This article was downloaded by: [Indian Agricultural Research Institute ]On: 29 June 2013, At: 01:59Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registeredoffice: Mortimer House, 37-41 Mortimer Street, London W1T 3JH, UK

Archives Of Phytopathology And PlantProtectionPublication details, including instructions for authors andsubscription information:http://www.tandfonline.com/loi/gapp20

Antisense RNA approach targeting Repgene of Mungbean yellow mosaic Indiavirus to develop resistance in soybeanVeer B. Singh a b , Q.M.R. Haq b & V.G. Malathi aa Advanced Centre for Plant Virology, Division of Plant Pathology ,Indian Agricultural Research Institute , New Delhi , Indiab Department of Biosciences , Jamia Millia Islamia (A CentralUniversity) , New Delhi , IndiaPublished online: 28 Jun 2013.

To cite this article: Veer B. Singh , Q.M.R. Haq & V.G. Malathi (2013): Antisense RNA approachtargeting Rep gene of Mungbean yellow mosaic India virus to develop resistance in soybean,Archives Of Phytopathology And Plant Protection, DOI:10.1080/03235408.2013.787751

To link to this article: http://dx.doi.org/10.1080/03235408.2013.787751

PLEASE SCROLL DOWN FOR ARTICLE

Full terms and conditions of use: http://www.tandfonline.com/page/terms-and-conditions

This article may be used for research, teaching, and private study purposes. Anysubstantial or systematic reproduction, redistribution, reselling, loan, sub-licensing,systematic supply, or distribution in any form to anyone is expressly forbidden.

The publisher does not give any warranty express or implied or make any representationthat the contents will be complete or accurate or up to date. The accuracy of anyinstructions, formulae, and drug doses should be independently verified with primarysources. The publisher shall not be liable for any loss, actions, claims, proceedings,demand, or costs or damages whatsoever or howsoever caused arising directly orindirectly in connection with or arising out of the use of this material.

Antisense RNA approach targeting Rep gene of Mungbean yellowmosaic India virus to develop resistance in soybean

Veer B. Singha,b, Q.M.R. Haqb and V.G. Malathia*

aAdvanced Centre for Plant Virology, Division of Plant Pathology, Indian Agricultural ResearchInstitute, New Delhi, India; bDepartment of Biosciences, Jamia Millia Islamia (A CentralUniversity), New Delhi, India

(Received 6 March 2013; final version received 18 March 2013)

The Yellow mosaic disease is caused by Mungbean yellow mosaic India virus(MYMIV) and Mungbean yellow mosaic virus (MYMV) belonging to the genusBegomovirus of the family Geminiviridae. Yellow mosaic disease (YMD) is a majorconstraint to the production of soybean in South-East Asia. In India, yield losses of10–88% had been reported due to YMD of soybean. An effort has been made togenerate resistant soybean plants, by a construct targeting replication initiationprotein (Rep) gene sequences of MYMIV. A construct containing the sequences ofRep gene (566 bp) in antisense orientation was used to transform cotyledonary nodeexplants of three soybean cultivars (JS 335, JS 95-60 and NRC 37). Transformationefficiencies of 0.2, 0.21 and 0.24% were obtained with three soybean cultivars,JS 335, JS 95-60 and NRC 37, respectively. The presence of transgene in T1 plantswas confirmed by polymerase chain reaction (PCR) and sequence analysis. Thelevel of resistance was observed by challenge inoculation with the virus in T1 lines.The inheritance of transgene showed classical Mendelian pattern in six transgeniclines.

Keywords: Begomovirus; RNAi; PDR; yellow mosaic virus; legumes

India is a major soybean-producing country ranking fifth in global production ofsoybean. About 4% of the total world production is contributed by India. Grains are animportant constituent in the vegetarian diet of majority of Indian population. Soy meal,soy flour, soy milk, tofu, textured vegetable protein tempeh, soy lecithin and soybeanoil are some valuable products of food processing industries.

The most important constraint in production is susceptibility of this crop to viraldiseases such as, yellow mosaic disease (YMD), which is caused by either Mungbeanyellow mosaic virus (MYMV) or Mungbean yellow mosaic India virus (MYMIV). InIndia, yield losses of 10–88% had been reported due to YMD of soybean. Thecharacteristic symptoms of YMD are scattered small specks or yellow spots in the leaflamina, which later enlarge to irregular yellow and green patches alternating with eachother on matured leaves (Malathi 2007; and Varma et al. 2011). The MYMIV andMYMV are the most important viral species because they have a wide host range andinfect all legumes like soybean (Glycine max), blackgram (Vigna mungo), mungbean(Vigna radiata), French bean (Phaseolus vulgaris), pigeonpea (Cajanus cajan) and cow-

*Corresponding author. Email: vgmalathi@rediffmail.com

Archives of Phytopathology and Plant Protection, 2013http://dx.doi.org/10.1080/03235408.2013.787751

� 2013 Taylor & Francis

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

pea (Vigna unguiculata). These two virus species belong to the genus Begomovirus,which includes viruses having typical geminate particle morphology with either bipartiteor monopartite genome. In a bipartite genome, there are two circular single stranded(ss) DNA components, DNA A (�2.7 kb) and DNA B (�2.6 kb) circular singlestranded (ss) DNA components.

Since MYMIV infection occurs in most of the cultivated areas in India, it is neces-sary to develop resistance in soybean against MYMIV. There is no report on the avail-ability of genetic resistance in soybean. But resistances are found in bean against beangolden mosaic virus (Bonfim et al. 2007) and blackgram against MYMV (Poogginet al. 2003). The only option in these circumstances is to achieve resistance usinggenetic engineering against begomoviruses. Viral gene silencing, also known as RNAinterference (RNAi) is one approach looked upon and developed for studying genefunction and for engineering virus resistance (Tenllado et al. 2004). RNAi can occureither through repression of transcription [transcriptional gene silencing (TGS)] or bymRNA degradation [post-transcriptional gene silencing (PTGS)] (Buchmann et al.2009; and Rodriguez-Negrete et al. 2009). In PTGS, dsRNA is formed by the RNA-dependent RNA polymerase, which is targeted by dsRNA-specific RNAses calledDICER, and digested into small 21–25 nt siRNAs. The two strands of small RNA getseparated and only a single strand of siRNA is incorporated into RNA-induced silenc-ing complex and used as guides in the specific binding (by complementary base pair-ing) and destruction of the targeted mRNA molecules.

RNAi is triggered by the expression of dsRNAs complementary to the viralsequences, which can be achieved by either the expression of transgenes in the senseand/or antisense orientation, as in co-suppression, in which expression is silenced byhomologous viral genes or by hairpin construct having target sequences in sense andantisense orientation, separated by an non-coding intron sequence. Intron is spliced posttranscriptionally to form dsRNA with a hairpin structure.

PTGS has been demonstrated in the development of resistance against the begom-oviruses species like, African cassava mosaic virus using targeting replication initiationprotein (Rep) gene (Chellappan et al. 2004), DNA-A bidirectional promoter (Vander-schuren et al. 2007) and chemically synthesised siRNA to Rep mRNA (Vanitharaniet al. 2003); MYMV using DNA-A bidirectional promoter (Pooggin et al. 2003);Tomato yellow leaf curl virus using Rep gene (Abhary et al. 2006; Fuentes et al. 2006),Coat protein (CP) gene (Zrachya et al. 2007); Bean golden mosaic virus using Repgene (Bonfim et al. 2007); Tomato leaf curl virus (ToLCV) using Rep gene and AC4gene (Ramesh et al. 2007); Srilankan cassava mosaic virus using Rep gene; and EastAfrican cassava mosaic virus using Rep gene (Chellappan et al. 2004).

Over the past decade; many methodologies are available to develop transgenic soy-bean plants. Two methods can be distinguished on the basis of DNA delivery. Theyare, Agrobacterium-mediated T-DNA transfer in axillary meristematic tissue of cotyle-donary nodes (Hinchee et al. 1988; Olhoft et al. 2003), immature seeds (Parrott et al.1989; Yan et al. 2000); embryogenic suspension cultures (Trick and Finer 1998);embryonic tip (Liu et al. 2004); hypocotyl (Geliang and Yinong 2008); infection of ger-minating seeds (Christou et al. 1989); half seed (Paz et al. 2006) and cotyledonarynodal callus (Sairam et al. 2003). Alternatively, microprojectile bombardment of DNA-coated carrier particles are used for somatic embryo (Liu et al. 1996; and Samoylovet al. 1998; Reddy et al. 2003), shoot meristems (McCabe et al. 1988); embryogenicsuspension cultures (Finer and McMullen 1991; El-Shemy et al. 2006) and embryonicaxes (Christou et al. 1989).

2 V.B. Singh et al.

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

Several constraints have been experienced in the production of soybean transgenicplants: first, transfer of T-DNA from Agrobacterium to the explants; second, selectionof proliferating transgenic cells and regenerated shoots; and third plant regeneration(Olhoft et al. 2003). Due to increases in YMD disease spread and severity and lack ofgenetic resistance, a programme was initiated to develop transgenic resistance againstMYMIV Rep gene. The present study focuses on Agrobacterium-mediated DNA deliv-ery direct and transformation by shoot organogenesis from cotyledonary node in threepopular Indian cultivars (JS 335, JS 95-60 and NRC 37).

Materials and methods

Antisense RNA construct preparation

Antisense RNA constructs targeting replicase gene (ORF AC1) of MYMIV (Soybeanisolate, Gene Bank Accession No. AY049772) was made in antisense orientation underCauliflower mosaic virus 35S (CaMV 35S) promoter in a pBinAR binary vector. Theantisense Rep primers (Table 1) were designed, targeting 1537 nt to 2103 nt region ofRep gene of MYMIV. This region, representing 235 amino acid residues, is the mosthighly conserved part of Rep gene in all begomoviruses. The polymerase chain reaction(PCR) was done using DNA A clone of MYMIV (Gene Bank Accession No.AY049772). Amplicons have BamHI site at 5′ terminus and XbaI site at 3′ terminalend. The PCR fragment was gel eluted with the help of gel elution kit (QAIGEN) andrestricted with BamHI (Fermentas) at 37 °C for 2–3 h. After heat shock at 80 °C for20min, the fragment was again restricted with XbaI (Fermentas). The vector pBinARwas also restricted with BamHI and XbaI. The purified insert and vector were ligatedby T4 DNA ligase enzyme (Fermentas). Competent cells of DH5α strain of Escherichiacoli were transformed with ligated product. The plasmids were isolated (Sambrooket al. 1989), and clones (pBinantiRep) were confirmed with the BamHI/XbaI restriction.The insertion of Rep gene in antisense orientation was further confirmed by sequencing.

Preparation of agrobacterium culture

The confirmed colony of pBinantiRep was mobilised into Agrobacterium tumefaciensstrain EHA105 by triparental mating method (Ditta et al. 1980). Agrobacterium colonies

Table 1. Primers used for amplification of different region.

Region Primer name Sequence (5′–3′)Productsize (bp)

Antisense Rep RepSoyV ATTGGATCCAATCAATTCGAGAGCGTC 566RepSoyC GGCTCTAGAGCCTACACAGGCATATGAG

CaMV 35Spromoter

35S forward ATGGAGTCAAAGATTCAAATA 525

35S reverse GTGTCCTCTCCAAATGAAAKanamycin Kan forward CATGGATCCATGGCTAAAATGAG 500

Kan reverse TCGTCTAGACTAAAACAATTCATCCAGCoat Protein of

MYMIVAV1 C108 ACAAAGCTTTGTACCAAAAGGTCGTCTGTC �250

AV1 N75 GGTGGATCCCCATGTAAAGTTCAATCA

Archives of Phytopathology and Plant Protection 3

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

were confirmed by colony PCR using gene-specific primer for antisense rep gene. Theconfirmed single colony (pBinantiRep) of A. tumefaciens strain EHA105 havingantisense Rep gene was maintained on Luria Agar (LA), containing rifampicin (30 μg/ml) and kanamycin (50 μg/ml). The colony was inoculated in 5ml LB medium, supple-mented with 30 μg/ml rifampicin and 50 μg/ml kanamycin and kept in a shaker at 28 °Cat 200 rpm for overnight. The overnight grown culture was reinoculated into 50ml LBmedium containing 30 μg/ml rifampicin and 50 μg/ml kanamycin and shaken at 28 °C at200 rpm until the OD600 reached 0.8–1.0. The bacterial culture was centrifuged for10min at 4000 rpm at 4 °C to pellet the cells. The pellet was subsequently washed in5ml liquid co-cultivation medium [(CCM-L), 1/10 B5 (Gamborg et al. 1968) mediumsupplemented with 6-benzylaminopurine (BAP) 1.67mg/l, acetosyringone 0.2mM,L-cysteine 8.8mM, sodium thiosulfate 1mM, and dithiothretol (DTT) 1mM, pH 5.4].The suspended culture was again centrifuged at 4 °C for 10min at 4000 rpm to pelletthe cells. A. tumefaciens pellet was finally suspended in liquid co-cultivation medium toreach the OD600 0.5.

Transformation

The transgenic soybean explants were regenerated following a modified protocol ofOlhoft et al. (2003). Three Indian soybean cultivars viz. JS 335, JS 95-60 and NRC 37were used for this study. The cotyledonary nodes were excised from the 5–6-day-oldseedling and approximately 300 explants were incubated with the 100ml of suspensionculture of Agrobacterium for 30min. After incubation, five explants were placed in eachPetri-dish (90mm diameter� 15mm deep) with adaxial side down on a sterile 1MWhatman #1 filter paper, layered on solid co-cultivation medium [(CCM-S) 1/10 B5medium supplemented with Agar 0.6%, BAP 1.67mg/l, acetosyringone 0.2mM,L-cysteine 3.3mM, sodium thiosulfate 1mM and DTT 1mM, pH 5.4] (Figure 1(a)).The Petri-dishes were sealed with parafilm “M” and incubated at 25 °C for 2–3 days indarkness. After three days, the explants were thoroughly washed in liquid shoot induc-tion medium [(SIM-L) full B5 medium without agar supplemented with 3% sucrose,BAP 1.67mg/l, Cefotaxime 300mg/l, Augmentin 70mg/l, Carbenecillin 100mg/l andpH 5.8] and dried on the sterile 1M Whatman filter paper to remove excess A. tumefac-iens on explants. The explants were placed on solid shoot induction medium [(SIM-S)liquid shoot induction medium with 0.7% agar] for 10–12 days with antibiotic selection(Figure 1(b)). After two weeks, the explants were placed in shoot elongation medium[(SEM) full MS medium (Murashige and Skoog 1962) supplemented with 3% sucrose,0.7% agar, Gibbrellic acid (GA3) 0.750mg/l, Cefotaxime 300mg/l, Augmentin 70mg/land Carbenecillin 100mg/l pH 5.8] (Figure 1(c)). After 12 days in SEM with antibioticselection, shoots surviving in the selection medium were transformed to rooting medium(Figure 1(d)) and then hardening medium (Figure 1(e)). The T0 plants were shifted toNational Phytotron Facility for maturity and production of seed (Figure 1(f)).

Experiment to assess sensitivity of soybean explants to kanamycin

After 2–3 days incubation in CCM-S medium, the cotyledonary node explants wereplaced in SIM-S supplemented with different concentrations of kanamycin (50mg/l,100mg/l, 200mg/l, 300mg/l, 400mg/l and 500mg/l). The experiments were performedin six replicates and each replicate had 1000 explants.

4 V.B. Singh et al.

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

Figure 1. Transformation of soybean using antisense Rep construct (pBinantiRep). (a) explantsin co-cultivation solid medium, (b) single shoot emerged in shoot induction solid medium fromeach explants, (c) explants in elongation medium, (d) transformed explants in rooting medium, (e)putative explants in hardening medium, (f) well developed T0 explants in National PhytotronFacility under the control condition, and (g) testing explants after challenge inoculation withMYMIV, the plants showed yellow mosaic area alternating with green mosaic one month postinoculation.

Archives of Phytopathology and Plant Protection 5

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

PCR and sequence analysis

Genomic DNA was extracted from 100mg of leaf tissue from transformed and non-transformed (control) plants, according to Gem-CTAB method (Rouhibakhsh et al.2008). The concentration of genomic DNA was quantified in Nanodrop spectrophotom-eter and quality was checked by electrophoresis in 0.8% agarose gel. PCR analysis wasperformed to confirm the integration of antisense Rep gene in T0 plants of JS 335 (10plants), JS 95-60 (11 plants) and NRC 37 (13 plants) using a gene specific primer(RepSoyC/RepSoyV) (Table 1) to amplify 566 bp fragment. The anticipated size ofamplicons was confirmed on 1.2% agarose gel. PCR amplicons obtained withthree T0

plants from three cultivars [JS 335 (9), JS 95-60 (13) and NRC 37 (11)] were purifiedwith PCR purification kit (Invitrogen, CA, USA) and sequenced using an ABI-auto-mated sequencer at the Delhi South Campus, Delhi University, India. The nucleotideidentity of the PCR amplicon sequences were confirmed by alignment with sequence oforiginal clone (MYMIV, Accession No. AY049772) in the BioEdit programme (Hall1999). About 100 ng of genomic DNA of T1 lines was used for the PCR amplificationwith four sets of primers. These primers included (Table 1) 35Sforward/35Sreverse for35S promoter region, RepSoyC/RepSoyV for antisense Rep gene, nptIIforward/nptIIre-verse for nptII (neomycin phosphotransferase II) gene and 35Sfroward/RepSoyC for thecomplete cassette including 35S promoter and antisense Rep gene. The PCR ampliconswere electrophoresed on 1.2% agarose gel.

Southern blot hybridisation

About 100 μg of genomic DNA of putative transformants was used for Southern blothybridisation and performed according to Sambrook et al. (1989). Total genomic DNAwas digested with HindIII restriction enzyme in a reaction volume of 100 μl andincubated at 37 °C for 16–18 h. Restriction with HindIII, which has unique site in thepBinantiRep construct, is expected to generate a fragment of only one size, if it is asingle copy insertion; and multiple bands, if it is more than one copy. The restrictedDNA was electrophoresed in 0.8% (w/v) agarose gel and blotted on nitrocellulose mem-brane (MDI). The membranes were prehybridised in 10ml of prehybridisation solutionand kept in 65 °C for 3–4 h. The antisense Rep gene released by PCR was purifiedthrough PCR purification kit (Invitrogen) and labelled with random primers (Feinbergand Vogelstein 1983) Bangalore Genei kit. About 10 μl of α32P dCTP labelled 566 bpantisense Rep probe (0.5� 106 dpm/μl) was added at the concentration in the 10ml ofprehybridisation solution and kept in 65 °C hybridisation oven for overnight. The mem-branes were washed three times with 2� SSC, 0.1% SDS, each time for duration of15min. The image was captured in Phospho Imager (Perkin Elmer) and later transferredto X-ray film (Kodak).

Segregation analysis of transgene

The segregation of transgene in T2 generation was confirmed on the basis of PCRanalysis (transgene positive:transgene negative) conducted in T1 lines and performing aChi-square (χ2) analysis testing the segregation ratios, where significance wasdetermined for those values with a p-value greater than 0.05.

6 V.B. Singh et al.

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

Challenge inoculation to screen for MYMIV resistance

For this experiment, non-viruliferous whitefly belonging to genotype A II (De Barroet al. 2011), reared on egg plants in insect proof glasshouse, were used. The viruliferousinsects were checked by PCR with CP region primer of MYMIV-Sb DNA-A. Trans-genic plants (T2 generation) were analysed for their resistance to MYMIV by a veryhigh inoculation pressure, using 100 viruliferous whiteflies per cage hardly 4–6 plantsfor a period of up to 15 days, using 45 days old seedlings. The plants were kept in awarm (30 °C) and humid chamber (85%). A total of 176 T2 lines (from all three culti-vars) were tested for resistance. Twenty non-transgenic plants from each cultivar (JS335, JS 95-60 and NRC 37) were used as control and treated same as transgenic lines.After 10 days, whiteflies were killed with an insecticide (0.1% L-Rogor) and test plantswere transferred to an insect-free glasshouse for symptom development and evaluation.Observations were carried out daily until full disease symptoms had developed. Thepresence of viral DNA in test plant was examined one month after transfer to the glass-house. Genomic DNA was extracted from all the test plants by Gem-CTAB method(Rouhibakhsh et al. 2008). The presence of viral DNA was checked in test plants byamplifying CP fragment with specific primer (Table 1). The PCR amplicons were sepa-rated on 1.0% agarose gel to confirm the presence of CP gene.

Results

Selection of explants on kanamycin

One thousand explants were placed in each of the concentration of kanamycin for12 days. The efficiency of regeneration was found to be 41.1% on 25mg/l of kanamy-cin, 26.3% on 50mg/l and 12.5% on 100mg/l. Beyond 100mg/l, none of the explantssurvived. The explants produced tissue necrosis and no fresh shoots were produced inconcentration above 100mg/l. Therefore, for selection of transformants, explants werekept in SEM having 100mg/l kanamycin. After 12 days’ incubation in SIM-S on100mg/l of selection, newly emerging single shoots were observed.

Regeneration of transformed plants

Three popular Indian cultivars, i.e. JS 335, JS 95-60 and NRC 37, were transformedwith the antisense rep construct pBinantiRep using cot-node as explants. A total of1925 explants were transformed for JS 335 in 13 events, 2083 explants for JS 95-60 in13 events and 2032 explants for NRC 37 in 14 events (Table 2). Finally after passagethrough selection media, 10 plants rooted in cv. JS 335, 11in cv.JS 95-60 and 13 inNRC 37. Each T0 plants were given number according to the event’s number, for exam-ple JS 335 event No. 1 was marked as JS 335 (1). All T0 plants were taken for furtheranalysis of gene incorporation in progeny.

PCR analysis of putative transformed T0 plants

The putative tansformants were examined for the presence of transgene by PCR usinggene specific primer (RepSoyC/RepSoyV) (Table 1). PCR amplicon was electrophore-sed on 1.2% agarose gel. The expected size of fragment (566 bp) was observed in fourT0 plants of JS 335 [JS 335 (1), JS 335 (8), JS 335 (9) and JS 335 (11)], five T0 plantsof JS 95-60 [JS 95-60 (1), JS 95-60 (4), JS 95-60 (11), JS 95-60 (12), JS 95-60 (13)]

Archives of Phytopathology and Plant Protection 7

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

and four T0 plants of NRC 37 [NRC 37 (10), NRC 37 (11), NRC 37 (12), NRC 37(14)] (Table 2, Figure 2). The transformation efficiency was computed based on survivalof kanamycin-resistant explants. JS 335 had 0.21% transformation efficiency in fourevents, JS 95-60 had 0.24% in five events and NRC 37 had 0.20% in four events

Table 2. Transformation and regeneration efficiency in the three Indian soybean cultivars.

Soybeancultivars

No. ofevents

No. of explants fortransformation

No. ofregenerated

plantsTotal no. of PCRpositive plants

Transformationefficiency (%)a

JS 335 1 166 2 1 0.602 166 0 0 0.003 154 1 0 0.004 158 0 0 0.005 144 0 0 0.006 120 3 0 0.007 135 0 0 0.008 143 1 1 0.709 140 1 1 0.7110 168 1 0 0.0011 170 1 1 0.5912 155 0 0 0.0013 147 0 0 0.00

Total 13 1925 10 4 0.21JS 95-60 1 136 1 1 0.74

2 178 1 0 0.003 188 1 0 0.004 124 2 1 0.815 174 1 0 0.006 136 0 0 0.007 156 1 0 0.008 145 1 0 0.009 122 1 0 0.0010 170 0 0 0.0011 188 1 1 0.5312 176 1 1 0.5713 190 1 1 0.53

Total 13 2083 11 5 0.24NRC 37 1 144 2 0 0.00

2 122 1 0 0.003 112 1 0 0.004 114 2 0 0.005 124 0 0 0.006 128 1 0 0.007 114 1 0 0.008 133 0 0 0.009 178 0 0 0.0010 167 1 1 0.6011 189 1 1 0.5312 157 1 1 0.6413 151 0 0 0.0014 199 2 1 0.50

Total 14 2032 13 4 0.20Grand

Total40 6040 34 13 0.22

a(number of T0 plants PCR positive for transgene/total number {n} of explants inoculated)� 100].

8 V.B. Singh et al.

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

(Table 2). Overall transformation efficiency obtained was 0.22% with this method.These 13 T0 PCR-positive plants were planted for further generation of T1 plants.

Sequence analysis of transgene in putative transformant T0 explants

The nucleotide sequences of three T0 plants were aligned with MYMIV-Sb sequence.The sequence of JS 335 (9) plant found identity in the Rep region of MYMIV-Sb from1591 to 2098 bp (507 nt). JS 95-60 found similarity from 1591 to 2106 bp (515 nt) andfor NRC 37 from 1590 to 2106 bp (516 nt). Graphic representation of the multiplealignment result is presented in Figure 3. A near 100% sequence identity with MYMIVwas seen for the three amplicon from T0 plants.

PCR analysis of T1 lines

All T0 putative transformants were unable to produce the seeds. A total of 176 T1 seedsgerminated from 6 T0 plants, 45 from JS 335 (11), 26 from JS 95-60 (4), 62 from JS95-60 (13), 9 from NRC 37 (11), 16 from NRC 37 (12) and 18 from NRC 37 (14).

T1 plants of transgenic lines were analysed for the incorporation of the Rep andreporter transgenes. The expected size of amplicons were seen with different sets ofprimers: (1) 566 bp with Antisense Rep, (2) 525 bp with CaMV 35S promoter, (3)500 bp with nptII, and (4) a segment of 1091 bp length, with CaMV 35S promoterforward/antisense Rep reverse primers (Figure 4). From 176 seedlings, the expected sizeof antisense Rep amplicons was seen in 143 lines, but all four amplicons were seenonly in five lines of JS 335 (11), one line of JS 95-60 (4); two lines of JS 95-60 (13),two lines of NRC 37 (11), three lines of NRC 37 (12) and one line of NRC 37 (14).On the basis of PCR result, only 14 T1 lines were considered to be transformed withcomplete T-DNA.

Segregation pattern of transgene

A total of 176 T1 seedlings from 6 independently transformed plants were screened forphynotypic segregation analysis by PCR for antisense Rep transgene (Table 3). χ2

analysis suggested the segregation ratio to be 3:1 (antisense Rep positive: antisense Repnegative) and single functional locus of transgene for all the transformants in T1

generation. The p-value was calculated for all lines using the MSTATC programme.

1 2 3 4 5 6 7 8

566 bp

Figure 2. Agarose gel electrophoresis of PCR amplicons of T0 putative transformants ofsoybean using antisense Rep gene specific primer: Lane1-JS 335 (8); Lane2-JS 335 (9); Lane3-JS335(11); Lane4-JS-95-60 (4); Lane5-NRC-37 (12); Lane6-Control (MYMIV-Sb clone); Lane7-Healthy; and Lane8–1Kb DNA Ladder.

Archives of Phytopathology and Plant Protection 9

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

Figure3.

Multip

lealignm

entof

antisense

Rep

gene

sequ

encesof

transgenic

lines

with

MYMIV.

10 V.B. Singh et al.

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

Out of six events, five (one of JS 335, two each of JS 95-60 and NRC 37) phenotypessegregated in statistically significant manner (p> 0.05). Only one event [NRC 37 (12)]phenotypically segregated in statistically highly significant manner (p 1.00).

Southern hybridisation analysis of T1 lines

In Southern blot analysis, very faint bands were seen in two plants of T1 lines (JS 335(11) T1L8 and T1L9. These bands were vague and were fairly visible after a longexposure of seven days. Southern blot analysis therefore did not give any conclusiveproof for integration of the transgene.

Response of T1 line to inoculation with MYMIV-Sb

The response of 176 T1 lines to MYMIV was verified by challenge inoculation withMYMIV-Sb isolate. The appearance of disease was monitored at regular intervals afterinoculation. Thirty-three plants expressed yellow mosaic symptoms one month postinoculation. Yellow mosaic symptoms appeared as specks to begin with 15 days postinoculation, which progressed to give typical yellow mosaic area alternating with greenmosaic (Figure 1(g)). The severity grade of symptoms in the plants showing symptomswere 3–4, as leaf lamina showed more than 75% yellow mosaic. The systemic spreadof the virus was examined by PCR using CP-specific primers. PCR amplicon of�250 bp fragment of virus was visible in 34 T1 lines of JS 335 (11), 25 T1 lines of JS95-60 (4), 50 T1 lines of JS 95-60 (13), six T1 lines of NRC 37 (11), three T1 lines ofNRC 37 (12) and 15 T1 lines of NRC 37 (14) (Figure 5). Out of 176, symptoms were

Table 3. Antisense Rep segregation analysis of the progenies of transformed soybean plants fortransgene+:transgene�.

T0 plant no. T1 segregation ratio (PCR+/PCR�) Best fit χ2 value p-value

JS-335 (11) 35/10 3:1 0.1203 0.7287JS-95–60 (4) 18/8 3:1 0.8600 0.3537JS-95-60 (13) 45/17 3:1 0.3517 0.5531NRC-37 (11) 8/1 3:1 0.8428 0.3585NRC-37 (12) 12/4 3:1 0.0000 1.0000NRC-37 (14) 15/3 3:1 0.3214 0.5707

(i) (ii) (iii)

1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 1 2 3 4 5 6 7 8

500 bp 525 bp1091 bp

Figure 4. Agarose gel electrophoresis of PCR amplicons of T1 lines of soybean using primers:(i) Antisense Rep; (ii) CaMV 35S promoter and (iii) CaMV 35S promoter forward/AntisenseRepreverse: Lane 1: JS-95-60 (4) T1L3; Lane 2: NRC-37 (11) T1L10; Lane 3: NRC-37 (11) T1L11;Lane 4: NRC-37 (12) T1L6; Lane 5: NRC-37 (12) T1L7; Lane 6: NRC-37 (12) T1L12; Lane 7:Control (MYMIV-Sb clone); and Lane 8: 1Kb DNA Ladder.

Archives of Phytopathology and Plant Protection 11

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

expressed in five T1 lines of JS 335 (11), seven T1 lines of JS 95-60 (13), three T1 linesof NRC 37 (11), three T1 lines of NRC 37 (12) and 15 T1 lines of NRC 37 (14)(Table 4). When non-transformed plants were inoculated in 20 plants of each variety,the symptoms were expressed in 16 plants of JS 335, 17 plants of JS 95-60 and 15plants of NRC 37.

On the basis of response to MYMIV inoculation and result of PCR amplification todetect transgene and virus, the 176 T1 lines can be categorised into five categories asshown in Table 4.

After challenge inoculation, plants were analysed for transgene integration and viralinfection using different combination of primers. Five types of results were observed:(1) 14 T1 plants were positive for antisense Rep gene and negative for CP gene andwere symptomless; (2) 109 T1 plants were positive for antisense Rep gene and CP, andwere symptomless; (3) 20 T1 plants were positive for antisense Rep gene and CP andexpressed symptom; (4) 19 T1 plants were negative for antisense Rep gene and CP andexpressed symptom; (5) 14 T1 plants were negative for antisense Rep gene and positivefor CP and expressed symptom.

Discussion

YMD caused by whitefly-transmitted begomoviruses is a major constraint in improvingthe productivity of grain legumes. There is no durable resistance source available,emphasising the need to resort to pathogen-derived transgenic resistance. Until now,RNAi-mediated resistance to manage DNA viruses had met with success only in fewcases. It is operative by silencing of mRNA transcript of the virus which overlaps atthe C terminal region of Rep and CP (Vanitharani et al. 2005); the PTGS initiated is

Table 4. Challenge inoculation and transgenic resistance to MYMIV.

Response of transgenic to MYMIV inoculation No. of plants

Transgenic not at all getting infected 14Transgenic, infected not expressing symptoms 109Transgenic, infected, expressing symptoms 20Non transgenic, infected and expressing symptoms 33

Transgenic: PCR positive for Rep gene.Infected/not infected: CP PCR reaction.

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18

~250 bp

Figure 5. Agarose gel electrophoresis of PCR amplicons of T1 lines of soybean plants usingMYMIV-Cp primers - Lane 1: JS-335 (11) T1L1; Lane 2: JS-335 (11) T1L2; Lane 3: JS-335 (11)T1L3; Lane 4: JS-335 (11) T1L4; Lane 5: JS-335 (11) T1L5; Lane 6: JS-335 (11) T1L6; Lane 7:JS-95-60 (4) T1L1; Lane 8: JS-95-60 (4) T1L2; Lane 9: JS-95-60 (4) T1L3; Lane 10: NRC-37 (11)T1L1; Lane 11: NRC-37 (11) T1L10; Lane 12: NRC-37 (12) T1L1; Lane 13: NRC-37 (12) T1L2;and Lane 14: NRC-37 (12) T1L6; Lane 15: NRC-37 (12) T1L7; Lane 16: Non transformedsoybean plants; Lane 17: Control (MYMIV-Sb clone); Lane 18: 1Kb DNA Ladder.

12 V.B. Singh et al.

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

expected to lead to methylation of viral DNA causing transcriptional inactivation. Inthis communication, we present results of our effort to develop transgenic resistance toMYMIV in soybean, targeting Rep gene.

The significant outcome of the study is a robust transformation protocol whichyielded single shoot regeneration of soybean plants from the cotyledonary node;frequency of shoot regeneration is high and regeneration period is very short. Untilnow, researchers have only improved the efficiency of cotyledonary node transformation(Clemente et al. 2000; Olhoft et al. 2001, 2003; Liu et al. 2004; Paz et al. 2004; andZeng et al. 2004). However, in our study, in a short period of time in culture,combining the thiol compound resulted in synergistic improvements in the regenerationof transformed plants, without non-transformed “escapes” (Olhoft et al. 2003). Co-culti-vation of explants in the presence of thiol compounds (L-cystein, sodium thiosulfate,acetosyringone and DTT) and kanamycin selection resulted in transformation efficiency,0.21% in JS 335, 0.24% in JS 95-60 and 0.20% in NRC 37. Olhoft et al. (2001) havereported that addition of thiol compounds to co-cultivation medium slow down thewound and plant pathogen-induced responses. The cot-node cells become more suscep-tible, enhancing the capacity for Agrobacterium infection. The thiol compounds appliedin co-cultivation medium inhibit the enzymes polyphenol oxidases and peroxidases,thereby increasing Agrobacterium infection and reducing enzymatic browning on theexplants. In this study, we have developed a procedure, which is efficient and takesonly eight weeks to reach the hardening stage. This method is shorter than Olhoft et al.(2003), which reported 12weeks for regeneration of soybean plants transformed withthe GUS (β-glucuronidase) gene.

In the cotyledonary node system, two explants were produced from a singleseedling. The cells which are located at vertical surfaces of the remaining hypocotylwere wounded. During incubation period in CCM-L, the Agrobacterium cells couldeasily enter the plant cells through the wounded cell (Olhoft et al. 2003). The SIM-S medium was having 1.2mg/l of BAP, which allowed only a single shoot to gener-ate and prevent the over-proliferation of callus from wounded tissues. As a result,all explants consistently generated single shoots. Barwale et al. (1986); Komatsudaand Ko (1990); and Delzer et al. (1990) expressed that the success rate of soybeantransformation is totally dependent on the genotype. However, in our study, all threegenotypes were successfully transformed and one of the significant finding is thatby adopting appropriate medium, 0.2% transformation can be achieved, independentof the genotype used.

PCR and sequencing of amplicons of JS 335 (11), NRC 37 (11) and NRC 37 (12)have confirmed the presence of transgene in plant genome. Sequence analysis of trans-gene amplified from three T0 samples matched with the original sequence of MYMIV(Accession No. AY049772).

We found two types of transgene insertion patterns in T1 plants. First, onlytransgene was present in 162 T1 lines. Second, five T1 lines were having transgenetogether with promoter. Thus, in 162 T1 plants, PCR amplicon was not obtained for35S promoter, suggesting the incorporation of transgene without 35S promoter. Thisdiscrepancy in the number of plants positive to Rep primer and number of plants posi-tive to 35S promoter primer indicates that there is rearrangement/truncation within theT-DNA in the incorporation loci, as suggested by Yin et al. (2004). Alternatively, multi-ple copies of insertion of promoter might have led to loss of promoter region andbecome fragmented because of promoter methylation and TGS (Matzke et al. 2000; Fuet al. 2000; and Reddy et al. 2003). Methylation of promoter region would directly

Archives of Phytopathology and Plant Protection 13

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

interfere in the binding of transcription factors or may alter the chromatin structure(Ng and Bird 1999; Vaucheret and Fagard 2001) leading to TGS.

In this study, all T1 lines phenotypically segregated for the antisense Rep gene inthe expected segregation ratio of 3:1. Out of six events, five segregated phenotypicallyin significant manner. Only one event [NRC 37 (12)] was found best in segregationbecause it showed phenotypically highly significant regeneration. The segregation ratioof the transgene in T1 generation was comparable to that of another similar study doneon tomato using antisense Rep gene of ToLCV against tomato leaf curl disease(ToLCD) (Praveen et al. 2005). They have shown single-transgene copy insertion inexpected 3:1 Mendelian segregation based on χ2 analysis.

Stable transformation was observed in 14 T1 lines (transgene positive, CP negativeand symptomless). These lines may have a homozygous transgene that expresses theantisense Rep transgene at levels that provide sufficient resistance to YMV infection(Tougou et al. 2007). Transgenic expression of hairpin RNA targeting Rep gene hasbeen demonstrated to provide complete protection against Begomovirus in cassava andtomato (Zhang et al. 2005; Ramesh et al. 2007). However, in all these cases field levelresistance is yet to be achieved.

It is observed that 109 T1 lines were PCR positive for transgene and CP, but didnot express symptoms. Aragao et al. (1998) have observed on the basis of Northern blotanalysis, that there was no positive correlation between the antisense RNA levels in thesusceptible transgenic plants and those showing virus resistances. Because of the lowlevel of antisense RNAs detected, it is possible that another mechanism may beinvolved.

Ten T1 lines were susceptible for YMV and expressed symptom, although they hadthe same transgene insertion as YMV-resistant T1 plants. Tougou et al. (2007)concluded that the level of transcript between homozygous and hemizygous hadaffected the degree of resistance in soybean against soybean dwarf virus. A smallchange in the transgene by methylation may affect the viral resistance via PTGS (Tou-gou et al. 2007). Another reason could be the implicated RNA threshold models forgene silencing at the level of gene expression rather than transgene copy number level(Meins and Kunz 1994; and Chareonpornwattana et al. 1999).

Many researchers have used sense and antisense version, targeting replicase gene ofvarious begomoviruses with various success rates (Bendahmane and Gronenborn 1997;Aragao et al. 1998; Lucioli et al. 2003; and Praveen et al. 2005). In this context, this isthe first report of begomovirus Rep gene transformation in soybean using kanamycinselection, with the Agrobacterium-mediated delivery into cotyledonary node as explant.We have developed transgenic soybean having resistance against MYMIV, targetingreplicase gene. Begomoviruses accumulate in the nucleus of the plant cell where theyreplicate. Therefore, antisense RNA-based approach targeting replicase gene is suitablefor developing disease resistant plants.

AcknowledgementsThe financial support given by the Indian Council of Agricultural Research (ICAR), Governmentof India is gratefully acknowledged. We are thankful to Dr H.S. Gupta, Director, IndianAgricultural Research Institute, New Delhi-110012, India, Dr R.K. Jain, Head, Division of PlantPathology, for providing the necessary facilities. We are also grateful to the scientists and staff atNational Phytotron Facility, Indian Agricultural Research Institute, New Delhi-110012, India, fortheir guidance and support to grow plants under controlled conditions.

14 V.B. Singh et al.

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

ReferencesAbhary MK, Anfoka GH, Nakhla MK, Maxwell DP. 2006. Post-transcriptional gene silencing in

controlling viruses of the tomato yellow leaf curl virus complex. Arch Virol. 151:2349–2363.Aragao SG, Ribeiro LM, Barros G, Brasileiro ACM, Maxwell DP, Rech EL, Faria JC. 1998.

Transgenic beans (Phaseolus vulgaris L.) engineered to express viral antisense RNAsshowed delayed and attenuated symptoms to bean golden mosaic geminivirus. Mol Breeding.4:491–499.

Barwale UB, Keans HR, Widholm JM. 1986. Plant regeneration from callus cultures of severalsoybean genotypes via embryogenesis and organogenesis. Planta. 167:473–481.

Bendahmane M, Gronenborn B. 1997. Engineering resistance against tomato yellow leaf curlvirus (TYLCV) using antisense RNA. Plant Mol Biol. 33:351–357.

Bonfim K, Faria JC, Nogueira EOPL, Mendes EA, Aragao FJL. 2007. RNAi-mediated resistanceto bean golden mosaic virus in genetically engineered common bean (Phaseolus vulgaris).Mol Plant-Microbe In. 20:717–726.

Buchmann RC, Asad S, Wolf JN, Mohannath G, Bisaro DM. 2009. Geminivirus AL2 and L2 pro-teins suppress transcriptional gene silencing and cause genome-wide reductions in cytosinemethylation. J Virol. 83:5005–5013.

Chareonpornwattana S, Thara KV, Wang L, Datta SK, Panbangred W, Muthukrishnan S. 1999.Inheritance, expression, and silencing of a chitinase transgene in rice. Theor Appl Genet.98:371–378.

Chellappan P, Masona MV, Vanitharani R, Taylor NJ, Fauquet CM. 2004. Broad spectrum resis-tance to ssDNA viruses associated with transgene-induced gene silencing in cassava. PlantMol Biol. 56:601–611.

Christou P, Swain WF, Yang NS, McCabe DE. 1989. Inheritance and expression of foreign genesin transgenic soybean plants. Proc Natl Acad Sci USA. 86:7500–7504.

Clemente TE, LaVallee BJ, Howe AR, Conner-Ward D, Rozman RJ, Hunter PE, Broyles DL,Kasten DS, Hinchee MA. 2000. Progeny analysis of glyphosate selected transgenic soybeansderived from Agrobacterium-mediated transformation. Crop Sci. 40:797–803.

De Barro PJ, Liu S-S, Boykin LM, Dinsdale AB. 2011. Bemisia tabaci: a statement of speciesstatus. Annu Rev Entomol. 56:1–19.

Delzer BW, Somers DA, Orf JH. 1990. Agrobacterium tumefaciens susceptibility and plant regen-eration of 10 soybean genotypes in maturity groups 00 to II. Crop Sci. 30:320–322.

Ditta G, Stanfield S, Corbin D, Helinski DR. 1980. Broad host range DNA cloning system forGram-negative bacteria: construction of a gene bank of Rhizobium meliloti. Proc Natl AcadSci USA. 77:7347–7351.

El-Shemy HA, Khalafalla MM, Fujita K, Ishimoto M. 2006. Molecular control of gene co-sup-pression of transgenic soybean. J Biochem Mol Biol. 39:61–67.

Feinberg AP, Vogelstein B. 1983. A technique for radiolabeling DNA restriction endonucleasefragments to high specific activity. Anal Biochem. 132:6–13.

Finer JJ, McMullen MD. 1991. Transformation of soybean via particle bombardment of embryo-genic suspension culture tissue. In Vitro Cell Dev Biol. 27:115–182.

Fu X, Duc LT, Fontana S, Bong BB, Tinjuangjun P, Sudhakar D, Twyman RM, Christou P, KohliA. 2000. Linear transgene constructs lacking vector backbone sequences generate low copy-number transgenic plants with simple integration patterns. Transgenic Res. 9:11–19.

Fuentes A, Ramos P, Fiallo E, Callard D, Sánchez Y, Peral R, Rodrýguez R, Pujol M. 2006. Intron–hairpin RNA derived from replication associated protein C1 gene confers immunity to Tomatoyellow leaf curl virus infection in transgenic tomato plants. Transgenic Res. 15:291–304.

Gamborg OL, Miller RA, Ojima K. 1968. Nutrient requirements of suspension cultures ofsoybean root cells. Exp Cell Res. 50:151–158.

Geliang W, Yinong X. 2008. Hypocotyle-based Agrobacterium-mediated transformation ofsoybean (Glycine max) and application of RNA interference. Plant Cell Rep. 27:1177–1184.

Hall TA. 1999. BioEdit: a user-friendly biological sequence alignment editor and analysisprogram for Windows 95/98/NT. Nucleic Acid Symp Ser. 41:95–98.

Hinchee MAW, Connor-Ward DV, Newell CA, McDonnell RE, Sato SJ, Gasser CS, FischhoffDA, Re DB, Fraley RT, Horsch RB. 1988. Production of transgenic soybean plants usingAgrobacterium-mediated DNA transfer. Biotechnol. 6:915–922.

Komatsuda T, Ko S-W. 1990. Screening of soybean [Glycine max (L.) Merrill] genotypes forsomatic embryo production from immature embryo. Jpn J Breed. 40:249–251.

Archives of Phytopathology and Plant Protection 15

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

Liu W, Torisky RS, McAllister KP, Avdiushko S, Hildebrand D, Collins GB. 1996. Somaticembryo cycling: evaluation of a novel transformation and assay system for seed-specific geneexpression in soybean. Plant Cell Tiss Organ Cult. 47:33–42.

Liu H-K, Chao Y, Zhi-Ming W. 2004. Efficient Agrobacterium tumefaciens mediated transforma-tion of soybean using an embryogenic tip regeneration system. Planta. 219:1042–1049.

Lucioli A, Noris E, Brunetti A, Tavazza R, Ruzza V, Castillo AG, Bejarano ER, Accotto GP,Tavazza M. 2003. Tomato yellow leaf curl Sardinia virus rep-derived resistance tohomologous and heterologous geminiviruses occurs by different mechanisms and is overcomeif virus-mediated transgene silencing is activated. J Virol. 77:6785–6798.

Malathi VG. 2007. Genetic identity of yellow mosaic viruses infecting legumes and their phylo-genetic relationship. Indian Phytopath. 60:143–155.

Matzke MA, Mette MF, Matzke AJ. 2000. Transgenic silencing by the host genome defense:implications for the evolution of epigenetic control mechanisms in plants and vertebrates.Plant Mol Biol. 43:401–415.

McCabe DE, Swain WF, Martinell BJ, Christou P. 1988. Stable transformation of soybean(Glycine max) by particle acceleration. BioTechnol. 6:923–926.

Meins F, Kunz C. 1994. Silencing chitinase expression in transgenic plants: an autoregulatorymodel. In: Paszkowski J, editor. Homologous recombination and gene silencing in plants.Dordrecht: Kluwer Academics; p. 335–348.

Murashige T, Skoog F. 1962. A revised medium for rapid growth and bioassays with tobacco tis-sue cultures. Physiol Plant. 15:473–497.

Ng HH, Bird A. 1999. DNA methylation and chromatin modification. Curr Opin Genet Dev.9:158–163.

Olhoft PM, Lin K, Galbraith J, Nielsen NC, Somers DA. 2001. The role of thiol compounds inincreasing Agrobacterium-mediated transformation of soybean cotyledonary-node cells. PlantCell Rep. 20:731–737.

Olhoft PM, Flagel LE, Donovan CM, Somers DA. 2003. Efficient soybean transformation usinghygromycin B selection in the cotyledonary-node method. Planta. 216:723–735.

Parrott WA, Hoffman LM, Hildebrand DF, Williams EG, Collins GB. 1989. Recovery of primarytransformants of soybean. Plant Cell Rep. 7:615–617.

Paz MM, Shou HX, Guo ZB, Zhang ZY, Banerjee AK, Wang K. 2004. Assessment of conditionsaffecting Agrobacterium-mediated soybean transformation using the cotyledonary nodeexplant. Euphytica. 136:167–179.

Paz MM, Martinez JC, Kalvig AB, Fonger TM, Wang K. 2006. Improved cotyledonary nodemethod using an alternative explants derived from mature seed for efficient Agrobacterium-mediated soybean transformation. Plant Cell Rep. 25:206–213.

Pooggin MM, Shivaprasad PV, Veluthambi K, Hohn T. 2003. RNAi targeting of DNA virus inplants. Nat Biotechnol. 21:131–132.

Praveen S, Kushwaha CM, Mishra AK, Singh V, Jain RK, Varma A. 2005. Engineering tomatofor resistance to tomato leaf curl disease using viral rep gene sequences. Plant Cell Tiss Org.83:311–318.

Ramesh SV, Mishra AK, Praveen S. 2007. Hairpin RNA-mediated strategies for silencing oftomato leaf curl virus AC1 and AC4 genes for effective resistance in plants. Oligonucleotides.17:251–257.

Reddy MS, Srinivasa DRD, Collins GB. 2003. Gene silencing in transgenic soybean plants trans-formed via particle bombardment. Plant Cell Rep. 2:676–683.

Rodriguez-Negrete EA, Carrillo-Tripp J, Rivera-Bustamante RF. 2009. RNA silencing againstGeminivirus: complementary action of posttranscriptional gene silencing and transcriptionalgene silencing in host recovery. J Virol. 83:1332–1340.

Rouhibakhsh A, Priya J, Periasamy M, Haq QMI, Malathi VG. 2008. An improved DNA isola-tion method and PCR protocol for efficient detection of multicomponents of Begomovirus inlegumes. J Virol Methods. 147:37–42.

Sairam RV, Franklin G, Hassel R, Smith B, Meeker K, Kashikar N, Parani M, Abed D, Ismail S,Berry K, Goldman SL. 2003. A study on the effect of genotypes, plant growth regulators andsugars in promoting plant regeneration via organogenesis from soybean cotyledonary nodalcallus. Plant Cell Tiss Org. 75:79–85.

Sambrook J, Fritsch EF, Maniatis T. 1989. Molecular cloning a laboratory manual, Vol I. 2nd ed.New York, NY: Cold Spring Horbour Laboratory Press.

16 V.B. Singh et al.

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013

Samoylov VM, Tucker DM, Thibaud-Nissen F, Parrott WA. 1998. A liquid-medium – based pro-tocol for rapid regeneration from embryogenic soybean cultures. Plant Cell Rep. 18:49–54.

Tenllado F, Llave C, Diaz-Ruiz JR. 2004. RNA interference as a new biotechnological tool forthe control of virus diseases in plants. Virus Res. 102:85–96.

Tougou M, Yamagishi N, Furutani N, Shizukawa Y, Takahata Y, Hidaka S. 2007. Soybeandwarf virus-resistant transgenic soybeans with the sense coat protein gene. Plant Cell Rep.26:1967–1975.

Trick HN, Finer JJ. 1998. Sonication-assisted Agrobacterium-mediated transformation ofsoybean [Glycine max (L.) Merrill] embryogenic suspension culture tissue. Plant Cell Rep.17:482–488.

Vanderschuren H, Akbergenov R, Pooggin M, Hohn T, Gruissem W, Zhang P. 2007. Transgeniccassava resistance to African cassava mosaic virus is enhanced by viral DNA-A bidirectionalpromoter-derived siRNAs. Plant Mol Biol. 64:549–557.

Vanitharani R, Chellappan P, Fauquet CM. 2003. Short interfering RNA-mediated interference ofgene expression and viral DNA accumulation in cultured plant cells. Proc Natl Acad SciUSA. 100:9632–9636.

Vanitharani R, Chellappan P, Fauquet CM. 2005. Geminiviruses and RNA silencing. Trends PlantSci. 10:144–151.

Varma A, Mandal B, Singh MK. 2011. Global emergence and spread of whitefly (Bemisia tabaci)transmitted geminiviruses. In: Thompson WMO, editor. The whitefly, Bemisia tabaci(Homoptera: Aleyrodidae) interaction with geminivirus-infected host plants. Amsterdam:Springer; p. 205–292.

Vaucheret H, Fagard M. 2001. Transcriptional gene silencing in plants: targets, inducers andregulators. Trends Genet. 17:29–35.

Yan B, Srinivasa Reddy MS, Collins GB, Dinkins RD. 2000. Agrobacterium tumefaciens-medi-ated transformation of soybean [Glycine max (L.) Merrill] using immature zygotic cotyledonexplants. Plant Cell Rep. 19:1090–1097.

Yin Z, Plader W, Malepszy S. 2004. Transgene inheritance in plants. J Appl Genet. 45:127–144.Zeng P, Vadnais DV, Zhang Z, Polacco JC. 2004. Refined glufosinate selection in Agrobacterium-

mediated transformation of soybean [Glycine max (L.) Merrill]. Plant Cell Rep. 22:478–482.Zhang P, Vanderschuren H, Futterer J, Gruissem W. 2005. Resistance to cassava mosaic disease

in transgenic cassava expressing antisense RNAs targeting virus replication genes. PlantBiotechnol J. 3:385–397.

Zrachya A, Kumar PP, Ramakrishnan U, Levy Y, Loyter A, Arazi T, Lapidot M, Gafni Y. 2007.Production of siRNA targeted against TYLCV coat protein transcripts leads to silencing of itsexpression and resistance to the virus. Transgenic Res. 16:385–398.

Archives of Phytopathology and Plant Protection 17

Dow

nloa

ded

by [

Indi

an A

gric

ultu

ral R

esea

rch

Inst

itute

] a

t 01:

59 2

9 Ju

ne 2

013