94%) 6(6%) 102(100%) * 102

46-60 57(90%) 06(10%) 60(95%) 3(5%) 60(95%) 3(5%) 63

61-75 18(86%) 03(14%) 18(86%) 3(14%) 21(100%) * 21

Total 543(90%) 57(10%) 570(95%) 30(05%) 582(97%) 18(03%) 600

(%)

Area-wise prevalence To investigate toxoplasmosis in relation to

area, 465 samples were collected from rural areas and 135 samples from the urban areas

of the study population in Mardan district. The results were statistically tested to know

any significant difference in sero-prevalence across the rural and urban areas. The

difference was non-significant (P=0.5004,

significance level= 0.05). Toxoplasmosis was recoded 18.06 % (n= 84/465) in rural

and 15.56 % (n= 21/135) in urban areas.

Chi square Value was 0.454, as non-significant at 0.05 level of significance. 465

rural samples, 84 (18.06%) were found positive for anti T. gondii antibodies and

381 (81.94%) were negative and among 135 urban samples, 21 (15.56%) were

seropositive for T. gondii antibodies and 114 (84.44%) were sero-negative. The

prevalence was slightly higher in rural areas than urban areas (Table 4). However the

difference was statistically non- significant

(X2=0.454, P=0.5004).

Table 4. Area wise sero-prevalence of Toxoplasmosis

Test Result Rural % Urban % Total

Negative 381 81.94 114 84.44 495

Positive 84 18.06 21 15.56 105

Total 465 100 135 100 600

522 X2=0.454, P=0.5004

521 Level of significance= 0.05

Risk factors for transmission In relation to mode of transmission, there were 411 individuals noted for contact with animals. Out of 41, 19% were sero-positive for the parasite antibodies. Subjects having no association with the animals showed only 14% sero-positivity. It seems that animals’ contact is positively associated factor with the infection. But difference observed in both groups was statistically non-significant

(X2=1.46, P= 0.2269). People used to wash

their hands after animal and soils contact showed 10% sero-positivity and those not

washing their hands were with 28% sero-positive. An extremely significant difference

(X2=22.36, P = 0.0001) was observed

between the groups. Most of the infected individuals (18%) were unaware about the infection and mode of toxoplasmosis transmission. While those having knowledge about the transmission mode were with 14% sero-positivity. But the difference was again

statistically non-significant (X2= 0.491, P =

0.4835). There was also a slight difference

(X2=0.016, P = 0.8993) in the sero-

positivity of individuals using unwashed raw

1300

141


vegetables and fruits. And those using

washed vegetables and fruits were having 18% and 17% ratios respectively for

toxoplasmosis. People with soil contact were with higher (08%) sero-positivity than those

having no contact with (4.75%) soil.

However the difference is statistically insignificant (Table 5). The result shows, the

prevalence of toxoplasmosis was higher

(20%) in individuals, having secondary

education than those having higher studies (18%) and none or primary education

(having 14% infection). However, there was no statistically significant relation

between sero-positivity to T. gondii and

educational standard of the study subjects (P > 0.05; P = 0.3848).

Table 5. Potential risk factors for T. gondii sero-positivity in human population

Risk Factor No.

No. positive (%) Chi-square P- value Significance

person’s

Animal

Contact

Yes 411 78 (18.97) 1.46 0.2269 non-significant

No 189 27 (14.28)

Hand

Washing

after animal

Contact

Yes 355 36 (10.14) 22.36 0.0001 highly significant

No 245 69 (28.16)

Knowledge

About

transmutation

Mode


No 510 92 (18.03)

Unwashed

Raw

Vegetables

Or fruits

consumption


No 525 91 (17.33)

Grading or

Contact

with soil


No 400 19 (4.75)

* Level of significance= 0.0

Discussion During the study, 600 samples having age range less than or equal to 01 to 75 years

were studied for Toxoplasma gondii sero-positivity. Out of total 600, 105 subjects were found seropositive for anti-T. gondii

1301


142

immunoglobulin. Overall sero-prevalence of human toxoplasmosis was found to be 17.5 %. The findings of Sadaruddin recorded

17.4% sero-prevalance of T. gondii in the capital territory of Pakistan in school going

children [23]. A study from Tehran, Iran reported 17.7% T. gondii infection [24].

However, the findings of other authors have also reported a high sero-prevalence rate in

China [25], Pakistan and Ethopia. Sero-

prevalence was recorded 37% in district Muzaffargarh, Punjab, Pakistan [16], 29.5%

in Dera Ghazi khan, Punjab [26] and 90% in African population of Ethiopia [27]. The

work done in Pakistan, Iran and china [23-

25] are in full agreement with our findings (Table 1). However, variations are evident in

the prevalence rate of T. gondii infection across different regions, societies and

countries. That might be due to different cultural activities, nutritional habits, socio-

economic condition, immunity, geographical region, animal contact, sample size, use of

raw or not properly cooked meat, unfiltered water, contaminated soil, hygienic conditions and climatic change among regions [28-30]. Regarding sero-prevalence in different sexes, our data recoded a slightly higher

prevalence in male sex as compared to

female sex. However, the difference was statistically non-significant (p> 0.05). The

possible explanation for the slight change may be the difference in human activities

and immune system [28], Klein had reported similar findings of higher occurrence of

infections in males as compared to females due to immune system differences [31]. The

intrinsic physiological changes between

females and males might be another reason in difference of frequency in different sexes

[32]. High rate ofT. gondiiinfection inmales was also reported from Punjab, Pakistan

[16] which is in agreement with this findings. Our findings (Table 1) arefurther

confirmed by the work of Moschen

Shah et al.

who also reported a slight dominance among males (18.2%) than females 17.5% in Italy [33]. Prevalence of toxoplasmosis varies in

different age groups. Lowest sero-prevalence (10%) was observed in the case

of subjects with age 01 year or below to 15 years, while in age group 31-45 years,

highest anti-T. gondii prevalence (29.41%) was recorded. Age group 61-75 years also

showed nearly same higher prevalence

(28.57%) of human toxoplasmosis (Table 2). Our data shows a higher infection in older

age group as compared to younger age groups which is in accordance with the work

of Tasawar who found 29.41% sero-prevalence in age group 51-60 years [16].

Work of earlier authors also supports the present findings of high rate of T. gondii

infection in old age groups. Likely, study

conducted in the neighboring province Lahore, Pakistan showed a high rate of

toxoplasmosis (28%) in 51-60 years age group [9]. Reason for higher infection rate

with the increasing age may increase the exposure time and the weakness of the

immune system in old age people. Table 3 shows that, highest IgG positivity (24%) in

age group 31-45. While IgM higest sero-

positivity (14%) is recorded in old age groups (61-75). On the other hand the

highest (05 %) sero-positivity for IgG+IgM is seen in age group16-30 and 46-60. The

work of Ngui is in agreement with the present results (Table 3), who also recorded

highest IgG sero-positivity than IgM and IgG+IgM [34]. While Mohan reported

highest (10%) IgM positivity in 6-12 years

age group in urban area and 17.7% highest IgM positivity in age less than or equal to 05

years in the rural area [35]. Statistically a non-significant (p > 0.05) difference was

noted in toxoplasmosis infection recorded in rural and urban areas in our findings (Table

4), which correlates with the earlier work

1302

143


[36]. While some studies evaluated highersero-prevalence in rural areas [37]. The effects of various factors such as the

animal contact, hand washing after contact, knowledge about transmission modes,

unwashed raw vegetables or fruits consumption, gardening or contact with soil

were studied (Table 5). A significant association (P= 0.0001) was found between

hand washing after contact with soil, animal

or infection. Previous studies support the association between these factors and

toxoplasmosis infection [36]. In the current study, no significant connection (P>0.05)

was observed between the T. gondii sero-positivity and such factors due to small

sample size. Conclusions It is concluded that the risk of infection increases with the increase in age, non-

washing of hands after animal and soil

contact. Men remain slightly at higher risk as compared to females. Infection occurs in

urban areas as well as in rural. IgG sero-positivity is high in 31-45 age group, while

IgM sero-positivity recorded high in old age group (61-75). Public awareness is sought

through health programmes, as the infection is prevalent equally in both educated and

non-educated subjects. Preventive measures

should be taken to ensure public health and avoid its detrimental health effects. Hands

should properly be washed, undercooked meal should be avoided, proper hand

washing is required and animals contact should be avoided. Authors’ contributions

Conceived and designed the experiments: M

Zahid, Performed the experiments: M Shah

& S Attaullah, Analyzed the data: M Haroon & B Ali, Contributed reagents/ materials/ analysis tools: B Bibi & A Hussain, Wrote the paper: M Zahid, & M Shah. References 1. Dubey JP & Jones JL (2008). Toxoplasma

gondii infection in humans and animals

in the United States. InternationalJournal Parasitology 38: 1257-1278. 2. Aldebret D, Hypolite M, Cavaillaes

P, Touque B, Flori P, Loeuillet C & Cesbron-Delauw MF (2011). Development of High-Throughput methods to quantify cysts of Toxoplasma gondii. Cytometry Part A 79: 952-958.

3. Shah M, Zahid M., Sthanadar AA & Asmat P (2014). Seroprevalence of

Toxoplasma gondii infection in human

population of Mohmand Agency, Pakistan. Pakistan Journal of Zoology

46(4): 1169-1172. 4. Al-Qureshi AR, Ghandour AM, Obeid

OE, Al-Mulhim A & Makki SM (2001). Seroepidemiological study of Toxoplasma gondii infection in the human population in the Eastern region. Saudi Medical Journal 22(1): 13-8.

5. Shah M, Zahid M, Asmat P & Sthanadar AA (2013b). Seroprevalence of Toxoplasma gondii in goats and sheep of district Mardan, Pakistan. International Journal of Biosciences 3:90-97.

6. Jones JL, Kruszon-Moran D, Sanders-

Lewis K & Wilson M (2007).

Toxoplasma gondii infection in the United States, 1999 2004, decline from

the prior decade. The American JournalTropical Medicine and Hygiene

77:405-410. 7. Kijlstra A & Jongert E (2008). Control

of the risk of human toxoplasmosis transmitted by meat. InternationalJournal of Parasitology 38: 1359-1370.

8. Arevalo JF, Belfort RJR, Muccioli C & Espinoza JV (2010). Ocular Toxoplasmosis in the developing world. International Ophthalmology Clinical

50: 57-69. 9. Ahmad MS, Maqbool A, Mahmood-Ul-

Hassan M, Mushtaq-Ul Hassan M & ANJUM AA (2012). Prevalence of

1303


144

Toxoplasma gondii antibodies in human beings and commensal rodents trapped from Lahore. Pakistan Journal AnimalPlant Sciiences 22(1): 51-53.

10. Robert-Gangneuxa & Darde ML (2012). Epidemiology of and Diagnostic Strategies for Toxoplasmosis. Clini. Microbio. Rev 25(2): 264–296.

11. Hajsoleimani F, Ataeian A, Nourian AA & Mazloomzadeh S (2012).

Seroprevalence of Toxoplasma gondii in pregnant women and bioassay of IgM

positive cases in Zanjan, Northwest of Iran. Iranian Journal of Parasitology

7(2): 82–86. 12. Bodaghi B, Touitou V, Paris CFL &

Lehoang P (2012). Toxoplasmosis: new challenges for an old disease. Eye 26: 241-244.

13. Montoya JG & Liesenfeld O (2004). Toxoplasmosis. Lancet 363(9425): 1965 1976.

14. Shah M, Zahid M, Sthanadar AA, Pir A,

Kausar A & Jan AH (2013a). Seroprevalence of Toxoplasma gondii

infection in domestic animals of Mohmand agency, Pakistan Journal

ofCoastal Life Medicence 1(1): 70-73. 15. Dubey JP & Beattie CP (1988).

Toxoplasmosis of Animals and Man. CRC Press, Boca. Raton, Florida 1-220.

16. Tasawar Z, Raza AA, Aziz F & Lashari MH (2012). Prevalence of Human Toxoplasmosis in District Muzaffargarh, Punjab. Gomal Journalof Medical Sciences 10(1): 37-41.

17. Mcallister MM (2005). A decade of discoveries in veterinary protozoology changes our concept of "subclinical" toxoplasmosis. Veterinary parasitology 132: 241-247.

18. Kolbekova P, Kourbatova E, Novotnal M, Kodym P & Flegr J (2007). New and old risk-factors for Toxoplasma gondii infection: prospective cross sectional study among military personnel in the

Shah et al. Czech Republic. Clinical Microbiologyand Infection 13: 1012-1017. 19. Cantos GA, Prando MD, Siqueira MV &

Teixeira RM (2000). Toxoplasmosis: occurrence of antibodies anti-Toxoplasma gondii and diagnosis. Revista Da Associação Médica Brasileira 46(4): 335-41.

20. Martin S (2001). Congenital Toxoplasmosis. Neonatal Netw 20(4): 23-30.

21. Lopes-Mori RMF, Breganó RM, Capobiango JD, Inoue IT, Reiche EMV, Morimoto HK, Casella AMB, Bittencourt LHF, Freire RL & Navarro IT (2011). Programs for control of congenital toxoplasmosis. AssociaçãoMédica Brasileira 57(5): 581-586.

22. Cabanas RMP, Araujo EJA, Da-Silva AV & Santana DMG (2012). Myenteric neuronal plasticity induced by

Toxoplasma gondii (genotype III) onthe

duodenum of rats. Anais da Academia

Brasileira de Ciencias 84(3): 737-745.

23. Sadaruddin A, Agha F, Anwar F & Ghafoor A (1991). Seroepidemiology of

Toxoplasma gondii infection in young

school children in Islamabad. Journal ofPakistan Medical Association 41:

131-134. 24. Soleimani Z, Salekmoghadam A,

Shirzadi M & Pedram N (2003). Seroepidemiological study of

Toxoplasma gondii in high school girls in Robatkarim, district by IFA and

ELISA. Proceeding of 4th national

congress of parasitology and parasitic diseases, Mashhad. Iran 388.

25. Sun X, Lu H, Jia B, Chang Z, Peng S, Yin J, Chen Q & Jiang N (2013). A

comparative study of Toxoplasma gondii seroprevalence in three healthy

Chinese populations detected using native and recombinant antigens.

Parasite Vectors 6: 1-241.

1304

http://www.ncbi.nlm.nih.gov/pubmed/?term=Hajsoleimani%20F%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Ataeian%20A%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Nourian%20A%5Bauth%5D

http://www.ncbi.nlm.nih.gov/pubmed/?term=Mazloomzadeh%20S%5Bauth%5D

145


26. Tasawar Z, Nawaz S, Lashari MH, Aziz F & Hayat CS (2011). Seroprevalence of human Toxoplasmosis in Dera Ghazi Khan, Punjab. Gomal Journal ofMedical Sciences 9(1): 82-85.

27. Shimelis T, Tebeje M, Tadesse E,

Tegbaru B & Terefe A (2009). Seroprevalence of latent T. gondii

infection among HIV-infected and HIV-uninfected people in Addis Ababa,

Ethiopia: A comparative cross-sectional study. BMC Research Notes 2: 213.

28. Ortiz-Alegria LB, Caballero-Ortega H, Canedo- Solares I, Rico-Torres CP, Sahagun-Ruiz A & Medina-Escutia ME (2010). Congenital toxoplasmosis: candidate host immune genes relevant for vertical transmission and pathogenesis. Genes and Immununity 11: 363-73.

29. Sroka S, Bartelheimer N, Winter A, Heukelbach J, Ariza L, Ribeiro H, Oliveira FA, Queiroz AJN, Alencar C & Liesenfeld O (2010). Prevalence and risk factors of toxoplasmosis among pregnant women in Fortaleza, Northeastern Brazil. The Americanjournal of tropical medicine and hygiene 83: 528-33.

30. Dhumne M, Sengupta C, Kadival G, Rathinaswamy A & Velumani A (2007). National Seroprevalence of T. gondii in India. Journal of Parasitolology 93: 1520-1.

31. Klein SL (2004). Hormonal and immunological mechanisms mediating sex differences in parasite infection. Parasite Immunology 26: 247-64.

32. Mcclelland EE & Smith JM (2011). Gender specific differences in the

immune response to infection. Archivum immunologiae et therapiae experimentalis 59: 203-13. 33. Moschen ME, Stroffolini T, Arista S,

Pistoia D, Giammanco A, Azara A, Mattia DE, Chiaramonte, M, Rigo G &

Scarpa B (1991). Prevalence of Toxoplasma gondii antibodies

amongchildren and teenagers in Italy. Microbiology 14: 229-34.

34. Ngui R, Yvonne AL, Lim Amir NF, Nissapatorn V & Mahmud R (2011). Seroprevalence and Sources of Toxoplasmosis among Orang Asli

(Indigenous) Communities in Peninsular Malaysia. The Americanjournal of tropical medicine and hygiene 85(4): 660-666.

35. Mohan B, Dubey ML, Malla N

&Kumar R (2002).

Seroepidemiological study of

toxoplasmosis in different sections of

population of Union Territory of

Chandigarh. The Journal of

communicable diseases 34(1): 15-22.

36. Studenicova C, Bencaiova G & Holkova R (2006). Seroprevalence of Toxoplasma gondii antibodies in a healthy population from Slovakia. European journal of internal medicine 17: 470-473. 37. Kawashima T, Win KS, Kawabata M,

Barzaga N, Matsuda H & Konishi E

(2000). Prevalence of antibodies to Toxoplasma gondii among urban and

rural residents in the Philippines.

TheSoutheast Asian journal of tropical medicine and public health 31(4): 742-7


http://europepmc.org/search?page=1&query=AUTH:%22Mohan+B%22

http://europepmc.org/search?page=1&query=AUTH:%22Dubey+ML%22

http://europepmc.org/search?page=1&query=AUTH:%22Dubey+ML%22

http://europepmc.org/search?page=1&query=AUTH:%22Malla+N%22

http://europepmc.org/search?page=1&query=AUTH:%22Malla+N%22

http://europepmc.org/search?page=1&query=AUTH:%22Kumar+R%22

http://europepmc.org/search?page=1&query=AUTH:%22Kumar+R%22

146

Pakistan J. Zool., vol. 46(6), pp. 1705-1710, 2014.

Seroprevalence of Toxoplasma gondii Infection in Gallus domesticus

of District Mardan, Khyber Pakhtunkhwa, Pakistan

Zia Ullah Mahmood,1 Muhammad Zahid,1 Aftab Alam Sthanadar,1,2 Mudassir Shah1,3 and

Arab Hussain1

1Islamia College University, Peshawar, Khyber Pakhtunkhwa (KPK), Pakistan 2Post-Graduate College, Dargai, Malakand, KPK, Pakistan 3Government Degree College, Darra Adam kheil, FR Kohat, Pakistan

Abstract.- The aim of present study was to determine the rate of prevalence ofToxoplasma gondiiin

chickensand to apprise the community about the negative effects of the T. gondii in the study area. A total of 536

blood samples of caged and free range chicken were tested, of which 18.85% were found infected with T. gondii. In

64 blood samples from caged 5.90% were found sero-positive. While out of 468 free range chickens 20.70% were

found with anti-toxoplasma antibody. The seroprevalence rate was 22.20% detected in female birds of free range

chickens, while 17.80% were found sero-positive in male free range chickens. A greater number of samples were

found positive in free range chickens, while little number of caged chickens was with negative result. The present

research study shows that infection of toxoplasmosis is high in chickens in Mardan, Pakistan, which is a public health

threat in the study area.

Key Words: Toxoplasmosis, indirect hemagglutination antibody (IHA),Toxoplasma gondii, Chickens, Mardan

INTRODUCTION

Toxoplasma gondiiis an obligate, intracellular protozoan parasite, cosmopolitan in distribution and a causative agent of toxoplasmosis (Blader and Saeij, 2009; Aldebret et al., 2011; Shah et al., 2014). Its infection is generally caused byingesting the oocyst stage, reaching to body tissues via water and food contacted by cat’s faeces (Schlundt et al., 2004; Webster, 2007; Robert-Gangneuxa and Darde, 2012). The condition is also passed via placenta from mother to offspring while feeding the child during pregnancy (Sibley et al., 2009; Hajsoleimani et al., 2012). The other possible

cause of toxoplasmosis transmission occurs through blood or leucocytes from infected blood donors to patient (Zhou et al., 2011; Bodaghi et al., 2012).

Prevalence rate of T. gondii varies in different countries (Shah et al., 2014). Toxoplasmosis is reported 30% in Europe and generally 10% observed across USA (Hill and Dubey, 2002). A highest rate of toxoplasmosis is recorded across Serbia and Poland with 58% and 60% (Hasan, ___________________________

* Corresponding author: [email protected] 0030-9923/2014/0006-1705 $ 8.00/0 Copyright

2014 Zoological Society of Pakistan

2011). Estimatidly, about 33% of the human

population may harbour this parasite, however its

prevalence rate varies with climate, nutritional

factors, geographic factors, sociocultural habits and

transmission route (Shah et al., 2013b). Improved

animal husbandry practices and increased awareness

can well counter the possible risks of toxoplasmosis

across the globe (Weiss and Dubey, 2009; Shah

etal., 2013a). The previous studies recorded 42.28% and

44.13% toxoplasmosis infection in goats and sheep, respectively in district Mardan. However, overall infection recorded in district Mardan was 43.12 % (Shah et al., 2013a). Similarly toxoplasmosis was recoded in federally adminisrted tribal area, in Mohamand agency with 32.29% in farm animals (Shah et al., 2013b). Recently, the seroprevalence of

T. gondii recorded in human population of thenearby district Mardan with 28.44% infection (Shah et al., 2014).

Initially toxoplasmosis infection

asymptomatic or specified with only generally

symptomatic with mild flue (Goz et al., 2007;

Selseleh et al., 2012). Medically it leads to

encephalitis (Hill and Dubey, 2002; Blader and

Saeij, 2009; Jones and Roberts, 2013), abortions

(Mori et al., 2011) and other congenital defects in

humans (Chaudhary et al., 2006). Other conditions

147

1706 Z.U. MAHMOOD ET AL.

caused are lymphadenopathy, retino-choroiditis in

new borns which readily leads to blindness (Blader

and Saeij, 2009; Weiss and Dubey, 2009).

Toxoplasma gondii may also become the cause

ofdiseases like pericarditis, pneumonia, and other

neurologic disorders (Cabanas et al., 2012; Lee

etal., 2012), central nervous system damage, mental retardation, chorioretinitis, blindness, meningoencephalitis, hydrocephalus, intracranial calcifications and epilepsy with fetal results or spontaneous abortion in about 10% of cases (Khan et al., 2011; Mori et al., 2011; Cabanas et al., 2012).It also leads to ocular disease (Jones and Roberts, 2013). The congenital infection can form lesions in the retina of the eye which can result in

eye pain and might loss the vision power of the eye (Weiss and Dubey, 2009).

Toxoplasmosis occurs in goats, sheep

(Stormoen et al., 2012) and cats (Holzworth, 1987),

dogs (Aiello and Mays, 1998) and horses (Nicolle

and Manceaux, 1908). It also causes mortality in

birds of different species including domesticated

and commercially available chickens (Devada et al.,

1998; Murao et al., 2008; Wu et al., 2011). Other

birds are pigeons (Biancifiori et al., 1986), sparrows

(Pinowski et al., 1999). As the birds are the

intermediate hosts of T. gondii so chickens are also

victimized by T. gondii infection worldwide and can

create serious problems for humans (Devada et al.,

1998). Meat from T. gondii infected poultry

(chickens) is consumed widely in many countries

and is known to be the primary source of infection

for humans (Dubey et al., 2007) The present study aims to record the

incidence of toxoplasmosis in chickens of district Mardan Khyber Pakhtunkhwa province in Pakistan. This investigation will further open new gates for the molecular level findings of T. gondii infection in

the region and will help in general awareness of the locals using commercial chicken as a preferable source of protein source.

MATERIAL AND METHODS

Serum collection The present study was conducted to

determine the sero-prevalence of T. gondii in chickens including commercially available as well

as domesticated chickens in Mardan District of Khyber Pakhtunkhwa province in Pakistan. Samples were randomly selected across the study area with a

1632 km2 area. A total of 536 samples were

collected from 03 geographically different areas (tehsil Mardan, tehsil Katlong and tehsil Takht Bhai). About 02 mL of blood was collected from wings by puncturing through disposable needle in vein. Collected blood was immediately transferred to collecting tubes containing anticoagulant. The samples were centrifuged at 3500 rpm for 5 min at 25-30°C or room temperature for the extraction of serum. The serum collected was stored in eppendorff tubes at -20°C until further analysis to be carried out (Chumpolbanchorn et al., 2009).

Serological examination The commercial Indirect Hemagglutination

Antibody (IHA) test kits were used according to manufacturer protocol (SERFIB, France) for

detection of antibodies of T. gondii. A serial two fold dilution was prepared starting from 1:40, up to 6th dilution. A drop of sensitized red blood cells was poured in the each vile containing diluted serum. While un-sensitized and sensitized blood was used as positive and reagent control. The samples were properly mixed and the plate was allowed to stand for 02 hours before recording the reading. All sera reactivated at ≥1:80 were considered as positive (Shah et al., 2014).

Statistical analysis The results were expressed in percentages.

The values between different sex groups were analyzed by using Chi Square test for Windows (Release 16.0 standard version). The P value < 0.05 was considered as statistically significant.

RESULTS

The present study was conducted regarding “seroprevalence of Toxoplasma gondii infection in domesticated and caged chickens in District Mardan”. The study area was divided in three geographically different zones i.e. Tehsil Mardan, Tehsil Takht Bhai and Tehsil Katlang with a total

area of 1632 km2 area. A total of 536 blood samples

were collected in Mardan district. There were 101

148

PREVALENCE OF TOXOPLASMA IN CHICKEN 1707

positive samples (18.85%) and 435 (81.15) were

with no anti-toxoplasma antibody detection. Over

all a total of 18.85 % toxoplasma infection was

recorded across the study area (Table I).

Table I.- Toxoplasmosis in caged (briolers) and free or

domesticated chickens.

in Table II. The data showed that female have little

high rate of prevalence (22.20%) as compare to

male (17.80 %) domestic chicken.

DISCUSSION

Chickens N Positive Negative (%) (%)

Caged (Broiler) 68 4 (5.90) 64 (64.10) Free range (Domestic) 468 97 (20.70) 371 (79.30)

Total chickens 536 101 (18.85) 435 (81.5)

Table II.- Toxoplasmosis in caged (briolers) and free

or domesticated chickens according to sex.

Chickens N Positive Negative (%) (%)

Caged/Broiler

Male 10 - 10 (100.00) Female 58 4 (6.90) 54 (93.10)

Total 68 4 (5.90) 64 (94.10)

Uncaged/Domestic

Male uncaged 152 27 (17.80) 125 (82.20) Female uncaged 316 70 (22.20) 246 (77.80)

Total 468 97 (20.70) 371 (79.30)

Grand total 536 101 (18.85) 435 (81.15)

The data collected shows that 04 (5.90%)

out of 68 samples were found positive for

toxoplasma infection in caged chickens (broilers).

94. 10 % sample was recorded negative for

toxoplasmosis antibody in their blood (Table II).

However the rate of infection was quite similar in

both sexes of caged broilers. Table II, shows 468

blood samples were collected from free range

(domestic) chickens for the detection of anti-

toxoplasma antibody in district Mardan. 97

(20.70%) out of total 468 samples were found

positive (20.70%), while 371 (79.30%) samples

were recorded negative by testing for T.gondii

infection. Regarding sex, toxoplasmosis

wasrecorded high in female birds (22.20%) as

compared to male uncaged or domesticated

chickens, as seen

The birds are the important hosts of T. gondii

and also considered as epidemiologically important

for toxoplasmosis infection. Usually toxoplasma

infection is passed to ground-foraging birds when

coming in contact with soil contaminated with

toxoplasma oocysts. Cats are the commonly known

for frequent infection of T gondii. Previous studies

showed that T. gondii causes major mortalities in

wild birds of different species (Murao et al., 2008;

Wu et al., 2011). Among birds, chickens also serve

as the intermediate hosts of T. gondii, so chickens

are readily victimized across the globe and even

causing problems for human population as well

(Devada et al., 1998). Regarding prevalence,

Toxoplasma infection is very much low in

cagedbirds and chickens. However, the

seroprevalence of toxoplasmosis is significantly

high in free-range or backyards chickens. Due to

their habit of feeding close to the ground, free-range

chickens are usually counted as a good indicator of

environmental contamination by Toxoplasma

oocysts (Dubey, 2010; Shah et al., 2013a). Out of 536 sera samples, obtained from

Mardan district, Pakistan, 101 (18.85%) were found seropositive for T. gondii. This figure for seroprevalence is quite lower than 64% toxoplasma infection recorded in chickens from Ghana. About 24.4% toxoplasmosis was reported in Indonesia, 30% in Poland, and 24.2% in Vietnam (Dubey etal., 2008). However seroprevalence recoded in USA(12.5%) is quite lower than our figures (18.85%) (Dubey et al., 2008). A study conducted

in adjacent province, in Punjab (Pakistan) shows that there is no anti-toxoplasma antibody in chickens (Zaki, 1995). The difference in rate of prevalence may be due to the geography, climate socioeconomic conditions, traditions, and customs and due to life style of the people living at there.

The infection rate in the present study in caged and uncaged (free-range) chickens is 20.70% and 5.90% respectively, which is nearly similar to a

149

1708 Z.U. MAHMOOD ET AL.

study conducted in Beni Suef, Egypt, showing

seroprevalence of 20% and 9.6% in free-range and

farmed chickens, respectively (Aboelhadid et al.,

2013). Our investigations are in full commitment

with the findings of Xu et al. (2012) Liaoning

Province, China showing 18.8% and 5.6%

prevalence in free-range and caged respectively

with a significantly higher prevalence in free-range

chickens. The prevalence rate in present study is

higher than 11.4% (of 361) in free-range and 4.1%

(of 244) in caged chickens reported from Southern

China (Yan et al., 2009). Another study suggest that

prevalence in caged and free-range chickens is

6.23% and 10.19% respectively, the study was

conducted in North-West China (Cong et al., 2012).

A study from China recorded a total of seropositive

rate of 30.36% (of 1173) in free-range chickens

reported from 13 provinces/municipalities of China

(Zhao et al., 2012). A study conducted in Addis

Ababa, Ethiopia revealed that seroprevalence of T.

gondii antibodies in free-range chickens was high as

38.4% (Tilahun et al., 2013). A study from Egypt reveals high rate (38.1%)

of toxoplasmosis in Kafr El-Sheikh, Capital of Kafr El-Sheikh Governorate, Egypt (Harfoush and Tahoon, 2010). There occurs a variation between rate of prevalence in caged and free ranged chikens. The high prevalence in free ranged chickens as compared to caged chickens, is because of environmental contamination with oocysts. The free ranged chickens become mainly infected by feeding from ground or soil as readily contaminated with oocysts of T. gondii (Edelhofer and Prossinger,

2010; Tilahun et al., 2013). In the present study anti-toxoplasma

antibodies were found to be more common in

females (22.20) as compared to males (17.80%)

domestic free range chickens. A significant

difference was observed in male and female

infection in the present study. However, there are

limited studies worked out gender based studies of

toxoplasmosis infection in chickens. This was the ever first scientific investigation

conducted across the study area regarding toxoplasma infection in chickens. In fact, it will

pave a way for future line of action and will create a better awareness regarding the problem in locals of the study area.

CONCLUSIONS

This is the first ever study regarding

seroprevalence of T. gondii infection in chickens of

Mardan, Pakistan. The results of the present study

showed that chickens (caged and uncaged) are

commonly victimized by T. gondii infection. The

overall infection rate was 18.85 % in chickens of

study area. The infection rate was higher in

uncaged/free range (20.70%) as compared to caged

chickens (5.90 %). The infection rate was higher in

females as compared to males. Susceptibility to

toxoplasmosis is more in females as compared to

male chickens. The high prevalence in free ranged

chickens as compare to caged indicates the

environmental contamination with oocysts because

free ranged chickens become mainly infected by

feeding from ground or soil and the ground is

contaminated with oocysts of T. gondii. It was

concluded that the main reason of the prevalence of

the toxoplasmosis was the transmission may be due

to cats presence in homes or unhygienic condition

of the society. It is suggested that more research

work should be carried out to find out other possible

routes of transmission other than cats and chickens.

REFERENCES

BOELHADID,S.M., ABDEL-GHANY, A.E., IBRAHIM, M.A.

AND MAHRAN, H.A., 2013. Seroprevalence of

Toxoplasma gondii Infection in chickens and humans

inBeni Suef, Egypt. Glob. Vet.,11: 139-144. AIELLO, S.E. AND MAYS, A., 1998. Toxoplasmosis. Merck.

Vet. Manual, 336-337. ALDEBRET,D., HYPOLITE, M., CAVAILLAES, P.,

TOUQUE, B., FLORI, P., LOEUILLET, C. AND

CESBRON-DELAUW, M.F., 2011. Development of

High-Throughput methods to quantify cysts of

Toxoplasma gondii. Cytometry Part A, 79:952-958. BIANCIFIORI, F., RONDINI, C., GRELLONI, V. AND

FRESCURA, T., 1986. Avian toxoplasmosis:

experimental infection of chicken and pigeon.

Comp.Immunol. Microbiol. Infect. Dis.,9:337-346 BLADER,I.J. AND SAEIJ, J.P., 2009. Communication between

Toxoplasma gondii and its host: impact on parasite

growth, development, immune evasion, and virulence.

Acta Path. Microbiol. Immunol. Scanvid., 117: 458-476.

BODAGHI,B., TOUITOU, V., PARIS, C.F.L. AND

LEHOANG, P., 2012. Toxoplasmosis: new challenges

for an old disease. Eye, 26: 241-244.

150

PREVALENCE OF TOXOPLASMA IN CHICKEN 1709

CABANAS, R.M.P., ARAUJO, E.J.A., DA-SILVA, A.V.

AND SANTANA, D.M.G., 2012. Myenteric

neuronal plasticity induced by Toxoplasma gondii

(genotype III) on the duodenum of rats. Anais.

Acad. Brasil. Cienc., 84: 737-745. CHAUDHARY, Z.I., AHMED, R.S., HUSSAIN, S.M.I.

AND SHAKOORI, A.R., 2006. Detection of

Toxoplasmagondii infection in butchers and

buffaloes bypolymerase chain reaction and latex

agglutination test. Pakistan J. Zool.,38: 333-336. CHUMPOLBANCHORN,K., ANANKEATIKUL, P.,

RATANASAK, W., WIENGCHAROEN, J.,

THOMPSON, R.C. AND SUKTHANA, Y., 2009.

Prevalence of Toxoplasma gondii indirect

fluorescent antibodies in naturally- and

experimentally-infected chickens (gallus

domesticus) in Thailand. ActaParasitolgica, 54:

194-196

CONG, W., HUANG, S.Y., ZHOU, D.H., XU, M., WU,

S.M., YAN, C., ZHAO, Q., SONG, H.Q. AND

ZHU, X.Q., 2012. First report of Toxoplasma

gondii infection in market-sold adult chickens,

ducks and pigeons in northwest China. Parasitol.

Vec., 5:110. DEVADA, K., ANANDA, R. AND DUBEY, J. B., 1998.

Serologic prevalence of T. gondii chickens in

Madras, India. J. Parasitol.,84: 621-622. DUBEY, J.P., 2010. Toxoplasmosis of animals and

humans, 2nd ed. CRC Press, Boca Raton, FL. DUBEY, J.P., HUONG, L.T., LAWSON,B.W., SUBEKTI,

D.T., TASSI, P., CABAJ, W., SUNDAR, N.,

VELMURUGAN, G.V., KWOK, O.C. AND SU,

C., 2008. Seroprevalence and isolation of

Toxoplasmagondii from free-range chickens in

Ghana, Indonesia,Italy, Poland, and Vietnam. J.

Parasitol.,94: 68-71. DUBEY, J.P, SUNDAR, N., NOLDEN, C.A., SAMUEL,

M.D., VELMURUGAN, G.V., BANDINI, L.A.,

KWOK, O.C., BODENSTEIN, B. AND SU, C.,

2007. Characterization of Toxoplasma gondii from

raccoons (Procyon lotor), coyotes (Canis latrans),

and striped skunks (Mephitis mephitis) in

Wisconsin identified several atypical genotypes. J.

Parasitol., 93:1524-1527. EDELHOFER, R. AND PROSSINGER, H., 2010. Infection

with Toxoplasma gondii during pregnancy: seroepidemiological studies in Austria. Zoonos. Publ.Hlth.,57: 18-26

GOZ, Y., BABUR, C., AYDIN, A. AND KILIC, S., 2007.

Seroprevalence of toxoplasmosis, brucellosis and

lestriosis in horse in hakkari, eastern region of

Turkey. Rev. Med. Vet.,158: 534-539. HAJSOLEIMANI, F., ATAEIAN, A., NOURIAN, A.A.

AND MAZLOOMZADEH, S., 2012.

Seroprevalence of Toxoplasma gondii in pregnant

women and bioassay ofIgM positive cases in

Zanjan, Northwest of Iran. Iran. J.Parasitol.,7: 82–

86.

HARFOUSH, M. AND TAHOON, A.N., 2010 Seroprevalence of

Toxoplasma gondii antibodies in domestic ducks,free-range

chickens, turkeys and rabbits in Kafr El-Sheikh Governorate

Egypt. J. Egypt. Soc. Parasitol., 40: 295-302. HASSAN, S.F., 2011. Seroprevalence of toxoplasmosis among

comers to marriage in Kerbala governorate. Ker. J.Pharmaceut.

Sci.,2: 97-102. HILL,D. AND DUBEY, J.P., 2002. Toxoplasma gondii:

transmission, diagnosis and prevention. Clin.

Microbiol.Infect.,8: 634–640. HOLZWORTH, J. 1987. Caring for cat. J. Am. Vet. Med.Assoc.,191:

794-796 JONES, J.L. AND ROBERTS, J.M., 2013. Toxoplasmosis

hospitalizations in the United States. 2008, and Trends, 1993–

2008. Cent. Infect. Dis., 54: 58-61 KHAN, S.N., KHAN, S., AYAZ, S., JAN, A.H., JEHANGIR, S.,

ATTAULLAH, S., ALI, J. AND SHAMS, S., 2011.

Seroprevalance and risk factors of toxoplasmosis among

pregnant women in district Kohat, Khyber Pakhtunkhwa

Pakistan. World appl. Sci. J., 14: 1032-1036. LEE, S.E., HONG, S.E., LEE, S.E., JEONG, Y.I., LIM, S.U.,

KWON, O.W., KIM, S.H., YOU, Y.S., CHO, S.H. AND LEE,

W.J., 2012. Detection of ocular Toxoplasmagondii infection in

chronic irregular recurrent uveitis byPCR. Korean J. Parasitol.,

50: 229-231. MORI, F.M.R., BREGANÓ, R.M., CAPOBIANGO, J.D., INOUE,

I.T., REICHE, E.M.V., MORIMOTO, H.K., CASELLA,

A.M.B., BITTENCOURT, L.H.F., FREIRE, R.L. AND

NAVARRO, I.T., 2011. Programs for control of congenital

toxoplasmosis. Rev. Assoc.Med. Bras.,57: 581-586. MURAO, T., OMATA, Y., KANO, R., MURATA, S., OKADA, T.,

KONNAI, S., ASAKAWA, M., OHASHI, K. AND ONUMA,

M., 2008. Serological survey of Toxoplasma gondii in wild

waterfowl in Chukotka,Kamchatka, Russia and Hokkaido,

Japan. J. Parasitol., 94: 830–833. NICOLLE, C. AND MANCEAUX, L., 1908. Sur une infection a`

corps de Leishman (ou organismes voisins) du gondi. C. R.

Hebd. Sean. Acad. Sci., 147:763–766. PINOWSKI, J., NIEWIADÖWSKA, A., JURICOVÁ, Z.,

LITERÁK, I. AND ROMANOWSKI, J., 1999. Chlorinated

aromatic hydrocarbons in the brains and lipids of sparrows

(passer domesticus and passer montanus) from rural and

suburban areas near warsaw. Bull. environ. Contam.

Toxicol.,63:736-43. ROBERT-GANGNEUXA, F. AND DARDE, M.L., 2012.

Epidemiology of and Diagnostic Strategies for Toxoplasmosis.

Clini. Microbiol. Rev., 25: 264–296. doi:10.1128/CMR.05013-

11. SCHLUNDT,J., TOYOFUKU, H., JANSEN, J. AND HERBST, S.A.,

2004. Emerging food-borne diseases. Rev. Sci. Tech.,23: 513-

533. SHAH, M., ZAHID, M., STHANADAR, A.A., PIR, A., KAUSAR,

A. AND JAN, A.H., 2013a. Seroprevalenceof Toxoplasma

gondii infection in domestic animals of Mohmand agency,

Pakistan. J. Coast. Life. Med., 1: 70-73. SHAH, M., ZAHID, M., ASMAT, P. AND STHANADAR, A.A.,

2013b. Seroprevalence of Toxoplasma gondii in goats and

sheep of district Mardan, Pakistan. Int. J.Biosci.,3: 90-97.

151

SHAH, M., ZAHID, M., STHANADAR, A.A. AND ASMAT,

P., 2014. Seroprevalence of Toxoplasma gondii

infection in human population of Mohmand Agency,

Pakistan. Pakistan J. Zool., 46: 1169-1172. SELSELEH,M., MODARRESSI, M.H., ALI, M.M.,

SHOJAEE, S., ESHRAGIAN, M.R., SELSELEH, M.,

AZIZ, E. AND KESHAVARZ, H., 2012. Real-Time

RT-PCR on SAG1 and BAG1 gene expression during

stage conversion in immunosuppressed mice infected

with Toxoplasma gondii, Tehran. Strain. Korean.

J.Parasitol.,3: 199-205. SIBLEY,L.D., KHAN, A., AJIOKA, J.W. AND ROSENTHAL,

B.M., 2009. Genetic diversity of Toxoplasma gondii in

animals and humans. Phil. Trans. R. Soc. B.,364: 2749-2761.

STORMOEN, M., THARALDSEN, J. AND HOPP, P., 2012.

Seroprevalence of Toxoplasma gondii infection in

Norwegian dairy goats. Acta Vet. Scand., 54: 75. TILAHUN, G., TIAO, N., FERREIRA, L.R., CHOUDHARY,

S., OLIVEIRA, S., VERMA, S.K., KWOK, O.C.,

MOLLA, B., SAVILLE, W.J., MEDHIN, G., KASSA,

T., ALEME, H., GEBREYES, W.A., SU, C. AND

DUBEY, J.P., 2013. Prevalence of Toxoplasma gondii

from free-range chickens (Gallus domesticus) from

Addis Ababa, Ethiopia 2013. J. Parasitol., 99: 740-1. WEBSTER, J.P., 2007. The effect of Toxoplasma gondii

onanimal behavior: Playing cat and mouse. Schizophr. Bull.,33: 752–756.

WEISS, L.M. AND DUBEY, J.P., 2009. Toxoplasmosis: a history

of clinical observations. Int. J. Parasitol., 39: 895–901. WU, S.M., HUANG, S.Y., BQ, F.U., LIU, G.Y., CHEN, J.X.,

CHEN, M.X., YUAN, Z.G., ZHOU, D.H., WENG, Y.B.,

ZHU, X.Q. AND YE, D.H., 2011. Seroprevalence of

Toxoplasma gondii infection in pet dogs in Lanzhou,

Northwest China. Parasitol. Vect., 4:64. XU, P., SONG, X., WANG, W., WANG, F., CAO, L. AND LIU,

Q., 2012. Seroprevalence of Toxoplasma gondii infection

in chickens in Jinzhou, northeastern China. J.Parasitol.,

98: 1300-1 YAN, C., YUE, C.L., YUAN, Z.G., HE, Y., YIN, C.C., LIN, R.Q.,

DUBEY, J.P. AND ZHU, X.Q., 2009. Toxoplasma gondii

infection in domestic ducks, free-range and caged chickens

in southern China. Vet.Parasitol.,165: 337–340. ZAKI, M., 1995. Seroprevalence of Toxoplasma gondii in

domestic animals in Pakistan. J. Pak. med Assoc., 45: 4-5. ZHAO, G., SHEN, B., XIE, Q., XU, L.X., YAN, R.F., SONG,

X.K., HASSAN, I.A. AND LI, X.R., 2012. Detection of

Toxoplasma gondii in free-range chickens in Chinabased

on circulating antigens and antibodies. Vet.Parasitol.185:

72-77. ZHOU, P., CHEN, Z., LI, H.L., ZHENG, H.L., SHENYI, H.E.,

LIN, R.Q. AND HU, X.Q., 2011. Toxoplasma gondii

infection in humans in China. Parasit. Vect., 4: 165.

(Received 1 September 2014, revised 25 September 2014.

152

International Journal of Fauna and Biological Studies 2018; 5(6): 18-22

ISSN 2347-2677 IJFBS 2018; 5(6): 18-22 Received: 11-09-2018 Accepted: 15-10-2018 Muhammad Taimur Khan

Department of Zoology,

Government Post Graduate

College, Charsadda, Pakistan Jalal Ud Din Department of Biotechnology, Faculty of Chemical and Life Sciences, Abdul Wali Khan University Mardan (AWKUM), Mardan, Pakistan Sajid Ali Department of Biotechnology, Faculty of Chemical and Life Sciences, Abdul Wali Khan University Mardan (AWKUM), Mardan, Pakistan Abid kamal Department of Zoology, Government Post Graduate College Charsadda, Pakistan Arab Hussain Department of Zoology, Government Post Graduate College Charsadda, Pakistan Ahmad Yar Department of Zoology, Government Post Graduate College Charsadda, Pakistan Hira Bibi Department of Biochemistry, Abdul Wali Khan University Mardan, Pakistan Hasnainjan Department of Biotechnology Quaid-izam University Islamabad, Pakistan Shah Faisal Department of Biotechnology Bacha Khan University Charsadda, KPK, Pakistan

Correspondence Shah Faisal Department of Biotechnology

Bacha Khan University

Charsadda, KPK, Pakistan

Seroprevalence of toxoplasma gondii infection in cows

and goats of district Charsadda, Khyber Pakhtunkhwa,

Pakistan

Muhammad Taimur Khan, Jalal Ud Din, Sajid Ali, Abid kamal, Arab

Hussain, Ahmad Yar, Hira Bibi, Hasnainjan and Shah Faisal

Abstract Toxoplasma gondii is a globally distributed protozoan parasite. This study was performed to find out theseroprevalence of Toxoplasma gondii in Cows and Goats in District Charsadda. A total of 288

samples 139 from Cows and 149 from Goats were xi collected and examined by latex agglutination test.

Out of 139 cow 77(55.39%) were detected seropositive for Toxoplasmosis and out of 149 Goats 62(41.61%) were found seropositive. In Cow, a high seroprevalence rate of (80.00%) was obtained in age

group of above 03 to 4 years while in Goats; the highest seroprevalence rate of (57.14%) was detected in age group Two to three year. In Cow the seroprevalence rate was higher in female (61.95% as compared

to male (42.55%) In Goats the seroprevalence rate was higher in female (47.31%) as compared to male (32.14%). The present study shows that the prevalence in Cow and Goats is higher in District Charsadda,

which is a risk factor for human infection. Therefore, proper control measure should be taken to avoid infection of Toxoplasmosis. Keywords: toxoplasmosis,Toxoplasma gondii Seroprevalence, cowsandgoats 1. Introduction

Toxoplasma gondii is an intracellular protozoan parasite[1]

. Toxoplasma gondii is

globallydistributed and a causative agent of toxoplasmosis [2]

. Toxoplasmosis is a parasitic

zoonotic disease that causes serious reproductive and economic losses all over the world [3]

. It has been estimated that approximately one third of the world’s population has been infected

with toxoplasma gondii [4]

. Toxoplasma is capable of infecting almost all the warm blooded

animalsin most part of the world and is estimated to infect 4 to 77% of humans [5]

. It especially affects immunosuppressed individuals, causing serious damage to the central

nervous system and also has a clinical impact on the unborn foetus [6]

. Its infection is generally caused by ingesting the Oocyst stage, reaching to body tissues via water and food contacted by

cat’s faeces [7]

. The condition is also passed via placenta from mother to offspring while

feeding the child during pregnancy [8]

. The other routes of T. gondii infection are vertical

organ transplantation and blood transfusion [9]

. As toxoplasma gondii is cosmopolitan in

distribution [1]

. For evaluating the comparative significance of wide causes of toxoplasmosis in humans, epidemiological survey still remains the main important approach. There have been a wide range of serological surveys conducted in different countries to determine the prevalence of toxoplasmosis in farm animals and humans; from north and South America, Europe, Africa

and Asia [5, 10, 11, 12]

. Diagnosis of toxoplasmosis can be aided by serologic or histocytologic examination, but serologic test are the usual means for establishing the diagnosis. Clinical signs of toxoplasmosis are nonspecific and cannot be depended on for a definite diagnosis.

Toxoplasmosis clinically mimics several other infectious diseases [13]

. Parasites enter gastrointestinal cells, after their release from cysts or oocysts, where they multiply, disrupt

cells, and infect contiguous cells [14]

. Organisms may spread first to the mesenteric lymph nodes and then to distant organs by invasion of lymphatics and blood stream. T. gondii infects all cell types, and cell invasion occurs as an active process. Then it generates the formation of

a parasite- porous vacuole which does not fuse with intracellular organelles [14]

. The aim of the current study was to determine the seroprevalence of toxoplasmosis infection in cows and goats in Charsadda, KPK Pakistan.

~ 18 ~

153

International Journal of Fauna and Biological Studies

2. Material and Methods

2.1 Study area Area of the study is conducted in district Charsadda. Charsadda is a town and headquarters of Charsadda District, in the Khyber Pakhtunkwa province of Pakistan

2.2 Sample size A total of 288 samples, 139 samples of Cows and 149 samples of

Goats were collected from different parts of district Charsadda

and examined for seroprevalence of T. gondii

2.3 Collection of blood 3-5 ml of blood was collected from jugular vein by using 5 ml of clean syringe. Blood was then centrifuge at 3500 rpm and

for 10 minutes to collect the serum.

2.4 Test procedure The test procedure was performed according to standard protocol and manufacturer of the company Toxo latex

agglutination test is performed using “toxo latex kit” of “Spin

react” company “Spain”. After obtaining serum, 20 micro litre

serum is added to the glass slide, and then 20 micro litre of

toxo latex reagent is added to the slide and mix with the

helpof stirrer for three minutes. After mixing it is studied for

positive and negative.

3. Results 3.1 Overall prevalence of Toxoplasma gondii in Cows and

Goats A total of 288 animals including Goats and Cows from

different localities (Tehsil Charsadda, Tehsil Tangi, Tehsil

shabqadar) of District Charsadda, Pakistan were examined for

the presence of T. gondii antibodies. Out of 288 animals 77

(55.39%) were detected positive for T. gondii in Cows and

62(41.61%) were detected in Goats. A high percentage of

infection was found in Cows as compared to Goats which is

show in (Table 1).

Table 1: Overall prevalence oftoxoplasma gondiiinCowsandGoats

Animals Total no of samples Positive samples Negative sample Positive % Cows 139 77 62 55.39% Goats 149 62 87 41.61%

3.2 Prevalence of Toxoplasma gondii in Cows and Goats of

the three Tehsils As this study was conducted in different Tehsils of district

Charsadda (Tehsil Charsadda, Tehsil Tangi and Tehsil

shabqadar). A total of 58, 45 and 36 samples of Cows is collected from Tehsil Charsadda, Tehsil Tangi and Tehsil

shabqadar in which 31(53.44%), 30(66.66%) and 16(44.44%)

were seropositive respectively. A total of 65, 61 and 23

samples of Goats is collected from the three Tehsils of district

Charsadda in which 30 (46.15%), 20 (32.78%) and 12

(52.17%) were seropositive in Tehsil Charsadda, Tangi and

shabqadar respectively which is show in (Table 2, 3).

Table 2: Prevalence ofT. gondiiinCowsof the three Tehsils

Tehsil Total sample Positive sample Negative samples Negative samples Tehsil Charsadda 58 31 27 53.44%

Tehsil Tangi 45 30 14 66.66% Tehsil shabqadar 36 16 20 44.44%

Total samples 139 77 62 41.61%

Table 3: Prevalence ofT. gondiiinGoatsof the three Tehsils

Tehsil Total sample Positive sample Negative samples positive %

Tehsil Charsadda 65 30 35 46.15%

Tehsil Tangi 61 20 41 32.78% Tehsil shabqadar 23 12 11 52.17%

Total samples 149 62 87 41.61%

3.3 Sex wise prevalence of Toxoplasma gondii of Cows and

Goats Out of 47 male Cows, 20 (42.55%) were detected

seropositive. In 92 examined female Cows, 57 (61.95%) were

detected seropositive for T. gondii infection. Out of 56

examined male Goats 18 (32.14%) were detected seropositive

for T. gondii antibodies while 44 (47.31%) out of 93 female

Goats were detected seropositive for T. gondii antibodies.

High seroprevalence of toxoplasmosis was seen in female

Cows as compared to male Cows. A significant difference

wasfound in the male of Cows and Goats. Similar results were

observed for male and female of Cows and Goats. Although

the percentage of infection in female Goats was higher

(47.31%) as compared to male Goats (32.14%) which is show

in (Table 4, 5).

Table 4: Sex wise prevalence of Toxoplasmosis ofCowsof the three Tehsils

Tehsil Total sample Female sample Male sample Positive % +ive -ive total +ive -ive -ive total Male female

Tehsil Charsadda 58 23 17 40 8 10 18 44.44% 57.5% Tehsil Tangi 45 25 7 32 5 8 13 38.46% 78.12%

Tehsil shabqadar 36 9 11 20 7 9 16 43.75% 45.00% Total 139 57 35 92 20 27 47 42.55% 61.95%

~ 19 ~

154


Table 5: Sex wise prevalence of Toxoplasmosis ofGoatsof the three Tehsils

Tehsil Total sample Female sample Male sample Positive % +ive -ive total +ive -ive total Male female

Tehsil Charsadda 65 22 18 40 8 17 25 32.00% 55.22% Tehsil Tangi 61 13 24 37 7 17 24 29.16% 35.13%

Tehsil shabqadar 239 9 7 16 3 4 7 42.85% 56.25% Total 149 44 49 93 38 56 56 32.14% 47.31%

3.4 Age wise prevalence of Toxoplasma gondii of

CowsToxoplasma gondii infection was also examined in

differentage groups of Cows. Out of 14 examined Cows whose age was up to one year 5 (35.71%) were detected

positive while 10 (52.63%) Cows were infected in age group

of 1 to 2 year in 19 examined samples. In age group of 2 to 3 year 18 (52.94%)

were seropositive in 34 examined samples. A high

seroprevalence 24 (80.00%) was found in age group of 3 to 4

year in 30 examined samples. In age group of 4 to 5 years 13

(52.00%) were seropositive in 25 examined samples, while 7

(41.17%) were seropositive in age group of above 5 years in

17 examined samples which is show in (Table 6).

Table 6: Age wise prevalence of toxoplasmosis amongCows

Age total sample positive sample negative sample positive % Up to one year 14 5 9 53.71%

One to two year 19 10 9 52.63% Two to three year 34 18 16 52.94% Three to four year 30 24 6 80.00% Four to five year 25 13 12 52.00% Above five year 17 7 10 41.17%

Total 139 77 62 55.39%

3.5 Age wise prevalence of Toxoplasma gondii of Goats.The prevalence also varied in different age groups of Goats

ranging from 30.00% to 57.14%. Out of 33 examined Goats

10 (30.30%) were seropositive in age group of upto 1 year. The T. gondii infection was found in 9 (25.71%) out of 35

samples in age group of 1 to 2 year. A high prevalence 24

(57.14%) was found in age group of 2 to 3 year out of 42

examined Goats. Out of 39 examined Goats 19 (48.71%)

were seropositive in age group of above three years which is

show in (Table 7).

Table 7: Age wise prevalence of toxoplasmosis amongGoats

Age Total sample Positive sample Negative sample Positive % Up to one year 33 10 23 30.30%

One to two year 33 9 26 25.71% Two to three year 42 24 18 57.14% Above three year 39 19 20 48.71%

Total 149 62 87 41.61%

4. Discussion The present study was conducted in order to know the seroprevalence of toxoplasma gondii infection. A total of 139 samples of Cows and 149 samples of Goats were collected and the result found were 55.39% and 41.61% respectively. Various studies carried out in other countries and other parts of Pakistan; have reported different contamination rates for T.gondii in Cows and Goats. This may be due to difference intime and season of sampling and also differences of sensitivities and specificities of assays used. T. gondii infection is widely distributed at a worldwide scale, with

incidences from zero to 100% in the different countries [15]

. The sero-prevalence rate of T. gondii was reported 17% in

Norway, 24% in Ethiopia 25.1% and 28.9% in Brazil [16, 17]

.

31% in Mexico, 52% in Pakistan, 59.8% in Bulgaria, 66% in

Czech Republic, and 67.9% in Zimbabwe [18, 19]

. Prevalence

of T. gondii infection of 41.61% found in sera of Goats

inpresent study is higher than 35.5% from Malaysia[20]

.

Greece 30.7 %, Brazil 30.6 % [21]

. Mexico 31 %, Thailand

27.9 %, Pakistan 14.32%, Egypt 28.7%, Bangladesh 32%, China 10%, China 14.1%, but is lower than that reported from Romania 52.8 %, Pakistan 53.84 %, Zimbabwe 67.9 %, Bangladesh 61.0 %, Pakistan 52 %, Stara Zagora Region 59,8%, but the results reported in Pakistan 42.28%, 42.8 % and West Indies 42.8 % Goats were reported from West Indies is

nearly same to the result of the present study

[27]. A high

prevalence of T. gondii infection was observed in females as compared to male Goats which are similar to the previously

conducted studies [22, 23]

. In Cows the prevalence of T. gondii

is greater in females as compared to male Cows as reported in

South East Iran [24]

. It is not possible to compare

prevalencedata of studies because of the use of different serological tests with variable specificity and sensitivity. Warm and humid environmental conditions are favourable for

the spread of toxoplasmosis [5]

. Prevalence of toxoplasma

gondii infection during this study in Cows is 55.39% which is higher than Egypt 23.6 %, Sudan 32 %, sudan 44.8 %, New Caledonia 33%, Southern China 5.7 %, Bangladesh 12 %, China 11 %, Bangladesh 27 %, Iran 1.6 %, Assam 26.66 %, Pakistan 19.75 %, Pakistan 20%, Algaria 3.92 %, Brazil 1.03 %, Somalia 7.1 %, But is lower than Iran 71.3 %, Brazil

83.40 % [25, 26]

. The differences in the results of

toxoplasmosis is due to various reasons, some factors depend on the climatic conditions, temperature, humidity and hygienic conditions hygienic condition is the major factor in the spread of toxoplasmosis. It is not possible to compare prevalence dataof studies because of the use of different serological tests with variable specificity and sensitivity. Warm and humid environmental conditions are favorable for the spread of toxoplasmosis. Toxoplasma gondii infection is high in regions

~ 20 ~

155


where the people eat undercooked meat, unwashed vegetables

and fruits and the people who have contact with cats and dogs or other domestic animals or have direct contact with the soil.

Toxoplasmosis is more common in those areas where people drink municipal water.

5. Conclusion The aim of the present study is to know the seroprevalence of

toxoplasma gondii in district Charsadda Pakistan. This

studydemonstrated that toxoplasmosis is prevalent in both the

sexes (male and female) and all age groups of Cows and

Goats in District Charsadda, Pakistan. The percentage of

toxoplasmosis is greater in Cows as compared to Goats. In

Cows the percentage of toxoplasmosis is 55.39% in

139examined Cows and 41.61% in 149 examined Goats. In

Cows the prevalence is 53.44%, 66.66% and 44.44% in Tehsil

Charsadda, Tehsil Tangi, and Tehsil shabqadar respectively.

In Goats the prevalence recorded is 46.15%, 32.78% and

52.17% in in Tehsil Charsadda, Tehsil Tangi, and Tehsil

shabqadar respectively. In Cows the percentage is high in

female’s cows (61.95%) as compared to male (42.55%). In

Goats the percentage is also greater in females (47.31%)

thanmales (32.14%). In Cows the percentage is greater in age

group of three to four year (80.00%) in 30 examined Cows. In

goats the percentage is greater in age group of two to three

year (57.14%) in 42 examined Goats. The results found in this

study demonstrate that the prevalence rate is higher in

female’s Goats as compared to male Goats. It means that

older and female Goats possess low immunity to

toxoplasmosis. This study also demonstrates that infected

Cows and Goats may be a potential risk for human

toxoplasmosis. Therefore, proper measures should be taken

tocontrol and prevent toxoplasmosis in Goats and sheep in the

region.

6. Acknowledgment The authors are thankful to Mardan medical complex for providing us research facilities.

7. References 1. Zhou P, Chen Z, Li HL, Zheng H, He S, Lin RQ, et al. Toxoplasma gondii infection in humans in China. Parasites & vectors. 2011; 4(1):165. 2. Aspinall TV, Guy EC, Roberts KE, Joynson

DH, Hyde JE, Sims PF. Molecular evidence for multiple

Toxoplasmagondii infections in individual patients in

England and Wales: public health implications.

International journal for parasitology. 2003; 33(1):97-

103. 3. Hill DE, Chirukandoth S, Dubey JP. Biology and epidemiology of Toxoplasma gondii in man and animals. Animal Health Research Reviews. 2005;

6(1):41-61. 4. Wang S, Zhao GW, Wang W, Zhang ZC, Shen

B, Hassan IA, et al. Pathogenicity of five strains of Toxoplasma gondii from different animals to chickens.

The Korean journal of parasitology. 2015; 53(2):155. 5. Dubey JP, Hill DE, Jones JL, Hightower AW,

Kirkland E, Roberts JM, et al. Prevalence of viable

Toxoplasma gondii in beef, chicken, and pork from retail

meat stores in the United States: risk assessment to

consumers. Journal of Parasitology. 2005; 91(5):1082-

1093.

6. Khan A, Su C, German M, Storch GA,

Clifford DB,

Sibley LD. Genotyping of Toxoplasma gondii strains

from immunocompromised patients reveals high prevalence of type I strains. Journal of Clinical

Microbiology. 2005; 43(12):5881-5887. 7. Webster JP. Prevalence and transmission of Toxoplasma

gondii in wild brown rats, Rattusnorvegicus. Parasitology. 1994; 108(4):407-411.

8. Hajsoleimani F, Ataeian A, Nourian AA, Mazloomzadeh

S. Seroprevalence of Toxoplasma gondii in pregnant

women and bioassay of IgM positive cases in Zanjan,

Northwest of Iran. Iranian journal of parasitology. 2012;

7(2):82. 9. Foroutan-Rad M, Majidiani H, Dalvand S, Daryani A,

Kooti W, Saki J, et al. Toxoplasmosis in blood donors: a systematic review and meta-analysis. Transfusion

medicine reviews. 2016; 30(3):116-122. 10. Gilot-Fromont E, Aubert D, Belkilani S, Hermitte P,

Gibout O, Geers R, Villena I. Landscape, herd

management and within-herd seroprevalence of

Toxoplasma gondii in beef cattle herds from Champagne-

Ardenne, France. Veterinary parasitology. 2009; 161(1),

36-40. 11. Bisson A, Maley S, Rubaire-Akiiki CM, Wastling JM.

The seroprevalence of antibodies to Toxoplasma gondii in domestic goats in Uganda. Acta Tropica. 2000;

76(1):33-38. 12. Huang CQ, Lin YY, Dai AL, Li XH, Yang XY, Yuan

ZG, et al. Seroprevalence of Toxoplasma gondii infection

in breeding sows in Western Fujian Province, China.

Tropical animal health and production. 2010; 42(1):115.

13. Aresh N, Vishwa Bharathi HA, Chitra S. Serological

study for torch infection in women with bad obstetric

history by Nano Elisa method. History. 2015; 15(48):202-217.

14. Remington JS, Barnett CG, Meikel M, Lunde MN.

Toxoplasmosis and infectious mononucleosis. Archives of internal medicine. 1962; 110(5):744-753.

15. Prelezov P, Koinarski V, Georgieva D. Seroprevalence of

Toxoplasma gondii infection among sheep and goats in the Stara Zagora region. Bulgarian Journal of Veterinary

Medicine. 2008; 11(2):113-119. 16. Stormoen M, Tharaldsen J, Hopp P. Seroprevalence of

Toxoplasma gondii infection in Norwegian dairy goats. Acta Veterinaria Scandinavica, 2012; 54(1):75.

17. Cavalcante ACR, Carneiro M, Gouveia AMG, Pinheiro RR, Vitor RWA. Risk factors for infection by

Toxoplasma gondii in herds of goats in Ceará, Brazil. Arquivo Brasileiro de Medicina Veterinária e Zootecnia.

2008; 60(1):36-41. 18. Tasawar Z, Lashari MH, Hanif M, Hayat CS.

Seroprevalence of Toxoplasma gondii in domestic goats

in Multan, Punjab, Pakistan. Pak. J Life Soc. Sci. 2011; 9:24-7.

19. Hove T, Lind P, Mukaratirwa S. Seroprevalence of Toxoplasma gondii infection in goats and sheep in

Zimbabwe. Onder stepoort Journal of Veterinary

Research. 2005; 72(4):267-272. 20. Chandrawathani P, Nurulaini R, Zanin C, Premaalatha B,

Adnan M, Jamnah O, Seah TC. Research Note

Seroprevalence of Toxoplasma gondii antibodies in pigs,

goats, cattle, dogs and cats in peninsular Malaysia. Trop

Biomed. 2008; 25:257-258.

156


21. Neto JQF, Bloemhof-Ruwaard JM, van Nunen JA, van

Heck E. Designing and evaluating sustainable logistics networks. International Journal of Production Economics.

2008; 111(2):195-208. 22. Iovu A, Györke A, Mircean V, Gavrea R, Cozma V.

Seroprevalence of Toxoplasma gondii and Neospora

caninum in dairy goats from Romania. Veterinary

Parasitology. 2012; 186(3-4):470-474. 23. Ramzan M, Akhtar M, Muhammad F, Hussain I,

Hiszczyńska-Sawicka E, Haq AU, Hafeez MA. Seroprevalence of Toxoplasma gondii in sheep and goats

in Rahim Yar Khan (Punjab), Pakistan. Tropical animal

health and production. 2009; 41(7):1225. 24. Tzanidakis N, Maksimov P, Conraths FJ, Kiossis E,

Brozos C, Sotiraki S, Schares G. Toxoplasma gondii in sheep and goats: seroprevalence and potential risk factors under dairy husbandry practices. Veterinary Parasitology. 2012; 190(3-4):340-348.

25. Khalil KM, Elrayah IE. Seroprevalence of Toxoplasma gondii antibodies in farm animals (camels, cattle, and

sheep) in Sudan. Journal of Veterinary Medicine and

Animal Health. 2011; 3(3):36-39. 26. Shahiduzzaman M, Islam MR, Khatun MM, Batanova

TA, Kitoh K, Takashima Y. Toxoplasma gondii

seroprevalence in domestic animals and humans in

Mymensingh District, Bangladesh. Journal of Veterinary Medical Science. 2011; 73(10):1375-1376.

27. Chikweto A, Kumthekar S, Tiwari K, Nyack B, Deokar

MS, Stratton G, Dubey JP. Seroprevalence of

Toxoplasma gondii in pigs, sheep, goats, and cattle from

Grenada and Carriacou, West Indies. Journal of

Parasitology. 2011; 97(5):950-951.

~ 22 ~

Arab Hussain Zoology 2020 icp peshwar.pdf

Documents

Transcript of Arab Hussain Zoology 2020 icp peshwar.pdf