Downloaded from www.microbiologyresearch.org by

IP: 23.22.50.124

On: Mon, 09 May 2016 08:02:04

Journal of General Virology (2002), 83, 2811–2820. Printed in Great Britain. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Analysis of the human herpesvirus-6 immediate-early 1protein

Richard Stanton,1 Julie D. Fox,1 Richard Caswell,3 Emma Sherratt2 and Gavin W. G. Wilkinson2

1, 2 Department of Medical Microbiology1 and Section of Infection and Immunity2, University of Wales College of Medicine,Tenovus Building, Heath Park, Cardiff CF14 4XN, UK3 Cardiff School of Biosciences, Cardiff University, Cardiff CF10 3US, UK

Herpesvirus immediate-early (IE) gene products play key roles in establishing productiveinfections, regulating reactivation from latency and evading immune recognition. Analyses ofHHV-6 IE gene expression have revealed that the IE1 gene of the HHV-6A and HHV-6B variantsexhibits a higher degree of sequence variation than other regions of the genome and no obvioussimilarity to its positional analogue in HCMV. We have analysed expression of the HHV-6 U1102(HHV-6A) and Z29 (HHV-6B) IE1 gene products using transient expression vectors, stable cell linesand in the context of lytic virus infection. The IE1 transcripts from both variants demonstrate asimilar pattern of splice usage within their translated regions. The HHV-6 IE1 proteins from bothvariants traffic to, and form a stable interaction with, PML-bodies (also known as ND10 or PODS).Remarkably, PML-bodies remained structurally intact and associated with the IE1 protein through-out lytic HHV-6 infection. Immunoprecipitation studies demonstrated that HHV-6 IE1 from bothvariants is covalently modified by conjugation to the small ubiquitin-like protein SUMO-1. Over-expression of SUMO-1 in cell lines resulted in substantially enhanced levels of IE1 expression;thus sumoylation may bestow stability to the protein. These results indicate that the HHV-6 IE1protein interacts with PML-bodies yet, unlike other herpesviruses, HHV-6 appears to have norequirement or mechanism to induce PML-body dispersal during lytic replication.

IntroductionHuman herpesvirus-6 (HHV-6) is a betaherpesvirus classi-

fied along with human herpesvirus-7 in the Roseolavirus genus.Two distinct variants exist, designated HHV-6A and HHV-6B,that exhibit consistent differences in DNA sequence, reactivityto monoclonal antibodies, cell tropism and disease association(Pellett & Black, 1996). The virus is ubiquitous with up to 95%of adults in industrialized nations being seropositive. Infectioncommonly occurs by age 3 years and the virus is the causativeagent of the childhood disease exanthem subitum (Yamanishi etal., 1988). HHV-6 virus load and antibody titre is frequentlyelevated in renal allograft patients and reactivation associatedwith immunosuppression has been correlated with organrejection. In bone marrow transplant recipients, HHV-6 isassociated with rash, graft-versus-host disease, pneumonitis,febrile episodes and suppression of graft outgrowth. Fur-thermore, HHV-6A has been associated with rapid progression

Author for correspondence: Gavin Wilkinson.

Fax ­44 29 20745003. e-mail WilkinsonGW1!cf.ac.uk

of human immunodeficiency virus (HIV)-related symptomsand both variants have also been linked in some studies withthe pathogenesis of multiple sclerosis and chronic fatiguesyndrome (Brenmer & Clark, 1999 ; Caserta et al., 2001).

Concomitant HHV-6 and human cytomegalovirus(HCMV) infections occur frequently in immunosuppressedorgan transplant patients (Irving et al., 1990 ; DesJardin et al.,1998) and, given that they infect overlapping cell types(Kondo et al., 1991 ; Taylor-Wiedeman et al., 1991), thepotential exists for the two viruses to interact directly in vivo.The HHV-6 genome (162–170 kb) is composed of a uniquelong segment bracketed by direct repeats. The unique longgenomic elements of HHV-6 and HCMV are essentiallycollinear (Neipel et al., 1992), with 67% of HHV-6A (U1102)genes having counterparts in HCMV (Gompels et al., 1995). Incommon with other herpesviruses, HHV-6 operates a cascadesystem of gene regulation conventionally divided into theimmediate-early (IE), early and late phases. A positionalhomologue of the HCMV major IE gene (IE1) exists in HHV-6(within the IE-A region). The HCMV major IE gene inter-acts with cellular factors (e.g. p107, E2F) and encodes a

0001-8522 # 2002 SGM CIBB

Downloaded from www.microbiologyresearch.org by

IP: 23.22.50.124

On: Mon, 09 May 2016 08:02:04

R. Stanton and othersR. Stanton and others

transcriptional trans-activator that acts synergistically withHCMV IE2 (Lukac et al., 1994). HCMV IE1 is essential forefficient productive infection at low m.o.i. in vitro, but is dis-pensable at high-input m.o.i. (Mocarski et al., 1996). HCMVIE1 induces the disruption of PML-bodies and causes bothIE1 and PML to become associated with mitotic chromatin(Lafemina et al., 1989 ; Wilkinson et al., 1998). PML-bodies(also known as ND10 or PODs) are punctate structures associ-ated with the nuclear matrix that contain, or transientlyassociate with, an assortment of cellular proteins includingSUMO-1, Sp100, Sp140, CBP, BLM, Daxx, pRB and p53(Zhong et al., 2000). PML is the defining marker for PML-bodies and is required for the recruitment of other proteins tothe domain (Ishov, 1999). PML modification by covalentlinkage to SUMO-1 (a small ubiquitin-like molecule) is re-quired for its migration to PML-bodies (Muller et al., 1998).Both HCMV IE1 and IE2 are SUMO-modified and, in the caseof IE2, this modification is necessary for its transactivatingfunctions (Muller & Dejean, 1999 ; Hofmann et al., 2000).

There is no obvious amino acid sequence homologybetween HCMV IE1 and its positional homologue in HHV-6.Four transcripts are produced from the HHV-6 IE-A region ofwhich only one, designated HHV-6 IE1, is produced under IEconditions (Schiewe et al., 1994 ; Mirandola et al., 1998). TheHHV-6A IE1 transcript is produced from five exons ; translationis initiated in exon 3 and encodes an open reading frame (ORF)(2826 bp) predicted to encode a product of 104 kDa (IE1

*%"aa).

The designated HHV-6B IE1 ORF is slightly longer (3237 bp)and is predicted to encode a 120 kDa protein (IE1

"!()aa)

(Dominguez et al., 1999). Interestingly, the IE-A region is themost variable part of the HHV-6 genome, with ORFs in thisregion showing only 63% nucleotide identity between HHV-6A and HHV-6B variants as compared with an overall identityfor all ORFs of 94% (Isegawa et al., 1999).

The herpesvirus IE genes exhibit extreme sequence vari-ation and have diverse biological properties yet clearly play apivotal role in both initiating and establishing the lytic phaseof the replication cycle. We were intrigued by the elevatedlevel of sequence variation in the IE1 region between theHHV-6 variants and its absolute divergence from its counter-part in HCMV. It is possible that while the sequence of thisgenetic element may have diverged during the evolution of thebetaherpesviruses, many of its functions have been conserved.In this study we therefore sought to analyse the products ofthe HHV-6A and HHV-6B IE1 genes and, more specifically, toexplore their potential interactions with components of PML-bodies.

Methods+ Cells and viruses. HHV-6 variant A strain U1102 was kindlyprovided by U. Gompels (London School of Hygiene and TropicalMedicine, UK), and variant B strain Z29 was provided by D. Clarke(University College London, UK) with permission from P. E. Pellett(Centers for Disease Control and Prevention, Atlanta, Georgia). HHV-6

variants were propagated using Molt 3 cells (strain Z29), JJhan cells(strain U1102) or peripheral blood mononuclear cells (PBMC) (strainU1102) in RPMI (Sigma) supplemented with 10% foetal calf serum and5mM -glutamine (Life Technologies). To infect PBMCs, strain U1102-infected JJhan cells were incubated with 83 µg}ml mitomycin C (Sigma)at 37 °C for 20 min. Cells were washed twice in PBS and added toseparated peripheral blood cells. Infected PBMC were stimulated with0±1 units}ml interleukin-2 (Sigma) and 5 µg}ml lectin (Sigma).

DNA transfections were carried out using Polyfect (Qiagen)according to the manufacturer’s standard protocol. U373 cells expressing6¬His-tagged SUMO-1 (U373-SUMO) were generated by puromycin(Invitrogen) selection following transfection with pIRES-HisSUMO,kindly provided by D. Bailey (Marie Curie Research Institute, Oxted,UK). pZ29-GFP and pU1102-GFP (see below) were transfected intoU373 cells and cell lines generated following G418 sulphate selection(2mg}ml ; Sigma).

+ Plasmid construction. The HHV-6 IE1 ORFs from strains U1102(Gompels et al., 1995) and Z29 (Dominguez et al., 1999) were amplifiedby PCR from genomic DNA and cloned directly as C-terminal GFPfusion constructs in the transient mammalian expression vector pCT-GFP-TOPO (Invitrogen) to generate the plasmids pU1102-GFP andpZ29-GFP. HHV-6 template DNA was extracted from tissue culturepreparations of the appropriate virus using a silica slurry methodpreviously described (Boom et al., 1990). For Z29 IE1 the 5« primer wasZ29IE-CL (GATAAATTTGAGCATTTTCTTCG) and the 3« primer wasA-IECL2 (GCGGTGTCTCAATTTGCATC). For U1102, the 5« primerA-IECL1 (GATAGATTTGAGCATTTTCTACG) and the 3« primerA-IECL2 were utilized. Primers were obtained from Oswel DNA servicesand HPLC-purified. The PCR conditions involved denaturation at 94 °Cfor 2 min ; 9 cycles of denaturation (94 °C for 30 s), annealing(50 °C for 30 s) and incubation (68 °C for 7 min) ; a further 19cycles in which the incubation period increased by 20 s per cycle ; andfinally incubation at 68 °C for 14 min. 100 pmol of each primer, 200 µMdNTPs (Amersham Biosciences), manufacturer’s buffer containing1±5 mM MgCl

#and 1 unit Pwo polymerase (Hybaid) were used in a final

reaction volume of 50µl. Thermocycling was undertaken in a PTC-100thermocycler (GRI Ltd). All PCR-generated fragments for cloning weresequenced and constructs that matched the published sequence used foreach variant.

A plasmid expressing a nuclear form of GFP was made by amplifyingexons 2 and 3 of HCMV IE1 by PCR and inserting the fragment into theEGFP-N1 mammalian expression vector (Clontech) as an N-terminal GFPfusion.

+ Construction of a recombinant adenovirus. The completeHHV-6 IE1 ORF from strain U1102 was amplified using primers RS1(GGCCGTCGACGCGGTGTCTCAATTTGCATC) and RS2 (GGCCA-CTAGTACATCTAGGTTTCATCTAGCTA) with the same cyclingconditions as for the generation of pU1102-GFP and pZ29-GFP. TheDNA sequence of the clone used in expression studies matched thepublished sequence (Gompels et al., 1995). A replication-deficientadenovirus recombinant (RAdHHV-6) encoding HHV-6-IE1

*%"aaunder

the control of the HCMV major IE promoter was generated as describedpreviously (Wilkinson et al., 1992).

+ Immunohistochemistry. An anti-HHV-6 IE1-specific polyclonalantibody was generated by intraperitoneal murine immunization with theRAdHHV-6 recombinant as described previously (Tomasec et al., 2000)and diluted 1 in 100 for use in immunofluorescence and Western blots.Monoclonal antibodies to SUMO-1 (Zymed) and PML (Santa Cruz)and rabbit polyclonal antisera specific for PML (MBL) were diluted 1 in100 for use in immunofluorescence. FITC- and Texas red-conjugatedsecondary antibodies were obtained from Sigma. Immunofluorescence

CIBC

Downloaded from www.microbiologyresearch.org by

IP: 23.22.50.124

On: Mon, 09 May 2016 08:02:04

Analysis of HHV-6 IE1 proteinAnalysis of HHV-6 IE1 protein

and Western blotting conditions were performed as described previously(Sambrook & Russell, 2001b). For co-immunofluorescence primaryantibodies were mixed and applied together, as were secondaryantibodies.

+ Immunoprecipitation. Extracts were made from U373 cell lines bylysing centrifuged intact cells in 500 µl RIPA buffer (0±5%, v}v, NP-40,0±5%, w}v, sodium deoxycholate, 0±5%, w}v, SDS, 150 mM NaCl,10 mM Tris pH 7±4, 5 mM EDTA, 2 mM PMSF, 4 mM N-ethylmalei-mide). Lysates were cleared by centrifugation at 10000 g (10 min). Rabbitpolyclonal anti-GFP (2 µl ; Abcam, UK) was added to 500 µl lysate andincubated with mixing overnight at 4 °C. Protein A–agarose(20 µl ; Amersham Biosciences) was added for a further 3 h at 4 °C.Precipitated material was recovered by centrifugation (10000 g for10 min) and washed four times in RIPA buffer. The sample was boiledfor 5 min in 1¬ SDS–PAGE running buffer containing 100 mM DTTand analysed in Western blot experiments (as above) following electro-phoresis on a 6% polyacrylamide gel (Sambrook & Russell, 2001a).

ResultsCo-localization of HHV-6 IE1 with PML-bodies

Although two potential in-frame ATG initiation codonsites, 162 bp apart, have been identified in the HHV-6 strainU1102 IE1 sequence, only the upstream site is maintained inboth A (U1102) and B (HST and Z29) variant IE1 genesequences (Schiewe et al., 1994 ; Gompels et al., 1995 ; Isegawaet al., 1999 ; Dominguez et al., 1999) ; the upstream start sitewas therefore selected for expression of the strain U1102 IE1gene. HHV-6 IE1 gene fusions were inserted into mammalianexpression vectors both in native form and as GFP-fusionconstructs as detailed in the Methods. Splicing of both HHV-6IE1 variant mRNAs in transient transfections was found tomatch that previously published (data not shown) (Kondo et al.,2002 ; Schiewe et al., 1994).

To examine the intracellular distribution of the HHV-6 IE1gene product in eukaryotic cells, U373 cells were transfectedwith plasmids expressing GFP-tagged IE1 proteins from bothA and B type HHV-6 variants. Proteins from both variant A(IE1

*%"aa-GFP) and B (IE1

"!()aa-GFP) were demonstrated

during real-time imaging to traffic to and remain associatedwith punctate nuclear domains (data not shown). Thisobservation was followed up with immunofluorescence exper-iments in which the endogenous fluorescence associated withexpressed IE1

*%"aa-GFP and IE1

"!()aa-GFP was shown to co-

localize with PML (Fig. 1). When expressed in isolation, bothIE1

*%"aa-GFP and IE1

"!()aa-GFP clearly traffic to and form a

stable interaction with the PML-associated nuclear domain.Unlike its positional analogue in HCMV, the HHV-6 IE1 geneproduct did not obviously perturb the intracellular distributionof PML nor associate with chromatin in cells undergoingmitosis.

Association of HHV-6 IE-1 with SUMO-1

Both of the HCMV major IE proteins (IE1%*"aa

and IE2&(*aa

)have been reported to form a covalent linkage with the smallubiquitin-like protein SUMO-1, an interaction that may play a

crucial role in regulating their function (Hofmann et al., 2000 ;Xu et al., 2001). Consequently, we wished to explore anypotential relationship between the HHV-6 IE1 gene productsand SUMO-1. In normal cells, SUMO-1 exhibits a diffusenuclear distribution combined with a concentration at PML-bodies. To facilitate studies, a U373 cell line expressing a myc}his-tagged version of SUMO-1 was generated (U373-SUMO).The U373-SUMO cell line was transfected with the pZ29-GFPand pU1102-GFP constructs and both IE1

*%"aa-GFP and

IE1"!()aa

-GFP were observed to co-localize with SUMO-1(Fig. 2). Remarkably, levels of IE1

*%"aa-GFP and IE1

"!()aa-GFP

fluorescence were also substantially enhanced in the U373-SUMO cell line. This observation was supported by data fromWestern blots (Fig. 3) in which IE1

"!()aa-GFP levels were sub-

stantially greater in the U373-SUMO cell line compared tocontrol U373 cells. Similar results were obtained with theHHV-6 IE1

*%"aa-GFP construct. Levels of the HHV-6 IE1

protein accumulate over time, suggesting that its associationwith SUMO-1 may be enhancing its stability. Control U373and U373-SUMO cells transfected with plasmids either ex-pressing GFP alone or expressing a nuclear form of GFP[which has the nuclear localization signal (NLS) from exon 2of CMV IE1] demonstrated approximately equal levels ofGFP-expression in both cell types (Fig. 3). Thus the differencein levels of HHV-6 IE1-GFP protein in the two cell typesdoes not appear to be due to the ability of the cells to betransfected, or to differences in levels of expression of trans-fected DNA. In addition, no association of NLS-tagged GFPwith PML was seen by immunofluorescence (data not shown),excluding the possibility that IE1

*%"aa-GFP or IE1

"!()aa-

GFP traffic to PML bodies purely as a result of theiroverexpression.

The intranuclear distribution of IE1"!()aa

-GFP is altered ina subpopulation of transfected U373-SUMO cells, possibly asa consequence of its overexpression. In approximately 10% ofcells transfected with pZ29-GFP large intranuclear inclusions(one or two per cell) formed as both SUMO-1 and IE1

"!()aa-

GFP accumulated (Fig. 2e–h). While PML also associates withintranuclear inclusions induced in IE1

"!()aa-transfected U373-

SUMO cells, some PML remains in small punctate domains(Fig. 2a–d). The large intranuclear inclusion associated withSUMO-1 could not be detected in cells that did not exhibitIE1

"!()aaexpression. Intranuclear inclusions were also not

detected in cells transfected with the pU1102-GFP construct.U373-SUMO cells expressing IE1

*%"aa-GFP exhibited only

punctate staining while still co-localizing with PML andSUMO-1 (Fig. 2i–p). SUMO-1 is clearly more stronglyassociated with a punctate nuclear structure in cells expressingeither IE1

*%"aa-GFP or IE1

"!()aa-GFP (Fig. 2n, o, arrowed).

HHV-6 IE1 is SUMO-1-modified

To detect expression of the HHV-6 IE1 gene product, anantibody specific for GFP was used in Western blot exper-iments. Two discrete protein species with estimated molecular

CIBD

Downloaded from www.microbiologyresearch.org by

IP: 23.22.50.124

On: Mon, 09 May 2016 08:02:04

R. Stanton and othersR. Stanton and others

Fig. 1. IE11078aa-GFP (a–d) or IE1941aa-GFP (e–h) co-localizes with PML when transfected into U373 cells. Where indicated,cells were imaged by EGFP autofluorescence (b, f), DAPI (a, e) or by using a PML-specific monoclonal antibody (c, g).

Fig. 2. IE11078aa-GFP (a–h) or IE1941aa-GFP (i–p) co-localizes with both PML and SUMO-1 in a U373 cell line overexpressingSUMO-1. Where indicated, cells were imaged by EGFP autofluorescence (b, f, j, n), DAPI (a, e, i, m) or by monoclonalantibodies specific for SUMO-1 (g, o) or PML (c, k). IE11078aa-GFP forms large nuclear inclusion bodies in approximately 10%of transfected cells (b, f), as opposed to the normal punctate pattern of staining (see arrowed cell in f). The inclusion bodiesremain co-localized with SUMO-1 (e–h). No such inclusion bodies are seen with IE1941aa-GFP, which remains in a nuclearpunctate pattern in all cells ( j, n). Cells expressing HHV-6 IE1 exhibit more punctate SUMO-1 staining than those notexpressing HHV-6IE1 (compare arrowed cells in n and o with cells in the same field which are not expressing IE1941aa-GFP).

CIBE

Downloaded from www.microbiologyresearch.org by

IP: 23.22.50.124

On: Mon, 09 May 2016 08:02:04

Analysis of HHV-6 IE1 proteinAnalysis of HHV-6 IE1 protein

Fig. 3. HHV-6 IE1 is more stable in U373 cells overexpressing SUMO-1 (U373-SUMO) than in the parent cell line (U373).Control transfections with nuclear GFP (lanes 1–2) and GFP expressing plasmids (3–4) demonstrate equal levels of expressionin both U373 and U373-SUMO cells at 48 h. IE1-GFP expression (5–8), demonstrating enhanced expression in U373-SUMOcell line compared to U373 cells at 48 h. All samples stained with anti-GFP monoclonal antibody.

(a)

(b)

1 2

Fig. 4. Expression of native IE1941aa from a replication-deficientadenovirus. Immunofluorescence (a) stained with a mouse polyclonalantibody to HHV-6 IE1 and rabbit antibody to PML and Western blot (b)stained with mouse polyclonal antibody to HHV-6 IE1. Track 1: emptyadenovirus vector. Track 2: Rad HHV6, m.o.i.¯100.

Fig. 5. Immunoprecipitation of IE11078aa-GFP (lane 2 and 3) and IE1941aa-GFP (lane 5 and 6) with anti-GFP show three bands staining with anti-GFPantibody (lanes 3 and 5). The upper two bands and a possible third band(arrowed) co-stain with antibody to SUMO-1 (lanes 2 and 6).Untransfected control stained for SUMO-1 (lane 1) or GFP (lane 4).

masses of approximately 235 and 260 kDa were detected incells transfected with pZ29-GFP (Fig. 3.). These values aresignificantly larger than the 147±5 kDa predicted size of thefusion protein (IE1

"!()aais estimated at 121±5 kDa and GFP at

27 kDa). Interestingly, the HCMV major IE protein alsomigrates anomalously on SDS–PAGE suggesting a signifi-cantly higher apparent molecular mass than that predictedfrom its sequence. The presence of a second higher molecularmass species detected in Western blot experiments would beconsistent with HHV-6 IE1 being covalently conjugated toSUMO-1.

To further investigate expression of HHV-6 IE1, thegene derived from strain U1102 was inserted into a replication-deficient adenovirus vector. Mice were immunized with theadenovirus recombinant (RAdHHV-6) to generate limited

CIBF

Downloaded from www.microbiologyresearch.org by

IP: 23.22.50.124

On: Mon, 09 May 2016 08:02:04

R. Stanton and othersR. Stanton and others

Fig. 6. HHV-6 IE1 co-localizes with PML in infected cells. HHV-6 Z29-infected Molt 3 cells (a–d), U1102-infected JJhan cells(e–h) and U1102-infected PBMC (i–l).

amounts of HHV-6 IE1-specific polyclonal antibodies. Co-immunofluorescence using the murine antibody demonstratedthat the native form of the HHV-6 IE

*%"aaco-localized

with PML-bodies when expressed following infection withRAdHHV-6

IE"(Fig. 4a). No cross-reactivity of either sec-

ondary antibody with the incorrect primary antibody wasseen, nor was any staining observed on the green channelwhen the same immunofluorescence was carried out on cellsinfected with empty adenovirus vector (data not shown). Cellextracts prepared from U373 cells infected with RAdHHV-6IE"

were analysed by Western blot using the HHV-6 IE1-specific polyclonal antibody. A major protein species with anestimated molecular mass of around 160 kDa was identified(by SDS–PAGE) (Fig. 4b) ; thus the native protein also migrateswith an anomalous mobility. Although only a single pre-dominant species was clearly identifiable for the native form of

the protein, this does not exclude SUMO-modification sincethe gross overexpression of the protein from the adenovirusrecombinant has the potential to overwhelm sumoylationpathways and mask detection of low abundance SUMO-modified species on Western blots.

Continuous cell lines stably expressing IE1*%"aa

-GFP andIE1

"!()aa-GFP were generated and an anti-GFP rabbit poly-

clonal antiserum was used to purify the GFP-fusion protein byimmunoprecipitation. When analysed by Western blot, thefastest migrating IE1

*%"aa-GFP and IE1

"!()aa-GFP species

reacted only with the GFP-specific antibody (Fig. 5). Thesesame bands also reacted with the HHV-6 IE1-specific antibody(data not shown). Two co-migrating species reacted with theSUMO-1-specific monoclonal antibody. The sizes of theseadditional protein species would be consistent with IE1

*%"aa-

GFP and IE1"!()aa

-GFP being covalently conjugated with one

CIBG

Downloaded from www.microbiologyresearch.org by

IP: 23.22.50.124

On: Mon, 09 May 2016 08:02:04

Analysis of HHV-6 IE1 proteinAnalysis of HHV-6 IE1 protein

Fig. 7. HHV-6 does not disrupt PODs even at late times of the infectious life-cycle. Z29-infected Molt 3 cells (a–d), U1102-infected JJhan cells (e–h) and U1102-infected PBMC (i–l) co-stained for PML and HHV-6 late antigen.

and two SUMO-1 molecules (arrowed). A third slower-migrating species is strongly labelled with the SUMO-1-specific antibody but only weakly with the anti-GFP antibody.It was therefore concluded that the HHV-6 U1102- and Z29-variant IE1 proteins are subjected to covalent linkage withSUMO-1.

The fate of PML-bodies during productive HHV-6infection

In transient DNA transfection, HHV-6 IE1 migrates toPML-bodies without exerting any obvious effect on their in-tegrity. We wished to investigate the fate of both the HHV-6IE gene product and PML-bodies during productive HHV-6infection. HHV-6 exhibits restricted tropism and growthproperties in vitro. To analyse HHV-6 during the lytic cycle,co-immunofluorescence assays were performed on cells in-fected with both HHV-6A U1102 (grown in PBMC and JJhancells) and HHV-6B Z29 (grown in Molt 3 cells) using themurine polyclonal anti-IE1 antibody and the rabbit anti-PMLantibody. Both HHV-6 U1102 and Z29 IE1 gene productsexhibited a punctate nuclear distribution and co-localized withPML-bodies (Fig. 6). In both HHV-6 variants, on average threenuclear domains per cell were immunolabelled, although theactual number per cell ranged from two to five. The disruptionof PML-bodies is a common feature of herpesvirusinfection ; thus their persistence during lytic infection wasunexpected. To address this issue directly, a further co-immunofluorescence experiment was undertaken with anantibody known to be specific for a late HHV-6 antigen (Foxet al., 1990). Even in cells expressing HHV-6 late antigen, we

were unable to detect any obvious effect on the integrity ofPML-bodies for HHV-6A in PBMC or HHV-6A and HHV-6Bin continuous T cell lines (Fig. 7). Thus productive HHV-6infection does not promote the destruction of PML-associatednuclear domains.

DiscussionThe HHV-6 IE1 gene product was demonstrated to be a

nuclear protein that associates with PML-bodies withoutcompromising their integrity and to be post-translationallymodified by conjugation to SUMO-1. The IE1 genes of HHV-6A strainU1102 andHHV-6B strain Z29 exhibit a substantiallyhigher level of sequence divergence than other HHV-6 genesand therefore both genes were studied in parallel. Both HHV-6IE1 proteins were observed to migrate anomalously whenanalysed by SDS–PAGE, indicating significantly higher mol-ecular masses than predicted from their sequence. The strainU1102 IE1 gene product is predicted to encode a 104 kDaproduct but the protein expressed using an adenovirus vectormigrates with an apparent size of 160 kDa. The HCMV IE1gene product also migrates anomalously, a property associatedwith the presence of a large C-terminal acidic domain(Wilkinson et al., 1998). Although the strain Z29 IE1

"!()aa

protein exhibited a tendency to form large intracellularaggregates when expressed in the U373-SUMO cell line, noclear biological differences were observed in assays performedwith the two constructs.

PML-bodies have been implicated in a wide range ofcellular processes including transcriptional control, chromatin

CIBH

Downloaded from www.microbiologyresearch.org by

IP: 23.22.50.124

On: Mon, 09 May 2016 08:02:04

R. Stanton and othersR. Stanton and others

remodelling, apoptosis, cellular transformation and immuneregulation. PML expression is stimulated by treatment withinterferon and its enhanced association with its nuclear domainmay act as a barrier to virus infection (Bonilla et al., 2002).Following infection, the HCMV genome traffics to PML-bodies and this is the site at which virus transcription and DNAreplication are established (Ishov & Maul, 1996 ; Maul et al.,1996 ; Ahn et al., 1999). Expression of the HCMV IE1 geneproduct promotes the disruption of PML-bodies, causing thePML protein to be dispersed throughout the nucleus and toassociate with mitotic chromatin. It is not clear why DNA virusgenomes are deposited at PML-bodies nor why viruses encodegenes that compromise their integrity. Herpes simplex virus 1ICP0 promotes both the dissolution of PML-bodies and thedegradation of PML, Epstein–Barr virus BZLF1 promotesthe nuclear dispersal of PML without its degradation andthe adenovirus E4 ORF3 induces the formation of thread-likePML-structures (Adamson & Kenney, 2001 ; Everett & Maul,1994 ; Carvalho et al., 1995). HHV-6 IE1 is clearly functionallydistinct from its positional analogue in HCMV in leaving PML-bodies superficially intact. Additionally, PML-bodies remainsuperficially intact in JJhan or Molt 3 lymphocytic cell lines andin PBMC cultures infected with either the HHV-6A or HHV-6B variant. HHV-6 infection is remarkable for not promotingthe disruption or destruction of these nuclear domains.

In addition to PML, a large number of cellular proteins havebeen reported to either transiently or stably associate withPML-bodies, including p53, Rb, CBP, Daxx, Bax and SP100(Zhong et al., 2000). Furthermore, a significant number of viralproteins traffic to PML-bodies without perturbing theirintegrity, e.g. HCMV IE2, EBV EBNA-5, HHV-8 K8, simianvirus 40 T Ag, bovine papillomavirus E2, L1 and L2 (Ahn& Hayward, 1997 ; Katano et al., 2001 ; Murges et al.,2001 ; Szekely et al., 1996 ; Day et al., 1998 ; Jiang et al., 1996 ;Bonilla et al., 2002). Currently, the HHV-6 IE gene product hasnot been assigned any specific function. However, the strongassociation revealed by immunohistochemistry and real-timeimaging suggests that HHV-6 IE1 may act by affecting thefunction of PML-bodies. HHV-6 IE1 clearly has the potentialto modify components, regulate the composition, or influencetrafficking to and from PML-bodies without inducing amorphological change.

SUMO-1 is conjugated to proteins by a thioester bondformed between the C terminus of SUMO-1 and a lysineresidue in the targeted protein. Unlike ubiqitination, whichtargets proteins for degradation, modification by SUMO-1 canhave a variety of different effects. Most significantly, SUMO-1modification of the PML protein is necessary for itslocalization to PML-bodies and the trans-activating function ofHCMV IE2 (Hofmann et al., 2000 ; Rodriguez et al., 1999). Weobserved that expression of the HHV-6 IE1-GFP fusionprotein, but not GFP alone, was substantially enhanced in aU373-SUMO-1 cell line. It is therefore likely that sumoylationis required to stabilize the expressed HHV-6 IE1 gene product.

This situation would not be unique ; SUMO-1-modified IκBα

and Mdm2 are resistant to ubiquitin-mediated degradation(Desterro et al., 1998). Herpesvirus IE proteins are associatedwith establishment of a cellular environment compatible withthe lytic phase of infection. SUMO-1 modification can beinduced in response to stress. The heat-shock transcriptionfactors 1 and 2 (HSF1 and HSF2) are both converted to theirDNA-binding form by SUMO-1 modification in response tostress (Hong et al., 2001), while DNA damage induces SUMO-modification of topoisomerase I and II (Goodson et al.,2001 ; Mao et al., 2000). It is possible that in both HCMV andHHV-6 infections the transition from latent to the lyticreplication cycle may be promoted by the SUMO-1 modifi-cation of IE gene products. Sumoylation pathways may playan important role in determining the fate of betaherpesvirusinfections.

On analysing the level of sumoylation of the HHV-6 IEprotein three slower-migrating species were identified thatwould be consistent with the protein containing threesumoylation sites. This degree of sumoylation would beunusual, although PML has been demonstrated to have threeSUMO-modification sites. However, analysis of the IE1 genesequence revealed only a single consensus sequence forSUMO-1 modification (I}LKXE) in both U1102 and Z29 IE1sequences at amino acids 665 and 802 respectively. Furthercryptic sites may yet be present. Alternatively, conjugationwith a single SUMO-1 molecule could potentially facilitate asecond SUMO-1-independent modification resulting in re-duced mobility, e.g. ubiquitination. Further analysis of theprotein is required to determine the number of SUMO-1-modification sites it contains.

Note added in proof. Since submission of this article, the followingrelated paper has been published which describes the behaviour of theHHV-6 variant B IE1 protein in transient transfection and lytic virusinfection : Gravel et al., Human herpesvirus 6 immediate-early 1 protein isa sumoylated nuclear phosphoprotein colocalizing with promyelocyticleukaemia protein-associated nuclear bodies. Journal of Biological Chemistry277, 19679–19687, 2002.

The authors thank both Carole Rickards and Lynne Neale for theirassistance throughout this work and Daniel Bailey for generouslyproviding the plasmid pIRES-HisSUMO and for helpful discussions.G.W. was supported by funding from the Wellcome Trust.

ReferencesAdamson, A. L. & Kenney, S. (2001). Epstein–Barr virus immediate-early protein BZLF1 is SUMO-1 modified and disrupts promyelocyticleukemia bodies. Journal of Virology 75, 2388–2399.

Ahn, J. H. & Hayward, G. S. (1997). The major immediate-early proteinsIE1 and IE2 of human cytomegalovirus colocalize with and disrupt PML-associated nuclear bodies at very early times in infected permissive cells.Journal of Virology 71, 4599–4613.

Ahn, J. H., Jang, W. J. & Hayward, G. S. (1999). The human cyto-megalovirus IE2 and UL112–113 proteins accumulate in viral DNA

CIBI

Downloaded from www.microbiologyresearch.org by

IP: 23.22.50.124

On: Mon, 09 May 2016 08:02:04

Analysis of HHV-6 IE1 proteinAnalysis of HHV-6 IE1 protein

replication compartments that initiate from the periphery of promyelo-cytic leukemia protein-associated nuclear bodies (PODs or ND10).Journal of Virology 73, 10458–10471.

Bonilla, W. V., Pinschewer, D. D., Klenerman, P., Rousson, V., Gaboli,M., Pandolfi, P. P., Zinkernagel, R. M., Salvato, M. S. & Hengartner, H.(2002). Effects of promyelocytic leukemia protein on virus–host balance.Journal of Virology 76, 3810–3818.

Boom, R., Sol, C. J., Salimans, M. M., Jansen, C. L., Wertheim-vanDillen, P. M. & van der Noordaa, J. (1990). Rapid and simple methodfor purification of nucleic acids. Journal of Clinical Microbiology 28,495–503.

Brenmer, J. A. G. & Clark, D. A. (1999). The clinical implications ofhuman herpesvirus-6 infection. Reviews in Medical Microbiology 10,11–18.

Carvalho, T., Seeler, J. S., Ohman, K., Jordan, P., Pettersson, U.,Akusjarvi, G., Carmo-Fonseca, M. & Dejean, A. (1995). Targeting ofadenovirus E1A and E4-ORF3 proteins to nuclear matrix-associated PMLbodies. Journal of Cell Biology 131, 45–56.

Caserta, M. T., Mock, D. J. & Dewhurst, S. (2001). Human herpes-virus-6. Clinical Infectious Diseases 33, 829–833.

Day, P. M., Roden, R. B., Lowy, D. R. & Schiller, J. T. (1998). Thepapillomavirus minor capsid protein, L2, induces localization of the majorcapsid protein, L1, and the viral transcription}replication protein, E2, toPML oncogenic domains. Journal of Virology 72, 142–150.

DesJardin, J. A., Gibbons, L., Cho, E., Supran, S. E., Falagas, M. E.,Werner, B. G. & Snydman, D. R. (1998). Human herpesvirus-6 re-activation is associated with cytomegalovirus infection and syndromes inkidney transplant recipients at risk for primary cytomegalovirus infection.Journal of Infectious Diseases 178, 1783–1786.

Desterro, J. M., Rodriguez, M. S. & Hay, R. T. (1998). SUMO-1modification of IκBα inhibits NF-κB activation. Molecular Cell 2,233–239.

Dominguez, G., Dambaugh, T. R., Stamey, F. R., Dewhurst, S., Inoue,N. & Pellett, P. E. (1999). Human herpesvirus-6B genome sequence :coding content and comparison with human herpesvirus-6A. Journal ofVirology 73, 8040–8052.

Everett, R. D. & Maul, G. G. (1994). HSV-1 IE protein Vmw110 causesredistribution of PML. EMBO Journal 13, 5062–5069.

Fox, J. D., Briggs, M., Ward, P. A. & Tedder, R. S. (1990). Humanherpesvirus-6 in salivary glands. Lancet 336, 590–593.

Gompels, U. A., Nicholas, J., Lawrence, G., Jones, M., Thomson, B. J.,Martin, M. E. D., Efstathiou, S., Craxton, M. & Macaulay, H. A. (1995).The DNA sequence of human herpesvirus-6 : structure, coding content,and genome evolution. Virology 209, 29–51.

Goodson, M. L., Hong, Y., Rogers, R., Matunis, M. J., Park-Sarge,O. K. & Sarge, K. D. (2001). Sumo-1 modification regulates the DNAbinding activity of heat shock transcription factor 2, a promyelocyticleukemia nuclear body-associated transcription factor. Journal of BiologicalChemistry 276, 18513–18518.

Hofmann, H., Floss, S. & Stamminger, T. (2000). Covalent modificationof the transactivator protein IE2-p86 of human cytomegalovirus byconjugation to the ubiquitin-homologous proteins SUMO-1 andhSMT3b. Journal of Virology 74, 2510–2524.

Hong, Y., Rogers, R., Matunis, M. J., Mayhew, C. N., Goodson, M.,Park-Sarge, O. K. & Sarge, K. D. (2001). Regulation of heat shocktranscription factor 1 by stress-induced SUMO-1 modification. Journal ofBiological Chemistry 276, 40263–40267.

Irving, W. L., Ratnamohan, V. M., Hueston, L. C., Chapman, J. R. &Cunningham, A. L. (1990). Dual antibody rises to cytomegalovirus and

human herpesvirus type 6 : frequency of occurrence in CMV infectionsand evidence for genuine reactivity to both viruses. Journal of InfectiousDiseases 161, 910–916.

Isegawa, Y., Mukai, T., Nakano, K., Kagawa, M., Chen, J., Mori, Y.,Sunagawa, T., Kawanishi, K., Sashihara, J., Hata, A., Zou, P., Kosuge,H. & Yamanishi, K. (1999). Comparison of the complete DNA sequencesof human herpesvirus-6 variants A and B. Journal of Virology 73,8053–8063.

Ishov, A. M. (1999). PML is critical for ND10 formation and recruits thePML-interacting protein Daxx to this structure when modified bySUMO-1. Journal of Cell Biology 147, 221–234.

Ishov, A. M. & Maul, G. G. (1996). The periphery of nuclear domain 10(ND10) as a site of DNA virus deposition. Journal of Cell Biology 134,815–826.

Jiang, W. Q., Szekely, L., Klein, G. & Ringertz, N. (1996). Intranuclearredistribution of SV40T, p53, and PML in a conditionally SV40T-immortalized cell line. Experimental Cell Research 229, 289–300.

Katano, H., Ogawa-Goto, K., Hasegawa, H., Kurata, T. & Sata, T.(2001). Human-herpesvirus-8-encoded K8 protein colocalizes with thepromyelocytic leukemia protein (PML) bodies and recruits p53 to thePML bodies. Virology 286, 446–455.

Kondo, K., Kondo, T., Okuno, T., Takahashi, M. & Yamanishi, K.(1991). Latent human herpesvirus-6 infection of human monocytes}macrophages. Journal of General Virology 72, 1401–1408.

Kondo, K., Shimada, K., Sashihara, J., Tanaka-Taya, K. & Yamanishi, K.(2002). Identification of human herpesvirus-6 latency-associated tran-scripts. Journal of Virology 76, 4145–4151.

Lafemina, R. L., Pizzorno, M. C., Mosca, J. D. & Hayward, G. S. (1989).Expression of the acidic nuclear immediate-early protein (IE1) of humancytomegalovirus in stable cell lines and its preferential association withmetaphase chromosomes. Virology 172, 584–600.

Lukac, D. M., Manuppello, J. R. & Alwine, J. C. (1994). Transcriptionalactivation by the human cytomegalovirus immediate-early proteins :requirements for simple promoter structures and interactions withmultiple components of the transcription complex. Journal of Virology 68,5184–5193.

Mao, Y., Desai, S. D. & Liu, L. F. (2000). SUMO-1 conjugation tohuman DNA topoisomerase II isozymes. Journal of Biological Chemistry275, 26066–26073.

Maul, G. G., Ishov, A. M. & Everett, R. D. (1996). Nuclear domain 10as pre-existing potential replication start sites of herpes simplex virustype-1. Virology 217, 67–75.

Mirandola, P., Menegazzi, P., Merighi, S., Ravaioli, T., Cassai, E. &DiLuca, D. (1998). Temporal mapping of transcripts in herpesvirus 6variants. Journal of Virology 72, 3837–3844.

Mocarski, E. S., Kemble, G. W., Lyle, J. M. & Greaves, R. F. (1996). Adeletionmutant in the human cytomegalovirus encoding IE1 is replicationdefective due to a failure in autoregulation. Proceedings of the NationalAcademy of Sciences, USA 93, 11321–11326.

Muller, S. & Dejean, A. (1999). Viral immediate-early proteins abrogatethe modification by SUMO-1 of PML and Sp100 proteins, correlatingwith nuclear body disruption. Journal of Virology 73, 5137–5143.

Muller, S., Matunis, M. J. & Dejean, A. (1998). Conjugation with theubiquitin-related modifier SUMO-1 regulates the partitioning of PMLwithin the nucleus. EMBO Journal 17, 61–70.

Murges, D., Quadt, I., Schroer, J. & Knebel-Morsdorf, D. (2001).Dynamic nuclear localization of the baculovirus proteins IE2 and PE38during the infection cycle : the promyelocytic leukemia protein colocalizeswith IE2. Experimental Cell Research 264, 219–232.

CIBJ

Downloaded from www.microbiologyresearch.org by

IP: 23.22.50.124

On: Mon, 09 May 2016 08:02:04

R. Stanton and othersR. Stanton and others

Neipel, F., Ellinger, K. & Fleckenstein, B. (1992). The unique region ofthe human herpesvirus-6 genome is essentially collinear with the ULsegment of human cytomegalovirus. Journal of General Virology 72,2293–2297.

Pellett, P. E. & Black, J. B. (1996). Human herpesvirus 6. In FieldsVirology, 3rd edn, pp. 2587–2608. Edited by B. N. Fields, D. M. Knipe &P. M. Howley. Philadelphia : Lippincott–Raven.

Rodriguez, M. S., Desterro, J. M., Lain, S., Midgley, C. A., Lane, D. P.& Hay, R. T. (1999). SUMO-1 modification activates the transcriptionalresponse of p53. EMBO Journal 18, 6455–6461.

Sambrook, J. & Russell, D. (2001a). Agarose gel electrophoresis. InMolecular Cloning : a Laboratory Manual, 3rd edn, pp. 5.4–5.13. ColdSpring Harbor, NY: Cold Spring Harbor Laboratory.

Sambrook, J. & Russell, D. (2001b). Commonly used techniques inmolecular cloning. In Molecular Cloning : a Laboratory Manual, 3rd edn,pp. A8.40–A8.51. Cold Spring Harbor, NY: Cold Spring HarborLaboratory.

Schiewe, U., Neipel, F., Schreiner, D. & Fleckenstein, B. (1994).Structure and transcription of an immediate-early region in the humanherpesvirus-6 genome. Journal of Virology 68, 2978–2985.

Szekely, L., Pokrovskaja, K., Jiang, W. Q., de The, H., Ringertz, N. &Klein, G. (1996). The Epstein–Barr virus-encoded nuclear antigenEBNA-5 accumulates in PML-containing bodies. Journal of Virology 70,2562–2568.

Taylor-Wiedeman, J., Sissons, J. G. P., Borysiewicz, L. K. & Sinclair,J. H. (1991). Monocytes are a major site of persistence of human

cytomegalovirus in peripheral blood mononuclear cells. Journal of GeneralVirology 72, 2059–2064.

Tomasec, P., Braud, V. M., Rickards, C., Powell, M. B., McSharry, B. P.,Gadola, S., Cerundolo, V., Borysiewicz, L. K., McMichael, A. J. &Wilkinson, G. W. (2000). Surface expression of HLA-E, an inhibitor ofnatural killer cells, enhanced by human cytomegalovirus gpUL40. Science287, 1031.

Wilkinson, G. W. & Akrigg, A. (1992). Constitutive and enhancedexpression from the CMV major IE promoter in a defective adenovirusvector. Nucleic Acids Research 20, 2233–2239.

Wilkinson, G. W., Kelly, C., Sinclair, J. H. & Rickards, C. (1998).Disruption of PML-associated nuclear bodies mediated by the humancytomegalovirus major immediate early gene product. Journal of GeneralVirology 79, 1233–1245.

Xu, Y., Ahn, J. H., Cheng, M., apRhys, C. M., Chiou, C. J., Zong, J.,Matunis, M. J. & Hayward, G. S. (2001). Proteasome-independentdisruption of PML oncogenic domains (PODs), but not covalentmodification by SUMO-1, is required for human cytomegalovirusimmediate-early protein IE1 to inhibit PML-mediated transcriptionalrepression. Journal of Virology 75, 10683–10695.

Yamanishi, K., Okuno, T., Shiraki, K., Takahashi, M., Kondo, T., Asano,Y. & Kurata, T. (1988). Identification of human herpesvirus-6 as a causalagent for exanthem subitum. Lancet i, 1065–1067.

Zhong, S., Salomoni, P. & Pandolfi, P. P. (2000). The transcriptionalrole of PML and the nuclear body. Nature Cell Biology 2, 85–90.

Received 17 April 2002; Accepted 17 July 2002

CICA