PENGEMBANGAN DIAGNOSIS MOLEKULER TOKSOPLASMOSIS BERDASARKAN SEKUEN

SPESIFIK Deoxyribonucleic Acid STADIUM TAKIZOIT DAN BRADIZOIT

oleh Ida Ayu Pasti Apsari

08/276691/SKH/62

PROGRAM STUDI SAIN VETERINER FAKULTAS KEDOKTERAN HEWAN

UNIVERSITAS GADJAH MADA YOGYAKARTA

2012

ii

PENGEMBANGAN DIAGNOSIS MOLEKULER TOKSOPLASMOSIS BERDASARKAN SEKUEN

SPESIFIK Deoxyribonucleic Acid STADIUM TAKIZOIT DAN BRADIZOIT

Disertasi untuk memperoleh derajat Doktor dalam Ilmu Kedokteran Hewan pada

Universitas Gadjah Mada

Dipertahankan terhadap sanggahan Dewan Penguji Program Studi Sain Veteriner

Fakultas Kedokteran Hewan Universitas Gadjah Mada Pada tanggal : 18 Juli 2012

oleh Ida Ayu Pasti Apsari 08/276691/SKH/62

Lahir di Denpasar – Bali

84

PENGEMBANGAN DIAGNOSIS MOLEKULER TOKSOPLASMOSIS BERDASARKAN SEKUEN Deoxyribonucleic Acid SPESIFIK

STADIUM TAKIZOIT DAN BRADIZOIT

RINGKASAN

PENDAHULUAN

Latar Belakang

Toksoplasmosis merupakan penyakit zoonosis yang tersebar di seluruh dunia.

Kasus toksoplasmosis pada hewan dan manusia di Indonesia sangat tinggi. Prevalensi

toksoplasmosis pada manusia 40–85%, sedangkan pada hewan berkisar antara 5–80%

(Subekti et al., 2005). Tingginya kasus toksoplasmosis dan dampak negatif yang

berakibat kerugian ekonomi maupun penurunan produksi, maka diagnosis menjadi hal

yang sangat penting. Diagnosis melalui gejala klinis, toksoplasmosis tidak menciri

(Bastien, 2002), melalui metode immunologis masih memerlukan uji tambahan

(Remington et al., 2004), sedangkan melalui level molekuler, walau memberi hasil yang

spesifik namun, biayanya mahal dan memerlukan peralatan khusus. Metode diagnosis

yang praktis dan akurat oleh karena itu perlu dilakukan pengembangan. Penelitian ini

berupaya mengembangkan diagnosis molekuler toksoplasmosis berdasarkan sekuen

DNA spesifik stadium takizoit dan bradizoit sebagai probe molekuler dengan metode

aplikasi hibridisasi dot blot.

Tujuan Penelitian

Tujuan umum untuk mendapat DNA probe berdasar fragmen DNA spesifik

stadium takizoit dan bradizoit yang dapat memenuhi syarat sebagai probe untuk

mendeteksi toksoplasmosis.

Tujuan khusus yaitu 1. mengamplifikasi dan sekuensing fragmen spesifik DNA

takizoit dengan primer gen sag-1 dan bag-1 T. gondii, 2. menganalisis sekuen spesifik

fragmen DNA stadium takizoit dan bradizoit yang dapat digunakan sebagai kandidat

probe, 3. membuat optimalisasi probe takizoit dan bradizoit dengan metode hibridisasi

85

dot blot untuk mendeteksi komplementernya, 4. menentukan spesifisitas dan sensitivitas

probe takizoit dan bradizoit dalam metode diagnosis aplikasi dot blot untuk mendeteksi

T. gondii.

Manfaat Penelitian

Probe takizoit dan bradizoit diharapkan dapat digunakan untuk mendeteksi

infeksi akut dan infeksi kronis, sehingga secara tidak langsung dapat membantu

meningkatkan keamanan pangan dari hewan ke manusia. Probe molekuler ini juga dapat

digunakan pada proses hibridisasi lain, seperti southern blot, northen blot atau in situ

hybridization, sehingga berguna bagi pengembangan ilmu pengetahuan baik dalam

bidang biologi maupun pada bidang parasitologi.

TINJAUAN PUSTAKA

Toksoplasmosis

Toksoplasmosis disebabkan oleh protozoa Toxoplasma gondii (Tenter et al.,

2000). Toxoplasma gondii adalah parasit intraseluler obligat yang termasuk phyllum

Apicomplexa, class Sporozoea, ordo Eucoccidiida, family Sarcocystidae dan genus

Toxoplasma (Soulsby, 1982; Levine, 1995; Ajioka et al., 2001). Parasit ini dapat

menginfeksi semua vertebrata termasuk manusia dan berbagai hewan termasuk unggas

serta hewan berdarah panas lainnya (Tenter et al., 2000; Dubey and Jones, 2008).

Stadium infektif T. gondii yaitu, oosista yang hanya terdapat pada feses hospes definitif,

sedangkan stadium takizoit dan bradizoit terdapat dalam bentuk sista jaringan di hospes

perantara (Tenter et al., 2000; Dubey, 2007).

Rantai siklus hidup dari T. gondii, bisa terjadi penularan dari hospes definitif ke

hospes perantara, dari hospes perantara ke hospes definitif dan diantara hospes

perantara. Penularan terus berlanjut dalam waktu yang tidak terbatas, melalui sista

jaringan diantara hospes perantara (walaupun pada keadaan ketidak hadiran hospes

definitif) dan juga penularan dari oosista diantara hospes definitif (bahkan dalam ketidak

hadiran hospes perantara) (Tenter et al., 2000).

Adanya antibodi dalam serum untuk keperluan diagnosis toksoplasmosis,

merupakan manifestasi dari respon hospes terhadap keberadaan T. gondii di dalam

86

tubuhnya. Antibodi IgM terbentuk pada awal infeksi dan dapat dideteksi 5 hari setelah

infeksi. Antibodi ini meningkat cepat selama 2 minggu dan menghilang setelah 2–3

bulan. Antibodi IgG dibentuk kemudian yang bisa bertahan cukup lama sampai 1 tahun.

Adanya IgG merupakan tanda infeksi kronis (Cornain et al., 1990; Lubis et al., 1997).

Takizoit yang menginfeksi hospes cepat berreplikasi dan dengan cepat menyebar

ke seluruh tubuh hospes. T. gondii secara mudah melewati barier darah retina, otak dan

plasenta. Hospes yang mempunyai imunitas, menyebabkan takizoit berubah menjadi

bradizoit. Bradizoit berada di dalam sel, membentuk sista jaringan yang resisten

(Filiceti and Candolfi, 2004).

Diagnosis Toksoplasmosis

Diagnosis penyebab toksoplasmosis dapat dilakukan dengan dua cara yaitu

secara klasik dan modern. Diagnosis secara klasik, berdasar gejala klinis, tidak berlaku

untuk toksoplasmosis, karena toksoplasmosis secara klinis tidak menunjukkan gejala

yang spesifik (Bastien, 2002), diagnosis dengan uji biologis, metode ini tidak praktis

karena memerlukan waktu lama, sedangkan diagnosis metode immunologis juga tidak

efektif karena masih memerlukan uji tambahan dan sering memberi hasil negatif palsu

(Remington et al., 2004). Diagnosis secara modern, pada level molekuler, berdasar

deoxyribonucleic acid (DNA) T. gondii, seperti metode Polymerase Chain Reaction

(PCR), (Susanto et al., 2002; Priyowidodo, 2003) yang mengamplifikasi sekuen

spesifik Toxoplasma gondii memberi hasil yang sangat spesifik, namun metode ini

biayanya mahal dan memerlukan peralatan khusus. Diagnosis pada level molekuler yang

mempunyai kendala dalam hal interpretasi hasil, maka metode teknik hibridisasi dengan

DNA probe dapat dikembangkan (Samuelson et al., 1989; Garberi et al., 1994; Akin,

2001; Aidawati et al., 2007; Sarova and Saigoval, 2010).

Gena sag-1 dan bag-1 Toxoplasma gondii

Toxoplasma gondii mempunyai tiga stadium infektif yaitu takizoit, bradizoit dan

sporozoit. Secara struktur ketiganya mirip, tapi mereka beda dalam penotipe dalam

ekspresi protein spesifik. Protein 65 kDa sebagai MAG-1 dipakai sebagai penanda

ekspresi secara khusus selama bradizoit, karena protein ini berlokasi dalam sista jaringan

87

dan secara imunobloting akan terdeteksi oleh ekstrak sista (Holec et al., 2007).

Penelitian sebelumnya juga mendukung bahwa P30 dan P22 merupakan antigen spesifik

takizoit yang reaktif.

Toxoplasma gondii mempunyai gena sag-1 merupakan gena spesifik untuk

stadium takizoit, sedangkan bag-1 merupakan gena spesifik untuk stadium bradizoit

(Weiss and Kim, 2000; Ajioka et al., 2001; Hartati et al., 2003; Cristina et al., 2004;

Kazemi et al., 2007a dan Kazemi et al., 2007b). Melalui metode Polymerase Chain

Reaction (PCR) gena spesifik stadium tertentu berhasil diisolasi menggunakan primer

dengan panjang 18-24 nukleotida (Susanto et al., 2002; Priyowidodo, 2003).

Landasan Teori

Sista T. gondii (terdapat di jaringan) terkandung di dalamnya sejumlah bradizoit,

dan takizoit terdapat bebas di cairan ekskresi dan sekresi (Tenter et al., 2000; Weiss and

Kim, 2000). Menurut Zhang et al.(1999), Weiss dan Kim (2000) dan Ajioka et al.

(2001) ada gena yang spesifik pada stadium takizoit dan gena spesifik pada stadium

bradizoit. Gena sag-1 merupakan gena spesifik untuk stadium takizoit, sedangkan bag-1

merupakan gena spesifik untuk stadium bradizoit (Weiss and Kim, 2000; Ajioka et al.,

2001; Hartati et al., 2003; Cristina et al., 2004; Kazemi et al., 2007a; Kazemi et al.,

2007b). Sampai saat ini, eksplorasi kedua gena tersebut untuk tujuan diagnosis belum

banyak dilakukan. Menggunakan metode Polymerase Chain Reaction (PCR) gena

spesifik stadium tertentu berhasil diisolasi menggunakan primer dengan panjang 18-24

nukleotida (Susanto et al., 2002; Priyowidodo, 2003).

Deoxyribonucleic acid dapat digunakan sebagai probe molekuler untuk diagnosis

penyakit, disamping DNA mempunyai sifat yang komplementer dan adanya sifat

sekuen yang conserve (konstan) dan variabel. Sekuen yang baik untuk calon probe

adalah sekuen yang conserve (Keller and Manak, 1989; Weiss, 1995). Panjang pendek

sekuen dan jumlah copy gene sebagai calon probe juga mempengaruhi kualitas probe.

Sekuen dengan panjang 100 – 300 bp ideal sebagai probe (Leitch et al., 1994), dan

repetitif sekuen gen dengan jumlah 300 copy berhasil digunakan sebagai probe untuk

mendiagnosis toksoplasmosis (Reischl et al., 2003; Sumartono, 2009; Pratama, 2009).

Probe yang diperoleh dari gena yang mempunyai jumlah copy gene yang tinggi,

88

hibridisasi lebih cepat daripada yang lebih rendah. Isolasi dan analisis gena sag-1

(Ajioka et al., 2001) dan bag-1 (Bohne et al., 1995) mempunyai single copy, sebagai

calon probe molekuler diharapkan dapat mendeteksi T. gondii.

Hipotesis

1. Primer spesifik gena sag1 dan bag-1 dapat dipergunakan untuk mengamplifikasi

fragmen DNA takizoit T. gondii isolat lokal

2. Sekuen spesifik DNA stadium takizoit dan bradizoit dapat digunakan sebagai

probe molekuler toksoplasmosis

3. Probe takizoit dan bradizoit dapat dipergunakan mendeteksi toksoplasmosis

4. Probe takizoit dan bradizoit memiliki spesifisitas dan sensitivitas yang tinggi

sehingga dapat diaplikasikan untuk mendeteksi T. gondii

METODE PENELITIAN DAN CARA ANALISIS

Deoxyribonucleic Acid (DNA) takizoit diisolasi dari Takizoit Toxoplasma gondii

isolat lokal dengan metode alkali lysis. Sekuen spesifik fragmen gena sag-1 dan bag-1

Toxoplasma gondii, berhasil diamplifikasi dengan metode polymerase chain reaction

(PCR) menggunakan primer sag-1 (forward: 5′-CACCTGTAGGAAGCTG

TAGTCACTG –3′ reverse: 5′- TCACTGTGACCATACAACTCTGTG - 3′) dan bag-1

(forward: 5′-AGGAGAGAAGACCTCGAAAGAAG-3′reverse: 5′-TGAACGCTAGGT

TTCTGGATACG-3′) dan PCR reaction mix (Invitrogen). Produk PCR disekuensing

dengan Automatic DNA sequencer Applied Biosystem 3130/3130x Genetic Analyser di

Eijkman Institute, Jakarta. Spesifisitas sekuen stadium takizoit (sag-1) dan bradizoit

(bag-1) dianalisis menggunakan program BLAST, dengan: genom T. gondii yang ada

pada GenBank, genom hospes (sapi, kambing, domba, babi, unggas dan manusia),

parasit yang mempunyai hubungan kekerabatan dekat dengan T.gondii (Sarcocystis,

Hammondia hammondi, Neospora, Isospora, Eimeria). Analisis juga dilakukan diantara

kedua sekuen, untuk memastikan tidak terjadi reaksi silang. Kajian sekuen sebagai probe

molekuler untuk metode hibridisasi dengan aplikasi dot blot, terlebih dahulu dilakukan

pelabelan menggunakan Dig high prime DNA labeling and detection starter kit (Roche).

89

HASIL PENELITIAN

Sekuen sag-1 T. gondii isolat lokal hasil sekuensing 612 sekuen dan sekuen bag-

1 T. gondii isolat lokal hasil sekuensing 470 sekuen sangat conserve dengan beberapa

strain yang ada di GenBank. Analisis bagian sekuen yang conserve dari sekuen sag-1

dan bag-1 T. gondii isolat lokal diperoleh sekuen sebagai kandidat probe. Kandidat

probe yang dipilih memiliki spesifisitas terhadap T. gondii (tidak bereaksi silang dengan

hospes dan parasit lain, serta memiliki tingkat homologi yang tinggi dengan berbagai

strain T. gondii). Hasil analisis probe sag1 dan bag1 dengan program BLAST terhadap

hewan yang berperan sebagai hospes T. gondii tidak ada sekuen yang dikenal oleh

hospes, demikian pula pada parasit lain seperti Tyzzeria anseris, Histomonas

meleagridis, Trichomonas gallinae, Hexamita sp dan Sarcocystis yang kemungkinan

bisa menyerang ayam tidak ada index similarity yang signifikan. Probe terpilih lebih

difokuskan untuk diagnosis ayam.

Probe sag1 panjang 136 nt mengandung 52,2% GC, dengan sekuen

CAGCGCCACAGAGCCTCCCACTCTTGCGTACTCACCCAACAGGCAAATCTGC

CCAGCGGGTACTACAAGTAGCTGTACATCAAAGGCTGTAACATTGAGCTCCT

TGATTCCTGAAGCAGAAGATAGCTGGTGGAC dan probe bag-1 panjang 98 nt

mengandung 57,6% GC, dengan sekuen GCGCGCCGGTTCCAGCTCCCGAGTA

ATTACAAGCCCGACGGAATCAGTGCGGCAATGGACAACGGCGTTCTACGTG

TCACGATCAAGGTCGAGGA. Aplikasi probe untuk mendeteksi suatu agen patogen

dalam sampel klinis, probe harus memiliki kemiripan genetik tinggi dengan agen

patogen dan kemiripan genetik yang rendah dengan genom hospes (Rueue, 1998;

Brown, 2006). Panjang probe juga mempengaruhi spesifisitasnya (Pruitt et al., 2005).

Probe sag1 6,72 pg/µl berhasil mendeteksi 0,45 ng/µl DNA, sedangkan probe bag1

5,87 pg/µl berhasil mendeteksi 0,23 ng/µl DNA ayam buras yang terinfeksi

toksoplasmosis.

90

SIMPULAN DAN SARAN

Simpulan

Deoxyribonucleic acid probe berdasar sekuen spesifik DNA stadium takizoit

(sag-1) dan bradizoit (bag-1) T. gondii dapat digunakan untuk mendeteksi

toksoplasmosis pada ayam buras dengan hibridasi dot blot. .

Saran

Disarankan menggunakan probe sag-1 dan bag-1 untuk diagnosis

toksoplasmosis pada ayam buras dengan metode hibridisasi dot blot. Penelitian

selanjutnya disarankan menggunakan probe sag-1 dan bag-1 untuk mendeteksi T. gondii

pada daging sebagai fungsi probe untuk keamanan pangan.

91

MOLECULAR DIAGNOSIS OF TOXOPLASMOSIS BASED ON DEOXYRIBONUCLEIC ACID SPECIFIC SEQUENCE

OF TACHYZOITE AND BRADYZOITE STAGE

SUMMARY

INTRODUCTION

Background

Toxoplasmosis is a zoonotic disease that spread throughout the world. Cases of

toxoplasmosis in animals and humans in Indonesia is very high. The prevalence of

toxoplasmosis in humans 40-85%, whereas in the animals ranged from 50-80% (Subekti

et al, 2005). The high cases of toxoplasmosis and negative impacts that result in

economic losses and decline in production, then the diagnosis becomes very

important. Diagnosis by clinical symptoms, toxoplasmosis does not distinguish (Bastien,

2002), by immunologically the method still requires an additional test (Remington et

al., 2004), whereas the molecular level, although giving a specific result, however, be

expensive and require special equipment. Therefore required the development the

practical and accurate methods of diagnosis. This study make serious efforts to develop

molecular diagnosis of toxoplasmosis based on specific DNA sequences tachyzoite and

bradyzoite stage as molecular probes by hybridization method of dot blot application.

Objectives of the Research

The general obyective of the research is to get a DNA probe based on specific

DNA fragments tachyzoite and bradyzoite stage that can qualify as molecular probe to

detect toxoplasmosis.

The specific objectives are 1) to amplifaying and sequensing tachyzoite specific

DNA fragment using the primer sag1 and bag1 gene Toxoplasma gondii, 2) to analyze

the specific sequences of DNA fragments tachyzoite and bradyzoite stage that can be

used as candidate probes, 3)to make optimization tachyzoite and bradyzoite probe by

hybridization method using dot blot aplication for detection of its complementary, 4) to

92

determine the spesivisity and sensitivity of the tachyzoite and bradyzoite probe in the dot

blot method of diagnostic applications to detect Toxoplasma gondii.

Benefits of Research

Tachyzoite and bradyzoite probe expected to be used to detect acute and chronic

infections, so it may indirectly help to improve food safety from animals to

humans. Molecular probes can also be used in the hybridization process, such as

Southern blotting, Northern blotting or in situ hybridization, making it useful for the

development of field science in biology and parasitology

LITERATURE REVIEW Toxoplasmosis

Toxoplasmosis is caused by the protozoan Toxoplasma gondii (Tenter et al.,

2000). Toxoplasma gondii is an obligate intracellular parasites belongs to phyllum

Apicomplexa, class Sporozoea, Eucoccidiida order, family Sarcocystidae and genus

Toxoplasma (Soulsby, 1982; Levine, 1995; Ajioka et al., 2001). These parasites can

infect all vertebrates including humans and various animals including birds and other

warm-blooded animals (Tenter et al., 2000; Dubey and Jones, 2008). Infective stage of

T. gondii, oocyst present only in the definitive host feces, while the tachyzoite , and

bradyzoite stage contained in the cyst form of intermediate host tissues (Tenter et al.,

2000; Dubey, 2007).

Life cycle chain of T. gondii, transmission can occur from the intermediate host to

definitive host, the intermediate host to definitive host and among intermediate

host. Transmission continues in indefinitely, through the tissue cyst between

intermediate host (although in the absence of definitive host) and also the transmission

of oocyst between definitive hosts (even in the absence of intermediate host) (Tenter et

al., 2000).

Presence of antibodies in the serum for diagnosis of toxoplasmosis, is a

manifestation of host response to the presence of Toxoplasma in its body. IgM

93

antibodies are formed early in infection and can be detected 5 days after infection. These

antibodies increase rapidly for 2 weeks and disappeared after 2-3 months. IgG antibodies

formed later that can survive long enough to 1 year. The presence of IgG is a sign of

chronic infection (Cornain et al., 1990; Lubis et al., 1997).

Tachyzoite infected host that fast replication and quickly spread throughout the

body. Toxoplasma easily pass through the blood retinal barrier, brain and placenta. Host

who have immunity, causing tachyzoite turned into bradyzoite form. Bradyzoite that is

in the intracellular, forming a resistant tissue cyst (Filiceti and Candolfi, 2004).

Diagnosis of Toxoplasmosis

The etiologic diagnosis of toxoplasmosis can be done by classical and modern

techniques. The classical techniques, based on clinical symptoms, do not apply to

toxoplasmosis, because toxoplasmosis is clinically not show specific symptoms

(Bastien, 2002), diagnosis with biological tests, this method is not practical because it

requires a long time, while the diagnosis of immunologically method is also not

effective because still require additional testing and often give false negative results

(Remington et al., 2004). The modern techniques, on a molecular level, based on

deoxyribonucleic acid (DNA) of T. gondii, such as the method of Polymerase Chain

Reaction (PCR), (Susanto et al. 2002; Priyowidodo, 2003) which amplifying a

Toxoplasma gondii specific sequences give very specific results, but the method is

expensive and requires special equipment. Diagnosis at the molecular level that have a

constraint in interpretation of the results, then the method of hybridization with DNA

probe techniques can be developed (Samuelson et al., 1989; Garberi et al., 1994; Akin,

2001; Aidawati et al., 2007; Sarova and Saigoval , 2010).

Sag-1 and Bag-1 Toxoplasma gondii genes

Toxoplasma gondii has a three infective stage namely, tachyzoite, bradyzoite and

sporozoites. In all of the structures are similar, but they vary in penotipe in the

expression of specific proteins. Protein 65 kDa as the MAG-1 is used as a marker

expression specifically during bradyzoite, because this protein is located in tissue cyst

94

and imunobloting cyst will be detected by a cyst extract (Holec et al., 2007). Previous

research also supports that the P30 and P22 is a specific tachyzoite reactive gene.

Toxoplasma gondii has specific gene. Sag-1 is specific gene for tachyzoite stage,

whereas Bag-1 is specific gene for bradyzoite stage (Weiss and Kim, 2000; Ajioka et

al., 2001; Hartati et al., 2003; Cristina et al. 2004; Kazemi et al., 2007a and Kazemi et

al., 2007b). Polymerase Chain Reaction (PCR) method successfully to be isolate specific

genes from certain stages using the primers specific (length of 18-24 nucleotides)

(Susanto et al., 2002; Widodo, 2003).

Basic Theory

Toxoplasma cyst (found in the tissues) contained a number of bradyzoite, and there

tachyzoite freely in excretion and secretion fluid (Tenter et al., 2000; Weiss and Kim,

2000). According to Zhang et al. (1999), Weiss and Kim (2000) and Ajioka et al. (2001)

there is a specific gene on tachyzoite stage and on bradyzoite stage. Sag-1 is specific

gene for tachyzoite stage, whereas bag-1 is specific gene for bradyzoite stage (Weiss

and Kim, 2000; Ajioka et al., 2001; Hartati et al., 2003; Cristina et al., 2004; Kazemi

et al., 2007a and Kazemi et al., 2007b). To date, exploration of both gene for the

purpose of diagnosis has not been done. Through the method of Polymerase Chain

Reaction (PCR) specific gene certain stages was isolated using the specific primers

(length 18-24 nucleotides)(Susanto et al., 2002 and Widodo, 2003).

DNA molecules can be used as molecular probes for diagnosis, because of the nature

of the sequence of conserve (constant) and variable. A good sequence for candidate

probe is conserve sequences (Keller and Manak, 1989; Weiss, 1995). The length of

sequence and the copy number of gene as a potential probe, also affects the quality of

the probe. Sequences with a length of 100-300 bp ideal as probes (Leitch et al., 1994),

and repetitive sequences of genes with copy number 300 successfully used as a probe for

diagnosing toxoplasmosis (Reischl et al., 2003; Sumartono, 2009; Pratama, 2009).

Probe from gene that have a high copy number, hybridization is faster than the lower.

Isolation and analysis of genes sag-1 (Ajioka et al., 2001) and bag-1 (Bohne et al., 1995)

95

has a single copy gene, as prospective molecular probes are expected to detect

Toxoplasma gondii.

Hypothesis 1. Using gene specific primers can be amplified sag1 and bag1 gene fragments that are

specific stages of T. gondii in 400-700bp

2.There are specific DNA sequences tachyzoite and bradyzoite stage that meets the

requirements as molecular probes

3. Probes can detect tachyzoite and bradyzoite complementary DNA.

4. Probe tachyzoite and bradyzoite has high sensitivity and specificity that can be

applied to detect toxoplasmosis.

RESEARCH METHODS AND ANALYSIS

Deoxyribonucleic acid (DNA) tachyzoite Toxoplasma gondii was isolated from local

isolates with alkaline lysis method. Specific sequences of gene fragments of sag-1 and

bag-1 T. gondii, a method successfully amplified by Polymerase Chain Reaction (PCR)

using the primers sag-1 (Forward: 5'-CACCTGTAGGAAGCTG TAGTCACTG -3

'Reverse: 5'-TCACTGTGACCATACAACTCTGTG - 3') and bag-1 (Forward: 5'-

AGGAGAGAAGACCTCGAAAGAAG-3 'Reverse: 5'-TGAACGCTAGGTTTCTGG

ATACG-3') and the PCR reaction mix (Invitrogen). PCR products were sequenced with

Automatic DNA sequencer Applied Biosystem 3130/3130x Genetic Analyser at the

Eijkman Institute, Jakarta. The specivicity tachyzoite stage sequence (sag-1) and

bradyzoite (bag-1) were analyzed using the BLAST program, for : T. gondii genome that

existed at GenBank, host genome (cow, goat, sheep, pigs, poultry and humans), a

parasite that has close kinship with T.gondii (Sarcocystis, Hammondia hammondi,

Neospora, Isospora, Eimeria). The analysis was also conducted between the two

sequences, to ensure no cross-reaction occurs. Study sequences as molecular probes for

hybridization method with dot blot applications, first performed using the Dig high

prime DNA labeling and detection starter kit (Roche).

96

RESEARCH RESULTS

Sag-1 sequence of T. gondii local isolates sequencing results of 612 sequences and

bag-1 sequence of T. gondii local isolates sequencing results were very conserve 470

sequences with several strains that exist in the GenBank. The conserve sequence

analysis of sag-1 and bag-1 T. gondii local isolates sequences, obtained locally as a

candidate probe. The selected candidate probes having specificity against T. gondii (not

cross-react with other hosts and parasites, as well as having a high degree of homology

with various strains of T. gondii). The results of the analysis probe sag-1 and bag-1 by

BLAST program for animals that act as hosts of T. gondii no sequence is known by the

host, as well as in other parasites such as Tyzzeria anseris, Histomonas meleagridis,

Trichomonas gallinae, Hexamita sp and Sarcocystis who might attack the chicken does

not no significant similarity index. Sag-1 probe length 136 nucleotide contains 52.2%

GC, with sequences CAGCGCCACAGAGCCTCCCACTCTTGCGTACTCACCCAA

CAGGCAAATCTGCCCAGCGGGTACTACAAGTAGCTGTACATCAAAGGCTGT

AACATTGAGCTCCTTGATTCCTGAAGCAGAAGATAGCTGGTGGAC and bag-1

probe length of 98 ntucleotide containing 57.6% GC, with sequences

GCGCGCCGGTTCCAGCTCCCGAGTAATTACAAGCCCGACGGAATCAGTGCG

CAATGGACAACGGCGTTCTACGTGTCACGATTCGAGGA. Application of probes

for detecting a pathogenic agent in clinical samples, the probe must have a high genetic

similarity with pathogenic agents and low genetic similarity with the host genome

(Rueue, 1998; Brown, 2006). The length of the probe also affect the specificity (Pruitt et

al., 2005). The sag1 and bag1 probe successfully detected 0.45 ng/µl and 0.23 ng/µl

DNA domestic poultry infected toxoplasmosis.

CONCLUSION AND SUGGESTIONS

Conclusion

Based on sequence specific DNA probes tachyzoite stage (sag-1) and bradyzoite

(bag-1) Toxoplasma gondii can be specific used to detect toxoplasmosis by dot blot

hybridization method

97

Suggestion

Suggested using a probe sag1 and bag1 for diagnosis of toxoplasmosis in free-range

chicken with dot blot hybridization applications.

98

DAFTAR PUSTAKA

Anonimus. 2007. Protocols and applications. Http://www.promega.com/paguide/chap9 html 3-12-2007.

Anonimus. 2008. 260/280 and 260/230 Ratios. T042-Technical Bulletin. Nanodrop

Spectrofotometer. www.nanodrop.com. Anonimus. 2009. Glen Reseach Product for RNA and DNA.

www.glenresearch.com/reference/...html. Ahn, H.J.; Kim, S.; Kim, H.E. and Lappin, M.R. 2006a. Molecular cloning of rhoptry

protein (ROP6) secreted from Toxoplasma gondii. Korean J.Parasitol. 44(3): 251-254.

______. 2006b. Interactions between secreted GRA protein and host cell proteins across

the parasitophorous vacuolar membrane in the parasitism of Toxoplasma gondii. Korean J.Parasitol. 44(4): 303-312.

Aidawati, N; Hidayat, S.H.; Hidayat, P.; Suseno, R.; Sujiprihati, S. 2007. Response of

Various Tomato Genotypes to Begomovirus Infection and Its Improved Diagnostic. Hayati J.Bioscience. 14(3): 93-97.

Ajioka J.W.; Fitzpatrick, J.M. and Reitter, C.P. 2001. Toxoplasma gondii genomic :

shedding ligth on Pathogenesis and Chemotheraphy. Expert Review. In Mol. Med. http://www.ermm.cbcu.cam.ac.uk. Departement of Pthology. University of Cambridge. Cambridge: 2 – 19

Akin, H.M. 2001. Penggunaan Pelacak Nonradioaktif (Digoxigenin-DNA Probe) untuk

Mendeteksi Peanut Stripe Virus. J.Hama dan Penyakit Tumbuhan Tropika. 1(2): 75-79.

Ali, N.Z.; Valian, H.K.; Rezaian, M.; Khorramizadeh, M.R.; Kazemi, B.; A.Fazaeli, A.

and Darde, M. 2005. Moleculer Characterization of Toxoplasma gondii from Bird Host. Iranian J.Publ Health. 34(3): 27-30.

Alcamo, E. 2001. DNA Analysis and Diagnosis. In DNA Technology. The A we some

skill. Second edition. Academic Press, Printed USA. 155-158. Alfonso, Y.; Fraga, J.; Jimenez, N.; Fonseca, C.; Dorta-Contreras, A.J.; Cox, R.; Cao,

V.; Bandera, F.; Fomer, O.and Ginorio, D. 2009. Detection of Toxoplasma gondii in cerebrospinal fluid from AIDS pasient by nested PCR and rapid identification of type I alele at Bi gene by RLFP. Exp.Parasitol. 122(3): 203-207.

99

Amirudin; Hastuti, S. dan Artama, W.T. 1999. Deteksi Antigen Toxoplasma gondii Isolat Lokal dengan cara ELISA Sandwich menggunakan Anti bodi monoklonal. Agrosain 12(3): 187-197.

Angel, S.O; Blanco, J.C.;Maero, E.;Pzsenny, V. and Garberi, J.C. 1991. Repetitive DNA

Sequences of Toxoplasma gondii for Development of Diagnostic Probes. Mem Inst Oswldo Cruz, Rio de Janeiro. 86(4): 483-484.

Angel, S.O.; Maero, E.; Blanco, J.C.; Pzsenny, V.; Zala, C.; Gonzalez, R.; Perelmulter,

H. and Garberi, J.C. 1992. Early Diagnosis of Toxoplasmic Encephalitis in AIDS Patient by Dot Blot Hyridization Analysis. J.Clinical Microbiol. 30(12): 3286-3287

Araujo, F.G. 1994. Immunization against Toxoplasma gondii. Parasitol.Todays 10(9):

358-360. Artama, W.T. 2007. Animal Toxoplasmosis in Indonesia : Serologic and Biomolecular

Diagnostic. Prosiding Simposium Nasional Parasitologi dan Penyakit Tropis. 25-26 Agustus 2007. Bali: 1-11

Artama, W.T.; Utami, W.S. and Sarjono. 2009. Recombinant Granule Protein-1 for

biomolecular diagnosis of Toxoplasmosis in Indonesia. Proceeding of Internationl Conference on Animal Health and Human Safety. 6-8 Des.2009. Kualalumpur Malaysia: 298-306.

Artama, W.T. 2009. Biologi Molekuler Toxoplasma dan Aplikasinya pada

Penanggulangan Toxoplasmosis. Pidato Pengukuhan Jabatan Guru Besar dalam bidang Biokimia pada FKH-UGM: 1-25.

Bastien, P. 2002. Diagnosis. Molecular diagnosis of toxoplasmosis. Transactions of The

Royal Society of Trop.Med.and Hyg. 96(1): 205-215. Behnke, M.S.; Radke, J.B.; Smith, A.T.; Sullivan, W.J. and White, M.W. 2008. The

transcription of bradyzoite genes in Toxoplasma gondii is controlled by autonomous promotor elements. Molecular Biology 68(6): 1502-1518.

Bonhomme, A; Maine, G.T.; Beorchia, A.; Burlet, H.; Aubert, D.; Villena, I.; Hunt, J.;

Chovan, L.; Howard, L.; Brojanac, S.; Sheu, M.; Tyner, J.; Pluot, M. and Pinon, J.M. 1998. Quantitative immunolocalization of a P29 Protein (GRA7) a new antigen of Toxoplasma gondii. J.Histochem.and Cytochem. 46: 1411-1422.

Brown, T. 2000. Hybridization Analysis of DNA Blots. Current Protocol in Molecular

Biology.2.10.1-2.10.16. By John Willey & Sons Inc.

100

Brown, T.A. 2006. The Basic Principles of Gene Cloning and DNA Analysis. In Gene Cloning and DNA Analysis. An Introduction. Fifth Ed. Blackwell Publishing:

1 – 84 Budijanto, S.K. 1995. Antibodi IgA anti P30 sebagai petanda pada toksoplasmosis

kongenital dan akut. Majalah Kedokteran Indonesia, 45(1): 61-65. Burg, J.L.; Grover, C.M.; Poeletty, P. & Boothroyd, J.C. 1989. Direct and Sensitive

Detection of a pathogenic protozoa Toxoplasma gondii by Polymerase chain Reaction. J.Clin.Microbiol. 27: 1787 – 1792

Burgess, G. W. dan Malcolm, K. M. 1995. ELISA untuk mendeteksi antigen. Dalam

Teknologi ELISA Dalam Diagnosis dan Penelitian. Terjemahan oleh W.T.Artama. Gadjah Mada University Press. Cetakan Pertama : 252 – 257.

Carruthers, V.B.; Sherman, G.D. and Sibley, L.D. 2000. The Toxoplasma adhesive

protein MIC2 is proteolytically processed at multiple sites by two parasite derived proteases. J.Biol.Chem. 275: 14346-14353.

Cesbron-Delauw, M.F.; Tomavo, S. and Beauchamp, P. 1994. Similarities between the

primary structure of two distinct major surface protein of Toxoplasma gondii. J.Biol.Chem. 269(62): 17-22.

Chandra, G. 2001. Toxoplasma gondii : Aspek Biologi, Epidemiologi, Diagnosis dan

Penatalaksanaannya. Medika XXVII (5): 297-304. Chatterton, J.M.W. 1992. Pregnancy In: Ho-Yen DO, Joss AWL, Editor: Human

Toxoplasmosis. Oxford: Oxford University Press: 144-184. Chen, X.G.; Gong, Y.; Li, H.; Lun, Z.R.; Fung, M.C. 2001. High-level expression and

Purification of Immunogenic recombinant SAG1 (P30) of Toxoplasma gondii in Escherichia coli. Protein Expression and Purification 23: 33-37.

Cheng, S; Fockler, C; Barnes, WM; Higuchi, R. 1994. Effective amplification of long

target from cloned insert and human genomic DNA. Proceeding of the National Academy of Sciences. 91 (12): 5695-5699.

Chevalier, J.; Yi, J.; Michel, O. and Tang, X.M. 1997. Biotin and Digoxigenin as Labels

for Ligth and Electron microscopy in situ hybridization probe : Where Do We Stand ?. J.Histochem.and Cytochem. 45: 481-492.

Chiabchalard, R.; Wiengcharoen, J.T. and Sukthana, Y. 2005. Sensitivity and Specificity

of Polymerase Chain Reaction for Detection of Toxoplasma gondii DNA added to laboratory samples. Southest Asian J.Trop.Med.Public Health. 36(2): 408-411

101

Cornain, S.; Suryana, E.J.; Sugiharto; Jacoeb, T.Z.; Rahman, I.A.; Lubis, N.S. dan Gusmiarti, N. 1991. Aspek immunolog dan pendekatan immunoterapi pada infeksi Toxoplasma. Majalah Kedokteran Indonesia. 41(7): 395-401.

Conraths, F.J. and Schares, G. 2006. Validation of Molecular diagnostic techniques in

parasitological laboratory. Vet.Parasitol. 136: 91-98. Clark, W.and Christopher, K. 2001. An Introduction to DNA: Spectrophotometry,

Degradation and Frankengel experiment. University of Alberto. Cristina, M.D.; Porto, P.D.; Buffolano, W.; Beghetto, E.; Spadoni, A.; Gaglietta, S.;

Piccolella, E.; Felici, F. and Gargano, N. 2000. The Toxoplasma gondi bradyzoite antigen BAG1 and MAG1 induce early humoral and cell-mediated immune responses upon human infection. Microbes and Infections. 6: 164-171.

Curry, E.; Pratt, S.L.; Kelley, D.E.; Lapin, D.R. and Gibbons, J.R. 2008. Use of a

combined Duplex PCR/Dot blot assay sor more sensitive genetic characterization. Biochemistry Insights: 35-39.

Damriyasa,I.M.; Bauer, C.; Edelhofer, R; Failling, K; Lind, P; Peterson, E.; Schares, G.;

Tenter, A.M.; Volmer, R. and Zahner, H. 2004. Cross Sectional study in pig breeding farm In Hesse, germany: Prevalence of antibodies to Toxoplasma gondii , Sarcocystis spp.,Neospora caninum in sows and analysis of risk factor. Vet.Parasitol. 126: 271-286.

Darcy, F and Santoro, P. 1994. Toxoplasmosis. Dalam Kierszen-baum, F (Ed). Parasitic

Infection and the immune system. Academic Press, London: 163-201. Darde, M.L. 2004. Genetic analysis of diversity in Toxoplasma gondii. Ann.Ist.Super

Sanita. 40 (1): 57-63. Daryani, A; Hosseini, A.Z.; Sharif, M.; Dalimi, A.; Dehghan, M.H. and Ziaei, H. 2006.

Protective role of antigens from pritoneal exudates of infected mice against toxoplasmosis. Iran J.Immunol. 3(2): 78-85.

Darwich, L.; Cabezon, O.; Echeverria, I.; Pabon, M.; Marco, I.; Lopez, R.M.; Alarcia-

Alejos, O.; Gatius, F.L.; Lavin, S. and Almeria, S. 2011. Presence of Toxoplasma gondii and Neospora caninum DNA in the brain of wild bird. Vet.Parasitol. 23: 21831525.

Desmonts, G. and Remington, J.S. 1980. Direct Agglutination test for Diagnosis of Toxoplasma Infection : Method for Increasing sensitivity and Specificity. J. Clinical Microbiol. 11: 562-568.

102

Drennan, J.L.; Westra, A.A.G.; Slack, S.A.; Delserone, I.M. and Collmer, A. 1993. Comparison of a DNA Hybridization Probe and ELISA for the Detection of Clavibacter michiganensis subsp. sepedonicus in Fild-Grown Potatoes. Plant Dis. 77(12): 1243-1247.

Dubey, J.P.; Desmont, G.; McDonald, C.; and Walls, K.W. 1985.Serologic evaluation of

Cattle inoculated with Toxoplasma gondii comparison of sabin-Fieldman dye test and other aglutination test. Am.J.Vet.Res. 46: 1085-1088

Dubey, J.P. 1986. : Riview of Toxoplasmosis in Pig. Vet.Parasitol: 19: 181-223. _________ 1988. Long term persistence of Toxoplasma gondii in tissue of pigs

inoculated with T.gondii ocyst and effect of freezing on viability of tissue cyst pork. Am.J.Vet.Res. 49(6): 910-913.

Dubey, J.P. and Beattle C.P. 1988. Toxoplasmosis of animal and man. Boca Raton,

FL. CRC. Press: 69-80 Dubey, J.P. 1994. Toxoplasmosis. J.Am.Vet.Med.Assoc. 205: 1593-1598. Dubey, J.P.; Thuliez, P.; Wegel, R.M.; Andrew,C.D.; Lind, P. and Powel, E.C. 1995.

Sencitivity and Specificity of various serologic test for detection of Toxoplasma gondii infection in naturally infected sows. Am.J.Vet.Res. 56: 1033-1036.

Dubey, J.P. 1996. Pathogenicity and Infectivity of Toxoplasma gondii oocyst for Rats.

J.Parasitol. 83(6): 95-956. _________ 1997. Distribution of tissue cyst in organ of rats fed Toxoplasma gondii

oocysts. J.Parasitol. 83(4): 755-757. _________ 1998. Refinement of Pepsin digestion method for isolation of Toxoplasma

gondii from infected tissue. Vet.Parasitol. 74: 75-77. Dubey, J.P.; Linsay, D.S. and Speer, A. 1998. Structure of Toxoplasma gondii

tachyzoites, bradizoites and spoozoites and biology and development of tissue cysts. Clin.Microbiol.Rev. 11(2): 267-299.

Dubey, J.P.; Graham, D.H.; Dahl, E.; Hilali, M.; El-Ghaysh, A.; Sreekumar, C.;

Kwok,O.C.H. Shen, S.K. and Lehman, T. 2003a. Isolation and Moleculer Characterization of Toxoplasma gondii from Chickens and Ducks from Egypt. Vet.Parasitol. 114: 89-95

Dubey, J.P. ; Navaro, I.T.; Graham, D.H.; Dahl, E.; Hilali, M.; Freire, L.B.; Prudencio,

L.B.; Sreekumar, C.; Viana, M.C.B. and Lehman, T. 2003b. Characterization of Toxoplasma gondii isolate from free range chickens from Parana, Brazil. Vet. Parasitol. 117: 229-234.

103

Dubey, J.P.; Venturini, M.C.; Venturini, L.; Piscopo, M.; Graham, D.H.; Dahl, E.; Sreekumar, C.; Viana, M.C. and Lehmann, T. 2003c. Isolation and Genotyping ofToxoplasma gondii from Free Ranging Chickens from Argentina. J.Parasitol. 89(5): 1063-1064.

Dubey, J.P.; Graham, D.H.; Dahl, E.; Sreekumar, C.; Lehmann, T.; Davis, M.F. and

Morishita, T.Y. 2003d. Toxoplasma gondii Isolates from Free Ranging Chickens from the United States. J.Parasitol. 89(5): 1060-1062.

Dubey, J.P.; Morales, E.S. and Lehman, T. 2004. Isolation and Genotyping of

Toxoplasma gondii from Free-Ranging Chickens from Mexico. J.Parasitol. 90(2): 411-412

Dubey, J.P.; Paula, L. and Lehmann, T. 2005. Characterization of Toxoplasma gondii Isolates in free-ranging chickens from argentina. J.Parasitol. 91(6): 1335-1339.

Dubey, J.P.; Su, C.; Oliviera, J.; Morales, J.A.; Bolanos, R.V.; Sundar, N.; Kwok,

O.C.H. and Shen, S.K. 2006. Biologic and Characterization of Toxoplasma gondii isolates in free-ranging chickens from Costa Rica, Central America. Vet. Parasitol. 139: 29-36

Dubey, J.P. 2007. The history and life cycle of Toxoplasma gondii. In : Toxoplasma

gondii the model apicomplexa. Perspectives and methods. Weiss, L.M. and Kim, K (eds). Elsevier Ltd, Amsterdam.

Dubey, J.P. and Jones, J.L. 2008. Toxoplasma gondii Infection in Human and Animals

in United State. Int.J.Parasitol. 38: 1257-1278 El-Massry, A.; Mahdy, O.A.; El-Ghaysh, A. and Dubey, J.P. 2003. Prevalence of

Toxoplasma gondii Antibodies in Sera of Turkey, Chicken and Duck from Egypt. J.Parasitol. 86(3): 627-628.

Evans, R. 1992. Life Cycle an animal infection. In Ho-Yen, DO and Joss, AWL (eds).

Human Toxoplasmosis. Oxford Univ.Press, Oxford, GB.: 26-55. Faria, E.B.; Gennari, M.S.; Pena, H.F.J.; Athayde, R.A.C.; Silva, M.L.C.R. and

Azevado, S.S. 2007. Prevalence of anti-Toxoplasma gondii and anti Neospora caninum antibodies in Goats Slaughtered in The Public Slaughterhouse of Patos city, Paraiba State, Northeast region of Brazil. Vet.Parasitol. 149: 126-129

Feyer, R; Gamble, HR; Lichtenfels, JR and Bier, JW (1992). Food borne and water

bone Parasites. In Compendium of Methods for microbiological examination of food (ed Speck, ML). Washington DC. USA Am.Pub.Health Ass.: 789-809

Frenkel, J.K. 1990. Transmision of Toxoplasmosis and The Role of Immunity in Limiting Transmission and Illness. J.Am.Vet.Med.Assoc. 196: 233-240.

104

Filliseti, D. and Candolfi, E. 2004. Immune response to Toxoplasma gondii. Ann.Ist. Super Sania. 40(1): 71-80.

Fusco, G.; Rinaldi, L; Guarino, A; Proroga, Y.T.R.; Pesce, A; Giuseppina, D.M. and

Cringoli, G. 2007. Toxoplasma gondii in sheep from the Champania region (Italy). Vet.Parasitol. 149: 271-274

Furuya, H; Yamada, T; Ikezoe, K; Ohyagi, Y; Fukumaki, Y; Fujii, N. 2006. An

improved method for Southern DNA and Northern RNA blotting using a Mupid-2 Mini-Gel electrophoresis unit. J.Biochem.Biophys.Methods. 68(2): 139-143

Garberi, J.C.; Angel, S.O.; Paulin, P.; Pszenny, V. And Romano, L. 1994. Use of a

monoclonal antibody and a DNA probe for diagnosing acute toxoplasmosis in ambiguous cases. J.Clin.Pathol. 47: 853-854

Ge, N.L.; Kocan, M.; Murphy, G.L. and Blouin, E.F. 1995. Detection of Anaplasma

marginale DNA in Bovine erythrocyte by slot-blot and In Situ hybridization with a PCR-mediated digoxigenin-labeled DNA Probe. J.Vet.Diagn.Invest. 7: 465-472.

Goel, R.; Kumar, P.; Sinha, R.and Ambwani, S. 2004. Dot blot assay using reverse-

probe genomic hybridization of repetitive DNA for environmental monitering of flourescent Pseudomonads. Indian J.Biotech. 3: 82-85.

Goodwin, MA; Dubey, JP and Hatkin, J. 1994. Toxoplasma gondi peripheral neuritis in

chickens. J.Vet.Diagn.Invest. 6: 682-385. Hanafiah, M.; Nurcahyo, W.; Kamarudin, M. dan Karmil, F. 2009. Produksi dan Isolasi

Protein Membran Stadium Bradizoit Toxoplasma gondii : Suatu usaha untuk mendapatkan material diagnostik dalam mendiagnosa toksoplasmosis. Jur.Vet. 10(3): 156-164.

Hartati, S; Widada, S.J.; Sumartono dan Kusumawati, A. 2003. Cloning of gene

encoding SAG1 of lokal isolate Toxoplasma gondii in Escherichia coli DH5α. J. Sain Vet. XX(2): 51-56.

Hartati, S.; Kusumawati, A.; Wuryastuti, H.and Widada, J.S. 2006. Primary structure of

mature SAG1 gene of an Indonesian Toxoplasma gondii and comparison with other strains. J.Vet.Sci. 7(3): 263-270.

Hartono, T. (1990). Identifikasi kista Toxoplasma gondii pada kambing/domba di RPH

Surabaya dan Malang. Cermin Dunia Kedokteran 61: 31-33.

105

Hayde, M. and Polack, A. 2000. A Clinical picture neonatal sign and symptoms. In: Ambroise Thomas P; Peterson E editor. Congenital Toxoplasmosis: scientific background, Clinical Management and Control. Paris. Springer verlag. France: 153-164.

Held, P. 2001. The Importance of the 240 nm Absorbance Measurement. Biotek

Instruments, Inc. Winooski, VT, USA. www.Biotek.com.: 1-3 Hendrix, C.M. 1998. Diagnostic Veterinary Parasitology. 2ndEd. Masby: 7-8.

Hermawan, P. 1988. Survey Serologis terhadap Toksoplamosis pada Ayam Buras di

Kabupaten Lamongan dengan Uji Haemaglutinasi tak Langsung. Skripsi. FKH-UNAIR. Surabaya: 1-53.

Herzer, S and Englert, D.F. 2001. Nucleic Acid Hybridization. Molecular Biology

Problem Solver: A Laboratory Guide. Willey-Liss, Inc. Hitt, J.A. and Filice, G.A. 1992. Detection of Toxoplasma gondii parasitemia by gene

amplification, cell culture and mouse inoculation. J.Clin.Microbiol. 30(12): 3181-3184.

Hohlfield, P.; Daffos, F.; Costa, J.M.; Thulliez, P.; Forestier, F. and Vidaud, M. 1994.

Prenatal diagnosis of congenital Toxoplasmosis with Polymerase Chain Reaction test on amniotic fluid. The New England J.Med. 331 (11): 695-699.

Holec, L.; Hiszczynska-Sawicka, E.; Gasior, A.; Brillowski-Dabrowski, A. and Kur, J.

2007. Clinical and Vaccine. Immunol.14(3): 220-225. Holliman, R.E. 2003. Toxoplasmosis. In: A manson,s tropical diseases. 21th ed. Cook,

G.C. and Zumia(eds). Saunders Elsevier Science, London: 211-240 Ho-Yen, D.O.; Joss, A.W.; Balfour, A.H.; Smyth, E.T.; Baird, D. and Chatterton, J.M.

1992. Use of the polymerase chain reaction to detect Toxoplasma gondii in human blood samples. J.Clin.Path. 45: 910-913.

Howe, D..K and Sibley, L.D. 1995. Toxoplasma gondii comprises three clonal lineages

corelation of parasites genotype with human diseases. J.Infect.Dis.172: 1561-1566.

Howe, D.K.; Mercier, C.; Messina, M. and Sibley, L.D. 1997. Expression of

Toxoplasma gondii in the closely related apicomplexan parasites Neospora caninum. Moleculer and Biochem.Parasitol. 86: 29-36.

Ibrahim, A.K.; Abeer, A.; Abdelall and Amin, A.S. 2012. Long-Term Diagnostic

Studies for Detection of Brucella spp. in Milk Samples. Global Veterinaria. 8(1): 54-61

106

Indra, C. 2003. Epidemiologi Toxoplasma gondii. USU Digital Library: 1-13 Indri, S. 1999. Hibridisasi Asam Nukleat. Dalam Biologi Molekuler Kedokteran. Ed

Suhartono Taat Putra. Airlangga University Press.: 168-172. Iskandar, T. 1998. Pengisolasian Toxoplasma gondii dari Otot Diafragma Seekor Domba

yang Mengandung Titer Antibodi Tinggi dan Tanah Tinja dari Seekor Kucing. Jurnal Ilmu Ternak dan Veteriner. 3(2): 111-116.

Jackson, M.H and Hutchinson, W.M. 1989. The prevalence and source of Toxoplasma

infection in the environtment. Adv.Parasitol. 28: 55-104. Jacobs, I; Remington, JS. And Milton, MI. 1960. A Survey of meat samples from swine,

cattle and sheep for the presence of encysted Toxoplasma. J.Parasitol. 46: 23-26 Jensen, L.; Heegaard, P.M.H. and Lind, P. 1998. A study of virulence parameters for

Toxoplasma gondii infections in mice. Parasitol.Res.84: 382-387. Jin, Si ; Chang, Z.Y.; Ming, Xu; Min, C.L.; Wei, He; Sheng, L.Y. and Hong, G.X. 2005.

Fast Dipstick Dye Immunoassay for Detection of Immunoglobulin G (IgG) and IgM Antibodies of Human Toxoplasmosis. Clin.Diagn.Lab.Immunol. 12(1) : 198-201.

Jittapalapong, S.; Nimsupan, B.; Pinyopanuwat, N.; Chimnoi, W.; Kabeya, H. and

Maruyama, S. 2006. Seroprevalence of Toxoplasma gondii antibodies in stray cats and dogs in the Bankok metropolitan area. Thailand Vet.Parasitol. 10: 3833-3837.

Johnson, A.M.; Robert, H. and Tenter, A.M. 1992. Evaluation of recombinant antigen

ELISA for the diagnosis of acute toxoplasmosis and comparison with traditional Antigen ELISAs. J.Med.Microbiol. 37: 404-409.

Joiner, I.A. and Roos, D.S. 2002. Secretory traffic in the Eukaryotic parasite

Toxoplasma gondii : Less is more. J.Cell Biol. 157(4): 557-563 Jones, D.D.; Okbravi, N.; Adamson, P; Tasker, S and Ligbtman, S. 2000. Comparison of

PCR detection methods for B1, P30 and 18S rDNA genes of Toxoplasma gondii in equeous humor. Int.Opthamol.Vis.Sci. 41(3): 634-644

Jungersen, G.; Bille-Hansen, V.; Jensen, L. and Lind, P. 2001. Tranplacental

transmission of Toxoplasma gondii in minipig infected with strain of different virulence. J.Parasitol. 87(1): 108-113.

Kazemi, B.; Bandepour, M.; Maghen, L. and Solgi, G.H. 2007a. Gene Cloning of 30

kDa Toxoplasma gondii tachyzoite surface antigen (SAG1). Iranian J.Parasitol. 2(2): 1-8.

107

Kazemi, B.; Maghen, L.; Bandehpour, M.; Shahabi, S. and Haghighi, A. 2007b. Gene Cloning of 43 kDa surface protein of Toxoplasma gondii tachyzoite and bradyzoite (SAG3). Gene Ther.Mol.Biol. 11: 113-116.

Karkata, K. dan Suwardewa, T.G.A.. 2006. Infeksi TORCH pada ibu hamil di RSUP

Sanglah Denpasar. Cermin Dunia Kedokteran. 151: 5-7. Kasper,L.H. and Boothroyd, J.C. 1993. Toxoplasma gondii and Toxoplasmosis. In

Immunology and Moleculr Biology of Parasitic Infections. Ed by Kenneth S Warren. Blackwell Scientific Publications. Oxford. London Edinburgh, Melbourne Paris Berlin Vienna: 269-301

Keller, G.H. and Manak, M.M. 1989. DNA Probe. Macmillan Publisher ltd.: 1-16. Khan, A.; Taylor, S.; Su, C.; Mackey, A.J.; Boyle, J.; Cole, R.; Glover, D.; Tang, K.;

Paulsen, I.T.; Berriman, M.; Boothroyd, J.C.; Pfefferkorn, E.R. Dubey, J.P.; Ajioka, J.W.; Roos, D.S.; Wootton, J.C. and Sibley, L.D. 2005. Composite genome map and recombination parameters derived from three archetypal lineages of Toxoplasma gondii. Nucleic Acid Res. 33(9): 2980-2992.

Koskiniemi, M.; Lappaiainen, M.; Hedman, K. 1989. Toxoplasmosis needs evaluation

on : Overview and proposals. Am.J.Dis.Chid. 143: 724-728. Kresno, S.B. 1996. Imunologi. Diagnosis dan Prosedur Laboratorium. Ed ketiga.

Penerbit Fakultas Kedokteran UI-Jakarta: 1-336. Kruchen, B. and Rueger, B. 2003. The Dig System – Nonradioactive and Highly

Sensitive Detection of Nucleic Acids. Biochemica. 3: 13-15. Kusumawati, A.; Nafratilova, S. and Hartati, S. 2011. Digoxigenin(DIG) Labeled Probe

Candidate of Surface antigen1 (SAG1) for Toxoplasma gondii Detection. Ind.J. Biotech. 16(1): 17-23.

Lehman, T.; Blacksten, C.R.; Parmiey, S.F.; Remington, J.S. and Dubey, J.P. 2000.

Strain typing of Toxoplasma gondii: Comparison of antigen-coding and housekeeping genes. J.Parasitol. 8(5): 960-971.

Lehman, T.; Graham, D.H; Dahl, E.; Sreekumar, C.; Launer, F.; Corn, J.L.; Gamble,

H.R and Dubey, J.P. 2003. Transmission dynamics of Toxolasma gondii on a pig farm. Infect.Genet.Evol. 3: 135-141.

Leitch, A.R.; Schwarzacher, T.; Jackson, D and Leitch, I.J. 1994. 1sted. In situ

hybridization. A practical guide, BOS Sciencetific Publisher Limited: 4-5: 33-39 Levine, N.D. 1994. Buku Pelajaran Parasitologi Veteriner. Edisi Indonesia. Gadjah

Mada University Press.: 1-531

108

__________ 1995. Protozoologi Veteriner. Edisi Indonesia. Gadjah Mada University Press.: 1-585

Liesenfeld, O.; Montoya, J.G.; Tathinemi, N.J.; Davis, M.; Brown, Jr. B.W.; Cobb, K.L.;

Parssonet, J. and Remington, J.S. 2001. Confirmatory serologic testing for acute toxoplasmosis and rate of induced abortions among women reported to have positive Toxoplasma immunoglobulin M antibody titer. Am.J.Obstet.Gynecol. 184: 140-145.

Lodish, H.; Berk, A.; Matsudaira, P.; Kaiser, C.A.; Krieger, M.; Scott, P.M.; Zipursky,

L. and Darnell, J. 2006. Moleculer Cell Biology. 5th Ed. Media conected.: 40-408.

Lubis, N.K.; Gandahusada, S. dan Surjana, E.J. 1997. Peran antibodi IgA dan IgE pada

diagnosis toksoplasmosis. Majalah Kedokteran Indonesia, 4(11): 563-567. Luft, B.J.; Haffler, M.D. and Korzun, A.H. 1993. Toxoplasmic encephalitis in patients

with the aquaired immunodeficiency syndrome. New England J.Med. 329: 995-1000.

Luft, BJ. and Remington, JS. 1988. AIDS commentary. Toxoplasmosis encephalitis.

J.Infect.Dis. 157(1): 1-6 Lyons, R.E.; McLeod, R. and Robert, C.W. 2002. Toxoplasma gondii Tachyzite-

bradyzoite interconversion. Trends in Parasitol. 18(5): 198-201. Maganathan, P; Singh, S; Ling, LY; Singh, J; Subrayan, V and Nisapatorn, V. 2010.

Detection of Toxoplasma gondii DNA by PCR following microwave treatment of serum and whole blood. Southeast Asian J.Trop.Med.Public Health. 41(2): 265-273.

Maroef, S. 1990. Toxoplasmosis di Indonesia. Cermin Dunia Kedokteran, 61: 34- 39. Martin, J.; Kwok, O.C.H. and Dubey, J.P. 2011. Seroprevalence of Neospora caninum in

free-range chickens (Gallus domesticus) from Americas. Vet.Parasitol. 27: 21676546.

McLeod, R.; Mack, D. and Brown, C. 1991. Toxoplasma gondii-New advance in

Cellular and Moleculer Biology. Exp.Parasitol. 72: 109-121.

McPherson, M.J.; Quirke, P.; Taylor, G.R.1992. PCR. A practical Approach. IRL Press Milton, M.; McAllister, Stephen, F.; Parmiey; Weiss, L.M.; Weich, V.J. and McGuire,

A.M. 1996. An Immunohistochemical Method for detecting Bradyzoite antigen (BAG5) in Toxoplasma gondii-Infected tissue cross-reacts with a Neospora caninum bradyzoite antigen. J.Parasitol. 82(2): 354-355.

109

Montoya, J.G. and Liesenfeld, O. 2004. Toxoplasmosis. The Lancet. 363: 1965-1967. Mori, J.; Field, A.M.; Clewley, J.P. and Cohen, B.J. 1989. Dot Blot Hybridization Assay

of B19 Virus DNA i Clinical Specimens. J.Clin.Microbiol. 27(3): 459-464. Mudenda, H.B.; Willliam, U.; James, M.C.L.; Charles, M.; Nayuta, I.; Evans, M.;

Ladslav, M.; Hiroshi, I. And Emiko, I. 2011. Feasibility of using dot blot hybridization to detect Salmonella InvA, SpiC and SipC directly from clinical specimens. African J.Microbiol.Res. 5(6): 582-585.

Mufasirin 1999. Kloning dan Ekpresi cDNA yang menyandi Protein Membran Takizoit

Toxoplasma gondii Isolat Bogor. Tesis. Universitas Gadjah Mada, Yogyakara: 1-69

Mufasirin; Suprihati, E. dan Suwanti, L.T. 2003. Studi Toksoplasmosis pada Telur

Ayam yang dijual sebagai campuran jamu di kota Surabaya dan Kabupaten Sidoarjo menggunakan uji Dot Blot. J.Penelitian Medika Eksakta. 4(2): 113-119.

Muller, N.; Zimmerman, V.; Hetrich, B. and Gottstein, B. (1996).Diagnosis of Neospora

caninum and Toxoplasma gondii infection by PCR and DNA hybridization immunoassy. J.Clin.Microbiol. 34: 2850-2652.

Nardone, R.M. 1999. Overview of In Situ Hybridization. In Imunocytochemical

Methods and Protocols. Second eds. Edited by Lorette C Javois. Humana Press. Totowa, New Jersey: 357-363.

Owen, M.R.; Clarkson, M.J. and Trees, A.J. 1998a. Diagnosis of Toxoplasma abortion

in ewes by polymerase chain reaction. Vet.Record. 142: 445-448. __________ 1998b. Acute phase Toxoplasma abortion in sheep. Vet.Record. 142: 480-

482. Palmer, H.M.; Atkinson, H.J. and Perry, R.N. 1991. The Use of DNA probe to identify

Ditylenchus dipsaci. Revue Nematol. 14(4): 625-628. Patricia, M.; Craver, J. and Knoll, L.J. 2007. Increased efficiency of homologous

recombination in Toxoplasma gondii dense granule protein 3 demontrates that GRA3 is not necessary in cell culture does contribute to virulence. Mol.and Biochem.Parasitol. 153: 149-157.

Pesic, Z. and Hiruki, C. 1988. Comparison of ELISA and dot-hybridization for of Alfalfa

mosaic virus in alfalfa pollen. Can.J.Plant Pathol. 10: 116-122. Polak, M.W.P.; Wojciech, R. and Zmudzinski, J.F. 2005. Implementation of Dot Blot in

Rapid Diagnosis of BSE. Bull.Vet.Inst.Pulawy. 49: 263-266.

110

Powell, L.C.; Brewer, M. and Lappin, M.R. 2001. Detection of Toxoplasma gondii in the milk of experientally infected lactating cats. Vet.Parasitol. 102: 29-33.

Pratama, D.A.O.A. 2009. Analisis Toxoplasma gondii repeat region 529 bp (NCBI Acc

No AF146527) sebagai kandidat probe untuk diagnosis molekuler toksoplasmosis. Tesis Program Studi Bioteknologi. Pascasarjana – UGM. Yogyakarta.

Priadi, A. 2003. Prinsip Dasar Enzyme Linked Immunosorbant Assay (ELISA).

Dalam Whorkshop Pengembangan Diagnostik Fasciolosis dengan ELISA untuk Mendeteksi Cathepsin L(CatL). BPV. Bogor. 17-19 Februari 2003.

Primrose, S.B. 1995. Principles of genome analysis. A guide to mapping and sequencing DNA from different organism. Blackwell Science. Oxford.

Priyana, A. 2000. Antibodi Anti Toxoplasma pada Ayam Kampung (Gallus domestius)

di Jakarta. Majalah Kedokteran Indonesia. 50(11): 504-507. Priyowidodo. 2003. Kajian Metoda Diagnosis Toksoplasmosis secara Polymerase Chain

Reaction (PCR) dan Pemeriksaan Histologis. Tesis. Universitas Gadjah Mada, Yogyakarta.: 1-51

Pruitt, K.D., Tatusova, T., Maglott, D.R. 2005. NCBI Reference Sequence. (RefSeq): a

curated non-redundant sequence database of genomes, transcripts and proteins. Nucleic Acids Res. 33, D501-D504

Purwanto, M.; Lusida, M.I. dan Handayani, R. 1997. Polymerase chain reaction. Dalam

Biologi Molekuler Kedokteran. Editor Suhartono Taat Putra. Edisi pertama. Erlangga Universiy Press.: 150-167

Raizman, R.E. and Neva, F.A. 1975. Detection of circulating antigen in acute

experimental Infection with Toxoplasma gondii. J.Infect.Dis. 122, 44-48.

Reischl, U., S. Bretagne, D. Kruger, P. Ernault, J.M. Costa. 2003. Comparison of Two DNA Targets for the Diagnosis of Toxoplasmosis by Real-time PCR using Fluorescence Resonance Energy Transfer Hybridization Probes. BMC. Infect.Dis. 3(1): 1-9.

Remington, J.S. and Destmon, G. 1990. In Remington, JS; Kleid GO (eds). Infection

Diseases of the fetus and Newborn infant 4th.ed.Philadelphia WB. Saunders Comp.: 89-195.

Remington, J.S.; McLeod, R.; Destmont, G. 1995. In: Remington JS : Kleid JO

(eds)Infection Diseases of the fetus and Newborn infant. 2 ed . Philadelphia WB Saunder Comp.: 140-257.

111

Remington, J.S.; Tulliez, P. and Montoya, J.G. 2004. Recent development for diagnosis of toxoplasmosis. J.Microbiol. 42(3): 941-945.

Roche, P.J. 2006. Preparationof Template DNA and Labeling Techniques. From

Methods in Molecular Biology, vol 326 : In Situ Hybridization Protocols : Third Edition. Edited by : I.A.Darby and T.D.Hewitson. Humana Press Inc, Totowa, NJ.: 9 – 16

Roche, 2009. DIG High Prime DNA Labeling and Detection Starter Kit I. WWW.roche-

applied-science.com. Rueue, K., 1998. mRNA Quantitation Techniques: Considerations for Experimental

Design and Application. J.Nutrition. 128(11): 2038-2044. Salehzada, T. and Taha, M.N. 1992. Licence de Biochemie. Travaux Practique de

Biochemie. Biochemie des Proteine. Biochemie Moleculaire. Universitie Montpellier II. U.F.R-S. F.A.: 10-22.

Salis, AD. 2009. Application in Clinical Microbiology. Real time PCR: Current

Technology and Application. Caister Academic Press. ISSN 978-1-90445539-4 Sambrook, J. and Russell, D.W. 2001. The Basic Polymerase Chain Reaction. In

Molecular cloning. A Laboratory manual. Third Ed. Cold Spring Harbor Laboratory Press, NewYork. Vol 2: 8.18 – 8.24

Samuelson, J.; Soto, R.A.; Reed, S.; Biage, F. and Wirth, D. 1989. DNA Hybridization

Probe for Clinical Diagnosis of Entamoeba histolitica. J.Clin.Microbiol. 27(4): 671-676.

Sandi, E.A. and Brenes, O.V. 2005. Serological Prevalence of Toxoplasma gondii in

Free-range Chickens from Costa Rica. Trop.Ann.Health Prod. 37: 369-372. Sarjono; Nurcahyo, W dan Hanafiah, M. (2004). Studi Produksi takizoit Toxoplasma

gondii dari pembiakan in vivo pada mencit (Mus musculus).Media Kedokteran Hewan. 20(2): 53-56

Sarovar, B. and Saigopal, D.V.R. 2010. Development of Probe-base blotting technique

for the detection of Tobacco streak virus. Acta Virologica. 54: 221-234. Sarva, U. and Holliman R.E. 1989. Diagnosis of Ovine Toxoplasmosis: an alternative to

Serology. Vet.Record. 125: 212. Sibley, D.; Howe, K.; Wan, K.L.; Khan, S.; Aslett, M.A.; Ajioka, J.W. 1996.

Toxoplasma as a model genetic system. In Molecular Biology of Parasitic Protozoa. Edited by Deborah F. Smith and Marilyn Parson. IRL Press.: 55 – 74.

112

Son, E.S. and Nam, H.W. 2001. Detection and Characterization of Excretory/Secretory Protein from Toxoplasma gondii by Monoklonal Antibodies. Korean J. Parasitol. 39(1): 49-56.

Soulsby, E.J.L. 1982. Protozoa. In Helminth, Arthropods and Protozoa of domesticated

animals. 7th Ed. Bailliere Tindall London: 507-759 Sreekumar, C.; Grahan, D.H.; Dahl, E.; Hilali, M.; Freire, L.B., Prudencio, L.B.; Viana,

M.C.B. and Lehman, T.; Dubey, J.P. 2003. Genotyping of Toxoplasma gondii isolates from Chickens from India. Vet.Parasitol.118: 186-194.

Steuber, V.S.; Niu, A.; Reetz, J.; Roth, A. and Janitschke, K. 1995. Der Nachweis von

Toxoplasma gondii in abortgeweben vom schaf mittels der polymerase-ketterreaktion. Dsch.Tierarztl.wschr. 102: 91-93.

Subekti, D.T.; Artama, W.T. dan Iskandar, T. 2005. Perkembangan kasus dan Teknologi

diagnosis Toksoplasmosis. Lokakarya Nasional Penyakit Zoonosis. Bogor Sudjadi. 2008. Bioteknologi Kesehatan. Cetakan pertama. Penerbit Kanisius: 21-279 Sumartono; Nurcahyo, W. dan PriyoWidodo, D. 2005. Pengembangan Probe Molekuler

untuk Optimalisasi diagnosis Koksidiosis. J.Sain Vet. 23(2): 60-66. Sumartono; Artama, W.T., Asmara, W. dan Tabbu, C.R. 2007. Analisis kandidat probe

molekuler untuk diagnosis toksoplasmosis berdasarkan fragmen sekuen repetitif genom takizoit. Media Kedokteran Hewan 23(1): 7-12.

Suratma, A. 2008. Sensitifitas dan Spesifisitas uji ELISA menggunakan antigen Protein

30 kDa untuk mendeteksi kista Toxoplasma gondii dalam jaringan Babi. Disertasi-Program Pascasarjana-UNUD.

Suryadi (2006). Bahan Genetik. Dalam Genetika Kedokteran. Fakultas Kedokteran.

UGM: 7-20. Susanto, L.; Supali, T. dan Gandahusada, S. 2002. Penentuan konsentrasi minimal Gen

B1 dan Gen P30 Toxoplasma gondii yang masih terdeteksi dengan reaksi Rantai Polimerase. Makara Kesehatan 6(2): 64-70.

Susanto, L.; Gandahusada, S. dan Muljono, R. 1999. Invasi Toxolasma gondii ke dalam

sel hospes serta deferensiasinya dari takizoit ke bradizoit. Majalah Kedokteran Indonesia. 49 (6): 208-211.

Suwanti, LT.; Suprihati, E.; Mufasirin. (2006). Prevalensi Toxoplasmosis pada Ayam di

beberapa Pasar di kota Surabaya. Media Kedokteran Hewan. 22(1): 32-35.

113

Taylor, G.R. 1991. Polymerase Chain Reaction. Basic principles and automation. In PCR a practical approach. Ed by M.J.Mepherson, P.Quirhe and GR.Taylor. Oxford University Press.: 1-13

Tenter, A.M.; Vietmeyer, C. and Johnson, A.M. 1992. Development of ELISAs based

on Recombinant antigen for the detection of Toxoplasma gondii-spesific in sheep and Cats . Vet.Parasitol. 43: 187-194

Tenter, A.M.; Seineke, P.; Simon, K. ; Heckerozh, A.R.; Damriyasa, I.M.; Bauer, C. and

Zahner, H. 1999. Aktuelle Studien zur Epidemiologie von Toxoplasma infectionen. Proc.German Vet.Med.Soc.1999: 247-264.

Tenter, A.M.; Heckeroth, A.R.; Weiss, L.M. 2000. Toxoplasma gondii : From Animals

to humans. Int.J.Parasitol. 30: 1217-1258. Tomavo, S.; Fortier, B; Soete, M.; Ansel, C.; Camus, D. and Dubremetz, J.F. 1991.

Characterization of bradyzoite-specific antigens of Toxoplasma gondii. Infect. and Immunity. 59(10): 3750-3753.

Tomavo. 1996. The Major Surface Protein of Toxoplasma gondii : Structures and

Functions. Toxoplasma gondii Gross, U (eds). Springer-Verlag. Berlin. Waree, P.; Ferguson, D.J.P.; Pongponratn, E.; Chaisri, U. and Sukthana, Y. 2007.

Immunohistochemical study of acute and chronic Toxoplasmosis in experimentally infected mice. Shouthest Asian J.Trop.Med.Helth. 38(2): 223-231.

Weiss, L.M; Ma, Y.F; Takvorian, P.M; Tanowitz, H.B and Wittner, M. 1998. Bradyzoite

Development in Toxoplasma gondii and the hsp 70 Stress Response. Infect. Imun. 66(2): 3295-3302.

Weiss, L.M. and Kim, K. 2000. The development and Biology of Bradizoite of

Toxoplasma gondii. Frontiers in Bioscience 6: 391-405. Weiss, J. 1995. DNA Probe and PCR for Diagnosis of Parasitic Infectious. Clin.

Microbiol. 8(1): 113-130 Winarto. 2008. Peran Protein Rekombinan ROPTRI dalam Pengembangan Diagnostik

secara Molekuler pada Infeksi Aktif Toxoplasma gondii. Disertasi. Universitas Diponogoro, Semarang: 1-227

Wu, K; Chen, X.G; Li, H.; Yan, H.; Yang, P.L.; Lun, Z.R; Zhu, X.Q. 2009. Diagnosis of

Human toxoplasmosis by using the recombinant truncated surface antigen 1 of Toxoplasma gondii. Diag. Microbiol.and Infect.Dis. 64(3): 261-266

114

Yang, H.; Wanner, I.B.; Roper, S.D. and Chaudhari, N. 1999. An Optimized Method for In Situ Hybridization with signal amplification hat allows the detection of Rare mRNAs. J.Histochem.and Cytochem. 47: 431-446.

Yasodara, P.; Ramalakshmi, B.A.; Sarma, M.K.J. 2001. A New Approach to

Defferentiate Recent VS Chronic Toxoplasma Infection : Avidity ELISA in Toxoplasma serology. Indian J.Med.Microbiol. 19(3): 145-148

Yuwono, T. 2006. Teori dan Aplikasi Polymerase Chain Reaction. Edisi pertama.

Penerbit Andi Yogyakarta: 1-237 Yuwono, T. 2008. Biologi Molekuler. Edisi pertama. Penerbit Erlangga: 1-258 Zhang, Y.W.; Kim, K.; Ma, Y.F.; Wittner, M; Tanowitz, H.B. and Weiss, L.M. 1999.

Disruption of Toxoplasma gondii bradyzoite-specific gene bag-1 decreases in vivo cyst formation. Mol.Microbiol. 31(2): 691-701.