A

rorlclss©

K

1

oimcrctTtom

0d

Neurobiology of Aging 28 (2007) 1396–1409

17�-Estradiol protects depletion of rat temporal cortexsomatostatinergic system by �-amyloid

David Aguado-Llera a,b, Eduardo Arilla-Ferreiro b, Julie A. Chowen a, Jesus Argente a,Lilian Puebla-Jimenez b, Laura M. Frago a, Vicente Barrios a,∗

a Department of Endocrinology, Hospital Infantil Universitario Nino Jesus, Universidad Autonoma de Madrid,Avda. Menendez Pelayo, 65, E-28009 Madrid, Spain

b Neurobiochemistry Unit, Universidad de Alcala, E-28871 Alcala de Henares, Spain

Received 12 January 2006; received in revised form 31 May 2006; accepted 12 June 2006Available online 14 July 2006

bstract

Estradiol prevents amyloid-beta peptide (A�)-induced cell death through estrogen receptors (ERs) and modulates somatostatin (SRIF)esponsiveness in the rat brain. As intracerebroventricular (ICV) A�25-35 administration reduces SRIFergic tone in the temporal cortex ofvariectomized (Ovx) rats, we asked whether 17�-estradiol (E2) treatment can restore the A�25-35 induced changes in SRIF content, SRIFeceptor density and adenylyl cyclase (AC) activity, as well as if these effects are mediated by ERs. E2 treatment did not change A�25-35evels in the temporal cortex, but partially restored the SRIFergic parameters affected by A� insult and decreased cell death, which wasorrelated with Akt activation. The ER antagonist ICI 182,780 prevented the protective effect of E2 on sst2 levels, but did not modify SRIF

evels. Furthermore, ICI 182,780 treatment further decreased sst2 protein and mRNA levels when administered alone to A�25-35-treated rats,uggesting that it may block the effects of endogenous estrogens. These findings indicate that E2 protects the temporal cortical SRIFergicystem from A�-induced depletion independently of A� accumulation.

2006 Elsevier Inc. All rights reserved.

n; ICI

gtaihgi

abr

eywords: �-Amyloid; Somatostatin; Alzheimer; Estradiol; Neuroprotectio

. Introduction

Alzheimer’s disease (AD) is characterized by depositionf amyloid �-peptide (A�), intraneuronal abnormalities andncreased neuronal death. A� deposition activates an inflam-

atory response that contributes to this cell death and theognitive alterations that characterize the disease [70]. Neu-ochemical studies in AD brains have shown that the mostonsistently reported alteration of neuropeptides is the reduc-ion of somatostatin (SRIF) in the temporal cortex [56].his neuropeptide is involved in the modulation of cogni-

ive processes [29] and therefore could be involved in somef the clinical features of AD [46]. The actions of SRIF areediated via five receptors coupled through heterotrimeric

∗ Corresponding author. Tel.: +34 91 5035900; fax: +34 91 5035939.E-mail address: vbarrios@telefonica.net (V. Barrios).

iFaat[

197-4580/$ – see front matter © 2006 Elsevier Inc. All rights reserved.oi:10.1016/j.neurobiolaging.2006.06.009

182,780

uanine nucleotide-binding inhibitory proteins (Gi proteins)o different transmembrane pathways, including inhibition ofdenylyl cyclase (AC) [57]. A marked loss of SRIF receptorsn the temporal cortex of AD patients has been reported [14];owever, the levels of Gi proteins were unaltered [22], sug-esting that the reduction in SRIF-mediated inhibition of ACs due to the reduction in receptor density.

Multiple approaches have been used to block A� toxicitynd there is evidence indicating that 17�-estradiol (E2) maye helpful in the treatment of AD. In fact, E2 increases theesistance of neurons to A� toxicity [63], prevents cell deathnduced by A� in vitro and promotes neuron survival [27].urthermore, estrogen therapy reduces peripheral A� levels

nd enhances memory in postmenopausal AD women [9,13],lthough this effect remains under debate [6]. Likewise,he influence of E2 on A� accumulation remains unclear34,36,72,73].

iology

etntcp[(tttaolatoEcmFto

2

2

U(StaMnb1aToctoegatptd(c1

sSAwFa(BbAOPr(E(cbat

2

2

bkwgcP(d1pAaiEcirsoaA3eardA

D. Aguado-Llera et al. / Neurob

In spite of accumulative data demonstrating favorableffects of E2 in AD, little is known concerning its protec-ive effects against the deleterious actions of A� on specificeurotransmitter systems. We have previously demonstratedhat continuous infusion of A�25-35 in rats results in SRIFhanges similar to those described in AD [1]. Because E2rotects SRIF neurons from toxic-induced cell death in vivo11] and modulates A� toxicity in vitro via estrogen receptorsERs) [37], we hypothesize that E2 treatment to ovariec-omized (Ovx) rats exerts a protective effect against A�25-35oxicity on the SRIFergic system of the temporal cortexhrough ERs. To this end, we analyzed SRIF-like immunore-ctive (SRIF-LI) content and SRIF mRNA levels, the bindingf 125I-Tyr11-SRIF to SRIF receptors, protein and mRNAevels of the SRIF receptor subtypes (sst) 1–4, AC activitynd �i1, �i2 and �i3 G protein concentrations after con-inuous A�25-35 administration in the absence or presencef E2 treatment. Furthermore, we determined the effect of2 treatment on A�-like immunoreactive (A�-LI) content,ell death, phosphorylated Akt (p-Akt) and phosphorylateditogen-activated protein kinase (p-MAPK) protein levels.inally, the ability of the ER antagonist ICI 182,780 to block

he effects of E2 and colocalization of cell death with SRIFr sst immunopositive cells were also examined.

. Material and methods

.1. Materials

Synthetic [Tyr11]-SRIF and SRIF-14 were purchased fromniversal Biological (Cambridge, UK); carrier-free Na125I

IMS 30, 100 mCi/ml) was purchased from Perkin-Elmer Lifeciences (Boston, MA) and A�25-35, A�35-25, E2, choles-

erol, Tri-Reagent, aprotinin, bacitracin and bovine serumlbumin (fraction V) were obtained from Sigma (St. Louis,O). The antibody used in the SRIF radioimmunoassay tech-

ique was raised in rabbits against SRIF-14 conjugated toovine serum albumin and is specific for SRIF. Since SRIF-4 constitutes the COOH-terminal portion of SRIF-28, thentiserum does not distinguish between these two forms.he binding of SRIF-14 to this antibody does not dependn an intact disulfide bond since reaction with 0.1% mer-aptoethanol (boiling water bath, 5 min) does not changehe immunoreactivity of the peptide. Cross-reactivity withther peptides was less than 0.5%. Cross-reaction with sev-ral SRIF analogs demonstrated that neither the N-terminallycine nor the C-terminal cysteine residue is required forntibody binding, suggesting that the antigen site is directedowards the central part of the molecule containing the trypto-han residue. Antibodies against A�25-35 (A2275-76) andhe secondary antibody, conjugated to horseradish peroxi-

ase (I1906-10), were obtained from United States BiologicalSwampscott, MA). ICI 182,780 was from Zeneca Pharma-euticals (Cheshire, UK). Specific antisera against sst1–4 (sc-1604, sc-11606, sc-11614, sc-11619) and �i1–3 G protein

amtr

of Aging 28 (2007) 1396–1409 1397

ubunits (sc-13533, sc-13534, sc-262) were obtained fromanta Cruz Biotechnologies (Santa Cruz, CA). Antibodies tokt, p-Akt (Ser473), MAPK and p-MAPK (Thr183/Tyr185)ere purchased from New England Biolabs (Beverly, MA).or immunohistochemistry the rabbit antisomatostatin-14ntibody was purchased from Peninsula Laboratories Inc.San Carlos, CA) and the goat anti-sst2 from Santa Cruziotechnologies (Santa Cruz, CA). The secondary anti-ody conjugated with Alexa Fluor 633 and streptavidin-lexa Fluor 633 were from Molecular Probes (Eugene,R) and the biotin-conjugated secondary antibody was fromierce Chemical Co. (Rockford, IL). DeadEnd Fluoromet-ic TUNEL system was obtained from Promega CorporationMadison, WI). EDTA-free protease inhibitor cocktail and theLISA cell death detection kit were from Roche Diagnostics

Penzberg, Germany). Immobilon PSQ membranes were pur-hased from Millipore (Bedford, MA), nitrocellulose mem-ranes were obtained from Pall Corporation (Ann Arbor, MI)nd the chemiluminescence Western blotting detection sys-em was purchased from Santa Cruz Biotechnologies.

.2. Methods

.2.1. Experimental animalsForty female Wistar rats (8 weeks of age) were

ilaterally ovariectomized under anesthesia (0.02 ml ofetamine/100 g wt and 0.04 ml of xylazine/100 g wt). Threeeeks after ovariectomy, animals were divided into eightroups of five rats each. The first group was anesthetized and aannula attached to an osmotic minipump (Alzet 2002, Alza,alo Alto, CA) was implanted into the right cerebral ventricle−0.3 mm anteroposterior, 1.1 mm lateral) and secured withental cement. Infusion of A�25-35 was administered during4 days (300 pmol/day, infusion rate 0.5 �l/h), as describedreviously [50]. The second experimental group received�25-35 at the same dose and for the same period of time andSilastic capsule (1.57 mm i.d. and 3.18 mm o.d.; Dow Corn-

ng, Midland; MO) was inserted into the midscapular region.2 capsules were 5 mm long and filled with a 1:1 mixture ofholesterol and E2 and designed to deliver high physiolog-cal doses [21]. A third group of rats received only the E2-eleasing implant. Control rats received an ICV saline infu-ion and an implant filled with cholesterol alone. A fifth groupf rats received a minipump delivering A�25-35 plus the ERntagonist ICI 182,780 (600 fmol/day, infusion rate 0.5 �l/h).nother group of rats received a minipump delivering A�25-5 plus ICI 182,780 and the E2-releasing implant. The sev-nth group received a minipump delivering ICI 182,780 andn implant filled with cholesterol alone. Finally, the last groupeceived an ICV infusion of A�35-25 at the same dose anduring the same time-period as that used for rats receiving�25-35. A�35-25 is a peptide containing the same 11 amino

cids as A�25-35, but with a scrambled sequence. After treat-ent, the rats were sacrificed, the brains removed and the

emporal cortex was immediately dissected on ice [33]. Theats were treated according to the European Community laws

1 iology

fm

2

mIbbsccS1dXQrI

2

uuWI9

am1pa

2

caesw

a[f270tAo1gdp[

1

po

2sM

caSsbd

M[mprUwcwpawcCuepcwe

2r(

tLfaipt(odo

398 D. Aguado-Llera et al. / Neurob

or animal care and the experiment was approved by the Ani-al Care Committee of Alcala University.

.2.2. Aβ-like immunoreactivity (Aβ-LI) quantificationA�-LI was measured as previously described [54] with

inor modifications. Purified samples were dot-blotted ontommobilon PSQ membranes (Millipore, Bedford, MA). Mem-ranes were incubated during 2 h with a monoclonal anti-ody to anti-A�25-35 (United States Biological, Swamp-cott, MA) diluted 1:2000 in a phosphate blocking bufferontaining 1% BSA and 0.05% Tween 20. A peroxidaseonjugated secondary antibody (United States Biological,wampscott, MA) was added for 30 min at a dilution of:500 and peroxidase activity was visualized using an ECLetection kit (Santa Cruz Biotechnologies, Santa Cruz, CA).-ray films (Hyperfilm ECL) were exposed for 30 s to 1 min.uantification of the bands was carried out by densitomet-

ic analysis using the Scion Image computer program (Scionnc., Blackstone, MI).

.2.3. E2 and SRIF radioimmunoassays (RIAs)Trunk blood was collected and the serum stored at −30 ◦C

ntil assayed. Serum levels of E2 were quantified by anltra-sensitive RIA assay (Diagnostic Systems Laboratories,ebster, TX). The sensitivity of the assay was 1.9 pg/ml.

ntra- and inter-assay variation coefficients were 6.8 and.2%, respectively.

SRIF was extracted from temporal cortical tissue in 2 Mcetic acid by homogenization and boiling during 5 min andeasured by a specific RIA [52] with a sensitivity limit of

0 pg/ml. Dilution curves for temporal cortical extracts werearallel to the standard curve. The intra- and inter-assay vari-tion coefficients were 5.7 and 7.5%, respectively.

.2.4. Binding assay[Tyr11]-SRIF was radio-iodinated by using the

hloramine-T method [35]. The tracer was purified inSephadex G-25 fine column (1 cm × 60 cm) that had been

quilibrated with 0.1 M acetic acid containing 0.1% bovineerum albumin (w/v). The specific radioactivity of the traceras approximately 600 Ci/mmol.Membranes from the temporal cortex were prepared [58]

nd protein concentration determined as previously described43]. Specific SRIF binding was measured in membranesrom the temporal cortex (0.15 mg protein/ml), incubated in50 �l of a medium containing 50 mM Tris–HCl buffer (pH.5), 5 mM MgCl2, 0.2% (w/v) bovine serum albumin and.1 mg/ml bacitracin with 250 pM of 125I-[Tyr11]-SRIF inhe absence or presence of 0.01–10 nM unlabeled SRIF [25].fter incubation for 60 min at 30 ◦C, free and bound radi-ligand was separated by centrifugation at 12,000 × g for.5 min, and the resultant pellet was counted in a Beckman

amma counter. To evaluate the extent of tracer degradationuring the incubation period, we measured the ability of theeptide to rebind to fresh membranes as previously described3].

soRe

of Aging 28 (2007) 1396–1409

To determine whether E2 interferes with SRIF receptors,25I-[Tyr11]-SRIF binding to membrane receptors from tem-oral cortex was analyzed in the absence and presence of 1 ngf E2 per mg protein in the incubation medium.

.2.5. Immunodetection of SRIF receptor subtypes, αiubunits of G proteins, Akt, phosphorylated Akt (p-Akt)APK and p-MAPKMembranes (100 �g) were solubilized in sodium dode-

yl sulfate (SDS)-sample buffer and the proteins run on12% SDS-polyacrylamide gel for immunoblotting of theRIF receptor subtypes 1–4 (sst1–4) or the �i1-3 G proteinubunits. The transfer of proteins to nitrocellulose mem-ranes (Pall Corporation, Pensacola, FL) was carried out asescribed elsewhere [48].

For the immunoblotting of Akt, p-Akt, MAPK or p-APK, protein was purified from the temporal cortex

29] and measured as previously described [43]. Thirtyicrograms of protein were resolved using a 10% SDS-

olyacrylamide gel and transferred to polyvinylidene difluo-ide membranes (Amersham Biosciences, Buckinghamshire,K). The filters were blocked and incubated overnight at 4 ◦Cith the specific primary antibody at a dilution of 1:1000 in all

ases. After washing, the filters were incubated during 60 minith the corresponding secondary antibody conjugated witheroxidase at a dilution of 1:2000. After eliminating unboundntibody, three 5-min washes with HEPES 20 mM pH 7.5ere carried out and the proteins detected by chemilumines-

ence using an ECL Western blotting analysis system (Santaruz Biotechnologies, Santa Cruz, CA) according to the man-facturer’s instructions. X-ray films (Hyperfilm ECL) werexposed for 30 s to 1 min. Quantification of the bands waserformed by densitometric analysis using the Scion Imageomputer program (Scion Inc.). Levels of p-Akt and p-MAPKere normalized to the respective unphosphorylated forms in

ach sample.

.2.6. RNA extraction, reverse transcription andeal-time PCR for brain-derived neurotrophic factorBDNF), SRIF and SRIF receptors

Total RNA was extracted from 50 mg of temporal cor-ex according to the Tri-Reagent protocol (Sigma, Saintouis, MO). The reverse transcription reaction was per-

ormed on 50 ng of total RNA using the high-capacity cDNArchive kit (Applied Biosystems, Foster City, CA), accord-ng to the manufacturer’s instructions. Real-time PCR waserformed in an ABI Prism 7000 Sequence Detection Sys-em (Applied Biosystems) using TaqMan PCR Master MixApplied Biosystems) and the termocycler parameters rec-mmended by the manufacturer. PCRs were performed inuplicate, in a total volume of 50 �l, containing 0.5–5 �lf the reverse transcription reaction. TaqMan gene expres-

ion assays were used for BDNF, SRIF and sst2 (assaysn demand numbers Rn00560868 m1, Rn00561967 m1 andn00571116 m1, respectively, Applied Biosystems). Thesexpression assays have the reporter dye 6-carboxyfluorescein

D. Aguado-Llera et al. / Neurobiology of Aging 28 (2007) 1396–1409 1399

Table 1Sequences of primers and probes used for real-time polymerase chain reaction

Gene Bank Forward Reverse Probe

sst1 NM 012719 TTCTCGGGTCCACAGTGACC GCATGGATGTGTTCTTGAAGCA ACCTGCAATGGTCGAATGCACTGTTGs ACATTs AGGA

s sst4, so

((3swpTSgc[sfr

merdosctcftt

2

pbap11(TtATt

2

itw

iwitdt

2

npfiaXhstiscdi3aaPi6AdcNtcmi

2

ttpct

st3 AH007515 GGCGACTGCAAAGGGAATT TCTGst4 NM 013036 AGCTTCTGAATCTGTTTGTCACCAG TGAG

st1, somatostatin receptor subtype 1; sst3, somatostatin receptor subtype 3;

FAM) at the 5′end of the TaqMan minor groove binderMGB) probe and a nonfluorescence quencher (NFQ) at the′end of the probe. Primers and TaqMan MGB probes for sst1,st3 and sst4 were designed using the Primer Express soft-are (Applied Biosystems) and the PCR mixture containsrimers (400 nM each) and 200 nM of the TaqMan probe.hese probes have the same reporter and quencher as above.equences of primers and probes for sst1, sst3 and sst4 areiven in Table 1. Relative gene expression comparisons werearried out using an invariant endogenous control (GAPDH)31]. The primers were designed using the Primer Expressoftware (Applied Biosystems) and the sequences were asollows: forward: 5′-CCAAGTATGACATCAAGAAG andeverse AGGCCAGGATGCCCTTTAGT.

According to manufacturer’s guidelines, the ��CTethod was used for relative quantification. Data are

xpressed as CT values (the cycle number at which loga-ithmic PCR plots cross a calculated threshold) and used toetermine �CT values (�CT = CT of the target gene − CTf the housekeeping gene). This value is calculated for eachample. The control sample was used as the baseline for eachomparison to be made. The last step in quantification is toransform these values to absolute value. The formula for foldhanges in gene expression is 2−��CT . Statistics were per-ormed with �CT values. Each experiment was carried outhree times and each sample was measured a minimum ofwo times in each assay.

.2.7. Adenylyl cyclase assayAC activity was measured in membranes from the tem-

oral cortex. Briefly, membranes (0.06 mg/ml) were incu-ated with 1.5 mM ATP, 5 mM MgSO4, 10 �M GTP,n ATP-regenerating system (7.5 mg/ml creatin phos-hate and 1 mg/ml creatine kinase), 1 mM 3-isobutyl--methylxanthine, 0.1 mM phenylmethylsulfonyl fluoride,mg/ml bacitracin, 1 mM EDTA, and test substances

10−4 M SRIF or 10−5 M forskolin [FK]) in 0.1 ml of 0.025 Mris/HCl buffer (pH 7.4). After a 15 min incubation at 30 ◦C,

he reaction was stopped by heating the mixture for 3 min.fter cooling, 0.2 ml of an alumina slurry (0.75 g/ml inris/HCl buffer, pH 7.4) were added and the suspension cen-

rifuged. The supernatant was used for assay of cAMP [32].

.2.8. Cell death detection

Detection of cell death was performed by ELISA accord-

ng to the manufacturer’s instructions (Roche Diagnos-ics). Briefly, the samples were added to microtiter plateells coated with anti-histone antibody and incubated dur-

obdc

CTGCTGCATGGA TTGCCCTGTGGGCAGAATCTTGGAAACCATAGAGAATCGG TCGATGCCACTGTCAACCATGTGTCC

matostatin receptor subtype 4.

ng 90 min at room temperature. After washing, the platesere incubated with an anti-DNA-peroxidase solution dur-

ng 90 min at room temperature. The substrate solution washen added and the plates agitated at 250 rpm until the coloreveloped adequately (around 15 min). Measurements wereaken at 405 nm with an automatic microplate analyzer.

.2.9. TUNEL/immunohistochemistryTerminal deoxynucleotidyltransferase-mediated dUTP

ick end labeling (TUNEL) and immunohistochemistry wereerformed on frozen 20 �m cryostat sections that werexed in 4% paraformaldehyde (w/v) for 20 min, washednd blocked with PBS containing 3% BSA and 1% Triton-100 for 60 min. Sections were incubated overnight in aumid chamber at 4 ◦C with primary antibody for somato-tatin (1:200) or sst2 (1:200). The next day cell death detec-ion by TUNEL was performed following the manufacturer’snstructions (Promega Corporation, Madison, WI). Briefly,ections were incubated in permeabilization solution (PBSontaining 1% Triton X-100) for 60 min and the labeling wasone with the terminal deoxynucleotidyl transferase enzymen a buffer containing fluorescein-12-dUTP for 60 min at7 ◦C. Sections were then washed and incubated with eithernti-rabbit Alexa Fluor 633 (1:1000; Molecular Probes) orbiotin-conjugated anti-goat secondary antibody (1:1000;

ierce) for 90 min. For sst2 detection, the sections were thenncubated with streptavidin-Alexa Fluor 633 conjugate for0 min (1:1000; Molecular Probes). After the addition of thelexa fluorochromes, all incubations were performed in theark. The results were visualized directly by using a DM IRBonfocal microscope (Leica Corporation, Madrid, Spain).egative controls for the TUNEL staining and immunohis-

ochemistry were performed by omitting terminal deoxynu-leotidyltransferase from the labeling mixture and the pri-ary antibody, respectively, and resulted in no specific label-

ng (data not shown).

.2.10. Statistical analysisThe computer program LIGAND [49] was used to analyze

he binding data. This program allows models of receptorshat best fit a given set of binding data to be selected. Thisrogram was also used to produce Scatchard plots and toompute values for receptor affinity (Kd) and density (Bmax)hat best fit the binding data for each rat. Statistical analysis

f all data was carried out by one-way ANOVA followedy a Scheffe F-test. Relationships between variables wereetermined by linear regression analysis. The values wereonsidered significantly different when the p-value was less

1 iology of Aging 28 (2007) 1396–1409

ts

3

3

itmiAAwAhfg

3S

s[ptwslig

ofdAwaua

Fig. 1. (A) Serum estradiol levels in ovariectomized (Ovx) rats (control),Ovx rats treated with �-amyloid 25–35 peptide (A�25-35), Ovx rats treatedwith A�25-35 plus 17�-estradiol (A�25-35 + E2) and Ovx rats treated withEtafi

TEi

KBssss

Bcm

400 D. Aguado-Llera et al. / Neurob

han 0.05. Statistical analyses were performed using Statviewoftware (Statview 5.01; SAS Institute, Cary, NC).

. Results

.1. E2 treatment to Ovx rats fails to alter Aβ-LI levels

Treatment of Ovx rats with E2 resulted in an increasen plasma E2 concentrations to the physiological range. A�reatment had no effect on these levels (Fig. 1A). To deter-

ine whether E2 alters A�-LI levels, dot-blot immunoassayn the absence or presence of E2 treatment was employed.�-LI levels were not modulated by the E2 status (Fig. 1B).s previously documented in other brain areas [34], thereas no linear relationship between serum levels of E2 and�-LI content (r = 0.09, p = 0.58). However, other authorsave found that estrogen deficiency accelerates A� plaqueormation [73] and that physiological levels of E2 reduce theeneration of A� peptides [72].

.2. E2 protects against Aβ-induced SRIF- andRIF-receptor-depletion

We and others have documented that continuous infu-ion of A� induces changes in neurotransmitter expression2,50]. SRIF-LI content was significantly reduced in the tem-oral cortex of Ovx A�25-35-treated rats. E2 treatment par-ially inhibited the loss of SRIF-LI in A�25-35-treated rats,hereas E2 alone had no effect (Fig. 2A). Treatment with a

crambled sequence of A�25-35 had no effect on SRIF-LIevels (28.2 ± 6.8 and 27.1 ± 3.4 ng SRIF-LI/mg of proteinn the saline and A�35-25-treated group, respectively), sug-esting that the effect is specific for A�25-35.

A marked loss in SRIF receptor density in cortical areasf brains from patients with AD has been reported [14]. Weound that A�25-35 administration significantly reduced theensity of SRIF receptors. E2 treatment partially reverted the�25-35 induced reduction in the density of these receptors,

hereas E2 alone had no effect in control Ovx rats (Fig. 2B

nd C). The affinity of the SRIF receptors was consistentlynchanged in all groups (Fig. 2C; Table 2). Continuous ICVdministration of A�35-25 or addition of E2 to the incuba-

t(ma

able 2ffect of �-amyloid 25-35 peptide (A�25-35), A�25-35 plus 17�-estradiol (E2) or E

n membranes from the temporal cortex and somatostatin receptor subtypes 1–4 (ss

Control A�25-3

d 0.55 ± 0.07 0.48 ±max 607 ± 68 391 ±st1 (% control DU) 100 ± 8 95 ±st2 (% control DU) 100 ± 8 67 ±st3 (% control DU) 100 ± 5 103 ±st4 (% control DU) 100 ± 9 88 ±inding parameters were calculated from Scatchard plots by linear regression. Kd iapacity expressed in fmol/mg protein; sst is the somatostatin receptor subtype expean ± S.E.M. of five rats. *p < 0.05 compared to control, #p < 0.05 compared to A

2 alone. (B) Relative beta-amyloid-like immunoreactivity (A�-LI) in theemporal cortex from the same experimental groups. Values are expresseds the mean ± S.E.M. The number of rats in each experimental group wasve. *p < 0.001 compared to control.

ion medium did not modify the density of SRIF receptors607 ± 68, 620 ± 42 and 584 ± 59 fmol of SRIF bound perg of protein, in the saline group, A�35-25-treated group or

fter addition of E2 to the incubation medium, respectively).

2 alone on the equilibrium parameters for 125I-[Tyr11]-somatostatin bindingt1–4)

5 A�25-35 + E2 E2

0.05 0.51 ± 0.06 0.53 ± 0.1879* 493 ± 56# 591 ± 828 97 ± 9 97 ± 98* 87 ± 6# 98 ± 915 102 ± 15 104 ± 157 95 ± 10 99 ± 10

s the dissociation constant expressed in nM; Bmax is the maximum bindingressed as percentage of control densitometry units (DU). Each value is the�25-35-treated group.

D. Aguado-Llera et al. / Neurobiology

Fig. 2. (A) Somatostatin-like immunoreactivity (SRIF-LI) content in thetemporal cortex from ovariectomized (Ovx) rats (control), Ovx rats treatedwith �-amyloid 25–35 peptide (A�25-35), Ovx rats treated with A�25-35 plus 17�-estradiol (A�25-35 + E2) and Ovx rats treated with E2 alone.Values represent the mean ± S.E.M. of five rats. (B) Competitive inhibition

Tit

3d

cprtirei

3d

strE

Eei(p3s(e

3r

fite

ob(tatT(s3

of Aging 28 (2007) 1396–1409 1401

emporal cortical membranes from all groups showed sim-lar tracer degradation capacities and the values were lowerhan 10% in all cases.

.3. Reduction in SRIF receptor density is due to aecrease in sst2

To test if A�25-35 and/or E2 have an effect on a spe-ific receptor subtype, Western blot analyses of sst1–4 wereerformed in membranes from the rat temporal cortex. SRIFeceptor subtype 5 was not measured because levels are unde-ectable in this brain area. A decrease in sst2 levels was foundn the A�25-35-treated group, whereas E2 treatment partiallyestored the loss of this receptor subtype. E2 alone had noffect on this parameter (Fig. 2D). No significant differencesn the levels of sst1, sst3 or sst4 were found (Table 2).

.4. E2 treatment protects against the Aβ25-35-inducedecrease in SRIF and sst2 mRNAs

Using real time RT-PCR, we found that SRIF (Fig. 3A) andst2 mRNA levels (Fig. 3B) were significantly decreased inhe A�25-35 treated group. E2 treatment to A�25-35-treatedats partially restored SRIF and sst2 mRNA levels, whereas2 alone had no effect.

Next, we examined whether A�25-35, A�25-35 plus2 or E2 alone can modify sst1, −3 and −4 mRNA lev-ls. Analyses of mRNA levels using real time RT-PCRndicated no significant differences in the levels of sst1112.5 ± 14.8, 93.2 ± 16.2 and 118.6 ± 29.9, expressed asercentage of mRNA in the control Ovx group, A�25-5, A�25-35 plus E2 and E2-treated groups, respectively),st3 (101.5 ± 24.5, 87.2 ± 22.1 and 92.3 ± 15.8) or sst498.7 ± 14.4, 101.9 ± 32.2 and 87.1 ± 21.9) among thexperimental groups.

.5. E2 treatment prevents the Aβ25-35 inducededuction in SRIF-mediated inhibition of AC activity

Since SRIF receptors are coupled to AC in an inhibitory

ashion [62], we examined basal and FK-stimulated AC activ-ty, as well as SRIF-mediated inhibition of the enzyme inemporal cortical membranes. No significant differences inither basal or FK-stimulated AC activity were detected

f specific 125I-[Tyr11]-somatostatin (125I-[Tyr11]-SRIF, 250 pM) bindingy unlabeled SRIF to membranes from the temporal cortex of Ovx ratsopen circles), Ovx rats treated with A�25-35 (solid circles), Ovx ratsreated with A�25-35 plus 17�-estradiol (A�25-35 + E2) (open squares)nd Ovx rats treated with E2 alone (solid squares). Each point representshe mean obtained from five rats. (C) Scatchard analysis of the same data.he corresponding equilibrium binding parameters are included in Table 2.

D) Immunodetection of the somatostatin receptor subtype 2 (sst2) in theame groups. *p < 0.05 compared to control, #p < 0.05 compared to A�25-5-treated group..

1402 D. Aguado-Llera et al. / Neurobiology

Fig. 3. (A) Relative somatostatin (SRIF) mRNA content in the tempo-ral cortex from Ovx rats (control), Ovx rats treated with �-amyloid 25-35 peptide (A�25-35), Ovx rats treated with A�25-35 plus 17�-estradiol(A�25-35 + E2) and Ovx rats treated with E2 alone. Values represent themean ± S.E.M. of five rats. (B) Relative somatostatin receptor subtype 2(sst2) mRNA content in the temporal cortex of the same experimentalgt

aaai

lcoA

3t

tpmeap2(e

3m

oomcstspett

3

TEa

BB%++%

Vt

roups. *p < 0.05 compared to control, #p < 0.05 compared to A�25-35-reated group.

mong any of the experimental groups (Table 3). Both basalnd FK-stimulated AC activity were inhibited by SRIF inll experimental groups. However, the capacity of SRIF tonhibit basal and FK-stimulated AC activity was significantly

tt3t

able 3ffect of �-amyloid 25-35 peptide (A�25-35), A�25-35 plus 17�-estradiol (E2) orctivity (pmol/min/mg protein) as well as on somatostatin (SRIF) 10−4 M-mediate

Control

asal activity 280 ± 61asal activity + 10−4 SRIF 202 ± 38SRIF inhibition of basal activity 27 ± 4

10−5 forskolin 552 ± 7210−5 forskolin + 10−4 SRIF 391 ± 12

SRIF inhibition of forskolin-stimulated activity 29 ± 2

alues represent the mean ± S.E.M. The number of rats in each experimental groupreated group.

of Aging 28 (2007) 1396–1409

ower in the A�25-35-treated group compared to the Ovxontrol group. E2 treatment reduced the effect of A�25-35n the capacity of SRIF to inhibit basal and FK-stimulatedC activity (Table 3).

.6. Gi proteins are unaltered by Aβ25-35 or E2reatments

Because SRIF receptors are coupled to AC via Gi pro-eins [61], we next studied whether the levels of the Grotein subunits �i1, �i2 and �i3 were altered by these treat-ents. Western blot analyses showed no significant differ-

nces in the levels of �i1 (22.6 ± 1.7, 23.4 ± 3.1, 23.5 ± 2.4nd 22.0 ± 3.1 square pixels, in Ovx, A�25-35, A�25-35lus E2 and E2-treated groups, respectively), �i2 (24.5 ± 4.0,5.3 ± 2.6, 23.8 ± 3.1 and 23.9 ± 2.8 square pixels) or �i323.2 ± 1.6, 24.8 ± 3.0, 23.0 ± 2.0 and 23.4 ± 2.5 square pix-ls) among the experimental groups.

.7. Effect of ER antagonist ICI 182,780 on BDNFRNA levels

To demonstrate that treatment with the specific ER antag-nist ICI 182,780 was effective in blocking E2 actions inur protocol, we studied its effect on E2 regulation of BDNFRNA levels. The rat gene encoding this neurotrophic factor

ontains an estrogen response element-like sequence and istimulated by E2 [65]. Our results showed that E2 adminis-ration increased BDNF mRNA levels, whereas ICI 182,780ignificantly reduced these levels, both in the absence orresence of exogenous E2 (Fig. 4), suggesting that localndogenous E2 also stimulates BDNF mRNA levels. Fur-hermore, A�25-35 did not change BDNF mRNA content inhe temporal cortex, as previously reported [67].

.8. Effect of ICI 182,780 on SRIF mRNA levels

It has been previously demonstrated that E2 administra-

ion increases SRIF mRNA levels [71]; hence, we analyzedhe effect of ICI 182,780 [69] on SRIF mRNA levels. A�25-5 reduced SRIF mRNA levels and ICI 182,780 adminis-ered together with A�25-35 resulted in a further reduction.

E2 alone on basal and forskolin (10−5 M)-stimulated adenylyl cyclase (AC)d inhibition of AC activity in temporal cortical membranes

A�25-35 A�25-35 + E2 E2

281 ± 48 291 ± 60 336 ± 53246 ± 49 223 ± 25 236 ± 55

12 ± 3* 23 ± 2# 29 ± 4338 ± 52 512 ± 82 587 ± 108297 ± 30 388 ± 47 409 ± 49

12 ± 4* 24 ± 2# 31 ± 4

was five. *p < 0.01 compared to control, #p < 0.01 compared to A�25-35-

D. Aguado-Llera et al. / Neurobiology

Fig. 4. Relative brain-derived neurotrophic factor (BDNF) mRNA content inthe temporal cortex from Ovx rats (control, open bar), Ovx rats treated with�-amyloid 25–35 peptide (A�25-35) in the absence (solid bar) or presenceof ICI 182,780 (ICI) (hatched bar), Ovx rats treated with ICI 182,780 alone(grey bar), Ovx rats treated with E2 alone (open bar) and Ovx rats treatedwith A�25-35 plus E2 in the absence (solid bar) or presence of ICI 182,780(ce

Ewdc1ts(

3m

wwpiaitlp1epwImaO

3d

p[tatnmore cell death than A�25-35 alone. However, ICI 182,780was unable to block the protective effect of E2 on A�25-35induced cell death. E2 or ICI 182,780 alone had no significanteffect in Ovx control rats (Fig. 7A).

Fig. 5. (A) Relative somatostatin (SRIF) mRNA content in the temporal cor-tex from Ovx rats (control, open bar), Ovx rats treated with �-amyloid 25–35peptide (A�25-35) in the absence (solid bar) or presence of ICI 182,780 (ICI)(hatched bar), Ovx rats treated with ICI 182,780 alone (grey bar), Ovx ratstreated with E2 alone (open bar) and Ovx rats treated with A�25-35 plus E2

ICI) (hatched bar). Values represent the mean ± S.E.M. of five rats. *p < 0.05ompared to control, #p < 0.05 compared to A�25-35 or A�25-35 plus 17�-stradiol (E2)-treated groups.

2 treatment partially blocked the effect of A�25-35, buthen ICI 182,780 was coadministered, E2 was unable too so, whereas ICI 182,780 treatment alone had no signifi-ant effect in control Ovx animals (Fig. 5A). However, ICI82,780 was unable to inhibit the protective effect of E2 onhe A�25-35 induced decrease in SRIF-LI content and had noignificant effect on this parameter when administered aloneFig. 5B).

.9. ICI 182,780 administration decreases both sst2RNA and protein levels

Because the rat sst2 gene is activated by estrogens [38],e tested whether ICI 182,780 could modulate its expressionhen concomitantly administered with A�25-35 or A�25-35lus E2. ICI 182,780 alone resulted in a significant decreasen sst2 mRNA levels in A�25-35 treated animals (Fig. 6A)nd prevented the protective effect of E2 on the A�25-35nduced decrease in sst2 mRNA levels. However, animalsreated with A�25-35 plus ICI 182,780 had significantlyower sst2 mRNA levels than those treated with A�25-35lus ICI 182,780 and E2. It is possible that the dose of ICI82,780 used in these studies was insufficient to block theffects of both endogenous and exogenous estrogen on thisarameter; however, this appears unlikely as this antagonist

as capable of blocking these effects on BDNF expression.

t is also possible that the E2 effects on sst2 expression areediated through more than one mechanism. ICI 182,780

lone had no effect on sst2 mRNA or protein levels in controlvx animals (Fig. 6B).

iuit(

of Aging 28 (2007) 1396–1409 1403

.10. E2 treatment decreases Aβ25-35-induced celleath and increases activation of Akt

The Alzheimer disease-associated A� peptide has beenreviously shown to induce cell death in cultured neurons42]. Our results show that relative cell death is increased inhe temporal cortex of A�25-35-treated rats and although E2lone has no effect on cell death, it is able to partially inhibithe A�25-35 induced death. Although ICI 182,780 alone hado effect, ICI 182,780 combined with A�25-35 resulted in

n the absence (solid bar) or presence of ICI 182,780 (ICI) (hatched bar). Val-es represent the mean ± S.E.M. of five rats. (B) Relative somatostatin-likemmunoreactivity (SRIF-LI) content in the same groups. *p < 0.05 comparedo control, #p < 0.05 compared to A�25-35 or A�25-35 plus 17�-estradiolE2)-treated groups.

1404 D. Aguado-Llera et al. / Neurobiology of Aging 28 (2007) 1396–1409

Fig. 6. (A) Relative somatostatin receptor subtype 2 (sst2) mRNA content inthe temporal cortex from Ovx rats (control, open bar), Ovx rats treated with�-amyloid 25–35 peptide (A�25-35) in the absence (solid bar) or presenceof ICI 182,780 (ICI) (hatched bar), Ovx rats treated with ICI 182,780 alone(grey bar), Ovx rats treated with E2 alone (open bar) and Ovx rats treated withA�25-35 plus E2 in the absence (solid bar) or presence of ICI 182,780 (ICI)(hatched bar). Values represent the mean ± S.E.M. of five rats. (B) Immun-o*

pI

tmTbts(

3s

p

Fig. 7. (A) Relative cell death, as determined by ELISA, in the temporalcortex from Ovx rats (control), Ovx rats treated with �-amyloid 25-35 pep-tide (A�), Ovx rats treated with A�25-35 plus 17�-estradiol (A� + E2), Ovxrats treated with 17�-estradiol (E2), Ovx rats treated with A�25-35 plus ICI182,780 (A� + ICI), Ovx rats treated with A�25-35 plus ICI 182,780 and E2(A� + ICI + E2) and Ovx rats treated with ICI 182,780 alone (ICI). Valuesrepresent the mean ± S.E.M. of five rats. (B) Relative phosphorylated (p)-Akt protein levels in the temporal cortex of the same groups. The upper bandrepresents p-Akt and the lower band total Akt. (C) Relative phosphorylated

detection of the somatostatin receptor subtype 2 (sst2) in the same groups.p < 0.05 compared to control, #p < 0.05 compared to A�25-35 or A�25-35lus 17�-estradiol (E2)-treated groups, op < 0.05 compared to A�25-35 plusCI group.

Immunoblots of p-Akt showed that A�25-35 decreasedhe levels of activated Akt and concomitant E2 treatment nor-

alized p-Akt protein levels, whereas E2 alone had no effect.he total amount of Akt protein was not significantly alteredy any of the treatments (Fig. 7B). Analysis of p-MAPK pro-ein levels indicated that neither A�25-35 nor E2 treatmentignificantly modulated this pathway in the temporal cortexFig. 7C).

.11. TUNEL labeling and colocalization of SRIF and

st2 immunolabeling in TUNEL-positive cells

Very few TUNEL-positive cells were detected in the tem-oral cortex of the control (Fig. 8A), E2-treated (Fig. 8C)

(p)-mitogen-activated protein kinase (p-MAPK) protein concentrations inthe temporal cortex of the same experimental groups. The upper band rep-resents p-MAPK and the lower band total MAPK. OD, optical density; DU,densitometry units. *p < 0.01 compared to control, #p < 0.01 compared toA�25-35 or A�25-35 plus ICI 182,780-treated groups.

D. Aguado-Llera et al. / Neurobiology of Aging 28 (2007) 1396–1409 1405

Fig. 8. (A–G) TUNEL-positive cells (green) in the temporal cortex of Ovx rats (control) (A), Ovx rats treated with �-amyloid 25–35 peptide (A�) (B), Ovx ratstreated with 17�-estradiol (E2) (C), Ovx rats treated with ICI 182,780 (ICI) (D), Ovx rats treated with A�25-35 plus E2 (A� + E2) (E), Ovx rats treated withA�25-35 plus ICI 182,780 (A� + ICI) (F) and Ovx rats treated with A�25-35 plus ICI 182,780 and E2 (A� + ICI + E2) (G). (H–M) Double labeling for TUNEL(green) (H and K) and somatostatin (SRIF) immunohistochemistry (red) (I and L). Note the colocalization in cells in an advanced stage of apoptosis (arrowhead) (J) and in an early stage of apoptosis (M). (N–P) Double labeling of TUNEL (green) (N) and somatostatin receptor subtype 2 (sst2)-immunopositive cells(red) (O). Note the colocalization in the merge (P).

1 iology

awm(iw3

ipsitcIws

4

tstcdAnAlliii

aprpc3mrtbabpbds

dsd

Le[tattaar[wIdan

oarttttiFiGGtsit

AiHESlcdleimiia[tp

406 D. Aguado-Llera et al. / Neurob

nd ICI-treated groups (Fig. 8D). Increased TUNEL labelingas found in A�25-35-treated rats (Fig. 8B) and E2 coad-inistration decreased the number of TUNEL-positive cells

Fig. 8E). The number of TUNEL labeled cells was increasedn the group treated with A�25-35 plus ICI 182,780 (Fig. 8F),hereas E2 coadministration with ICI 182,780 plus A�25-5, appeared to reduce the signal (Fig. 8G).

Immunohistochemistry for SRIF and sst2 was performedn conjunction with TUNEL labeling on sections of tem-oral cortex to identify cells types undergoing apopto-is. Fig. 8H–M illustrates the colocalization of SRIF-mmunopositive cells with TUNEL staining in A�25-35-reated rats, whereas the colocalization of TUNEL positiveells with sst2-immunoreactive cells is shown in Fig. 8N–P.n addition, TUNEL-positive cells that do not colocalizeith SRIF or sst2-immunostaining were also found (data not

hown).

. Discussion

Here we demonstrate that E2 treatment partially restoreshe decrease in both SRIF-LI content and SRIF receptor den-ity in the temporal cortex induced by A�25-35 infusion andhis effect may be mediated through both classical and non-lassical ERs mechanisms. In addition, we show that theecrease in SRIF-mediated inhibition of AC activity after�25-35 infusion, which is restored with E2 treatment, isot due to an alteration in the levels of AC catalytic subunit.nother major finding is that E2 treatment does not alter A�

evels and its protective effects are most likely direct at theevel of SRIF and SRIF receptor expressing cells. Finally,ncreased cell death in the temporal cortex after A�25-35nfusion is also partially inhibited with E2 treatment and thiss coincident with changes in p-Akt levels.

One of the key features of AD is the accumulation ofmyloid plaques in degenerating brain neurons [70]. In theresent study, we used a continuous A�-infusion model thateproduces some alterations similar to those described in ADatients such as A� deposits disseminated throughout theortex [44] and depletion of cortical SRIF levels [1]. A�25-5 was chosen because it has a more rapid toxicity, provokesore oxidative damage [68] and causes a more pronounced

eduction in brain SRIF-LI content and SRIF receptor densityhan A�1-42 [2]. In addition, soluble (d-Ser26) A�1-40 maye converted by proteolysis to toxic (d-Ser26) A�25-35 [40]nd A� racemized at the Ser26 residue has been detected inrains of AD patients [39]. Also, A�25-35 is the minimumeptide region to which the cytotoxic properties of A� cane attributed [53] and this fragment contains two essentialomains, one with a �-turn site and other indispensable fortable aggregation [55].

Our present results confirm and extend previous resultsescribing profound alterations in neurotransmitter expres-ion in rat brain after continuous A� infusion [50]. Here weemonstrate that ICV infusion of A�25-35 decreases SRIF-

pdit

of Aging 28 (2007) 1396–1409

I content in the rat temporal cortex. A reduction in thexpression of SRIF mRNA in AD patients has been described28], which is similar to that demonstrated here in A�25-35-reated rats. Administration of A�25-35 increased cell death,s previously reported [66], and lead to a significant reduc-ion in p-Akt, an intracellular signaling mechanism knowno be involved in neuronal protection [26]. This pathway haslso been shown to be down-regulated in AD patients withltered forms of the A� precursor protein [60]. SRIF neu-ons are more susceptible to A� toxicity than other neurons50] and we found that death of these neurons was increased,hich could explain the loss of SRIF-LI content in these rats.

t remains to be demonstrated that SRIF neurons selectivelyie due to A�. Indeed, it appears that other cell types maylso be affected as TUNEL labeled cells were found that didot express SRIF.

A�25-35 infusion also leads to a reduction in the numberf SRIF receptors, which was selective for sst2 as we foundreduction in the mRNA and protein content of only this

eceptor subtype. Because SRIF receptors are coupled to AChrough Gi proteins [57], we analyzed the levels of Gi pro-eins and the capacity of SRIF to inhibit AC activity in theemporal cortex after A�25-35 infusion. Our results indicatehat A�25-35 does not alter basal or FK-stimulated AC activ-ty, but the ability of SRIF to inhibit AC activity was lower.urthermore, this reduction in SRIF inhibition of AC activity

n A�25-35 treated rats was not associated with a change ini levels. Cowburn et al. have previously demonstrated thati levels in the temporal cortex of patients with AD are unal-

ered [22,23]. Thus, these results indicate that AC catalyticubunit function is preserved and that the reported reductionn the ability of SRIF to inhibit AC activity could be relatedo the partial loss of SRIF receptors.

Evidence suggests that E2 has many positive effects inD, but the cellular and molecular mechanisms underly-

ng its neuroprotective actions are only partially elucidated.ere we demonstrate that physiological concentrations of2 partially prevent the deleterious effects of A�25-35 onRIF and sst2 by modulation of their respective mRNAs

evels and through a protective effect against A� inducedell death. Indeed, it is known that under physiological con-itions E2 influences SRIF secretion and increases mRNAevels and protein content of SRIF and sst2 [51]. Althoughstrogen response elements (EREs) have not been reportedn the SRIF and sst2 genes, the actions of estrogens include

echanisms leading to modifications in gene transcriptionndependent of nuclear ERs [16]. For example, one possibil-ty is via the cAMP response element (CRE) in SRIF [47]nd sst2 genes [38], as E2 increases cAMP concentrations76] and this nucleotide is a potent activator of the transcrip-ion of the SRIF gene [51]. In addition, E2 administrationrotects against A�25-35 induced death of SRIF and sst2

ositive cells. Indeed, we found that A�25-35 induced celleath in the temporal cortex, with some of these cells beingmmunopositive for either SRIF or sst2, and that E2 adminis-ration partially prevented this cell death. This is in agreement

iology

wctidiSelm

toEta[tiabttr[hlmwt

c[wBgamotsaoa1moioFepRti[

m1atasabtcptabspiictihi

ettItrTac

A

ITFtt

R

D. Aguado-Llera et al. / Neurob

ith previous results demonstrating that physiological con-entrations of E2 decrease A�-induced cell death [75] andhat there is a reduction in SRIF-positive neurons and sst2-likemmunoreactivity in the cortex of patients with Alzheimer’sisease [41]. The number of TUNEL positive cells colocal-zing with sst2 immunostaining was less than that found withRIF immunostaining. This could be due to the lower level ofxpression of sst2, together with the fact that this receptor isargely confined to dendrites [24] making cell identification

ore difficult.We found that E2 treatment partially reverts cell death and

hat this could involve Akt, as E2 increased the activated formf Akt in A�25-35-treated rats, returning it to normal. Indeed,2 has been shown to prevent neuronal death after injury

hrough up-regulation of Akt phosphorylation [20], althoughctivation of other pro-survival kinases has also been reported4]. For example, ovariectomy reduces ERK2 phosphoryla-ion and E2 replacement activates the ERK/MAPK pathwayn brain [15], whereas other studies report that estrogensct through membrane receptors activating concomitantlyoth Akt and MAPK [4,8]. Previous studies have suggestedhat estrogen depletion could exacerbate the features of ADhrough A� accumulation [74]. Some authors report that E2educes the generation of A� [72], whereas others do not34,36]. We found that E2 did not modulate brain A� levels;owever, the discrepancy in the effect of E2 on A� accumu-ation between our A�-infusion model and some transgenic

odels of amyloidosis could be explained by the fact thate analyzed the effect of E2 on A� clearance alone, while

ransgenic models include the effect on A� production.We tested whether the effects of E2 are mediated by classi-

al ER mechanisms by using the ER antagonist ICI 182,78069]. To assure that the dose and delivery of ICI 182,780as adequate to block a known effect of E2, we analyzedDNF mRNA levels. The gene for this factor has an estro-en response element-like motif [65] and its mRNA levelsre modified by estrogens [5,64,65]. In our protocol, treat-ent with ICI 182,780 blocked the stimulatory effect of E2

n BDNF mRNA content in temporal cortex. Furthermore,reatment with this ER antagonist in the absence of E2 alsoignificantly reduced BDNF mRNA levels, suggesting block-ge of local endogenous estrogens, and this was regardlessf whether the rat had received A�. Interestingly, in thebsence of exogenous E2 treatment administration of ICI82,780 also increased cell death and reduced SRIF and sst2RNAs, but only in A�-treated rats. This suggests an effect

f local endogenous estrogens on neuron survival, but onlyn the presence of a noxious substance such as A�, and thusnly when mechanisms of cell death are activated [17,18].urthermore, this effect most likely includes SRIF and sst2xpressing neurons, explaining why ICI 182,780 only hadrotective effects on these proteins in the presence of A�.

ecent studies have shown that the expression of aromatase,

he enzyme that converts androgens to estrogens, is inducedn the brain after different types of neurodegenerative stimuli19] and that endogenous formation of E2 in the brain by aro-

of Aging 28 (2007) 1396–1409 1407

atase is neuroprotective [12]. Therefore, the ability of ICI82,780 to exacerbate the effect of A� could be explained,t least in part, by the blockage of endogenous ER activa-ion by locally formed E2. Furthermore, ligand-independentctivation of ERs may also be involved in this effect [45]. Inupport of this, we have previously reported that the relativemount of SRIF mRNA in neurons in cortex is not affectedy E2 replacement [7]. Although ICI 182,780 administra-ion modulated SRIF mRNA levels, it did not affect SRIF-LIontent and was unable to block the effect of E2 on thisarameter. This indicates a possible disconcordance betweenhe regulation of SRIF mRNA levels and protein productionnd/or secretion and that modulation of SRIF protein levelsy estrogens may involve mechanisms other than the clas-ical ER. Although the mechanism involved is unknown, Grotein-coupled receptor 30 (GPR30) could be implicatedn the modulation of brain SRIF levels. Activation of thisntracellular transmembrane ER by E2 results in intracellularalcium mobilization [59] that is required for proSRIF forma-ion, resulting in an increase in peptide content [10]. Finally,t has also been reported that E2 inhibits SRIF release fromypothalamic cultures by an unknown mechanism, resultingn increased intracellular content [30].

In conclusion, our results demonstrate an in vivo protectiveffect of E2 on the SRIFergic system of the temporal cortexhat is independent from brain A� regulation and at least par-ially independent from classical ICI 182,780 sensitive ERs.n addition, our findings suggest that after A� toxic stimula-ion, the SRIFergic system is regulated by ER-mediated neu-oprotective mechanisms activated by endogenous signals.hese findings contribute to our understanding of the mech-nisms involved in E2 neuroprotection and suggest that ERsould be possible target candidates for the treatment of AD.

cknowledgements

This work was supported by grants from the Fondo denvestigacion Sanitaria (PI02/1241), Ministerio de Ciencia yecnologıa (SAF 2002-03324 and SAF 2003-07207) and theundacion Endocrinologıa y Nutricion. The authors wish to

hank Prof. Luis M. Garcıa-Segura for the critical review ofhe manuscript and Dr. Ana Arroba for the technical support.

eferences

[1] Aguado-Llera D, Martın-Martınez M, Garcıa-Lopez MT,Arilla-Ferreiro E, Barrios V. Gly-Pro-Glu protects �-amyloid-induced somatostatin depletion in the rat cortex. Neuroreport2004;15(12):1979–82.

[2] Aguado-Llera D, Arilla-Ferreiro E, Campos-Barros A, Puebla-JimenezL, Barrios V. Protective effects of insulin-like growth factor-I on the

somatostatinergic system in the temporal cortex of �-amyloid-treatedrats. J Neurochem 2005;92(3):607–15.

[3] Aguilera G, Parker DS, Catt KJ. Characterization of somato-statin receptors in the rat adrenal glomerulosa zone. Endocrinology1982;111(4):1376–84.

1 iology

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

408 D. Aguado-Llera et al. / Neurob

[4] Alexaki VI, Charalampopoulos I, Kampa M, Nifli AP, HatzoglouA, Gravanis A, et al. Activation of membrane estrogen recep-tors induce pro-survival kinases. J Steroid Biochem Mol Biol2006;98(2–3):97–110.

[5] Allen AL, McCarson KE. Estrogen increases nociception-evoked brain-derived neurotrophic factor gene expression in the female rat. Neuroen-docrinology 2005;81(3):193–9.

[6] Almeida OP, Lautenschlager NT, Vasikaran S, Leedman P, Gelavis A,Flicker L. A 20-week randomized controlled trial of estradiol replace-ment therapy for women aged 70 years and older: effect on mood,cognition and quality of life. Neurobiol Aging 2006;27(1):141–9.

[7] Argente J, Chowen-Breed JA, Steiner RA, Clifton DK. Somatostatinmessenger RNA in hypothalamic neurons is increased by testosteronethrough activation of androgen receptors and not by aromatization toestradiol. Neuroendocrinology 1990;52(4):342–9.

[8] Asimiadou S, Bittigau P, Felderhoff-Mueser U, Manthey D, SifringerM, Pesditschek S, et al. Protection with estradiol in developmentalmodels of apoptotic neurodegeneration. Ann Neurol 2005;58(2):266–76.

[9] Asthana S, Baker LD, Craft S, Stanczyk FZ, Veith RC, Raskind MA, etal. High-dose estradiol improves cognition for women with AD: resultsof a randomized study. Neurology 2001;57(4):605–12.

10] Austin CD, Shields D. Prosomatostatin processing in permeabilizedcells. Calcium is required for prohormone cleavage but not for-mation of nascent secretory vesicles. J Biol Chem 1996;271(2):1194–9.

11] Azcoitia I, Sierra A, Garcıa-Segura LM. Estradiol prevents kainicacid-induced neuronal loss in the rat dentate gyrus. Neuroreport1998;9(13):3075–9.

12] Azcoitia I, Sierra A, Veiga S, Honda S, Harada N, Garcıa-Segura LM.Brain aromatase is neuroprotective. J Neurobiol 2001;47(4):318–29.

13] Baker LD, Sambamurti K, Craft S, Cherrier M, Raskind MA, StanczykFZ, et al. 17�-Estradiol reduces plasma A�40 for HRT-naive post-menopausal women with Alzheimer disease: a preliminary study. AmJ Geriatr Psychiatry 2003;11(2):239–44.

14] Beal MF, Mazurek MF, Tran VT, Chattha G, Bird ED, Martin JB.Reduced numbers of somatostatin receptors in the cerebral cortex inAlzheimer’s disease. Science 1985;229(4710):289–91.

15] Bi R, Foy MR, Thompson RF, Baudry M. Effects of estrogen, age,and calpain on MAP kinase and NMDA receptors in female rat brain.Neurobiol Aging 2003;24(7):977–83.

16] Bjornstrom L, Sjoberg M. Mechanisms of estrogen receptor signaling:convergence of genomic and nongenomic actions on target genes. MolEndocrinol 2005;19(4):833–42.

17] Brown RC, Cascio C, Papadopoulos V. Pathways of neurosteroidbiosynthesis in cell lines from human brain: regulation of dehy-droepiandrosterone formation by oxidative stress and �-amyloid pep-tide. J Neurochem 2000;74(2):847–59.

18] Brown RC, Han Z, Cascio C, Papadopoulos V. Oxidative stress-mediated DHEA formation in Alzheimer’s disease pathology. Neuro-biol Aging 2003;24(1):57–65.

19] Carswell HV, Dominiczak AF, Garcıa-Segura LM, Harada N, Hutchi-son JB, Macrae IM. Brain aromatase expression after experimentalstroke: topography and time course. J Steroid Biochem Mol Biol2005;96(1):89–91.

20] Choi YC, Lee JH, Hong KW, Lee KS. 17 Beta-estradiol preventsfocal cerebral ischemic damages via activation of Akt and CREB inassociation with reduced PTEN phosphorylation in rats. Fundam ClinPharmacol 2004;18(5):547–57.

21] Chowen JA, Argente J, Vician L, Clifton DK, Steiner RA. Pro-opiomelanocortin messenger RNA in hypothalamic neurons isincreased by testosterone through aromatization to estradiol. Neuroen-

docrinology 1990;52(6):581–8.

22] Cowburn RF, Fowler CJ, Garlind A, Alafuzoff I, Nilsson L, Win-blad B, et al. Somatostatin receptors and the modulation of adenylylcyclase activity in Alzheimer’s disease. J Neurol Neurosurg Psychiatry1991;54(8):748–9.

[

of Aging 28 (2007) 1396–1409

23] Cowburn RF, O’Neill C, Bonkale WL, Ohm TG, Fastbom J. Receptor-G-protein signalling in Alzheimer’s disease. Biochem Soc Symp2001;67:163–75.

24] Csaba A, Dournaud P. Cellular biology of somatostatin receptors. Neu-ropeptides 2001;35(1):1–23.

25] Czernik AJ, Petrack V. Somatostatin receptor binding in rat cerebralcortex. Characterization using a nonreducible somatostatin analog. JBiol Chem 1983;258(9):5525–30.

26] Dhandapani KM, Brann DW. Protective effects of estrogen andselective estrogen receptor modulators in the brain. Biol Reprod2002;67(5):1379–85.

27] Dhandapani KM, Wade FM, Mahesh VB, Brann DW. Astrocyte-derivedtransforming growth factor-� mediates the neuroprotective effects of17�-estradiol: involvement of nonclassical genomic signaling path-ways. Endocrinology 2005;146(6):2749–59.

28] Dournaud P, Cervera-Pierot P, Hirsch E, Javoy-Agid F, KordonC, Agid Y, et al. Somatostatin messenger RNA-containing neu-rons in Alzheimer’s disease: an in situ hybridization study in hip-pocampus, parahippocampal cortex and frontal cortex. Neuroscience1994;61(4):755–64.

29] Dournaud P, Jazat-Poindessous F, Slama A, Lamour Y, Epelbaum J.Correlations between water maze performance and cortical somato-statin mRNA and high-affinity binding sites during ageing in rats. EurJ Neurosci 1996;8(3):476–85.

30] Fernandez G, Sanchez-Franco F, de los Frailes MT, Tolon RM, LorenzoMJ, Lopez J, et al. Regulation of somatostatin and growth hormone-releasing factor by gonadal steroids in fetal rat hypothalamic cells inculture. Regul Pept 1992;42(3):135–44.

31] Frago LM, Paneda C, Dickson SL, Hewson AK, Argente J, ChowenJA. Growth hormone (GH) and GH-releasing peptide-6 increasebrain insulin-like growth factor-I expression and activate intracellu-lar signaling pathways involved in neuroprotection. Endocrinology2002;143(10):4113–22.

32] Gilman AG. A protein binding assay for adenosine 3′5′-cyclic monophosphate. Proc Natl Acad Sci USA 1970;67(1):305–12.

33] Glowinski J, Iversen LL. Regional studies of catecholamines inthe brain. I. The disposition of [3H]norepinephrine, [3H]dopamineand [3H]DOPA in various regions of the brain. J Neurochem1966;13(8):655–69.

34] Green PS, Bales K, Paul S, Bu G. Estrogen therapy fails to alter amyloiddeposition in the PDAPP model of Alzheimer’s disease. Endocrinology2005;146(6):2774–81.

35] Greenwood FC, Hunter WM, Glover JS. The preparation of 131I-labeled human growth hormone of high specific radioactivity. BiochemJ 1963;89:114–23.

36] Heikkinen T, Kalesnykas G, Rissanen A, Tapiola T, Iivonen S, Wang J,et al. Estrogen treatment improves spatial learning in APP + PS1 micebut does not affect beta amyloid accumulation and plaque formation.Exp Neurol 2004;187(1):105–17.

37] Kim H, Bang OY, Jung MW, Ha SD, Hong HS, Huh K, et al. Neu-roprotective effects of estrogen against �-amyloid toxicity are medi-ated by estrogen receptors in cultured neuronal cells. Neurosci Lett2001;302(1):58–62.

38] Kimura N, Tomizawa S, Arai KN, Osamura RY, Kimura N. Charac-terization of 5′-flanking region of rat somatostatin receptor sst2 gene:transcriptional regulatory elements and activation by Pitx1 and estro-gen. Endocrinology 2001;142(4):1427–41.

39] Kubo T, Kumagae Y, Miller CA, Kaneko I. Beta-amyloid racemizedat the Ser26 residue in the brains of patients with Alzheimer disease:implications in the pathogenesis of Alzheimer disease. J NeuropatholExp Neurol 2003;62(3):248–59.

40] Kubo T, Nishimura S, Kumagae Y, Kaneko I. In vivo conversionof racemized beta-amyloid ([d-Ser 26]A beta 1-40) to truncated andtoxic fragments ([d-Ser 26]A beta 25-35/40) and fragment presencein the brains of Alzheimer’s patients. J Neurosci Res 2002;70(3):474–83.

iology

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

D. Aguado-Llera et al. / Neurob

41] Kumar U. Expression of somatostatin receptor subtypes (SSTR1-5) inAlzheimer’s disease brain: an immunohistochemical analysis. Neuro-science 2005;134(2):525–38.

42] Loo DT, Copani A, Pike CJ, Whittemore ER, Walencewicz AJ,Cotman CW. Apoptosis is induced by �-amyloid in cultured cen-tral nervous system neurons. Proc Natl Acad Sci USA 1993;90(17):7951–5.

43] Lowry OH, Rosenbrough NJ, Farr AL, Randall RJ. Protein measure-ment with the folin phenol reagent. J Biol Chem 1951;193(1):265–75.

44] Maurice T, Lockhart BP, Su TP, Privat A. Reversion of �-amyloidpeptide-induced amnesia by NMDA receptor-associated glycine siteagonists. Brain Res 1996;731(1–2):249–53.

45] Mendez P, Azcoitia I, Garcıa-Segura LM. Interdependence of oestrogenand insulin-like growth factor-I in the brain: potential for analysingneuroprotective mechanisms. J Endocrinol 2005;185(1):11–7.

46] Minthon L, Edvinsson L, Gustafson L, Somatostatin, neuropeptide. Yin cerebrospinal fluid: correlations with severity of disease and clinicalsigns in Alzheimer’s disease and frontotemporal dementia. DementGeriatr Cogn Disord 1997;8(4):232–9.

47] Montminy M, Brindle P, Mitra S, Hayes E, Liu Q, Schaeffer J, et al. Reg-ulation of somatostatin gene transcription by cAMP. In: Somatostatinand its receptors. Ciba foundation symposium 190. 1995. p. 7–20.

48] Mumby SM, Kahn RA, Manning DR, Gilman AG. Antisera of designedspecificity for subunits of guanine nucleotide-binding regulatory pro-teins. Proc Natl Acad Sci USA 1986;83(2):265–9.

49] Munson PJ, Rodbard D. Ligand: a versatile computerized approachfor characterization of ligand binding systems. Anal Biochem1980;107(1):220–39.

50] Nag S, Yee BK, Tang F. Reduction in somatostatin and substance P lev-els and choline acetyltransferase activity in the cortex and hippocampusof the rat after chronic intracerebroventricular infusion of �-amyloid(1–40). Brain Res Bull 1999;50(4):251–62.

51] Patel YC. Somatostatin and its receptor family. Front Neuroendocrinol1999;20(3):157–98.

52] Patel YC, Reichlin S. Somatostatin in hypothalamus, extrahy-pothalamic brain and peripheral tissues of the rat. Endocrinology1978;102(2):523–30.

53] Perez M, Cuadros R, Benıtez MJ, Jimenez JS. Interaction ofAlzheimer’s disease amyloid beta peptide fragment 25-35 with tau pro-tein, and with a tau peptide containing the microtubule binding domain.J Alzheimers Dis 2004;6(5):461–7.

54] Permanne B, Buee L, David JP, Fallet-Bianco C, Di Menza C, Dela-courte A. Quantitation of Alzheimer’s amyloid peptide and identifica-tion of related amyloid proteins by dot-blot immunoassay. Brain Res1995;685(1–2):154–62.

55] Pike CJ, Burdick D, Walencewicz AJ, Glabe CG, Cotman CW. Neu-rodegeneration induced by beta-amyloid peptides in vitro: the role ofpeptide assembly state. J Neurosci 1993;13(4):1676–87.

56] Reinikainen KJ, Soininen H, Riekkinen PJ. Neurotransmitter changesin Alzheimer’s disease: implications to diagnostics and therapy. J Neu-rosci Res 1990;27(4):576–86.

57] Reisine T, Bell GI. Molecular biology of somatostatin receptors. EndocrRev 1995;16(4):427–42.

58] Reubi JC, Perrin MH, Rivier JE, Vale V. High affinity binding sites forthe somatostatin-28 analogue in rat brain. Life Sci 1981;28(19):2191–8.

59] Revankar CM, Cimino DF, Sklar LA, Arterburn JB, Prossnitz ER. Atransmembrane intracellular estrogen receptor mediates rapid cell sig-naling. Science 2005;307(5715):1625–30.

[

of Aging 28 (2007) 1396–1409 1409

60] Ryder J, Su Y, Ni B. Akt/GSK3beta serine/threonine kinases: evidencefor a signalling pathway mediated by familial Alzheimer’s diseasemutations. Cell Signal 2004;16(2):187–200.

61] Sakamoto C, Nagao M, Matozaki T, Nishizaki H, Konda Y, BabaS. Somatostatin receptors on rat cerebrocortical membranes. Struc-tural characterization of somatostatin-14 and somatostatin-28 recep-tors and comparison with pancreatic type receptors. J Biol Chem1988;263(28):14441–5.

62] Schettini G, Florio T, Meucci O, Landolfi E, Grimaldi M, Ventra C,et al. Somatostatin inhibition of adenylate cyclase activity in differentbrain areas. Brain Res 1989;492(1–2):65–71.

63] Shah RD, Anderson KL, Rapoport M, Ferreira A. Estrogen-inducedchanges in the microtubular system correlate with a decreased sus-ceptibility of aging neurons to beta amyloid neurotoxicity. Mol CellNeurosci 2003;24(2):503–16.

64] Singh M, Meyer EM, Simpkins JW. The effect of ovariectomy andestradiol replacement on brain-derived neurotrophic factor messengerribonucleic acid expression in cortical and hippocampal brain regionsof female Sprague-Dawley rats. Endocrinology 1995;136(5):2320–4.

65] Sohrabji F, Miranda RC, Toran-Allerand CD. Identification of a putativeestrogen response element in the gene encoding brain-derived neu-rotrophic factor. Proc Natl Acad Sci USA 1995;92(24):11110–4.

66] Stepanichev MY, Zdobnova IM, Yakovlev AA, Onufriev MV, LazarevaNA, Zarubenko II, et al. Effects of tumor necrosis factor-� centraladministration on hippocampal damage in rat induced by amyloid �-peptide (25–35). J Neurosci Res 2003;71(1):110–20.

67] Tang Y, Yamada K, Kanou Y, Miyazaki T, Xiong X, Kambe F, et al.Spatiotemporal expression of BDNF in the hippocampus induced bythe continuous intracerebroventricular infusion of beta-amyloid in rats.Brain Res Mol Brain Res 2000;80(2):188–97.

68] Varadarajan S, Kanski J, Aksenova M, Lauderback C, Butter-field A. Different mechanisms of oxidative stress and neurotoxi-city for Alzheimer’s A�(1–42) and A�(25–35). J Am Chem Soc2001;123(24):5625–31.

69] Wakeling AE, Bowler J. ICI 182,780, a new antioestrogen with clinicalpotential. J Steroid Biochem Mol Biol 1992;43(1–3):173–7.

70] Walsh DM, Selkoe DJ. Deciphering the molecular basis of memoryfailure in Alzheimer’s disease. Neuron 2004;44(1):181–93.

71] Werner H, Koch Y, Baldino Jr F, Gozes I. Steroid regulationof somatostatin mRNA in the rat hypothalamus. J Biol Chem1988;263(16):7666–71.

72] Xu H, Gouras GK, Greenfield JP, Vincent B, Naslund J, Mazzarelli L,et al. Estrogen reduces neuronal generation of Alzheimer �-amyloidpeptides. Nat Med 1998;4(4):447–51.

73] Yue X, Lu M, Lancaster T, Cao P, Honda S, Staufenbiel M, etal. Brain estrogen deficiency accelerates Abeta plaque formation inan Alzheimer’s disease animal model. Proc Natl Acad Sci USA2005;102(52):19198–203.

74] Zheng H, Xu H, Uljon SN, Gross R, Hardy K, Gaynor J, et al. Mod-ulation of A� peptides by estrogen in mouse models. J Neurochem2002;80(1):191–6.

75] Zhang Y, Champagne N, Beitel LK, Goodyer CG, Trifiro M, LeBlancA. Estrogen and androgen protection of human neurons against intra-

cellular amyloid beta1-42 toxicity through heat shock protein 70. JNeurosci 2004;24(23):5315–21.

76] Zubin P, Taleisnik S. Hypothalamic cyclic AMP after the injection ofovarian steroids into ovariectomized rats. Can J Physiol Pharmacol1989;67(4):322–5.