02 Kuliah Fisio (Dr. Yuliana 240315)
-
Upload
reza-satria-halim -
Category
Documents
-
view
223 -
download
4
description
Transcript of 02 Kuliah Fisio (Dr. Yuliana 240315)
-
PERUBAHAN FISIOLOGIS
PADA PROSES MENUA
Yuliana HS, dr.MSc
Departemen Fisiologi FK UNS
-
KONSEP MENUA FISIOLOGIS
Dasar dari proses menua adalah kegagalan fungsi homeostatik penyesuaian diri terhadap faktor intrinsik dan ekstrinsik (Comfort A, 1964).
Menua adalah proses yang mengubah seorang dewasa sehat menjadi seorang yang rapuh dengan berkurangnya sebagian besar cadangan sistem fisiologis dan meningkatnya kerentanan terhadap berbagai penyakit seiring dengan bertambahnya usia (Comfort A, 1964).
Perubahan fisiologis berpengaruh terhadap penampilan fisik, sekaligus terhadap fungsi dan tanggapan pada kehidupan sehari-hari dan perubahan tersebut bervariasi antar individu.
Proses menua bukan hanya terjadi pada orang berusia lanjut, melainkan suatu proses normal yang berlangsung sejak maturitas dan berakhir dengan kematian. Namun efek penuaan umumnya menjadi lebih terlihat setelah usia 40 tahun.
-
KONSEP MENUA FISIOLOGIS
Menurunnya kapasitas fungsional baik pada tingkat molekular, selular maupun pada tingkat organ sejalan dengan proses menua.
Akibat penurunan kapasitas fungsional tersebut, usia lanjut umumnya tidak berespon secara efektif terhadap berbagai rangsangan, internal atau eksternal.
Sehingga usia lanjut sulit untuk memelihara kestabilan status fisik dan kimiawi dalam tubuh (memelihara homeostasis).
Gangguan terhadap homeostasis tersebut dapat memudahkan terjadinya disfungsi berbagai sistem organ dan turunnya toleransi terhadap obat-obatan.
-
DASAR MOLEKULER
PENUAAN SEL DAN
KEMATIAN SEL
-
The main factors acting in aging process
and the functional relationship between them
-
Mitochondriae are the main unit of chemical power supply in the cell.
Free radicals when released in large quantities cause intercellular oxidative stress (e.g. oxidative damage of DNA, proteins and other bio-molecules).
Oxidative stress is the main reason of accelerated senescence.
Free radicals can result tissue degeneration by damaging mitochondria genome and cause early apoptosis (programmed cell death) through the damage of nuclear genome.
Endogenous oxidative damage and repair systems play a big role in spontaneous mutagenesis. Mutated genes usually encode nonfunctional products, which disturb biochemical or/and signaling pathways leading to more or less expressed pathological state.
Free radicals attack proteins and modify them. It usually disturbs protein function and can accelerate the aging process.
MITOCHONDRIAL DISFUNCTION
-
Cell cycle regulation
Cell cycle is regulated by different specific proteins.
Different proteins regulate cell cycle, phase change (cancer supressors, cyclins, and MAP kinases).
When these proteins are damaged by mutations cell cycle regulation can be disturbed.
Cells could die or become not controlled depending on the nature of mutation- this could lead to cancer.
Cell cycle regulation disorders leads to accelerated aging and/or cell malignancy.
-
GERONTOGENES
Genes concerned with pathological aging.
When they are damaged organism ages much faster. These genes are named gerontogenes - aging genes.
Genetic polymorphisms (determining individual's longevity) are found
Some age linked diseases are known in medical practice (Werner's, Bloom's, Cocaine's syndromes, progery and other). Patients had damaged various gerontogenes. It was observed that these genes encoded replication, transcription and repair machinery components of the cell.
-
Progeria:
Two forms in humans;
Werner's syndrome (adult-
onset progeria) and
Hutchinson-Gilford
syndrome (juvenile-onset
progeria).
Most clinicians believe that
progeria is segmental aging
for a DNA helicase (DNA
repair/unwind)
From:http://www.scripps.edu/~jjperry/research.html
From: www.immortalhumans.com/982/
-
TELOMERES
Telomeres are the terminal parts of eukaryotic chromosomes. They are called "molecular clock" of the cell. Cell division times are correlated with telomere length. After each cell division telomeres get shorter. When telomere shortens to the critical stage, the intensity of cell division significantly decreases, and then cell differentiates and ages. Telomeres are persistent in the not aging cells: cancer and germ line.
-
CHROMOSOME
TTAGGGTTAGGGTTAGGGTTAGGGTTAGGG
AATCCCAATCCC
TELOMERE
-
What are telomeres?
Repetitive DNA sequences at the ends of all human
chromosomes
They contain thousands of repeats of the six-nucleotide
sequence, TTAGGG
In humans there are 46 chromosomes and thus 92 telomeres
(one at each end)
senescent cells have shorter telomeres
length differs between species
in humans 8-14kb long
telomere replication occurs late in the cell cycle
-
Provide protection from enzymatic degradation and maintain chromosome stability
Organisation of the cellular nucleus by serving as attaching points to the nuclear matrix
Allows end of linear DNA to be replicated completely
Telomeres are also thought to be the "clock" that regulates how many times an individual cell can divide. Telomeric sequences shorten each time the DNA replicates.
Functions
-
Replicative senescence
Telomeres shortens progressively with each
cell division
100 base pair lost with each cell division
Growth arrest
Go
G1
S
G2
M
C-FOS, ID-1, ID-2 , E2F1
E2F5
p21, p16
-
How Does Telomerase
Work?
Telomerase works by adding back telomeric DNA to the
ends of chromosomes, thus compensating for the loss of
telomeres that normally occurs as cells divide.
Most normal cells do not have this enzyme and thus they
lose telomeres with each division.
-
Telomeres & Aging
Healthy human cells are mortal because they can divide
only a finite number of times, growing older each time
they divide. Thus cells in an elderly person are much
older than cells in an infant.
-
transcription, translation and
posttranslational modification systems
The influence of transcription, translation and posttranslational modification systems to the cell is not static but highly regulated.
When synthesized protein is modified incorrectly (wrong phosphorylation) its function alters. If protein function is important, appropriate intracellular processes or regulation could be disturbed. Such errors lower vitality of organism and accelerate aging.
-
Signal Transduction
Cell is highly organized and integrated system. Information (signal transduction) and the regulation of bioprocess are the main players in the development and the maintenance of this system and aging.
When mutations or modification disturb proteins/genes of signal systems, signal transduction and other bioprocesses proceed abnormally.
-
Death by suicide Cells that are induced to commit suicide:
- shrink
- have their mitochondria break down with the release of cytochrome c
- develop bubble-like blebs on their surface
- have the chromatin (DNA and protein) in their nucleus degraded
- break into small, membrane-wrapped, fragments
- The phospholipid phosphatidylserine, which is normally hidden within
the plasma membrane is exposed on the surface.
- This is bound by receptors on phagocytic cells like macrophages and
dendritic cells which then engulf the cell fragments.
- The phagocytic cells secrete cytokines that inhibit inflammation.
The pattern of events in death by suicide is so orderly that the process is often
called programmed cell death or PCD. The cellular machinery of programmed cell
death turns out to be as intrinsic to the cell as, say, mitosis. Programmed cell death
is also called apoptosis
-
The Mechanisms of Apoptosis
There are 2 different mechanisms by which a cell
commits suicide by apoptosis.
- one generated by signals arising within the cell
- the other triggered by death activators binding to
receptors at the cell surface.
* TNF-a
* Lymphotoxin
* Fas ligand (FasL)
-
Major Apoptotic Pathways in Mammalian Cells
Hengartner, M.O. 2000. Nature. 407:770.
Green, D. and Kroemer, G. 1998. Trends Cell Biol. 8:267.
Mitochondrial Pathway Death Receptor Pathway
FasL
Caspase 3
D D D D
Fas/Apo1
/CD95
FADD
Procaspase 8
DISC
Caspase 8
BID
oxidants ceramide others
Bcl-2 D
Cytochrome
c
dATP
Procaspase 9
Apaf -1
dATP
Apaf -1
Caspase 9
Procaspase 3
apoptosome
DNA
damage
Cellular targets
-
Apoptosis triggered by internal signals
- In a healthy cell, the outer membranes of its mitochondria
express the protein Bcl-2 on their surface.
- Bcl-2 is bound to a molecule of the protein Apaf-1.
- Internal damage in the cell causes Bcl-2
* to release Apaf-1
* to no longer keep cytochrome c from leaking
out of the mitochondria
- The released cytochrome c and Apaf-1 bind to
molecules of caspase 9.
-
- The resulting complex of * cytochrome c
* Apaf-1
* caspase 9
* (and ATP)
is called the apoptosome.
- These aggregate in the cytosol.
- Caspase 9 is one of a family of over a dozen caspases. They are all proteases. They get their name because they
cleave proteins - mostly each other - at aspartic acid (Asp) residues).
- Caspase 9 cleaves and, in so doing, activates other caspases.
- The sequential activation of one caspase by another creates
an expanding cascade of proteolytic activity
(rather like that in blood clotting and complement
activation) which leads to
* digestion of structural proteins in the cytoplasm
* degradation of chromosomal DNA and phagocytosis of the cell
-
Apoptosis triggered by external signals
- Fas and the TNF receptor are integral membrane proteins with
their receptor domains exposed at the surface of the cell
- binding of the complementary death activator (FasL and
TNF respectively) transmits a signal to the cytoplasm that leads to
activation of caspase 8
- caspase 8 (like caspase 9) initiates a cascade of caspase
activation leading to
- phagocytosis of the cell.
The early steps in apoptosis are reversible - at least in C. elegans.
In some cases, final destruction of the cell is guaranteed only with
its engulfment by a phagocyte.
-
PERUBAHAN
AKIBAT PROSES
MENUA
-
SISTEM SARAF PUSAT
Terjadi pengurangan massa otak, aliran darah otak,
densitas koneksi dendritik, reseptor glukokortikoid
hipokampal, dan terganggunya autoregulasi perfusi.
Timbul proliferasi astrosit dan berubahnya
neurotransmiter, termasuk dopamin dan serotonin.
Terjadi peningkatan aktivitas monoamin oksidase dan
melambatnya proses sentral dan waktu reaksi.
-
FUNGSI KOGNITIF
Terjadi penurunan kemampuan meningkatkan fungsi intelektual.
Berkurangnya efisiensi transmisi saraf di otak yang menyebabkan proses informasi melambat dan banyak informasi hilang selama transmisi
Berkurangnya kemampuan mengakumulasi informasi baru dan mengambil informasi dari memori.
Kemampuan mengingat kejadian masa lalu lebih baik dibandingkan kemampuan mengingat kejadian yang baru saja terjadi.
-
SISTEM SARAF TEPI
Berkurangnya sensasi getar, terutama di kaki
Berkurangnya sensitivitas termal (hangat-dingin)
Berkurangnya amplitudo aksi potensial yang termielinasi
dan meningkatnya heterogenitas selaput akson myelin
-
Fungsi Penglihatan
Terjadi gangguan adaptasi gelap.
Pengeruhan pada lensa.
Ketidakmampuan untuk fokus pada benda-benda jarak
dekat (presbiopia).
Berkurangnya sensitivitas terhadap kontras dan lakrimasi.
Mulai dekade ke 4 pupil berkurang ukuran dan responnya
terhadap cahaya
-
Fungsi Pendengaran
Hilangnya nada berfrekuensi tinggi secara bilateral.
Kesulitan untuk membedakan sumber bunyi dan
terganggunya kemampuan membedakan target dari noise.
Disebabkan karena perubahan tulang pendengaran dan sel
rambut koklea pada telinga dalam
-
Indera Pengecap dan
Penghidu
Sensasi rasa oleh indera pengecap berkurang akibat
berkurangnya jumlah taste buds khususnya setelah usia
80 tahun.
Kemampuan menghidu pada beberapa individu
mengalami penurunan tetapi kebanyakan disebabkan
karena sumbatan atau kerusakan reseptor olfaktori.
-
Sistem Kardiovaskuler
Pengisian ventrikel kiri dan sel pacu jantung (pacemaker) di nodus SA berkurang.
Terjadi hipertrofi atrium kiri.
Kontraksi dan relaksasi ventrikel kiri bertambah lama.
Respons inotropik, kronotropik, terhadap stimulasi beta-adrenergik berkurang.
Menurunnya curah jantung maksimal.
Peningkatan atrial natriuretic peptide (ANP) serum dan resistensi vaskular perifer.
(Sussman et al., 2003; Edelberg et al., 2004)
-
SISTEM RESPIRASI
Penurunan forced expiration volume 1 second (FEVI) dan forced volume capacity (FVC).
Berkurangnya efektivitas batuk dan fungsi silia serta meningkatnya volume residual.
ventilation- menyebabkan PaO2 menurun seiring bertambahnya usia : 100 (0,32 x umur)
Kelemahan otot-otot pernafasan dan diafragma
Nafas cepat dan dangkal
Jumlah O2 yang berdifusi ke pembuluh darah berkurang
Paling penting : jalan nafas mudah menutup karena kolaps terutama pada tirah baring lama.
-
SISTEM
GASTROINTESTINAL
Penurunan ukuran dan aliran darah ke hati, terganggunya bersihan (clearance) obat oleh hati sehingga membutuhkan metabolisme fase I yang lebih ekstensif.
Terganggunya respons terhadap cedera pada mukosa lambung.
Berkurangnya massa pankreas dan cadangan enzimatik
Berkurangnya kontraksi kolon yang efektif dan absorpsi kalsium
Berkurangnya produksi asam lambung, enzim pencernaan dan saliva (sulit menelan).
-
METABOLISME
Setelah usia 25, terjadi penurunan kecepatan metabolisme
rata-rata 1%/tahun.
Mengakibatkan nutrisi lebih lama diabsorsi dan
didistribusikan serta digunakan dalam bentuk energi.
Terjadi penurunan metabolisme obat secara keseluruhan
-
SISTEM UROGENITAL
Menurunnya bersihan kreatinin (creatinin clearance) dan laju filtrasi glomerulus (GFR) 10 ml/dekade terjadi dengan semakin bertambahnya usia seseorang.(8)
Penurunan massa ginjal sebanyak 25%, terutama dari korteks dengan peningkatan relatif perfusi nefron jukstamedular.
Aksentuasi pelepasan anti diuretic hormone (ADH) sebagai respons terhadap dehidrasi berkurang dan meningkatnya ketergantungan prostaglandin ginjal untuk mempertahankan perfusi.
-
SISTEM UROGENITAL
Pada saluran kemih dan kelamin timbul perpanjangan
waktu refrakter untuk ereksi pada pria.
Berkurangnya intensitas orgasme pada pria maupun
wanita.
Berkurangnya sekresi prostat di urin dan pengosongan
kandung kemih yang tidak sempurna serta peningkatan
volume residual urin.
-
Hormon
Toleransi glukosa terganggu (gula darah puasa meningkat 1 mg/dl/dekade; gula darah postprandial meningkat 10 mg/dl/dekade).
Insulin serum meningkat, HbA1C meningkat, IGF-1 berkurang.
Penurunan yang bermakna pada dehidroepiandrosteron (DHEA), hormon T3, testosteron bebas maupun yang bioavailable, dan produksi vitamin D oleh kulit
Peningkatan hormon paratiroid (PTH).
Ovarian failure disertai menurunnya hormon ovarium
-
MUSKULOSKELETAL
Massa otot berkurang secara bermakna (sarkopenia) karena berkurangnya serat otot.
Tonus dan kekuatan otot berkurang.
Mengakibatkan gangguan pernafasan, pencernaan dan perkemihan (inkontinensia).
Kalsium tulang berkurang sehingga terjadi osteopenia
Penipisan vertebra sehingga menjadi lebih pendek, terjadi kalsifikasi
Inflamasi sendi berhubungan dengan kerentanan terhadap artritis.
-
KULIT
Berkurangnya jaringan adiposa dan kelenjar minyak,
menyebabkan keriput dan berkurang elastisitasnya
(rentan dekubitus, dan udara dingin).
Peningkatan deposit melanin
Rambut kehilangan pigmennya, kuku menjadi tebal
karena berkurangnya aliran darah ke jaringan penyangga.
Berkurangnya sensasi terhadap panas, dingin, nyeri.