α-DNA VI: comparative study of α- and β-anomeric oligodeoxyribonucleotides in hybridization to...

cx-DNA VI: comparative study of a- and (3-anomeric oligodeoxyribonucleotides in hybridization tomRNA and in cell free translation inhibition

Corinne Gagnor, Jean-Remy Bertrand2*, Sophie Thenet2, Marc Lemaitre, Fran9ois Morvan1,Bernard Rayner', Claude Malvy2, Bernard Lebleu, Jean-Louis Imbachl and Claude Paoletti2

Laboratoire de Biochimie des Proteines, UA 1191 CNRS, 1Laboratoire de Chimie Bio-organique, UA488 CNRS, Universite des Sciences et Techniques du Languedoc, Place E. Bataillon, 34060Montpellier Cedex and 2LA 147 CNRS, U 140 INSERM, Institut Gustave Roussy, 53 rue CamilleDesmoulins, 94800 Villejuif, France

Received August 10, 1987; Revised and Accepted November 25, 1987

ABSTRACTi and B-anomeric d(G,T1iG2) oligodeoxyribonucleotides were com-pared for their hybridization to rA12 : the observed meltingtemperatures are 27*C for B-oligodeoxyribonucleotide/RNA hybridand 53 C for o-oligodeoxyribonucleotide/RNA. o-oligonucleoti-des with the four bases, complementary to natural mRNAs, weresynthesized for the first time, labeled at their 5'-end withF"-2P] and used as probes in Northern blot experiments. Inspite of these higher affinities for their target RNA's, theywere unable to block translation of natural or synthetic mRNA'sin rabbit reticulocyte lysate. We have studied the RNase Hactivity on model rA12:c- or B-d(G2T.z2G2) hybrids or on mRNA:2-or B-oligonucleotides hybrids. Specific hybridization protectsRNA strech when using X-oligonucleotides but not B-oligonucleo-tides. Thus, our results show the inability of RNase H todegrade RNA in o-oligodeoxyribonucleotides:RNA duplexes.

INTRODUCTIONNaturally occuring RNA sequences that negatively control

gene expression have been recently discovered in procaryotes(1). Their inhibitory activity probably results from specifichybridization to complementary sequences in RNAs (1, 2).

These observations led several laboratories to work on

different experimental systems aiming at arresting mRNA trans-

lation with antisense RNA, antisense oligodeoxyribonucleotides(wich will be called oligonucleotides throughout this paper) or

analogues, in cell-free systems and in intact cells (3-13).A limitation in the utilisation of B-oligonucleotides is

their degradation by nucleases in culture media, biological

fluids (such as plasma) or in cells themselves (14). Our

recent studies show that o-oligonucleotides are more resistant

to various nucleases as calf spleen and snake venom phospho-diesterases or S1 nuclease (15). Furthermore, these o-oligonu-cleotides present the following features of potential impor-tance for their future use as tools in studies of gene

©) I RL Press Limited, Oxford, England. 10419

Nucleic Acids ResearchVolume 15 Number 24 1987

Nucleic Acids Research

expression regulation. The four synthons can be synthesized

and polymerized by solid-phase automated methylphosphoramidite

method with as good yields as for B-anomeric synthons (16).

They have been shown in model systems to anneal in parallel

orientation to a complementary B-oligodeoxyribonucleotide

strech (17-18). Furthermore, the thermal stability of short U-

DNA/RNA (as o-(dT)a/rAE) or U-DNA/DNA (as c-(dT)a/dAr_) (19)

duplexes is appreciably greater then corresponding B/B duple-

xes.

As pointed out in a recent paper (19), it was necessary to

synthesize U-oligonucleotides complementary to natural mRNAs to

test the generality of the observations made with short

synthetic U-oligonucleotides and to assess their potentiality

in blocking natural mRNA translation.

In the present report, we attempted to achieve this goal

by additional studies of o-anomeric oligonucleotides : i) their

affinity and their specificity for target mRNA's ii) their

inhibitory efficiency in in vitro translation as compared to

B-anomers; iii) their ability to become substrate for RNase H

after hybridization with the target RNA.

Two mRNAs preparations were used in these studies, e.g. i)

an in vitro translated mRNA coding for a human 26 kD protein

with growth regulatory properties (also called interferon I3.,

interleukin-6 or B-cells stimulatory factor 2; 20 for a review)

and ii) a mixture of three vesicular stomatitis virus (VSV)

mRNA coding for viral N, NS and M proteins. The synthetic

oligonucleotides used in hybridization studies and hybrid

arrest of translation were complementary to the initiation

region of 26 kD protein mRNA and to the same region of the mRNA

coding for VSV N protein, since most studies have identified

these targets to be the most efficient to block mRNA transla-

tion (21).

MATERIAL AND METHODSMaterials

Reticulocyte lysate translation system was purchased from

N.E.N. E. coli RNase H was from B.R.L. or Pharmacia. T4

polynucleotide kinase and SP6 RNA polymerase were from Biolabs.

10420


rA.:, poly(dT), poly(dC) and m7(G)- ppp-5" (G) were from Phar-

macia. L-F[5S]-methionine (600 Ci/mmol) and 4-([32P]-ATP (3000

Ci/mmol) were purchased from Amersham.

Oligodeoxyribonucleotide synthesisa-oligonucleotides (see fig. 1) were synthesized on an

Applied Biosystems 381A solid phase synthesizer using the

methylphosphoramidite approach (16), taking account of the

parallel orientation of the a-oligonucleotides/RNA duplexes.

In oligonucleotide presented in panel A, two G were added at

the 5' and 3' ends of the T strech to ensure a complete

matching of base pairing in the hybrid.

N-protected a-deoxy-2'-ribonucleosides (15) were selecti-

vely 5'-dimethoxytritylated and subsequently converted into the

corresponding 3'-O-methyl-N,N-diisopropylaminophosphoramidites

using a standard procedure (22).

The o-dG derivatized support was prepared by converting

5'-O-dimethoxytrityl-2-N-palmitoyl-X-2'-deoxyguanosine into its

3'-pentachlorophenylsuccinate (23) and then reacting the active

ester with the amino group of the long chain alkylamine on

controlled pore glass beads (LCAA-CPG) (24).

The amount of nucleoside loaded onto the resin was 27

pmoles per gram from the calculation of the released dime-

thoxytrityl cation by 0.1 M toluensulfonic acid in acetoni-

trile. In a similar way, the (rA) derivatized support (26

pmol/g) was prepared from 5'-O-dimethoxytrityl-di-6-N,2'(3')-O-

benzoyladenosine (25). a-oligonucleotide assembling was achie-

ved using a slightly modified methylphosphoramidite ABI cycle.

Due to the low solubility of o-dG phosphoramidite derivative in

acetonitrile, 0.05 M solution was used and high yield coupling

reactions were achieved through duplication of the coupling

step. The time required for the cycle was 13 minutes (15 min.

for G) and the average coupling yield per cycle was 99%.

Unblocking and release of the I-oligonucleotides from the

support were achieved through a standard procedure (26).

The B-oligonucleotides (see fig. 1) were synthesized on

the same ABI 381 A, using the standard methylphosphoramiditemethod (1 pmol scale).

Purity and length of the desired o- or B-oligonucleotides

10421


were checked by acrylamide gei electrophoresis under denatura-

ting conditions (27). Electrophoretic mobilities of X and B-

oligonucleotides did not present significative difference.

Preparation of Vesicular Stomatitis VirusAVSV)_mRNAsConfluent mouse L929 cells growing on 14 cm diameter

tissue culture Petri dishes in minimum essential medium

(Eurobio. Paris) supplemented with 10% (v/v) fetal calf serum

were infected with VSV at a multiplicity of infection of 5. in

the presence of 5 pg/ml actinomycin D. 5 hours after infec-

tion, the cells were washed twice with ice cold PBS and

scrapped with a rubber policeman. After centrifugation. the

cells were lysed and RNA were extracted as described in (28).

Poly(A)4 mRNAs were fractionated on oligo(dT) cellulose column

and precipitated twice with ethanol.

Preparation of capped 26 kD protein mRNA

The pSP64 T-26K plasmid was obtained from Dr. J. Content

(Institut Pasteur. Bruxelles. Belgium) (29). It was digested

with Sal I restriction endonuclease. One jg of linearized DNA

was transcribed with SP6 RNA polymerase as described in (29).

In experiments performed with radiolabeled mRNA, 20 pCi of

[;<-:P] UTP were added in the transcription medium.

5.135'P) labelingThe phosphorylation of rA1, was performed on 0.76 nmole in

10 p1 RNase H buffer (20 mM Tris.HCl, pH 7.5. 10 mM MgCl>, 100

mM KCl, 0.1 mM DTT) supplemented with 1 pl of T4 polynucleotide

kinase solution and 5 pl of 8-[(5P)-ATP in 30 pl final volume.

Incubation was performed for 1 hour at 37'C.

Protein was extracted 3 times with RNase H buffer saturated

chloroform-isoamylalcool mixture (24:1, v:v) and 3 times with

RNase H buffer saturated ether.

5'-F"2P) labeling of o- or 13-oligonucleotides with b-V3P]

ATP was performed as described in (30). Labeling of U-oligonu-

cleotides gives slightly lower yields (around 25% reduction)

than the labeling of B-oligonucleotides.

Prehybridization

This was performed in RNase H buffer between eitherlabeled or unlabeled rA12 (20 pmoles) and complementary 0- or

B-d(G>T1;.G=) strand (20, 50. or 120 pmoles). We have also used

10422


B-poly(dT) and B-poly(dC) (1 pl of a 50 A27.- U./ml solution).

The mixture was heated 10 min. at 65*C and then brought to room

temperature for about 3 hours to achieve good base pairing.

RNase H digest

1 unit of RNase H was added either to prehybridized

mixture or to rA,-., only in 5 pl final volume and incubated for

4 hours at 20°C. Hydrolysis was measured on 20% (w/v)

acrylamide. 7M urea gel (27) and autoradiography was performed.

In vitro translation

100 ng of "26 Kd protein" mRNA in sterile water were mixed

with the desired oligonucleotide and added to the translation

mixture. The samples were incubated for 60 min. at 37 C. 20

pl of the reticulocyte assay contained 10 pl of lysate, 5.5 pl

of commercial cocktail (composition not known), 80 mM

K.Acetate. 20 mM Mg.Acetate and 5 pCi of L- [(`S] -methionine.

In the experiments performed in the presence of RNase H, enzyme

concentration was 20 units/ml.

At the end of the incubation time, 7 pl of reticulocyte

translation assay were diluted with the same volume of sample

buffer (0.3 M Tris.HCl, pH 8.9, 5% (w/v) SDS, 5% (v/v) B-

mercaptoethanol, 20% (v/v) glycerol and 0.05% (w/v) bromophenol

blue). The mixture was analyzed on SDS-PAGE (31) with a 3%

stacking gel: the amount of bis-acrylamide varies as given in

the legends of the figures. Protein distribution in gels was

analyzed by fluorography (32) and autoradiography.

Thermal melting experimentations

Optical measurements were performed with an UVIKON 810

spectrophotometer using a thermostated cell. Temperature was

increased manually. Hyperchromicity at temperature T was

calculated using the formula :

H = [ A,.0(T) - A-,>(40) ] / kzos(4-) x 100

For each duplex rA1::K- or B-d(G2T1G2G), determination was

performed in RNase H buffer with equimolar concentration of

each strand.

Northern blot analysis

0.20 pg of synthetic "26 kD protein" mRNA were run on a

denaturating 1.1% (w/v) agarose gel and transfered on Hybond-N(Amersham) membrane. Prehybridization and hybridization with

10423


A riboadenylate rA12

AAAAAAAAAAAA

dc 5' GGTTTTTTTTTTTTGG 3'

3' 5'3

GGTTT TTTTTTTTT GG

B - p26K mRNA

5' 3*------UAUGAACUCCUUCUCCACAAGCG------

ffi5#

ATACTTGAGGAAGAGGTGTT 3

Oligo I3* oATACTTGAGGAAGAGGTGTT 5

C _ VSV N protein mRNA

5' 3'------CAGUAAUCAAAAUGUCUGUU------

5' 3ct GTCATTAGTTTTACAGAC Oligo II

3' GTCATTAGTTTTACAGAC5G

Figure 1 : Positions and sequences of u- and B-oligonucleotidescomplementary to rAt2, 26 kD protein mRNA or VSV N mRNA.Notice in all cases the parallel orientation of o-oligonucleo-tides and the antiparallel orientation of B-oligonucleotides.panel A : synthetic model used in hybrid stability (Si) and inRNase H sensitivity (S4) studies.panel B pSP64 T-26K plasmid. is transcribed with SP6 RNApolymerase in a major 1,000 nucleotides long mRNA (29).The synthetic oligo I (20-mer) is complementary to the regionimmediately downstream from 5' proximal initiation codon.panel C : VSV genome codes for 5 proteins.Oligo II (18-mer) is complementary to the 18 first nucleotides(including initiation codon) of N protein mRNA.

o- or B-oligonucleotide I were performed in 6X SSC, 5X

Denhard't solution, 0.5% (w/v) SDS, 100 pg/ml denaturatedsalmon sperm DNA, for 20 hours at 42 C. The probes, consistingin 5'-(F-'P) labeled oligonucleotides (see figure 1) are presentat a concentration of 5 x 10"i cpm/ml in the hybridizationbuffer.

Filters were washed in 6X SSC, 0.1% (w/v) SDS, 3 timesfor 15 min. at the hybridization temperature and once for 2

min. at 52 C.

10424


1.00

o ~~~~~~~~~~~~~~~~~~~1N~~~~~~~~~~~o 0.95 /

0

N

0.90

z -U

0.850 20 40 60 80

TEMPERATURE (C')

Figure 2 Melting curves of 1:1 mixtures of synthetic o- andB-d(G~2T1->G:) hybridized to rA12 as schematized on fig. 1,ABuffer solution : Tris.HCl 20 mM pH 7.5, MgClz 10 mM, KCl 100mM and DTT 0.1 mM * reference cell contained buffer.Sample cell contained synthetic nucleic acids in equimolarconcentrations. Temperature was raised from 8-C to 60 C for B(_ ) and from 8 C to 74'C for B (----). U) and (+)represents experimental datas and lines presented the bestmathematical fits.Tm determinations are 27.4-C for B-oligo/RNA and 52.8-C for a-oligo/RNA

When using X- or B-oligo II (fig 1) as probe to reveal VSV

N protein mRNA, we had to reduce the hybridization temperatureto room temperature. The washing temperature will be discussed

in the text. The blots were exposed to Kodak X-Omat AR films

at -70'C.

RESULTS1) Thermal stability of rA^%/0- and 8-d(GTA_zGa) hybrids

We have measured the melting temperature of the two

duplexes rA12:o-d(G-T12G0) and rA:L:13-d(G2T12G2) by a spectro-photometric method. Tm value is 27 C when the hybrid involves

B-oligonucleotide and raises to 53eC when the hybrid is formed

with an o-oligonucleotide (figure 2). A stability enhancement

of 26'C thus results from the formation of the unnatural

parallel duplex (18) between an o-oligonucleotide (whose lengthis in the range required for experiments aiming at inhibitingspecifically the expression of mRNA with antisense oligonucleo-tides) and a synthetic RNA.

10425


1 2 1 2

.~~~~~~~.

A B

Figure 3 Northern blot analysis with 5' end labeled a- or B-oligonucleotidic probes.0.25 jig of "26 kD protein" mRNA (lanes 1) or 0.625 pg of VSVmRNAs (lanes 2) were analysed on 1.1% (w/v) agarose gel indenaturating conditions transferred on nylon membrane and thenhybridized to 5'-end [-2P] labeled B-oligo I (fig l,B) (panelA) or a-oligo I (fig 1,B) (panel B) probes as described undermaterial and methods.

2) Use of a- or B-oligonucleotides as probes for Northern

blot analysis

In order to check the ability of complementary a-oligonu-

cleotides to hybridize specifically with natural mRNA target

and to compare their behaviour with B-oligonucleotides, 5'-

`12P3 labeled o- or 1-probes were prepared and used in Northern

blot experiments.

As shown in figure 3, both a- and B-oligonucleotides (20-

mer; oligo I in fig. 1) are able to recognize and hybridize

specifically with their natural target, "26 kD protein" mRNA

(lane 1 in fig. 3A and 3B).

10426


These c- or A-oligonucleotides do not cross-hybridize with

natural VSV mRNAs (lane 2 in fig. 3A and 3B), showing the

specificity of both probes.

However, in a similar experiment, hybridization of the

same blots with a-oligonucleotide complementary to the VSV N

protein mRNA (18-mer; oligo II in figure 1) gave rise to

additional unspecific signals (results not shown) while no

such spots arise with equivalent B-oligonucleotidic probe.

This unspecific hybridization was eliminated when washing

the blots in more stringent conditions (washing at 37*C,

instead of 30'C and in 3X SSC, in place of 6X SSC). At the

same stringency, B-oligonucleotides did not hybridize anymore

thus confirming the increased stability of hybrid involving C-

oligonucleotides. A more detailed analysis of this phenomenon

is currently under investigation.

Notwithstandingly, these results display the parallel

orientation of c-oligonucleotides/RNA hybrids (fig. 1 panel B).

This characteristic was supposed from previous studies on c-

DNA/DNA duplexes (17-18) but was never shown before in the case

of a-DNA/mRNA duplexes.3) Cell-free translation in the presence of complementaryc- or B-oligodeoxyribonucleotides

These and previous data (19) led us to investigate the

ability of the cX analogues to inhibit the translation of mRNA

in cell free systems.

We used the same two models previously described, i.e. a

cellular mRNA coding for a 26 kD protein and viral mRNAs

extracted from VSV-infected cells. The translation system

consisted of a rabbit reticulocyte lysate eventually complemen-

ted with RNase H since this enzyme appears to be essential in

achieving "hybrid arrest of translation" in such a system (21,

33, 34). The oligonucleotides (fig. 1, I for 26 kD proteinmRNA and II for N protein mRNA) overlap with translation

initiation sites.

Figure 4A presents the results with 26 kD protein mRNA

programmed reticulocyte lysate and CX- or B-oligonucleotide I.

The results obtained with B-oligonucleotide were consistent

with previous data (21,33,34). No significative inhibition was

10427


- asg 5 Ei

m-.2,: .1

- a_w _ ew a__

1 2 3 4 6-

Figure 4 : Translation arrest assays mediated by a- or B-oligo-nucleotides.panel A : reticulocyte lysate programmed with 100 ng of "26 kDprotein"' mRNA transcribed in vitro ; samples were analysed on15% (w/v) SDS-PAGE containing 0.34% bis-acrylamide and autora-diographied as indicated in Material and methods.Lanes 1,2 : no oligonucleotideLanes 3,4 : 12 pM i-oligonucleotide I addedLanes 5,6 : 12 pM a-oligonucleotide I addedLane 7 * Radiolabeled molecular weight standards : phosphory-lase B (97 kD), bovine serumalbumin (69 kD), ovalbumin (46kD), carbonic anhydrase (30 kD) and lactoglobulin A (18.4 kD).Panel B : reticulocyte lysate programmed with 250 ng VSV mRNAs.Samples were analysed on 10% (w/v) SDS-PAGE containing 0.13%bis-acrylamide Lanes 1,2 : no olh onucleotideLanes 3,4 : 20 pM B-oligonucleotiae II addedLanes 5,6 : 20 pM a-oligonucleotide II addedArrows indicate positions of VSV proteins : M (34 kD), N (45kD), NS (50 kD).Assays were supplemented (lanes 2,4,6) or not (lanes 1,3,5)with 20 U/ml of E. coli RNase H.

10428

11.,--J

I

'. A.t

-.-

,Nommmdft -weavome, mown-maft:


observed without RNase H even in the presence of 12 PM of

oligonucleotide. i.e. an oligonucleotide/RNA ratio of 1,000

(fig. 4A, lanes 3 and 5). A near complete inhibition was

attained when adding RNase H (fig. 4A, lane 4) even at low

oligonucleotide/RNA ratio (not shown). No inhibition was

observed when the I-oligonucleotide was used (Fig. 4A, lane 6).

We have tested in the same condition the effect of o- or

B-oligonucleotide II on the in vitro translation of VSV mRNAs

(fig. 4B).

When VSV mRNAs are translated in the absence of comple-

mentary oligonucleotide, three viral proteins (M (35 kD), N (45

kD) and NS (50 kD)) can be distinguished, as shown on fig. 4B,

lane 1. The results were as expected in terms of specificity

and RNase H dependancy (Fig 4B, lanes 3 and 4) and the C-

anomeric oligonucleotide was devoided of inhibitory effect

(Fig. 4B, lanes 5 and 6).

Taking account the increased stability of RNA/a-oligonu-

cleotide duplexes and reasonably assuming duplex formation in

cell extracts (S 1 and 2), we supposed that RNase H could not

recognize or could not cleave such duplexes. This could

explain the discrepancy between d- and B-anomer oligonucleoti-

des in translation inhibition in RNase H supplemented reticulo-

cyte lysates.

4) Activity of E. coli RNase H on RNA/a-oligonucleotide or

RNA/B-oligonucleotide duplexes

We have first studied the E. coli RNase H digestion

products of labeled 5' F"2P] rA1; hybridized with o- or B-

complementary synthetic d(G2T12G2). Figure 5 shows the autora-

diography of RNase H digestion products after 4 hours of

incubation at 20 C. The enzyme degrades labeled rA12 when

hybridized with B-poly(dT) (slot 19) or with B-d(G2TimGm)(slots 3-5). As expected, RNase H is unable to degrade singlestranded oligoribonucleotide alone (slot 1) or in the presence

of B-poly(dC) (slot 20).The concentration effect of B-d(G2T,mGm) prehybridized

with 5' [32P] rALz on the RNase H activity is shown on lanes 3

to 5; increased B-d(G2TimG2) concentration induces RNase H to

generate shorter digestion fragments with a limit in the range

10429


cc'-~~~~~~~~~~~~~~~~a

a f

It..~~~~~~~~~~~~~~.

Figure 5 RNase H degradation of 5' [32-P] labeled rA22hybridized to a- or B-d(G2TL2G2).Hybrids were digested with RNase H and degradation productswere analysed on 20% (w/v) acrylamide/urea gel and autoradio-graphied as described in Material and methodsLanes 1,2 : rA12 only.Lanes 3-10 : rA12 and B-oligonucleotide at the indicated molar

ratio ; the prehybridization step was neglected inlanes 7-10.

Lanes 11-18 : rA±2 and o-oligonucleotide at the indicated molarratio ; the prehybridization step was neglected inlanes 15-18.

Lane 19 : rA12 prehybridized to B-poly(dT).Lane 20 : rA1X prehybridized to i3-poly(dC).

2 to 5 nucleotides. This is probably due to a better

hybridization adjustement of the duplex. We observed a lowered

RNase H efficacy when the prehybridization step was omitted

(slots 7-9).In the same experimental conditions, the results are quite

different when rA12 is hybridized with C-d(G2T1.2G2) (slots 11-

14 and 15-18) : we do not observe any digestion of the RNAstrand in duplexes. The result is independent of either the a-

oligonucleotide concentration or the presence of a prehybridi-zation step.

Finally, we have analysed mRNA on acrylamide/urea gels(27) after incubation in cell free translation system (see S

10430


1 2 324tt6e72 3

70b

1$~tlt

Figure 6 Analysis of 26 kD mRNA integrity after incubation inreticulocyte lysate.100 ng radiolabeled 26 kD protein mRNA was incubated (lanes 2to 7) for 15 min. at 37*C with or without 2 jg of o- or 1-oligonucleotide I and RNase H in 10 Ml reticulocyte lysate.RNA was reisolated after phenol-chloroform extraction andfractionated on 10% (w/v) acrylamide/urea gels (27) as descri-bed in Material and methods. Gels were dried and autoradiogra-phied.Lane 1 control digestion (mRNA (100 ng) + B-oligonucleotide

(2 jg) + RNase H (20 U/ml) in RNase H buffer) in theabsence of reticulocyte lysate.

Lane 2 :mRNA aloneLane 3 :mRNA + RNase HLane 4 :mRNA + B-oligonucleotide ILane 5 :mRNA + RNase H + B-oligonucleotide ILane 6 :mRNA + a-oligonucleotide ILane 7 :mRNA + RNase H + a-oligonucleotide I

10431


3). The cleavage by RNase H of uniformly labeled 26 kD protein

mRNA hybridized to I3-oligo I releases a 70 nucleotides long

labeled fragment (Fig. 6, lane 1).

As shown on fig. 6, rabbit reticulocyte lysate has a very

low endogenous RNase H activity (lane 4) and RNase H is unable

to degrade unhybridized mRNA (lane 3). When incubating mRNA

and complementary B-oligonucleotide in reticulocyte lysate

supplemented with RNase H, the mRNA is rapidly degraded and

radiolabeled fragments (lane 5) in the expected size range (29)

are released. In the same conditions, the o-oligonucleotide

does not induce RNase H degradation of the mRNA (lanes 6-7).

Such set of data thus indicates that RNase H cannot

degrade o-DNA/RNA duplexes.

DISCUSSIONOur first goal was to study the capacity of 12 to 20-mer

a-oligonucleotides to hybridize to synthetic RNAs and to natu-

ral mRNAs, and to compare the stabilities of these duplexes to

equivalent B-oligonucleotide/RNA hybrids. Published studies

had been restricted to short o-oligonucleotide stretches hybri-

dized to complementary DNA (d-d(CCTTCC) in ref. 17 or o-

d(5"CATGCG3') in ref. 18). An extension of such studies to

longer a-oligonucleotides was considered essential to their

eventual utilization as tools for the regulation of gene

expression since : i) it can be calculated that any random

oligonucleotides in the 12- to 15-mer range is represented

statistically once in a typical eukaryotic cell mRNA population

(35), ii) DNA/RNA and DNA/DNA duplexes do not have identical

thermal stabilities (e.g. 19) and iii) stability data measured

on short homopolymer duplexes do not necessarily extrapolate to

longer hybrids containing the four bases.

An d-d(GzTL1G2)/RNA duplex exhibits a Tm of 53 C while the

corresponding 1-d(GmT12G2)/RNA duplex has a Tm of only 27 C.

This observation was further extended to longer c-oligonucleo-tides complementary to sequences located in the translation

initiation region of two natural mRNAs. X-oligonucleotides

could be labeled efficiently at their 5'-end with T4 polynu-

10432


cleotide kinase and used as radiolabeled probe in Northern blot

experiments.

As expected, hybrid formation with o- or B-oligonucleoti-des takes place in normal conditions of stringency (6X SSC,42-C for the revelation of "26 kD protein" mRNA; 6X SSC, 30 Cfor the labeling of VSV N protein mRNA). However, the higherTm of U-oligonucleotide/RNA duplex is not devoided of problems.Indeed we have observed non-specific labeling of other VSVmRNAs (NS for instance) displaying partial homology with the

target VSV mRNA (N in this case). When increasing thestringency (3X SSC, 370C), o-oligonucleotide/VSV N protein RNAremains completly stable while corresponding B-oligonucleo-tide/RNA hybrid does not subsist in these conditions. Althoughpreliminary, these results confirm the higher thermal stabilityof a-oligonucleotide/RNA duplexes hence the potential interestof o-oligonucleotides as antisense agents as well as nucleic

acids probes.

Stable hybrid formation with complementary mRNA andincreased resistance to enzymatic degradation of o-oligonucleo-tides led us to investigate their ability to inhibit transla-tion in cell-free assays. If indeed RNase H amplifies hybridarrest of translation by short oligonucleotides (21,33), three

possibilities could be envisaged : i) - and B-oligonucleotidesgive similar results, ii) o-oligonucleotides inhibit mRNAtranslation in the absence of RNase H since they have a higheraffinity for target RNA and/or they are not recognized byribosome-associated unwinding activities (38) and iii) X-

oligonucleotides are unable to inhibit translation in allsystems.

Our results confirmed the third hypothesis in that in all

conditions tested so far, X-oligonucleotides were unable to

inhibit translation in spite of their greater hybrid stabilitywhich might not be high enough to circumvent the translation-

ally associated helix-destabilizing activity present in rabbit

reticulocyte lysate (36). Whether combination of a- or B-

oligonucleotides complementary to the 5'-untranslated region of

mRNA could provide RNase H independent arrest of translation as

10433


suggested for B-oligonucleotides (37) is now under

investigation.

Further investigations led us to test the action of E.

coli RNase H on 5'-phosphate rAt./c- or B-d(G..T1>G>) hybrids.

As shown on fig. 5, RNase H hydrolyses the RNA strand

hybridized to 13-oligonucleotide whereas it does not degrade

this same strand duplexed to an U-oligonucleotide. Prehy-

bridization enhances the efficiency of the digestion and leads

to the production of shorter fragments. The decrease of

fragment size suggests that absence of prehybridization does

not produce perfect alignement of the two stretches and that,

in this case, two adenines are not hybridized at the 5'-end of

rA,.7; it has been reported that a 5' phosphate lowers the

hybrid stability (38).

Along the same line, RNase H degrades the 26 kD protein

mRNA to the expected 5'-terminal 70 nucleotides fragment when

the assay is supplemented with the complementary B-oligonucleo-

tide but not when the corresponding U-oligonucleotide is added.

Both sets of data strongly suggest that RNase H does not use d-

DNA/RNA duplexes as a substrate, whatever the precise mechanism

for this absence of activity could be. These results confirm

the key role played by RNase H in hybrid arrest of translation

(21, 33). Whether a similar mechanism operates in intact cells

and accounts for the reported biological activities of B-

antisense oligonucleotides in various systems is essentially

unknown. c-oligonucleotides introduced in the proper way in

intact cells could provide an answer to this question. If not

active in intact cells, their modification through conjugation

with free radicals generating moiety (11, 39) could provide an

alternative tool for targeting and cleaving specific sequences

of polynucleotides.

ACKNOWLEDGEMENTSWe thank Dr. Jean Content for his generous gift of plasmid

pSP64 T-26K. This research was supported by grants from

INSERM, CNRS, ARC and Institut Gustave Roussy.

*To whom correspondence should be addressed

10434


REFERENCES1. Green, J., Pines, O., and Inouye, M., (1986) Ann. Rev.

Biochem., S, 569-597.2. Mizuno T Chou, M., and Inouye, M., (1984) Proc. Natl.

Acad. §ci. USA, .81, 1966-1970.3. Kim, S .K. and WETd B J. , (1985), Cell, 4j, 129-138.4. Melton, bL.A., (1986), Proc. Natl. Acad. 5ai. USA, la, 144-

1485. Weintraub, H., Izant, I.G., and Harland, R.M., (1985),

Trends in Genetics, 1, 22-25.6. Lemaltre, M., Bayard, B., and Lebleu, B., (1987), Proc.

Natl. Acad. Sci. USA,M4 648-652.7. Zamecnik, P.C., Good4Tild, J., Taguchi, Y., and Sarin,

P.S., (1986), Proc. Natl. Acad. Sci. USA, 83, 4143-4146.

8. Smith, C.C., Aurelian, L., Reddy, M.P., Miller, P.S., andTs'o, P.O.P., (1986), Proc. Natl. Acad. Sci. USA, 83, 2787-2791.

9. Agris, C.H., Blake, K.R., Miller, P.S., Reddy, M.P. andTs'o, P.O.P., (1986), Biochemistry, 2S56268-6275.10. Toulmd, J.J., Kirch, H.M., Loreau, N. ci-uong, N.T., andHelene C., (1986), Proc. Natl. Acad. ci. USA, 83, 1227-1231

11. Le Doan, T., Perrouault, L., Chassignol, M., Thuong, N.T.,and Helene, C., (1986), Biochemistry, 25. 6736-6739.

12. Coleman, J., Hirashima, A., Inokuchi, Y7, Green, P.J., andInouye, M., (1985), Nature, 315, 601-603.

13. Hirashima, A., Sawaki, S. , Tniokuchi, Y., and Inouye, M.,(1986), Proc. Natl. Acad. Sci. USA, 8$, 7723-7727.

14. Wickstrom, E., (1986), J. Biochem.7Hiophys. Methods, 13,97-102.

15. Morvan, F., Rayner, B., Imbach, J.L., Thenet, S., Bertrand,J.R., Paoletti, J., Malvy, C., and Paoletti, C., (1987),Nucl. Acids Res., 15 3421-3437.

16. Morvan, F., Rayner7TB., Imbach, J.L., unpublished results17. Morvan, F., Rayner, B., Imbach, J.L., Chang, D.K., and

Lown, J.W., (1986), Nucl. Acids Res., 1A, 5019-5035.18. Morvan, F., Rayner, B. Imbach, J.L., Lee, M., Hartley,

J.A. Chang, D.K., and town, J.W., (1987), Nucl. AcidsRes., 1S, 7027-7044.

19. Thuong, N.T., Asseline, U., Roig, V., Takasugi, M., andHelene, C., (1987), Proc. Natl. Acad. Sci. USA, 14, 5129-5132.

20. Billiau, A., (1987), Antiviral Res., 8 55-70.21. Cazenave, C., Loreau, N., Thuong, NTT., Toulmd, J.J., and

Helene, C., (1987), Nucl. Acids Res., 15 4715-4736.22. McBride L.J., and Caruthers, M.H.7-Ti983), Tetrahedron

lett., j4 245-248.23. Myoshi r-.K .,. Miyake, T., Hozumi, T., and Itakura, K.,

(1980), Nucl. Acids Res., 3, 5473-5486.24. Adams, P., Kayka K.S., Wi es, E.J., Holder, S.B., and

Gallupi, G.R., (1963), J. Amer. Chem. Soc., 105 661-663.25. Tanaka, T., Tamatsukuri, S., and Ikehara, M. T1986), Nucl.

Acids Res., 14 6265-6279.26. Matteucci, MT. and Caruthers, M.H., (1981), J. Amer.

Chem. Soc., 103, 3185-3191.27. Maniatis, T., Je-TTrey, A.. and Kleid, D.G., (1975), Proc.

Natl. Acad. Sci. USA, Za, 184-1188.28. Auffray, C., and Kougeon, F., (1980), Eur. J. Biochem.,

107, 303-314.29. F upart, P., Vandenabeele, P., Cayphas, S., Vansnick, J.,

Haegeman G. Kruys, V., Fiers, W., and Content, J.,(1987), tMBo J., £, 1219-1224.

30. Maniatis, T., Fritsch, E.F., and Sambrook, J., (1982)Molecular Cloning a laboratory manual, Cold SpringHarbor LaboratorY.

31. Laernmli, U.K. (1970), Nature, 27, 680-685.32. Bonner, W.M. and Laskey, R.A., (1974), Eur. J. Biochem.,

46, 83-88.33. Einshull, J., and Hunt, T., (1986) Nucl. Acids Res., 14,

6433-6451.34. Haeuptle, M.T., Frank, R., and Dobberstein, B., (1986),

Nucl. Acids Res., 14, 1427-1448.35. Praseuth, D., Chassignol, M., Takasugi, M., LeDoan, T.,

10435


Thuong, N.T., and H61ne, C., et al. (1987) J. Mol. Biol.,196, 939-942.

36. Lieflhaber, S.A., Cash, F.E., and Shakin. S.H., (1984), J.Biol. Chem., 259, 15597-15602.

37. Maher, L. J.T,and Dolnick, B. J., (1987), Arch. Biochem.,Biophys., 253, 214-220.

38. Petersheim,TM., and Turner, D.H., (1983), Biochemistry, 22,256-263.

39. Iverson, L.B., and Dervan, P.B.. (1987), J. Am. Chem. Soc.,109, 1241-1243.

10436

α-DNA VI: comparative study of α- and β-anomeric oligodeoxyribonucleotides in hybridization to...

Documents

Transcript of α-DNA VI: comparative study of α- and β-anomeric oligodeoxyribonucleotides in hybridization to...