Toxicology and Applied Pharmacology 230 (2008) 67–77

Contents lists available at ScienceDirect

Toxicology and Applied Pharmacology

j ourna l homepage: www.e lsev ie r.com/ locate /ytaap

An in vitro method to assess toxicity of waterborne metals to fish

Paul A. Walker a,1, Peter Kille b, Anna Hurley b, Nic R. Bury a, Christer Hogstrand a,⁎a Nutritional Sciences Research Division, King's College London, Franklin-Wilkins Building, 150 Stamford Street, London SE1 9NN, UKb Cardiff School of Biosciences, Main Building, Cardiff University, Museum Avenue, Cardiff CF10 3TL, UK

a r t i c l e i n f o

⁎ Corresponding author. Fax: +44 0 20 7848 500.E-mail address: Christer.Hogstrand@KCL.ac.uk (C. Ho

1 Present address: Cells to Tissues, University of MancRoad, Manchester, M13 9PT, UK.

0041-008X/$ – see front matter © 2008 Elsevier Inc. Aldoi:10.1016/j.taap.2008.02.012

a b s t r a c t

Article history:Received 8 November 2007Received 1 February 2008Accepted 6 February 2008Available online 26 February 2008

The transcription of metal-responsive genes in the rainbow trout (Oncorhynchus mykiss) gill tissue can be usedto detect effects of bioreactive metals in natural waters. Here we take advantage of an in vitro gill epithelium,which can be directly exposed to test water samples. The in vitro gill epithelial model mimics the molecularresponse of in vivo gill epithelial cells to waterborne contaminants. The same culture system can detect tracemetals and organic waterborne contaminants. Furthermore, combining this epithelial model withtranscriptomic profiling yields an extremely discriminatory biomonitoring tool able to detect anddifferentiate waterborne metal contaminants. The bioreactive fraction of metal in the water sample isdetected using the cells naturally occurring metal sensor, metal-responsive transcription factor 1 (MTF1), whichacts upon Metal Response Elements (MRE's) in the enhancer region of metal regulated genes. Induction of theMTF1 responsive genes, metallothionein-A (MTA), metallothionein-B (MTB), and zinc transporter 1 (ZnT-1) inthe cell culture was strongly dependent of the concentrations of bioreactive zinc and silver in the test water.Importantly, gene expression in cell culture reflected animal toxicity, measured as inhibition of Ca2+ and Na+

influx, in live rainbow trout exposed to the same waters. A cDNA microarray was deployed to determine thedifferential profiles of transcripts characteristic of exposure to silver, copper or cadmium within this in vitrosystem. These experiments illustrated the potential power of combining the in vitro gill model epitheliumwithgenetic profiling for accurate characterisation and identification of bioreactive toxicants inwaterborne samples.

© 2008 Elsevier Inc. All rights reserved.

Keywords:Metallothioneinslc30a1BioavailabilityWaterborneBiomonitoringGill cell cultureEcotoxicology

Introduction

International legislative commitment to reduced animal testing ata time when there is increased pressure for chemical, pharmaceuticaland environmental testing has made the identification of alternativeapproaches to animal testing an imperative. At present toxicology andecotoxicology testing rely on acute toxicity testing as the norm foridentification and classification of environmental hazards (Castano etal., 2003). Finding alternative test methods for metals is particularlyproblematic, because toxicity of metals is influenced dramatically bywater chemistry, which is difficult to replicate in a cell culture system.Trace metals may show reduced bioavailability in natural waters, dueto the physio-chemical parameters such as pH, alkalinity, Ca, Mg, Naand dissolved organic matter (DOM), which compete with or bind tothe available metals (Paquin et al., 2002; Niyogi andWood, 2004). Theobjective of the present study was to develop an in vitro system, basedon cultured gill cells, to determine molecular end-points of bioavail-able waterborne Class IB and IIB metals. Cultured gill cells grown onpermeable supports are unique in their ability to generate a polarisedepitheliumwhich can tolerate being maintainedwith freshwater at its

gstrand).hester, Smith Building, Oxford

l rights reserved.

apical surface (Wood et al., 2002b). Thus, test water samples can beanalysed to detect effects of bioavailable toxicants, such as metals, viaa metal-induced transcriptional response or other end-points (Walkeret al., 2007).

The gill is one of the most critical sites of toxicity to waterbornecontaminants in fish (Wood, 2001), as it is in constant and directcontact with the water and a site for uptake of minerals includingmetals (Bury et al., 2003). In fish, disruption of ion transport across thegill is a major cause of toxicity (Wood, 2001). Metals also interact atthe gill by increasing the production of proteins involved inbiochemical detoxification and defence pathways, such as theincreased production of the zinc-binding protein metallothionein(MT; (Dang et al., 2000)) and the zinc exporter; Zinc transporter-1(ZnT-1 [synonym SLC30A1]; (Balesaria and Hogstrand, 2006) inresponse to Class IB and IIB metals.

Vertebrate cells naturally contain a metal sensing protein, namelymetal transcription factor-1 (MTF1) (Andrews, 2000). MTF1 senses anincrease in the concentration of labile and, therefore, potentially toxicZn2+, resulting in the transcription factor binding to metal responseelements (MREs) in its target genes (Radtke et al., 1993; Koizumi et al.,1999). MTF1 is also highly responsive to other metals, such as copper,silver and cadmium although the mechanisms involved are lesscertain (LaRochelle et al., 2001; Mayer et al., 2003; Palmiter, 2004). Itis therefore possible that MTF1-mediated gene expression could beused to gauge the pool of bioreactive metal in cells.

68 P.A. Walker et al. / Toxicology and Applied Pharmacology 230 (2008) 67–77

Metallothioneins (MTs) and ZnT-1 arewell-characterised targets ofMTF1. MTs are cysteine-rich low molecular weight proteins that bindtransition metals (Kagi and Kojima, 1987; Kille et al., 1992). In rainbowtrout, two isoforms of MT have been identified, MTA and MTB(Bonham et al., 1987), and both of these are upregulated by metalsthrough multiple MREs in their upstream regulatory regions (Olssonet al., 1990; Dang et al., 2000; Lange et al., 2002). ZnT-1 is located at theplasma membrane and transports zinc out from the cell (Palmiter,2004). ZnT-1 has been cloned from fish, including rainbow trout, andthe fish protein has similar properties to its mammalian counterparts(Balesaria and Hogstrand, 2006). Metal activated expression of MTA,MTB and ZnT-1 are utilised in the present study as surrogate toxicityend-points for effects of waterborne zinc or silver. Acute toxicity ofzinc and silver to freshwater rainbow trout is principally caused byinhibition of Ca2+ and Na+ uptake, respectively, across the gill (SpryandWood, 1985; Hogstrand andWood, 1998). Therefore, anchoring ofgene expression end-points in the cell culture to toxicity of the animalwas achieved by measuring unidirectional branchial influx of Ca2+ orNa+ in fish exposed to the same waters as the cell culture.

A microarray representing metal-responsive transcripts fromrainbow trout (John et al., 2001) was used to identify alternativegenes, or gene clusters, with potential to be used as markers forexposure to the Class IIA and IIB metals, cadmium, copper or silver.Our findings show that chemically similar metals can be distinguishedby their gene expression patterns. We suggest that a similartranscriptomic approach could be used to determine predictive geneexpression clusters for other contaminants and expand the gill cellculture described herein to a versatile tool in ecotoxicology.

Materials and methods

Animal husbandry. Gill cells for primary cultures in this project were derived fromjuvenile (i.e.b1 yr) rainbow trout (Oncorhynchus mykiss; 75–120 g) obtained fromHoughton Spring Fish Farm (Dorset, UK). Rainbow trout (0.7–1.2 g) used in wholeanimal flux experiments were produced at King's College London from eggs and miltobtained from the same fish supplier. All fish were housed at King's College Londonwhere theywere maintained in fibreglass tanks (400 L) with flowing and aerated City ofLondon tap water ([Na+]=0.53 mM; [Ca2+]=0.92 mM; [Mg2+]=0.14 mM; [K+]=0.066mM; [NH4

+]=0.027 mM), which was passed through activated carbon, mechanicaland biological filters. Water temperature was maintained at 11–15 °C, varying withseason, while photoperiod was held constant (16 h light, 8 h dark). Fish were fed daily aone-percent (w/w) ration of trout pellets, obtained from Houghton Spring Fish Farm(Dorset, UK).

Gill cell culture. All cell culture procedures were performed using sterile techniques.Surgical equipment was disinfected with ethanol (70%) prior to use. All solutions weresterilised by autoclave or filtration (0.2 µm; Acrodisc syringe filter).

The primary gill cell isolation was carried out as described previously by Pärt etal. (1993) and Fletcher et al. (2000). The cell culture protocol followed thosepreviously described (Wood and Pärt, 1997; Wood et al., 1998), with additionalmodifications (Walker et al., 2007). In brief M-DSI culture involved the primaryisolated gill cells being directly seeded (0.44×106 cells cm−2) onto permeablesupports (0.45 µm pore size, Falcon). The membrane supports (i.e. inserts) sit in 12well companion culture plates (Falcon). The primary gill cells on inserts were bathedin L-15 media (5% foetal bovine serum (FBS); Sigma, 100 μg mL−1 penicillin, 100 μgmL−1 streptomycin; Invitrogen, 200 μg mL−1 gentamycin; GIBCO) at 18 °C for 24 h inan air atmosphere cooler incubator (LMS). The inserts were then washed three timeswith PBS followed by a second seed of cells (0.44×106 cells cm−2). The M-DSI weremaintained in L-15 media at 18 °C (Pärt et al., 1993; Wood and Pärt, 1997; Fletcher etal., 2000). After 96 h M-DSI preparations were subsequently maintained at 18 °C in L-15 without antibiotics and without FBS, with media replaced every second day,before experimentation. The gill epithelium is cultured from gill cell isolation for atotal of 10 days.

Table 1Primer and probe sequences used for quantitative real time PCR (Q-PCR) of gene expression

Gene (GenBank No) Forward primer 5′→3′ R

18s rRNA (AF308735) CGGAGGTTCGAAGACGATCA TMTA (M18103) CATGCACCAGTTGTAAGAAAGCA GMTB (M18104) TCAACAGTGAAATTAAGCTGAAATACTTC AZnT-1 (NM_001032723) ACAACAGCCCCCCTAATGG G

Cell culture preparation waterborne exposure. M-DSI epithelia were exposed to ASTMmoderately hard water (MHW; 1.14 mM NaHCO3, 0.35 mM CaSO4 d 2H20, 0.5 mMMgSO4, 54.1 μM KCl; pH 7.6). This water was selected as recommended by U.S. EPAguidelines for acute toxicity testing of freshwater organisms (USEPA,1993). Metals wereadded in the form of ZnSO4, AgNO3 (in 0.1 MHNO3), CuSO4 and CdSO4 (Sigma) from 1Mstock solutions and their concentrations measured in test waters by inductively-coupled plasma mass spectroscopy (ICP-MS, see below). Humic acid (Sigma) was usedfor dissolved organic matter (DOM). Paraquat, Igarol, Atrazine and Pentachlorophenol(Sigma) was supplemented in moderately hard water to the desired concentration. ThepH was checked and modified by KOH and HCl. Toxicity due to silver and zinc in testwaters was measured as Na+ and Ca2+ uptake inhibition across the gills in juvenilerainbow trout (see below). The copper and cadmium concentrations used in this studywere 0.25 and 1.5 times, respectively, the published 96h-LC50 for rainbow trout inwaters with hardness of 100–140 mg CaCO3/L (Hollis et al., 1999; Taylor et al., 2000;Hansen et al., 2002). No mortalities were observed when juvenile rainbow trout wereexposed for 24 h to any of the test waters (Walker, 2004; Walker et al., 2007). Allexposure waters were sterilised by passage through a 0.2 μm syringe filter (Gelman).Cell culture experiments were carried out using five inserts (n=5).

Transepithelial resistance (TER) and transepithelial potential (TEP). The TER wasmeasured daily to monitor the progress of the epithelium. The TER was measured usingan epithelial tissue voltohmmeter (EVOMX; World precision instruments; modified toread b200 kV) fitted with STX-2 electrodes. A TER N5 kΩ cm2 was used as criterion forthe presence of a tight epithelium (Fletcher et al., 2000).

Cell viability. Cell viability was assessed as loss of metabolically active cellsdetermined by the MTT assay. In healthy cells, MTT (3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyl tetrazolium bromide) is reduced by dehydrogenase enzymes formingintracellular formazan, which can be quantified spectrophotometrically. MTT (5 mgmL−1) was added in the ratio of 1:10 to cell culture medium and incubated for 4 h. Thecells were air-dried for 1 to 2 h at room temperature (RT). The resulting formazan wasdissolved in 500 μL of DMSO and incubated at RT for 30 min. The absorbency wasmeasured at 570 nm.

Quantitative real time PCR (Q-PCR). DSI inserts were bathed in 0.75 mL TRI ReagentLS (Sigma-Aldrich) and the RNA isolation procedure followed as to the manufacturer'sguidelines with the additional step of RNase-free glycogen (Promega). The RNAobtained from gill epithelial cells was treated with DNase I (Promega) as described inthe manufacturer's protocol. The first strand cDNAwas produced using PowerscriptTMReverse Transcriptase (Clontech). Using oligo (dT)15 primer (Promega) and randomhexamers (Promega), following the manufacturers guidelines. Q-PCR amplification wascarried out on an ABI Prism 7000 Sequence detection system (Applied Biosystems).Using gene specific primers for 18s rRNA, Metallothionein isoforms A and B (MTA andMTB), and Zinc transporter-1 (ZnT-1). The GenBank accession numbers for thesetranscripts along with the primer and Q-PCR probe (18s rRNA, MTB and ZnT-1; Qiagen,MTA; Applied Biosystems) sequences used are given in Table 1. Q-PCR reactions werecarried out in a buffer containing 200mM Tris–HCl (pH 8.3), 500 mMKCl, 40 mMMgCl2and 10 mM 6-carboxy-X-rhodamine (ROX).

A purified plasmid containing each amplicon was used as a standard curve forquantification, quantified using PicoGreen™ (Molecular Probes) as to the manufac-turers guidelines. The concentrations of primers and probe were calibrated to give thelowest Ct (Cycle threshold) and the highest Rn (normalised reporter signal). Allreactions were carried out in triplicate.

In vivo Na+ and Ca2+ influx experiments. Whole body in vivo Na+ or Ca2+ uni-directional influx was measured radioisotopically and was performed in 3 L of MHW(USEPA, 1993), contained in aerated, light shielded polyethylene bags, within atemperature controlled bath (12 °C). Since fish in freshwater drink very little, wholebody ion influx represents uptake of ions across the gill (Wood, 2001). Metals wereadded in the form of ZnSO4 (3 μM), AgNO3 (0.08 μM) (in 0.1 M HNO3; Sigma) from 1 Mstock solutions. The water chemistry of MHW was modified by changing KCl, CaNO3,NaNO3 (Sigma) to obtain the desired Cl−, Ca2+ and Na+ concentrations as describedpreviously (Bury et al., 1999b). Humic acid (Sigma) was used for dissolved organicmatter (DOM). The pH was monitored and adjusted by KOH and HCl. The juvenile 0.7–1.2 g rainbow trout (n=5) were exposed to metal in the flux bags for 12 h. Nine hoursinto the treatment, 1 μCi L−1 (37 kBq L−1) of 22Na+ (PerkinElmer-Life Sciences) or 45Ca2+

(ICN Pharmaceuticals) were added to each flux bag. Water samples were taken everyhalf hour and placed in 20 mL polypropylene tubes for 22Na+ counting or in 20 mL glassvials for analysis of 45Ca2+. After 3 h exposure in presence of radioisotope (12 h metal

everse primer 5′→3′ Probe and tag 5′→3′

CGCTAGTTGGCATCGTTTATG JOE-ATACCGTCGTAGTTCCG-BHQ 3CAGCCTGAGGCACACTTG VIC-TGCTGCGACTGCTGT-MGB 3AGAGCCAGTTTTAGAGCATTCACA 6-FAM-TTTGACTAAAGAAGCG-BHQTTCATCTGCATCTCACTGTCGTT 6-FAM-TGAACACCGAGAGACGTA-BHQ 3

Table 2Primer sequences used for semi-quantitative RT-PCR of gene expression

Gene (GenBank No) Forward primer 5′→3′ Reverse primer 5′→3′

18s rRNA (AF308735) GAGCCTGAGAAACGGCTAC CCCATTATTCCTAGCTGCGMTA (M18103) ACACCCAGACAAACTACTAC GGTACAAAAGCTATGCTCAAMTB (M18104) GCTCTAAAACTGGCTCTTGC GTCTAGGCTCAAGATGGTACZIP1 (AY387045) CGTGCACTATTGGTGGACTC GAGTGAAAGAGAAGCAGGGAGGST (BE669056) GTCCCTACAAATCACCTAC AGACGAAGGTCCTCAACGCG6PD (EF551311) GTCACCAAGAACATCAAGCAC CAGTGGGGTCATCAAGGTAACGAPDH (AB066373) GGGTAAAGCCGGTGCCGATTA GCCTTCTTGACAGCCCCTTTG

69P.A. Walker et al. / Toxicology and Applied Pharmacology 230 (2008) 67–77

exposure) the fish were euthanised by an overdose of benzocaine (dissolved in 75%ETOH). They were then washed in a 10 M solution of stable Na+ or Ca2+ isotope (i.e.10 M NaSO3 or CaSO4 added to MHW) and blotted dry to remove loosely bound isotopefrom the body surface (Bury et al., 1999b). Radioactivity of the water and whole bodywas measured on a gamma counter (LKB1282 Compugamma) for 22Na, or on ascintillation counter (Beckman LS 5000CE) for 45Ca. For scintillation counting of wholefish, the bodies were first digested with 2 mL of tissue solubiliser (Amersham,Bioscience) for 12 h and then mixed with 10 mL of Ecolume™ (ICN Biomedicals) andincubated at RT in the dark overnight. Whole body influx of Na+ and Ca2+ werecalculated as mol kg−1 h−1 as described previously (Prodocimo et al., 2007) andexpressed as percent of control.

cDNA microarray analysis. A cDNA microarray was generated from 582 cDNAtranscripts isolated using a subtractive suppression hybridisation protocol betweenrainbow trout early life stages (from fertilisation to loss of yolk sack) treated with Cd(0.3 μM) and simultaneously sampled developmental stage-matched controls (John etal., 2001). Expression sequence tags (EST) were generated from the cDNA library byfluorescent dye terminator sequencing on a capillary sequencer (Applied Biosystems3100 Genetic Analyzer). Primary chromatograms were processed using trace2dbEST,which incorporates a perl pipeline that exploits Phil Green's Phred (Ewing et al., 1998)and user-defined information to base call and trim sequences, and formatting themsubsequent to submission to GenBank dbEST. Sequences not passing the rigorous QCparameters were removed although the DNAs were retained for transcript profiling.Sequences attaining the quality criteria were clustered with rainbow trout transcriptsdeposited in GenBank and dbEST using Clobb (Parkinson et al., 2002). The consensuscontigs generated were assembled and combined with BlastX and N annotationsagainst Uniprot and GenBank Non-redundant using Partigene database (Parkinson etal., 2002) that can be interactively queried through ecoworm.bios.cf.ac.uk. The 582cDNA sequences were cloned and PCR amplified prior to solid pin deposition onto lysinecoated glass array slides (Flexs robot, Genomic Solutions) as described previously (Johnet al., 2001).

DSI epithelia were treated with Cu (0.3 μM), Cd (0.3 μM), or Ag (0.1 μM) in MHW, orwith MHW, only, as a control (n=3). A common reference design was employed inwhich signal intensities from each sample were compared with those of a compositereference sample (Churchill, 2002). Dye-swap hybridisations were also carried out. Thereference RNAwas a composite sample consisting of an equal amount of RNA from eachtreatment condition, including the control.

The RNAwas isolated as described above for Q-PCR analysis and amplified using theMessageAmp™ aRNA Kit (Ambion), following the manufacturer's guidelines. Briefly1 μg of total RNA was used in first strand cDNA synthesis using a T7 Oligo (dT) primer(Ambion). Double stranded cDNAwas synthesised using DNA polymerase (Ambion) andpurified with a cDNA filter cartridge (Ambion). The aRNA was synthesised by theaddition of T7 RNA polymerase (Ambion). Subsequently DNase I (Ambion) was added toremove the cDNA template and aRNA purified using an additional filter cartridge(Ambion). The Purity of aRNA was assessed by running a 1.5% agarose electrophoresisgel and quantified using Genequant (Pharmacia).

Cy3 and Cy5 dUTP was incorporated into the first strand cDNA synthesis of theaRNA using CyScribe™ first strand cDNA labelling module with 25 nmol Cy3 dUTP and25 nmol Cy5 dUTP (Amersham) following the manufacturers guidelines. Thefluorescently labelled cDNA was purified using CyScribe GFX purification kit(Amersham). Labelled cDNA was visualised on an agarose electrophoresis gel using aLSIV (Genomic Solutions) to check dye incorporation into the cDNA.

The microarrays slides were firstly blocked using 1% BSA, 5% 20× SSC, 0.1% SDS at42 °C for 45 min prior to hybridisation of the fluorescently labelled cDNA. The relevantqualities of Cy3 and Cy5 labelled targets were concentrated using a vacuummicrocentrifuge (Eppendorf). The resulting pellets were dissolved in 20 μL of sterilewater and then denatured by resuspension in an equal quantity of 2× hybridisationbuffer (50% formamide, 10% 20× SSC, 0.2% SDS). Hybridisation solution was then addedto the blocked array slides and incubated at 42 °C, for 14 h. The hybridised slides werewashed in ddH2O and isopropanol and air-dried. Slides were then immersed for 10 minat 55 °C in wash solution (1% 20× SSC, 0.2% SDS) followed by a second wash (0.1% 20×SSC, 0.2% SDS) for 10 min at 55 °C. The slides were subsequently washed in ddH2O anddried under compressed air and scanned using Scan Array Express configured at 90%laser power and an optimal PMT setting ranging from 60–80% to provide the optimalsignal to noise output (PerkinElmer).

Images were analysed and pre-processed using the Biodiscovery software suiteImagene and GeneSight. The default segmentation and quality flagging parameterswere employed although all arrays were manually checked and addition data flagsintroduced if required. This pipeline removed background, removed bad spots (with anImagine quality flag 3 or 6), introduced a minimum floor in the data at 20 relative lightunits (RLUs), and the average of triplicate spots calculated. Since the cDNA microarraywas produced from a subtractive library generated in trout exposed to cadmium, themajority of the 582 featuring genes were regulated in response tometal exposure. Thus,a global array expression normalisation procedure was not used. Instead, elongationfactor-1-α (EF1-α), Glyceraldehyde-3-phosphate dehydrogenase (GAPDH), and actin-β(ACTB) were assessed for their suitability as non-variant reference genes. Thisevaluation showed that EF1-α did not change in expression between conditions.Therefore, between chip normalisationwas performed in Genesight against the relativeabundance of EF1-α. Data were subsequently exported to GeneSpring GX (Agilent)where gene measurements were expressed relative to the median of the control data.

RNA amplification has previously been shown not to significantly distort therelative abundance of individual mRNA sequences within an RNA population (Baugh etal., 2001; Pabon et al., 2001). To validate the linearity of RNA amplification among genesin our experiment, control hybridisations were performed with cDNA labelled with Cy5or Cy3 and synthesised from amplified and non-amplified RNA generated from identicalsamples. These control experiments verified that mRNA amplification introduced noselective bias.

RT-PCR validation of microarrays. RNA isolation and cDNA synthesis was carried outas above. PCR reaction mixtures contained 1 μL of the first strand cDNA, 0.2 mM dNTPs(Promega), 1× storage buffer B (Promega), 2.5 mM MgCl2, 0.15 μM of each primer (i.e.forward and reverse primer; Table 2), and 1 U of Taq DNA polymerase (Promega).Amplification proceeded in a thermal cycler (PCR Express; Hybaid) using gene specificprimers for Metallothionein isoforms A and B (MTA and MTB), 18s rRNA, Zrt/Irt-likeprotein 1 (ZIP1), Glucose-6-phosphate dehydrogenase (G6PD), glutathione-S-transferase, class pi (GST) and Glyceraldhyde-phosphate dehydrogenase (GAPDH).The GenBank accession numbers and the primer sequences used for these transcriptsare given in Table 2. 18s rRNAwas used as an invariant house keeping gene as describedpreviously (Walker et al., 2007). The primers were designed over intron/exonboundaries. Each PCR product was sequenced to ensure specificity. The cycle numberand temperature for each gene was calibrated to achieve linear PCR amplification.

Chemical analysis. Water samples were collected and immediately acidified by theaddition of 0.5% (v/v) HNO3 and stored in acid-cleaned polyethylene containers untilanalysis. Analytical determinations of ions inwater andmedia samples were performedusing ICP-MS (Cu, Cd, Zn, Ag, Pb) and ICP-AES (Ca, Na, K, Mg). Measured metalconcentrations were always within 7.2% of nominal values. Chloride was measuredusing the colorimetric mercuric thiocyanate method (Zall et al., 1956). Calibrationstandards (Sigma-Aldrich) and a reagent blank were analysed with every ten samples.

Statistical analysis. All datawere expressed asmeans±Standard error of themean (S.E.M.). Statistical differences between two groups was assessed using Mann Whitney U-test (SPSS software, SPSS Inc.), and statistical significance was set to Pb0.05. Differencesbetween all groups were tested with ANOVA followed by Tukey's HSD test (Sigma Stat,v.2.0, 1995). Statistical significance was set to Pb0.05. Correlation coefficient wascalculated using Sigma Plot (v8.0, SPSS Inc.).

Results

The expression of the two isoforms of metallothionein; MTA andMTB mRNA in response to a zinc concentration gradient in MHW wasquantified after 24 h using Q-PCR (Fig. 1). Exposure to waterborne zincresulted in a dose-dependent increase in MTA and MTB mRNAaccumulation, which was statistically significant at all zinc concentra-tions above 14 μM. At 100 μM, the maximum concentration of zincused in the experiment, MTA and MTB were induced 3.5 fold and 3fold, respectively, relative to the control (Fig. 1A). The cytotoxicity ofwaterborne zinc (1.8–100 μM Zn) to the DSI preparations was alsoinvestigated using theMTTassay. While therewas no significant effecton cell viability after 24 h of treatment, concentrations of zinc above14 μM were increasingly cytotoxic when exposure time was extendedto 36 h (Fig. 1A insert). In addition, zinc concentrations above 14 μMcaused a dose-dependent reduction in transepithelial resistance (TER)after 36 h of treatment, but no such effect was observed after 24 h(data not shown). Thus, MT expression at 24 h was predictive ofcytotoxicity at 36 h.

The induction of MTA and MTB in response to differentconcentrations of waterborne silver (0.015–0.2 μM) was also investi-gated. Mean values for MTA and MTB mRNA accumulation increasedfrom 0.015–0.1 μM silver and at 0.1 μM and above this was statisticallysignificant (Fig. 1B). The maximum fold increase in MTA and MTB

Fig. 1. Panel A shows the expression of MTA (black circles) and MTB (white circles) inresponse to a zinc concentration curve exposure in M-DSI epithelial cells over 24 h.The mRNA level is expressed as fold induction relative to the MHW control and allmRNA levels are normalised to 18s rRNA expression levels. Panel A [insert] shows thetoxicity of M-DSI epithelial cells exposed to increasing zinc concentrations over 24 h(black bars) and 36 h (grey bars). The relative toxicity is represented as % of control.Panel B shows the expression of MTA (black circles) and MTB (white circles) inresponse to a silver concentration curve exposure in M-DSI epithelial cells over 24 h.The mRNA level is expressed as fold induction relative to the MHW control and allmRNA levels are normalised to 18s rRNA expression levels. Panel B [insert] shows thetoxicity of M-DSI epithelial cells exposed to increasing silver concentrations over 24 h(black bars) and 36 h (grey bars). Asterisks denote significant difference from controlPb0.05 as assessed by ANOVA followed by a Tukey HSD test and the values are plottedas means±1 S.E.M, n=5.

70 P.A. Walker et al. / Toxicology and Applied Pharmacology 230 (2008) 67–77

expression was 2.7 and 3, respectively, relative to the MHW control.Exposing the cells for 24 h or 36 h to this range of silver concentrationshad no significant effect on cell viability (Fig. 1B insert).

The water chemistry was modified to investigate how theconcentration of Ca2+ influenced the zinc-induced expression of theMT isoforms and ZnT-1 in vitro (Fig. 2A). Both MT isoforms and ZnT-1were expressed with approximately a 3 fold inductionwhen thewatercontained 50 μM Ca2+. Increasing the Ca2+ content of the waterresulted in a significant and dose-dependent reduction in the ability of14 μM zinc to induce the expression of these genes. To compare theinfluence of waterborne Ca2+ on zinc-mediated gene expression in thecell culture to the effect of waterborne Ca2+ on toxicity in vivo, wecarried out exposures with juvenile rainbow trout to the same waterqualities as those used in the cell culture experiments. Inhibition ofCa2+ uptake across the gills is the principal mode-of-action for acutewaterborne zinc toxicity to rainbow trout, so this was analysed introut exposed to zinc for 12 h. Exposure to 14 μM zinc in watercontaining 50 μM Ca2+ resulted in an inhibition of Ca2+ influx by about45%. Increasing the Ca2+ concentration of the water ameliorated theinhibitory effect of zinc on Ca2+ influx and at 1 mM Ca2+ there was nodifference between zinc exposed fish and control fish in terms of zincuptake (Fig. 3A). Thus, the pattern of Ca2+ dependency of zinc effects

was similar in gill culture and live fish. This protective effect of Ca2+

has been shown previously with rainbow trout and it is a result ofcompetition between Ca2+ and Zn2+ for uptake sites at the apicalsurface of the gill (Hogstrand et al., 1995). Thus, measurement of MTand ZnT-1 mRNA expression provides a realistic readout for the Ca2+

dependency of waterborne zinc toxicity.Since Na+ is known to inhibit Ag+ uptake at the rainbow trout gill in

vivo and ameliorate silver toxicity (Bury et al., 1999b; Wood et al.,2002a), the expression of MTA, MTB and ZnT-1 mRNA wasinvestigated in the presence of waterborne silver (0.11 μM) withincreasing Na+ concentration (50–2500 μM) in thewater. As predicted,Na+ reduced the expression of all the genes in a concentration-dependent manner (Fig. 2B). Greater than 2000 μM sodium wasrequired to completely counteract the silver-induced MTA, MTB andZnT-1 expression (Fig. 2B). This effect of Na+ on Ag+ induced geneexpression in vitrowas identical to the ameliorating effect of Na+ on Ag+

induced inhibition of branchial Na+ uptake inhibition in juvenilerainbow trout in vivo (Fig. 3B).

Dissolved organic matter (DOM) reduces bioavailability of metalsto fish through chelation (Rose-Janes and Playle, 2000). DOM contentof the water was therefore modified to investigate if DOM (0.1–20 mgcarbon L−1) protects against the effects of silver (0.13 μM) on thecultured gill epithelium, as assessed by MTA, MTB and ZnT-1 mRNAaccumulation. Presence of DOM in the water reduced silver-inducedexpression of the metal-responsive genes in a concentration-depen-dentmanner and above 5mg carbon L−1 DOM inMHW, the expressionof the genes was reduced to control levels (Fig. 2C). DOM similarlyprotected against Ag+ toxicity to juvenile rainbow trout as was shownby a concentration-dependent reduction in the capacity of Ag+ toinhibit Na+ uptake (Fig. 3C). These experiments show that, manipula-tion of water constituents, which reduce toxicity of metals to fish bycompetition (Ca2+ vs Zn2+; Na+ vs Ag+) or metal chelation (DOM),result in reduced expression of metal-responsive genes in the culturedgill epithelium and amelioration of metal-induced Ca2+ or Na+ influxin vivo.

Water constituents may also reduce metal toxicity withoutchanging metal accumulation in the fish gill. Chloride forms inorganiccomplexes with Ag(I) and in freshwaters, the circumneutral AgCl0aq isthe most common silver chloride species (Hogstrand et al., 1998; Buryand Hogstrand, 2002). The free Ag+ ion dominates silver speciation atchloride concentrations below 500 μM, but increasing the chlorideconcentration of the water from 10 to about 2000 μM successivelyincreases the prevalence of AgCl+aq while the Ag+ concentration isdramatically decreased. Both Ag+ and AgCl0aq are bioavailable, but inrainbow trout and Atlantic salmon only Ag+ is toxic (Hogstrand et al.,1998; Bury and Hogstrand, 2002). Interestingly, increasing the waterchloride concentration from 40 to 1500 μMdose-dependently reducedsilver-inducedMTA andMTB expression from 3 fold to control value inthe cultured gill cells (Fig. 2D). A very similar relationship wasconfirmed to exist between water Cl− concentration and the potencyof Ag+ to inhibit Na+ influx across the gills of live rainbow trout(Fig. 3D). This indicates that MTA and MTB mRNA levels are indicativeof the bioreactive fraction of bioavailable silver, which is the pool thatcauses toxicity to fish.

The M-DSI cell culture has previously been shown to respond withMTA and MTB expression in response to exposure with zinc, silver,lead, copper, and cadmium in MHW (Walker et al., 2007). Thisindicates that MTA and MTB mRNA accumulation may provide anintegrated readout of combined effects from a number of metals thatare toxic to fish. However, it would also be of value to be able todetermine which specific metal is present at toxic concentration in awater sample and to determine whether it is presenting a hazard tofish health. One potential approach to this problem is to use geneexpression profiles to discriminate between metal toxicants. Amicroarray enriched for cadmium-responsive genes from rainbowtrout (John et al., 2001), was used to investigate the genomic response

Fig. 2. The expression of MTA (black circles), MTB (white circles) and ZnT-1 (black triangles) using Q-PCR in M-DSI cells exposed for 24 h to zinc or silver in different waterchemistries. Panel A shows the effect of Ca2+ concentration in exposure water on zinc (14.1±0.2 μM) induced gene expression. Panel B shows the effect of Na+ concentration inexposure water on silver (0.11±0.05 μM) induced gene expression. Panel C shows the effect of increasing DOM content in exposure water on silver (0.13±0.03 μM) induced geneexpression. Panel D shows the effect of increasing Cl− content in exposure water on silver (0.1±0.06 μM) induced gene expression. All mRNA levels are expressed as fold inductionrelative to unexposed cells in the respective water and are normalised to the house keeping gene 18s rRNA expression levels. The dashed line represents the control expression ineach panel. A significant difference between metal treated and control conditions is denoted by an asterisk Pb0.05 as assessed by ANOVA followed by a Tukey HSD test. Values areplotted as means±1 S.E.M, n=5.

71P.A. Walker et al. / Toxicology and Applied Pharmacology 230 (2008) 67–77

when the M-DSI were treated with Cu (0.3 μM), Cd (0.3 μM) and Ag(0.1 μM). These three metals are closely related chemically and allbelong to Groups 1B and 2B of the Periodic Chart of Elements. The Cu,Cd and Ag concentrations used correspond to 0.25, 1.5, and 1 times,

Fig. 3. Inhibition of Na+ and Ca2+ influx by silver and zinc, respectively, in juvenile rainbow troused in M-DSI experiments (Fig. 2). Panel A shows the effect of Ca2+ concentration in exposurNa+ concentration in exposure water on silver (0.08±0.03 μM) induced inhibition of Na+ influ0.02 μM) induced inhibition of Na+ influx. Panel D shows the effect of increasing Cl− contentto zinc or silver are over 12 h with Ca2+ or Na+ influx analysed over the final 3 h of this periodwater chemistry. The dashed line at the 100% mark represents Ca2+ or Na+ influx in absence orespective control is denoted by an Asterisk Pb0.05 as assessed by ANOVA followed by a Tu

respectively, of the 96 h LC50 in comparable water quality (Walker etal., 2007).

To assess if each individual metal exposure resulted in a similargenomic response hierarchical cluster analysis of all genes and all

ut under varying water conditions. Thewater chemistries tested are identical to the onese water on zinc (3±0.1 μM) induced inhibition of Ca2+ influx. Panel B shows the effect ofx. Panel C shows the effect of increasing DOM content in exposure water on silver (0.09±in exposure water on silver (0.08±0.03 μM) induced inhibition of Na+ influx. Exposures. Influx is expressed as percentage inhibition relative to the unexposed control for eachf zinc or silver in the water. A significant difference between metal treated fish and thekey HSD test. Values are plotted as means±1 S.E.M, n=5.

72 P.A. Walker et al. / Toxicology and Applied Pharmacology 230 (2008) 67–77

samples was performed on EF1-α normalised data using Spearman-correlation as similarity measure and average linkage algorithm tocreate a condition tree (Fig. 4). The analysis revealed that the non-essential metals, silver and cadmium, produce similar expressionpatterns whereas the essential metal, copper, was more similar to thecontrol. There was also a strong tendency for individual samples tocluster according to condition with silver generating to most distinctexpression profile. This suggests that effects of even closely relatedmetals can be discriminated through transcriptomic profiling.

Fig. 4. A hierarchical cluster diagram of gene expression in response to cadmium, silver,copper and control. The branches of the condition tree are coloured by experimentalparameter: yellow for cadmium, red for silver, dark blue for copper, and light blue forcontrol. Experimental conditions are also labelled on the XI-axis. The Y-axis showsindividual gene clusters. Statistical comparisons used Pearson correlation coefficient onthe mean of dye swap technical replicates. Three M-DSI cultures were used for eachcondition (n=3).

The results of the microarray data set are summarised as a Dart-Chart (Fig. 5). Genes which responded with a greater than 2 foldchange relative to EF1-α and showed a significant differencecompared to the control (Student's t-test; Pb0.05) are listed. Thegenes with annotations identified by BlastX and N against Uniprot andGenBank can be found online (ecoworm.bios.cf.ac.uk), by using theDart-Chart gene number (Fig. 5) and corresponding gene identifier(Supplementary Table 1). Out of the 582 genes represented on themicroarray 84.7% showed a significant change in expression inresponse to metal treatment of the gill cells. Only 59 genes showedsignificant downregulation in response to copper, silver or cadmium(Supplementary Table 2). Hence, only 89 genes on the microarray didnot respond to any of the metals. The small cohorts of genes, whichwere only affected by specific metals are represented in the peripheralband of the Dart-Chart (Fig. 5), whereas the clusters of 116 genes,which show altered mRNA expression to either of the metals isrepresented in the centre. The band between contains the genes thatwere regulated by two different metals. Cadmium and silver result inthe highest number of genes to respond with 461 and 450,respectively. Copper exposure resulted in 125 genes with changedmRNA expression. Cadmium exposure resulted in the majority ofgenes being regulated either specifically or as a response shared withothermetals. Specifically, 340 genes responded to cadmium, but not tocopper, whereas only 4 genes respond to copper but not to cadmium.Cadmium and silver have the most genes with altered expression incommon. Forty of the genes, which responded to cadmium, were notregulated by silver and silver changed the expression of 29 genes thatwas unaffected by cadmium. Cadmium specifically influenced theexpression of 35 genes. Only three genes were identified as beingspecific to copper, whereas silver regulated the mRNA abundance of28 genes specifically.

Glucose-6-phosphate dehydrogenase (G6PD; No 3), glutathione-S-transferase (GST; No 5), stress-induced phosphoprotein 1 (STI1; 17,18),myosin heavy chain (27) and cytochrome C-2 (No 213,275) areexamples of genes that were identified as responding to all metals.Each gene in addition, shows variation in the level of alteredexpression indicating that some of the genes respond with a greaterfold change to certain metals (Data not shown). MTA (No 6), MTB (No7), voltage dependant anion channel isoform-3 (VDAC-3; No 293) andproliferating cell nuclear antigen (PCNA; No 426,438,534) were shownto be upregulated by cadmium and silver, whereas the zinc importer,ZIP1 [synonym: solute carrier 39, member 1, SLC39A1; No 582) andpurpurin (No 63) were upregulated only by cadmium and copper.Cadmium was also determined to uniquely affect the expression ofindividual genes, such as the voltage-dependent anion channel(VDAC; No 118).

A subset of genes were also analysed by RT-PCR to validate andcharacterise the differential expression of microarray identifiedmetal-induced genes with different metals (Fig. 6). The expressionof MTA, MTB, ZIP, G6PD, GST and GAPDH using RT-PCR showed thesame expression profiles as identified by the microarray, (simplifiedin Table 3). Each gene fits into the metal category previouslyidentified (Fig. 5). Interestingly, expression of the genes does varyover time with most genes showing maximum transcriptionalactivity at 24 h, some of which show subsequent reduced expressionat 48 h.

Independent verification of our observations was performed byinterrogation of the available literature. The Comparative Toxicoge-nomic Database (CTD) (Mattingly et al., 2006) provided an excellentresource which could be queried for interactions with a specificchemical (in our case the appropriate metal ion) and a definedinteraction type allowing us to restrict the search to those geneswhose expression were altered in response to the metal ions used inour study. These genes were locally filtered for those annotated asupregulation in response to metal ion exposure and manually crossreferenced with the best match annotation (using BlastX) for

Fig. 5. A schematic diagram showing the genes (gene number) which responded by a 2-fold induction (Pb0.05) to metal exposure. The inner circle represents the genes showingaltered expression to all metals (Ag; 0.1 μM, Cu; 0.3 μM, and Cd; 0.3 μM). The 2nd tier represents the genes switched on by two metal combinations and the outer circle representsgenes only showing increased mRNA expression in response to a single metal. Script in bold indicates the metal or metal groups.

73P.A. Walker et al. / Toxicology and Applied Pharmacology 230 (2008) 67–77

transcripts observed as upregulated to the corresponding metal ionsin our study.

Matching genes were categorised to illustrate where the databasecontained either the same isoform, alternative isoforms of the sameprotein or protein contributing to a common multi-protein complex(i.e. ribosomal protein complex). This analysis unfortunately providedno hits in CTD for copper or silver reflecting the paucity of globalexpression analysis for these metals and the novelty of our observa-tions. However, limited verification against curated data in CTD wasobserved for cadmium displaying 8 genes encoding the same isoformand 5 encoding related isoformswhere previous studies had displayedcorresponding expression changes (Supplementary Table 3).

The identification of a fishmicroarray study investing the temporalresponse of flounder liver (Williams et al., 2006) to cadmium that wasnot integrated into CTD allowed us to repeat the matching procedureagainst our own observations. The results showed exceptionalconcordance with 35 of our reporters having corresponding isoformswithin the Flounder data set, 37 with related isoforms and 24 beinginvolved with the same multi-protein complexes (SupplementaryTable 3). This degree of correspondence is despite the different tissuesused in the experiments and the fact that our study used an in vitrosystem and exploited a microarray generated from a biassedsubtractive library.

Further investigations were undertaken to determine if othercommon water contaminants are detectable by the in vitro gillepithelial model through analysis of MTA, MTB, and ZnT-1 mRNAexpression. A selection of herbicides and pesticides were exposed toDSI preparations at their 96-h LC50 concentrations to rainbow trout(Fig. 7). The commonly occurring water contaminants used wereparaquat (PQ; 32 mg L−1), irgarol (0.88 mg L−1), atrazine (9.9 mg L−1)and pentachlorophenol (PCP; 5.2×10−3 mg L−1) compared to themRNA expression levels of Zn (11 μM; 0.73 mg L−1). Atrazine and PCPhad no significant effect on the expression of MTA, MTB or ZnT-1. PQ

and Irgarol, however, both significantly increased the expression ofMTA mRNA above that of control (1.8 fold induction). ZnT-1 alsoshowed increased mRNA expression above control level in thepresence of PQ, but not irgarol. MTB appeared to be elevated inresponse to PQ with a fold induction of 1.6, however, this was notstatistically significantly. Zinc alone induced the expression of all threemetal-responsive genes. This shows that expression of the metal-responsive genes, MTA, MTB and ZnT-1 was not exclusive to metals,but that a suite of biomarker genes improve specificity.

Discussion

The present study demonstrates the potential of a cultured fish gillepithelium to be used as a sophisticated in vitro system to assesstoxicity of waterborne chemicals, in particular metals. In a directcomparison between end-points measured in cell culture and live fish,we further show that expression levels of marker genes in vitro reflecteffects of waterborne metal exposure and are modulated by waterchemistry in the same manner as toxicity is influenced in the intactanimal. These findings are supported by thework of Zhou et al. (2005),who showed that metal binding to a cultured rainbow gill epitheliumwas sensitive to water chemistry mimicking in vivo data. The resultsfrom the present study suggest that the relative concentration ofbioreactive and potentially toxic trace metals in waters can bedetermined by transcriptional expression levels of specific genes.

Manymetal inducible genes, includingMTand ZnT-1, are regulatedby metal-responsive transcription factor-1 (MTF1), which acts uponmetal response elements (MREs) in the promoter regions of targetgenes. This facet was taken advantage of to determine effects ofbioavailable metal in a recently developed in vitro gill epithelium(Walker et al., 2007). The bioreactive components of ionic and ligand-bound metals were detected using expression of the known metal-responsive genes MT (isoforms MTA and MTB) and ZnT-1 (synonym:

Fig. 6. Semiquantitative RT-PCR data showing the expression of selected genes represented on the microarray in M-DSI cell cultures exposed to metals (Ag; 0.1 μM, Cu; 0.3 μM, Zn;14 μM and Cd; 0.3 μM) in MHWover time. The genes analysed are MTA (black bars), MTB (light grey bars), ZIP1 (grey bars), G6PD (very light grey bars), GST, class pi (dark grey bars),GAPDH (medium grey bars). Gene expressionwas determined at 6, 12, 24 and 48 h. The dashed line represents a 2-fold increase in gene expression, corresponding to the fold changefilter applied to microarray data. The mRNA level is expressed as fold induction relative to cells in MHW and all mRNA levels are normalised to 18s rRNA expression levels. Asterisksdenote significant difference from control Pb0.05 as assessed by ANOVA followed by a Tukey HSD test and the values are plotted as means±S.E.M, n=5.

74 P.A. Walker et al. / Toxicology and Applied Pharmacology 230 (2008) 67–77

SLC30A1) as surrogate toxicity readouts. The metal-responsive genesshowed concentration-dependant upregulation in response to water-borne metals and amelioration of this response when agents thatreduced bioavailability or bioreactivity were added to the test water.In a range of metal exposure scenarios, induction of metal-responsivegenes in the cell culture closely tracked inhibition of Ca2+ and Na+

uptake in juvenile rainbow trout in vivo. In other words, MT and ZnT-1mRNA accumulation in the gill epithelium reflected toxicity of metalsto rainbow trout in different water chemistries. To further investigatethe potential to detect and discriminate between effects fromdifferentwaterborne metals, microarray technology was used to generateunique gene expression profiles to silver, copper, and cadmium. It wasshown that different closely relatedmetals act with varying specificity

Table 3Cross-validation of gene expression using RT-PCR (RT) andmicroarray (MA). An upwardarrowhead indicates significant N2-fold upregulation and a dash represents no changerelative to the MHW control

Gene Cd Ag Zn Cu

RT MA RT MA RT RT MA

MTA ▲ ▲ ▲ ▲ ▲ – –

MTB ▲ ▲ ▲ ▲ ▲ – –

ZIP1 ▲ ▲ – – – ▲ ▲G6PD ▲ ▲ ▲ ▲ ▲ ▲ ▲GST ▲ ▲ ▲ ▲ ▲ ▲ ▲GAPDH – – – – – – –

Significant difference from control values were evaluated as described in Figs. 4 and 6.

Fig. 7. The expression of MTA (black bars), MTB (gray bars) and ZnT-1 (white bars) asdetermined by Q-PCR in M-DSI gill epithelial cells exposed to common watercontaminants in MHW. The water contaminants used were Paraquat (PQ; 32 mg L−1),Irgarol (0.88 mg L−1), Atrazine (9.9 mg L−1) Pentachlorophenol (PCP; 5.2 μg L−1) and Zn(11 μM; 0.73 mg L−1 added as ZnSO4). The dashed line represents the expression of therespective gene in MHW alone (control). The mRNA level is expressed as fold inductionrelative to the control and all mRNA levels are normalised to 18s rRNA expression levels.Asterisks denote significant difference from control Pb0.05 as assessed by ANOVAfollowed by a Tukey HSD test and the values are plotted as means±1 S.E.M, n=5.

75P.A. Walker et al. / Toxicology and Applied Pharmacology 230 (2008) 67–77

on discrete genes, making it possible to determine which metal orgroup of metals is likely a cause of concern in terms of fish health inany particular water. The importance of using multivariate end-pointsto gain specificity in the system was highlighted in experiments withorganic toxicants; while paraquat and irgarol both increased expres-sion of MTA, only zinc was able to induce MTA, MTB and ZnT-1 attoxicologically equivalent concentrations. Thus, the use of a panel ofresponse genes increased the specificity to the readout in terms ofidentification of the causative agent.

Toxicity of metals to aquatic organisms is strongly dependent onwater chemistry (Rose-Janes and Playle, 2000; Paquin et al., 2002;Santore et al., 2002). In natural waters, ligands such as reactivesulphides, dissolved organic matter (DOM), and chloride complex andcompete with the fish gill for binding of trace metals (Rose-Janes andPlayle, 2000) and this can result in reduced toxicity (Paquin et al.,2002; Santore et al., 2002). Some cations, like Na+ and Ca2+ alsoameliorate metal toxicity, but in this case it is by competing withmetal ions for uptake sites on the gill (Hogstrand et al., 1995; Bury etal., 1999b). Because of the importance of metal speciation for metaltoxicity to aquatic organisms, there has been limited success indevelopment of in vitro models to assess toxicity of metals to fish. Inthe present study, expression of metal-responsive genes increaseddose-dependently in response to zinc and silver exposure andimportantly, metal-induced expression of MTA, MTB and ZnT-1 wasquenched by addition of chelators and cations that were also shown toreduce metal toxicity to rainbow trout. Increasing the Ca2+ concentra-tion of the test water gradually reduced the ability of zinc to inducetranscription of MTA, MTB and ZnT-1. Sodium in thewater reduced thesilver-induced expression of metal-responsive genes in a concentra-tion-dependent manner. This is exactly what would have beenexpected based on established knowledge of sodium and calciuminfluences on acute silver and zinc toxicity to rainbow trout (Bury etal., 1999b). DOM also prevented silver-induced gene expression in thecultured epithelium, a finding that, again, is in keeping with pre-viously reported studies on acute silver toxicity to whole fish (Bury etal., 1999a; Rose-Janes and Playle, 2000). One of the strongest evidencethat expression of the three MTF1 driven genes is a good surrogatetoxicity end-point is that increasing chloride concentrations in thewater dose-dependently reduced silver-induced expression of MTA,MTB and ZnT1. In the chloride concentration-range used, chloridedoes not markedly affect bioavailability of silver, but it decreases silvertoxicity to rainbow trout quite dramatically (Hogstrand et al., 1998;Bury and Hogstrand, 2002). Thus, expression of MTA, MTB and ZnT1seems to be activated only in water that causes toxicity to rainbowtrout. These findings suggest that the in vitro gill epithelial modelresponds to the bioreactive fraction of waterborne metals.

To experimentally anchor the gene expression results from gill cellculture to toxicity of the animal, we treated juvenile rainbow troutwith the same waters as those used in the in vitro experiments andmeasured zinc and silver toxicity as inhibition of branchial Ca2+ andNa+ influx respectively. There was a remarkable correspondencebetween the level of expression of MTA, MTB, and ZnT-1 in vitro andinhibition of Ca2+ or Na+ uptake across the gill in vivo. The resultsfrom this direct comparison suggests that metal-responsive geneexpression is an appropriate marker for metal toxicity and givesprecedence for the potential of this in vitro system to be used as abiomonitoring tool or a platform for toxicity-testing.

Metal response genes such as MT have been used extensively asbiomarkers to assess the health of organisms in metal contaminatedenvironments (Hamza-Chaffai et al., 2000; Lacorn et al., 2001).However, ecotoxicological biomarkers, including MT, can be season-ally variable. Variability in biomarker readouts can be attributed tobiological processes, such as reproductive cycles, moulting (incrustaceans), or intensity of metabolic processes (Ringwood andConners, 2000), suggesting an in vitromodel maybemore reliable. Thein vitro gill epithelial model could be used to test water samples

collected from industrial outfalls and natural waters within laboratoryconditions, removing much of the biological variability as well asother problems associated with in situ sampling of wild animals. Onegeneral concern with cell based toxicity test methods is thatsensitivity to chemicals is often lower than that of the intact organism,limiting their use as replacement for animal testing (Castano et al.,2003). Inhibition of β-naphtoflavone-induced ethoxyresorufin-O-deethylase (EROD) activity has been used as an end-point for coppereffects on a cultured rainbow trout gill epithelium, but at least 5 μM ofcopper was required to cause an effect (Jonsson et al., 2006). Zhou etal. (2005) found that binding of silver to a cultured rainbow trout gillepithelium had an apparent 50% saturation of 0.1 μM, which was theapproximate in vivo 96 h LC50 value in the same water. There was alsoan inhibition of Na+/K+-ATPase activity after 24 h exposure to 0.3 μMsilver (Zhou et al., 2005). In the present study, we observed no effect ofcell viability, TER or TEP at waterborne zinc concentrations below100 μM and at any silver concentration tested (up to 0.2 μM). The useof metal-responsive genes as surrogate end-points of toxicitymarkedly improved sensitivity of the system compared with theMTT cell death assay. Importantly, statistically significant induction ofMTA, MTB and ZnT1 was observed at three orders of magnitude lowerconcentrations of silver than of zinc, reflecting the large difference intoxicity between these metals to fish.

In the interest of animal welfare, we did not employ lethality as anend-point in our in vivo assays used to anchor cell culture results toanimal toxicity and, hence, the sensitivity of gene expression readoutscannot be directly related to 96 h LC50 data. Instead of lethality wemeasured in live fish the potency of zinc and silver to inhibit Ca2+ andNa+ influx across the gill. These are the established modes-of-actionfor acute toxicity of zinc and silver, respectively, in rainbow trout(Wood, 2001) and there is published data on the relationship betweeninhibition of branchial ion uptake and acute toxicity. Bury et al.(1999a) found that the 96-h LC50 of free Ag+ to juvenile rainbow troutis 0.046 μM and 50% reduction in Na+ influx occurs at 50% of the 96 hLC50 (i.e. 0.023 μM; (Bury et al., 1999b)). The EC50 for silver inhibition(12 h exposure) of Na+ influx to juvenile rainbow trout in MHW hasbeen determined to 0.076 μM total silver (Walker, 2004). From thisrelationship it can be calculated that the 96 h LC50 to silver in MHWwould be about 0.15 μM, which is slightly above the silver concentra-tion (0.10 μM) that resulted in maximum MTA and MTB expression inthe cell culture. Similarly, Hogstrand et al. (1995) found that 12-hrexposure to 2.3 μMzinc in Lake Ontariowater ([Ca2+]=1 mM) caused a41% reduction in Ca2+ influx across the gill of juvenile rainbow trout.The 96-h LC50 for zinc to rainbow trout in Lake Ontario water is about14 μM (Alsop et al., 1999), so the 41% reduction of Ca2+ influx after 12 hexposure occurred at 16% of the 96-h LC50. In MHW, 12-h a 41%reduction of Ca2+ influx in rainbow trout has been observed at 2 μMzinc (Walker, 2004). Hence, it can be calculated that the 96 h LC50 forzinc to juvenile rainbow trout in MHWwould be about 12 μM, similarto the lowest concentration where MT induction was observed in thecell culture. It, therefore, appears that when related to toxicity of theanimal, the gene expression end-points used here in the gill cellculture aremore sensitive to the non-essential metal silver than to thetrace-nutrient zinc. Thus, there is reason to further improve thesensitivity of M-DSI as an in vitro metal toxicity test system and inparticular with regards to detection of zinc toxicity. In a recent study,we explored Ca2+ fluxes as a surrogate end-point to zinc toxicity in theM-DSI and found that reduction in net Ca2+ uptake by the gill cellculture is more sensitive to zinc than is expression of metal-responsive genes (Walker et al., 2007). Ultimately, a suite of surrogatetoxicity end-points might be employed to harness the full potential ofthe gill cell culture system as an in vitro toxicity test.

To determine the specificity of the response from the MTA, MTBand ZnT1 genes to metals, M-DSI were exposed to 96 h LC50concentrations of PQ, irgarol, atrazine and PCP. While there was noregulation of these genes in response to atrazine and PCP, MTA was

76 P.A. Walker et al. / Toxicology and Applied Pharmacology 230 (2008) 67–77

significantly induced by paraquat and irgarol, MTB by irgarol, andZnT1 by paraquat. However, only Zn (11 μM; 0.73 mg L−1) upregulatedall three genes, indicating that suites of biomarkers improvespecificity to specific chemicals compared with single end-points.Gene profiling of known toxicants, thus could improve our ability todetermine potential hazards in test water samples.

Using a cDNA microarray, featuring a cDNA library of metal-responsive rainbow trout genes as targets (John et al., 2001), weattempted to identify gene expression profiles and potential addi-tional biomarker genes that respond in M-DSI to copper, silver andcadmium. Unsupervised hierarchical clustering of the samplesresulted in a good classification of the samples according to treatment(Fig. 4) demonstrating that it is feasible to generate specific geneexpression profiles even for closely related IB and IIB metals.

Myosin heavy chain, glutathione-6-phosphate dehydrogenase(G6PD), glutathione-S-transferase, class pi (GST), myosin heavychain, and cytochrome-c were among the genes responding to anyof the three metals tested. Glutathione is regulated as part of the γ-glutamyl cycle involving the actions of γ-glutamylcysteine synthetaseand GSH synthetase. GST in the current study was shown to beupregulated in response to copper, silver and cadmium exposure. Thismetal responsiveness has been shown previously using cDNA arraytechniques (Bartosiewicz et al., 2001; Hogstrand et al., 2002;Regunathan et al., 2003) and in rainbow trout cells in vitro (Chunget al., 2006). The pufferfish (Takifugu rubripes) G6PD contains threeMREs in its upstream regulatory region (Chung et al., 2006) and thehuman G6PD enhancer region contains 5 MREs (Lichtlen et al., 2001).This shows that there is an evolutionary conservation of the metalresponse of this gene. G6PD may function in metal detoxification byproviding the NADPH required to form reduced glutathione (GSH;(Tsukamoto et al., 1998; Preville et al., 1999)), which would sequesterfree metal ions as described above (Outten and O'Halloran, 2001). It isalso well known that G6PD is instrumental in the cell's antioxidantdefence by the same mechanism (Chung et al., 2006).

Myosins are proteins that hydrolyse ATP to mediate a conforma-tional change to move along actin fibres (Frank et al., 2004). Severalmembers of the myosin family are thought to be involved intransportation of vesicles and proteins (Linz-McGillem and Alliegro,2003), therefore their role through increased transcription may be toenhance export of particles phagocytosed by intracellular vesicles.Vesicle detoxification of metals could involve the phagocytosis ofproteins which have sequestered the metal as shown in the marineprosobranch (Neriti saxtilis; (Abdallah and Moustafa, 2002)) and theearthworm (Aporrectodea caliginosa; (Morgan and Morgan, 1998)).

Zinc finger transcription factors, GATA-6, and KLF5/BTEB2 havebeen shown to activate myosin promoter elements, interacting withNOS, PDGF-A, EGR-1 and VEGF receptors in vitro (Wada et al., 2000;Nagai et al., 2003). This indicates that metals may directly or indirectly(by liberating cytosolically bound zinc; (Palmiter, 1994)), activatetranscription factors other than MTF1 that regulate the expression ofmetal response genes.

In addition to proteins that complex metals, genes were alsoidentified that may play a role in metal detoxification pathways, such asthe voltage-dependent anion channels-3 (VDAC-3). VDAC channelshave been implicated in the conductance of ATP (Sampson et al., 1997),thus providing the gateway for energy production for metal detoxifica-tion pathways when exposed to either cadmium or silver. In addition,isoforms of the mitochondrial ATP-synthase were shown to beupregulated in response to cadmium or silver. ATP-synthase plays anessential role by synthesising the majority of the cell's ATP (Das, 2003).

It is clear from this study that many genes are involved in theresponse to and detoxification of metals and furthermore, certainmetals or metal combinations may specifically regulate geneticpathways. Genes identified as showing metal specificity may proveto be interesting candidates in gene profiling sets. Many of the geneson the current microarray represent novel genes that have not been

identified or characterised, thus these target sequences are interestingcandidates for further analysis. Although this sets the stage for futureresearch into the roles of specific genes in defence againstmetal insult,the objective of the microarray experiment was to investigate if theidentity of a bioreactive metal causing effects on the gill can beresolved based on metal specificity of gene expression patterns.Althoughmorework needs to be done to identify genes that are robustclass predictors, the results presented here show that effects fromeven chemically closely related metals can be resolved throughtranscriptome analysis.

The present study has highlighted the invaluable use of the in vitrogill epithelialmodel as a tool to investigate the toxic effects ofmetals tofish. We have been able to develop a cell culture system that respondsvery similarly to the intact gill in vivo to waterborne metals andmoreover, that this cell culture can be used as an in vitro tool to analysewaters for presence of metals that would likely have negative effectson fish. The results of this investigation further show that transcriptionof metal response genes are suitable indicators of bioreactivemetals incultured rainbow trout gill epithelial cells and that specificity of theresponse can be improved through analysis of gene clusters. Certainmetals ormetal combinations specifically regulate several of the genesidentified through microarray analysis; as such they are interestingcandidates in creating gene profiling panels.

Acknowledgments

The authors wish to thank Dr Richard Handy for the use of the ICP-MS and ICP-AES facility at Plymouth University. This work wassupported by research grants from the Natural Environment ResearchCouncil (NERC), grant #NER/A/S/2000/00550 and NER/S/J/2000/05957.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.taap.2008.02.012.

References

Abdallah, A.T., Moustafa, M.A., 2002. Accumulation of lead and cadmium in the marineprosobranch Nerita saxtilis chemical analysis, light and electron microscopy.Environ. Pollut. 116, 185–191.

Alsop, D.H., McGeer, J.C., McDonald, D.G., Wood, C.M., 1999. Costs of chronic waterbornezinc exposure and the consequences of zinc acclimation on the gill/zinc interactionsof rainbow trout in hard and soft water. Env. Tox. Chem. 18, 1014–1025.

Andrews, G.K., 2000. Regulation of metallothionein gene expression by oxidative stressand metal ions. Biochem. Pharmacol. 59, 95–104.

Balesaria, S., Hogstrand, C., 2006. Identification cloning and characterization of a plasmamembrane zinc efflux transporter, TrZnT-1, from fugu pufferfish (Takifugu rubripes).Biochem. J. 394, 485–493.

Bartosiewicz, M.J., Jenkins, D., Penn, S., Emery, J., Buckpitt, A., 2001. Unique geneexpression patterns in liver and kidney associated with exposure to chemicaltoxicants. J. Pharmacol. Exp. Ther. 297, 895–905.

Baugh, L.R., Hill, A.A., Brown, E.L., Hunter, C.P., 2001. Quantitative analysis of mRNAamplification by in vitro transcription. Nucleic Acids Res. 29, E29.

Bonham, K., Zafarullah, M., Gedamu, L., 1987. The rainbow trout metallothioneins:molecular cloning and characterization of two distinct cDNA sequences. DNA 6,519–528.

Bury, N.R., Galvez, F., Wood, C.M., 1999a. Effects of chloride calcium, and dissolvedorganic carbon on silver toxicity: comparison between rainbow trout and fatheadminnows. Env. Tox. Chem. 18, 56–62.

Bury, N.R., McGeer, J.C., Wood, C.M., 1999b. Effects of altering freshwater chemistry onphysiological responses of rainbow trout to silver exposure. Env. Tox. Chem. 18,49–55.

Bury, N.R., Hogstrand, C., 2002. Influence of chloride and metals on silver bioavailabilityto Atlantic salmon (Salmo salar) and Rainbow trout (Oncorhynchus mykiss) yolk-sacfry. Environ. Sci. Technol. 36, 2884–2888.

Bury, N.R., Walker, P.A., Glover, C.N., 2003. Nutritive metal uptake in teleost fish. J. Exp.Biol. 206, 11–23.

Castano, A., Bols, N., Braunbeck, T., Dierickx, P., Halder, M., Isomaa, B., Kawahara, K., Lee,L.E., Mothersill, C., Pärt, P., Repetto, G., Sintes, J.R., Rufli, H., Smith, R., Wood, C.,Segner, H., 2003. The use of fish cells in ecotoxicology. The report andrecommendations of ECVAM Workshop 47. Altern. Lab. Anim. 31, 317–351.

Chung, M.J., Hogstrand, C., Lee, S.J., 2006. Cytotoxicity of nitric oxide is alleviated byzinc-mediated expression of antioxidant genes. Exp. Biol. Med. (Maywood) 231,1555–1563.

77P.A. Walker et al. / Toxicology and Applied Pharmacology 230 (2008) 67–77

Churchill, G.A., 2002. Fundamentals of experimental design for cDNA microarrays. Nat.Genet. 32, 90–495 Suppl.

Dang, Z.C., Flik, G., Ducouret, B., Hogstrand, C., Wendelaar Bonga, S.E., Lock, R.A., 2000.Effects of copper on cortisol receptor and metallothionein expression in gills ofOncorhynchus mykiss. Aquat Toxicol 51, 45–54.

Das, A.M., 2003. Regulation of the mitochondrial ATP-synthase in health and disease.Mol. Genet. Metab. 79, 71–82.

Ewing, B., Hillier, L., Wendl, M.C., Green, P., 1998. Base-calling of automated sequencertraces using phred.I. Accuracy assessment. Genome Res. 8,, 175–185.

Fletcher, M., Kelly, S.P., Pärt, P., O'Donnell, M.J., Wood, C.M., 2000. Transport propertiesof cultured branchial epithelia from freshwater rainbow trout: a novel preparationwith mitochondria-rich cells. J. Exp. Biol. 203, 1523–1537.

Frank, D.J., Noguchi, T., Miller, K.G., 2004. Myosin VI: a structural role in actinorganization important for protein and organelle localization and trafficking. Curr.Opin. Cell Biol. 16, 189–194.

Hamza-Chaffai, A., Amiard, J.C., Pellerin, J., Joux, L., Berthet, B., 2000. The potential use ofmetallothionein in the clam Ruditapes decussatus as a biomarker of in situ metalexposure. Comp. Biochem. Physiol., C Toxicol. Pharmacol. 127, 185–197.

Hansen, J.A., Lipton, J., Welsh, P.G., 2002. Relative sensitivity of bull trout (Salvelinusconfluentus) and rainbow trout (Oncorhynchus mykiss) to acute copper toxicity. Env.Tox.Chem. 21, 633–639.

Hogstrand, C., Reid, S., Wood, C., 1995.. Ca2+ versus Zn2+ transport in the gills offreshwater rainbow trout and the cost of adaptation towaterborne Zn2+. J. Exp. Biol.198, 337–348.

Hogstrand, C., Webb, N., Wood, C.M., 1998. Covariation in regulation of affinity forbranchial zinc and calcium uptake in freshwater rainbow trout. J. Exp. Biol. 201,1809–1815.

Hogstrand, C., Wood, C.M., 1998. Toward a better understanding of the bioavailabilityphysiology, and toxicity of silver in fish: implications for water quality criteria. Env.Tox. Chem. 17, 547–561.

Hogstrand, C., Balesaria, S., Glover, C.N., 2002. Application of genomics and proteomicsfor study of the integrated response to zinc exposure in a non-model fish species,the rainbow trout. Comp. Biochem. Physiol., B. Biochem. Mol. Biol. 133, 523–535.

Hollis, L., McGeer, J.C., McDonald, D.G., Wood, C.M., 1999. Cadmium accumulation gill Cdbinding, acclimation, and physiological effects during long term sublethal Cdexposure in rainbow trout. Aquat. Toxicol. 46, 101–119.

John, A.L., Sweeney, G.E., Kille, P., 2001. Gene profiling heavy metal responses in thedeveloping rainbow trout. Toxicology 164, 213–213.

Jonsson, M.E., Carlsson, C., Smith, R.W., Pärt, P., 2006. Effects of copper on CYP1Aactivity and epithelial barrier properties in the rainbow trout gill. Aquat. Toxicol.79, 78–86.

Kagi, J.H., Kojima, Y., 1987. Chemistry and biochemistry of metallothionein. ExperientiaSuppl. 52, 25–61.

Kille, P., Lees, W.E., Darke, B.M., Winge, D.R., Dameron, C.T., Stephens, P.E., Kay, J., 1992.Sequestration of cadmium and copper by recombinant rainbow trout and humanmetallothioneins and by chimeric (mermaid and fishman) proteins with inter-changed domains. J. Biol. Chem. 267, 8042–8049.

Koizumi, S., Suzuki, K., Ogra, Y., Yamada, H., Otsuka, F., 1999. Transcriptional activity andregulatory protein binding of metal-responsive elements of the human metal-lothionein-IIA gene. Eur. J. Biochem. 259, 635–642.

Lacorn, M., Lahrssen, A., Rotzoll, N., Simat, T.J., Steinhart, H., 2001. Quantification ofmetallothionein isoforms in fish liver and its implications for biomonitoring. Env.Tox. Chem. 20, 140–145.

Lange, A., Ausseil, O., Segner, H., 2002. Alterations of tissue glutathione levels andmetallothionein mRNA in rainbow trout during single and combined exposure tocadmium and zinc. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 131, 231–243.

LaRochelle, O., Gagne, V., Charron, J., Soh, J.W., Seguin, C., 2001. Phosphorylation isinvolved in the activation of metal-regulatory transcription factor 1 in response tometal ions. J. Biol. Chem. 276, 41879–41888.

Lichtlen, P., Wang, Y., Belser, T., Georgiev, O., Certa, U., Sack, R., Schaffner,W., 2001. Targetgene search for the metal-responsive transcription factor MTF-1. Nucleic Acids Res.29, 1514–1523.

Linz-McGillem, L.A., Alliegro, M.C., 2003. Myosin II in retinal pigmented epithelial cells:evidence for an association with membranous vesicles. Exp. Eye Res. 76, 543–552.

Mattingly, C.J., Rosenstein, M.C., Davis, A.P., Colby, G.T., Forrest, J.N., Boyer, J.L., 2006. TheComparative Toxicogenomics Database: a cross-species resource for buildingchemical-gene interaction networks. Toxicol. Sci. 92, 587–595.

Mayer, G.D., Leach, A., Kling, P., Olsson, P.E., Hogstrand, C., 2003. Activation of therainbow trout metallothionein-A promoter by silver and zinc. Comp. Biochem.Physiol. B Biochem. Mol. Biol. 134, 181–188.

Morgan, J.E., Morgan, A.J., 1998. The distribution and intracellular compartmentation ofmetals in the endogeic earthworm Aporrectodea caliginosa sampled from anunpolluted and a metal-contaminated site. Environ Pollut. 99, 167–175.

Nagai, R., Shindo, T., Manabe, I., Suzuki, T., Kurabayashi, M., 2003. KLF5/BTEB2, aKruppel-like zinc-finger type transcription factor, mediates both smoothmuscle cellactivation and cardiac hypertrophy. Adv. Exp. Med. Biol. 538, 57–65 discussion 66.

Niyogi, S., Wood, C.M., 2004. Biotic ligand model a flexible tool for developing site-specific water quality guidelines for metals. Environ. Sci. Technol. 38, 6177–6192.

Olsson, P.E., Hyllner, S.J., Zafarullah, M., Andersson, T., Gedamu, L., 1990. Differences inmetallothionein gene expression in primary cultures of rainbow trout hepatocytesand the RTH-149 cell line. Biochim. Biophys. Acta 1049, 78–82.

Outten, C.E., O'Halloran, T.V., 2001. Femtomolar sensitivity of metalloregulatoryproteins controlling zinc homeostasis. Science 292, 2488–2492.

Pabon, C., Modrusan, Z., Ruvolo, M.V., Coleman, I.M., Daniel, S., Yue, H., Arnold Jr., L.J.,2001. Optimized T7 amplification system for microarray analysis. Biotechniques 31,874–879.

Palmiter, R.D., 1994. Regulation of metallothionein genes by heavy metals appears to bemediated by a zinc-sensitive inhibitor that interacts with a constitutively activetranscription factor MTF-1. Proc. Natl. Acad. Sci. U. S. A. 91, 1219–1223.

Palmiter, R.D., 2004. Protection against zinc toxicity by metallothionein and zinctransporter 1. Proc. Natl. Acad. Sci. U. S. A. 101, 4918–4923.

Paquin, P.R., Gorsuch, J.W., Apte, S., Batley, G.E., Bowles, K.C., Campbell, P.G., Delos, C.G.,Di Toro, D.M., Dwyer, R.L., Galvez, F., Gensemer, R.W., Goss, G.G., Hostrand, C.,Janssen, C.R., McGeer, J.C., Naddy, R.B., Playle, R.C., Santore, R.C., Schneider, U.,Stubblefield, W.A., Wood, C.M., Wu, K.B., 2002. The biotic ligand model: a historicaloverview. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 133, 3–35.

Parkinson, J., Guiliano, D.B., Blaxter, M., 2002. Making sense of EST sequences byCLOBBing them. BMC. Bioinformatics 3, 31.

Pärt, P., Norrgren, L., Bergstrom, E., Sjoberg, P., 1993. Primary cultures of epithelial cellsfrom rainbow trout gills. J. Exp. Biol. 175, 219–232.

Preville, X., Salvemini, F., Giraud, S., Chaufour, S., Paul, C., Stepien, G., Ursini, M.V., Arrigo,A.P., 1999. Mammalian small stress proteins protect against oxidative stress throughtheir ability to increase glucose-6-phosphate dehydrogenase activity and bymaintaining optimal cellular detoxifying machinery. Exp. Cell Res. 247, 61–78.

Prodocimo, V., Galvez, F., Freire, C.A., Wood, C.M., 2007. Unidirectional Na(+) and Ca (2+)fluxes in two euryhaline teleost fishes Fundulus heteroclitus and Oncorhynchusmykiss, acutely submitted to a progressive salinity increase. J. Comp. Physiol. [B] 177,519–528.

Radtke, F., Heuchel, R., Georgiev, O., Hergersberg, M., Gariglio, M., Dembic, Z., Schaffner,W., 1993. Cloned transcription factor MTF-1 activates the mouse metallothionein Ipromoter. EMBO J. 12, 1355–1362.

Regunathan, A., Glesne, D.A., Wilson, A.K., Song, J., Nicolae, D., Flores, T., Bhattacharyya,M.H., 2003. Microarray analysis of changes in bone cell gene expression early aftercadmium gavage in mice. Toxicol. Appl. Pharmacol. 191, 272–293.

Ringwood, A.H., Conners, D.E., 2000. The effects of glutathione depletion onreproductive success in oysters, Crassostrea virginica. Mar. Environ. Res. 50,207–211.

Rose-Janes, N.G., Playle, R.C., 2000. Protection by two complexing agents thiosulphateand dissolved organic matter, against the physiological effects of silver nitrate torainbow trout (Oncorhynchus mykiss) in ion-poor water. Aquat. Toxicol. 51, 1–18.

Sampson, M.J., Lovell, R.S., Craigen, W.J., 1997. The murine voltage-dependent anionchannel gene family. Conserved structure and function. J. Biol. Chem. 272,18966–18973.

Santore, R.C., Mathew, R., Paquin, P.R., DiToro, D., 2002. Application of the biotic ligandmodel to predicting zinc toxicity to rainbow trout, fathead minnow, and Daphniamagna. Comp. Biochem. Physiol. C Toxicol. Pharmacol. 133, 271–285.

Spry, J.S., Wood, C.M., 1985. Ion flux rates, acid-base status, and blood gases in rainbowtrout, Salmo gairdneri, exposed to toxic zinc in natural soft water. Canad. J. FisherAquat. Sci. 42, 1332–1341.

Taylor, L.N., Mcgeer, J.C., Wood, C.M., McDonald, D.G., 2000. Physiological effects ofchronic copper exposure to rainbow trout (Oncorhynchus mykiss) in hard and softwater: evaluation of chronic indicators. Env. Tox. Chem. 19, 2298–2308.

Tsukamoto, N., Chen, J., Yoshida, A.,1998. Enhanced expressions of glucose-6-phosphatedehydrogenase and cytosolic aldehyde dehydrogenase and elevation of reducedglutathione level in cyclophosphamide-resistant human leukemia cells. Blood CellsMol. Dis. 24, 231–238.

USEPA,1993. Methods for measuring the acute toxicity of effluents and receiving watersto freshwater and marine organisms. EPA600-4-92-027F, US Environment Protec-tion Agency.

Wada, H., Hasegawa, K., Morimoto, T., Kakita, T., Yanazume, T., Sasayama, S., 2000. Ap300 protein as a coactivator of GATA-6 in the transcription of the smooth muscle-myosin heavy chain gene. J. Biol. Chem. 275,, 25330–25335.

Walker, P.A., 2004. Molecular and physiological responses to waterborne metal inrainbow trout gill epithelial cells (Ph.D. Thesis), pp. 273. University of London,King's College London, London.

Walker, P.A., Bury, N.R., Hogstrand, C., 2007. Influence of culture conditions on metal-induced responses in a cultured rainbow trout gill epithelium. Environ. Sci. Technol.41, 6505–6513.

Williams, T.D., Diab, A.M., George, S.G., Godfrey, R.E., Sabine, V., Conesa, A., Minchin, S.D.,Watts, P.C., Chipman, J.K., 2006. Development of the GENIPOL European flounder(Platichthys flesus) microarray and determination of temporal transcriptionalresponses to cadmium at low dose. Env. Sci. Technol. 40, 6479–6488.

Wood, C.M., 2001. Toxic responses of the gill. In: Schlenk, D.B., W.H. (Eds.), Target OrganToxicity in Marine and Freshwater Teleosts. Taylor and Francis, New York, pp. 1–89.

Wood, C.M., Gilmour, K.M., Pärt, P., 1998. Passive and active transport properties of agill model the cultured branchial epithelium of the freshwater rainbow trout(Oncorhynchus mykiss). Comp. Biochem. Physiol. A Mol. Integr. Physiol. 119,87–96.

Wood, C.M., Grosell, M., Hogstrand, C., Hansen, H., 2002a. Kinetics of radiolabelled silveruptake and depuration in the gills of rainbow trout (Oncorhynchus mykiss) andEuropean eel (Anguilla anguilla): the influence of silver speciation. Aquat. Toxicol.56, 197–213.

Wood, C.M., Kelly, S.P., Zhou, B., Fletcher, M., O'Donnell, M., Eletti, B., Pärt, P., 2002b.Cultured gill epithelia as models for the freshwater fish gill. Biochim. Biophys. Acta1566, 72–83.

Wood, C.M., Pärt, P., 1997. Cultured branchial epithelia from freshwater fish gills. J. Exp.Biol. 200, 1047–1059.

Zall, D.M., Fisher, D., Garner, M.D., 1956. Photometric determination of chlorides inwater. Anal. Chem. 28, 1665–1678.

Zhou, B., Nichols, J., Playle, R.C., Wood, C.M., 2005. An in vitro biotic ligand model (BLM)for silver binding to cultured gill epithelia of freshwater rainbow trout(Oncorhynchus mykiss). Toxicol. Appl. Pharmacol. 202, 25–37.