Antiproliferative Effects by Let-7 Repression of High-Mobility Group A2 in Uterine Leiomyoma

Antiproliferative Effects by Let-7 Repression ofHigh-Mobility Group A2 in Uterine Leiomyoma

Yi Peng, Jordan Laser, Guizhi Shi, Khush Mittal, Jonathan Melamed,Peng Lee, and Jian-Jun Wei

Department of Pathology, New York University School of Medicine, New York, New York

AbstractHigh-mobility group A2 (HMGA2) is commonly

overexpressed in large leiomyomas. HMGA2 is an

important regulator of cell growth, differentiation,

apoptosis, and transformation. As a predicted target of

Let-7 microRNAs (Let-7s), HMGA2 can be repressed by

Let-7s in vitro . MicroRNA profiling analysis revealed

that Let-7s were significantly dysregulated in uterine

leiomyomas: high in small leiomyomas and lower in

large leiomyomas. To evaluate whether Let-7 repression

of HMGA2 plays a major role in leiomyomas, we analyzed

the molecular relationship of HMGA2 and Let-7s,

both in vitro and in vivo. We first characterized that

exogenous Let-7 microRNAs could directly repress

the dominant transcript of HMGA2, HMGA2a . This

repression was also identified for two cryptic HMGA2

transcripts in primary leiomyoma cultures. Second, we

found that the endogenous Let-7s were biologically

active and played a major role in the regulation of

HMGA2. Then, we illustrated that Let-7 repression

of HMGA2 inhibited cellular proliferation. Finally,

we examined the expression levels of Let-7c and HMGA2

in a large cohort of leiomyomas (n = 120), and we

found high levels of Let-7 and low levels of HMGA2 in

small leiomyomas, and low levels of Let-7 and high

levels of HMGA2 in large leiomyomas. Our findings

suggest that the Let-7 –mediated repression of HMGA2

mechanism can be an important molecular event in

leiomyoma growth. (Mol Cancer Res 2008;6(4):663–73)

IntroductionUterine leiomyomas are a major public health problem,

represented by a high incidence (1), a high rate of hysterec-

tomies for symptomatic disease (2), and a high medical cost

(3, 4). About 20% of patients with leiomyomas experience

clinical symptoms and seek medical treatment. The severity of

symptoms is often associated with large leiomyomas.

Overexpression of high-mobility group A2 (HMGA2) is

very common in uterine leiomyomas and it is induced by

chromosomal changes involving 12q13-15 (5, 6). Most of

the 12q15 breakpoints in leiomyomas are located 5¶ to the

HMGA2 locus (7, 8), giving rise to a nontruncated HMGA2

overexpression, and are strongly associated with large leio-

myomas (9, 10). Leiomyomas with and without HMGA2

expression have distinctly different gene expression profiles

(11, 12), indicative of the unique molecular role of HMGA2 in

the tumorigenesis of uterine leiomyomas.

HMGA2, a high-mobility-group AT-hook (HMGA) protein,

is a non-histone DNA binding factor. It has three AT-hook

DNA binding domains through which HMGA2 binds to AT-

rich sequences in the minor groove of the DNA helix. HMGA2

is expressed in embryonic tissue but not in most normal adult

tissues (13, 14). As an important regulator of cell growth,

differentiation, apoptosis, and transformation (15), HMGA2

interacts with many different transcription factors and influen-

ces numerous gene expression patterns (15).

Overexpression of HMGA2 in human uterine leiomyomas

is mainly contributed by its dominant transcript HMGA2a by

Northern blot analysis (14). In addition to the major transcript

HMGA2a , several ‘‘cryptic’’ HMGA2 (HMGA2b-HMGA2g)

isoforms can be transcribed by alternative splicing from the large

intron 3 (16, 17). These cryptic transcripts can only be detected

in very low levels in fetal cells and some cultured cells (16).

Let-7 microRNAs (Let-7s) are one of the first microRNAs

identified in Caenorhabditis elegans and is highly conserved in

C. elegans, Drosophila , zebrafish, and humans (18-20). Let-7s

regulate target genes through either posttranscriptional repres-

sion (mRNA; refs. 21-23) or translational repression (protein;

refs. 22, 23). In normal embryonic development, temporal

up-regulation of Let-7s is required for terminal differentiation.

In humans, various Let-7 genes have been reported to map to

regions deleted in many human cancers (24), such as lung

cancer (25), in which the loss of Let-7 expression results in the

up-regulation of RAS oncogenes (26). There are several

predicted Let-7 complementary sites (LCS) at the 3¶ untrans-lation region (3¶-UTR) of human HMGA2 . Recently, several

studies have illustrated that Let-7s can regulate HMGA2

expression in squamous cell carcinoma (27) and in vitro

systems (28, 29).

In our microRNA profiling study, we found that several

Let-7 members were significantly dysregulated in uterine

leiomyomas: high levels in small leiomyomas and low in large

ones (30). To evaluate the biological role of Let-7s in the

regulation of leiomyoma growth, we analyzed the relationship

Received 8/7/07; revised 11/27/07; accepted 11/30/07.The costs of publication of this article were defrayed in part by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.Note: This work was presented in part at the 96th Annual Meeting of United Statesand Canadian Academy of Pathology, March 24–30, 2007, San Diego, CA.Y. Peng and J. Laser contributed equally to this work.Requests for reprints: Jian-Jun Wei, Department of Pathology, New YorkUniversity School of Medicine, 462 First Avenue, NB4W1, New York, NY10016. Phone: 212-562-7893; Fax: 212-263-7573. E-mail: [email protected],or Peng Lee, Department of Pathology, New York University School of Medicine.E-mail: [email protected] D 2008 American Association for Cancer Research.doi:10.1158/1541-7786.MCR-07-0370

Mol Cancer Res 2008;6(4). April 2008 663

between Let-7s and HMGA2 and their roles in cellular

proliferation, both in vitro and in vivo . Our data showed that

Let-7s could be a key negative regulator for HMGA2

expression and cellular proliferation. Our findings provide

additional support that repression of HMGA2a by Let-7s is a

specific molecular mechanism responsible for leiomyoma

growth.

ResultsLet-7 microRNAs Regulate the Dominant TranscriptHMGA2a and Two Additional Cryptic Transcripts inLeiomyomas

Several recent studies (27, 29), including ours (30), illustrate

that Let-7 microRNAs can directly repress HMGA2 expression

at the translational level. Lee and Dutta (28) further

characterized that the repression of HMGA2 was mostly

through destabilization of HMGA2 mRNA in HeLa cells. We

previously found that transfection of exogenous Let-7c in

primary leiomyoma culture cells can repress HMGA2 transla-

tion (30) with minimal effect on HMGA2 mRNA levels

(Fig. 1A). Provided that the presence of Let-7 LCS at the

3¶-UTR of HMGA2 is required for Let-7 activity, several

potential mechanisms can explain the overexpression of

HMGA2 in uterine leiomyomas: (a) loss or reduction of Let-

7 expression; (b) the truncated transcripts of HMGA2 with a

partial or complete loss of Let-7 LCS, secondary to

chromosomal 12q13-15 changes (7, 31); and (c) expression

of cryptic HMGA2 isoforms (HMGA2b-HMGA2g ; refs. 17, 32)

that may lack Let-7 LCS.

To exclude leiomyomas with truncated HMGA2 transcripts,

which may have partial or complete loss of the HMGA2

3¶-UTR, we carried out reverse transcription-PCR (RT-PCR)

with primers from exon 3 and exon 5 (see Table 1). These primer

pairs were chosen because they cover almost the entire HMGA2a

3¶-UTR. We found no loss of the Let-7 LCS in our study.

Little is known about the expression of HMGA2 isoforms in

uterine leiomyomas. Studies showed that HMGA2 isoforms

might be induced in tissue culture conditions (16, 17). To test

whether HMGA2 isoforms were differentially expressed in

native leiomyomas versus culture conditions, we examined six

HMGA2 mRNA transcripts (primers for each isoforms were

listed in Table 1). We found that noncultured leiomyomas

contained a high abundance of HMGA2a mRNA and a low

abundance of HMGA2b and HMGA2c isoforms. Minimal or no

expression of transcripts HMGA2d, HMGA2e , and HMGA2f

was identified (Fig. 1B). In examination of an additional 10

HMGA2-positive leiomyomas, similar HMGA2 expression

patterns were observed (data not shown).

We then examined the expression of HMGA2 isoforms in

three leiomyomas under culture conditions. We found that all

HMGA2 mRNA isoforms except for transcript HMGA2e were

detectable by RT-PCR with 32 amplification cycles (Fig. 1B).

The full-length HMGA2 mRNAs have only been published

FIGURE 1. Transcriptional regulation ofHMGA2 and its alternatively spliced transcriptsby Let-7 in culture and nonculture leiomyomacells. A. Photonegative images illustrate minimalchange in HMGA2 mRNA levels (common domainfrom exon 1 and exon 3; see Table 1) in primaryculture leiomyoma cells in the absence (lanes 1-3)or presence (lanes 4 and 5) of exogenous Let-7ctreatment. Mature Let-7c and HMGA2 in each cellsample were examined by RT-PCR and therelative abundance of each cDNA product wasscored under each band. B. Differential expres-sion of HMGA2a and cryptic transcripts (alterna-tively spliced transcripts of HMGA2 ; see Table 1)in native and cultured leiomyoma cells (ULM ).C. Photonegative images illustrated posttranscrip-tional regulation of the endogenous HMGA2a andcryptic transcripts by transient transfection ofmature let-7c mimic in primary culture leiomyomacells. D. Posttranscriptional regulation of theendogenous HMGA2a mRNA by transient trans-fection of control RNA, mature let-7c mimic, andlet-7 inhibitor in two additional cultured tumor cells.Actin and U6 were examined as RNA loadingcontrols for mRNA and microRNA.

Peng et al.

Mol Cancer Res 2008;6(4). April 2008

664

for isoforms HMGA2a and HMGA2b (NM_003483 and

NM_003484). Sequence analysis shows that HMGA2a , but

not HMGA2b , contains the Let-7 LCS. To determine which of

the HMGA2 transcripts can be destabilized by Let-7s, we

examined the levels of the HMGA2 isoforms by RT-PCR in

cultured leiomyoma cells following transient transfection of

Let-7c . Under these culture conditions, a reduction of HMGA2

transcripts HMGA2a, HMGA2c , and HMGA2f was observed,

and the reduction of HMGA2c and HMGA2f seemed to be dose

dependent. No change of transcripts HMGA2b and HMGA2d

was seen (Fig. 1C). These findings showed that not all of the

HMGA2 isoform mRNAs can be destabilized by exogenous

Let-7s.

In another two independent experiments, let-7c repression of

HMGA2a mRNA was reproducible (Fig. 1D). However, the

levels of HMGA2a mRNA reduction by exogenous Let-7c were

not as efficient as we saw in HMGA2a stable cell lines (see

below).

Let-7 microRNAs Are Major Players in the Regulation ofHMGA2 Expression in Leiomyomas

By computer searches (TargetScan and miRanda; refs. 33,

34), it has been shown that, in addition to Let-7s, HMGA2 can

be potentially regulated by more than 30 other microRNAs.

Among these 30 microRNAs, only three of them were found

to be significantly overexpressed in leiomyomas (miR-30a,

miR-34, and miR-24; ref. 30). These microRNAs (miR-30a,

miR-34, and miR-24) were shown to have a much lower

binding score to HMGA2 than Let-7s.

To evaluate the role of endogenous Let-7 microRNAs in the

regulation of HMGA2a expression, we prepared the pGL3

constructs with the luciferase (LCF) reporter gene under control

of the HMGA2a 3¶-UTR (Fig. 2A). For this assay, we used

HeLa cells because (a) HeLa cells have a moderate level of

endogenous Let-7 expression (35), and (b) HeLa cells have

minimal HMGA2 expression by RT-PCR and Western blot

analysis (data not shown). We found that in cells transfected

with LCF + HMGA2a 3¶-UTR, there was 5.2-fold reduction of

luciferase expression in comparison with baseline control (LCF

only; Fig. 2B). To test whether repression of luciferase

expression with HMGA2a 3¶-UTR was mainly contributed by

Let-7 , cotransfection of Let-7 inhibitor at various concentrations

was done and the luciferase expression was measured. As

illustrated in Fig. 2B, the luciferase expression was rescued by

anti–Let-7 treatment, and the level of luciferase expression was

dose dependent. Of note is the fact that the level of luciferase

activity did not return to baseline (Fig. 2B). This suggests that

additional minor regulatory mechanisms for HMGA2 may exist

in HeLa cells, such as long 3¶-UTR reducing translation

efficiency and other microRNA or non-microRNA regulators.

To determine the relationship of Let-7c and HMGA2 in vivo ,

we selected five HMGA2 (mRNA) positive leiomyomas of

varying tumor sizes (1-10 cm; T1.0, T2.0, T5.0, T7.0, and

T10.0 cm). The endogenous Let-7c and HMGA2 proteins were

semiquantitatively evaluated in each tumor and the expected

inverse relationship was identified (Fig. 2C). Namely, large

leiomyomas contained low levels of endogenous Let-7c and

high levels of HMGA2, and small leiomyomas contained high

levels of Let-7c and low levels of HMGA2 (Fig. 2C).

After establishing primary cultures from these five leiomyo-

mas, transient transfections of control (LCF only), test 1 (LCF +

HMGA2a 3¶-UTR), and test 2 (LCF + HMGA2a 3¶-UTR and

Let-7c inhibitor) were done in each tumor in triplicate. The

luciferase expression was measured after 48 hours of

transfection. The reduction in luciferase expression was

significantly greater in small leiomyomas (high Let-7c levels)

than in larger tumors (low Let-7c levels; 3.3- and 2.6-fold

reduction in 1.0- and 2.0-cm tumors versus 1.2- to 1.5-fold in

the 5-, 7-, and 10-cm tumors; r = 0.86; Fig. 2D). Similar to

previous cell line experiments, cotransfection with Let-7

inhibitor (40 pmol) rescued the luciferase activity up to 80%

of the original levels (Fig. 2D).

The findings indicate that (a) the level of HMGA2a

repression is correlated with the level of endogenous Let-7

microRNA; (b) repression of HMGA2a in leiomyomas was

largely contributed by Let-7 microRNAs; and (c) there was an

inverse association of endogenous Let-7c and HMGA2a protein

in native leiomyomas.

Table 1. RT-PCR Primers for HMGA2

Primers Exon (nt) Primer Direction Sequence (5¶-3¶) PCR Products (bp)

HMGA2f Exon 1 (630) F TCCGGTGTTGATGGTGGCAGHMGA2r Exon 3 (1,042) R CTTGGCCGTTTTTCTCCAGTG 411HMGA2a3f Exon 1 (811) F ATGAGCGCACGCGGTGAGGGCHMGA2a4f Exon 5 (1,250) F GAGGAAACTGAAGAGACATCCHMGA2a5r Exon 5 (4,089) R GTTAGAAGACACTCAAAGGAACAGHMGA2a1 Exon 4 (1,061) F TGGTTGCTAATGAAGAGCCCGHMGA2a2 Exon 5 (1,400) R CCAGATGAAAGTGGAAAGACC 340HMGA2b1 Exon 3 (1,021) F CACTGGAGAAAAACGGCCAAGHMGA2b2 Exon 3.6 (1,322) R ACTACATCTTGGGATGCAGACT 302HMGA2c1* Exon 1 (839) F CAGCCGTCCACTTCAGCCCAGGGAHMGA2c2* Exon 3.1 R CAAATTTCAATTGGCAGGACTGGCT 404HMGA2d1* Exon 1 (713) F CCGGCGTCCCCAGCCCTATCACCTHMGA2d2* Exon 3.2 R CAGTTCCGGGATCAGCAGGCTTCC 409HMGA2e1* Exon 1 (839) F CAGCCGTCCACTTCAGCCCAGGGAHMGA2e2* Exon 3.3 R CATGGTGAAACCCCGTCTCTACTA 509HMGA2f1* Exon 1 (839) F CAGCCGTCCACTTCAGCCCAGGGAHMGA2f2* Exon 3.4 R GATGTTTTCTTCTTGGAGCTGGTTC 509

Abbreviations: F, forward primer; R, reverse primer.*Hauke et al. (17).

Repression of HMGA2 by Let-7 in Leiomyomas


665

Let-7 Inhibits Tumor Growth through Repression ofHMGA2a

Studies showed that overexpression of HMGA2 is strongly

associated with large leiomyomas (9, 10). It is important to

determine whether the regulatory mechanism of Let-7 repres-

sion of HMGA2 affects tumor growth. There were a couple of

limitations in the analysis of the Let-7 ::HMGA2 regulation in

primary leiomyoma cell cultures: First, primary cultures

showed a slow growth rate, and second, the culture induced

cryptic HMGA2 transcripts that may not respond to Let-7 due

to lack of Let-7 LCS in some transcripts (Fig. 1C). We therefore

chose PC3 and LNCaP cell lines for our proliferation assays.

The rationale for using these two cell lines is that, first, these

prostate cell lines have minimal or no endogenous HMGA2

and let-7 expressions (36); particularly, there are no culture-

induced HMGA2a and other cryptic transcripts commonly

seen in leiomyoma primary cultures. Second, the constructions

of HMGA2 with and without 3¶-UTR in these cell lines using

retroviral pBabe vectors (Fig. 3A) will allow us to further

characterize the specificity for let-7 repression of HMGA2a in

the presence and absence of let-7 LCS. Stable overexpression of

HMGA2a in these cell lines was shown by both RT-PCR and

Western blot (Fig. 3B).

Confirmation that the Let-7c ::HMGA2 regulatory mecha-

nism is preserved in these transduced cells was provided by

transfection of exogenous Let-7c and Let-7c inhibitor. Of note

was that HMGA2a expression could be completely repressed in

both cell lines (Fig. 3C and D).

To evaluate the role of the Let-7c ::HMGA2 regulatory

mechanism in cellular proliferation, we determined the

proliferation rate of PC3 and LNCaP cell lines by controlling

HMGA2a expression. In PC3 and LNCaP cells with pBabe

only (control cell lines), transfection of exogenous Let-7c

resulted in up to 12% reduction in the proliferation rate after

24 to 48 hours (Fig. 3E and F, left). In PC3 and LNCaP cell

lines with stable overexpression of HMGA2a without 3¶-UTR(lack of Let-7 LCS), transfection of exogenous Let-7c had

similar reductions of proliferation rate as pBabe control

(Fig. 3E and F, middle), whereas in the cell lines with stable

overexpression of HMGA2a with 3¶-UTR (presence of Let-7

LCS), transfection of exogenous Let-7c (Fig. 3C and D)

resulted in up to a 35% reduction in the proliferation rate

(Fig. 3E and F, right). There were minimal differences of tumor

cell growth rates between control and anti–Let-7 groups. This

could be explained by very low levels or no endogenous Let-7

expression in these cell lines.

To test whether Let-7 microRNAs affect the proliferation

in leiomyomas, we compared the correlation between

endogenous Let-7 microRNAs and the cell proliferation

index in leiomyomas. We selected 36 leiomyomas, in which

the relative abundance of Let-7 microRNAs was scored

based on a microRNA gene microarray analysis (30). By

FIGURE 2. Repression of luciferase expression under HMGA2a 3¶-UTR control by endogenous Let-7 microRNAs in HeLa cells and five leiomyomas.A. Sketch diagram illustrates the luciferase (LCF) reporter gene constructs with and without HMGA2a 3¶-UTR in pGL3.B. Luciferase expression (y axis ) wasmeasured in LCF vehicle alone (empty box ) and LCF + HMGA2a 3¶-UTR (shadowed boxes ) by administration of five different doses of Let-7 inhibitor(0-60 pmol). Fold changes were indicated on top of the bars. ***, P < 0.001. C. Expression analysis of endogenous mature Let-7c (RT-PCR) and HMGA2protein (Western blot) in five HMGA2 mRNA positive leiomyomas corresponding to tumor sizes of 1 cm (T1), 2 cm (T2), 5 cm (T5), 7 cm (T7), and 10 cm (T10).U6 and extracellular signal – regulated kinase (ERK) were loading controls for microRNA and total protein in each sample. D. Luciferase expression (y axis )analysis in these five tumors (T1.0-T10.0) and normal myometrium (MM) in triplicate following transfection with LCF vehicle only (luc+ ), LCF + HMGA2a 3¶-UTR (luc+/3-UTR ), and LCF + HMGA2a 3¶-UTR with Let-7 inhibitor (anti –Let-7 ). Bars, SE. Control LCF expression (vehicle alone) was set at 100 in y axis .

Peng et al.


666

determining the proliferation rate using immunostains for

Ki-67 (a proliferation marker), we found that there was a

weakly negative correlation between Let-7 microRNAs (Let-

7a-1, Let-7b, Let-7c, Let-7d, Let-7e, Let-7f-1 , and Let-7f-2)

and Ki-67 (r = �0.15 to �0.33; data not shown). By

comparing the Ki-67 index (by immunohistochemistry) and

Let-7c expression (by in situ hybridization) in a large

cohort of leiomyomas, an inverse association was observed

(Table 2). These findings suggest that the Let-7c ::HMGA2

regulatory mechanism may play a role in governing

proliferation in leiomyomas.

Correlation of HMGA2 and Let-7 Expression in a LargeLeiomyoma Cohort

Protein levels of HMGA2 were determined via immunohis-

tochemistry. Overall, 45% of leiomyomas had recognizable

nuclear immunoreactivities for HMGA2 (Fig. 4A). Among

them, 37.8% (68 of 180) of leiomyomas had an immunointen-

sity score of 1+ and above. These findings are consistent with

previously published data (37).

The 180 leiomyomas were arbitrarily divided into four

groups, depending on the size of the tumor: 1-3 cm (n = 47),

4-6 cm (n = 53), 7-9 cm (n = 50), and z10 cm (n = 30). The

FIGURE 3. Antiprolifer-ation analysis of Let-7c inPC3 and LNCaP cell lines withstable overexpression ofHMGA2a . A. Sketch diagramillustrates HMGA2a con-structs with and without Let-7LCS in retrovirus pBabe. B.Established PC3 (left ) andLNCaP (right ) cell lines withstable overexpression ofHMGA2a . C and D. Repres-sion of HMGA2a by exoge-nous Let-7c in HMGA2 + PC3(C) and HMGA2 + LNCaP (D)cells with Let-7 LCS. Sampleswere loaded from left to rightas nontreated, Block-iT, Let-7c (40 pmol), Let-7c (40 pmol)+ Let-7c inhibitor (40 pmol),and Let-7c inhibitor (40 pmol)only. The levels of Let-7c andHMGA2 protein were deter-m ined by RT-PCR andWestern blot analysis. U6and actin were used as RNAloading controls. E and F.Cell growth curves in PC3(E) and LNCaP (F) cellswith pBabe (PC3+pBabe ;left ), stable overexpression ofHMGA2a without 3 ¶-UTR(PC3+HMGA2-3¶-UTR ; mid-dle ), and stable overexpres-sion of HMGA2a with 3¶-UTR(PC3+HMGA2+3¶-UTR ; right).Cells were treated by controlRNA (dotted lines ), Let-7c(solid lines ), and Let-7 inhibi-tor (dashed lines ) in triplicate.Cell counts (y axis ) werequantitatively measured bycolorimetric WST-1 stain (seeMaterials and Methods) andtime points (x axis ) were at24, 48, 72, and 96 h. Celltypes were listed below thediagrams.



667

mean immunointensity and positive rate of HMGA2 in each

group were calculated (Fig. 4B), with the highest immunor-

eactivities for HMGA2 present in the 7-9 cm group (2.45 F0.47) and the lowest in the V3 cm group (1.16 F 0.39;

P < 0.05). The percentage of HMGA2-positive cases was

25.9% (7 of 27) in tumors of V3 cm and 61.1% (11 of 18) in

tumors of z10 cm.

HMGA2 mRNA levels, with respect to tumor size, were

determined by RT-PCR with primers from exons 4 and 5

(Table 1). A total of 60 leiomyomas [30 large (z10 cm) and

30 small (V3 cm)] with matched myometrium were analyzed.

HMGA2a mRNAwas detected in 38% (23 of 60) of tumors with

a similar proportion in both the large and small groups. Minimal

expression of HMGA2a mRNA in myometrial controls was

identified (Fig. 4C). The expression of HMGA2a mRNA varied

greatly and the difference between the large and small groups

was insignificant (P = 0.89; Fig. 4C). These results suggest that

Let-7c regulated HMGA2 expression mostly via inhibition of

translation.

Our previous studies identified that 7 of the 11 Let-7

microRNA family members were significantly overexpressed in

leiomyomas via microRNA microarray analysis (30). Of these

seven, five (Let-7c, Let-7d, Let-7e, Let-7f-1 , and Let-7f-2 ;

Ambion) were statistically significant with respect to tumor

size, where smaller tumors had higher levels (Fig. 5A). To

further evaluate the differential expression of Let-7 microRNAs

in different tumor sizes, we examined the mature Let-7a,

Let-7c , and Let-7f-2 by semiquantitative RT-PCR (mirVana

microRNA PCR, Ambion). With an appropriate U6 control,

small (<3 cm) tumors had higher Let-7 expression than the

large (>10 cm) tumors (Fig. 5B).

Let-7c was the most abundant microRNA in Let-7 family

in leiomyomas (Fig. 5B). To further characterize differential

expression of Let-7c in leiomyomas, we examined Let-7c by

microRNA in situ hybridization (Exiqon) in a total of 120

tumors (Fig. 5C and D). The intensity of Let-7c microRNA

was scored in a semiquantitative method in triplicate tissue

cores from each case. The matched myometrium was used as

an internal control and the net gain or loss of Let-7c was

calculated. Overexpression of Let-7c was observed in this

large cohort. When the levels of Let-7c microRNA were

analyzed with respect to leiomyoma size (V3, 4-6, 7-9, andz10 cm), a reduction of Let-7c was substantial in larger

leiomyomas in comparison with small tumors (Fig. 5D). There

was a 2.6-fold difference of Let-7c net loss between the

smallest and the largest leiomyomas (P < 0.05). These

findings are consistent with our previous global microRNA

profiling analysis.

Table 2. Expression of HMGA2 and Ki-67 (Immunohistochemistry) and Let-7c (Tissue In situ Hybridization) in 180Leiomyomas

Tumor Size (cm) P

1-3 4-6 7-9 z10

Cases (n ) 47 53 50 30HMGA2 1.16 F 0.39 2.11 F 0.43 2.45 F 0.47 2.41 F 0.58 <0.05Ki-67 2.03 F 0.91 2.01 F 0.88 4.53 F 0.85 3.52 F 1.08 <0.05Cases (n ) 22 29 45 24Let-7c 0.56 F 0.11 0.46 F 0.13 0.27 F 0.11 0.23 F 0.13 <0.05

FIGURE 4. Differential expression of HMGA2 with respect to leiomyoma size. A. Photomicrographs illustrated examples of immunoreactivity for HMGA2in leiomyomas (positive) and matched myometrium (negative). B. Columns, mean immunoreactivities for HMGA2 gene products (y axis ) in four groups ofdifferent leiomyoma sizes; bars, SE. Significance of immunoscores (P < 0.05) between tumor sizes of 1-3 and 7-9 cm was shown above the columns. C. Dotplot analysis of HMGA2a mRNA expression in small leiomyomas (V3 cm; middle ), large leiomyomas (z10 cm; right ), and matched myometrium (left ). Eachdot represents the relative amount of cDNA scaled by semiquantitative RT-PCR products (y axis ) by density photometry in each tissue sample. Shorthorizontal bars, mean values in each group.

Peng et al.


668

DiscussionHMGA2 is normally expressed in embryonic tissue but

not in normal adult tissue. Proper regulation of HMGA2 is

imperative for its biological function in the development of

specific cell types. Previous studies have shown that HMGA2 is

abnormally overexpressed in many benign and malignant

neoplasms, particularly in uterine leiomyomas. Although its

role in tumorigenesis is not fully understood, overexpression of

HMGA2 is found to be associated with large tumor size in

leiomyomas (16, 37), suggesting its role in promoting tumor

growth.

MicroRNAs are important small molecules known to

participate in the fine-tuning of functional gene activity. Because

HMGA2 is one of the major targets of Let-7 microRNAs

(27-30), and large leiomyomas have high levels of HMGA2

(16, 37) and a high Ki-67 index (38), we speculate that dys-

regulation of the Let-7::HMGA2 regulatory mechanism may be

one of key genetic events promoting leiomyoma growth.

Characterization of Let-7 repression of HMGA2 in leiomyomas

can provide a better understanding of HMGA2 function.

The HMGA2 gene consists of five exons and spans >200 kb

with a large intronic sequence (>100 kb) between exons 3

FIGURE 5. Differentialexpressions ofLet-7 microRNAswith respect to leiomyomasize.A. Unsupervised dendro-gram cluster analysis of sevenLet-7 family members (row )in a total of 48 leiomyomas(column ) of small (1-3 cm),intermediate (4-9 cm), andlarge (z10 cm) leiomyomas(the tumor sizes were indicatedin colored bars underneath).The net changes of Let-7microRNAs are marked in red(overexpression), black (nochange), and green (underex-pression). B. Photonegativeimages of Let-7a, Let-7c , andLet-7f-2 by RT-PCR in ran-domly selected eight small(S1-S8) and eight large (L1-L8) leiomyomas. U6 was usedas an RNA loading control. C.Photomicrographs illustratingexamples of Let-7c expressionin myometrium (left) and small(middle ) and large (right ) leio-myomas (ULM ) by microRNAin situ hybridization (details inMaterials and Methods). Inten-sity of the purple color repre-sents the relative amount ofLet-7c expression. D. Semi-quantitative analysis of Let-7cexpression based on the inten-sity of microRNA in situ hybrid-ization signals (seeC). The netchanges of Let-7 expression inleiomyomas were normalizedagainst the matched myome-trium (y axis ). The means ofLet-7c in each of four tumorsize groups are given (x axis ).The fold changes betweenthe smallest leiomyomas andother sizes of leiomyomaswere listed above. *, P < 0.05.



669

and 4. The major transcript is HMGA2a , a 4.1-kb mRNA from

five exons that translates to a 108-amino-acid HMGA2 protein.

The first exon encodes the first 37 amino acid residues for the

first AT-hook domain. The second and third AT-hook domains

are encoded by the second and third exons, respectively. Exon 4

encodes 12 amino acids to separate the AT-hooks from the

COOH-terminal amino acid domain, encoded by exon 5 (39).

Many cryptic transcripts seem to have unique 3¶ exons along thelarge intron 3. Although the full-length mRNA sequences from

most cryptic transcripts remain undetermined, we illustrate that,

in addition to the dominant transcript,HMGA2a , two other minor

transcripts,HMGA2c andHMGA2f , can be destabilized by Let-7

microRNAs in leiomyomas. Apparently, regulation of HMGA2

transcripts can be complicated by its genetic and transcriptional

mechanisms, depending on whether Let-7 LCS exists.

Several attempts to characterize the molecular regulation of

Let-7 ::HMGA2 pairing in leiomyomas have been conducted in

this study. We characterized that HMGA2 , in natural leiomyo-

mas and stable HMGA2a expression cell lines, can be repressed

by exogenous Let-7 microRNAs. Endogenous Let-7 micro-

RNAs in leiomyoma tumor cells can repress luciferase activity

when HMGA2 3¶-UTR is present. In HMGA2a-positive

leiomyomas, the levels of endogenous Let-7 microRNAs

determine the levels of HMGA2a gene products. Because

HMGA2 overexpression and a loss of Let-7 microRNA

expression are more common in large leiomyomas (Fig. 5),

we proposed that disrupting the pairing between Let-7 and

HMGA2 is an important molecular mechanism in promoting

leiomyoma growth. A supporting factor arises from the inverse

association between Let-7 expression and the Ki-67 index in

leiomyomas (Table 2). Although we do not have a good in vitro

model to show that HMGA2 promotes leiomyoma growth

(due to a slow growth rate of leiomyoma primary culture), the

mitogenic role of HMGA2 was examined in the HMGA2-

positive PC3 and LNCaP cell lines (Fig. 3) and in the NIH 3T3

cell line in xenografts of nude mice (29). The findings from this

study and other recent publications (27-29) strongly suggest

that Let-7 microRNAs are important molecules that regulate

HMGA2 expression and tumor cell growth.

Let-7 microRNAs may regulate 500 to 600 genes (PicTar

and TargetScan). Of the 1,780 significantly dysregulated genes

in leiomyomas (40, 41), 33 are predicted targets of Let-7

microRNAs. Of these, only a few are significantly dysregulated

in leiomyomas and are therefore likely biological targets. In

addition to HMGA2, Let-7 regulation of leiomyoma growth

may also be mediated through other predicted targets. Although

RAS genes have been characterized as Let-7 targets (42), no

evidence of abnormal expression of RAS genes in leiomyomas

has been documented.

Regulation of Let-7 microRNAs is not a well established

phenomenon. In humans, various Let-7 genes have been

reported to map to regions deleted in many human cancers

(24, 25). Therefore, direct genomic alterations could result in a

loss of Let-7 expression. Recently, Kulshreshtha et al. (43)

conducted a global analysis of microRNA expression and

identified a group of microRNAs that can be regulated by

hypoxia (hypoxia-regulated microRNAs) in colon and breast

cancer cells. Of interest, Let-7 microRNAs can be regulated by

hypoxia, and Let-7 hypoxia-regulated microRNAs seem to be

tissue specific. For example, in squamous cell carcinoma,

hypoxia induces Let-7s overexpression (27); in comparison, in

nasopharyngeal carcinoma, down-regulation of Let-7s by

hypoxia is evident (44). The loss of Let-7 in large leiomyomas

requires further study.

Materials and MethodsPatient and Tissue Samples

Leiomyoma tissue samples were collected from hysterecto-

my specimens removed for symptomatic disease. Of the 30

cases selected, fresh frozen tissues from one large (z10 cm)

and one small (V3 cm) leiomyoma and matched myometrium

were collected. All tissue samples were collected within 1 to

4 h of surgery. Tissues were stored at �80jC before being used

to examine mRNA, microRNA, and protein by RT-PCR,

Northern blot, and Western blot analyses, respectively. Eight

HMGA2-positive leiomyomas were selected for additional

transfection and luciferase assays.

Two large tissue microarrays (TMA1 and TMA2), prepared

from paraffin-embedded tumors and matched myometrium,

were used to examine HMGA2 and Let-7c microRNA

expression. TMA1 contained 60 cases (45) and TMA2

contained 120 cases (46). Details about mean age and tumor

sizes are summarized in Table 3. The study was approved by

the NYU Medical Center Institutional Review Board.

Let-7 MicroRNA and let-7 InhibitorsMature double-stranded microRNAs of Let-7 and Let-7

inhibitors were purchased from Dharmacon, Inc. All experi-

ments were controlled using a nonfunctional double-stranded

random 22-nucleotide RNA (Block-it, Invitrogen).

HMGA2 cDNA ConstructsThe PCR products of full-length HMGA2a (forward primer,

5¶-ATGAGCGCACGCGGTGAGGGC-3¶; reverse primer, 5¶-GTTAGAAGACACTCAAAGGAACAG-3¶) and HMGA2a

3¶-UTR (forward, 5¶-GAGGAAACTGAAGAGACATCCTC-3¶; reverse, 5¶-GTTAGAAGACACTCAAAGGAACAG-3¶,

Table 3. Summary of Patients and Tissue Samples

Tissue Source No. Cases (No. Tumors) Mean Age (Range), y Tumor Sizes (Range), cm References

TMA1 60 (60) 49.2 (37-82) 5.77 (1.5-19.0) Wei et al. (45)TMA2 120 (120) 46.8 (35-59) 6.83 (1.0-22.0) Wei et al. (46)Fresh-frozen tissue 30 (60) 45.8 (35-52) V3/z10 This studyPrimary cell culture 5 (8) 42.5 (41-45) 1-10 This study

Peng et al.


670

containing 5 Let-7 LCS; Table 1) were cloned into the

pDNA3.1 construct (Invitrogen). The HMGA2a 3¶-UTRcDNAs were prepared with the XbaI linker and further

subcloned into the Luciferase Reporter Vector pGL3 (Prom-

ega). Retroviral pBabe-puro vectors were treated with NdeI and

BamHI, releasing the full-length HMGA2a cDNA insert from

pcDNA3.1 and subsequently subcloning it into the pBabe-puro

vector. The orientation and fidelity of the cDNA sequence were

verified by sequence analysis.

PC3 and LNCaP Cell Lines with Stable Overexpression ofHMGA2a

To produce viral vectors, pBabe retroviral constructs

containing HMGA2a , with and without the 3¶-UTR, were

transfected onto the Phoenix amphotropic packaging cell line

(American Type Culture Collection) per manufacturer’s proto-

col for Lipofectamine-mediated transfection. Subsequently,

LNCaP and PC3 cells were infected with a mixture of viral

supernatant and fresh medium at a ratio of 1:4 in the presence of

4 Ag/mL polybrene for 24 to 48 h. Single colonies with proven

expression of HMGA2 by Western blot were isolated and

further cultured for use in proliferation assays.

Let-7c MicroRNA In situ HybridizationThe hybridization system and probes, miRCURY LNA,

Let-7c , and U6 , were purchased from Exiqon. The detailed

procedure for in situ hybridization was done per manufacturer’s

protocol (47). In brief, 4-Am TMA2 slides were prepared.

Following deparaffinization and deproteinization, the slides

were prehybridized with 1� hybridization buffer without

probe. The hybridization was carried out overnight in a

1� hybridization buffer (30-70 AL) with predenatured miR-

CURY LNA, Let-7c , or U6 probes. After washing, the slides

were blocked and incubated with alkaline phosphatase–

conjugated anti-DIG Fab fragments (1:1500; Roche) and

visualized for color detection.

Quantitative RT-PCRFor the detection of mature microRNAs, mirVana quantita-

tive RT-PCR primers and the mirVana Quantitative RT-PCR

Detection Kits (Ambion) were used and optimized according

to the abundance of microRNAs in the samples. In brief, 50 to

100 ng of total RNA were reverse transcribed with specific

microRNA primers. A total of 15 to 30 cycles were done for

quantitation. Primers for the common domain of HMGA2 , the

dominant transcript (HMGA2a), and the cryptic HMGA2

transcripts were designed (Table 1). The abundances of cDNA

products were detected by quantitative RT-PCR and were

normalized by the internal control products of U6 and a-actin.

ImmunohistochemistryThe TMA blocks from formalin-fixed and paraffin-embedded

tissues were sectioned at 4 Am. After deparaffinization and anti-

gen retrieval, all immunohistochemical staining was done on a

Ventana Nexus automated system.

Western Blot AnalysisFresh frozen tissue or culture cell samples were homogenized

at 4jC in a protein lysis buffer (0.5 g tissue in 1-2 mL). Identical

amounts of total proteins from each sample were separated

through a 12% SDS-PAGE gel and then transferred onto a

polyvinylidene difluoride membrane (Perkin-Elmer Life Scien-

tific, Inc.). Development of the immunoblot with antisera

against HMGA2 and negative control HMGA2 blocking peptide

(from Dr. Alfredo, Universita degli Studi di Napoli, Napoli, Italy,

and Santa Cruz Biotechnology, Inc.) was tested and a single

specific HMGA2 band at 25 kDa was detected, as previously

described.

Primary Cell CultureSelected leiomyomas were chopped into small fragments

(1 mm) and placed in DMEM (Invitrogen) containing 10%

fetal bovine serum (Gemini) and 250 units/mL collagenase V

(Sigma-Aldrich) for 2 to 4 h in a 37jC incubator. Cells were

washed and maintained in 37jC incubators with 5% CO2 until

the cells reached 30% to 40% confluence. For long-term

storage, cells were trypsinized, resuspended in freezing

medium, and stored in liquid nitrogen.

MicroRNA TransfectionBefore transfection, cells were placed in standard medium

without antibiotics for 24 h. Per manufacturers’ protocol,

transfection was done using the Lipofectamine system with

microRNA concentrations of 20 to 60 pmol/well in either

6-well or 24-well plates. To estimate transfection efficiency,

cotransfection with the Block-iT Fluorescent double-stranded

random 22-mer RNA (Invitrogen) was done. The FITC

fluorescence was visualized by lex = 494 nm and lem = 519

nm to assess the percentage of cells that were successfully

transfected. Cells receiving only the tagged random sequence

double-strand 22-mer were used as nonspecific references at all

data points. Following transfection, cells were harvested and

analyzed at the indicated times.

Luciferase Transfection AssaysHeLa cells and primary leiomyoma cell cultures were split at

a cellular density of 1 � 104 per well into 24-well plates f24 h

before transfection. After washing with PBS, cells in each well

were transfected with 200 ng of either the luciferase reporter

pGL3 control (Promega) or the pGL3HMGA2 3¶-UTR construct,

as well as with 1 ng of the pRLuc internal control plasmid

(Biosignal). To block the endogenous effect of Let-7, cotrans-

fection of Let-7 inhibitors at various doses (0, 20, 30, 40, and

60 pmol; Dharmacon) was also done. Cells were maintained in

transfection conditions for 48 h and harvested for the dual

luciferase assay (Promega). Briefly, cells were washed and lysed

in 100 AL of 1� lysis buffer. The lysis mixture was transferred

into an Eppendorf tube containing 100 AL of solution A. The

luciferase expression was determined as recommended by

Promega or by a Western blot analysis of HMGA2.

Cellular Proliferation AssayPC3 and LNCaP cell lines of control (with pBabe) and of

tests (stable overexpression of HMGA2a with and without

Let-7 LCS) were passed in 24-well plates in triplicate at

densities of 5 � 103 per well for LNCaP and 1 � 104 per well

for PC3 cells. Cells were subsequently transfected with control



671

RNA (nonfunction; Invitrogen), Let-7c , and/or Let-7 inhibitors

(Dharmacon) at a dose of 40 pmol/well. Cellular proliferation

was counted at 24, 48, 72, and 96 h using the colorimetric

WST-1 assay (Cell Proliferation Reagent, Roche). Briefly,

the cells were rinsed with PBS and then incubated with 10%

WST-1 reagent in a serum-free medium for 2 h. Aliquots were

then transferred to 96-well plates and the samples were read in

a spectrophotometric plate reader at 450 nm (FLUOstar

OPTIMA, BMG Lab Technologies).

Statistical AnalysisMean and SEs were calculated for the quantitative values.

Statistical significance was analyzed by a paired t test and

P < 0.05 was considered significant.

AcknowledgmentsWe thank Dr. Eva Hernando for the scientific discussions, and Drs. PatriciaSoteropoulos, Virginie Aris, Tongsheng Wang, Luis Chiriboga, Peng Lan, andHuihui Ye for providing technical assistance in our early microRNA profilinganalysis, TMA preparation, microRNA in situ hybridization, and immunostains.

References1. Baird DD, Dunson DB, Hill MC, Cousins D, Schectman JM. High cumulativeincidence of uterine leiomyoma in black and white women: ultrasound evidence.Am J Obstet Gynecol 2003;188:100 –7.

2. Varol N, Healey M, Tang P, et al. Ten-year review of hysterectomy morbidityand mortality: can we change direction? Aust N Z J Obstet Gynaecol 2001;41:295– 302.

3. Zhao SZ, Wong JM, Arguelles LM. Hospitalization costs associated withleiomyoma. Clin Ther 1999;21:563–75.

4. Mauskopf J, Flynn M, Thieda P, Spalding J, Duchane J. The economic impactof uterine fibroids in the United States: a summary of published estimates.J Womens Health (Larchmt) 2005;14:692– 703.

5. Flake GP, Andersen J, Dixon D. Etiology and pathogenesis of uterineleiomyomas: a review. Environ Health Perspect 2003;111:1037–54.

6. Ligon AH, Morton CC. Leiomyomata: heritability and cytogenetic studies.Hum Reprod Updat 2001;7:8 –14.

7. Quade BJ, Weremowicz S, Neskey DM, et al. Fusion transcripts involvingHMGA2 are not a common molecular mechanism in uterine leiomyomata withrearrangements in 12q15. Cancer Res 2003;63:1351 –8.

8. Schoenberg Fejzo M, Ashar HR, Krauter KS, et al. Translocation breakpointsupstream of the HMGIC gene in uterine leiomyomata suggest dysregulation ofthis gene by a mechanism different from that in lipomas. Genes ChromosomesCancer 1996;17:1 –6.

9. Rein MS, Powell WL, Walters FC, et al. Cytogenetic abnormalities inuterine myomas are associated with myoma size. Mol Hum Reprod 1998;4:83 –6.

10. Hennig Y, Deichert U, Bonk U, et al. Chromosomal translocations affecting12q14-15 but not deletions of the long arm of chromosome 7 associated with agrowth advantage of uterine smooth muscle cells. Mol Hum Reprod 1999;5:1150–4.

11. Quade BJ, Wang TY, Sornberger K, et al. Molecular pathogenesis of uterinesmooth muscle tumors from transcriptional profiling. Genes ChromosomesCancer 2004;40:97–108.

12. Vanharanta S, Wortham NC, Laiho P, et al. 7q deletion mapping andexpression profiling in uterine fibroids. Oncogene 2005;24:6545 –54.

13. Rogalla P, Drechsler K, Frey G, et al. HMGI-C expression patterns in humantissues. Implications for the genesis of frequent mesenchymal tumors. Am JPathol 1996;149:775 –9.

14. Gattas GJ, Quade BJ, Nowak RA, Morton CC. HMGIC expression in humanadult and fetal tissues and in uterine leiomyomata. Genes Chromosomes Cancer1999;25:316 –22.

15. Reeves R. Molecular biology of HMGA proteins: hubs of nuclear function.Gene 2001;277:63 –81.

16. Gross KL, Neskey DM, Manchanda N, et al. HMGA2 expression in uterine

leiomyomata and myometrium: quantitative analysis and tissue culture studies.Genes Chromosomes Cancer 2003;38:68 –79.

17. Hauke S, Leopold S, Schlueter C, et al. Extensive expression studies revealeda complex alternative splicing pattern of the HMGA2 gene. Biochim BiophysActa 2005;1729:24– 31.

18. Reinhart BJ, Slack FJ, Basson M, et al. The 21-nucleotide Let-7 RNAregulates developmental timing in Caenorhabditis elegans . Nature 2000;403:901 –6.

19. Pasquinelli AE, Reinhart BJ, Slack F, et al. Conservation of the sequence andtemporal expression of Let-7 heterochronic regulatory RNA. Nature 2000;408:86 –9.

20. Lagos-Quintana M, Rauhut R, Lendeckel W, Tuschl T. Identification of novelgenes coding for small expressed RNAs. Science 2001;294:853– 8.

21. Bagga S, Bracht J, Hunter S, et al. Regulation by Let-7 and lin-4 miRNAsresults in target mRNA degradation. Cell 2005;122:553 –63.

22. Lee YS, Kim HK, Chung S, Kim KS, Dutta A. Depletion of human micro-RNA miR-125b reveals that it is critical for the proliferation of differentiated cellsbut not for the down-regulation of putative targets during differentiation. J BiolChem 2005;280:16635– 41.

23. Pillai RS, Bhattacharyya SN, Artus CG, et al. Inhibition oftranslational initiation by Let-7 MicroRNA in human cells. Science 2005;309:1573– 6.

24. Calin GA, Sevignani C, Dumitru CD, et al. Human microRNA genes arefrequently located at fragile sites and genomic regions involved in cancers. ProcNatl Acad Sci U S A 2004;101:2999–3004.

25. Takamizawa J, Konishi H, Yanagisawa K, et al. Reduced expression of theLet-7 microRNAs in human lung cancers in association with shortenedpostoperative survival. Cancer Res 2004;64:3753 –6.

26. Hui P, Li N, Johnson C, et al. HMGA proteins in malignant peripheralnerve sheath tumor and synovial sarcoma: preferential expression ofHMGA2 in malignant peripheral nerve sheath tumor. Mod Pathol 2005;18:1519– 26.

27. Hebert C, Norris K, Scheper MA, Nikitakis N, Sauk JJ. High mobility groupA2 is a target for miRNA-98 in head and neck squamous cell carcinoma. MolCancer 2007;6:5.

28. Lee YS, Dutta A. The tumor suppressor microRNA Let-7 represses theHMGA2 oncogene. Genes Dev 2007;21:1025 –30.

29. Mayr C, Hemann MT, Bartel DP. Disrupting the pairing between Let-7 andHMGA2 enhances oncogenic transformation. Science 2007;315:1576–9.

30. Wang T, Zhang X, Obijuru L, et al. A micro-RNA signature associated withrace, tumor size, and target gene activity in human uterine leiomyomas. GenesChromosomes Cancer 2007;46:336– 47.

31. Mine N, Kurose K, Nagai H, et al. Gene fusion involving HMGICis a frequent aberration in uterine leiomyomas. J Hum Genet 2001;46:408 –12.

32. Kurose K, Mine N, Iida A, et al. Three aberrant splicing variants of theHMGIC gene transcribed in uterine leiomyomas. Genes Chromosomes Cancer2001;30:212–7.

33. John B, Enright AJ, Aravin A, et al. Human microRNA targets. PLoS Biol2004;2:e363.

34. Lewis BP, Burge CB, Bartel DP. Conserved seed pairing, often flanked byadenosines, indicates that thousands of human genes are microRNA targets. Cell2005;120:15–20.

35. Schmitter D, Filkowski J, Sewer A, et al. Effects of Dicer and Argonautedown-regulation on mRNA levels in human HEK293 cells. Nucleic Acids Res2006;34:4801–15.

36. Volinia S, Calin GA, Liu CG, et al. A microRNA expression signature ofhuman solid tumors defines cancer gene targets. Proc Natl Acad Sci U S A 2006;103:2257– 61.

37. Tallini G, Vanni R, Manfioletti G, et al. HMGI-C and HMGI(Y)immunoreactivity correlates with cytogenetic abnormalities in lipomas, pulmo-nary chondroid hamartomas, endometrial polyps, and uterine leiomyomas and iscompatible with rearrangement of the HMGI-C and HMGI(Y) genes. Lab Invest2000;80:359–69.

38. Wei JJ, Chiriboga L, Mittal K. Expression profile of the tumorigenic factorsassociated with tumor size and sex steroid hormone status in uterine leiomyomata.Fertil Steril 2005;84:474 –84.

39. Chau KY, Patel UA, Lee KL, Lam HY, Crane-Robinson C. The gene forthe human architectural transcription factor HMGI-C consists of five exonseach coding for a distinct functional element. Nucleic Acids Res 1995;23:4262– 6.

Peng et al.


672

40. Hoffman PJ, Milliken DB, Gregg LC, Davis RR, Gregg JP. Molecularcharacterization of uterine fibroids and its implication for underlying mechanismsof pathogenesis. Fertil Steril 2004;82:639–49.

41. Arslan AA, Gold LI, Mittal K, et al. Gene expression studies provide clues tothe pathogenesis of uterine leiomyoma: new evidence and a systematic review.Hum Reprod 2005;20:852– 63.

42. Johnson SM, Grosshans H, Shingara J, et al. RAS is regulated by the Let-7microRNA family. Cell 2005;120:635 –47.

43. Kulshreshtha R, Ferracin M, Negrini M, et al. Regulation of microRNAexpression: the hypoxic component. Cell Cycle 2007;6:1426–31.

44. Hua Z, Lv Q, Ye W, et al. MiRNA-directed regulation of VEGF and otherangiogenic factors under hypoxia. PLoS ONE 2006;1:e116.

45. Wei J, Chiriboga L, Mizuguchi M, Yee H, Mittal K. Expression profile oftuberin and some potential tumorigenic factors in 60 patients with uterineleiomyomata. Mod Pathol 2005;18:179 –88.

46. Wei JJ, Chiriboga L, Arslan AA, et al. Ethnic differences in expression of thedysregulated proteins in uterine leiomyomata. Hum Reprod 2006;21:57– 67.

47. Kloosterman WP, Wienholds E, de Bruijn E, Kauppinen S, Plasterk RH.In situ detection of miRNAs in animal embryos using LNA-modifiedoligonucleotide probes. Nat Methods 2006;3:27–9.



673

Antiproliferative Effects by Let-7 Repression of High-Mobility Group A2 in Uterine Leiomyoma

Documents

Transcript of Antiproliferative Effects by Let-7 Repression of High-Mobility Group A2 in Uterine Leiomyoma