0014-2980/00/0505-1469$17.50+.50/0© WILEY-VCH Verlag GmbH, D-69451 Weinheim, 2000

Variability of invariant mouse CD3 6 chains detectedby anti-CD3 antibodies

Gabriel Criado1, Maria Jose Feito1, Gloria Ojeda2, Alejandra Sanchez1, Charles A.Janeway, Jr.3, Pilar Portoles2 and Jose M. Rojo1

1 Centro de Investigaciones Biologicas, CSIC, Madrid, Spain2 Centro Nacional de Biologıa Fundamental, Instituto de Salud Carlos III, Majadahonda, Madrid,

Spain3 Section of Immunobiology, Yale University School of Medicine and Howard Hughes Medical

Institute, New Haven, USA

Current models of the TCR/CD3 complex assume that, in mature peripheral T lymphocytes,variability is restricted to the § g (or + ˇ ) chains of the TCR heterodimer responsible for anti-gen recognition, whereas the CD3 polypeptides involved in signal transmission are invariant.Here we show that mouse CD4+ T lymphocytes and T cell lines are bound with different avid-ity by anti-CD3 monoclonal antibodies. These findings cannot be accounted for by allelic dif-ferences between CD3 chains, by the nature of the TCR chains, or by the ratio of CD3 4 ˇ toCD3 4 + chain pairing. Rather, they are linked to heterogeneity of the N-terminal region ofCD3 4 chains, as detected by peptide-specific antibodies. In turn, these differences amongCD3 4 chains correlate with variations in the strength of TCR/CD3 interaction. N-terminalCD3 4 heterogeneity is not due to alternative splicing mechanisms, but rather involves diges-tion by metalloproteases, as suggested by reverse transcription-PCR amplification and bythe effect of protease inhibitors, respectively. Based on these data, we propose a model link-ing CD3 4 N-terminal variability with altered CD3 recognition by monoclonal antibodies andTCR/CD3 interaction. This model suggests the possibility of distinct spatial arrangements ofthe TCR/CD3 complex.

Key words: CD3 / CD3 4 / TCR

Received 22/7/99Revised 21/2/00Accepted 25/2/00

[I 19903]

Abbreviation: RT: Reverse transcription

1 Introduction

In most peripheral T lymphocytes, the TCR complex(TCR/CD3 complex) consists of at least six different type Imembrane polypeptides (reviewed in [1–4]). Two of thechains ( § and g ) form the disulfide-linked, highly diverseclonotypic TCR heterodimer. TCR chains contain oneconstant (C) and one variable (V) Ig-like domain, and areresponsible for the specific recognition of antigen pep-tides complexed to MHC molecules [5, 6]. The other foursubunits are the CD3 + , CD3 ˇ , CD3 4 and ´ polypeptidesnoncovalently associated with the § g heterodimers,which, except for ´ chains, also belong to the Ig super-family. CD3 and ´ polypeptides are the products of singlegenes lacking variability mechanisms [7, 8]; their mainrole is the interaction with intracellular proteins involvedin signal transduction to the cytoplasm [4, 9].

The CD3 chains have also a structural function, andTCR/CD3 complex assembly requires the previous for-mation of non-covalently bound CD3 + . 4 and CD3 ˇ . 4dimers and disulfide-linked ´ - ´ homodimers in additionto the § g heterodimer [10–13]. The stoichiometry ofthese elements in the TCR/CD3 complexes has been thesubject of much controversy, but early findings as well asrecent evidences favor a minimal model of TCR/CD3complex formed by two § g heterodimers, two CD3 + ( ˇ ). 4dimers and one ´ - ´ homodimer [( § g )2. + 4 . ˇ 4 . ´ 2] [13–18].All current models of the TCR/CD3 complex share theassumption that the CD3 chains are invariant at the poly-peptide level, as they are at the genetic level. Implicitly, itfollows from this assumption that invariant polypeptideslike the CD3 chains cannot tune up or modulate thestrength of their interactions with the TCR heterodimer.In the present study, we have detected CD3 chain vari-ability as differences in the avidity of CD3-specific mAbfor the CD3 of different T cells, as well as by altered CD3 4recognition by antibodies specific for the N-terminalregion of mouse CD3 4 . These differences correlate withchanges in the strength of TCR/CD3 association, andinvolve proteolytic digestion by metalloproteases.

Eur. J. Immunol. 2000. 30: 1469–1479 Variability of CD3 4 chains 1469

Fig. 1. Binding of anti-CD3 antibody YCD3-1 to AE103 cells is comparatively weaker than to CD4+ spleen T lymphocytes or toD10.G4.1 cells, as shown by indirect staining with affinity-purified antibodies (40 ? g/ml) and FITC-conjugated anti-Ig. The valueof the mean fluorescence channel is shown. Figures in parentheses are the relative values of fluorescence taking the value of TCRstaining for each cell type as a reference (= 100).

2 Results

2.1 CD3 is differentially recognized by YCD3-1 indifferent CD4+ T cells

While analyzing by flow cytometry TCR and CD3 expres-sion in the CD4+ T cell lines D10 and AE103, weobserved that staining with one anti-CD3 antibody(YCD3-1) was clearly lower in AE103 than in D10 cells, ascompared with the fluorescence obtained using F23.1, aV g 8-specific anti-TCR antibody.

Since the antibodies were used at concentrations closeto saturation for D10 cell staining, there was no evidentreason for this discrepancy. Experiments were set up todetermine if this phenomenon was peculiar to AE103cells and the YCD3-1 mAb, or could be observed in otherCD4+ T cells and anti-CD3 antibodies. Fig. 1 shows thatthe mean fluorescence for YCD3-1 staining was about70–80 % of the fluorescence for F23.1 staining in D10cells or in CD4+ spleen T lymphocytes, yet it was around20 % in AE103 cells. On the other hand, these differ-ences were lower if the 500A2 anti-CD3 mAb was used.Staining of AE103 with another anti-CD3 antibody(145-2C11) showed an intermediate behavior betweenYCD3-1 and 500A2 (data not shown). Altogether, theseresults indicated that CD3 on the surface of AE103cells was better recognized by certain anti-CD3 mAb(i.e. 500A2) than by others (i.e. YCD3-1), as compared toCD3 in other cell lines like D10, or CD3 expressed bynormal spleen CD4+ T lymphocytes.

2.2 Low binding of YCD3-1 to AE103 cells is notdue to differences in q / p content

One possible reason for the low binding of YCD3-1 toAE103 might be an imbalance between CD3 4 ˇ andCD3 4 + pairing and expression in these cells. AlthoughYCD3-1 recognizes CD3 4 ˇ as well as CD3 4 + pairs [15],we used the CD3 4 + -specific 7D6 antibodies to deter-mine possible differences in the relative content ofCD3 4 + pairs of AE103 and D10 cells. Fig. 2 shows thatthe ratio of TCR to 7D6 staining was only slightly higherin D10 cells than in AE103, and followed the same pat-tern as 500A2, rather than the pattern of YCD3-1 stain-ing. These data show that the fraction of CD3 4 + dimers isnot very different in AE103 or D10 cells. Hence, it isunlikely the reason for the observed differences betweenAE103 and other CD4+ T cells regarding YCD3-1 recog-nition.

2.3 CD3 from different CD4+ T cells is bound byYCD3-1 with different avidity

All the above results were obtained by flow cytometricanalysis after indirect cell staining. The differences inYCD3-1 staining between AE103 and D10 cells were fur-ther analyzed using FITC-coupled anti-CD3 or anti-TCRantibodies. F23.1 staining data at saturating concentra-tions showed that the TCR was expressed at higher lev-els in AE103 than in D10 cells, yet the avidity of F23.1

1470 G. Criado et al. Eur. J. Immunol. 2000. 30: 1469–1479

Fig. 2. Differences in YCD3-1 staining of AE103 andD10.G4.1 cells are not due to differences in the ratio ofCD3 4 . ˇ to CD3 4 . + dimer expression by these cells, as shownby the staining pattern obtained with 7D6, an anti-CD3 4 . +antibody. The ratio of mean fluorescence for TCR (F23.1)staining to anti-CD3 staining using different anti-CD3 anti-bodies (500A2, 7D6, or YCD3-1) is shown for each cell line.Staining conditions as in Fig. 1.

Fig. 3. Differences between cells for YCD3-1 staining aredue to differences in its avidity for binding to different CD4+

T cells, which is higher for D10.G4.1 (D10, ‡ ) than for AE103( , , top right) or CD4+ spleen T lymphocytes ( , , bottomright). In contrast, binding of anti-TCR (F23.1, left panels)has similar avidity for all the cells considered, regardless ofthe number of binding sites at saturation. Staining was donewith FITC-coupled anti-TCR or anti-CD3 antibodies as indi-cated. Staining of spleen CD4+ T cells with FITC-conjugatedF23.1 at concentrations lower than 1 ? g/ml did not allowcomplete separation of the F23.1+ and F23.1– populations,and was not considered.

binding was very similar in both cell lines, as shown bythe overlap of staining using low, non-saturating concen-trations of antibody (Fig. 3). In contrast, comparison ofbinding at low antibody concentrations showed that theavidity of YCD3-1 was about tenfold lower for AE103than for D10 CD3 (Fig. 3). These differences in aviditycould account for the different ratios of YCD3 to F23.1staining observed in Fig. 1 using optimal concentrationsfor D10 staining. It is remarkable that, once corrected forthe differences in FITC/protein molar ratios, the numberof anti-TCR (F23.1) and CD3 (YCD3-1) binding sites atsaturation was very similar in these cell lines, suggestinga TCR to CD3 ratio close to 1:1, as previously describedfor 125I-labeled F23.1 and YCD3-1 in CD4+ mouse T cells[15].

Fig. 3 also compares F23.1 and YCD3-1 binding to D10cells and normal spleen CD4+ T lymphocytes. As shownin this figure, the avidity of F23.1 binding to the V g 8+

population in spleen lymphocytes was at least as high asthat of D10 cells. However, the avidity of YCD3-1 forCD4+ T lymphocytes was lower than for D10 cells,although not as low as its avidity for AE103.

Since AE103 and D10 share the same genetic back-ground (AKR mice, Table 1), allelic differences in CD3chains can be ruled out as a cause for the differences inYCD3-1 avidity between these cell lines. Moreover, Fig. 4shows that YCD3-1 binding to AK-8, another CD4+ T cellline of AKR origin, had an intermediate avidity between

that of D10 and AE103. In addition, Fig. 4 shows thatthere was a clear difference between the avidity ofYCD3-1 for D10 and for D10. TCR25 and D10.TCR2.3,two CD4+ T cell lines established from mice transgenicfor D10 TCR. Consequently, the nature and specificity ofthe TCR § and g chains are not involved in the differ-ences in YCD3-1 avidity between these cell lines.

2.4 Variations in YCD3-1 avidity correlate withdifferences in the N-terminal region of CD3 6chains

Assays were carried out to assess possible differences inCD3 chains from D10 and AE103 cells. Initial immuno-blotting experiments using antiserum no. 17, specific forresidues 2–15 of mouse CD3 4 chains (Table 2), sug-gested that CD3 4 chains from AE103 cells were better

Eur. J. Immunol. 2000. 30: 1469–1479 Variability of CD3 4 chains 1471

Fig. 4. Differences in the avidity of anti-CD3 (FITC-conjugated YCD3-1) binding to cells with identical, AKR/Jgenetic background (D10.G4.1, AK-8, AE103) or expressingidentical TCR (D10.G4.1, D10.TCR2.3, D10.TCR.25) indicatethat neither the background nor the TCR specificity areinvolved in this phenomenon.

Fig. 5. Immunoprecipitation of surface TCR or CD3 detectsdifferences in TCR/CD3 association and CD3 4 N-terminalregion between cell lines. Under the same experimental condi-tions, TCR (F23.1) immunoprecipitates from D10.G4.1 cells co-precipitate lower amounts of CD3 4 chains than immunoprecipi-tates from AE103 cells (A), and these chains are less efficientlyrecognized by antibodies specific for the CD3 4 2–15 sequence(A, B). Efficient precipitation of CD3 from AE103 cells requireshigh concentrations ( n 50 ? g/ml) of anti-CD3 antibodies likeYCD3-1, which bind with low avidity to these cells (B). Further-more, YCD3-1 binding reinforces TCR/CD3 association in D10cells (B), yet lowers the amount of co-precipitated TCR fromAE103 (B). Immunoprecipitation, electrophoresis under non-reducing conditions, and immunoblot with anti-TCR (F23.1),CD3 4 (APA1/1), or N-terminal CD3 4 (CD3 4 2–15, serum no. 17)were performed as described in Sect. 4.

Table 1. T cell lines used

Cell line Phenotype Specificitya) TCR V § /TCR V g Background References

AE103 Th1 I-Ak N.D./V g 8.2 AKR/J (H-2k) [38]

AK-8 Th2 CA 134–146: I-Ak AK-8 V § /V g 8.2 AKR/J (H-2k) [39–41]

D10.G4.1 Th2 CA 134–146: I-Ak D10 V § /V g 8.2 AKR/J (H-2k) [40, 42, 43]

D10.TCR25 Th1 CA 134–146: I-Ak D10 TCR (transgenic) B10.BR (H-2k) [43]

D10.TCR2.3 Th2 CA 134–146: I-Ak D10 TCR (transgenic) B10.BR (H-2k) [43]

a) CA: Conalbumin.

recognized by this antiserum than those of D10 cells.This phenomenon was confirmed using APA1.1 as a ref-erence for total CD3 4 , since the binding of this anti-CD3 4mAb depends on an internal sequence in the cytoplas-mic domain (Table 2, [19]).

Fig. 5 A shows the results obtained with immunoprecipi-tates of surface TCR from D10 and AE103 cells. Twofindings are worth noting: on one hand, CD3 4 co-precipitation with the TCR was clearly higher in AE103than in D10 cells [about fivefold, as determined by com-parison of TCR (F23.1) and CD3 4 (APA1.1) immunoblot].This indicated a stronger TCR/CD3 interaction in AE103than in D10 cells. Secondly, those CD3 4 chains co-precipitating with surface TCR from AE103 were alsomore easily recognized (about twofold) by anti-CD3 4 2–15

antiserum (CD2 4 2–15, Fig. 5 A) than those from D10 cells.

These results show N-terminal differences betweenCD3 4 chains of T cells as well as differences in thestrength of TCR/CD3 interaction.

1472 G. Criado et al. Eur. J. Immunol. 2000. 30: 1469–1479

Table 2. Characteristics of the anti-TCR and anti-CD3 antibodies used in this study

Antibody Specificity Host (isotype) References

F23.1 TCR V g 8 Mouse mAb (IgG2a) [44]

145-2C11 Mouse CD3 Hamster mAb (IgG1) [45]

500A2 Mouse CD3 Hamster mAb (IgG2b) [46]

YCD3-1 Mouse CD3 Rat mAb (IgG2b) [15]

APA1/1 Human CD3 4 152–161 (mouse CD3 4 135–144) Mouse mAb [12, 19]

no. 17 Mouse CD3 4 2–15 (DDAENIEYKVSISGT) Rabbit antiserum This study

7D6 Mouse CD3 4 + Mouse mAb (IgG2a) [47]

To better ascertain the differences between D10 andAE103 in terms of CD3 4 chain structure and CD3/TCRinteractions, surface CD3 was precipitated using low(5 ? g/ml) or high (50 ? g/ml) YCD3-1 concentrations. Asshown in Fig. 5 B, the amount of surface CD3 4 precipi-tated from D10 cells was moderately enhanced byincreasing the concentration of antibody, as determinedby APA1.1 immunoblot (CD3 4 , Fig. 5 B). In contrast, effi-cient CD3 4 precipitation from AE103 could be onlyobserved using YCD3-1 at high concentrations (50 ? g/ml, CD3 4 , Fig. 5 B). These data are in full agreement withthe relative avidity of YCD3-1 for D10 and AE103 CD3chains (Figs. 3, 4). On the other hand, Fig. 5 clearlyshows the differences between D10 and AE103 in termsof recognition by the antiserum no. 17 specific for the N-terminal sequence of mouse CD3 4 . Thus, AE103 CD3 4chains were efficiently recognized by this antiserum,whereas D10 CD3 4 chains could be hardly bound byantiserum no. 17 (CD3 4 2–15, Fig. 5 B). These results showthat there are different molecular species within the poolof surface CD3 4 chains of each T cell line, whose propor-tions vary according to the cell line considered. Further-more, Fig. 5 B shows that blotting with the anti-CD3 4 2–15

antiserum preferentially recognized CD3 4 chains of highapparent molecular weight and low electrophoreticmobility, as clearly observed in the minor fraction of D10CD3 4 chains recognized by the antiserum. This suggeststhat the differences in electrophoretic mobility of CD3 4chains might be partially due to differences in the N-terminal region of the polypeptide.

Concerning TCR co-precipitation with surface CD3(Fig. 5 B), there was a differential behavior upon antibodyligation, depending on the cell line analyzed. In D10 cells,YCD3-1 ligation stabilized CD3/TCR interaction, asjudged from the amount of TCR co-precipitated underthese conditions. This result fits well with the early ob-servations in human T cells showing that TCR co-precipitates better with CD3 than CD3 with the TCR [14,

20]. On the other hand, it was surprising that, unlike D10,the binding of YCD3-1 to AE103 surface CD3 did notinduce efficient TCR co-precipitation. On the contrary,TCR was very poorly co-precipitated by CD3 in thesecells (TCR blot, Fig. 5 B). This result was unexpected inview of the results from AE103 TCR immunoprecipitatesshowing a strong TCR/CD3 interaction in this cell line(Fig. 5 A), and suggests that, in fact, YCD3-1 breaksTCR/CD3 interactions upon binding to the TCR complexof cells like AE103.

2.5 Mechanisms of CD3 6 chain variability

At least two, nonexclusive mechanisms of N-terminalvariability of CD3 4 chains are conceivable. One is thealternative splicing of CD3 4 mRNA, the second the pro-teolytic degradation of CD3 4 N-terminal regions. Asnoted in the early work of Clevers et al. [21, 22], thestructure of mouse and human CD3 4 genes is compati-ble with a mechanism of alternative splicing of two(mouse) or three (human) miniexons coding for 8 and 15N-terminal amino acid residues, respectively. The occur-rence of alternatively spliced mRNA species wasassessed in D10 and AE103 cells by reverse transcrip-tion (RT)-PCR amplification of a fragment of the mouseCD3 4 mRNA including the exons 3 and 4 potentiallyinvolved in alternative splicing, such that could detectthe small (14 to 33 bp) differences involved (Fig. 6). Asdepicted in Fig. 6, there was only one PCR product of162 bp in either cell line, matching the expected sizeof the unspliced cDNA fragment. Furthermore, thesequence of the amplified fragment exactly matched thesequence of mouse CD3 4 in this region (data not shown).Indeed, sequencing of cDNA encompassing the full-length open reading frame of CD3 4 chains did not revealany difference between D10 and AE103 cells, or be-tween these cells and the previously published CD3 4chain cDNA sequence (data not shown). These data are

Eur. J. Immunol. 2000. 30: 1469–1479 Variability of CD3 4 chains 1473

Fig. 6. RT-PCR analysis of CD3 4 mRNA extracted from D10and AE103 cells shows no indication of alternative splicingof mini-exons 3 and 4 producing different N-terminalsequences. (A) Nucleotide sequence of the amplified frag-ment. The untranslated cDNA sequence is depicted as smallletters; the sequence belonging to the mouse CD3 4 openreading frame is depicted in capitals. Exon limits are markedby triangles. The predicted leader peptide of the translatedsequence is underlined. Alternative splicing of exons 3 and/or 4 would yield RT-PCR products of 147, 144 and 129 bp inaddition to the full-length 162-bp product. (B) RT-PCR prod-ucts from D10 or AE103 (AE) after amplification of CD3 4mRNA fragment.

Fig. 7. Effect of protease inhibitors on YCD3-1 binding andCD3 4 recognition by antibodies specific for N-terminalmCD3 4 . (A) D10 cells were incubated for 18 h with the pro-tease inhibitors indicated, and then stained with 2 ? g/mlFITC-conjugated YCD3-1. Mean fluorescence of treatedcells ± SE from three different experiments is depicted(mean fluorescence of untreated cells = 100). (B) D10 cells,incubated or not with 0.1 mM 1,10-phenantroline, werewashed, incubated with 40 ? g/ml YCD3-1, and surface CD3immunoprecipitated. Immunoprecipitates were successivelyprobed by immunoblot with anti-CD3 4 (APA1/1) and anti-CD3 4 2–15. The densitometric anlysis in the graph shows anincreased binding of anti-CD3 4 2–15 in 1,10-phenantroline-treated cells. The OD value for CD3 4 in lane 2 was taken asa reference (A.U. = 100) in each blot.

in full agreement with previous analysis showing no alter-native splicing in human or mouse CD3 4 mRNA [21, 22].

In view of these results, we looked for proteolytic degra-dation as a possible post-translational modificationmechanism for the N-terminal region of CD3 4 . Since D10cells possess the most altered CD3 4 chains and thehighest avidity for YCD3-1, we anticipated that, in thesecells, inhibition of mechanisms leading to CD3 4 N-terminal modification would result in lower YCD3-1 avid-ity. Consequently, D10 cells were cultured with differ-ent protease inhibitors for 16–20 h and then analyzedfor YCD3-1 recognition at non-saturating antibody con-centrations. As shown in Fig. 7 A, under these condi-tions two metalloprotease inhibitors (0.1 mM 1,10-phenantroline or 1 mM minocycline) consistently andreproducibly inhibited YCD3-1 binding to D10 cells with-out significantly lowering cell viability.

We also predicted that protease inhibition shouldenhance the binding of antibodies specific for the N-terminal sequence of CD3 4 in D10 cells. Fig. 7 B showsthat this was indeed the case, as incubation of D10 cellswith the protease inhibitor 1,10-phenantroline increasedby 30–40 % the recognition of surface CD3 4 by anti-

bodies specific for the N-terminal region of CD3 4 . Care-ful densitometric analysis of the data also showed thatthere was a small shift in the electrophoretic mobility ofsurface CD3 4 chains in 1,10-phenantroline-treated cells,suggesting that proteases can lower the apparent size ofCD3 4 chains.

3 Discussion

Our results show heterogeneity of CD3 chains from dif-ferent mouse CD4+ T lymphocytes and T cell lines, whichis detected by antibodies specific for a peptide in the N-terminal region of invariant CD3 4 chains as well as by dif-ferences in the avidity of certain anti-CD3 mAb. We

1474 G. Criado et al. Eur. J. Immunol. 2000. 30: 1469–1479

Fig. 8. A schematic model of how differences in the N-terminal region of CD3 4 chains (N 4 ) might be involved in the regulation ofTCR/CD3 interactions and conformation, altering the exposure of the epitope for YCD3-1 antibody binding (arrow). Only theextracytoplasmic domains of CD3 4 , ˇ , and + chains ( 4 , ˇ , + ) and the TCR (C § , V § , C g , V g ) are depicted. Figures within TCR Vdomains show the approximate location of hypervariable regions.

believe that these two phenomena are linked betweenone another and with differences in the strength of TCR/CD3 interaction, as discussed below.

Since these differences have been observed during theanalysis of cell lines sharing the same genetic back-ground, and since different species of surface CD3 4chains can be found in one single cell line (Figs. 3–5),they have no genetic origin. Furthermore, we have foundno evidence of alternative splicing of mini-exons encod-ing the N-terminal region of CD3 4 chains (Fig. 6), inagreement with previous data from human and mouseCD3 4 chains [21, 22]. Moreover, the analysis of CD3 4cDNA from either D10 or AE103 cells shows identicalsequences in both cells lines (data not shown). Rather,our data indicate that metalloproteases sensitive to inhi-bition by 1,10-phenantroline or minocycline, but not tophosphoramidon, are responsible for the modification ofCD3 4 chains (Fig. 7). The precise nature, specificity andmechanism(s) of action of the protease(s) involved in thisphenomenon need to be further ascertained.

The correlation between high avidity of YCD3-1 bindingto cells and the abundance of N-terminally defectiveforms of CD3 4 in surface TCR/CD3 complexes, and viceversa, suggests that these phenomena are linked to one

another. The simplest explanation is that the N-terminalregion of those CD3 4 chains harboring completesequences, abundant in cells like AE103, blocks theaccess of YCD3-1 to its epitope, lowering its avidity.Although this effect cannot be discarded, we believe thatthe mechanism is a more complex one, given the possi-bility that the N-terminal sequence of CD3 4 is involved inits interaction with the TCR heterodimer, as discussedbelow. In this case, it is conceivable that the accessibilityof YCD3-1 (and, to a lesser extent, also other anti-CD3antibodies like 145-2C11) to its epitope is impeded bythe TCR itself, and is controlled by the strength of CD3 4 /TCR interaction, which in turn would be regulated by thenumber of negatively charged residues in the N-terminalregion of CD3 4 (Fig. 8). The basis for this assumption is:firstly, a minimal TCR/CD3 complex stoichiometry of[( § g )2. + 4 . ˇ 4 . ´ 2], based on the ratio of anti-TCR to anti-CD3 binding sites, the number of CD3 4 chains and TCRheterodimers per TCR/CD3 complex, plus data onCD3 4 , + and ˇ pairing, TCR complex arrangement, andelectrostatic equilibrium of the complex [13–18]; sec-ondly, that the most likely location for each CD3 4 chain inthe complex is a “cave” beneath TCR C g domains,flanked by C § and CD3 + or ˇ [18, 23]. This location isconsistent with previous data showing that H57, an anti-TCR antibody which binds to the extended FG loop of

Eur. J. Immunol. 2000. 30: 1469–1479 Variability of CD3 4 chains 1475

Fig. 9. The N-terminal sequences of CD3 4 chains from dif-ferent species have conserved a high content of negativelycharged aspartic (D) or glutamic acid (E) residues (shaded).Gaps are marked by dashes. Bars show the approximatelocation of A and B g strands in the extracytoplasmicdomain of CD3 4 .

the C g domain [23], cross-blocks the binding of differentanti-CD3 antibodies including YCD3-1 [24]. Third, thedata on C-C Ig domain interactions involved in CD3 4pairing with CD3 + / ˇ , the known location of sugar moi-eties in CD3 + and CD3 ˇ in different species [25], and theproximity of conserved regions involved in CD3 4 /CD3 + / ˇ interactions close to the transmembrane region[19] need to be reconciled. Given these premises, the N-terminal region of CD3 4 is likely to be in an upper loca-tion, concealed beneath the TCR heterodimer. In fact, acluster of negatively charged amino acids could beformed in the CD3 4 chains of most species by the prox-imity of the N-terminal tail, the B to C loop, and the F toG loop of the external Ig domain (Fig. 9; see, for example[19, 26] for complete CD3 4 sequence data). The interac-tion of this cluster with positively charged amino acidside chains located in TCR constant regions mightexplain why the extracytoplasmic domain of CD3 4 isinvolved in the interaction with TCR g chains [27]. Inaddition, the number of negative charges in the N-terminal region would regulate the strength of TCR/CD3interactions. Consequently, the loss of residues in theN-terminal region of CD3 4 would eventually result in aweaker, but also more flexible TCR/CD3 interaction, assuggested in Fig. 8, allowing an easier access of anti-CD3 antibodies like YCD3-1 to their epitopes (Fig. 8).

The model in Fig. 8 is also compatible with available dataon the binding of superantigens to the TCR and MHCclass II or the location of sugar moieties on TCR, CD3 +and CD3 ˇ chains. Furthermore, it allows for the interac-tion of CD4 with the TCR and MHC class II dimer ofdimers as suggested by Li et al. [28], provided that each§ g TCR dimer is interacting with MHC molecules

belonging to a different dimer of dimers.

We propose that the variability of CD3 4 chains could alsoallow fine tuning of TCR-mediated activation. The side(“tilting”) mobility of the TCR is probably restricted by thestrength of CD3 4 /TCR interaction. The model in Fig. 8shows how the nature of N-terminal sequences of CD3 4chains might regulate the structure of TCR/CD3 com-plexes from a “closed” to an “open”, more flexible con-formation, i.e. loss of N-terminal negative charges wouldfavor an “open” conformation of the complex, and looseTCR/CD3 interaction. On one hand, as proposed above,this would favor YCD3 binding to certain T cell lines likeD10.G4.1. On the other, open, tilted forms of the TCRmight favor the building of TCR/MHC/coreceptor com-plexes during antigen recognition [28]. Furthermore,such a model might help in explaining how antibody-[29, 30] or peptide/MHC-induced [31] conformationalchanges in the TCR can be stabilized. Howe thesechanges relate to other aspects of activation like theavailability of CD3 intracytoplasmic domains to kinases,

or easier dissociation of CD3 chains from the antigenrecognition module upon TCR ligation [32] remains to beelucidated.

4 Materials and methods

4.1 Cell lines

Mouse CD4+ T cell lines used in this study are summarized inTable 1. AE103 cells were grown in Click’s EHAA mediumsupplemented with 10 % heat-inactivated FCS (culturemedium) containing 10 U/ml mouse IL-2. D10.G4.1 cellswere from the SR.D10 subclone [33]; they were grown in cul-ture medium containing 5 U/ml mouse IL-2, 10 U/ml mouseIL-4, and 25 pg/ml mouse IL-1 § . AK-8, D10.TCR2.3, andD10.TCR25 were maintained by stimulation (105 cells/ml)every 2–3 weeks with irradiated (2000 rad) C3H spleen cells(5 × 105/ml) plus antigen (100 ? g/ml conalbumin).

4.2 CD4+ T lymphocytes

CD4+ T lymphocytes were isolated by Ig anti-Ig columns [34,35]. Cell suspensions from C3H spleens in culture mediumwere obtained, and the erythrocytes were lysed by hypo-tonic shock. The washed cells were incubated with anti-CD8and anti-CD11b antibodies in the cold, washed and resus-pended in culture medium. Then, they were loaded on amouse Ig/anti-mouse Ig column ( p 4 × 107 cells/ml bed vol-ume). The cells collected in the flow-through were n 95 %viable; n 90 % CD3+; and 85–90 % CD4+ as determined byflow cytometry.

1476 G. Criado et al. Eur. J. Immunol. 2000. 30: 1469–1479

4.3 Antibodies and protease inhibitors

The characteristics of the anti-TCR and anti-CD3 mAb usedare summarized in Table 2. F23.1, YCD3-1, 500A2, and 145-2C11 were purified by protein A affinity chromatographyfrom ammonium sulfate precipitates of culture supernatants;7D6 (a gift of Dr. Antonio de la Hera, Centro de Investigacio-nes Biologicas, C.S.I.C., Madrid), was a protein A-purifiedpreparation. APA1.1 was the generous gift of Dr. BalbinoAlarcon (Centro de Biologıa Molecular, C.S.I.C.-U.A.M.,Madrid), and was used as ammonium sulfate precipitate ofascites. Other mAb used were M1/70 (anti-mouse CD11brat IgG2b [36]) and 53-6.72 (anti-mouse CD8, rat IgG2a).They were used as ammonium sulfate precipitates of culturesupernatants.

Rabbit antiserum no. 17 (Table 2) was raised by repeatedimmunization with a synthetic peptide (DDAENIEYKVSISGT,residues 2–15 of mouse CD3 4 ) coupled to OVA using glutar-aldehyde. Polyclonal anti-mouse or anti-rat Ig antisera wereraised in rabbits using protein A-purified Ig. The antibodieswere affinity purified over Ig-Sepharose and coupled toCNBr-Sepharose. FITC-conjugated goat anti-hamster IgG(6061-02) was from Southern Biotechnology Associates,Inc. (Birmingham, AL); FITC conjugate of sheep anti-mouseIgG (F-2266) was from Sigma Chemical Company (SaintLouis, Mo.); FITC-conjugated goat anti-rat IgG (401414) wasfrom Calbiochem (San Diego, CA).

F23.1 and YCD3-1 were FITC conjugated as described [37],equilibrated in PBS and filter sterilized. FITC/protein molarratios were 6/1 (F23.1) and 8.5/1 (YCD3-1).

Protease inhibitors used were bestatin (inhibitor of amino-peptidase metalloproteases), dipeptidylpeptidase IV inhibi-tor II [DPPaseINH, dipeptidylpetidase II and IV (CD26) inhibi-tor], and leupeptin (inhibitor of serine and cysteine prote-ases) from Calbiochem. p-aminobenzoyl-Gly-Pro-D-Leu-D-Ala hydroxamic acid [(pAB-GP-DL-DA), matrix metallopro-tease inhibitor, minocycline, 1,10-phenantroline, phosphor-amidon (metalloprotease inhibitors) and phenylmethylsul-fonyl fluoride (PMSF) (serine protease inhibitor) were fromSigma.

4.4 Flow cytometry

For direct staining, cells (107/ml) were incubated for 30 minon ice with FITC-coupled antibodies diluted in cold stainingbuffer (PBS containing 2 % FCS and 0.1 % sodium azide).Then, the cells were washed four times with staining bufferand analyzed on an EPICS-XL flow cytometer (Coulter Elec-tronics). For indirect staining, the cells were first incubatedwith unlabeled antibody and washed as above. Then, FITC-conjugated species-specific anti-Ig antibody was addedand the cells incubated for another 30 min on ice. The cellswere eventually washed four times with staining buffer andanalyzed.

4.5 Immunoprecipitation

Precipitation of cell surface TCR and CD3 was performed asfollows. Cells (5 × 106–1 × 107/determination, 107 cells/ml)were resuspended in ice-cold staining buffer and incubatedwith anti-TCR or anti-CD3 mAb on ice for 30 min. Then,unbound antibodies were removed by washing with ice-coldstaining buffer. Cells were lysed on ice (30 min at 107/ml)with 10 mM 3-[(3-cholamidopropyl)-dimethyl ammonium]-1-propane sulfonate (CHAPS) in 50 mM Tris/HCl, pH 7.6,150 mM NaCl, 1 mM MgCl2, 1 mM EGTA, 10 ? g/ml aproti-nin, 10 ? g/ml leupeptin, 1 mM PMSF, 50 mM NaF, 10 mMNa4P2O7, and 1 mM NaVO4 (lysis buffer). Post-nuclearlysates were precleared by rotation (1 h at 4 °C) with normalrat IgG covalently coupled to Sepharose beads (20 ? l ofpacked, washed beads/ml of lysate). After centrifugation,precleared supernatants were immunoprecipitated with15 ? l of packed Sepharose beads with coupled rabbit anti-mouse Ig or rabbit anti-rat Ig antibodies, depending on themouse or rat origin of the mAb bound to the cells. After rota-tion for 2 h at 4 °C, the immunoprecipitates were washedfive times with ice-cold 2 mM CHAPS in 50 mM Tris/HCl,pH 7.6, 150 mM NaCl, 200 ? M NaVO4, extracted with non-reducing SDS-PAGE sample buffer and boiled for 1 min.After brief centrifugation, the sample supernatants weretaken and electrophoresed, or kept at − 70 °C for further use.

4.6 Immunoblotting

After separation of immunoprecipitates by SDS-PAGE in10 % or 12 % acrylamide gels, the proteins were transferredto polyvinylidene difluoride membranes (Immobilon-P, Milli-pore Corp., Bedford, MA). The membranes were blocked for2 h at room temperature with 3 % nonfat dried milk in PBS/0.1 % Tween-20 (PBST). The blots were washed twice withPBST, incubated overnight at 4 °C with antibodies (F23.1 at5 ? g/ml; APA1.1 at 1:1000 of ascites) or antiserum (no. 17,1 :1000) diluted in PBST/1 % nonfat milk. After four washeswith PBST, blots were incubated for 2 h at room temperaturewith horseradish peroxidase (HRP)-conjugated secondreagents in PBST/1 % nonfat milk [1 :10000 HRP-anti-mouse IgG (A9309, Sigma); or 1:2000 HRP-protein A(P8651, Sigma)]. Eventually, the blots were washed fivetimes with PBST and the proteins visualized using theSupersignal West Pico chemiluminiscent substrate (Pierce).Where necessary, the membranes were washed, incubatedin 62.5 mM Tris/HCl, pH 6.7, 100 mM 2-ME, 2 % SDS(30 min, 50 °C), washed extensively with PBST and reprobedwith antibodies as indicated. Quantitation was performedwith Fuji Bas equipment (Fuji, Japan) using the PC Bas 2.09image analysis software.

4.7 RT-PCR assays

For mRNA isolation, 15 × 106 cells were extracted using theDirect mRNA Mini Kit Oligotex (Qiagen, Valencia, CA). The

Eur. J. Immunol. 2000. 30: 1469–1479 Variability of CD3 4 chains 1477

quantity and quality of the mRNA was determined by OD at260 and 280 nm and by electrophoresis on 1 % agarose geland ethidium bromide staining. PCR was conducted in a50 ? l volume using 100 ng mRNA, 50 pmol of sense andanti-sense primers, and the Access RT PCR System (Pro-mega, Madison, WI). A CD3 4 cDNA fragment was amplifiedusing a 5’-primer oligonucleotide (GAGAGAGAGAAT-TCTGAGAGGATGCGG) encompassing part of the 5’untranslated region and two amino acids of the leadersequence in mouse CD3 4 exon 2. An EcoRI site was intro-duced by means of a C to A substitution (bold). The 3’-primer (CTGCACGGGAGATCTGTCACTG) included oneknown XbaI site within CD3 4 exon 5. Cycling conditionswere one initial cycle at 48 °C for 45 min, 94 °C for 2 min,plus 40 cycles at 94 °C for 30 s, 60 °C for 1 min (65 °C forAE103), and 72 °C for 2 min, followed by final extension at72 °C for 7 min. The resulting products were electropho-resed on a 2 % agarose gel and stained with ethidium bro-mide.

Acknowledgements: We thank Maria Luisa del Pozo forskillful technical assistance. We are grateful to B. Alarconand A. de la Hera for the gift of the antibodies APA1/1 and7D6, respectively. G.C. is supported by a fellowship fromMinisterio de Educacion y Ciencia (Spain); A.S. is supportedby a fellowship from Fondo de Investigacion Sanitaria(Spain); M.J.F. is supported by a postdoctoral fellowshipfrom Comunidad Autonoma de Madrid (Spain). P.P. is a CSICTenured Scientist at the C.N.B.F. (Instituto de Salud CarlosIII). This work was supported by grants from Fondo deInvestigacion Sanitaria.

References

1 Ashwell, J. D. and Klausner, R. D., Genetic and mutational anal-ysis of the T-cell antigen receptor. Annu. Rev. Immunol. 1990. 8:139–167.

2 Clevers, H., Alarcon, B., Wileman, T. and Terhorst, C., The Tcell receptor/CD3 complex: A dynamic protein ensemble. Annu.Rev. Immunol. 1988. 6: 629–662.

3 Janeway Jr., C. A., The T cell receptor as a multicomponent sig-naling machine: CD4/CD8 Co-receptors and CD45 in T cell acti-vation. Annu. Rev. Immunol. 1992. 10: 645–674.

4 Malissen, B. and Schmitt-Verhulst, A.-M., Transmembrane sig-naling through the T-cell-receptor-CD3 complex. Curr. Opin.Immunol. 1993. 5: 324–333.

5 Dembic, Z., Haas, W., Weiss, S., McCubrey, J., Kiefer, H., vonBoehmer, H. and Steinmetz, M., Transfer of specificity bymurine § and g T-cell receptor genes. Nature 1986. 320:232–238.

6 Garcıa, K. C., Degano, M., Stanfield, R. L., Brunmark, A.,Jackson, M. R., Peterson, P. A., Teyton, L. and Wilson, I. A., An§ g T cell receptor structure at 2.5 Å and its orientation in the

TCR-MHC complex. Science 1996. 274: 209–219.

7 Tunnacliffe, A., Buluwela, L. and Rabbits, T. H., Physical link-age of three CD3 genes on human chromosome 11. EMBO J.1987. 6: 2953–2957.

8 Saito, H., Koyama, T., Georgopoulos, K., Clevers, H., Haser,W. G., LeBien, T., Tonegawa, S. and Terhorst, C., Close linkageof the mouse and human CD3- + and ˇ -chain genes suggests thattheir transcription is controlled by common regulatory elements.Proc. Natl. Acad. Sci. USA 1987. 84: 9131–9134.

9 Letourneur, F. and Klausner, R. D., Activation of cells by a tyro-sine kinase activation domain in the cytoplasmic tail of CD3 4 .Science 1992. 255: 79–82.

10 Manolios, N., Letorneur, F., Bonifacino, J. S. and Klausner, R.D., Pairwise, cooperative and inhibitory interactions describe theassembly and probable structure of the T-cell antigen receptor.EMBO J. 1991. 10: 1643–1651.

11 Koning, F., Maloy, W. E. and Coligan, J. E., The implications ofsubunit interactions for the structure of the T cell receptor-CD3complex. Eur. J. Immunol. 1990. 20: 299–305.

12 Alarcon, B., Ley, S. C., Sanchez-Madrid, F., Blumberg, R. S.,Ju, S. T., Fresno, M. and Terhorst, C., The CD3- + and CD3- ˇsubunits of the T cell antigen receptor can be expressed withindistinct functional TCR/CD3 complexes. EMBO J. 1991. 10:903–912.

13 San Jose, E., Sahuquillo, A. G., Bragado, R. and Alarcon, B.,Assembly of the TCR/CD3 complex: CD3 4 / ˇ and CD3 4 / + dimersassociate indistinctly with both TCR § and TCR g chains. Evi-dence for a double TCR heterodimer model. Eur. J. Immunol.1998. 28: 12–21.

14 Meuer, S., Acuto, O., Hussey, R. E., Hodgdon, J. C., Fitzge-rald, K. A., Schlossman, S. F. and Reinherz, E. L., Evidence forthe T3-associated 90K heterodimer as the T-cell antigen receptor.Nature 1983. 303: 808–810.

15 Portoles, P., Rojo, J., Golby, A., Bonneville, M., Gromkowski,S., Greenbaum, L., Janeway, Jr., C. A., Murphy, D. B. and Bot-tomly, K., Monoclonal antibodies to murine CD3 4 define distinctepitopes, one of which may interact with CD4 during T cell acti-vation. J. Immunol. 1989. 142: 4169–4175.

16 Blumberg, R. S., Ley, S., Sancho, J., Lonberg, N., Lacy, E.,McDermott, F., Schad, V., Greenstein, J. L. and Terhorst, C.,Structure of the T-cell antigen receptor: evidence for two CD3 4subunits in the T-cell receptor complex. Proc. Natl. Acad. Sci.USA 1990. 87: 7220–7224.

17 de la Hera, A., Müller, U., Olsson, C., Isaaz, S. and Tunnacliffe,A., Structure of the T cell antigen receptor (TCR): two CD3 4 sub-units in a functional TCR/CD3 complex. J. Exp. Med. 1991. 173:7–17.

18 Fernandez-Miguel, G., Alarcon, B., Iglesias, A., Bluethmann,H., Alvarez-Mon, M., Sanz, E. and de la Hera, A., Multivalentstructure of an § g T cell receptor. Proc. Natl. Acad. Sci. USA1999. 96: 1547–1552.

19 Borroto, A., Mallabiabarrena, A., Albar, J. P., Martınez-A. C.and Alarcon, B., Characterization of the region involved in CD3pairwise interactions within the T cell receptor complex. J. Biol.Chem. 1998. 273: 12807–12816.

20 Meuer, S. C., Cooper, D. A., Odgdon, J. C., Hussey, R. E., Fitz-gerald, K. A., Schlossman, S. F. and Reinherz, E. L., Identifica-tion of the antigen/MHC receptor on human inducer T lympho-cytes. Science 1983. 222: 1239–1242.

21 Clevers, H., Dunlap, S., Saito, H., Georgopoulos, K., Wileman,T. and Terhorst, C., Characterization and expression of themurine CD3- 4 gene. Proc. Natl. Acad. Sci. USA 1988. 85:8623–8627.

22 Clevers, H. C., Dunlap, S., Wileman, T. E. and Terhorst, C.,Human CD3- 4 gene contains three miniexons and is transcribedfrom a non-TATA promoter. Proc. Natl. Acad. Sci. USA 1988. 85:8156–8160.

1478 G. Criado et al. Eur. J. Immunol. 2000. 30: 1469–1479

23 Wang, J., Lim, K., Smoylar, A., Teng, M., Liu, J., Tse, A. G. D.,Liu, J., Hussey, R. E., Chishti, Y., Thomson, C. T., Sweet, R. M.,Nathenson, S. G., Chang, H.-C., Sacchettini, J. C. and Rein-herz, E. L., Atomic structure of an § g T cell receptor (TCR) het-erodimer in complex with an anti-TCR Fab fragment derived froma mitogenic antibody. EMBO J. 1998. 17: 10–26.

24 Dianzani, U., Shaw, A., Al-Ramadi, B. K., Kubo, R. T. andJaneway Jr., C. A., Physical association of CD4 with the T cellreceptor. J. Immunol. 1992. 148: 678–688.

25 Dietrich, J., Neising, A., Hou, X., Wegener, A.-M. K., Gajhede,M. and Geisler, C., Role of CD3 + in T cell receptor assembly.J. Cell Biol. 1996. 132: 299–310.

26 Göbel, T. W. F. and Fluri, M., Identification and analysis of thechicken CD3 4 gene. Eur. J. Immunol. 1997. 27: 194–198.

27 Manolios, N., Kemp, O. and Li, Z. G., The T cell antigen receptor§ and g chains interact via distinct regions with CD3 chains. Eur.

J. Immunol. 1994. 24: 84–92.

28 Li, S., Satoh, T., Korngold, R. and Huang, Z., CD4 dimerizationand oligomerization: implications for T-cell function andstructure-based drug design. Immunol. Today 1998. 19:455–462.

29 Saizawa, K., Rojo, J. M. and Janeway, C. A., Jr., Evidence for aphysical association of CD4 and the CD3: § : g T-cell receptor.Nature 1987. 328: 260–263.

30 Janeway Jr., C. A., Dianzani, U., Portoles, P., Rath, S., Reich,E. P., Rojo, J. M., Yagi, J. and Murphy, D. B., Cross-linking andconformational change in T cell receptors: Role in activation andrepertoire selection. Cold Spring Harb. Symp. Quant. Biol. 1989.54: 657–666.

31 Alam, S. M., Davies, G. M., Lin, C. M., Zal, T., Nasholds, W.,Jameson, S. C., Hogquist, K. A., Gascoigne, N. R. J. and Tra-vers, P. J., Quantitative and quantitative differences in T cellreceptor binding of agonist and antagonist ligands. Immunity1999. 10: 227–237.

32 Kishimoto, H., Kubo, R. T., Yorifuji, H., Nakayama, T., Asano,Y. and Tada, T., Physical dissociation of the TCR-CD3 complexaccompanies receptor ligation. J. Exp. Med. 1995. 182:1997–2006.

33 Ojeda, G., Ronda, M., Ballester, S., Dıez-Orejas, R., Feito, M.J., Garcıa-Albert, L., Rojo, J. M. and Portoles, P., A hyperreac-tive variant of a CD4+ T cell line is activated by syngeneic antigenpresenting cells in the absence of antigen. Cell. Immunol. 1995.164: 265–278.

34 Wigzell, H., Specific affinity fractionation of lymphocytes usingglass or plastic bead columns. Scand. J. Immunol. 1976. 5,Suppl. 5: 23–30.

35 Criado, G., Feito, M. J. and Rojo, J. M., CD4-dependent and-independent association of protein tyrosine kinase to the TcR/CD3 complex of CD4+ mouse T lymphocytes. Eur. J. Immunol.1996. 26: 1228–1234.

36 Springer, T., Galfre, G., Secher, D. S. and Milstein, C., Mac-1:a macrophage differentiation antigen identified by monoclonalantibody. Eur. J. Immunol. 1979. 9: 301–306.

37 Forni, L. and de Petris, S., Use of fluorescent antibodies in thestudy of lymphoid cell membrane molecules. Methods Enzymol.1984. 108: 413–425.

38 Yagi, J., Baron, J., Buxser, S. and Janeway Jr., C. A., Bacterialproteins that mediate the association of a defined subset of T cellreceptor: CD4 complexes with class II MHC. J. Immunol. 1990.144: 892–901.

39 Rojo, J. M., Kerner, J. D. and Janeway, C. A., Jr., Selectiveinduction of growth factor production and growth factor receptorexpression by different signals to a single T cell. Eur. J. Immunol.1989. 19: 2061–2067.

40 Hong, S.-C., Chelouche, A., Lin, R., Shaywitz, D., Braunstein,N. S., Glimcher, L. and Janeway, C. A., An MHC interaction sitemaps to the amino-terminal half of the T cell receptor § chain var-iable domain. Cell 1992. 69: 999–1009.

41 Hong, S.-C., Sant’ Angelo, D. B., Dittel, B. N., Medzhitov, R.,Yoon, S. T., Waterbury, P. G. and Janeway Jr., C. A., The orien-tation of a T cell receptor to its MHC class II :peptide ligands.J. Immunol. 1997. 159: 4395–4402.

42 Kaye, J., Porcelli, S., Tite, J., Jones, B. and Janeway Jr., C. A.,Both a monoclonal antibody and antisera specific for determi-nants unique to individual cloned helper T cell lines can substi-tute for antigen and antigen-presenting cells in the activation ofT cells. J. Exp. Med. 1983. 158: 836–856.

43 Dittel, B. N., Sant’ Angelo, D. B. and Janeway, C. A. Jr., Pep-tide antagonists inhibit proliferation and the production of IL-4and/or IFN- + in T helper 1, T helper 2, and T helper 0 clones bear-ing the same TCR. J. Immunol. 1997. 158: 4065–4073.

44 Staerz, U. D., Rammensee, H. G., Benedetto, J. D. and Bevan,M. J., Characterization of a murine monoclonal antibody specificfor an allotypic determinant on T cell antigen receptor. J. Immu-nol. 1985. 134: 3994–4000.

45 Leo, O., Foo, M., Sachs, D. H. and Samelson, L., Identificationof a monoclonal antibody specific for a murine T3 polypeptide.Proc. Natl. Acad. Sci. USA 1987. 84: 1374–1378.

46 Havran, W. L., Poenie, M., Kimura, J., Tsien, R., Weiss, A. andAllinson, J. P., Expression and function of the CD3-antigenreceptor on murine CD4+8+ thymocytes. Nature 1987. 330:170–173.

47 Coulie, P. G., Uyttenhove, C., Wauters, P., Manolios, N.,Klausner, R. D., Samelson, L. E. and Van Snick, J., Identifica-tion of a murine monoclonal antibody specific for an allotypicdeterminant on mouse CD3. Eur. J. Immunol. 1991. 21:1703–1709.

Correspondence: Jose M. Rojo, Departamento de Inmuno-logıa, Centro de Investigaciones Biologicas, CSIC, Velaz-quez, 144, E-28006 Madrid, SpainFax: +34-91-562 7518e-mail: jmrojo — cib.csic.es

Eur. J. Immunol. 2000. 30: 1469–1479 Variability of CD3 4 chains 1479