Ai

ALLa

b

c

d

e

f

a

ARRA

KMSGA

1

eaiegte

IooAp(

s

0h

Scientia Horticulturae 162 (2013) 204–212

Contents lists available at ScienceDirect

Scientia Horticulturae

journa l h om epa ge: www.elsev ier .com/ locate /sc ihor t i

first molecular investigation of monumental olive treesn Apulia region

melia Salimontia, Vito Simeoneb, Gianluigi Cesari c, Flutura Lamajb,uigi Cattivelli d, Enzo Perri a, Francesca Desideriod, Francesco Paolo Fanizzie,aura Del Cocof, Samanta Zelascoa,∗

Olive Growing and Olive Oil Industry Research Centre, Agricultural Research Council, 87036 Rende, Cosenza, ItalyThe Mediterranean Agronomic Institute of Bari, CIHEAM, Via Ceglie 9, 70010 Valenzano, Bari, ItalyOliveti Terra di Bari, Organizzazione Produttori Olivicoli Bari, ItalyGenomics Research Centre, Agricultural Research Council, S. Protaso 302, 29017 Fiorenzuola d’Arda, Piacenza, ItalyDepartment of Biological and Environmental Sciences and Technologies, Salento University, Prov.le Lecce-Monteroni, 73100 Lecce, ItalyC.A.R.S.O. Consortium, Strada Provinciale, Casamassima Km 3, 70010 Valenzano, Bari, Italy

r t i c l e i n f o

rticle history:eceived 27 February 2013eceived in revised form 22 July 2013ccepted 6 August 2013

eywords:

a b s t r a c t

The Apulia region is the most important area for the production of olive oil in Italy. About 80% of theApulian olive growing is traditionally managed and characterized from very old olive groves. In order toprotect and exploit such ancient germplasm, a regional law was recently approved which provides theintroduction of the following mention in labeling: “extra-virgin oil from the Apulian secular olive trees”.The wide ancient olive germplasm has never been identified before and the genetic discrimination may

onumental oliveSRenetic identificationpulia region

furthermore be complicated by in situ grafting practices carried out, sometimes on the branches, centuriesago. A set of nine microsatellite markers was used in order to identify 36 multi-secular olive tree samplescollected from an area spanning the Brindisi, Bari and Foggia provinces. Clustering analysis conductedwith 7 reference cultivars, distinguished two main groups showing a high genetic similarity betweenmost of the multi-secular samples and two known cultivars. Locus-by-locus AMOVA seems to confirm

roba

such genetic divergence p

. Introduction

Italy, due to favorable pedoclimatic conditions, the wide vari-tal heritage and not last, a centuries-old culinary tradition, hasll the requirements for the production of valuable oils. The qual-ty and peculiarity of Italian Extra Virgin Olive Oil (EVOO) find fullxpression in its relationship to land and then, to autochthonousermplasm. Furthermore, the protection of geographical origin andhe typical characteristics of EVOO translate into a marketing strat-gy for the promotion of Italian products in international markets.

The 80% of the olive cultivation is concentrated in Southerntaly, where the production touches the 88% of the whole Italianlive production. In particular, Apulia region alone produces 1/3f the total (about 1.7 million tons) (Alba et al., 2011). Moreover,

pulia is traditionally the most important region for the olive oilroduction in Italy providing the 37% of the national productionRusso, 2004). Five extra-virgin olive oils have obtained marks of

∗ Corresponding author. Tel.: +39 0984 4052200/233; fax: +39 0984 402099.E-mail addresses: samanta.zelasco@entecra.it,

amantazelasco@gmail.com (S. Zelasco).

304-4238/$ – see front matter © 2013 Elsevier B.V. All rights reserved.ttp://dx.doi.org/10.1016/j.scienta.2013.08.005

bly dating back thousands of years ago.© 2013 Elsevier B.V. All rights reserved.

protected designation of origin (PDO) at a European level accord-ing to EC Regulation 2081/92. To gain the PDO quality mark, foodproducts should derive from few local cultivars. Besides the “Col-lina di Brindisi”, prepared from Ogliarola Salentina (minimum 70%)(Pasqualone et al., 2007), “Terra di Bari” represents one of themost produced PDO oils in Apulia and can be subdivided intothree distinct sub-denominations: “Bitonto”, “Castel del Monte”and “Murgia dei Trulli e delle Grotte”. In particular, the disciplinaryof production of “Terra di Bari”, sub-denomination “Bitonto” pro-vides that this oil is obtained from the following varieties, presentfor at least 80%, alone or in combination: Cima di Bitonto, OgliarolaBarese or Coratina (Alba et al., 2011).

Apulia covers over 19,000 square kilometers succession ofbroad plains and low-lying hills representing 56.3% and 42.5%regional surface, respectively. The main mountainous area isGargano promontory, located in the north of Apulia, represent-ing 1% regional surface. Along the 450 km from the north-west tothe south-east of Apulia, soil and climatic characteristics notably

change as well as the varietal assortments and is usually definedsuch as “a huge olive grove with irregular planting distance anda number of multi-secular olive trees (Russo, 2004). It is notimpossible to meet up trees aged about 10 centuries and more,

orticu

ia2

dmiBr‘Caii‘roisf2nahdg

oepa

A. Salimonti et al. / Scientia H

ndeed the 80% of the Apulian olive growing is traditionally man-ged and often characterized from very old olive groves (Godini,006).

The wide survey of the regional germplasm includes ‘Ogliarolai Lecce’ commonly defined ‘Ogliarola Salentina’, undoubtedly theost cultivated variety in Apulia region (120,000 ha), largely spread

n the provinces of Lecce and Brindisi followed by the provinces ofari and Taranto where it is named ‘Cima di Mola’ and ‘Pizzuta’,espectively. Other synonyms are ‘Cima di Monopoli’, ‘Chiarita’,Mennella’, ‘Ogliarola’ and ‘Ogliarola tenera grossa’. The cultivaroratina with the most common synonyms, ‘Cima di Corato’, ‘Olivo

Grappoli’, ‘Racemo’, ‘Racioppa’, is cultivated in 60,000 ha, mainlyn the provinces of Bari and Foggia but is significantly present alson the other provinces. The ‘Cellina di Nardò’ (synonyms: ‘Cafarella’,Cellina Inchiastra’, ‘Leccese’, ‘Olivo di Nardò’, ‘Saracena’, ‘Scur-anese’, ‘Vosciola’) is grown in 70,000 ha mainly in the provincesf Lecce, Taranto and Brindisi. The cultivar ‘Ogliarola Barese’ withts synonyms ‘Cima di Bitonto’, ‘Ogliarola del Gargano’ and ‘Pae-ana’ is cultivated mainly in the province of Bari (35,000 ha) andor about 5000 ha in the other provinces (Lombardo, 2004; Godini,006). Apulian olive germplasm includes also other varieties of eco-omic importance (‘Peranzana’, ‘Bella di Cerignola’, ‘Sant’Agostino’nd ‘Rotondella’) cultivated over a large surface (several thousandectares). Therefore, a number of minor alleged varieties have beenescribed but poor information is available about their genetic ori-in or characterization (Lombardo, 2004).

The genetic characterization and phylogenetic analysis of theldest trees could be a powerful tool for the olive biodiversity

nrichment and for understanding the earliest origins of clonallyropagated fruit crops (Dııez et al., 2011). Poor knowledge is avail-ble about molecular characterization of the Apulian ancient olive

Fig. 1. Map of Apulia region showi

lturae 162 (2013) 204–212 205

trees which, in general, are becoming more and more importantin population genetics studies (Baldoni et al., 2006; Erre et al.,2010; Albertini et al., 2011; Dııez et al., 2011) and for the potentialeconomic impact they could acquire into the high quality localproduction. Indeed Apulia region has recently approved a lawaimed at protecting and enhancing of multi-secular trees. It claimsthe introduction of the special mention in labeling: “Extra VirginOlive Oil from the Apulia secular olive trees” (art. 7 L. R. n. 14,4 June 2007).

Microsatellite markers are the markers of choice for variabil-ity studies in olive as they are transferable, highly polymorphic,multi-allelic polymerase chain reaction (PCR)-based co-dominantmarkers, relatively simple to interpret (Belaj et al., 2003). At themoment less than one hundred SSR molecular markers have beenidentified in olive but several authors reported about the ability of arestricted set of microsatellites as useful tools for molecular charac-terization of olive germplasm (Baldoni et al., 2006; Sarri et al., 2006;Cantini et al., 2008). In particular, when molecular characterizationconcerns unknown genotypes, it becomes increasingly importantusing a validated set of microsatellites and performing a compar-ison with known cultivars from officially recognized collections.Baldoni et al. (2009) have selected a set of 11 SSR markers testedin four different laboratories and validated in a wide collection ofknown cultivars.

In this work, a first investigation about the genetic identifica-tion was carried out on a sample of 36 multi-secular olive treeslocated in an area spanning three Apulian provinces (Bari, Brin-disi and Foggia) using nine simple-sequence repeat (SSR) markers

chosen from those selected by Baldoni et al. (2009). Some prelim-inary insights about population structure at local level were alsodiscussed.

ng the area of the provinces.

206 A. Salimonti et al. / Scientia Horticulturae 162 (2013) 204–212

Table 1List of multi-secular samples of Apulia region: accession code, location and position.

Multisecular accessions Location Position

Code Town Farm Longitude Latitude

Sec007 Monopoli (Bari) Az. Barnaba 17◦32′68′′ 40◦89′45′′

Sec008 Monopoli (Bari) Az. Barnaba 17◦30′83′′ 40◦89′08′′

Sec009 Monopoli (Bari) Az. Annese 17◦27′33′′ 40◦91′25′′

Sec010 Monopoli (Bari) Az. Angiulli 17◦25′52′′ 40◦95′25′′

Sec011 Polignano (Bari) Az. Angiulli 17◦21′94′′ 40◦95′77′′

Sec027 Monopoli (Bari) Az. Contento – –Sec030 Conversano (Bari) Az. Annese 17◦09′26′′ 40◦55′ 44′′

Sec031 Conversano (Bari) Az. Agribama 17◦05′49′′ 40◦ 57′ 07′′

Sec032 Monopoli (Bari) Az. Cavallo 17◦13′09′′ 40◦56′31′′

Sec033 Monopoli (Bari) Az. Ostuni 17◦16′20′′ 40◦54′38′′

Sec001 Ostuni (Brindisi) Itas Ostuni 17◦ .57′41′′ 40◦74′34′′

Sec002 Fasano (Brindisi) Museo Egnazia 17◦38′83′′ 40◦88′63′′

Sec003 Ostuni (Brindisi) Az. Brancati 17◦55′42′′ 40◦76′35′′

Sec004 Ostuni (Brindisi) Az. Brancati 17◦55′44′′ 40◦76′37′′

Sec005 Fasano (Brindisi) Az. Borri 17◦38′27′′ 40◦86′99′′

Sec006 Cisternino (Brindisi) Az. Raggioverde 17◦45′02′′ 40◦72′97′′

Sec012 Ostuni (Brindisi) Az. Asciano 17◦62′14′′ 40.74′74′′

Sec013 Ostuni (Brindisi) Az. Il Frantoio 17◦52′14′′ 40◦75′90′′

Sec014 Carovigno (Brindisi) Az. Cavallo 17◦66′43′′ 40◦69′90′′

Sec015 Carovigno (Brindisi) Az. Sciamola – –Sec016 Cisternino (Brindisi) Az. Valentini 17◦42′36′′ 40◦79′20′′

Sec017 Carovigno (Brindisi) Az. Carrone 17◦64′84′′ 40◦68′62′′

Sec018 Carovigno (Brindisi) Az. Tamborrino 17◦77′14′′ 40◦69′51′′

Sec019 Ostuni (Brindisi) Az. Tutosa 17◦54′06′′ 40◦78′87′′

Sec020 Ostuni (Brindisi) Az. Santoro 17◦ 32′10′′ 40◦ 46′77′′

Sec021 Ostuni (Brindisi) Mass. Fontenuova – –Sec022 Ostuni (Brindisi) Mass. Giummetta – –Sec028 Ostuni (Brindisi) Az. Brancati 17◦33′30′′ 40◦45′82′′

Sec034 Serranova (Brindisi) Az. Vallone 17◦45′51′′ 40◦42′06′′

Sec037 Ostuni (Brindisi) Az. Asciano – –Sec023 Mattinata (Foggia) Az. Giorgio 16◦02′ 72′′ 41◦ 42′ 38′′

Sec024 Mattinata (Foggia) Az. Incoronata 16◦ 02′ 53′′ 41◦ 43′ 19′′

Sec025 Vico del Gargano (Foggia) Az. Budrago 15◦ 56′ 79′′ 41◦ 55′ 21′′◦ ′ ′′ ◦ ′ ′′

2

2

ootl“tspcOcs

oau((

2

1i2

Sec026 Vico del Gargano (Foggia)

Sec035 (olivastro) Mattinata (Foggia)

Sec036 selvatico (oleastro) Mattinata (Foggia)

. Materials and methods

.1. Plant material and DNA isolation

Leaf samples of ancient olive trees were collected from privatelive growers located in a rather large area among the provincesf Foggia, Bari and Brindisi (Fig. 1). The most of multi-secular oliverees were also georeferenziated (Table 1). The main known Apu-ian varieties (“Coratina”, “Ogliarola di Lecce”, “Cellina di Nardò”,Ogliarola Barese”, “Ogliarola del Gargano”,”Cima di Mola”, “Olias-ro”) were also analyzed to conduct genetic comparisons. Leafamples were collected from each known cultivar in the qualifiedublic source localized in Mirto Crosia (CS), the olive germplasmollection of the CRA-Research Centre for the Olive Growing andlive Oil Industry, Rende (CS), Italy. The “Leccino” and “Frantoio”ultivars were also included in the molecular analysis as internaltandards in order to check experimental conditions.

Genomic DNA was extracted from 100 mg of fine powderbtained from leaves stored at −80 ◦C until use and grounded with

mortar and pestle in liquid nitrogen. Genomic DNA was extractedsing the“GenElute Plant Genomic DNA miniprep” commercial kitSigma–Aldrich), quantified by NanoDrop 2000 spectrophotometerThermo Scientific) and diluted to about 10 ng/�l.

.2. SSR analysis

Amplification reactions were performed in a final volume of0 �l in the presence of 20 ng template DNA, 1× buffer contain-

ng 1.5 mmol MgCl2, 0.5 �mol of forward and reverse primers,00 �mol of each deoxynucleotide, and 0.5 U Taq polymerase

Soc.Coop. Gargano 15 59 13 41 53 96– – –– – –

(Roche). The forward primers were 5′ labeled with a 6 FAM fluo-rophore. Polymerase chain reaction (PCR) was carried out usinga VerityTM Thermal Cycler (Applied Biosystems) using PCR condi-tions described by Sefc et al. (2000), Carriero et al. (2002) and De LaRosa et al. (2002). Samples were prepared by adding 1 �l PCR prod-ucts to Formammide and GenSize HD 400 Rox in the ratio 60:1. Thedetection of amplification products was carried out using 3130XLGenetic Analyzer (Applied Biosystems).

2.3. Data analysis

SSR data were scored and verified using Genemapper 3.7v. soft-ware (Applied Biosystems). Two independent samples (Cima diMola, Ogliarola Barese) were run in double in order to verify thereliability of the score method. Moreover two cultivars (Frantoio,Leccino) were used as inner controls in order to get a varietalstandard to insert in every analysis to check the correctness of PCRamplification and of sequencer analysis.

To assess the level of polymorphism of olive SSRs the expectedheterozigosity (He) of each microsatellite was calculated accordingto the formula

He = n(1 −

∑p2

i)

(n − 1)

where pi is the frequency of the ith allele and n is the number of genecopies in the sample for the given locus (Nei and Roychoudhury,

1974). The number of alleles and their frequency were also calcu-lated using POPGENE32 software (Yeh et al., 1997). The probabilityof null alleles was estimated according to the formula of Brookfield(1996): r = (He − Ho) (1 + He).

A. Salimonti et al. / Scientia Horticulturae 162 (2013) 204–212 207

Table 2List of SSR markers, repeat motifs and size range.

Locus Repeat motifs Size range Primer sequences References

GAPU71b (AG)8(AAG)12 (121–144) F 5′-GATCAAAGGAAGAAGGGGATAAA-3′

R 5′-ACAACAAATCCGTACGCTTG-3′Carriero et al. (2002)

GAPU103A (TCTTTCATGGTGGATCAGACG)0–1 (TC) 8–32

(136–190) F 5′-TGAATTTAACTTTAAACCCACACA-3′

R 5′-GCATCGCTCGATTTTTATCC-3′Carriero et al. (2002)

DCA3 (AT)1(GA)19 (232–255) F 5′-CCCAAGCGGAGGTGTATATTGTTAC-3′

R 5′-TGCTTTTGTCGTGTTTGAGATGTTG-3′Sefc et al. (2000)

DCA5 A5(GA)11 (194–208) F 5′-AACAAATCCCATACGAACTGCC-3′

R 5′-CGTGTTGCTGTGAAGAAAATCG-3′Sefc et al. (2000)

DCA9 (GA)29 (162–210) F 5′-AATCAAAGTCTTCCTTCTCATTTCG-3′

R 5′-GATCCTTCCAAAAGTATAACCTCTC-3′Sefc et al. (2000)

DCA14 (AC)18(A)9(TAA)9 (173–191) F 5′-AATTTTTTAATGCACTATAATTTAC-3′

R 5′-TTGAGGTCTCTATATCTCCCAGGGG-3′Sefc et al. (2000)

DCA16 (GT)16(GA)15 (124–174) F 5′-TTAGGTGGGATTCTGTAGATGGTTG-3′

R 5′-TTTTAGGTGAGTTCATAGAATTAGC-3′Sefc et al. (2000)

DCA18 (CT)20(TG)4(AG)(TG)6 (163–187) F 5′-AAGAAAGAAAAAGGCAGAATTAAGC-3′

R 5′-GTTTTCGTCTCTCTACATAAGTGAC-3′Sefc et al. (2000)

EMO090 (AC) (186–198) F 5′-CATCCGGATTTCTTGCTTTT-3′

R 5′De La Rosa et al. (2002)

K

1

wS

it1ci

15

Discriminating power (PD) was calculated according toloosterman et al. (1993):

−∑

P2j

here pj is the frequency of the jth genotype using PowerStatsV12.oftware.

Genetic diversity among olive trees samples and its signif-cance were estimated by computing pairwise Fis and exact

ests by GENEPOP v4.1.1 software (Raymond and Rousset,995). A probability test based on Markov Chain method wasarried out to estimate deviations of observed heterozigos-ty values from Hardy-Weimberg expectations for each SSR

Coeff icient

0.34 0.50 0.67

Fig. 2. UPGMA dendrogram showing genetic s

-AGCGAATGTAGCTTTGCATGT-3′

locus (Fis index) and its significance (p-value) using 1000dememorization steps, 100 batches and 1000 interactions perbatch.

Genetic relationships between olive genotypes were studied onthe basis of a similarity matrix using the Dice’s coefficient. A den-drogram was constructed by means of the UPGMA (unweightedpair-group method with arithmetical averages) algorithm. NT-SYS2.2v software was used.

The hierarchical analysis of molecular variance (AMOVA) was

preliminary carried out using Arlequin 3.5v software (Excoffier andLischer, 2010). Total genetic variance was partitioned into varianceamong populations and within population. The significance of fix-ation indices was tested by a permutation approach with 5000

0.83 1.00

SEC010

SEC022

SEC009

SEC015

SEC034

SEC008

SEC032

SEC030

SEC020

SEC028

SEC003

SEC006

SEC007

SEC017

SEC018

CIMAD IM

CIMAD IM

SEC004

SEC033

SEC031

SEC001

SEC027

SEC016

SEC021

SEC002

SEC013

SEC011

SEC012

OGLLECC

SEC014

SEC005

SEC019

SEC026

SEC023

SEC024

OGLGARG

FRAN TOIO

OGLBAR

OGLBAR

CORATINA

SEC025

SEC036

LECCINO

SEC035

SEC037

OLIASTRO

CEL DIN

imilarity among the 47 olive accessions.

208 A. Salimonti et al. / Scientia Horticulturae 162 (2013) 204–212

Table 3Parameters of the intra-population genetic diversity and discrimination efficiency of SSR markers: allele number (Na); size locus; allele frequency; number of alleliccombinations; observed heterozygosis (Ho); expected heterozygosis (He); p value HW; discriminating power (PD); probability of null alleles (r).

Locus Na Size locus Allele frequency Number of alleliccombinations

Ho He p value HW PD r

GAPU71b 4 6 0.98 0.56 0.00 0.235 −0.26A 121 0.02B 124 0.47C 127 0.04D 144 0.47GAPU103A 8 10 1 0.67 0.00 0.521 −0.20A 134 0.01B 136 0.02C 150 0.01D 157 0.06E 159 0.38F 162 0.07G 174 0.42H 186 0.01DCA3 6 8 0.98 0.64 0.00 0.5 −0.20A 232 0.03B 237 0.08C 239 0.03D 243 0.49E 253 0.02F 255 0.34DCA5 3 3 0.9 0.5 0.00 0.23 −0.25A 194 0.01B 198 0.44C 206 0.55DCA9 9 13 0.3 0.6 0.00 0.69 0.19A 162 0.08B 172 0.6C 182 0.2D 184 0.01E 186 0.02F 194 0.01G 198 0.02H 204 0.01I 206 0.06DCA14 6 6 0.94 0.66 0.00 0.55 −0.17A 173 0.2B 179 0.01C 181 0.02D 183 0.2E 189 0.01F 191 0.48DCA16 6 5 0.17 0.46 0.00 0.55 0.20A 124 0.01B 146 0.01C 150 0.7D 154 0.02E 156 0.23F 174 0.02DCA18 5 6 0.3 0.5 0.00 0.5 0.15A 171 0.02B 173 0.68C 177 0.15D 179 0.11E 181 0.04EMO090 7 10 0.49 0.56 0.019 0.75 0.05A 186 0.04B 188 0.2C 190 0.01D 192 0.06E 194 0.63F 196 0.03

ptuelu

G 198 0.02

ermutations. Locus-by-locus AMOVA was also performed usinghe same software. In this approach, the permutation procedure

sed to test their significance actually assumes that the SSR mark-rs are unlinked, as alleles are permuted across populations for eachocus independently. Population diversity indices were calculatedsing the same software.

3. Results

3.1. SSR polymorphism and molecular profile

A total of 36 multi-secular olive accessions in comparison with7 Apulian known cultivars were analyzed using 9 SSR loci (Table 2)chosen among those previously selected by Baldoni et al. (2009).

A. Salimonti et al. / Scientia Horticu

Table 4Private Alleles scored in multi-secular samples for the 9 SSR loci analyzed.

Locus Allele size Multi-secular samples

GAPU71b 121 Sec037, Sec019DCA 5 194 Sec010DCA9 198 Sec030,Sec004, Sec035

184 Sec037DCA16 156 Sec008,Sec009,Sec015,Sec032,Sec034,Sec005,

Sec022,Sec023,Sec024,Sec025,Sec026, Sec035,Sec036

146 Sec035EMO090 198 Sec005, Sec035

196 Sec012, Sec019192 Sec001, Sec027, Sec031, Sec033, Sec016,

Sec022186 Sec032, Sec034, Sec019

GAPU103A 157 Sec025, Sec036, Sec021, Sec014, Sec005,Sec019

150 Sec035

sdw

ifmSc0av

tgta1aatADnl

maa01(

otacaS

3

tv

DCA14 189 Sec025179 Sec025

Repeated PCR amplifications and genotyping using theequencer 3130XL Genetic Analyzer showed complete repro-ucibility of the scored SSR data and particularly for alleles detectedith the lowest frequency (data not shown).

The measures of genetic diversity intra population are shownn Table 3. The nine SSR loci revealed a total of 54 alleles, rangingrom 3 to 9 alleles at the DCA5 and DCA9 loci, respectively, with a

ean of 6 alleles per locus. In order to evaluate the efficiency of theSR markers for varietal identification, discriminating power wasalculated. The highest PD value was 0.75 while the lowest was.23 for EMO090 and DCA5 loci, respectively, with an average overll loci of 0.5. Only two SSR loci (GAPU71b and DCA5) showed PDalues lower than the average.

The number of allelic combinations per locus ranged from 3o 13 for DCA5 and DCA9 loci, respectively, with a total of 67enotypes. The expected heterozigosity (He) varied from 0.456o 0.66 for DCA16 and DCA14 loci, respectively, with an aver-ge of 5.18. Observed heterozygosity (Ho) ranged from 0.17 to

with an average of 0.67. The probability of occurrence of nulllleles values ranged from −0.26 to 0.20. At 5 out of the 9 locinalyzed, the observed heterozigosity was significantly higherhan the expected values under Hardy-Weinberg equilibrium.

significant heterozigosity deficiency was observed for DCA16,CA18 and DCA9 loci (Table 3) whereas only EMO090 locus didot show any divergence from HWE at the 0.01 significance

evel.The allele frequencies ranged from 0.01 to 0.7 showing poly-

orphism for each locus since the frequency of the most commonllele was <0.95. However, except DCA 18 locus, at least twolleles for each locus showed a frequency equal or higher than.2. The highest frequencies were observed for two alleles of50 bp and 173 bp at the DCA16 and DCA18 loci, respectively,Table 3).

Fourteen out of 54 alleles were scored only in multi-secularlive trees (Table 4). A unique allele combination was detected inhe Sec025 sample at the locus DCA14 and in the Sec010, Sec035nd Sec037 at the loci indicated in Table 4, conferring them a spe-ific molecular profile. Molecular profiles of the olive tree samplesnalyzed are reported in Electronic supplementary material (Table1).

.2. Clustering analysis

The cluster analysis of the 47 olive trees allowed to iden-ify 32 SSR profiles (Fig. 2) with a wide range of geneticariability (from 0.2 to 1 genetic similarity). Most of the

lturae 162 (2013) 204–212 209

multi-secular olive samples were divided in two main groups.A first cluster grouped 29 multi-secular samples collected fromBari and Brindisi provinces and two known cultivars, Ogliaroladi Lecce and Cima di Mola. Three groups of multi-secular olivetrees showed the same molecular profile at the 9 SSR locianalyzed, clearly demonstrating a clonal origin. Seven multi-secular tree samples (Sec020, Sec028, Sec003, Sec006, Sec007,Sec017, Sec018) exhibited a molecular profile correspondingto the known cultivar ‘Cima di Mola’. The second group includedSec009 and Sec015 while the third group included other four multi-secular olive trees (Sec033, Sec031, Sec001 and Sec027). Amongthese three groups, the pair-wise comparisons showed a similar-ity coefficient of 0.96, showing a difference of a single allele. Thefirst group was distinguished from the second group by a 194 bpvs. 192 bp allele, respectively, at the EMO090 locus and from thethird group by a 150 bp vs. 156 bp allele at the DCA16 locus. Thelatest difference was also observed between the second and thethird group of multi-secular olive trees.

The known cultivar Ogliarola di Lecce strictly clustered withthree monumental olive trees showing a similarity coefficient of0.93 with Sec011, Sec012 samples and 0.96 with the Sec013 sam-ple. One allele polymorphism of 191 bp (Ogliarola di Lecce) vs.183 bp (Sec011, Sec012 and Sec013) was detected at the locusDCA 14. Furthermore Sec011 displayed also a difference at DCA9 locus for one allele of 162 bp vs. 172 bp allele while Sec012sample displayed polymorphism at EMO090 locus for one alleleof 196 bp vs. 194 bp allele. Twenty-one multi-secular accessionsshowed a high genetic similarity (>0.8) with Ogliarola di Leccecultivar.

It is worthy to note that Ogliarola di Lecce and Cima di Mola, usu-ally considered as synonyms, showed a high similarity coefficient(0.89) with a unique different allele combination of 183/183 bp vs.173/191 bp at the locus DCA14, respectively.

The second group included 5 multi-secular accessions (Sec026,Sec023, Sec024, Sec025, Sec036) collected in the provinceof Foggia and Ogliarola Barese, Ogliarola Garganica, Coratinaknown cultivars. Excluding reference cultivars (Leccino, Fran-toio) found in this group, genetic variability ranged from 0.54 to0.91.

Three multi-secular samples (Sec026, Sec023, Sec024) strictlyclustered with Ogliarola Barese and Ogliarola Garganica knowncultivars showing a genetic similarity range between 0.8 and 0.9.All the three multi-secular samples displayed the private alleleat DCA16 locus in homozygous status (156/156 bp) while sharedalleles (159 bp, 162 bp and 174 bp) but in different combinationswere observed at theGAPU103A locus. The Sec026 showed a dif-ferent allele than the others (172 bp) in homozygous status at theDCA9 locus too.

Three known cultivars (Frantoio, Ogliarola Barese, Ogliarola Gar-ganica) showed a high degree of genetic similarity at the 9 SSR locianalyzed: ‘Ogliarola barese’ and ‘Frantoio’ were not distinguishableeach other whereas, between ‘Ogliarola Garganica’ and ‘OgliarolaBarese’ was discovered a similarity coefficient of 0.94, showing adifference for a single allele at the EMO090 locus (159 bp vs.162 bp,respectively).

Two minor groups were also detected, the first one consist-ing of two multi-secular samples, Sec035 and Sec037 samples andanother small group of two known cultivars, Cellina di Nardò andOliastro. Sec035 sample has been described such as ‘olivastro’ aferal form of the cultivated olive, and collected in a not well definedfarm in Foggia (Cesari personal communication) while Sec037 wascollected from a multi-secular plant grafted on the branches. Thehighest genetic diversity was observed between Cellina di Nardòcultivar and two monumental accessions, Sec025 and Sec019, col-

lected in Foggia and Brindisi provinces, respectively, showing aDice’s similarity coefficient of 0.2.

210 A. Salimonti et al. / Scientia Horticu

Table 5Locus-by-locus AMOVA analysis. Loci SSR; variance between populations (Va); vari-ance within population (Vb); percentage of variation (% var); differentiation index(Fst) and p-value of Fst.

Locus SSR Betweenpopulations

Within population

Va % var Vb % var Fst p-value

GAPU71b −0.009 − 3.5 0.27 103.4 −0.03 0.37DCA18 0.35 84.8 0.06 15.2 0.8 0.00DCA5 −0.009 −3.72 0.26 103.7 −0.037 0.72DCA 9 0.12 36 0.21 63.9 0.36 0.001DCA16 0.09 33.37 0.18 66.6 0.33 0.009DCA14 0.054 14.87 0.31 85.13 0.15 0.000DCA 3 0.07 20.33 0.27 79.67 0.2 0.000

3

fddittmbc

atGd

op(s

piDow

(wgp

sap‘

lfeft0oahu

This work also allowed to check genetic identity of known culti-

EMO090 0.09 30.36 0.22 69.64 0.30 0.000GAPU103A 0.04 11.28 0.31 88.72 0.11 0.000

.3. Locus-by-locus AMOVA analysis

Dendrogram seems to indicate a certain degree of genetic dif-erentiation of the olive trees analyzed suggesting a subpopulationivision. A group of multi-secular cultivars from Bari and Brin-isi provinces and another small group from Foggia province were

ndividuated. Then we decided to carry out a preliminary statis-ical description of the partitioning of molecular variance and toest the statistical ability of each SSR locus to assign cultivars and

ulti-secular germplasm to different geographic sites, using locus-y-locus AMOVA. The two minor groups and the internal referenceultivars were excluded from the analysis.

Analysis of the molecular variance showed that most of the vari-nce was attributable to within population variation (72.38% ofhe variance) whereas between populations variation was 27.62%.enetic differentiation index (Fst = 0.276) was highly significant toistinguish the two populations (s.l. = 0.05).

Locus-by-locus AMOVA showed that this pattern of partitioningf the variance between ‘within- population’ and ‘among-opulations’ variation is consistent across almost all SSR lociTable 5). Only two SSR loci, GAPU71b and DCA5, showed a nonignificant p-values of Fst (s.l. = 0.001).

The DCA18 locus leaded the highest contribute to the inter-opulation variance (84.8%) and the lowest contribute to the

ntra-population variance (15.2%). Indeed, exclusive alleles at theCA18 locus were detected in both the populations: private allelesf 177 bp, 179 bp and 181 bp were found in the ‘Foggia’ populationhile an allele of 173 bp identified the ‘Bari-Brindisi’ population.

The DCA3 locus contributed also to inter-population varianceVa) but in lower measure (20.33%). Indeed only a single alleleas discovered in the both population: an allele of 237 bp of ‘Fog-

ia’ population, (excluding Sec036) sample and in the Bari-Brindisiopulation a 255 bp allele was found (excluding Sec019 sample).

As expected from the clustering analysis, ‘Ogliarola Barese’howed allele combination of 177 bp/179 bp at the DCA18 locusnd an allele of 237 bp at the DCA3 locus, belonging to molecularrofile of ‘Foggia’ population. It is worth to note that the cultivar

Frantoio’ showed the same molecular profile.Standard diversity indices within -population were also calcu-

ated (data not shown) showing 8 polymorphic loci for populationrom Bari and Brindisi provinces indicating a total loss of het-rozigosity by DCA18 locus. Heterozigosity loss was observed alsoor DCA 16, EMO090 and DCA9 although only the latest one was sta-istically significant. The expected heterozigosity (He) varied from.32 to 0.61 for DCA9 and DCA16 loci, respectively, with an averagef 0.48 observed heterozigosity (Ho) ranged from 0.13 to 1 with an

verage of 0.69. At 5 out of the 9 SSR loci analyzed, the observedeterozigosity was significantly higher than the expected valuesnder Hardy-Weinberg equilibrium.

lturae 162 (2013) 204–212

In the population from Foggia all loci analyzed were polymor-phic. The expected heterozigosity (He) varied from 0.5 to 0.8 forDCA16 and GAPU103a loci, respectively, with an average of 0.62.Observed heterozigosity (Ho) ranged from 0 to 1 with an averageof 0.82. A general major level of heterozigosity was detected evenif at only two loci, significant divergences by HWE was observedfor DCA 16 and DCA14 loci, respectively.

4. Discussion

This study represents a first investigation focused on the geneticidentification of 36 monumental olive trees from a local areaextended to Foggia, Bari and Brindisi provinces, in Apulia region.Baldoni et al. (2009) selected a set of 11 SSR loci able to distin-guish the most part of olive germplasm worldwide. Nine of thesevalidated SSR loci were used in this work and their ability to fin-gerprinting unknown olive germplasm tested. Usually, the level ofpolymorphism and the associated information content are the cru-cial criterion for the choice of a particular set of SSR loci. Accordingto Alba et al. (2009), the comparison of the diagnostic capacity ofSSR markers is often generally based on results from small-scalestudies. To this goal, the use of the Power Discrimination function,strongly correlated to the genotype frequency, but independentof the absolute number of genotypes investigated, could facilitatecomparisons between researches conducted on different number ofgenotypes. However, marker polymorphism also varies accordingto the number and origin of the plants analyzed (Lopes et al., 2004).Taking in account that the most multi-secular olive trees revealed aclonal origin, the power of discrimination value and locus-by-locusAMOVA revealed that seven microsatellites loci were particularlyable to characterize the sample of olive trees considered in thisstudy.

Considering the whole sample of the olive trees analyzed, wefound a significant heterozygosis deficiency at three loci out ofthe 9 analyzed, with a relatively low probability of occurrence ofnull alleles. Loss of heterozygosity can be correlated to a popu-lation differentiation phenomenon, such as a subdivision of thelocal population into isolated and differentiated reproductive units(Wahlund effect). The cluster analysis seemed to indicate the exist-ence of a certain degree of local genetic differentiation confirmedby AMOVA analysis. The total loss of heterozigosity observed atthe DCA18 locus in the ‘Bari-Brindisi’ population encourages thishypothesis.

Considering Apulia morphology, Gargano promontory is theonly potential geographic barrier which might to explain this diver-gence probably occurred thousands of years ago.

The known cultivars (Ogliarola di Lecce, Cima di Mola) widelycultivated in the southern region showed a strictly relationshipwith almost all the 29 multi-secular samples confirming theirautochthonous origin. Furthermore, we found a high genetic sim-ilarity between “Ogliarola di Lecce” and “Cima di Mola” whichdifferentiated each other at only one SSR locus showing a geneticvariability of 10%. A much more strict relationship (about 1% geneticvariability) was also observed in a previous work carried out withAFLP markers by using a number of selective primers combina-tion (Zelasco et al., 2011). Despite the different source and entityof genetic variation due to the kind of molecular marker used, theneutral nature usually attributed to these markers seems here tobe confirmed by similarity of morphological traits and uniformbio-agronomic behavior detected under the same environmentalconditions (Muzzalupo et al., 2006).

vars such as “Ogliarola di Lecce” considering that the molecularprofile is consistent with the most of multi-secular tree sam-ples analyzed: a few cultivar-specific alleles were detected when

orticu

cion

pvaL2(mdSefoadtlob

ogcbaoP

asoup2BsodeOlOohld

gAih

A

F

A

f2

A. Salimonti et al. / Scientia H

ompared with the other main cultivars from Apulia region, provid-ng further genomic information in addition to the existing protocolf traceability for mono-varietal EVOO and PDO (Protected Desig-ation of Origin) developed by Pasqualone et al. (2007).

Allele differences found among most of the multi-secular sam-les and known cultivars might suggest a potential intra-cultivarariability considering the clonal origin shown. Intra-cultivar vari-bility has been reported by different authors (Cipriani et al., 2002;opes et al., 2004; Khadari et al., 2008; Muzzalupo et al., 2009,010) but it has been questioning from some other authors as wellCantini et al., 2008; Baldoni et al., 2009; Dııez et al., 2011). Timely,

ethods are being standardized by using of genetic analyzers, pro-ucing a lot of reference alleles and adopting a common set ofSR markers leading to results more and more comparable. How-ver the di-nucleotide nature of the most of SSR markers isolatedrom olive together with the stuttering phenomenon frequentlyccurring, can still easily lead to mistake in the interpretation ofllelic size (Zelasco et al., 2012). Stutter peaks are common ini-nucleotide microsatellites and are produced by the slippage ofhe polymerase during amplification complicating the pattern andeading to a very complex microsatellite morphology. The adoptionf automatic sequencers made SSR analysis highly reproducible,ut it makes stutter peaks rather viewable (Luty et al., 1990).

We observed a depth divergence for an allelic combination atne SSR locus between ‘Ogliarola di Lecce’ and ‘Cima di Mola’, sug-esting that intra-cultivar variability could have occurred. In thease of the ‘Ogliarola Barese’ and ‘Ogliarola Garganica’, as well asetween a number of multi-secular samples and known cultivars,

subtle difference for only one allele, often characterized by a shiftf one repeated unit, was observed, suggesting an artifact of theCR technique.

The Ogliarola Barese and Ogliarola del Gargano cultivars showed high relationship with a restricted number of the multi-secularamples collected from around the Foggia province. Otherwiseur results reveal strong similarities among the nationally diff-sed cultivar Frantoio and these known cultivars confirming theotential sinonymy reported by different authors (Godini et al.,002; Resta et al., 2002; Lombardo, 2004; Muzzalupo et al., 2006;artolini, 2008). Pannelli and Alfei (2008) summarized the geneticimilarity observed by several authors among the main Italianlive varieties, including Frantoio, Ogliarola Barese and Ogliarolael Gargano cultivars in a wider group of cultivars with differ-nt nationally geographic proveniences. The molecular profile ofgliarola Barese, being geographically linked to the Gargano area,

eads us to consider more correct to denominate this cultivargliarola del Gargano. A depth wider study including multi-secularlive trees and genetically analog cultivars should be conducted foraving a new insight about the origin of this cultivar. These SSR

oci showed to be useful for population genetic studies of micro-ifferentiations between geographically chosen populations.

This work gives some valuable insights about the Apulian oliveermplasm biodiversity. A deeper study with a larger sample ofpulian multi-secular olive trees is currently in progress includ-

ng wild olive individuals in order to verify the above-describedypothesis.

cknowledgment

This research was funded by the Italian Ministry of Agriculture,ood and Forestry (RIOM Project).

ppendix A. Supplementary data

Supplementary data associated with this article can beound, in the online version, at http://dx.doi.org/10.1016/j.scienta.013.08.005.

lturae 162 (2013) 204–212 211

References

Alba, V., Montemurro, C., Sabetta, W., Pasqualone, A., Blanco, A., 2009. SSR-basedidentification key of cultivars of Olea europaea L. diffused in Southern-Italy. Sci.Hortic. 123, 11–16.

Alba, V., Sabetta, W., Summo, C., Caponio, F., Simeone, R., Blanco, A., Pasqualone,A., Montemurro, C., 2011. Olive (Olea Europaea L.): Southern-Italian biodiver-sity assessment and traceability of processed products by means of molecularmarkers. Biodiversity, 1–19.

Albertini, E., Torricelli, R., Bitocchi, E., Raggi, L., Marconi, G., Pollastri, L., Di Minco, G.,Battistini, A., Papa, R., Veronesi, F., 2011. Structure of genetic diversity in Oleaeuropaea L. cultivars from central Italy. Mol. Breed. 27, 533–547.

Baldoni, L., Tosti, N., Ricciolini, C., Belaj, A., Arcioni, S., Pannelli, G., Germanà, M.A.,Mulas, M., Porceddu, A., 2006. Genetic structure of wild and cultivated olives inthe central Mediterranean basin. Ann. Bot. 98, 935–942.

Baldoni, L., Cultrera, N.G., Mariotti, R., Ricciolini, C., Arcioni, S., Vendramin, G.V.,Buonamici, A., Porceddu, A., Sarri, V., Ojeda, M.A., Trujillo, I., Rallo, L., Belaj, A.,Perri, E., Salimonti, A., Muzzalupo, I., Casagrande, A., Lain, O., Messina, R., Testolin,R., 2009. A consensus list of microsatellite markers for olive genotyping. Mol.Breed. 24, 213–231.

Bartolini, G., 2008. Olive Germplasm (Olea europaea L.): Cultivars, Synonyms, Culti-vation Area, Collections, Descriptors. http://www.oleadb.it

Belaj, A., Satovic, Z., Cipriani, G., Baldoni, L., Testolin, R., Rallo, L., Trujillo, I., 2003.Comparative study of the discriminating capacity of RAPD, AFLP and SSR markersand of their effectiveness in establishing genetic relationships in olive. Theor.Appl. Genet. 107, 736–744.

Brookfield, J.F.U., 1996. A simple new method for estimating null allele frequencyfrom heterozygote deficiency. Mol. Ecol. 5, 233–257.

Cantini, C., Cimato, A., Autino, A., Redi, A., Cresti, M., 2008. Assessment of Tuscangermplasm by microsatellite markers reveals genetic identities and differentdiscrimination capacity among and within cultivars. J. Am. Soc. Hort. Sci. 133,598–604.

Carriero, F., Fontanazza, G., Cellini, F., Giorio, G., 2002. Identification of simplesequence repeats (SSRs) in olive (Olea europaea L.). Theor. Appl. Genet. 104,301–307.

Cipriani, G., Marrazzo, M.T., Marconi, R., Cimato, A., Testolin, R., 2002. Microsatellitemarkers isolated in olive are suitable for individual fingerprinting and revealpolymorphism within ancient cultivars (Olea europaea L.). Theor. Appl. Genet.104, 223–228.

De La Rosa, R., James, C.M., Tobutt, K.R., 2002. Isolation and characterization of poly-morphic microsatellites in olive (Olea europaea L.) and their transferability toother genera in the Oleaceae. Mol. Ecol. Notes 2, 265–267.

Dııez, C.M., Trujillo, I., Barrio, E., Belaj, A., Barranco, D., Rallo, L., 2011. Centennialolive trees as a reservoir of genetic diversity. Ann. Bot. 108, 797–807.

Erre, P., Chessa, I., Munoz-Diez, C., Belaj, A., Rallo, L., Trujillo, I., 2010. Geneticdiversity and relationships between wild and cultivated olives (Olea europaeaL.) in Sardinia as assessed by SSR markers. Genet. Res. Crop. Evol. 57,41–54.

Excoffier, L., Lischer, H.E.L., 2010. Arlequin suite ver 3.5: a new series of programsto perform population genetics analyses under Linux and Windows. MolecularEcology Resources 10, 564–567.

Godini, A., Mariani, R., Pacifico, A., Palasciano, M., 2002. Repeatedly reported buthitherto undescribed olive cultivars native to Southern Italy. Acta Hort. 586,201–204.

Godini, A., 2006. The Apulian olive growing: between tradition and innovation.Olivebioteq 2, 115–122, Marsala-Mazara del Vallo, Italy.

Khadari, B., Charafi, J., Moukhli, A., Ater, M., 2008. Substantial genetic diversity incultivated Moroccan olive despite a single major cultivar: a paradoxical situationevidenced by the use of SSR loci. Tree Genet. Genomes 4, 213–221.

Kloosterman, A.D., Budowle, B., Daselaar, P., 1993. PCR-amplification and detectionof the human D1S80 VNTR locus. Intl. J. Legal Medicine105, 257–264.

Lombardo, N., 2004. Contributo alla caratterizzazione del germoplasma olivicoloPugliese. Ist. Sperim. Olivicoltura, Cosenza, Italy, pp. 113.

Lopes, M.S., Mendoca, D., Sefc, K.M., Gil, F.S., Da Camara Machado, A., 2004. Geneticevidence intra-cultivar variability within Iberian olive cultivars. Hort. Sci. 39,1562–1565.

Luty, J.A., Guo, Z., Willard, H.F., Ledbetter, D.H., Ledbettearn, S., Litt, D.M., 1990. Fivepolymorphic microsatellite VNTRs on the human X chromosome. Am. J. Hum.Genet. 46, 776–783.

Muzzalupo, I., Lombardo, N., Musacchio, A., Noce, M.E., Pellegrino, G., Perri, E., Saj-jad, A., 2006. DNA sequence analysis of microsatellite markers enhances theirefficiency for germplasm management in an Italian olive collection. J. Am. Soc.Hort. Sci. 131, 352–359.

Muzzalupo, I., Stefanizzi, F., Perri, E., 2009. Evaluation of olive cultivated in southernItaly by simple sequence repeat markers. Hort. Sci. 44, 582–588.

Muzzalupo, I., Chiappetta, A., Benincasa, C., Perri, E., 2010. Intra-cultivar variabilityof three major olive cultivars grown in different areas of central-southern Italyand studied using microsatellite markers. Sci. Hortic. 126, 324–329.

Nei, M., Roychoudhury, A.K., 1974. Genetic variation within and between the threemajor races of man, Caucasoids, Negroids and Mongoloids. Am. J. Hum. Genet.26, 421.

Pannelli, G., Alfei, B., 2008. Valore alimentare, identità e peculiarità sensoriali. Olivo

Olio 4, 38–45.

Pasqualone, A., Montemurro, C., Summo, C., Sabetta, W., Caponio, F., Blanco, A., 2007.Effectiveness of microsatellite DNA markers in checking the identity of Collinadi Brindisi PDO Extra Virgin Olive Oil. J. Agric. Food Chem. 55, 3857–3862.

2 orticu

R

R

R

S

S

Zelasco, S., Koehmstedt, A.M., Aradhya, M., Salimonti, A., Baldoni, L., Preece, J., 2012.

12 A. Salimonti et al. / Scientia H

aymond, M., Rousset, F., 1995. Genepop (version 1.2), population genetics softwarefor exact tests and ecumenicism. J. Hered. 86, 248–249.

esta, P., Lotti, C., Fanizza, G., Godini, A., Mariani, R., Palasciano, M., 2002. Use ofAFLP to characterize Apulian olive varieties (Olea europaea L.). In: Vitagliano,C., Martelli, G.P. (Eds.), Proc 41”1 IS on Olive Growing. Acta Hort. 586,pp. 73–77.

usso, G., 2004. Biodiversità del germoplasma olivicolo Pugliese. Convegno Germo-plasma olivicolo e tipicità dell’olio 90–95 SOI. Univ. Perugia, Dip. Arboricolturae Protezione piante, Perugia, Italy.

arri, V., Baldoni, L., Porceddu, A., Cultrera, N.G.M., Contento, A., Frediani, M., Belaj, A.,

Trujillo, I., Cionini, P.G., 2006. Microsatellite markers are powerful tools for dis-criminating among olive cultivars and assigning them to geographically definedpopulations. Genome 49, 1606–1615.

efc, K.M., Lopes, M.S., Mendonca, D., Rodrigues Dos Santos, M., Laimer Da CâmaraMachado, M., Da Câmara, M.A., 2000. Identification of microsatellite loci in olive

lturae 162 (2013) 204–212

(Olea europaea L.) and their characterization in Italian and Iberian olive trees.Mol. Ecol. 9, 1171–1173.

Yeh, F.C., Yang, R.C., Boyle, T.B.J., Ye, Z.H., Mao, J.X., 1997. The Userfriendly Sharewarefor Population Genetics Analysis. Edmonton, Biology and Biotechnology Center,University of Alberta, Canada.

Zelasco, S., Faccioli, P., Madeo, A., Cesari, G., Perri, E., Simeone, V., Lanza, B.,2011. Valorizzazione del germoplasma autoctono della regione Puglia: cor-rispondenza varietale e fingerprinting molecolare di olivi monumentali. ItalusHortus 1.

Efficiency of SSR markers for exploring olive germplasm diversity through agenetic comparison between the USDA-NCGR and the CRA-OLI olive collections.In: VII International Symposium on Olive Growing, September 25–29, San Juan,Argentina.