Translational and morphological effects of signalling alcohols on C. albicans

A thesis submitted to the University of Manchester for the degree of Doctor of

Philosophy in the Faculty of Life Sciences.

2014

Nkechi Egbe

2

CONTENTS

CONTENTS ........................................................................................................................ 2

List of Figures ..................................................................................................................... 7

List of tables ........................................................................................................................ 9

List of Abbreviations ......................................................................................................... 10

Abstract ............................................................................................................................ 12

Declaration ........................................................................................................................ 13

Copyright statement ........................................................................................................... 13

Communications ................................................................................................................ 14

Acknowledgements ............................................................................................................ 15

1. Introduction ................................................................................................................... 16

1.1: The Problem of Fungal Pathogenicity ............................................................................. 16

1.2: Cellular Morphogenesis .................................................................................................. 19

1.3: Morphogenetic signalling pathways in Candida albicans ............................................... 22

1.3.1: The Mitogen-Activated protein kinase (MAP kinase) pathway in C. albicans. ....... 23

1.3.1.1 The MAP kinase module..................................................................................... 24

1.3.2: The cAMP – dependent Protein kinase pathway in C. albicans. .............................. 25

1.3.2.1 Upstream signalling components ........................................................................ 25

1.3.2.2 Adenylase cyclase, Phospodiestereses and cAMP levels .................................... 26

1.3.2.3 Protein kinase A (PKA) ...................................................................................... 27

1.3.2.4 Downstream effectors ......................................................................................... 28

1.3.2.5 Transcriptional repressors (Tup1, Nrg1 and Rfg1) and hyphal/pseudohyphal

growth ............................................................................................................................. 28

1.3.3 Tec1p and Cph2p: Convergent regulation of Cph1p and Efg1p ................................ 29

1.3.4: Summary of Cellular Morphogenesis ...................................................................... 32

1.4: The Cell Wall Integrity Pathway in C. albicans .............................................................. 33

1.4.1 Fusel Alcohols ........................................................................................................... 34

1.5: Protein Synthesis .............................................................................................................. 35

1.6: Translation pathway overview ......................................................................................... 36

1.6.1: Translation Initiation -the mechanism of translation initiation in Eukaryotes .......... 37

1.6.1.1 Formation of the 43S pre-initiation complex ...................................................... 39

1.6.1.2 mRNA preparation and selection ........................................................................ 40

1.6.1.3 43S preinitiation complex recruitment to the mRNA and mRNA scanning ....... 40

1.6.1.4 AUG recognition and 60S subunit joining .......................................................... 41

1.6.1.5 The eIF2 guanine nucleotide exchange cycle, eIF2B and the ternary complex .. 42

1.6.2 Translation initiation via other mechanisms -cellular internal ribosome entry sites .. 42

1.6.3 Translation Elongation ............................................................................................... 43

1.6.4 Translation Termination ............................................................................................. 45

1.6.5 Ribosome recycling.................................................................................................... 46

1.7 Detailed steps in the Translation Initiation pathway ......................................................... 46

3

1.7.1 The ternary complex cycle ......................................................................................... 46

1.7.1.1 Initiator tRNA ..................................................................................................... 47

1.7.1.2 eIF2 ..................................................................................................................... 47

1.7.2 eIF2B .......................................................................................................................... 48

The activity of translation initiation factors in C. albicans is less well understood. However

similar to S. cerevisiae ........................................................................................................... 48

1.7.3 mRNA selection pathway .......................................................................................... 51

1.7.3.1 eIF4E ................................................................................................................... 51

1.7.3.2 PABP ................................................................................................................... 52

1.7.3.3 eIF4A .................................................................................................................. 52

1.7.3.4 eIF4G .................................................................................................................. 53

1.8: Regulation of protein translation initiation ...................................................................... 56

1.8.1: Regulation by activation of the stress responsive eIF2α kinases .............................. 57

1.8.1.1 Mammalian eIF2α kinases .................................................................................. 58

1.8.1.2 eIF2α dephosphorylation .................................................................................... 59

1.8.1.3 Other mechanisms for eIF2B regulation ............................................................. 60

1.8.2 Regulation by eIF4E-binding proteins ....................................................................... 60

1.8.3 Amino acid starvation and GCN4 regulation ............................................................. 62

1.8.4: Translational response to membrane stress ............................................................... 67

1.9 Localisation of translation initiation factors ..................................................................... 68

1.9.1 Stress granules and processing bodies (P-bodies) ...................................................... 68

1.9.2 eIF2B Bodies ............................................................................................................. 68

1.10 Fusel alcohols .................................................................................................................. 70

1.10.1 The impact of fusel alcohols on protein translation ................................................. 71

1.10.2 Effect of alcohols on Candida albicans ................................................................... 73

1.10.3 Fusel alcohols induce morphological changes in yeast ............................................ 74

1.10.4 Alcohols induce morphological changes in Candida albicans ................................ 75

1.11 Farnesol a seisquiterepene alcohol .................................................................................. 76

1.11.1 Farnesol and quorum sensing in C. albicans ........................................................... 77

1.11.2 Mechanism of inhibition of hyphal growth by farnesol. .......................................... 79

1.12: Outline of Research ....................................................................................................... 80

2. Materials and Methods ................................................................................................... 82

2.1 Culture conditions ............................................................................................................. 82

2.1.1 Strains and growth conditions .................................................................................... 82

2.1.2 Monitoring the growth of yeast cultures .................................................................... 82

2.1.3 Bacterial strain and growth conditions ....................................................................... 83

2.1.4 Alcohol tolerance ....................................................................................................... 83

2.2 Morphogenesis assays ....................................................................................................... 83

2.2.1 Colony morphology in liquid media .......................................................................... 83

2.2.2. Colony morphology on solid media .......................................................................... 84

2.3 Manipulation of protein in vitro ........................................................................................ 85

2.3.1 Preparation of C. albicans cell extracts for Western analysis .................................... 85

4

2.3.2: Determination of protein concentration .................................................................... 85

2.3.3: Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis (SDS PAGE) ........ 86

2.3.4 Coomassie stain ......................................................................................................... 86

2.3.5: Western blotting ........................................................................................................ 86

2.3.6 [35

S] methionine incorporation assay ......................................................................... 87

2.3.7 GCN4 Reporter assays ............................................................................................... 88

2.3.8 Preparation of yeast cell extracts for Tandem Affinity Purification .......................... 88

2.3.9 Tandem Affinity Purification of proteins ................................................................... 89

2.3.10 Preparation of yeast cell extracts for FLAG-Affinity purification ........................... 89

2.3.11 FLAG Affinity purification of proteins.................................................................... 90

2.4 Polysome analysis ............................................................................................................. 91

2.4.1: Preparation of C. albicans cell extracts for polysome analysis ................................ 91

2.4.2: Preparation of sucrose gradients ............................................................................... 92

2.4.3: Sedimentation of polyribosomes ............................................................................... 92

2.5 Transformations ................................................................................................................ 94

2.5.1 Transformation of bacteria with plasmid DNA ......................................................... 94

2.5.2 Transformations into C. albicans ............................................................................... 94

2.6 Manipulation of DNA in vitro .......................................................................................... 95

2.6.1 Extraction of genomic DNA from yeast .................................................................... 95

2.6.2 Amplification of DNA by polymerase chain reaction ............................................... 95

2.6.3 Agarose gel electrophoresis ....................................................................................... 96

2.7 Microscopic analysis ......................................................................................................... 97

2.7.1 Slide preparation ........................................................................................................ 97

2.7.2 Epifluorescent microscopy ......................................................................................... 97

2.8 Formaldehyde cross-linked polysome analysis ................................................................. 98

2.8.1 Extract preparation ..................................................................................................... 98

2.8.2 Gradient fractionation and protein purification .......................................................... 98

2.9 RNA sequencing of polysome fractions ........................................................................... 98

2.9.1 Preparation of C. albicans extracts ............................................................................ 98

2.9.2 Extraction of RNA from the input and polysome fractions. ...................................... 99

2.9.3 Ribodepletion treatment to remove ribosomal RNA from the sample ....................... 99

2.9.3.1 Magnetic Beads preparation ................................................................................ 99

2.9.3.2 Treatment of the Total RNA sample with Ribo-Zero rRNA removal solution. 100

2.9.3.3 Magnetic Bead Reaction and rRNA Removal .................................................. 100

2.9.3.4 Purification of the rRNA-Depleted Sample ...................................................... 101

2.9.4 Assay for ribodepletion from RNA samples using Agilent RNA 6000 Nano Kit ... 101

2.9.4.1 Preparing the gel-dye mix ................................................................................. 101

2.9.4.2 Agilent RNA 6000 Nano Gel Electrophoresis .................................................. 101

2.9.4.3 Data analysis ..................................................................................................... 102

2.9.4.4 Quantitative real-time PCR ............................................................................... 103

2.10 Mass spectrometric analysis.......................................................................................... 103

2.10.3 Data Analysis ......................................................................................................... 104

5

3 Alcohols inhibit translation initiation in Candida albicans yet have opposing effects on

morphological transition ................................................................................................... 108

3.1 Introduction ..................................................................................................................... 108

3.2 Results ............................................................................................................................. 109

3.2.1 Different alcohols inhibit growth of both CAI4 and mutant (gcn2Δ) Candida albicans

.......................................................................................................................................... 109

3.2.2 Fusel alcohols and ethanol induce pseudohyphae formation in C. albicans, while

farnesol blocks it. .............................................................................................................. 114

3.2.3 Farnesol’s mode of action is predominant over butanol or serum ........................... 117

3.2.4 Inhibition of protein synthesis is a common response to alcohol ............................ 117

3.2.5 Fusel alcohols and farnesol inhibit translation initiation in a process that is

independent of the eIF2α kinase. ...................................................................................... 121

3.2.5 Does the signalling pathway that regulate morphogenesis also play a role in

translation initiation in C. albicans? ................................................................................. 126

3.2.6 Dephosphorylation of eIF2α by fusel alcohols and farnesol in C. albicans ........... 127

3.3 Discussion ....................................................................................................................... 133

4 Effects of various alcohols on the eukaryotic initiation factor 2B (eIF2B) ......................... 136

4.1 Introduction ..................................................................................................................... 136

4.2 Results ............................................................................................................................. 138

4.2.1 Butanol and ethanol induce the translation of GCN4 mRNA in a Gcn2p independent

manner in C. albicans ....................................................................................................... 138

4.2.2 Effect of alcohols on the cellular localisation of eIF2B ........................................... 143

4.2.2.1 Generating strains ............................................................................................. 143

4.2.3 Alcohols do not affect the localisation of eIF2B subunits to the eIF2B body ......... 147

4.2.4 Effect of alcohols on the dynamics of the eIF2B body ............................................ 147

4.2.5 Purification of eIF2B and eIF2 subunits from C. albicans for Mass spectrometry . 148

4.2.5.1 Strategy for V5S-His6x tagging of GCD1 in C. albicans ................................. 152

4.2.5.2 Purification of proteins from V5-6xHis tagged strains. .................................... 152

4.3.5.3 Construction of the 4X-FLAG-URA3dpl tagging cassette ................................ 156

4.2.5.4 FLAG affinity purification of eIF2B for analysis by mass spectrometry ......... 161

4.3 Discussion ....................................................................................................................... 165

5 Farnesol inhibits translation initiation in Candida albicans in a pathway that targets some

aspect of 48S preinitiation complex formation ................................................................... 168

5.1 Introduction ..................................................................................................................... 168

5.2 Results ............................................................................................................................. 169

5.2.1 MLY61 strain of S. cerevisiae exhibited similar translational responses to fusel

alcohol and farnesol as C. albicans ................................................................................... 169

5.2.2 Farnesol causes resedimentation of specific translation factors in MLY61 strain of S.

cerevisiae .......................................................................................................................... 173

5.2.3 Tandem affinity purification (TAP) of eIF4G1 ....................................................... 177

5.3 Discussion ....................................................................................................................... 181

6 RNA sequencing reveals a global change in gene expression following treatment with farnesol

in C. albicans .................................................................................................................. 183

6.1 Introduction ..................................................................................................................... 183

6

6.2 Results ............................................................................................................................. 184

6.2.1 RNA isolation from input and polysome samples ................................................... 184

6.2.2 Enrichment of mRNA and processing of enriched sample for RNA sequencing .... 184

6.3 Analysis of gene expression from the sequencing data .................................................. 188

6.4 Clarifying the translational regulation of TUP1 mRNA by q RT-PCR. ......................... 197

6.5 Validation of some of the transcriptional changes that are relevant to filamentation and

stress response using qRT-PCR ............................................................................................ 198

6.5 Discussion ....................................................................................................................... 201

7 General discussion ........................................................................................................ 203

7.1 Alcohols inhibit translation initiation in C. albicans in addition to exerting opposing

effects on growth morphology .............................................................................................. 204

7.1.1 Role of Sit4p in eIF2αP dephosphorylation ............................................................. 206

7.1.2 Alcohols affect morphogenesis ................................................................................ 207

7.2 Movement of the eIF2B body is impeded by fusel alcohol, but not farnesol ................. 208

7.2.1 Biochemical analysis of eIF2B ................................................................................ 209

7.3 The formation of the 48S preinitiation complex is affected by farnesol treatment. ........ 210

7.4 Transcriptomic analysis reveals a global change in gene expression following farnesol

treatment of C. albicans ........................................................................................................ 212

7.5 Concluding remarks and future perspectives .................................................................. 214

8. Bibliography ................................................................................................................ 217

9. Appendix ..................................................................................................................... 233

Word count: 55,656

7

List of Figures

Figure 1.1 Conserved MAP-Kinase and cAMP-dependent PKA pathways regulate

morphogenesis in C. albicans (30)

Figure 1.2 Eed1 mediates the elongation of germ tubes to hyphae (32)

Figure 1.3 Overview of Translation Initiation (38)

Figure 1.4 Structure of the ribosome showing the large and the small subunits (45)

Figure 1.5 Translational initiation control (57)

Figure 1.6 a A model for translational control of yeast GCN4 under non starvation

condition (64)

Figure 1.6 b A model for translational control of yeast GCN4 under starvation

condition (65)

Figure 1.7 Ehrlich pathway for fusel alcohol production from branched chain amino

acids. (71)

Figure 1.8 Chemical structure of farnesol (3,7,11-trimethyl-2,6,10-dodecatrien-1-ol)

(77)

Figure 2.1. An example of a polysome trace from actively translating cells and

following translation. (93)

Figure 3.1 Butanol inhibits growth of Candida albicans wildtype (CAI4) and mutant

(gcn2Δ) strains in a dose dependent manner (111)

Figure 3.2 Ethanol inhibits growth of Candida albicans wildtype (CAI4) and mutant

(gcn2Δ) strains in a dose dependent manner. (112)

Figure 3.3 The quorum sensing molecule, farnesol inhibits growth of Candida albicans

wildtype (CAI4) and mutant (gcn2Δ) strains in a dose dependent manner (113)

Figure 3.4 The effect of farnesol on filament formation in C. albicans competes with

the effect of serum or butanol. (115)

Figure 3.5 The effect of farnesol on filament formation in C. albicans competes with

that of serum or butanol (116)

Figure 3.6 Inhibition of protein synthesis in response to alcohol (119)

Figure 3.7 Translation initiation is inhibited by alcohols in the CAI4 strain (120)

Figure 3.8 Translation initiation is inhibited by alcohols in a gcn2Δ strain (123)

Figure 3.9 Polysome/monosome ratio of WT and gcn2∆ mutant strains shows similar

pattern of inhibition of translation for the two strains. (124)

Figure 3.10 Effect of farnsol and butanol on different transcriptional regulator mutants.

(125)

Figure 3.11 Butanol causes a dose dependent decrease in eIF2α serine 51

phosphorylation (eIF2α-P) in the wild type CAI4 strain. (130)

Figure 3.12 Ethanol seems to have no effect on the level of eIF2α serine 51

phosphorylation (eIF2α-P) in the wild type CAI4 strain. (131)

Figure 3.13 Farnesol causes a dose dependent decrease in eIF2α serine 51

phosphorylation (eIF2α-P) in the wild type CAI4 strain (132)

Figure 4.1 Alcohols impact on the general control pathway in C. albicans in a Gcn2p

independent manner (141)

Figure 4.2 Alcohols induce GCN4 expression in C. albicans in a Gcn2p independent

manner. (142)

Figure 4.3 Verification of GFP tagged CAI4 strain (145)

Figure 4.4 GFP tagging of GCD1 shows that eIF2Bγ is present in an eIF2B body. (146)

Figure 4.5 Alcohols do not affect the localisation of eIF2Bγ subunits to eIF2B bodies.

(149)

8

Figure 4.6 Butanol impedes the movement of eIF2B bodies. (150)

Figure 4.7 Butanol impedes movement of eIF2B bodies (151)

Figure 4.8 Verification of GCD1-V5-6xHis-tagged and SUI3 V5-6xHis-tagged CAI4

strains (154)

Figure 4.9 Affinity purification of V5-6xHis tagged eIF2B. (155)

Figure 4.10 Strategy for tagging the two alleles of C. albicans genes using the mini

Ura-blaster technique (158)

Figure 4.11 Verification of genomic C-terminal FLAG tagging of the first allele of

GCD1 in CAI4 strain (159)

Figure 4.12 Verification of genomic C-terminal FLAG tagging of the second allele of

GCD1 in CAI4 strain (160)

Figure 4.13 FLAG affinity purification of eIF2B (163)

Figure 5.1 Translational initiation is inhibited by farnesol similarly in CAI4 strain of C.

albicans and MLY61 strain of S. cerevisiae. (171)

Figure 5.2 Butanol and farnesol cause a dose dependent decrease in eIF2α serine 51

phosphatase (eIF2α-P) in the wild type S. cerevisiae MLY 61 strain. (172)

Figure 5.3 Protocol overview for formaldehyde crosslinking (175)

Figure 5.4 Farnesol affects the association of the specific translation factors with the

ribosomes (176)

Figure 5.5 Effect of farnesol on translation factors eIF4G and eIF4E was not observed

after probing with antibodies (179)

Figure 5.6 Farnesol causes the depletion of the factors that associate with the closed

loop complex downstream. (180)

Figure 6.1 Strategy of experiment for RNA sequencing of polyribosomal fractions

(186)

Figure 6.2 Flow chart for RNA sequencing (187)

Figure 6.3A Illumina Hiseq sequencing of input (total) RNA shows global changes at

the transcriptional level following farnesol treatment of C. albicans culture (193)

Figure 6.3B Illumina Hiseq sequencing of the input and polyribosomal fractions shows

global changes at the translation level following farnesol treatment of C. albicans

culture (194)

Figure 6.4A Functional annotation reveals differential regulation of certain categories

of genes (195)

Figure 6.4B Functional annotation reveals differential regulation of certain categories

of genes (196)

Figure 6.4C Functional annotation of mRNAs that are not coregulated at the

transcription and translation level. (197)

Figure 6.5 Farnesol causes redistribution of TUP1 mRNA from the polysome to the

submonosomal fraction (199)

Figure 6.6 Verification of gene expression analysis by quantitative real-time PCR

(qRT-PCR) (200)

Figure 7.1 Model for the impact of various alcohols on protein synthesis in C. albicans

and S. cerevisiae (216)

9

List of tables

Table 1.1 Distinguishing features of hyphae and pseudohyphae formed by C. albicans

(20)

Table 1.2 Protein subunits and gene names for eIF2, eIF2B, the protein kinase Gcn2p

and the transcription factor Gcn4p (50)

Table 1.3 The protein subunits and gene names of the eIF4F complex, as well as the

interacting proteins Pab1 and the ribosomal protein Rps3 (55)

Table 2.1 Sucrose solutions for gradient preparation (92)

Table 2.2 Candida albicans strains used in this study (105)

Table 2.3 S. cerevisiae strains (105)

Table 2.4 Plasmids used in this study (106)

Table 2.5 Primary antibodies used in this study (106)

Table 2.6 Oligonucleotides used in this study (106)

Table 3.1 Summary of effects of various alcohols on the physiology of C. albicans

strains (135)

Table 4.1 Identification of the eIF2B subunits by mass spectrometry (MS) analysis

(162).

Table 4.2 Treatment with butanol had no observable effect on the levels of eIF2B

subunits (164)

Table 6.1 Assessment of the sequencing reads mapping to different RNA types in the

samples (188)

10

List of Abbreviations

α Alpha

β Beta

∆ Delta

µ Micro

aa-tRNA Amino acid-bound tRNA

AIDS Acquired immune deficiency syndrome

ATF4 Activating transcription factor 4

ATP Adenosine triphosphate

bp Base pairs

C. albicans Candida albicans

cAMP Cyclic adenosine monophosphate

Cd2+

SO4 Cadmium sulphate

DEPC Diethylpyrocarbonate

DIC Differential interference contrast

DNA Deoxyribonucleic acid

dNTP Deoxyribonucleotide

DTT Dithiothreitol

ECL Electrochemiluminescence

EDTA Ethylenediaminetetraacetic acid

eEF Eukaryotic elongation factor

eIFs Eukaryotic initiation factor

eRF Eukaryotic release factor

ER Endoplasmic reticulum

FBS Fetal bovine serum

g Gram(s)

GAAC General amino acid control

GAPDH Glyceraldehyde-3-phosphate dehydrogenase

GCRE Gcn4-response elements

Gcn General control non-derepressible

Gcd General control derepressed

GDP Guanosine diphosphate

GEF Guanine nucleotide exchange activity

GFP Green fluorescent protein

GlcNAc N-acetylglucosamine

GRX1 Glutaredoxin genes

GTP Guanosine triphosphate

HEPES 4-(2-hydroxyethyl)-1-piperazineethanesulfonic acid

HisRS Histidyl tRNA synthetase

HIV Human immunodeficiency virus

H2O2 Hydrogen peroxide

HOG1 High osmolarity glycerol response 1

HRI Heme-regulated inhibitor

HRP Horseradish peroxidase

ISR Integrated stress response

IRES

k

Internal ribosome entry sites

Kilo (prefix)

l Litre(s)

LB Luria-Bertani media

M Milli (prefix)

M Molar

MAPK Mitogen-activated protein kinase

m7GTP 7-methyl-guanosine triphosphate

Met-tRNAMet

Initiator methionyl-tRNA

MFC Multi factor complex

MMS Methyl methanesulfonate

11

Mn Manganese

Mnk Mitogen activated protein kinase signal-integrating kinases

mRNA Messenger RNA

mRNP Messenger ribonucleoprotein

mTORC Mammalian target of rapamycin complex 1

n Nano (prefix)

N. crassa Neurospora crassa

NIH National institute of health

Nrf2 Nuclear factor (erythroid-derived 2)-like 2

OD Optical density

ORF Open reading frame

P Phosphorylation

PABP Poly(A)-binding protein

P-bodies Processing bodies

PCR Polymerase chain reaction

PEG Polyethylene glycol

PERK/PEK PKR endoplasmic reticulum eIF2α kinase

PKR Double stranded RNA-activated protein kinase

PMSF Phenylmethylsulfonylfluoride

Rev Revolution

RLUC Renilla luciferase

RNA Ribonucleic acid

ROS Reactive oxygen species

Rpm Revolutions per minute

rRNA Ribosomal RNA

RT-PCR Real time-PCR

SC Synthetic complete

S. cerevisiae Saccharomyces cerevisiae

SD Synthetic minimal

SG Stress granule

siRNA Small interfering RNA

Sod Superoxide dismutase

Spp Species

SUI Supressor of initiation

TAE Tris base, acetic acid, EDTA

TC Ternary complex

TCA Tricarboxylic acid

Tef1 Translation elongation factor 1

TEMED Tetramethylethylenediamine

TOR Target of rapamycin

tRNA Transfer RNA

Tm Melting temperature

uORF Upstream open reading frame

UTR Untranslated region

UV Ultraviolet

v/v Volume per volume

w/v Weight per volume

WT Wild-type

YEPD Yeast extract peptone dextrose

2-DE Two-dimensional gel electrophoresis

3AT 3-amino-1,2,4-triazole

4E-BP 4E-binding protein

5-FOA 5-fluoroorotic acid

12

Abstract

Candida albicans is a polymorphic yeast that can cause life threatening systemic

infections in immunocompromised individuals. One key attribute of C. albicans that

enhances its pathogenicity is the ability to switch morphologies between filamentous

and vegetative modes in response to specific environmental conditions. Stressful

changes in such cellular conditions commonly cause a rapid inhibition of global protein

synthesis leading to altered programmes of gene expression. In Saccharomyces

cerevisiae, fusel alcohols signal nitrogen scarcity and induce pseudohyphal growth

enabling yeast colonies to spread towards nutrient replete areas. These alcohols also

inhibit protein synthesis by targeting the translation initiation factor, eIF2B. eIF2B is

the guanine nucleotide exchange factor for eIF2, which supports eIF2-GTP production

and represents a key regulated step in translation initiation. eIF2-GTP interacts with

Met-tRNAiMet

to form the ternary complex which is essential for translation initiation.

Fusel alcohols target eIF2B leading to reduced levels of ternary complex and reduced

protein synthesis.

In Candida albicans, a variety of cell biological and genetic assays suggest that fusel

alcohols and ethanol inhibit protein synthesis by targeting the translation initiation

factor, eIF2B, and they also induce hyphal/pseudohyphal growth, a process that is

associated with pathogenesis in C. albicans. In contrast to fusel alcohols, farnesol, a

quorum sensing alcohol, does not appear to impact upon eIF2B activity. Rather,

biochemical and mass spectrometric analysis suggest farnesol affects the interaction of

the mRNA with the small ribosomal subunit during translation initiation. Further

elucidation of the effect of farnesol on C. albicans transcript levels and ribosome

association by next generation sequencing gave insight into the genes that are

differentially expressed following farnesol treatment. While genes involved in

morphological differentiation were generally repressed, those involved in protein

synthesis were upregulated, possibly as an adaptive response to inhibition of protein

synthesis by farnesol. Intriguingly, the regulation of these functional categories of genes

occurred in a co-ordinated manner at either the transcript level or at the level of

ribosome association, but rarely was gene expression regulated at both transcriptional

and post-transcriptional levels for the same gene.

Nkechi E. Egbe

The University of Manchester

A thesis submitted to the University of Manchester for the degree of Doctor of

Philosophy in the Faculty of Life Sciences. 2014

Translational and morphological effects of signalling alcohols on C. albicans

13

Declaration

No portion of the work referred to in the thesis has been submitted in support of an

application for another degree or qualification of this or any other university or other

institute of learning

Copyright statement

I. The author of this thesis (including any appendices and/or schedules to this

thesis) owns certain copyright or related rights in it (the “Copyright”) and s/he

has given The University of Manchester certain rights to use such Copyright,

including for administrative purposes.

II. Copies of this thesis, either in full or in extracts and whether in hard or

electronic copy, may be made only in accordance with the Copyright, Designs

and Patents Act 1988 (as amended) and regulations issued under it or, where

appropriate, in accordance with licensing agreements which the University has

from time to time. This page must form part of any such copies made.

III. The ownership of certain Copyright, patents, designs, trade marks and other

intellectual property (the “Intellectual Property”) and any reproductions of

copyright works in the thesis, for example graphs and tables (“Reproductions”),

which may be described in this thesis, may not be owned by the author and may

be owned by third parties. Such Intellectual Property and Reproductions cannot

and must not be made available for use without the prior written permission of

the owner(s) of the relevant Intellectual Property and/or Reproductions.

IV. Further information on the conditions under which disclosure, publication and

commercialisation of this thesis, the Copyright and any Intellectual Property

and/or Reproductions described in it may take place is available in the

University IP Policy (see

http://documents.manchester.ac.uk/DocuInfo.aspx?DocID=487), in any relevant

Thesis restriction declarations deposited in the University Library, The

University Library’s regulations (see

http://www.manchester.ac.uk/library/aboutus/regulations) and in The

University’s policy on Presentation of Theses

14

Communications

Nkechi Egbe, Mark P. Ashe. Understanding the mechanism of inhibition of protein

synthesis by signalling molecules in Candida albicans. Oral presentation-FLS PhD

Conference Manchester, 2014

Nkechi E. Egbe, Mark P. Ashe. Quorum sensing, protein synthesis and morphological

transitions in Candida albicans. Poster presentation- SGM Autumn Conference UK

2013

Nkechi E. Egbe, Mark P. Ashe. Different alcohols inhibit translation initiation by

distinct mechanisms in yeast correlating with effects on morphological transitions.

Poster presentation-Translation UK 2013

Nkechi E. Egbe, Mark P. Ashe. The impact of alcohols on translation initiation in the

human fungal pathogen Candida albicans. Poster presentation-Translation control

Cold Spring Harbor 2012

Nkechi E Egbe, Caroline M Paget, Hui Wang and Mark P Ashe. Alcohols inhibit

translation to regulate morphogenesis in C. albicans J Fung Genet Biol. In press

15

Acknowledgements

Firstly I want to thank my supervisor, Dr Mark Ashe who gave me this opportunity to

accomplish a key aim in my career. He inspired me with his vast knowledge on diverse

areas and was always willing to answer my questions regarding my research. He is a

model supervisor. Special thanks to my advisor, Prof Chris Grant for our useful

meetings and for providing strains. Many thanks to Prof Graham Pavitt for his input

during lab meetings and journal clubs. In addition I would like to thank Prof Alistair

Brown, Dr Stephen Milne and Prof Joe Heitman for providing some of the strains used

in this research.

I also want to acknowledge Prof Theodore White for suggesting RNA sequencing of

input and polysome fractions following farnesol treatment.

I am grateful to team MASHE (past and present): Jenny, Hui, Kazz, Claire, Jemma,

Pete, Hassan, Reem, Vittoria, Henry, Gbenga, Fabian, Kathy and Tawni for their help

and friendship. Special regards to the LOLA group: Lydia, Chris and Joe for helping out

with protocols on protein and RNA work.

Many thanks to the Grant and Pavitt lab members for their help in providing some of

the reagents I needed when our lab has run out. I say a huge thank you to Arunkumar,

my partner in Candida work; he has been very helpful, and also a good lab neighbour.

I would not have come this far in my programme without the help and prayers of my

family and brethren. To my husband and children: Chukwuka (Snr), Chukwuka(Jnr),

Chukwunonso, Uchenna and Chinenye; my sisters, brothers and mum, thank you all for

holding the fort for these four long years while I was away in search of the golden

fleece.

My regards to my sponsors, the Tertiary education Trust Fund for providing the funding

for this thesis.

To the Almighty God who has made all these possible, I say praise be to his holy name.

16

1. Introduction

1.1: The Problem of Fungal Pathogenicity

Yeasts belong to the large and diverse fungal kingdom. These ubiquitous

microorganisms appear in various forms and inhabit a whole range of different

environments. Fungi are heterotrophic organisms, which possess a chitinous cell wall

and sterol containing cell membranes. Several species are pathogens of human or other

animals and plants. The most frequently diagnosed fungal infections of humans are

caused by pathogens from the genera Candida, Aspergillus and Cryptococcus

(Richardson 2005). Single-celled yeasts belong to the phylum Ascomycota and this

phylum contains the order Saccharomycetales consisting of the most prominent genera

Saccharomyces and Candida. The genus Candida was formerly of the order

Cryptococcales. Traditionally, species within the genus have been classified and

identified on the basis of a limited number of morphological features such as production

of true hyphae, formation of chlamydospores and the assimilation of a range of nutrients

as the sole source of carbon or nitrogen. The genus Candida is the form genus

consisting of an array of yeast species in which no complete sexual cycle has been

observed (Kwon-Chung and Bennett 1992; Forche et al. 2008). Although an elaborate

mechanism for mating can still be operational (Kim and Sudbery 2011). In C. albicans,

mating occurs between diploid mating type-like (MTL) a and α strains to generate an

a/α tetraploid strain. The resulting tetraploids then undergo efficient, random

chromosome loss resulting in diploid cells. (Forche et al. 2008). Mating occurs both

under laboratory conditions and different invivo niches (Hull et al. 2000). Efficient

mating requires that the diploid cells of opposite mating type first switch morphology

from the more common ‘white’ phase to the ‘opaque’ phase and then undergo cell

fusion (Miller and Johnson 2002).

17

Candida species is a normal part of the human microflora. They usually reside as

commensal organisms on the skin, in the gastrointestinal tracts and/or in the

genitourinary tracts of mammalian hosts. As such, they can be detected in

approximately 50% of the human population in this form (Jarvis 1995).

However, Candida species especially C. albicans, is an opportunistic pathogen and if

the balance of the normal microflora is disrupted or the immune system is

compromised, as in cancer, transplant or AIDS patients, Candida infections pose a

specific and major problem; as they can quickly become the cause of morbidity.

Individuals with healthy immune systems limit Candida growth at mucosal sites. In

contrast, a compromised immune system often leads to mucocandidiasis, oral thrush or

systemic candidiasis in which the fungus can spread to all major organs of the body

(Pfaller and Diekema 2007). Candidiasis (infection caused by Candida species) is

increasing in an ever-expanding population of immunodeficient patients. As a result,

Candida species now rank among the top four microbes isolated from clinical

specimens (Pfaller and Diekema 2007) and mortality attributed to bloodstream

infections caused by Candida species approaches 35% (Pittet and Wenzel 1995).

Common risk factors for bloodstream candidiasis include extremes of age (low-birth

weight infants and the elderly), immunosuppression, malignancy with leukopenia,

major abdominal surgery, trauma, burns, chemotherapy or radiotherapy as well as

exposure to multiple antibacterial agents, central venous catheterization, prolonged

length of stay in intensive care units and parenteral nutrition (Jarvis 1995).

The most common species that cause candidiasis is C. albicans, but others, such as C.

glabrata, C. parapsilopsis and C. dublinensis, can be associated with disease; however,

C. albicans is generally regarded as the most virulent of all Candida species.

Pathogenesis of C. albicans requires differential expression of virulence factors at each

new stage of the process. Some of these virulence attributes are the ability to exist in

18

various morphologies, expression of surface adhesion molecules to colonise epithelial

surfaces, range of proteolytic enzymes such as secreted aspartyl proteinases (SAP) and

lipases, that are required for nutrient acquisition and invasion of epithelial surfaces

(Ross et al. 1990; Cutler 1991).

Candida albicans is a dimorphic pathogenic fungus alternating between the vegetative

(yeast) form and filamentous (pseudohyphae or hyphae) form.

Fusel alcohols such as 1-butanol, isoamyl alcohol, active amyl alcohol are products of

amino acid catabolism in yeast, and their production is associated with nitrogen

starvation. Fusel alcohols have been shown to affect various cellular processes such as

protein translation initiation in S. cerevisiae (Ashe et al. 2001) and morphogenesis

(pseudohyphal formation) in S. cerevisiae and C. albicans (Dickinson 1996).

Farnesol, an acyclic sesquiterpene alcohol is produced and secreted predominantly by

two species of Candida: Candida albicans and Candida dubliniensis. Apart from

transcriptional activation, farnesol has been shown to prevent yeast-to-hyphae transition

and most likely as a result inhibits the colonization of several matrices, such as

polystyrene or tissues by C. albicans (Ramage et al. 2002; Kruppa 2009).

Ethanol is a byproduct of the metabolism of glucose in S. cerevisiae, C. albicans and

other fungi. However C. albicans produce less ethanol than S. cerevisiae, as their

metabolism is more geared towards respiration. Ethanol has been shown to inhibit

protein translation in S. cerevisiae and induce germ tube formation in C. albicans

(Pollack and Hashimoto 1985). Ethanol also has a wide use in medical practice due its

antiseptic properties against a variety of micro-organisms including Candida species.

19

1.2: Cellular Morphogenesis

The ability to switch between unicellular yeast cells and filamentous forms, such as

hyphae and pseudohyphae, in response to diverse stimuli is important for fungal

pathogenicity (D'Souza and Heitman 2001). The hyphal form is particularly associated

with virulence attributes, including passage through host tissues and defence against

immune cells. (Fernandez-Arenas et al. 2007). However, there is no absolute

relationship between hyphal growth and pathogenesis because many clinically relevant

fungi including Histoplasma capsulatum and Coccidiodes imitis, are pathogenic in yeast

form and saprophytic in hyphal form (Nemecek et al. 2006; Wang et al. 2012).

Candida albicans undergoes reversible morphological transitions between ovoid,

unicellular budding cells (yeast cells) and chains of filamentous cells (pseudohyphae or

hyphae). It is also capable of producing chlamydospores usually believed to be dormant

growth forms (Odds 1988). Therefore, C. albicans has the ability to adopt a spectrum of

morphologies and mechanisms responsible for morphological switching have received a

great deal of attention (Reviewed in Sudbery et al. 2004).

During the switch from vegetative yeast-form growth to the hyphal form, the production

of germ tubes appears to represent a key first stage (Biswas and Morschhauser 2005).

The conversion of yeast form cells to pseudohyphae occurs as a result of polarized cell

division when yeast cells growing by budding have elongated without detaching from

adjacent cells. As a result, filaments composed of elongated cells with constrictions at

the septa are formed. Sometimes the buds elongate so much that they resemble true

hyphae. However as shown in Table 1.1, various subtle distinctions have been identified

between hyphae and pseudohyphae (Sudbery et al. 2004).

20

Table 1.1 Distinguishing features of hyphae and pseudohyphae formed by C.

albicans (Sudbery et al. 2004).

Despite the observed differences between hyphae and pseudohyphae, it is interesting

that similar environmental conditions induce these morphologies, with the balance

being tipped towards hyphae as the conditions become more extreme (Sudbery et al.

2004).

A second morphological switch involves the interconversion between white and opaque

forms of C. albicans. This is an epigenetic switch that allows rapid and reversible

switching between cells in white colonies that are round and cells in opaque colonies

that are ellipsoidal (Slutsky et al. 1987). Cells from white colonies are similar in shape,

size, and budding pattern to cells of common laboratory strains. In contrast, cells from

opaque colonies are elongate, or bean shaped, and twice as large as the white cells.

‘Opaque’ cells also undergo filamentation, but they do so in response of different

environmental cues than those of ‘white’ cells (Si et al. 2013).

Criterion Hyphae Pseudohypha

Shape Sides parallel Sides not parallel

Septa No constrictions at septal junctions Constrictions at mother-bud neck

and subsequent septal junctions

First septum within the germ tube First septum at the mother

bud neck

Cell width Width ~2µ Minimum width ≥ 2.8µ

Septins Septin ring within germ tube Septin ring at mother-bud neck

Filaments Less branches, cell cycle not Highly branched with cell cycle

synchronised synchrony

21

Under extreme non-optimal growth conditions rather than forming hyphae or

pseudophyphae, C. albicans can undergo the formation of chlamydospores, which are

round, retractile spores with a thick wall. These are thought to function as dormant

cellular forms (Raudonis and Smith 1982; Staib and Morschhäuser 2007).

The yeast to hyphae transition in C. albicans is induced in response to several

environmental conditions. Parameters that promote hyphal development in vitro include

temperatures above 37oC, a pH greater than 6.5, serum, proline or N-acetylglucosamine,

low dissolved oxygen concentrations and elevated CO2 concentrations, nitrogen or

carbon starvation; while high cells densities inhibit hyphal development (Brown and

Gow 1999; Klengel et al. 2005). It has become clear that an increase in temperature to

about 37oC is particularly important, being required before most of the above conditions

can impact on morphogenesis. An exception to this is embedded C. albicans cells which

form hyphae even at 25oC (Brown and Gow 1999). The production of unicellular yeast

forms is stimulated by lower temperatures and more acidic pH, absence of serum and

high concentrations of glucose.

Recently, quorum sensing has been described as a phenomenon contributing to

morphogenetic control in C. albicans. Dependence on cell density has been shown to be

one of the effects that contribute to yeast to hyphae transition in vitro; and this has been

termed the ‘inoculum effect’ (Kruppa 2009). The inoculum effect is observed when

yeast cells are diluted to concentrations less than 106 cells ml

-1 in culture medium;

conditions which induce germ tube formation. However, when cells are inoculated at

higher concentrations (›106 cells ml

-1), they remain predominantly in a yeast state. The

term inoculum effect has been associated with regulation by quorum sensing (Kruppa

2009) and one of the molecules that is considered important for this is farnesol, a

quorum sensing molecule (QSM) of C. albicans (Hornby et al. 2001).

22

Thus the morphological transitions are often a response of the fungus to changing

environmental conditions and it has been hypothesized that these form part of a

mechanism permitting adaptation to a different biological niche. Evidence supporting

this hypothesis includes the fact that strains of C. albicans defective in morphogenesis

are attenuated in terms of virulence and hence their capacity to cause systemic

candidiasis. These experiments correlated the avirulent phenotype of C. albicans

mutants with that of a failure to form hyphae in a mouse model (Lo et al. 1997).

However virulence is a complex trait with both the yeast and hyphal switching of C.

albicans thought to play vital roles in pathogenesis, as mutants lacking genes

responsible for the production of either trait are less virulent (Calderone and Fonzi

2001).

1.3: Morphogenetic signalling pathways in Candida albicans

Hyphal development in C. albicans is determined by a broad range of signals or culture

conditions in vivo. According to Liu (2001) many signalling pathways or regulators

have been found to influence filamentation in various in vitro hyphae-inducing

conditions. These signalling pathways are complex and comprise several pathways

encompassing crosstalk and feedback. Despite the diversity of external signals

promoting dimorphic transition in several fungal species, pathways transducing these

external signals to the cellular machinery are highly conserved (D'Souza and Heitman

2001). This has allowed the identification of components of these pathways based on

the insight gained from studies of pseudohyphae formation in S. cerevisiae (Lengeler et

al. 2000).

The major morphogenetic signalling pathways in C. albicans are: the Cek1p Mitogen-

Activated Protein Kinase pathway, the cyclic Adenosine Monophosphate (cAMP)-

dependent Protein Kinase A pathway, the Czf1p pathway (induced by embedding in a

23

solid matrix) (Brown and Gow 1999) and the Rim 101p pathway induced in response to

pH alterations (Liu 2001). In addition, two negative regulators of filamentous growth

act through the transcriptional regulator Tup1p (Braun and Johnson 1997) associated

with Nrg1p (Braun et al. 2001) and Rfg1p (Kadosh and Johnson 2001) respectively.

1.3.1: The Mitogen-Activated protein kinase (MAP kinase) pathway in C. albicans.

The first morphogenetic signalling components to be identified in C. albicans were

members of a mitogen activated protein (MAP) kinase pathway similar to the

pheromone signalling and morphogenetic signalling pathway in S. cerevisiae (Monge

et al. 2006). Mitogen-activated protein kinase signalling cascades are widely used

mechanisms in eukaryotic cells coupling environmental cues to transcriptional

regulation. Four MAPKs have been identified in C. albicans (Navarro-Garcia et al.

2005; Roman et al. 2009). They are the Cek1p-mediated pathway involved in

morphogenesis and hyphal formation (Whiteway 2000), the Cek2p pathway with a role

in mating (Chen et al. 2002). Others are the cell integrity pathway, culminating in the

Mkc1 MAPK, which plays a role in cell wall construction, the response to certain stress

conditions (Navarro-Garcia et al. 2005) and biofilm formation (Kumamoto 2005) and

the High Osmolarity Glycerol (HOG) pathway, which enables adaptation to both

osmotic and oxidative stress (Alonso-Monge et al. 1999; Arana et al. 2005).

The morphogenetic or Cek1p MAPK cascade of C. albicans comprising the Cst20p

(MAPK kinase kinase; PAK (P21-activated protein kinase) (Leberer et al. 1996); Hst7p

(MAPK kinase; MEK (MAPK/ERK kinase), Cek1 (MAPK) (Liu et al. 1994; Leberer et

al. 1996; Csank et al. 1997) are all required for hyphal morphogenesis, invasive hyphal

growth and virulence.

24

1.3.1.1 The MAP kinase module

The core of the MAPK pathway is a Map kinase module (Cst20p, Hst7p, Cek1p) which

is activated by Cst20p (Fig. 1.1). When upstream signals are fed into the MAPK kinase

kinase (Cst20p), it becomes phosphorylated and in turn phosphorylates the MAPK

kinase, which in turn phosphorylates the MAPK. A MAPK cascade normally transmits

and amplifies the signal to downstream transcription factors that generate a specific

adaptive response. (Monge et al. 2006). The transcription factor, Cph1p, which is

homologous to the Ste12p transciption factor in S. cerevisiae, lies downstream of the

MAPK module. (Liu et al. 1994). Null mutants of the MAPK pathway (Cst20, Hst7 or

Cek1) or the transcription factor Cph1 all display a defect in hyphal development on

solid medium in response to many inducing conditions (Liu 2001).

In addition to these components, homologous MAP Kinase Phosphatases, Cpp1p and

Cpp2p, have been identified which regulate filamentous growth in C. albicans (Csank et

al. 1997). Disruption of both alleles of the CPP1 gene results in a hyperfilamentous

phenotype. The cpp1/cpp2 mutant strains are also reduced for virulence in both

systemic and localized models of candidiasis (Csank et al. 1997). Activation of MAPK

pathway can occur through Cdc42p, which itself binds with high affinity to the Cst20

kinase (Leberer et al. 1997).

Cek1p MAPK activity and/or expression could also be regulated by quorum sensing

(QS). Two QS molecules tyrosol and farnesol recently identified in C. albicans have

been shown to be involved in morphogenesis (Hornby et al. 2001) and studies have

shown that farnesol reduces the levels of both the HTS7 and CPH1 mRNAs (Sato et al.

2004).

However, a key consideration that was recognised in early studies of this pathway in C.

albicans, is that in the presence of serum, all of the MAPK pathway mutants are able to

undergo filamentous growth, thus indicating that this pathway is neither the only

25

mechanism leading to hyphal formation nor is it likely to be the main one in

pathogenesis (Liu 2001).

1.3.2: The cAMP – dependent Protein kinase pathway in C. albicans.

The cAMP-PKA pathway also plays a crucial role in filamentation in S. cerevisiae, C.

albicans and other filamentous fungi (Lengeler et al. 2000). In C. albicans, an increase

in cAMP levels accompanies the yeast to hyphae transition, and inhibition of the cAMP

phosphodiesterase induces this transition (Sabie and Gadd 1992).

A number of homologues of S. cerevisiae cAMP-dependent PKA pathway components

have been identified in C. albicans including the transmembrane receptor Mep2p

(Biswas and Morschhauser 2005), the G-protein coupled receptor Gpr1p, the Gα protein

Gpa2p, the G-protein Ras1p, the adenylyl cyclase Cdc35p, the cAMP-dependent protein

kinase A and the transcriptional factor Flo8p (Leberer et al. 2001); reviewed in Biswas

et al. (2007) (Fig. 1.1).

1.3.2.1 Upstream signalling components

In S. cerevisiae, the cAMP-PKA pathway is activated by a G protein coupled receptor

(GPRC) system Gpr1p and the Gα protein Gpa2p; and this system is required for the

induction of pseudohyphal and invasive growth. More specifically, GPR1 and GPA2

mutants are deficient in this growth switch and this deficiency can be suppressed by the

addition of cAMP (Lorenz et al. 2000).

C. albicans GPA2 may function upstream of both the Cek1 MAPK pathway and the

cAMP-PKA pathway (reviewed in Biswas et al. 2007). GPA2 (the Gα protein) or GPR1

(the receptor) deletion strains of C. albicans show defects in morphogenesis which are

reversed by overexpression of downsteam components in the pathway or by addition of

26

dibutyryl-cAMP (dbcAMP). Epistasis analysis showed that GPA2 acts downstream of

GPR1 in the cAMP-PKA pathway (Miwa et al. 2004).

Another potential upstream component that might signal through PKA is C. albicans

Ras1p. By analogy with S. cerevisiae where Ras2p regulates morphogenesis pathways

(Biswas et al. 2007), ras1 mutants of C. albicans are impaired in hyphal growth under

a wide range of inducing conditions (Leberer et al. 2001) and this morphogenetic defect

can be reversed by supplementing the growth medium with cAMP or by overexpressing

components of the MAPK cascade (Leberer et al. 2001). This result highlights the

crosstalk that occurs between these in morphogenetic differentiation in C. abicans.

1.3.2.2 Adenylase cyclase, Phospodiestereses and cAMP levels

C. albicans CDC35 is a homologue of the S. cerevisiae adenylyl cyclase gene

CYR1/CDC35 (Rocha et al. 2001). The presence of a Ras1p binding domain in C.

albicans Cdc35p, suggests that, similar to other fungal isoforms, C. albicans Cdc35p

could be regulated by Ras1p. C. albicans cells deleted for both alleles of CDC35 had no

detectable cAMP levels, suggesting that this gene encodes the only adenylyl cyclase in

this organism. C. albicans cdc35 mutants are avirulent in a mouse model of infection,

are unable to form hyphae in most liquid and solid hyphae-inducing media; however,

they are slow growing (Rocha et al. 2001). The morphogenetic defect can be rescued by

exogenous cAMP, which points to a role for Cdc35p in the activation of the cAMP-

PKA pathway (Rocha et al. 2001).

Low and high-affinity phosphodieterase genes (PDE1 and PDE2) have also been

identified in C. albicans (Bahn et al. 2003; Jung et al. 2005). pde2 mutants have

increased sensitivity to cell wall and membrane perturbing agents, fail to produce

normal hyphae in liquid medium and form aberrant hyphae on solid medium (Jung et al.

27

2005). Under non-hyphae inducing conditions on agar media, the homozygous pde2

mutant forms wrinkled colonies consisting of mixtures of elongated yeast,

pseudohyphae and true hyphae. Germ tube formation in liquid media is also accelerated

in the pde2 mutant compared to wild-type strains. Therefore, Pde2p is viewed as a

negative regulator of cAMP signalling.

1.3.2.3 Protein kinase A (PKA)

The cAMP-dependent protein kinase (PKA) is crucial for growth and cellular

differentiation in eukaryotic cells. PKA consists of two catalytic subunits (Tpk1 and

Tpk2) that are inactivated by the binding of a heterodimer of regulatory subunits

(Bcy1). External signals increase intracellular levels of cAMP, which when bound to

the regulatory subunits liberates and thereby activates the catalytic subunits. PKA is

therefore thought to phosphorylate and activate the transcription factor Efg1 (Bockmühl

and Ernst 2001). C. albicans has only two PKA catalytic subunits, Tpk1p and Tpk2p.

Unlike S. cerevisiae in which only one of the three catalytic subunits is an activator and

the other two are inhibitors of pseudohyphal growth, both PKA isoforms in Candida

albicans are positive regulators of hyphal morphogenesis. However the phenotypic

outputs of the two PKA mutants differ, while tpk1 mutants are defective in hyphal

formation on solid media, tpk2 mutants are blocked for hyphal formation in liquid

medium (Sonneborn et al. 2000) . Epistasis analyses place both TPK1 and TPK2

downstream of RAS1 (Bockmuhl et al. 2001).

The regulatory subunits of PKA in S. cerevisiae and C. albicans are encoded by BCY1

genes. It has been shown that a Tpk1-GFP fusion is dispersed throughout the cell in the

bcy1 tpk2 double mutant, while it is normally localised in the nucleus in the wild-type

cells. This suggests that C. albicans Bcy1p may tether the PKA catalytic subunit to the

28

nucleus and thereby perform a vital role in regulating the enzymatic activity and

availability of PKA in response to growth (Cassola et al. 2004).

1.3.2.4 Downstream effectors

Efg1p, a basic helix-loop-helix (bHLH) protein similar to Phd1p and Sok2p of S.

cerevisiae, StuAP of Aspergillus nidulans and Asm1 of Neurospora crassa plays a

major role in hyphal morphogenesis (Ernst 2000). Serum-induced morphogenesis, a

process that is regulated by the PKA pathway, requires Efg1p. The efg1 null mutant

strain does not form hyphae under most inducing conditions and is defective in the

induction of hyphae-specific genes (Liu 2001). Efg1p is therefore considered an

activator of hyphal development as it is essential for the activation of hypha-specific

genes in C. albicans (Sohn et al. 2003). An efg1 cph1 double mutant strain has an

extreme filamentous growth defect and is essentially avirulent in a mouse model of

systemic infection (Lo et al. 1997). Another transcription factor, Flo8p, interacts with

Efg1 in vivo and is required for both morphogenesis and for virulence (Cao et al. 2006).

1.3.2.5 Transcriptional repressors (Tup1, Nrg1 and Rfg1) and

hyphal/pseudohyphal growth

As well as activators, transcriptional repressors are important downstream effectors of

signalling pathways. Tup1p has been described by Braun and Johnson (1997) to

negatively control filamentatous growth in C. albicans. Tup1p in association with either

Nrg1p or Rfg1p negatively regulates the expression of hypha-specific genes (Kadosh

and Johnson 2001; Murad et al. 2001; Kadosh and Johnson 2005). Nrg1p mRNA is

down regulated by serum and temperature (Braun et al. 2001); hence, the hyphal-

specific genes controlled by Nrg1p and Tup1p are likely induced as a result of this

29

down regulation. Thus a specific subset of C. albicans genes involved in filamentation

are repressed in a Tup1p dependent fashion, however; Nrg1p and another repressor

Mig1p also repress other C. albicans genes independently of Tup1p (Murad et al.

2001). Cells lacking any of these repressors grow constitutively as pseudohyphae, as the

expression of hypha-specific genes is constitutively derepressed (Sudbery 2011).

1.3.3 Tec1p and Cph2p: Convergent regulation of Cph1p and Efg1p

Tec1p, a member of the TEA/ATTS family of transcription factors, has been shown to

regulate hyphal development in C. albicans (Schweizer et al. 2000). In S. cerevisiae,

Tec1p and Ste12p (a homologue of Cph1p in C. albicans) form a transcription factor

complex to specifically activate genes involved in pseudohyphal growth (Madhani and

Fink 1997). In C. albicans however; TEC1 transcription is regulated by Cph2p and

Efg1p. Cph2p binds directly to two sterol regulatory element promoter elements

upstream of the TEC1 gene. Furthermore, ectopic expression of TEC1 suppresses the

defect of a CPH2 deletion in hyphal development.

30

Figure.1.1 Conserved MAP-Kinase and cAMP-dependent PKA pathways regulate

morphogenesis in C. albicans. Boxes represent transcriptional regulators, green colour

represents positive regulators and red colour represents negative regulators. Arrows

indicate positive regulation and bars negative regulation. Adapted from Sudbery (2011).

31

1.3.4: Hyphal Extention Pathway

The C. albicans epithelial escape and dissemination 1 (EED1) (Zakikhany et al. 2007)

and UME6 (Banerjee et al. 2008) play a crucial role in extension of germ tubes into

elongated hyphae and also in the maintenance of filamentous growth (Martin et al.

2011). Expression of UME6 depends on Eed1, which itself is a target of the

transcription factor Efg1 (Doedt et al. 2004) (Figure 1.2). Mutants lacking eed1 failed to

extend germ tubes into long filaments and switched back to yeast growth after 3 h of

incubation; however overexpression of UME6 restored the hyphal elongation. UME6

was found to be NRG1 repressed but under hyphae-inducing conditions may play a role

in suppressing NRG1 transcription (O'Connor et al. 2010; Martin et al. 2011). EED1

expression is regulated by Nrg1 and Tup1 as the expression of EED1 is upregulated in

nrg1∆ and tup1∆ mutants (Doedt et al. 2004; Martin et al. 2011). EED1 is a unique

species-specific gene of C. albicans as no homologous gene was found in any genome

sequence accessible via NCB1. Another important target of Ume6 is the kinase HGC1

encoding a hypha-specific G1 cyclin (Zheng et al. 2004). HGC1 was downregulated in

eed1∆ and this downregulation was bypassed by overexpression of Ume6 in eed1∆.

Hgc1 is involved in the phosphorylation of Efg1.

32

1.3.4: Summary of Cellular Morphogenesis

A variety of pathways have been identified which impact on morphogenesis leading to

alterations in the virulence of Candida albicans. Much of the work has relied upon

direct comparisons with S. cerevisiae pseudohyphal growth. Therefore, signal

transduction pathways that lead to changes in gene transcription during the switch to

pseudohyphal growth are well studied. It yet remains to be revealed whether control of

gene expression at the post-transciptional level plays a role in this switch (Gancedo

2001), particularly in the human pathogen, Candida albicans. As will be covered in

more detail in Section 1.10, a variety of alcohols which inhibit protein synthesis also

cause changes to morphogenesis, although it is not entirely clear which pathway(s) are

Figure 1.2 Eed1 mediates the elongation of germ tubes to hyphae. Environmental

signals transduced via the signalling regulators like Ras1p, Cph1p and Efg1 convert

yeast cells into germ tubes. Eed1 and Ume6 are required for the extention of the

germ tube into long hyphae. Arrows indicate positive regulation and bars negative

regulation Adapted from Martin et al. (2011).

33

involved and how the translational control connects with other aspects of the effects of

alcohols on cells.

1.4: The Cell Wall Integrity Pathway in C. albicans

It is well established that alcohols have chaotropic effects on membrane structure

(Ingram 1981; Ingram 1986). In C. albicans, several signaling pathways regulate cell

wall and membrane integrity (Lengeler et al. 2000; Kruppa and Calderone 2006).

Mkc1p (the homologue of S. cerevisiae Slt2p MAPK) is involved in regulating cell wall

integrity and is required for growth at elevated temperatures in C. albicans (Navarro-

Garcia et al. 1995). A C. albicans mkc1 null mutant exhibits increased susceptibility to

cell wall perturbing agents and to some inhibitors of cell wall synthesis. The mutant also

has defects in morphogenesis, has attenuated virulence and exhibits reduced cell

viability at 42oC (Navarro-Garcia et al. 1995; Diez-Orejas et al. 1997; Zhao et al.

2007). In S. cerevisiae, the analgous slt2Δ mutant is unable to form pseudohyphae and

to penetrate agar (Navarro-Garcia et al. 1998). The activation of Slt2p is triggered by

various oxidants, certain osmotic stresses, antifungal drugs (targeted at cell wall and

membrane synthesis), calcium ions, cold shock and alcohols (Martinez-Anaya et al.

2003; Navarro-Garcia et al. 2005). Mkc1p is phosphorylated in the presence of these

stress conditions; mostly by Pkc1p, but under certain conditions Hog1p is required for

Mkc1p phosphorylation, illustrating the interconnection between different MAPK

pathways in C. albicans (Navarro-Garcia et al. 2005).

By analogy with S. cerevisiae, the Hog1p MAP kinase pathway is presumed to play a

vital role in the biosynthesis of cell wall of C. albicans (Kruppa and Calderone 2006).

The Hog1p protein is thought to be important in regulating the phosphorylation of the

cell wall integrity MAP kinase Mkc1p (Arana et al. 2005). Finally, in reference to the

work in this thesis, Slt2p (Mpk1p), the cell integrity MAP kinase has been implicated in

34

the response of S. cerevisiae to fusel alcohols and Slt2p is activated upon exposure to

fusel alcohols (Martinez-Anaya et al. 2003).

1.4.1 Fusel Alcohols

Intriguingly, fusel alcohols impact on morphological transitions, the cell wall integrity

pathway and protein synthesis simultaneously in S. cerevisiae. A number of studies

have shown that the nutritional conditions that induce global regulation of protein

synthesis are also cues for various forms of filamentous growth in yeasts. For instance,

glucose depletion causes a rapid inhibition of translation initiation and also leads to

haploid invasive growth (Ashe et al. 2000; Cullen and Sprague 2000). In addition, the

effects of various alcohols and nitrogen limitation on translation initiation are

accompanied by a switch to pseudohyphal growth in the yeast, S. cerevisiae (Lorenz et

al. 2000; Ashe et al. 2001; Gancedo 2001).

A number of signal transduction networks in S. cerevisiae have been elucidated which

play a role in the switch from yeast form to pseudohyphal growth form (Gancedo 2001).

As described above, similar signal transduction pathways have also been identified in C.

albicans and other fungi. The question that remains to be addressed is whether control

of gene expression at the level of protein synthesis plays a role in the morphological

switch (Gancedo 2001).

Connections between protein synthesis and pseudohyphal growth have been suggested.

It was observed in S. cerevisiae that a minimal cycloheximide treatment results in a

lower proportion of pseudohyphal cells. The authors reasoned that the inhibition of

protein synthesis might be contributing to the block in the conversion of vegetative cells

to the pseudohyphal form (Kron et al. 1994). Ibrahimo et al. (2006), investigated

whether the regulation of translation initiation could play a role in the S. cerevisiae

35

pseudohyphal response. They showed that the disruption of the genes for either of the

yeast eIF4E binding proteins (Eap1p or Caf20p) or other key translational regulators

(GCN2 or GCN4) inhibits the capacity of yeast to undergo filamentous growth in

response to nitrogen limitation. Mutations in the 4E binding domains in both genes

prevent complementation of this phenotype, highlighting the importance of translational

control (Ibrahimo et al. 2006). To further highlight the connection between protein

synthesis and morphological transition in fungi, (Tripathi et al. 2002) reported that

Gcn4p plays a central role in coordinating morphogenetic and metabolic responses to

amino acid starvation in C. albicans.

1.5: Protein Synthesis

Proteins comprise one of the essential molecules vital for life processes. They account

for a large fraction of biological macromolecules, catalyse most of the reactions on

which life depends and serve numerous structural, transportational, regulatory and other

roles in all organisms. A high proportion of a cell’s energy budget and components are

devoted to protein synthesis. For instance, in rapidly growing bacterium protein

synthesis consumes 30-50% of the energy generated (Mathews et al. 2007). In addition,

a rapidly growing yeast cell contains nearly 200,000 ribosomes occupying as much as

30-40% of its cytoplasmic volume (Mathews et al. 2007).

The transfer of genetic information from DNA to protein occurs via mRNA. In

prokaryotes, co-transcriptional translation occurs, whereas in eukaryotes the two

processes of transcription (production of mRNA) and translation (production of

proteins) are separated as a consequence of eukaryotic cell having a defined nucleus.

The process of protein synthesis in both prokaryotes and eukaryotes occurs in three

steps: initiation, elongation and termination.

36

The requirements for high levels of energy, ribosomes, RNAs and other factors

necessitates that a process such as protein synthesis be closely monitored and regulated

by the cell in order to conserve energy and resources. Control occurs mostly at the

initiation stage of protein synthesis. This allows rapid, reversible and spatial control of

gene expression. In addition, response at this early stage means that cells respond

rapidly to environmental changes in order to prevent further wastage of energy and the

accumulation of intermediates as by-products.

1.6: Translation pathway overview

Translation is an extremely complex process by which the information content of

mRNA is converted to proteins. The process starts with translation initiation, where the

goal is to assemble a full ribosome on the mRNA with an initiator methionyl tRNA

(Met-tRNAi) in the peptidyl transferase (P) site of the ribosome. Ribosomes are highly

conserved between prokaryotes and eukaryotes and have three tRNA binding sites: the

acceptor (A) site, the peptidyl transferase (P) site and the exit (E) site. The process by

which ribosomes are recruited to mRNAs, however, varies between prokaryotes and

eukaryotes. Polycistronic mRNAs are commonly found in prokaryotes. Prokaryotic

mRNA contains a sequence called the Shine-Dalgarno sequence, which is

complementary to the 5ʹ end of the 16S rRNA subunit and located upstream of the AUG

start codon (Shine and Dalgarno 1975). In contrast, eukaryotic mRNA is modified by a

5′ cap and 3′ poly (A) tail. These modifications not only protect the mRNA from

degradation but also facilitate its recognition by the translation initiation machinery.

In eukaryotes, at least 11 translation initiation factors are involved in assembling a

translationally competent ribosome on the mRNA: while only three factors are involved

in prokaryotic translation initiation. After initiation in both prokaryotes and eukaryotes,

the appropriate aminoacylated tRNA enters the A site, a peptide bond is formed

37

between the amino acids and the ribosome translocates one codon along the mRNA. In

this manner, the mRNA is sequentially decoded into a chain of amino acids and

ultimately a protein. This entire process termed translation elongation is GTP-dependent

and, in eukaryotes, requires only three elongation factors (eEF1A, eEF1B, and eEF2)

(Taylor et al. 2007). Translation is terminated when a stop codon is translocated into the

ribosomal A site. The bond which links the last peptidyl-tRNA to the ribosomal P-site is

hydrolysed to release the protein and this is facilitated by the release factor eRF1 (Kapp

and Lorsch 2004). The process of eukaryotic translation is discussed in greater detail

below, this discussion however, will focus mainly on the initiation stage of translation

in eukaryotes as this is the stage where most regulation occurs and it is the stage

targeted by alcohols in S. cerevisiae.

1.6.1: Translation Initiation -the mechanism of translation initiation in Eukaryotes

Translation initiation is the process that leads to the assembly of an elongation

competent 80S ribosome on an mRNA in which the initiation codon is base paired with

the anticodon loop of aminoacylated initiator methionyl-transfer RNA (Met-tRNAiMet

)

in the ribosomal P site (Pestova et al. 2007; Jackson et al. 2010). The process requires

separated small (40S) and large (60S) ribosomal subunits, initiation factors and the

nucleotide triphosphates (ATP and GTP) (Pestova et al. 2007).

38

Fig.1.3. Overview of Translation Initiation: eIF2B catalyzes guanine nucleotide

exchange to produce eIF2-GTP. eIF2-GTP binds to Met-tRNAi

Met to form a Ternary

complex (TC). A multifactor complex made up of TC, eIFs 1, 1A, 3 and 5 binds to the

40S ribosomal subunit to form a 43S pre-initiation complex (PIC). The eIF4F (eIF4E,

eIF4G and eIF4A) complex forms a closed loop complex with the mRNA via the

interaction of 4G with 4E and Pab1p. PIC is recruited to mRNA by the eIF4F complex

and possibly Pab1p to form 48S initiation complex. The 48S complex selects the

appropriate AUG (initiation codon), followed by the joining of 60S ribosomal subunit to

form 80S initiation complex

The eukaryotic translation initiation mechanism most widely accepted is that based on

the scanning model (Kozak 1991), however, in some eukaryotes and under some

circumstances, another method of initiation has been proposed which is independent of

80S

S

39

the 5′ m7G-cap structure. This method of translation initiation on a few mRNAs

involves direct binding of the 40S ribosomal subunit to the mRNA at the internal

ribosome entry site (IRESs) located at or near to an AUG codon (reviewed in Hellen

and Sarnow (2001).

Prior to translation, the mRNA transcript must be synthesized in the nucleus and

processed by capping, splicing and polyadenylation, after which it is exported to the

cytoplasm. In addition the post-termination ribosomal complexes, which comprise an

80S ribosome still bound to mRNA, deacylated tRNA and eukaryotic release factor 1

(eRF1) (Jackson et al. 2010) must dissociate. Ribosomes are dissociated and are thought

to be released from the mRNA as free 60S and factor-associated 40S subunits to

provide a pool of separated ribosomal subunits needed for translation. This dissociation

is aided by the eukaryotic factors eIF3, eIF1 and eIF1A (Kolupaeva et al. 2005).

1.6.1.1 Formation of the 43S pre-initiation complex

Initiation of protein synthesis begins with the assembly of eIF2, GTP, Met-tRNAiMet

into a ternary complex. eIF2 in the GTP bound form interacts specifically with the

initiator methionyl tRNA. The resulting ternary complex is responsible for delivering

the Met-tRNAiMet

to the 40S subunit to form the 43S pre-initiation complex. Formation

of this complex is also promoted by eIF1, eIF1A and eIF3 (Hershey and Merrick 2000).

Some of these factors bind the 40S subunit before the ternary complex, likely as a result

of their prior role in subunit dissociation (Pestova et al. 2007). The initiation factors

e1F1, eIF3, eIF5 and eIF2- Met-tRNAiMet

can also form a multifactor complex (MFC)

which exists both free of and bound to the ribosome (Asano et al. 2000). Interactions

between the MFC components co-operatively increase their affinity for the 40S subunit.

The resulting 43S pre-initiation complex is competent for binding to the 5′ end of most

mRNAs.

40

1.6.1.2 mRNA preparation and selection

Recruitment of the 43S preinitiation complex to mRNA is mediated by members of the

eIF4F group of initiation factors, which is a heterotrimer containing eIF4A (an

ATPase/RNA helicase of the DEAD box family), eIF4G (a large modular protein which

functions as a scaffold that binds the other factors) and eIF4E (the cap binding protein)

(Pestova et al. 2007). mRNA selection for translation is prompted by eIF4E and Poly

(A) binding protein (PABP; Pab1p in yeast), which bind to the mRNA 5ʹ cap structure

and 3ʹ poly(A) tail respectively. These proteins both interact with separate domains of

eIF4G. eIF4G can therefore interact simultaneously with eIF4E and the Poly (A)

binding protein bridging across the 5′ cap and 3′ poly (A) tail structures to form a

closed-loop mRNP complex (Wells et al. 1998). This ‘circularisation’ of the mRNA

likely explains the synergistic effect of the mRNA cap and poly (A) tail structures on

translation initiation (Tarun and Sachs 1995; Wells et al. 1998). eIF4G also recruits the

eIF4A RNA helicase which has been proposed to function in the removal of secondary

structure from the 5′ end of the mRNA (Oberer et al. 2005).

1.6.1.3 43S preinitiation complex recruitment to the mRNA and mRNA scanning

One of the least well understood aspects of the translation initiation process is the

mechanism by which the primed closed loop mRNA complex interacts with the 43S

pre-initiation complex. In higher eukaryotes an interaction between eIF3 on the 43S

complex and eIF4G on the mRNA is thought to be critical (Lamphear et al. 1995;

Korneva et al. 2000). There is no report of similar interaction in S. cerevisiae. However,

it has been reported that yeast eIF5 can interact with the carboxy-terminal half of

eIF4G, and could act as a link between eIF3 and the mRNA (Asano and Hinnebusch

2001).

41

After the binding of the pre-initiation complex at the 5′ end of the mRNA, the complex

scans the mRNA in a 5′ to 3′ direction until a ‘start’ codon is encountered (Kozak

2005). In eukaryotes, the start codon is usually the first AUG triplet that the ribosome

encounters and is identified by virtue of complementarity to the Met-tRNAi anticodon

(reviewed in Kapp and Lorsch 2004).

1.6.1.4 AUG recognition and 60S subunit joining

Binding of the 40S ribosomal subunit to the start codon results in a pause in scanning

and triggers GTP hydrolysis on eIF2 by eIF5, a GTPase activating protein (GAP). This

process is regulated by the initiation factors eIF1, eIF1A and eIF3 which prevent

premature hydrolysis to limit initiation within poor sequence context or at non-AUG

start codons (Majumdar and Maitra 2005). Specific mutants in eIF1 are deficient in

discriminating correct start codons exhibiting increased initiation at UUG codons (Yoon

and Donahue 1992). eIF1 dissociation from the pre-initiation complex mediates release

of Pi following GTP hydrolysis on eIF2 upon AUG recognition, a process facilitated by

eIF1A (Cheung et al. 2007). eIF2.GDP, eIF5, eIF1 and eIF3 are thought to be released

from the complex following GTP hydrolysis, whereas eIF1A remains associated to

recruit eIF5B.GTP. GTP hydrolysis on eIF5B promotes eIF1A dissociation from the

ribosomal A site to drive 60S subunit joining leading to the formation of the 80S

initiation complex. This process leaves the initiator methionyl tRNA in the ribosomal P

site with its anticodon base-paired to the mRNA start codon (Lee et al. 2002). The

ribosomal A site is now accessible to an incoming aminoacylated tRNA (aa-tRNA)

during the elongation phase of translation (Hershey and Merrick 2000).

42

1.6.1.5 The eIF2 guanine nucleotide exchange cycle, eIF2B and the ternary

complex

After hydrolysis of GTP to generate eIF2.GDP, the release of GDP from eIF2 is very

slow, so to function in multiple rounds of initiation, eIF2 requires a guanine nucleotide

exchange factor (GEF), eIF2B. The exchange factor increases the rate of exchange of

GDP with GTP by at least ten-fold (Williams et al. 2001). Interestingly the guanine

nucleotide exchange step can occur at a defined cytoplasmic focus within the cell,

where eIF2B is a resident feature and eIF2 cycles rapidly through the focus (Campbell

et al. 2005). One possibility is that the eIF2/eIF2B focus could serve to concentrate

eIF2B, which is sub-stoichiometric to eIF2, to enable sufficient guanine exchange in

rapidly growing yeast cells (von der Haar and McCarthy 2002; Campbell et al. 2005).

After replacement of GDP with GTP on eIF2, the factor switches into a form with high

affinity for Met-tRNAiMet

(Kapp and Lorsch 2004). The affinity of the initiator

methionyl tRNA for eIF2.GTP is 15-fold tighter than for eIF2.GDP as measured using

S. cerevisiae components. This is important for release of the tRNA by eIF2.GDP

during start codon recognition (Kapp and Lorsch 2004). However a new regulatory

function of eIF5 in the recycling of eIF2 from its inactive eIF2.GDP form has recently

been described (Jennings and Pavitt 2010). eIF5 acts as a GDP dissociation inhibitor

(GDI) by stabilizing the binding of GDP to eIF2 and restricts the recycling of eIF2 to

ternary complex.

1.6.2 Translation initiation via other mechanisms -cellular internal ribosome entry

sites

During viral infection, apoptosis, heatshock or hypoxia, cap-dependent translation is

often compromised (Johannes et al. 1999; Qin and Sarnow 2004; Bushell et al. 2006).

Under such conditions, a subset of mRNAs are able to initiate translation in a 5′ cap

43

independent manner, through secondary structure elements within their 5′ UTR called

internal ribosomal entry sites (IRES). IRES elements are able to recruit the ribosome

directly to, or in close proximity to the start codon and coordinate translation initiation

with a limited number of translation initiation factors and IRES trans-acting factors

(ITAFs). mRNAs where translation is instigated by an IRES are generally not translated

efficiently under normal conditions, and may require a down regulation of cap-

dependent translation for their expression (Merrick 2004; Qin and Sarnow 2004). In

addition, many viral RNAs contain IRESs, which mediate their translation after viral

infection. The host cell translation is shut-off as the viral RNA often encodes proteases

that cleave initiation factors and the presence of the viral dsRNA triggers eIF2α

phosphorylation by the eIF2 kinase, PKR (See Section 1.8.1.1). Different viral IRESs

vary greatly in their translation initiation factor requirements. For instance, the EMCV

(encephalomyocarditis virus) IRES minimally requires eIF4A and the central domain of

eIF4GI, eIF2, eIF3 and eIF4B, whereas HCV (hepatitis C virus) IRES requires only

eIF2 (Pestova et al. 1996; Pestova et al. 1998) . In an extreme case the cricket paralysis

virus IRES requires no canonical translation initiation actors, not even the initiator

methionyl tRNA (Jan and Sarnow 2002). The differential factor requirements mean that

IRES-containing mRNAs are often resistant to conditions that reduce global translation

initiation. The fact that many of the proteins encoded by these mRNAs facilitate

recovery from stress provides a rationale for this alternative mechanism for translation

initiation.

1.6.3 Translation Elongation

Translation elongation is mediated by ribosomes and multiple soluble factors, most of

which are conserved across bacteria and eukaryotes. During elongation, the ribosome

catalyses the addition of new amino acids via the amino acylated-tRNA (aa-tRNAs) to a

44

growing polypeptide chain, according to the sequence of codons in the mRNA assisted

by eukaryotic elongation factors (eEFs) (Taylor et al. 2007). At the onset of translation

elongation, a Met-tRNAi is already present in the P site of the ribosome and the

eukaryotic elongation factor 1A (eEF1A; EF-Tu in bacteria) binds and recruits aa-

tRNAs to the A-site of the ribosome. The aa-tRNA, eEF1A and GTP exist as a ternary

complex. As a result of stringent codon-anticodon base pairing, only the cognate aa-

tRNA is accepted at the A site (Ogle et al. 2001). Codon-anticodon base pairing

produces a conformational change in eEF1A that leads to GTP hydrolysis of the ternary

complex. Upon GTP hydrolysis, the eEF1A.GDP complex is released from the

ribosome, leaving the aa-tRNA in the A site. Spontaneous GDP dissociation from

eEF1A is slow, so the eEF1Bαβγ complex, guanine nucleotide exchange factor,

stimulates the exchange of GDP for GTP maintaining the level of active eEF1A.GTP

(Slobin and Moller 1978). Peptide bond formation then occurs to leave the nascent

peptide fleetingly associated with the A site tRNA (Rodnina and Wintermeyer 2001).

Rapid translocation of the ribosome relative to the mRNAs and tRNAs leaves the A site

free to accept the next aa-tRNA (Taylor et al. 2007). This translocation step is

facilitated by eEF2 (EF-G in bacteria) which promotes ribosome movement along the

mRNA (Taylor et al. 2007). Fungal translation elongation is striking in its absolute

requirement for a third factor, the ATPase eEF3. eEF3 binds close to the E-site of the

ribosome and has been proposed to facilitate the removal of deacylated tRNA from the

E-site (Sasikumar and Kinzy 2014). The whole elongation cycle is repeated until a stop

codon is reached.

45

Figure 1.4 Structure of the ribosome showing the large and the small subunits. The

ribosomal tRNA binding sites are the aminoacyl (A), the peptidyl (P) and the exit (E).

Each of the ribosomal subunits contributes to these EPA sites. Adapted from Russel P.

J. (2010)

1.6.4 Translation Termination

Translation termination occurs when a stop codon is translocated into the ribosomal A

site. There are three stop codons in eukaryotes, UAA, UAG, and UGA (Kapp and

Lorsch 2004). The eukaryotic release factor 1 (eRF1) encoded by the SUP45 gene in S.

cerevisiae recognises the stop codons. One model is that eRF1 is a functional mimic of

the tRNAs and through its binding to the A site of the ribosome triggers the hydrolysis

of the peptidyl-tRNA, resulting in the release of the peptide chain. A second eukaryotic

release factor eRF3, encoded by the SUP35 gene in S. cerevisiae accelerates this

process in a GTP-dependent manner (Baierlein and Krebber 2010; Khoshnevis et al.

2010). Additional factors have also been described to play roles in this process. For

instance, the DEAD box RNA helicase Dbp5p has recently been shown to assist eRF1

in stop codon recognition and controls the subsequent eRF1-eRF3 interaction through

its dissociation from eRF1 (Gross et al. 2007).

46

1.6.5 Ribosome recycling

At the end of the termination stage the ribosome exists as an 80S complex on the

mRNA with a deacylated tRNA. For the ribosomal subunits to be used in another round

of translation, they must be dissociated and be recycled. eIF3, one of the factors

proposed to be involved in recycling, has anti-association activity in that it binds to the

40S subunit lowering the rate of association with 60S (Valasek et al. 2003). Under

stress conditions where translation initiation is inhibited, the idle ribosomal subunits

reassociate to form a large pool of non-translating 80S ribosomes. During recovery from

these stress conditions, these inactive ribosomes need to be mobilised for translation

restart. Dom34p-Hbs1p complex, together with the Rli1p NTPase have been implicated

in the dissociation of such inactive ribosomes (van den Elzen et al. 2014).

1.7 Detailed steps in the Translation Initiation pathway

Two specific aspects of the translation initiation pathway are of particular importance in

terms of both the work in this thesis and the regulation of translation initiation. These

are the ternary complex cycle and the selection of mRNA for translation. Therefore

these will be covered in greater detail in the following sections.

1.7.1 The ternary complex cycle

As described above, the ternary complex consists of eIF2.GTP bound to Met-tRNAiMet

.

This complex delivers the initiator methionyl tRNA and provides chemical energy in

the form of GTP for the structural rearrangements that occur following AUG

recognition. eIF2.GDP is recycled back to eIF2.GTP via the guanine nucleotide

exchange factor eIF2B.

47

1.7.1.1 Initiator tRNA

In all kingdoms of life, two different methionyl tRNAs are used in protein synthesis:

elongator methionyl tRNA (Met-tRNAeMet

) and initiator methionyl tRNA (Met-

tRNAiMet

). The Met-tRNAiMet

initiates protein synthesis, whereas Met-tRNAeMet

inserts

methionine at internal sites in the growing polypeptide during elongation ((Pestova et

al. 2007). Initiator methionyl tRNA reads the start codon, allowing the initiating

ribosome to begin translation in the correct location.

Initiator methionyl tRNA has a unique sequence and structural features that enable it to

be specifically recognized by eIF2 and excluded from binding to elongation machinery

(see 1.6.1.5). These features are important for productive binding in the P site (Pestova

et al. 2007). The base pair at position 1:72 in the acceptor stem is an important

contributor to initiator/elongator discrimination. In Met-tRNAiMet

, the A1:U72 base pair

at the top of the acceptor stem is crucial for binding to eIF2.GTP (Farruggio et al.

1996), while elongator tRNAs generally bear a G:C base pair in the 1:72 position. Two

initiator-specific G:C base pairs in the anticodon stem are also important for the binding

of the eIF2.GTP.MettRNAiMet

to the 40S subunit (Astrom et al. 1993).

1.7.1.2 eIF2

eIF2 is a highly conserved heterotrimeric complex consisting of α, β, and γ subunits

encoded by the yeast genes SUI2, SUI3 and GCD11 respectively (Hershey and Merrick

2000). Table 1.2 shows the nomenclature used for eIF2, eIF2B subunits, protein kinase

(Gcn2p) and transcription factor (Gcn4p) in both S. cerevisiae and C. albicans. The α

subunit of eIF2 contains a highly conserved region in which Ser51 can be

phosphorylated. A number of stress and metabolite-activated kinases phosphorylate

eIF2α, resulting in a stable, unproductive interaction with eIF2B (see section 1.8.1.1).

The β subunit of eIF2 is involved in binding to both eIF2B and eIF5. The catalytic

48

domain in the ε subunit of eIF2B and the C-terminus of eIF5 contain a conserved region

which binds to the same sequence in their common substrate, eIF2β (Asano et al. 1999;

Gomez and Pavitt 2000). The γ subunit has binding sites for GTP and Met-tRNAiMet

(Gaspar et al. 1994). Mutations of amino acids in eIF2γ proposed to be vital for tRNA

binding result in reduced affinity for Met-tRNAiMet

(Kapp and Lorsch 2004).

1.7.2 eIF2B

eIF2B is a heteropentameric complex consisting of α, β, γ, δ, and ε, encoded by GCN3,

GCD7, GCD1, GCD2 and GCD6 respectively. In S. cerevisiae all the eIF2B subunits,

apart from the α subunit, are essential for growth and mutations in these subunits can

lead to a temperature sensitive phenotype and derepression of GCN4 translation (Gcd-

phenotype) indicative of reduced ternary complex levels (Krishnamoorthy et al. 2001).

The eIF2B subunits are able to form two stable sub-complexes, a regulatory complex

consisting of the α, β and δ subunits and a catalytic complex consisting of the ε and γ

subunits (Pavitt et al. 1998). The regulatory subcomplex is able to bind eIF2, showing a

higher affinity for the phosphorylated form of this protein; however it lacks guanine

nucleotide exchange function. The catalytic subcomplex is sufficient for guanine

nucleotide exchange only and in fact shows a faster rate of exchange than the wild type.

This essential reaction is catalysed by the carboxy-terminal segment of eIF2Bε, which

interacts directly with the G domain of eIF2γ and with lysine-rich regions of eIF2β

(Gomez and Pavitt 2000; Gomez et al. 2002). Therefore, it has been proposed that the

regulatory subcomplex is required to mediate binding of eIF2 to eIF2B and to prevent

exchange on phosphorylated eIF2 (Pavitt et al. 1998).

The activity of translation initiation factors in C. albicans is less well understood.

However similar to S. cerevisiae only one C. albicans ORF (GCN2; orf19.6913)

encodes a protein with significant sequence similarity to S. cerevisiae Gcn2p (37%

49

identity). The C. albicans Gcn2p protein sequence contains pseudo kinase, eIF2α

kinase, and histidyl-tRNA synthetase-like domains. It also displays significant sequence

similarity to GCN2 eIF2α kinases from mammals, flies, and plants (Tournu et al. 2005).

50

Table 1.2 Protein subunits and gene names for eIF2, eIF2B, the protein kinase

Gcn2p and the transcription factor Gcn4p

Name of

protein

Mass in kDa Gene in

S. cerevisiae

Gene in

C. albicans

eIF2α/Sui2p 34.7 33.9 SUI2/YJR007W SUI2/C1_06960W_A

eIF2β/Sui3p 31.6 31.1 SUI3/YPL237W SUI3/C7_04130C_A

eIF2γ/Gcd11p 57.9 58.6 GCD11/YER025W GCD11/C5_02170_A

eIF2Bα/Gcn3p 34.0 35.1 GCN3/YKR026C GCN3/C7_01220W_A

eIF2Bβ/Gcd7p 42.6 41.0 GCD7/YLR291C GCD7/C2_03990W_A

eIF2Bγ/Gcd1p 65.7 54.3 GCD1/YOR260W GCD1/CR_03990C_A

eIF2Bδ/Gcd2p 70.8 55.9 GCD2/YGR083C GCD2/C3_07250W_A

eIF2Bε/Gcd6p 81.1 81.9 GCD6/YDR211W GCD6/C1_08600C_A

Gcn2p 190.1 200.9 GCN2/YDR283C GCN2/C7_01330_A

Gcn4p 31.3 35.4 GCN4/YEL009C GCN4/C2_09940W_A

SUI= Supressor of initiation

GCN=General control nonderepressible

GCD=General control derepressed

S. cerevisiae C. albicans

51

1.7.3 mRNA selection pathway

As described above the selection of mRNA relies upon interactions of the mRNA cap

and poly(A) tail with the translation machinery. eIF4E interacts with the cap and Pab1p

with the poly(A) tail. eIF4G serves as a scaffold between the two and also interacts

with the ATP-dependent RNA helicase eIF4A. In addition, eIF4E binding proteins (4E-

BPs) can competitively inhibit the interaction between eIF4G and eIF4E to regulate

translation initiation (see section 1.8.2). Table 1.3 shows the protein subunits and gene

names of the eIF4F complex, as well as the interacting proteins Pab1 and the ribosomal

protein Rps3 in S. cerevisiae and C. albicans.

1.7.3.1 eIF4E

The S. cerevisiae eIF4E is encoded by a single essential gene CDC33 (Altmann et al.

1987). The structural features of eIF4E shed light on the biological properties of this

factor. The amino terminal part of eIF4E is dispensable for cap recognition, for binding

to eIF4G and 4E-BP, for stimulation of cap-dependent translation, and for in vivo

functionality of the protein (Hernandez et al. 2005). On the other hand, the sequence

and three dimensional structure of eIF4E carboxy-terminal part contains all the residues

important for functionality and is highly conserved. Due to its central role in cap-

dependent translation, regulation of eIF4E activity is critical to normal cell growth

(Lachance et al. 2002; Richter and Sonenberg 2005). eIF4E binds directly to the cap

structure at the 5′ end of the mRNA. The binding site contains two tryptophan residues

which are stacked either side of the m7GTP nucleotide on the cap (Matsuo et al. 1997).

52

1.7.3.2 PABP

The single-copy essential gene PAB1 encodes yeast PABP (Sachs 2000). In yeast cell-

free extracts, a Pab1p-poly(A) complex interacts with eIF4G which in turn interacts

with eIF4E bound to the mRNA cap (Tarun and Sachs 1996). Mutations within the

yeast PAB1 gene resulted in an inhibition of translation and cell growth (Sachs and

Davis 1989). The poly(A) binding protein family carry four non-equivalent RNA-

recognition motifs (RRMs) and a C-terminal domain. In yeast Pab1p, RRMs 3 and 4

and the C-terminus do not contribute to the translational activities of the protein

(Kessler and Sachs 1998). Further dissection of eIF4G-Pab1p interaction revealed that

the first and second RRMs of Pab1p are needed for eIF4G binding and that substitution

of as few as two amino acids within RRM2 of Pab1p can prevent this binding (Kessler

and Sachs 1998; Otero et al. 1999). The consequence of the simultaneous association of

eIF4E and Pab1p with eIF4G is that the mRNA could become circularised. As a result

Pab1p would promote translation initiation by stabilisation of eIF4G on the mRNAs and

hence increased recruitment of the 43S complex to the mRNA. The so- called ‘closed

loop’ hypothesis is supported by the direct demonstration of circular polyribosomes in

electron micrographs of serial sections through rough ER membranes (Tarun and Sachs

1996; Sachs 2000). It has also been suggested that Pab1p may mediate translational

activation by inducing 60S subunit joining. The observation that 60S subunit protein

mutants suppress pab1∆ phenotypes provides some support for such a role (Sachs and

Davis 1989; Searfoss et al. 2001).

1.7.3.3 eIF4A

eIF4A is the archetypal member of the ATP-dependent RNA helicase family (Schmid

and Linder 1991; Schmid and Linder 1992). Conserved sequences within eIF4A couple

ATP binding and hydrolysis to RNA helicase activity in order to disrupt RNA-RNA

53

interactions; thereby ‘melting’ secondary RNA structures within a transcript (Tanner et

al. 2003; Marsden et al. 2006). The effect of mRNA secondary structure on translation

initiation is varied but can have an inhibitory role by disrupting initiation factor function

or ribosome transit on the RNA (Tanner et al. 2003; Marsden et al. 2006). An A66V

substitution in yeast eIF4A, which prevents ATP-hydrolysis, abolishes its ability to

rescue depleted translation extracts (Blum et al. 1992). The helicase activity of eIF4A is

enhanced through its interactions with eIF4G. In S. cerevisiae however, eIF4A is not as

stably associated with eIF4E and eIF4G. eIF4A interacts with the middle domain of

eIF4G through interactions in both N-terminal and C-terminal domains. This interaction

seems to stabilise the conformation of eIF4A and enhance the accessibility of its RNA

and ATP-binding surfaces (Oberer et al. 2005). A number of conditions have been

described that affect the association of eIF4A with the eIF4F complex or the helicase

activity of eIF4A. For instance, glucose starvation in yeast has been shown to lead to the

loss of eIF4A from the eIF4G-containing complex which is thought to inhibit global

translation initiation (Castelli et al. 2011). (Cruz-Migoni et al. 2011) recently showed

that the toxin produced by the bacterium, Burkholderia pseudomallei causes a

translational block by inhibiting the helicase activity of eIF4A and this manifests in the

human disease melioidosis. Furthermore during mitosis, intense phosphorylation of

Ser1232 in eIF4G by the cyclin dependent kinase 1:cyclin B complex strongly enhances

the interaction of eIF4A with the HEAT domain 2 of eIF4G and decreases the

association of eIF4G/eIF4A with RNA. This results in the inhibition of eIF4A helicase

activity leading to suppression of global translation (Dobrikov et al. 2013).

1.7.3.4 eIF4G

eIF4G is a large modular protein which in mammalian systems acts as scaffolding

protein with binding sites for eIF4E, eIF4A, eIF3 and PABP. In S. cerevisiae, there are

54

two isoforms of eIF4G; eIF4G1 and eIF4G2, which are 50% identical and encoded by

the genes TIF4631 and TIF4632. Deletion of both genes is lethal, but the presence of

either gene alone is sufficient to support growth (Goyer et al. 1993).Yeast cells deleted

for TIF4631, but not TIF4632 shows slow-growth (slg-) phenotype and translation

initiation defect (Clarkson et al. 2010) consistent with the fact that eIF4G1 is expressed

at higher levels than is eIF4G2 (Tarun and Sachs 1996; Clarkson et al. 2010). However

at high cell density, eIF4G2 mRNA is expressed at higher levels compared to eIF4G1

which may imply a preferential role in nutrient limited cells (Gasch et al. 2000). Yeast

eIF4G has binding sites for eIF4E, eIF4A and Pab1p, but not eIF3. In fact the eIF3e

subunit in mammalian cells that appears to be involved in binding to eIF4G is not

conserved in yeast (LeFebvre et al. 2006). Therefore, direct interactions between eIF4G

and eIF3 have not been shown, rather it has been suggested that eIF5 and eIF1 act as

bridges between eIF4G and the 43S complex to promote 48S complex formation (He et

al. 2003). The interaction between eIF4G and eIF4A is important in recruiting 43S

complex to the cap. Mammalian eIF4G contains two eIF4A binding domains, one in the

central domain and one in the C- terminal domain. The central domain binding site is

conserved in yeast, but the C-terminal binding domain is absent (Imataka and

Sonenberg 1997). The interaction between eIF4G and eIF4A is dependent on conserved

residues within the yeast eIF4G binding site and the central domain binding site

(Dominguez et al. 2001). It is becoming increasingly clear that eIF4A and possibly the

interaction with eIF4G may be a site of regulation for protein synthesis (as described

above).

C. albicans has only a single eIF4G gene encoded by TIF4631, and overexpression of

this gene causes hyperfilamentation (Lee et al. 2005). Interestingly, Candida eIF4G is

induced by conditions promoting hyphal growth and by macrophages (Lorenz et al.

2004).

55

The gene for Candida eIF4E has also been described (Lorenz et al. 2004; Lee et al.

2005; Feketova et al. 2010). This gene, CaCDC33, contains one CUG codon at position

116 of the amino acid residues (Feketova et al. 2010), but overall the sequence

similarity between CaCDC33 and ScCDC33 is 54% identical at the amino acid level.

Indeed a S. cerevisiae cdc33 null mutant is complemented by CaCDC33 in terms of

lethality (Feketova et al. 2010). Interestingly, eIF4E can naturally exist as Ca4E116ser

and Ca4E116Leu

(CUG codon at position 116 is encoded as serine or leucine) in C.

albicans. The mutation of the CUG codon into the universally serine-coding UCU

triplet alleviates the temperature sensitivity of the Ca4E translation initiation factor in

the S. cerevisiae. (Feketova et al. 2010).

Table 1.3 The protein subunits and gene names of the eIF4F complex, as well as

the interacting proteins Pab1 and the ribosomal protein Rps3

Name of protein Mass in kDa Gene in

S.cerevisiae

Gene in

C. albicans

eIF4G/Tif4631p 107 118.3 TIF4631/YGR162W TIF4631/C2_08760C_A

eIF4E/Cdc33p 24.2 31.1 CDC33/YOL139C EIF4E/CR_10490W_A

eIF4A/Tif1p 44.6 44.6 TIF1/YKR059W TIF1/C1_01350C_A

Pab1p 64.3 70.4 PAB1/YER165W PAB1/C1_03370W_A

Rsp3p 26.5 27.3 RPS3/YNL178W RPS3/CR_04810W_A

S. cerevisiae C. albicans

56

1.8: Regulation of protein translation initiation

The regulation of protein synthesis allows a rapid and dynamic cellular response to

stresses such as amino acid starvation, glucose starvation, viral infection, hypoxia, heat

shock and exposure to heavy metals. The vast majority of such stress conditions

regulate protein synthesis by targeting the translation initiation step (Simpson and Ashe

2012). This global inhibition has an immediate effect on protein levels and allows the

cell to re-channel resources toward stress survival (Yamasaki and Anderson 2008;

Simpson and Ashe 2012). Mechanisms by which translation initiation can be regulated

fall into two main categories: the control of eIF2 or of eIF4F, often by reversible protein

phosphorylation (Jackson et al. 2010) (Fig. 1.5).

57

Figure 1.5. Translational initiation control via: a, eIF2α phosphorylation and b,

binding of the hypophosphorylated 4E-BP (the cap-binding protein). Phosphorylation of

4E-BPs and their regulation by mTOR has been identified in mammalian systems,

whereas in S. cerevisiae TOR targets the eIF2α kinase, Gcn2p. Figure adapted from

Gebauer and Hentze (2004).

1.8.1: Regulation by activation of the stress responsive eIF2α kinases

As described above in detail, eIF2 forms a complex with Met-tRNAiMet

and GTP and in

conjuction with the 40S ribosomal subunit, participates in the selection of the start

codon. In S. cerevisiae there is just a single eIF2α kinase, Gcn2p, which is activated in

response to a number of stress conditions including amino acid starvation (Dever et al.

1992), purine starvation (Rolfes and Hinnebusch 1993), rapamycin (Kubota et al. 2003)

and peroxide (Shenton et al. 2006). Following amino acid starvation, there is an

accumulation of uncharged tRNA, which binds to the regulatory histidyl-tRNA

58

synthetase-like (HisRS) domain of Gcn2p: located C-terminal to the protein kinase

domain (Hinnebusch 1994; Wek et al. 1995). It has been proposed that this binding

induces a conformational change in Gcn2p thereby activating the adjacent protein

kinase domain to induce phosphorylation of eIF2α (Wek et al. 1995). The

phosphorylated eIF2α binds tightly to and sequesters the guanine nucleotide exchange

factor, eIF2B, thus prevents the recycling of eIF2-GDP to the active eIF2-GTP that is

required for subsequent rounds of translation (Dever et al. 1995; Hinnebusch 2000).

Similar to S. cerevisiae, C. albicans only expresses the Gcn2 eIF2 kinase which can

phosphorylate eIF2α in response to amino acid starvation conditions (Tournu et al.

2005). Furthermore, C. albicans can mount a GCN (general control nonrepressible)

response to amino acid starvation; where it induces the expression of most amino acid

biosynthetic pathways, via Gcn4 transcription factor (Tripathi et al. 2002).

1.8.1.1 Mammalian eIF2α kinases

In mammalian cells, four different Serine Threonine protein kinases induce eIF2α

phosphorylation. They include; haem-regulated inhibitor of translation (EIF2AK1 or

HRI), double-stranded RNA activated kinase (EIF2AK2 or PKR) important in the

antiviral response; the PKR-like endoplasmic reticulum kinase (PERK or EIF2AK3), a

transmembrane ER enzyme that is activated by ER stress due to misfolded proteins in

the ER lumen; and a homologue of the eIF2α kinase in yeast, Gcn2 (EIF2AK4 or

GCN2) which is activated in response to amino acid starvation and ultraviolet (UV)

light (Dever 2002; Hinnebusch 2005; Jiang and Wek 2005).

HRI is the principal kinase in erythroid cells where it is activated under conditions of

haem deprivation. The primary function of HRI in erythroid cells is to coordinate globin

synthesis with available iron by blocking protein synthesis when haem is scarce (Han et

al. 2001; Lu et al. 2001). Haem binds to and inactivates HRI, but when haem

59

availability is limited, it is released, activating HRI. HRI has also been shown to

respond to other stress conditions when present in other cell types (Lu et al. 2001).

Expression of PKR is induced by interferon, and the kinase is activated by binding

double stranded RNAs, as part of the cellular antiviral response. Two dsRNA-binding

motifs (dsRBMs) precede the protein kinase domain and it has been suggested that these

promote dimerization and kinase activation in the presence of dsRNA (Lee et al. 1993;

Garcia et al. 2007). Increased activation of HRI and PKR in cells can dramatically

inhibit almost all protein synthesis in the affected cells (Pavitt 2005).

PERK, a transmembrane ER (endoplasmic reticulum) spanning enzyme is activated by

ER stress due to misfolded proteins in the ER lumen. In response to the accumulation of

unfolded proteins in the ER, PERK activation should limit translation of proteins

destined for the ER, and other signals generated as part of the unfolded protein response

lead to activation of ER chaperone genes.

1.8.1.2 eIF2α dephosphorylation

Phosphorylated eIF2α is also targeted by protein phosphatases and it is possible that

regulation exists at this level too. In mammalian cells, the phosphatase PP1c (Latreille

and Larose 2006) and GADD34, dephosphorylate eIF2α in a negative feedback loop

(Novoa et al. 2003) as part of the integrated stress response. Indeed GADD34 is a

transcriptional target of ATF4 (see section 1.8.3). In an analogous manner, in yeast the

essential phosphatase Glc7p has been shown to antagonise Gcn2p activity and repress

GCN4 when over-expressed (Wek et al. 1992). It has also been suggested that type II

phosphatases may also be capable of dephosphorylating eIF2α (Taylor et al. 2010).

60

1.8.1.3 Other mechanisms for eIF2B regulation

In mammalian cells, direct phosphorylation of eIF2B has also been identified as an

important regulatory mechanism. For example in the absence of insulin, the kinase

GSK3 phosphorylates eIF2B, inhibiting its activity. Insulin stimulates eIF2B activity by

relieving this inhibition through inactivation of GSK3. GSK3 phosphorylation sites

have been identified within the catalytic domain of eIF2Bε at Ser535 and Ser539

(Welsh et al. 1998; Wang et al. 2001). In addition, in both yeast and higher cells,

volatile anaesthetics appear to inhibit protein synthesis via eIF2B (Palmer et al. 2006).

Furthermore, in yeast, fusel alcohols have been shown to inhibit translation initiation

via a mechanism involving eIF2B (Ashe et al. 2001).

In humans specific mutations in any of the genes encoding the five subunits of eIF2B

lead to the onset of a fatal autosomal recessive brain disease known as CACH

(childhood ataxia with central nervous system hypomyelination) also called vanishing

white matter leukodystrophy (Fogli et al. 2002; van der Knaap et al. 2002). The disease

is chronic, progressive and fatal but has a wide clinical spectrum. Often symptoms

become apparent after a head trauma or following stress conditions that may down-

regulate eIF2B function (Fogli et al. 2004). All the model systems developed to study

the disease, suggest that eIF2B activity is reduced in affected patients, with the degree

of reduction showing some correlation with the severity of the disease (reviewed in

Pavitt (2005).

1.8.2 Regulation by eIF4E-binding proteins

Cap-dependent translation can be regulated by the association of eIF4E with the eIF4E-

binding proteins (4E-BPs). There are three functionally equivalent 4E-BPs in mammals;

4E-BP1, 4E-BP2, and 4E-BP3 (Jackson et al. 2010), S. cerevisiae has two 4E-BPs and

C. albicans has a single 4E-BP. In mammalian cells, when hypo-phosphorylated, 4E-

61

BP1 binds to eIF4E (in a binary complex), which prevents eIF4E’s association with

eIF4G and therefore prevents translation initiation (Jackson et al. 2010).

Phosphorylation of 4E-BP1 on multiple sites, mainly by mammalian target of

rapamycin (mTOR), releases eIF4E for assimilation into eIF4F. Rapamycin addition

and nutrient stress inhibit the mTOR pathway leading to dephosphorylation of 4E-BP,

sequestration of eIF4E and a general down-regulation of 5′ cap-dependent protein

synthesis (Richter and Sonenberg 2005). These translational regulators are relevant to

human disease. For example, LRRK2, which is mutated in Parkinson’s disease, has

been shown to be a 4E-BP1 kinase. The altered LRRK2 activity may affect synapse

structure and function in Parkinson’s disease. Mutated forms of this protein show

increased kinase activity resulting in hyper-phosphorylation of 4E-BP1

Other 4E-BP binding proteins that are mRNA-specific have been found to play a role in

transcript-specific translational regulation. For instance, Maskin in Xenopus laevis and

Cup in Drosophila melanogaster are two such 4E-BPs that are targeted to specific

mRNAs by interaction with mRNA-binding proteins that are targeted to specific 3’UTR

sequences (Richter and Sonenberg 2005).

S. cerevisiae has two eIF4E binding proteins, Caf20p and Eap1p whose binding sites are

on the dorsal surface of eIF4E (Cosentino et al. 2000). Caf20p is a phosphoprotein of

about 20kDa, which shares a conserved region of eIF4G required for binding eIF4E.

Studies show that it competes with eIF4G for the same eIF4E binding site and inhibits

cap-dependent but not cap-independent translation (Altmann et al. 1997). Caf20p is

phosphorylated to various degrees under different conditions, suggesting a role in

translation control analogous to the mammalian 4E-BPs. Disruption of CAF20 has been

shown to stimulate a slight increase in the growth of yeast cells, but overexpression

causes a mild slow growth phenotype in yeast, consistent with a negative role in

translation (Altmann et al. 1997).

62

Eap1p also blocks Cap-dependent translation in yeast via competition with eIF4G.

Though Caf20p and Eap1p translationally regulate some mRNAs they are unlikely to

act as global translational regulators (Ibrahimo et al. 2006). Both of the yeast eIF4E-

binding proteins, are required for pseudohyphal growth as the mutants were shown to be

deficient in pseudohyphal growth in S. cerevisiae (Ibrahimo et al. 2006).

While cap-independent translation does occur, cap-dependent translation is believed to

be the major pathway for translation initiation in eukaryotes (McCarthy 1998).

Intriguinly in C. albicans, deletion of genes involved in catalayzing the formation of

mRNA cap structure including triphosphatase-encoding gene (CET1) and the mRNA

methyltransferase encoding gene (CCM1) does not cause lethality (Dunyak et al. 2002),

unlike the parallel mutations in S. cerevisae (Shibagaki et al. 1992; Tsukamoto et al.

1997). Therefore the m7GpppN mRNA cap structure is not absolutely required in C.

albicans and the mRNA cap probably contributes to efficiency but is not essential

(Dunyak et al. 2002).

C. albicans harbours just a single eIF4E binding protein, Caf20p, which represses CAP-

dependent translation and the protein is enriched during stationary phase (Kusch et al.

2008).

1.8.3 Amino acid starvation and GCN4 regulation

Probably the best characterised translational regulatory circuit in S. cerevisiae is the

general amino acid control pathway that is activated in response to amino acid

starvation, although other cellular stresses can also have an impact. In stressed yeast

cells Gcn2p phosphorylates eIF2α to reduce eIF2B activity and thereby lower the

abundance of Ternary Complex (TC) in the cell. The consequent reduction in TC

formation by eIF2α phosphorylation paradoxically stimulates translation of GCN4

63

mRNA while decreasing the rate of general translation. Gcn4p is a transcription factor

which up-regulates transcription of over 500 genes including many that encode amino

acid biosynthetic enzymes (Natarajan et al. 2001). This pathway is referred to as the

general amino acid control (GAAC) pathway (Hinnebusch 2005). The induction of

GCN4 translation is determined by four short open-reading frames (ORF) in the GCN4

mRNA leader region (Fig. 1.6 a,b) (Hinnebusch et al. 2004). According to the scanning

mechanism of translation initiation, each of the four upstream AUGs in the GCN4

mRNA leader should be selected as initiation sites prior to the start codon of the GCN4

ORF. Control of GCN4 mRNA translation is thought to occur via a reinitiation model.

The AUG start codon in uORF1 is the first to be recognised and translated. The

termination context of uORF1 is unusual and allows the ribosome to remain bound to

the mRNA after termination and to continue scanning (Grant and Hinnebusch 1994). In

non-starved cells, scanning ribosomes select the first AUG, translate the uORF1 and

resume scanning downstream.

64

Figure 1.6 a. A model for translational control of yeast GCN4 under non starvation

condition. GCN4 mRNA is shown with uORFs 1 and 4 and the GCN4 coding sequence

indicated as a box. Shaded 40 S ribosomal subunits are competent to initiate translation

as they are associated with the ternary complex. Unshaded 40S ribosomal subunits lack

TC and thus cannot reinitiate. Following the translation of uORF1, 50% of the 40S

ribosomes remain attached to the mRNA and resume scanning. Under non-starvation

conditions, the 40S subunit quickly rebinds the TC before reaching uORF4, because the

TC concentration is high, translate uORF4, and dissociate.

65

Figure 1.6 b. A model for translational control of yeast GCN4 under starvation

condition. GCN4 mRNA is shown with uORFs 1 and 4 and the GCN4 coding sequence

indicated as a box. During amino acid starvation, eIF2α is phosphorylated by the protein

kinase Gcn2p, thus converting eIF2 from substrate to inhibitor of the GEF eIF2B and

reducing the eIF2-GTP level in the cell. As a result, TC levels are reduced. Following

the translation of uORF1, 50% of the 40S ribosomes remain attached to the mRNA and

resume scanning. Under starvation conditions, ~ 50% of the rescanning 40S ribosomes

fail to rebind the TC until scanning past uORF4, because the TC concentration is low

and reinitiate at GCN4. (Adapted from Hinnebusch 2005).

Since eIF2B activity is high and TC is abundant, all of the scanning 40S ribosomes

rebind TC before reaching uORF4, which permits its recognition and translation (Fig.

1.6 a). Unlike the uORF1, the termination context of the uORF4 termination codon

promotes dissociation of the ribosome, thereby preventing the ribosome from scanning

to the downstream GCN4 ORF (Grant and Hinnebusch 1994). However under

66

starvation conditions, there is a lower abundance of TC as eIF2B is sequestered by

phosphorylated eIF2 (Dever et al. 1995). While there remains a sufficient amount of TC

to permit translation of uORF1, it takes much longer to recruit TC onto the 40S

ribosomes scanning downstream from uORF1. This delay in the TC recruitment enables

about 50% of the 40S subunits to bypass uORF4, rebind TC in the interval between

uORF4 and GCN4. This permits recognition and reinitiation of translation at GCN4 (fig.

1.6b). Genetic evidence indicates that reinitiating ribosomes bypass uORFs 2 to 4 under

derepressing conditions because the distance between uORF1 and uORF4 is not large

enough to ensure that they rebind the factors required for reinitiation before reaching

uORF4 (Hinnebusch 2005).

It is important to note that conditions which induce eIF2 phosphorylation are not the

only means by which GCN4 can be translationally induced. Indeed any alteration in the

rate of ternary complex formation will cause such induction. Hence, a number of

Gcn2p-independent mechanisms for the regulation of GCN4 translation have been

discovered (Ashe et al. 2001). For example inhibition of eIF2B activity by fusel

alcohols in S. cerevisiae occurs independently of eIF2α phosphorylation, this also leads

to reduced TC levels and derepression of GCN4 translation (Ashe et al. 2001).

In the human pathogenic yeast C. albicans, the GCN4 mRNA leader contain three

uORFs. Intriguingly, recent findings show that a single inhibitory uORF (uORF3) is

sufficient for translational regulation of GCN4 in C. albicans (Sundaram and Grant

2014).

In mammals, similar mechanisms to GCN4 regulation exist; such that as well as

inhibiting general translation, the phosphorylation of eIF2α in response to a range of

stress conditions induces the translation of specific mRNAs. For example, the ATF4,

ATF5, CHOP and IBTKα mRNAs are induced by virtue of uORFs in a manner

analogous to GCN4 (Harding et al. 2000; Vattem and Wek 2004). The protein ATF4

67

forms part of an integrated stress response where it is involved in the feedback

regulation of protein synthesis via activation of the phosphatase GADD34 (see 1.8.1.2)

and it activates a cascade of transcriptional effects, for instance the transcription factor

CHOP is activated. In addition, ATF4 alters the transcription of many other genes

involved in amino acid metabolism, the response to oxidative stress and regulation of

apoptosis (Harding et al. 2000; Harding et al. 2003).

1.8.4: Translational response to membrane stress

Another pathway of translational regulation that could prove relevant to the cellular

response to alcohols is the response to membrane stress. The transport of lipids and

proteins between intracellular organelles is a highly regulated process. Perturbations to

this transport pathway result in changes to the lipid composition and mis-localisation of

membrane proteins. Exposure of S. cerevisiae to membrane stress causes the cells to

repress the transcription of genes encoding rRNA, tRNA and ribosomal proteins (Li et

al. 1999). In addition, perturbation of this pathway using the drug Chlorpromazine

causes a rapid and specific inhibition of translation. This regulation of translation

involves both eIF2α phosphorylation and the eIF4E binding protein Eap1p. GCN4

translation is upregulated in response to blocks in the membrane transport pathway;

however the mechanism by which eIF2α phosphorylation is induced is not clear. It has

been shown that eIF2α phosphorylation under membrane stress is not dependent on

Gcn2p because there is no accumulation of uncharged tRNAs in the cell. Therefore it

has been suggested that a protein phosphatase could be inhibited, giving rise to

increased levels of phosphorylated eIF2α (De Filippi et al. 2007). However, the capacity

of alcohols to trigger these effects has not been studied and it seems highly unlikely that

fusel alcohols are acting in a similar manner to Chlorpromazine as they lead to a

dephosphorylation of eIF2α (Taylor et al. 2010).

68

1.9 Localisation of translation initiation factors

1.9.1 Stress granules and processing bodies (P-bodies)

A variety of translation initiation factors and factors involved in mRNA maintenance

have been found to localise to a number of discrete cellular foci under different

conditions. Stress granules and processing bodies (P bodies) are two well described

examples of such bodies. Cellular stress induces the formation of stable mRNA and

mRNP aggregates, termed stress granules (SGs), that are induced in an eIF2α

phosphorylation dependent or independent manner (Anderson and Kedersha 2006). In

mammalian cells, eIF2α phosphorylation independent formation of SGs can be brought

about by drugs that affect either eIF4A’s or eIF4G’s activity (Low et al. 2005; Kim et

al. 2007). Stress granules harbour ribosomal proteins and early translation initiation

factors such as eIF2, eIF3, eIF4E and eIF4G (Kedersha et al. 1999). Stress granules are

dynamic and interact with other cytoplasmic proteins and also with processing bodies

(Kedersha et al. 1999). Distinct granules known as P bodies are found in both yeast and

mammalian systems. P-bodies have been defined as cytoplasmic bodies that harbour

many of the enzymes involved in the 5′ to 3′ pathway of mRNA decay and are

presumed to sort mRNA content according to cellular requirement (Sheth and Parker

2003; Kedersha et al. 2005). Stress granules are distinct from P-bodies in their

composition and function, however, several factors populate both structures in vivo

(Cougot et al. 2004).

1.9.2 eIF2B Bodies

Recent work has shown that eIF2B and eIF2 reside in a large cytoplasmic body termed

the eIF2B body (2B body) and this body represents a site where guanine nucleotide

exchange of eIF2-GDP to eIF2-GTP can occur (Campbell et al. 2005; Taylor et al.

2010). This localisation is specific for these factors and requires active translation.

69

Other initiation factors studied were found to be dispersed throughout the cytoplasm

during log-phase of growth in complete media (Taylor et al. 2010). Addition of

cycloheximide, which acts to inhibit translation initiation and elongation leads to the

eradication and dispersal of the eIF2/eIF2B foci, therefore indicating the requirement

for active translation for their formation.

Quantitative analysis of the proportion of cellular eIF2B and eIF2 found in these foci

showed that under unstressed conditions around 20% of eIF2 and 40% of eIF2B is

found within the eIF2B body. The dynamic cycling of eIF2 through the 2B body can be

assessed using FRAP (fluorescence recovery after photobleaching). FRAP analysis

showed that eIF2B remains a largely resident feature, whilst eIF2 shuttled through the

focus. This could indicate that these foci are sites of guanine nucleotide exchange.

Using FRAP, it was shown that amino acid starvation leads to a significant increase in

the half-time of recovery after photobleaching for eIF2 (Campbell et al. 2005). It can be

deduced from this that a stress known to reduce GEF activity of eIF2B, reduces the rate

of eIF2 shuttling onto foci (Campbell et al. 2005). In addition to this, the recovery of

gcn2∆ strain was unaffected when a similar experiment was carried out with the strain.

Butanol treatment also causes an increase in the half-time of recovery after

photobleaching, but the magnitude of this change is very much smaller than that

observed after amino acid starvation. Other conditions that inhibit guanine nucleotide

exchange, for example a GCN2-constitutive mutant, also reduce the rate of eIF2

shuttling (Campbell et al. 2005).

The 2B body was also shown to traverse almost all regions of the cytoplasm. Time lapse

microscopy was used to investigate the dynamics of the 2B body. It appears that the

body can cycle between two phases: a tethered non-mobile phase and a mobile diffusing

phase (Taylor et al. 2010). Treatment with fusel alcohols increases the length of time

70

that the body remains in a tethered state, thus reducing the movement of the body

around the cell (Taylor et al. 2010).

1.10 Fusel alcohols

It is well-established that Saccharomyces cerevisiae produces fusel alcohols. 1-butanol,

isoamyl alcohol and isobutanol are end products of catabolism of threonine, leucine and

valine respectively (Webb and Ingraham 1963; Dickinson 2000). Fusel alcohol

production from amino acids proceeds via the Ehrlich pathway. This pathway consists

of three enzymatic steps:

1. transamination to form an α-keto acid

2. decarboxylation to yield an aldehyde

3. reduction to a fusel alcohol

The decaboxylation step for the different fusel alcohols is carried out by different

pyruvate decarboxylases (Dickinson 2000) and a range of alcohol dehydrogenases

(ADHI, ADHII and ADHVI) with reductase activity have been implicated in the final

reduction of aldehydes to fusel alcohols (Dickinson 2000; Larroy et al. 2003).

71

α- ketoisocaproic

acidα- keto-β-methylvaleric

acid

α- ketoisovaleric

acid

leucine Isoleucine Valine

3-methylbutanal 2-methylbutanal Isobutanal

Isoamyl alcohol Active amyl alcohol Isobutanol

NH2 NH2

NH2

CO2 CO2 CO2

Pdc1pPdc5pPdc6pYd1080cp

Pdc1pPdc5pPdc6p

Yd1080cp

NAD+

NADH, H+

NAD+ NAD+

NADH, H+ NADH, H+

Figure 1.7 Ehrlich pathway for fusel alcohol production from branched chain

amino acids. Catabolism of branched-chain amino acids leads to the formation of fusel

alcohols

1.10.1 The impact of fusel alcohols on protein translation

A range of fusel alcohols including n-butanol and isoamyl alcohol have been shown to

rapidly inhibit translation initiation in yeast through an eIF2B-dependent yet eIF2α

72

phosphorylation independent mechanism (Ashe et al. 2001). The studies defined a role

for eIF2B in regulating translation in response to butanol. Two variants of the S.

cerevisiae W303-1A strains were identified which respond differently to the addition of

butanol and were termed ButS (butanol sensitive) and But

R (butanol resistance) strains.

The difference between the strains was traced to a mutation in the GCD1 gene, which

results in a P180S variation in the Gcd1p protein (the γ subunit of eIF2B) (Ashe et al.

2001). The inhibition of translation initiation exerted by the addition of butanol is

extremely rapid occurring within one minute as determined by polysome analysis and a

35S-methionine incorporation assay (Ashe et al. 2001). Intriguingly, this regulation of

translation inhibition does not occur via previously described mechanisms. This was

demonstrated by the use of mutants: a strain bearing an non-phosphorylatable form of

eIF2α (SUI2-S51A) and a strain without the eIF2α kinase (gcn2Δ), which are

translationally resistant to amino acid starvation; and TOR1-S1971I, which is resistant

to rapamycin treatment. These mutant strains were both translationally sensitive to

butanol in the ButS strain, thus indicating that the amino acid starvation and exposure to

rapamycin pathways of translational control are not the same as the butanol-dependent

pathway. Furthermore, it has been shown that fusel alcohols bring about a decrease in

the phosphorylation of eIF2α, in contrast to the effects of amino acid starvation (Taylor

et al. 2010), but similar to the effect of volatile anaesthetics (Palmer et al. 2005; Palmer

et al. 2006); however, this dephosphorylation is not essential for the inhibition of

translation by fusel alcohols (Ashe et al. 2001). Gene expression profiling has revealed

that as well as translation of GCN4 mRNA, other sets of genes are also upregulated in

response to butanol. These include genes that are required for the cell cycle, protein

synthesis, cellular transport and nitrogen metabolism. Therefore there is a correlation

between the physiological impact of butanol and the genes that are upregulated in

response to it (Smirnova et al. 2005). Furthermore, fusel alcohols were shown to

73

prevent the movement of this eIF2B body through the yeast cell cytoplasm, perhaps

because the alcohols stabilize a tethered form (Taylor et al. 2010).

All of the work performed on the impact of alcohols, particularly fusel alcohols, on

protein synthesis has centred on the budding yeast, S. cerevisiae. Therefore, the

question as to how these alcohols affect a Crabtree negative yeast like the human

pathogen, Candida albicans is unresolved.

1.10.2 Effect of alcohols on Candida albicans

There is increasing evidence that alcohols have profound effects on some clinically

relevant properties of Candida species and other pathogenic microorganisms. Fusel

alcohols are by products of amino acid catabolism in yeast and their production is

associated with nitrogen scarcity. In both S. cerevisiae and C. albicans, as well as

ethanol, fusel alcohols including isoamyl alcohol, isobutanol, active amyl alcohol and 1-

butanol are also formed (Webb and Ingraham 1963). C. albicans when grown in poor

nitrogen conditions can also utilize aromatic amino acids by the Erlich pathway and

form aromatic alcohols as a byproduct (Ghosh et al. 2008). Ethanol is one of the

products of the metabolism of glucose in C. albicans, but as a Crabtree negative yeast

species the production of biomass via respiration is the favoured metabolic route rather

than ethanol production from fermentation (Pronk et al. 1996; Piskur et al. 2006).

Hence, while C. albicans can utilize ethanol as a sole source of carbon, it is effectively

inhibited by quite low concentrations of ethanol compared to S. cerevisiae (Zeuthen et

al. 1988).

74

1.10.3 Fusel alcohols induce morphological changes in yeast

As already mentioned in section 1.4.1, a number of connections have been described

between the regulation of protein synthesis and filamentous growth in fungi. It was

found that minimal cycloheximide treatment which will normally cause a cessation of

protein synthesis also results in a lower proportion of pseudohyphal cells (Kron et al.

1994). In addition, studies have shown that nutritional conditions that elicit global

effects on protein synthesis also impact upon morphological transitions in yeast (Ashe

et al. 2000; Ashe et al. 2001; Gancedo 2001).

The formation of pseudohyphae can be induced in S. cerevisiae exposed to fusel

alcohols. Isoamyl alcohol and 1-butanol have been shown to induce pseudohyphal

formation in yeast and this may function as a foraging mechanism (Dickinson 1996). At

a concentration of 0.5% (v/v) in complex media, isoamyl alcohol was reported to induce

the formation of hypha-like extentions in haploid and diploid strains of S. cerevisiae,

however at a lower concentration of isoamyl alcohol (0.25%)(v/v) the cells formed

pseudohyphae (Dickinson 1996). The mechanism of fusel alcohol dependent

filamentous growth is quite different from that occurring during nitrogen-limited growth

because a distinct set of genes are involved. For example, butanol-induced

pseudohyphal growth is induced by the Swe1p-dependent morphogenesis checkpoint,

(Martinez-Anaya et al. 2003), and is independent of genes such as FLO8 and FLO11

that are required for pseudohyphal induction during nitrogen limitation (Lorenz et al.

2000). The morphogenesis checkpoint is a unique cell cycle checkpoint in budding

yeast that coordinates bud formation with mitosis and ensures that mitosis only occurs

after bud formation (Martinez-Anaya et al. 2003). It was also demonstrated that fusel

alcohol-induced filamentous growth is dependent on Pkc/Slt2p (Mpk1p), the cell

integrity MAP kinase and S1t2p is activated upon exposure to isoamyl alcohol

(Martinez-Anaya et al. 2003).

75

1.10.4 Alcohols induce morphological changes in Candida albicans

One of the major predictors of C. albicans virulence is the ability to switch from yeast

to pseudohyphal or hyphal morphology. The yeast to hyphal morphogenesis is induced

in response to various environmental cues (Lengeler et al. 2000). Alcohols have been

implicated in the induction of pseudohyphal morphogenesis in Candida albicans and

other pathogenic Candida species. Isoamyl alcohol was reported to induce the

formation of pseudohyphae in C. albicans when the cells are grown in YEPD

containing 0.6% (v/v) isoamyl alcohol, about 75% of the C. albicans cells formed

pseudohyphae within 24 h (Dickinson 1996). Another study suggests that tyrosol, an

aromatic alcohol secreted by Candida albicans during growth can reduce the lag phase

and accelerate germ tube formation in dilute cultures of C. albicans (Chen and Fink

2006), while other aromatic alcohols tested (trypthophol and phenylethanol) failed to

stimulate filamentation in C. albicans. However these aromatic alcohols stimulated

morphogenesis in S. cerevisiae cells by inducing the expression of FLO11 through a

Tpk2p-dependent mechanism (Chen and Fink 2006). Studies carried out using C.

albicans mutants defective in cAMP-dependent PKA pathway (efg1/efg1), MAP kinase

pathway (cph1/cph1), or both (cph1/cph1 efg1/efg1), showed that while their parent

strain (CAI-4) formed pseudohyphae in the presence of 100µM tyrosol, the mutant

strains failed to form pseudohyphae under the same conditions (Ghosh et al. 2008). This

observation suggests that the cAMP-PKA kinase and MAP kinase pathways are

involved in the induction of pseudohyphae by aromatic alcohols in C. albicans.

Furthermore, the observation that aromatic alcohols activate Gcn4p through an eIF2α

independent manner (Ghosh et al. 2008) correlates with the findings of Ashe et al.

(2001) using n-butanol in S. cerevisiae.

Ethanol has been reported to induce a number of morphological changes in fungi

including germ tube formation in C. albicans and this occurs without the addition of

76

nitrogen-containing nutrients (Pollack and Hashimoto 1985). In another study, four

strains of C. albicans were used to determine the concentration of ethanol that will

induce germ tube formation, the results show that germ tubes are formed by all four

strains at concentrations of ethanol of 0.25-1% (Zeuthen et al. 1988). At a concentration

of 4.0% ethanol or below 0.015% no germ tubes were formed. The effect of ethanol on

germ tube formation is connected to protein synthesis as it was observed that exposure

of cells to ethanol depressed normal protein synthesis, but increased the synthesis of

stress proteins (Zeuthen et al. 1988).

1.11 Farnesol a seisquiterepene alcohol

Fungi produce a whole range of volatile organic compounds comprising monoterpenes,

sesquiterpenes and diterpenes. Volatile sesquiterpenes have almost exclusively been

reported from Ascomyta and Basidiomycota. (Hibbett et al. 2007). Sesquiterpenes are

usually formed by fungi in the late growth phase. The formation of volatile

sesquiterpenes is often based on enzymes expressed in differentiated cells. Only a few

sesquiterpene alcohols have been reported from fungi, however, for several of them

some specific ecological functions are known.

Farnesol is a natural 15-carbon acyclic sesquiterpene alcohol (3,7,11-trimethyl-2,6,10-

dodecatrien-1-ol) produced from 5-carbon isoprene compounds in both plants and

animals. It has three carbon-carbon double bonds and exists in four isomers but only the

E,E isomer has QS molecule activity (Shchepin et al. 2005). Farnesol is produced by a

few fungal species: Candida albicans, (Hornby et al. 2001; Langford et al. 2009),

Candida dubliniensis, (Hornby et al., 2001), Aspergillus fumigatus (Dichtl et al. 2010)

and Ceratocystis coerulescens (Sprecher and Hanssen 1983).

77

Figure 1.8 Chemical structure of farnesol (3,7,11-trimethyl-2,6,10-dodecatrien-1-

ol)

1.11.1 Farnesol and quorum sensing in C. albicans

Candida albicans has the capacity to switch from a yeast form to a hyphal form. One of

the parameters that impacts upon the yeast-to-hyphal switch in vitro is cell density. This

phenomenon has been associated with regulation by Quorum sensing (QS) (Hornby et

al. 2001).

Quorum sensing is the regulation of gene expression and group behaviour in response to

changes in cell population density. QS molecules were first discovered in bacteria. They

can mediate the sensing of cell density and control group behaviour like virulence,

antibiotic production, conjugation and biofilm formation (Miller and Bassler 2001).

In C. albicans, two studies identified two related compounds, farnesoic acid [(2E,6E)-

3,7,11-trimethyldodeca-2,6,10-trienoic acid] and farnesol [(2E.6E)-3,7,11-

trimethyldodeca-2,6,10-trien-1-ol], as QS regulators of the yeast-to-hyphal switch

(Hornby et al. 2001; Oh et al. 2001). Farnesoic acid was only produced in C. albicans

10231, the strain background used in the study by Oh et al. (2001). Farnesoic acid was

shown to have only 3.3% of the activity (compared with farnesol) on farnesol-producing

strains of C. albicans (Shchepin et al. 2003). C. albicans produces farnesol from an

intermediate of the sterol biosynthetic pathway, farnesyl pyrophosphate (FPP).

Compounds that block sterol pathway beyond FPP, such as zaragozic acids, were shown

to cause an eightfold increase in intracellular and extracellular farnesol levels. (Hornby

78

et al. 2003) showed that FPP was converted to farnesol by incubating [1-3H] (E,E)-FPP

with a C. albicans cell homogenate in a modification of allylpyrophosphatse assay. No

farnesol was made when the cell extract was heated to 95°C for 10 min. This shows that

C. albicans possesses the enzymatic machinery to convert FPP to farnesol. (Hornby et

al. 2003). Also treatment with the antifungal, fluconazole (another sterol inhibitor),

resulted in a 13-fold increase in the amount of farnesol produced by C. albicans

(Hornby et al. 2003).

According to Hornby et al. (2001), the properties of farnesol as a QS molecule are

consistent with those expected of a fungal QS molecule. (a) It is extracellular, diffusible

and can be removed from cells by washing. (b) It is produced continually during growth

in amounts roughly proportional to cell mass. (c) It inhibits the formation of germ tubes

under germ tube inducing conditions. (d) It alters cell morphology but does not alter cell

growth at the physiological concentration (below 40µM). Thus its mode of action is

likely more specific than just general inhibition. (e) It is produced at all growth

temperatures and its production is dependent on cell growth and not on a particular

carbon or nitrogen source.

C. albicans produces farnesol as an extracellular autoregulatory compound and when

farnesol accumulates above a threshold level, it inhibits yeast-to-hyphal switch as well

as biofilm formation (Hornby et al. 2001; Ramage et al. 2002; Martins et al. 2007). In

their study, (Ramage et al. 2002) observed that budded yeast cells in a mature biofilm

could not germinate in culture media containing high concentrations of farnesol. This

observation suggested that at certain farnesol concentration, mycelia development is

inhibited and the resulting yeast cells are prone to detach from the biofilm. However

farnesol had minimal effect on mycelia formation or biofilm growth if introduced after

any of these processes has already begun. Thus farnesol inhibits hyphal initiation but

79

does not suppress hyphal elongation (Mosel et al. 2005). Farnesol can also affect the

expression of virulence genes (Cao et al. 2005).

Low concentrations of farnesol (twenty to fifty micromolar) inhibits or kills a range of

fungi, opaque C. albicans cells, several mammalian cell lines and some bacteria

(reviewed in Langford et al. 2009). The report that C. albicans can exhibit exceptional

tolerance to farnesol (Hornby et al. 2001) was challenged by Shirtliff et al. (2009) who

showed that C. albicans were killed at concentrations of farnesol as low as 40µM.

However the differences in growth conditions used in these studies were shown to be

responsible for the discrepancies observed with growth sensitivities of C. albicans to

farnesol (Langford et al. 2009). Log phase cells or cells grown in minimal media were

shown to be more sensitive to farnesol than stationary phase cells or cells grown in rich

media (Langford et al. 2009). To gain insight into the response of C. albicans to

farnesol, global gene expression analysis were performed (Cao et al. 2005; Cho et al.

2007). Although various experimental approaches were used in these studies, farnesol

commonly affected the genes that belong to functional categories such as stress

response, heat shock, drug resistance, amino acid and carbon metabolism, iron

transport, cell wall and cell cycle.

1.11.2 Mechanism of inhibition of hyphal growth by farnesol.

Sato et al. (2004) suggested that the farnesol-dependent inhibition of hyphal formation

involves the mitogen-activated protein kinase pathway, which regulates the expression

of transcription factor Cph1p and the MAPKK Hst7p. This was determined by reduction

in the transcript levels of the genes for the proteins involved in this pathway in the

presence of farnesol. However farnesol inhibited the yeast-to-hypha transition in a

cph1/cph1 mutant, suggesting that CPH1 is not a primary but rather a secondary target

of farnesol (Davis-Hanna et al. 2008). Other morphogenetic regulators may play a role

80

in the C. albicans response to farnesol. For instance Chk1p, a two-component signal

transduction histidine kinase has been implicated in the farnesol mediated inhibition of

hyphal growth (Kruppa et al. 2004). Chk1p could function via the Hog1p MAP kinase,

which was shown to be phosphorylated in the presence of farnesol (Kruppa et al. 2004).

Tup1p has also been implicated in the response to farnesol. It was shown that

expression of TUP1 was slightly increased in response to farnesol and strains lacking

TUP1 or NRG1 did not respond to farnesol but generated higher levels of farnesol than

the wild type cells (Kebaara et al. 2008). In addition, the Ras1p-cyclic AMP-protein

kinase signalling pathway has been identified in the farnesol response. Farnesol

treatment increased the mRNA levels of cAMP-repressed genes, suggesting that cAMP

levels were reduced in the presence of farnesol (Davis-Hanna et al. 2008). Furthermore,

Hall et al. (2011), showed that farnesol can directly affect the activity of the C. albicans

adenylyl cyclase, thereby reducing the cAMP output to inhibit morphogeneis. With

regard to the yeast-to-hyphae transition, it appears that the response to farnesol is

multifactorial as there is no specific signalling pathway controlled in this response and a

single receptor for farnesol has yet to be identified.

1.12: Outline of Research

A starting point for the work in this thesis was provided by the observations that fusel

alcohols induce morphological differentiation in Candida albicans, whereas farnesol

blocks this process. Morphological transition is one of the key virulence factors in the

Candida albicans, a human pathogen and a relative of non- pathogenic yeast, S

cerevisiae. The mechanism through which fusel alcohol and farnesol induce these

changes have not been characterised in C. albicans. During the course of the studies in

this thesis, both fusel alcohols and farnesol were found to inhibit global translation

initiation in Candida albicans. The research presented takes both biochemical and cell

81

biological approaches to follow the mechanism by which alcohols exert translational

control in C. albicans, by mainly focusing on the effects on translation initiation factors.

Furthermore alterations in transcription and translation of C. albicans exposed to

farnesol are studied using RNA sequencing of Total and polysome associated RNA,

respectively. In addition, the mechanisms by which alcohols mediate morphological

transition in C. albicans will be investigated. It is hoped that this will lead to a better

understanding of the link between alcohol induced translational control and

morphological transition in C. albicans. Given the connection between virulence and

morphogenesis it is possible that this work may ultimately inform potential treatment

strategies.

82

2. Materials and Methods

2.1 Culture conditions

2.1.1 Strains and growth conditions

The Candida albicans CAI4 strain (Fonzi and Irwin 1993), an isogenic derivative of the

parental wild-type clinical isolate (SC5314) (Gillum et al. 1984), was used throughout

this study unless otherwise indicated (see Table 2.2). The CAI4 strain is a URA3

auxotroph, but has been used extensively in studies of stress responses in C. albicans

without significant difference when compared to the parent strain (SC5314) except in

animal model of systemic candidiasis assays where absence of URA3 affected virulence

of the CAI4 strain (Staab and Sundstrom 2003). Candida strains were routinely cultured

at 30oC in YPD (1% (w/v) Yeast Extract, 2% (w/v) Bacto peptone and 2% (w/v)

glucose) to mid-logarithmic phase (~1.0x107 cells/ml or optical density at 600 nm of

0.7). The alcohols (butanol, ethanol and farnesol) were added for 10 or 15 min to

particular concentrations in liquid or solid culture as stated in the results.

For radiolabelling experiments, C. albicans strains were grown in Synthetic Complete

Media (SCD) (Guthrie and Fink 1991) composed of 0.67% (w/v) Yeast Nitrogen Base

without amino acids (Formedium), 2% (w/v) glucose. The medium was supplemented

with synthetic complete amino acid drop out mix lacking methionine (Formedium).

Solid SCD and YPD agar plates were prepared as for liquid media, except for the

addition of 2% (w/v) Bacto Agar.

2.1.2 Monitoring the growth of yeast cultures

The growth of Candida albicans and Saccharomyces cerevisiae strains was determined

by measuring the optical density of the culture at a wavelength of 600 nm. For routine

83

OD measurements, 1ml of the culture was aliquoted into a disposable plastic cuvette

and the OD600 was measured using an Eppendorf Biophotometer plus

2.1.3 Bacterial strain and growth conditions

The DH5α Escherichia coli strain was used to amplify plasmid DNA for PCR and yeast

transformation. Cells were grown in Luria-Bertani (LB) media (10g/l Bacto-trypone and

sodium chloride, 0.5g/l Bacto yeast extract) at 37oC. Plasmid DNA was isolated using

the Qiagen Spin® Miniprep alkaline lysis kit according to manufacturers’ instructions.

Selection of plasmids was achieved by growth on LB+Carbenicillin plates. Carbenicillin

(Sigma) was added to LB at a concentration of 50µg/ml and 2% (w/v) Bacto Agar

(Melford) was included.

2.1.4 Alcohol tolerance

Strains were grown overnight to OD600 of 0.1 in YPD. 50ml cultures were set up in

250ml Erlenmeyer flasks containing butanol (0.5%, 1% and 2%); ethanol (2%, 4%, 6%

and 8%) and farnesol (40µM, 100µM, 200µM and 300µM). Control flasks had no

alcohol. The cultures were incubated on an orbital shaker (New Brunswick) for 6 h at

30oC. Growth was assessed at hourly intervals by measuring the OD600.

2.2 Morphogenesis assays

2.2.1 Colony morphology in liquid media

Overnight exponential C. albicans cultures were harvested, washed once in water and

resuspended in water to give an OD600 of 1.0. 50μl of the cell suspension was diluted

into 5ml YPD and the required concentrations of the appropriate alcohol (butanol,

84

ethanol and farnesol) were added. As controls, cells prepared in the same manner were

inoculated into 10% serum medium and into YPD without any of the alcohols. All of

the tubes were incubated at 37oC and 200 rpm on an orbital shaker (New Brunswick

Scientific). At various times during incubation (1 h, 2 h 4 h, 8 h and 24 h), cells were

mounted onto a microscopy slide and the morphology of the cells was monitored using

a Nikon Eclipse E600 a Nikon x10 and x40 objective and Axiocam MRm camera.

Images were acquired using Axiovision 4.5 software. The percentage of the cells

forming germ tubes or pseudohyphae were counted using a haemacytometer. Each

count was repeated for three different experiments and the mean of the three counts

recorded.

2.2.2. Colony morphology on solid media

To determine colony morphology on solid media, YPD agar supplemented with or

without the appropriate alcohol was used. Alcohols were added just before the agar

solidified to reduce their volatility. YPD agar with 10% serum was also prepared to

serve as a positive control. Log phase cells washed in water were diluted to give 101/ml-

104/ml of cells. 100μl of the lowest two dilutions were spread on the plates using sterile

glass beads. The plates were incubated at 37oC until colonies appeared. Colony

morphology was monitored using a Nikon Eclipse E600 with a Nikon x10 and x40

objective and Axiocam MRm camera. Images were acquired using Axiovision 4.5

software.

85

2.3 Manipulation of protein in vitro

2.3.1 Preparation of C. albicans cell extracts for Western analysis

50ml of an OD600 0.7 YPD-grown yeast culture was harvested in a Sigma 4K15

centrifuge at 5000хg for 5 min. The cell pellet was resuspended in 1ml of chilled 1 x

Buffer A (30mM Hepes.KOH pH 7.5, 100mM Potassium Acetate, 2mM Magnesium

Acetate, 1mM phenylmethylsulfonyl fluoride) and the cells harvested at 4oC in an

Eppendorf 5415D microfuge at 10,000хg for 2 min. The cell pellet was resuspended in

100μl of chilled 1 x Buffer A prior to the addition of 200μl of glass beads (425-600μm,

Sigma-Aldrich). The samples were mixed vigorously on a vortex mixer for 15 sec then

incubated in iced water for at least 40 sec. This step was repeated five times except the

final mix was extended to 25 sec. The samples were centrifuged at 10,000хg for 15 min

at 4oC. The final supernatant was collected and the protein concentration was measured

(see section 2.3.2). Protein extracts were routinely stored at -20oC in 2 x SDS loading

buffer (10% (v/v) Glycerol, 5% (v/v) mercaptoethanol, 3% (w/v) SDS, 62.5mM Tris-

Hcl pH 6.8, Bromophenol blue) and boiled at 95oC for 5 min prior to loading.

2.3.2: Determination of protein concentration

The total protein concentration of whole cell extracts was determined using the

Bradford method (Bradford 1976). This method is based on the fact that protein-dye

complexes cause a shift in the dye (Coomassie) absorption maximum from 465 to 595

nm. Absorption at 595 nm is proportional to protein concentration. A standard curve

was prepared using dilutions of bovine serum albumin (Sigma). 200µl of BioRad

Bradford reagent was added to 800µl of each sample and mixed thoroughly.

Absorbance readings were measured at OD595 and the values obtained were plotted

against the protein concentration to obtain a standard curve. To measure the protein

concentration of yeast samples, 10µl of a 1:10 dilution of yeast protein extract was

86

added to 790µl water and 200µl Bradford reagent. The OD595 of samples was measured

and protein concentration determined based on the standard curve.

2.3.3: Sodium Dodecyl Sulphate Polyacrylamide Gel Electrophoresis (SDS PAGE)

Protein electrophoresis was performed as described by Laemmli (1970), Sambrook and

Russel, (2001) using the BioRad Protean III mini gel apparatus. 10% polyacrylamide

resolving gels (364mM Tris-HCL pH 8.8, 0.1% (w/v) SDS), were routinely used. The

stacking gel composition was 125mM Tris-HCL pH6.8, 0.1% (w/v) SDS, 4% (v/v)

polyacrylamide (Sigma-Aldrich). Polymerisation was promoted by adding 11μl

TEMED (Sigma) and 30μl (10mg/ml) ammonium persulphate to a total gel volume of

5.5ml immediately prior to pouring. Gels were run at 130 V for 1 h in a reservoir of 1 x

protein running buffer (0.19M glycine, 25mM Tris base, 1% (w/v) SDS). Precision plus

protein All Blue standards (BioRad) were routinely used as size standards throughout

this study.

2.3.4 Coomassie stain

SDS PAGE resolving gels were removed from the gel running apparatus and soaked in

Simply Blue SafeStain (Invitrogen) for 1 h, then washed in water.

2.3.5: Western blotting

SDS PAGE resolving gels were removed from the gel running apparatus and immersed

in 1 x transfer buffer (20% (v/v) methanol, 25mM Tris base, 192mM glycine, 0.1%

(w/v) SDS). The blotting apparatus, consisting of four sponges, blotting paper and

Hybond-ECL nitrocellulose membrane (Pharmacia), was also soaked in 1 x transfer

buffer. These were assembled in the BioRad electroblotting apparatus such that proteins

87

would be transferred from the gel to the membrane. Electroblotting was performed at 25

V in 1 x transfer buffer for 2 h, cooled with an ice chamber. The membrane was

removed and immersed in blocking solution (1 x PBS (137mM sodium chloride, 10mM

sodium phosphate buffer pH 7.4, 2.7mM potassium chloride), 0.1% (v/v) Tween 20 and

5% (w/v) skimmed milk) for 1 h at room temperature. The membrane was subsequently

immersed in the same solution containing an antibody to the protein of interest (see

table 2.5) for at least 1 h. The membrane was then washed three times for 15 min each

in 1 x PBS Tween solution (137mM sodium chloride, 10mM sodium phosphate buffer

pH 7.4, 2.7mM potassium chloride and 0.1% (v/v) Tween 20). A source specific

horseradish peroxidise (HRP) conjugated secondary antibody, typically a 1:10,000

dilution in 1 x PBS Tween + 5% (w/v) skimmed milk was added for 1 h with rocking.

The membrane was then washed for 3 x 15 min in 1 x PBS Tween before addition of

equal volumes of ECL detection reagent (Thermo Scientific). The membrane was

overlaid with a strip of blotting paper then wrapped with the Saran wrap before

exposure to autoradiography film (Fuji, Japan).

2.3.6 [35

S] methionine incorporation assay

C. albicans strains were grown to OD600 of 0.7 in SCD medium lacking methionine

(0.67% (w/v) Yeast nitrogen base without amino acid (Formedium), 2% (w/v) glucose

and 0.2% synthetic Complete Amino acid Drop out-Met (Formedium). The culture was

split into two flasks and an appropriate quantity of a particular alcohol was added to one

of these. The two flasks were incubated for 10 min at 30oC, then methionine was added

to a final concentration of 60ng/ml, of which 0.5ng/ml was [35

S] methionine (cell-

labelling grade 1175 Ci/mmol; New England Nuclear, Boston, MA). Samples (1ml)

were taken and processed as described previously (Ashe et al. 2000). Briefly, 1ml

samples were added to 1ml of 20% trichloroacetic acid (TCA) at the various time points

88

and heated at 95°C for 20 min in a water bath. The protein precipitate was collected on

GFC filters (Whatman, GE Healthcare Buckinghamshire, UK), washed with 2ml of

10% TCA and then with 2ml of 95% ethanol, and counted in Scintisafe (Fisher,

Leicestershire, UK,) scintillation fluid using the Liquid Scintillation Analyzer

(Packard).

2.3.7 GCN4 Reporter assays

Luciferase assays to evaluate expression from the GCN4 and the GCRE reporters were

performed essentially as described by Srikantha et al. (1996). Briefly, cells were

harvested and extracted using RLUC buffer (0.5M NaCl, 0.1M K2HPO4 (pH 7.6), 1mM

Na2 EDTA, 0.6mM sodium azide, 1mM phenylmethylsulfonyl fluoride, 0.02% bovine

serum albumin). Luciferase assays were started by adding 1.25µM coelentrazine h

(Promega USA) to cell extracts, and activity was measured using GloMax 20/20

luminometer (Promega). Luciferase activity (RLU) is expressed as relative

luminescence per 10 sec/mg protein.

2.3.8 Preparation of yeast cell extracts for Tandem Affinity Purification

1litre of S. cerevisiae TAP-tagged strains at mid-log phase was harvested at 8,000хg for

4 min at 30oC in an Avanti J-20 centrifuge (Beckman Coulter). The supernatant was

removed and the yeast cell pellet was resuspended in 50ml of SC-His containing 3%

glucose. The cells were then transferred to a 50ml tube and pelleted at 5,000хg for 5

min at 4oC in a clinical centrifuge. All media was removed and yeast cells were flash

frozen in liquid nitrogen. 5ml of LOLA140 complete lysis buffer (20mM Tris-HCl (pH

8.0), 140mM NaCl, 1mM MgCl2, 0.5% NP40, 0.5mM DTT, 1mM PMSF, phospho

inhibitors (5mM NaF, 100µM Na3VO4) and protease inhibitor cocktail) was added to

89

the frozen cells, re-frozen again and stored at -80oC prior to processing. Cells were

ground to a fine powder in liquid nitrogen in a freezer mill (Spec 6870, SPEX, UK).

The powder was allowed to thaw on ice and clarified by centrifugation at 15000хg for

10 min at 4oC in a microcentrifuge (Eppendorf, Model 5414D) to give the whole cell

extract.

2.3.9 Tandem Affinity Purification of proteins

200µl of an IgG bead slurry (Dynabeads M-280 Tosylated - Invitrogen) was washed

twice in LOLA140 complete buffer. Then 10mg of whole cell extract was incubated

with the beads on a rotating wheel in the cold room for 20 min. Following this, 50µl of

supernatant (flowthrough) was removed for SDS-PAGE analysis. The conjugated beads

were washed 3 times for 15 min using 1ml of LOLA140 complete. NP40 was not

included in the buffer for the final wash step as the detergent interferes with mass

spectrometry. Bound proteins were eluted using the elution peptide (O(PEG)4-

DCAWHLGELVWCT) (Peptide Protein Research Limited). 200µl of elution buffer

(40mM Tris-HCl (pH8, 100mM NaCl, 1mM EDTA, 0.01% (v/v) Tween 20, 5%

ethanol) containing 2.1mM final concentration of the peptide was mixed with the beads

after the final wash and incubated with rotation at room temperature for 15 min. The

eluate was collected and concentrated using a YM13 ultracentrifugal filter (Millipore).

Samples were mixed with 2x SDS loading buffer and run on SDS-PAGE gel for either

Western analysis or stained with Coomassie for mass spectrometry.

2.3.10 Preparation of yeast cell extracts for FLAG-Affinity purification

4litre of mid-log phase C. albicans FLAG-Gcd1p strain was harvested at 8,000хg for 4

min at 30oC in an Avanti J-20 centrifuge (Beckman Coulter). All supernatant was

90

removed and the yeast were resuspended in 50ml of SC containing 3% glucose. The

suspension was transferred to 50ml tube and yeast were pelleted at 5,000хg for 5 min at

4oC in a clinical centrifuge. The spent media was removed and the yeast cells were

frozen in liquid nitrogen. 5ml of lysis buffer (30mM HEPES, 800mM KCl, 10% (v/v)

glycerol, 0.1% (v/v) Triton X-100, 5mM NaF, 1mM PMSF, 5mM β-mercaptoethanol,

1% (v/v) Calbiochem Set IV Protease Inhibitor Cocktail, 1µg/ml pepstatin, 1µg/ml

leupeptin, 1µg/ml aprotinin in dH2O pH 7.5) was added to the frozen cells, re-frozen

and stored at -80oC prior to processing. Cells were ground to a fine powder in liquid

nitrogen in a freezer mill (Spec 6870, SPEX, UK). The powder was allowed to thaw on

ice and 2ml of lysis buffer per gram of cell powder was added. The resulting mixture

was clarified by centrifugation at 5,000хg for 20 min at 4oC and the supernatant

collected into a new tube. The supernatant was further clarified by centrifugation at

20,000xg for 30 min at 4oC in a Biofuge stratos (Heraeus Instruments) to give the whole

cell extract.

2.3.11 FLAG Affinity purification of proteins

400µl of ANTI-FLAG M2 Magnetic beads (Sigma) was pre-washed twice with 1ml

lysis buffer. Whole cell extract (10g of total protein) was added to the beads and

incubated with rotation for 2 h at 4oC. The supernatant (flowthrough) was removed

from the beads, which were further washed twice in 25ml lysis buffer and twice in 25ml

low salt buffer (30mM HEPES, 100mM KCl, 10% (v/v) glycerol, 0.1% (v/v) Triton X-

100, 5mM NaF, 1mM PMSF, 5mM β-mercaptoethanol, 1% (v/v) Calbiochem Set IV

Protease Inhibitor Cocktail, 1µg/ml pepstatin, 1µg/ml leupeptin, 1µg/ml aprotinin in

dH2O pH 7.5). Bound proteins were eluted by incubation with 500µl elution buffer

(30mM HEPES, 100mM KCl, 10% (v/v) glycerol, 0.1% (v/v) Triton X-100, 5mM NaF,

1mM PMSF, 5mM β-mercaptoethanol, 1% (v/v) Calbiochem Set IV Protease Inhibitor

91

Cocktail, 1µg/ml pepstatin, 1µg/ml leupeptin, 1µg/ml aprotinin in dH2O pH 7.5,

0.1mg/ml 3X FLAG peptide (Sigma) for 30 min at 4oC with constant rotation and the

resulting eluate was collected.

2.4 Polysome analysis

2.4.1: Preparation of C. albicans cell extracts for polysome analysis

C. albicans cultures were grown to an OD600 of 0.7 and 50ml aliquots were either

maintained as untreated or a particular alcohol was added for 10 min. Cultures were

transferred to a pre-chilled tube containing 1ml of 50mg/ml cycloheximide

(Calbiochem). The cells were harvested by centrifugation at 4,000хg for 5 min at 4oC in

a clinical centrifuge (Sigma). Cells were washed in 25ml pre-chilled lysis buffer (20mM

HEPES pH7.4, 2mM Magnesium Acetate, 100mM Potassium Acetate, 1mg/ml

cycloheximide, 0.5mM dithiothreitol), pelleted by centrifugation at 4,000хg for 5 min

and resuspended in 800μl lysis buffer. Cells were pelleted at 10,000хg for 30 sec at 4oC

and resuspended in 200μl lysis buffer. 200μl of 425-600μm acid-washed glass beads

(Sigma-Aldrich) were added and the tubes were mixed vigorously for 6 x 20 sec

allowing cooling for at least 40 sec in iced water between each mixing step. The

resulting cell extract was centrifuged twice at 10,000хg for 5 min and 15 min at 4oC in a

microfuge and the OD260 was measured using NANODROP-8000 Spectrophotometer

(Thermo Scientific). The extract was snap frozen in liquid Nitrogen and stored at -80oC.

The same protocol was used for the preparation of S. cerevisiae polysomes extracts,

except that the concentration of cycloheximide required to prevent ribosomal run-off

was significantly lower. Hence, 500μl of 10mg/ml cycloheximide was added to the

chilled falcon tubes and the samples were left to chill on iced-water for 1 h before the

cells were harvested.

92

2.4.2: Preparation of sucrose gradients

15-50% (w/v) sucrose gradients were prepared using filter-sterilized diethyl

pyrocarbonate (DEPC)-treated sucrose solution (60% stock, made with water containing

200μl/L DEPC), and 10 x polysome buffer (100mM Tris Acetate, pH 7.4; 700mM

ammonium acetate, 40mM magnesium acetate). Individual solutions were prepared as

follows:

Table 2.1 Sucrose solutions for gradient preparation

2.25 ml amounts of the different sucrose solutions were dispensed, starting with 50%

solution, then 42%, 33%, 24% and finally 15% into SW41 polyallomer centrifuge tubes

(Beckman coulter) and flash frozen in liquid nitrogen between each layer. Gradients

were stored at -80oC and defrosted for 12 h at 4

oC prior to loading of the samples (Luthe

1983).

2.4.3: Sedimentation of polyribosomes

A volume equivalent to 2.5 OD260 units of the C. albicans or S. cerevisiae polysome

extract was layered onto the top of a 15-50% sucrose gradient. The gradients were

centrifuged in a SW41 rotor (Beckman Instruments) in an L-90K ultracentrifuge

(Beckman Instruments) for 2.5 h at 40,000хg. Gradients were collected and the

absorbance was continuously measured at 254 nm to generate polysome profiles using a

UV/Vis detector (ISCO UA-6) attached to a pump (Tris TM) and an Optical unit type II

60% sucrose solution (ml)

50% 42% 33% 24% 15%

5.0

41.6 35.0 27.3 20.0

5.0 5.0 5.0 5.0

3.4 10.0 17.3 25.0 32.0

10% Polysome buffer (ml)

DEPC (ml)

12.5

93

(Teledyne ISCO). An example polysome trace is shown in the figure below with the

various ribosomal peaks labelled.

Figure 2.1 An example of a polysome trace from actively translating cells and

following inhibition of translation. A. The 40S small ribosomal subunit, 60S large

ribosomal subunit, 80S monosome and polysomes are labelled. A trace from yeast

inhibited at the translation initiation step would show a redistribution from the

polysome peaks to the 80S/monosome peak. B. Possible changes in profile following

blocks to either initiation or elongation/termination.

Sedimentation of ribosomes in a 15-50% sucrose gradient

polyribosomes

40s60s

80s

A254

A

B

94

2.5 Transformations

2.5.1 Transformation of bacteria with plasmid DNA

0.5-1µl of purified plasmid was added to 70µl of thawed competent DH5α E. coli cells

and incubated on ice for 3 min. The bacterial cells were incubated at 42oC for 1.5-2 min,

then 600µl of LB media was added and the mix was incubated at 37oC for 30 min. The

cells were pelleted at 5000хg in a microfuge for 15 sec. Excess LB was removed to

leave 100-200µl, which was spread on LB carbenicillin agar plate.

2.5.2 Transformations into C. albicans

C. albicans cells were transformed using the lithium acetate procedure (Wilson et al.

1999). 50ml cultures were grown at 30oC in YPD to the equivalent of 5x10

6 cells/ml.

Cells were pelleted at 5000хg for 5 min in a clinical centrifuge and washed in 5ml

Lithium acetate (LATE) buffer (0.1M lithium acetate, 10mM Tris HCl (pH 7.5), 1mM

EDTA) before being resuspended in 500µl of LATE buffer. A transformation mix

consisting of 100µl cell suspension, 5µl salmon sperm DNA (10mg/ml) and 80µl PCR

product was prepared and incubated in a shaker incubator at 30oC for 30 min. Before

salmon sperm DNA was added to the transformation mix, the DNA was denatured by

boiling for 5 min then chilling on ice. Then 700µl of PLATE buffer (40% PEG4000 in

LATE buffer) was added to the culture, mixed briefly and incubated at 30oC overnight.

The samples were incubated at 42oC for 1 h before 3ml YPD media was added and the

cell suspension was incubated overnight at room temperature. The cells were pelleted

and most of the supernatant was tipped off, leaving 200µl, which was spread onto

selective solid media. Plates were incubated at 30oC for 3-5 days and transformants

were selected from these plates.

95

2.6 Manipulation of DNA in vitro

2.6.1 Extraction of genomic DNA from yeast

C. albicans was grown in appropriate media at 30oC to stationary phase. 5ml was

harvested by centrifugation at 16,000хg for 2 min in a microfuge. Pellets were

resuspended in 1ml of a pre-spheroplasting mix (1M sorbitol, 1mM EDTA and 30mM

dithiothreitol), then repelleted by centrifugation at 16,000хg for 5 min. The cells were

resuspended in 500µl of spheroplasting mix (1M sorbitol, 1mM EDTA, 15mM β-

mercapthoethanol and 0.235mg/ml lyticase), then incubated at 37oC for 20 min before

55µl of stop solution (3M NaCl, 100mM Tris pH7.5, 20mM EDTA) with 30µl of 20%

(w/v) SDS was added and mixed. An equal volume of phenol chloroform (1:1 (v/v) Tris

HCl, pH8.0 buffered) was added to the extract, mixed and the aqueous phase was

separated from the organic phase by centrifugation at 13,000хg for 2 min in a

microfuge. The aqueous layer was collected and the phenol-chloroform step was

repeated. An equal volume of chloroform was added, samples were mixed and

centrifuged at 16,000хg for 2 min in a microfuge. The aqueous layer was collected and

nucleic acids were precipitated by the addition of 2 volumes of ethanol. The samples

were centrifuged at 16,000хg for 15 min and the pellet was resuspended in 50µl of TE

buffer (10mM Tris pH7.5, 1mM EDTA pH8.0).

2.6.2 Amplification of DNA by polymerase chain reaction

Polymerase chain reaction (PCR) using an Expand High Fidelity kit (Roche) was

carried out to amplify cassettes used for genomic epitope tagging. Verification of

genomic integration was carried out using the same kit. Oligonucleotides used in this

study are listed in table 2.6.

96

In vitro amplification of DNA using the Expand High Fidelity kit were performed in

0.5ml thin walled microfuge tubes by adding 1µl of the desired DNA template (5-50ng)

with 1 x PCR buffer 2 (containing MgCl2), 2.5mM dNTPs, 0.2µM of each

oligonuctleotide primer, 3.4 U of DNA Expand polymerase and sterile distilled water to

a final volume of 50µl. Samples were then placed in a Biometra® T3 thermocycler and

subjected to the following reaction conditions:

1. Initial denaturation at 95oC for 3 min

2. Denaturation at 95oC for 15 sec

3. Annealing at the appropriate temperature for the oligonucleotide primers for 30 sec

4. Extension at 72oC for 1 min

5. Final extension at 72oC for 7 min

Stages 2-4 were repeated 30 times. Melting temperature ™ of the oligonucleotides was

estimated using the following formula; Tm=2[(A+T) +2(G+C)] where A, T, G and C

refer to the base composition of the oligonucleotide. If the Tm for two oligonucleotides

used in one reaction varied the lower value was used.

2.6.3 Agarose gel electrophoresis

DNA was separated according to its size via electrophoresis on agarose gels (1% (w/v)

agarose in 1 x TAE buffer (40mM Tris base, 20mM acetic acid, 1mM EDTA pH8.0)

containing 0.5µg/ml of Safe view nucleic acid stain (NBS Biologicals, UK). DNA

samples were mixed with 5µl of orange loading dye (25% Ficoll, 10mM EDTA and

25µg/ml orange G) and loaded onto the gel. Electrophoresis was carried out in a BioRad

electrophoresis chamber at 100V for 60 min DNA was visualized with a UV

transilluminator.

97

2.7 Microscopic analysis

2.7.1 Slide preparation

Cells were grown to an OD600 of 0.6 in YPD and harvested by centrifugation for 1 min

at 5000хg. Cell pellets were resuspended in 1x PBS containing particular concentrations

of alcohol or untreated and incubated for 15 min at 30oC. 1ml of cells was pelleted, the

supernatant was removed leaving approx. 100µl of culture. 5µl of cell suspension was

applied to a 0.01% (w/v) poly-lysine (Sigma) coated glass slides. A cover slip was

carefully lowered onto the slide and the edges sealed with a solvent based nail polish.

2.7.2 Epifluorescent microscopy

Real-time 2D deconvolved projections generated from continuous z-sweep acquisition

were generated using a Delta Vision RT microscope with an Olympus 100X/1.4 NA

differential interference contrast (DIC) oil Plan Apo objective and Roper Coolsnap HQ

(Photometrics) camera using Applied Precision Softworx 1.1 software and 2X2 binning

at room temperature. Z-sweep acquisition allowed fast visualisation of all planes whilst

minimizing fluorescent bleaching. Time course experiments were performed by

acquiring images every 5 sec over a two min time period. ImageJ was used to track and

quantitate the movement of the eIF2B body in the images acquired during the time

course. The values calculated for the mean total distance moved by the eIF2B body in

Chapter 4 were subjected to a two-sample t test to determine if the mean total distance

moved by the eIF2B body in cell treated with either 1% (v/v) butanol or 100µM

farnesol was significantly different from the movement of eIF2B body in untreated

cells. Where p˂0.05 the null hypothesis that there was no significant difference between

the means of the samples was rejected. Where p˃0.05 there was no evidence to reject

the null hypothesis.

98

2.8 Formaldehyde cross-linked polysome analysis

2.8.1 Extract preparation

Extracts for cross-linked sucrose density gradient analysis were made using the method

described by (Nielsen et al. 2004). 80ml of yeast culture grown to OD600 0.6 in YPD

was added to 15ml of crushed, frozen YPD media and 2.16ml of 40% formaldehyde.

After 1 h on ice, glycine was added to 0.1M. Cross-linked cells were harvested by

centrifugation and polysome extracts made as described in section 2.4.1, except that

cycloheximide was omitted from the buffers.

2.8.2 Gradient fractionation and protein purification

7.5 Abs260 units of cross-linked cell extract were separated on 15-50% (w/v) sucrose

gradients using the method described in section 2.4.1. 650µl gradient fractions were

collected using a Foxy Jr fraction collector (Isco) while the Abs254 was continuously

measured. Individual fractions were precipitated with 20% (w/v) tricarboxylic acid,

washed with 500µl acetone and resuspended in 50µl Laemmli buffer. Proteins were

analysed by SDS-PAGE and western blotting.

2.9 RNA sequencing of polysome fractions

2.9.1 Preparation of C. albicans extracts

C. albicans extracts for polysome analysis for RNA sequencing cultures were prepared

as was described in section 2.4.1 except that 100ml of cell culture was used. 1/4 of the

polysome extracts (approx. 100µl) was made up to 300µl with the polysome lysis buffer

and stored in the -80oC freezer to serve as the input fraction.

10 A260 units of the remaining extract (approx. 300µl) were separated on 15-50% (w/v)

sucrose gradients as described above except that the sensitivity was on the ISCO UA-6

detector was set at 1. 600µl gradient fractions were collected into tubes. Fractions 10-

99

15 harboured the polysomal material and were used to prepare RNA. The polysomal

samples were pooled after precipitating with isopropanol.

2.9.2 Extraction of RNA from the input and polysome fractions.

900µl of Trizol (Invitrogen) was added to the input fraction, whereas for the polysome

fractions, samples were split into two 300µl amounts and 900µl of Trizol was added to

each. The samples were stored in the -20oC freezer overnight, then thawed on ice,

mixed vigorously for 1 min and left at room temperature for 5 min. 0.2ml of chloroform

per 1ml of Trizol was added to the samples and mixed vigorously for 5 min then left at

room temperature for 10 min. Samples were then centrifuged at 15,000хg for 15 min at

4oC in a microfuge to separate the phases. The aqueous layer was transferred to a fresh

tube and 1µl of glycoblue was added (glycogen is co-precipitated with the RNA, but

does not inhibit first strand synthesis at concentrations ≤4mg/ml and does not inhibit

PCR). 500µl of 100% isopropanol for 1ml of Trizol reagent used was also added.

Samples were incubated at room temperature for 10 min and then centrifuged at 15,000

хg for 10 min at 4oC. The resulting pellet was washed in 1ml of 70% (w/v) ethanol in

DEPC treated water. The wash process was repeated, the samples were dried and then

resuspended in 10µl of nuclease free water. The RNA suspension was heated to 55oC

for 10 min and the RNA concentration was determined using a NanoDrop 8000

Spectrophotometer (Thermo Scientific).

2.9.3 Ribodepletion treatment to remove ribosomal RNA from the sample

2.9.3.1 Magnetic Beads preparation

Ribo-zero™ magnetic Gold kit for yeast was used for the ribodepletion. The magnetic

core kit was left at room temperature to equilibrate. For each Ribo-Zero reaction, 225µl

100

of the magnetic beads suspension was aliquoted into an RNase-free tube. The tube was

placed on magnet stand and the supernatant was removed. The bead was then washed

twice with 225µl of RNase-free water and resuspended in 65µl of bead resuspension

solution.

2.9.3.2 Treatment of the Total RNA sample with Ribo-Zero rRNA removal

solution

To each reaction set 1-5µg sample RNA, 8-10µl rRNA Removal solution and 4µl

Reaction buffer were added. The reaction was then made up to 40µl with RNase-free

water, mixed by pipetting and incubated first at 65oC for 10 min then at room

temperature for 5 min.

The volume of Ribo-Zero rRNA Removal solution used was calculated based on:

Amount of input total RNA Max volume of total RNA Volume of removal

solution

1-2.5µg 28µl 8µl

2.5-5µg 26µl 10µl

2.9.3.3 Magnetic Bead Reaction and rRNA Removal

The entire reaction was added to a tube containing the washed magnetic beads and

immediately mixed by pipetting. Following incubation at room temperature for 5 min,

the reaction was mixed vigorously for 10 sec and then incubated at 50oC for 5 min.

Samples were placed in the magnetic stand and the supernatant (rRNA-depleted sample)

was removed to a fresh RNase-free tube.

101

2.9.3.4 Purification of the rRNA-Depleted Sample

The volume of each sample was adjusted to 180µl using RNase-free water and the RNA

precipitated with 18µl of 3 M Sodium acetate, 2µl of 10mg/ml glycoblue and 600µl of

ice-cold 100% ethanol at -20oC for 1 h followed by centrifugation at 15,000хg in

microfuge for 30 min. The supernatant was carefully removed and the RNA pellet

washed with ice-cold 70% ethanol then centrifuged at 15,000хg for 5 min. This wash

step was repeated and any residual supernatant was removed. The RNA pellet was dried

at room temperature for 5 min then dissolved in RNase-free water and stored at -80oC.

2.9.4 Assay for ribodepletion from RNA samples using Agilent RNA 6000 Nano Kit

2.9.4.1 Preparing the gel-dye mix

The RNA 6000 Nano dye was allowed to equilibrate at room temperature for 30 min,

and mixed well. For each assay, 1µl of dye was added to 65µl of filtered RNA 6000

Nano gel matrix in a 0.5ml RNase-free tube. The solution was mixed well and

centrifuged at 15,000хg for 10 min.

2.9.4.2 Agilent RNA 6000 Nano Gel Electrophoresis

Electrophoresis was performed as described in the manufacturers (Agilent) manual

using the RNA 6000 Nano-chip. Briefly, 9µl of the gel-dye mix was loaded into the

appropriate wells, 5µl of RNA 6000 Nano marker was loaded in the sample wells and

the ladder well. 1µl of the prepared ladder was also loaded in the ladder well and 1µl of

the sample was loaded in each of the sample well on the chip. The chip was mixed

horizontally on the IKA vortexer (Agilent) for 1 min at 2400хg and run in the Agilent

2100 bioanalyzer for 5 min.

102

The ribodepleted RNA samples were then sent to the Genomic facilities of the

University of Manchester for RNA sequencing using the Illumina Hiseq RNA

sequencing technique. Briefly to generate the RNA-seq libraries, the RNA samples were

fragmented, then double-stranded complementary DNA (cDNA) was generated from

the fragmented RNA. Adapter sequences were added at either end of each cDNA

molecule using the TruSeq stranded mRNA LT sample Prep kits and RNA Adapter

indices (AR001-AR016, AR018-ARO23, AR025, AR027 (Illumina, USA)

The cDNA that have adapter molecules on both ends are then selectively enriched and

amplified by PCR using PCR Primer cocktails that anneal to the ends of the adapters.

Next, the cDNA library is validated to check the purity of the sample by running 1µg of

sample on an Agilent Technologies 2100 Bioanalyzer using the Agilent DNA 1000 chip

and then by quantified by qPCR. The cDNA library is sequenced using illumina HiSeq

sequencing platform.

2.9.4.3 Data analysis

Illumina HiSeq data was initially trimmed by removing low quality bases (quality

scores ‹ 20) from the 3′ end of all reads. Trimming was conducted using

TRIMMOMATIC (Bolger et al. 2014). Trimmed reads were mapped (aligned) to

Candida albicans SC5314 genome assembly and annotations

(www.candidagenome.org.Assembly version 21) using STAR mapper (Dobin et al.

2013). The mapped reads were counted for all annotated genes using bedtools (Quinlan

and Hall 2010). More specifically, two equations were obtained and these were applied

to arrive at a set of differentially expressed genes. For the change in transcript,

log2([TF/TU]) and for the change in translation (log2[PF/TF]/log

2[PU/TU]), with a cut

off value of ±1.0 for alteration in both the transcript and translation.

103

2.9.4.4 Quantitative real-time PCR

RNA samples from input and polysome fractions were prepared as in section 2.9.2.

except that the samples were spiked with Luciferse RNA to serve as a reference. RNA

(1-6µl of each sample) was reverse transcribed into cDNA using a Protoscript Moloney

murine leukemia virus (M-MuLV) RT-PCR kit and random hexamer primer (New

England Biolabs). Oligonucleotide primers (Table 2.6) were designed to specific

transcripts that are either differentially regulated transcriptionally or translationally in

the prescence of farnesol. Oligonucleotide primers were designed using the Primer3

software. Quantification was performed using the CFx Connect Real-Time system with

iTaq Universal SYBR Green Supermix (BioRad Laboratories). 10ng of cDNA was

added to 1x SYBR green RT-PCR buffer, 30nM of forward and reverse primer, and

nuclease-free water up to a volume of 10µl. Reactions were run with initial

denaturation of 95oC for 3 min, 5 sec at 95

oC, 30 sec at 60

oC and 40 cycles of 95-60

oC

and finally a melting curve. LUC was used as reference for this study. Samples were run

in triplicate and in each case signals were normalized to the untreated sample for each

primer pair. Data was analysed manually using the 2-∆∆Ct

method (Livak and Schmittgen

2001).

2.10 Mass spectrometric analysis

SDS PAGE resolving gels were removed from the gel running apparatus and soaked in

Simply Blue SafeStain (Invitrogen) for 1 h, then washed in water. Bands stained with

Coomassie were excised from SDS PAGE gels and dehydrated using acetonitrile

followed by vacuum centrifugation. Dried gel pieces were reduced with 10mM

dithiothreitol and alkylated with 55mM iodoacetamide. Gel pieces were then washed

alternately with 25mM ammonium bicarbonate followed by acetonitrile. This was

repeated, and the gel pieces dried by vacuum centrifugation. 100ng sequencing grade

104

trypsin (Sigma), diluted in 50mM ammonium bicarbonate, was added and the gel

samples were incubated overnight at 37 C. Following digestion, the supernatants were

removed to a fresh tube.

Digested samples were analysed by LC-MS/MS using an UltiMate® 3000 Rapid

Separation liquid chromatography (RSLC, Dionex Corporation, Sunnyvale, CA)

coupled to a LTQ Velos Pro (Thermo Fisher Scientific, Waltham, MA) mass

spectrometer.

Peptide mixtures were separated using a gradient from 92% solution A (0.1% formic

acid (FA) in water) and 8% solution B (0.1% FA in acetonitrile) to 33% solution B, in

44 min at 300nl min-1

, using a 250mm x 75μm i.d 1.7µM BEH (Ethylene Bridged

Hybrid) C18, analytical column (Waters). Peptides were selected for fragmentation

automatically by data dependent analysis.

2.10.3 Data Analysis

Data produced were searched using Mascot (Matrix Science UK), against the Uniprot

database with taxonomy of [S. cerevisie and C. albicans] selected. Data were validated

using Scaffold (Proteome Software, Portland, OR).

105

Table 2.2 Candida albicans strains used in this study

Table 2.3 S. cerevisiae strains

MLY61/YMK

1908

MATα/a ura3-52/ura3-52 (Lorenz et al. 2000)

YMK 2197 MATa; his3Δ 1; leu2Δ 0; met15Δ 0; ura3Δ 0;

HIS3+ Costello et al,

submitted

YMK 2198 MATa; his3Δ 1; leu2Δ 0; met15Δ 0; ura3Δ 0;

HIS3+; CDC33-TAP Costello et al,

submitted

YMK 2084 MATa; his3Δ 1; leu2Δ 0; met15Δ 0; ura3Δ 0;

TIF4631-TAP::His3 Open Biosystems

Strains Genotype Source

CAI4/YMK 1766 ura3/ura3::λimm434/ura3::λimm434 (Fonzi and Irwin

1993)

HTC52/YMK1767 ura3/ura3::λimm434/ura3::λimm434

gcn2::hisG/gcn2::hisG

(Tournu et al.

2005)

JKC19/YMK

1823

ura3/ura3::λimm434/ura3::λimm434

cph1::hisG/cph1::hisG-URA3-hisG

(Liu et al. 1994)

HLC52/YMK

1824

ura3/ura3::λimm434/ura3::λimm434

efg1::hisG/efg1::hisG-URA3-hisG

(Lo et al. 1997)

BCA2-10/YMK

1828

ura3/ura3::λimm434/ura3::λimm434

tup1::hisG/tup1::hisG-URA3-hisG

(Braun and

Johnson 1997)

YMK 1863 ura3/ura3::λimm434/ura3::λimm434 GCD1-

v5S-6xHis-NAT1

This study

YMK 1864 ura3/ura3::λimm434/ura3::λimm434 SUI3-

v5S-6XHis-NAT1

This study

YMK 2311 ura3/ura3::λimm434/ura3::λimm434-GCD1-

4XFLAG-dpl200::GCD1

This study

YMK 2312 ura3/ura3::λimm434/ura3::λimm434-GCD1-

4XFLAG-dpl200::GCD1-4xFLAG-URA3-

dpl200

This study

YMK 2313 ura3/ura3::λimm434/ura3::λimm434 GCD1-

GFP

This study

YMK 2314 ura3/ura3::λimm434/ura3::λimm434-GCRE-

LUC

(Sundaram and

Grant 2014)

YMK 2316 ura3/ura3::λimm434/ura3::λimm434-GCN4-

LUC

(Sundaram and

Grant 2014)

106

Table 2.4 Plasmids used in this study

Plasmid Main Features Source

pGFPNAT1/BMK

665

GFP (Milne et al. 2011)

pV5-NAT1/BMK

668

V5 (Milne et al. 2011)

BMK 691 4X FLAG –URA3 This study

Table 2.5 Primary antibodies used in this study

Target Secondary

Antiboby

Dilution Source

eIF2α phospho Rabbit 1:5000 Invitrogen

eIF4A Rabbit 1:10000 M. Ashe

eIF4G Rabbit 1:5000 M. Ashe

eIF4E Rabbit 1:5000 M. Ashe

eIF3 Rabbit 1:5000 M. Ashe

Protein A (PAP) HRP conjugate 1:5000 Sigma

GFP Rabbit 1:1000 Clontech

V5 Mouse 1:5000 Invitrogen

FLAG Mouse 1:1000 M. Ashe

Tef1 Rabbit 1:5000 C. Grant

Rps3p Rabbit 1:10000 M. Poole

Table 2.6 Oligonucleotides used in this study

Oligonucleotides Sequence Use

GFP-FCaGCD1 TACTGATGACGAAGATGAGAGCGAGTTTGAAGATGA

GTACACAGGAAACGAAGATGGTTTATTTGCCTATGG

TGGTGGTTCTAAAGGTGAAGAATTATT

Tagging

Forward

GFP-RCaGCD1 TCTATTTTCAGATACACTTATAATGTGTCTCTTTTCTG

TTTATTATCACAGTGGTATACTACTATATCAACGTTA

GTATCGAATCGACAGC

Tagging

Reverse

VFCaGCD1 AGCACCAACGAGGTAGCTCATA Verification

forward VRCaGCD1 GGATGAATCACTAGTTGTTACT Verification

reverse CaNAT1F ATATGTCTATGCCATGTCCAT Internal

forward GFP-UP CACCTTCACCGGAGACAG Internal

reverse V5-NAT1F(GCD1) TACTGATGACGAAGATGAGAGCGAGTTTGAAGATGA

GTACACAGGAAACGAAGATGGTTTATTTGCCTATAA

GGGCGAGCTTCGAGGTC

Tagging

Forward

V5-NAT1R(GCD1) TCTATTTTCAGATACACTTATAATGTGTCTCTTTTCTG

TTTATTATCACAGTGGTATACTACTATATCAACGTTA

GTATCGAATCGACAGC

Tagging

Reverse

107

V5-NAT1F (SUI3) TGGTTCTACGAGATCCGTGTCTTCGATCAAGACTGGG

TTCCAAGCCCAAATCGGGAAGAGAAAGAAGTTCAAG

GGCGAGCTTCGAGGTC

Tagging

Forward

V5-NAT1R (SUI3) TTCCCTACTATACATAGATGATAATACACAATGCAA

AAAAAAAAAAAATAGAAACCCAAAAGCTATACTGA

ACATCTCGACGTTAGTATCGAATCGACAGC

Tagging

Reverse

VFCaSUI3 GAAGATACATTATTGAATATGT Verification

forward VRCaSUI3 ATTCTACAGTATCAGAGCCAGG Tagging

Forward V5-S TGCAGGGCCGCAGCTTGC Verification

reverse 4XFLAG-

FCaGCD1

TGATGACGAAGATGAGAGCGAGTTTGAAGATGAGTC

ACAGGAAACGAAGATGGTTTATTTGCCTATGGTGGG

TTCTAAAGGTGAAGAATTATT

Tagging

Forward

4XFLAG-RCaGCD1 TCTATTTTCAGATACACTTATAATGTGTCTCTTTTCTG

TTTATTATCACAGTGGTATACTACTATATCAACGTTA

GTATCGAATCGCAGC

Tagging

Reverse

4XFLAG-FCa-SUI3 TGGTTCTACGAGATCCGTGTCTTCGATCAAGACTGGG

TTCCAAGCCCAAATCGGGAAGAGAAAGAAGTTCAAG

GGCGAGCTTCGAGGTC

Tagging

Forward

4XFLAG-RCa-SUI3 TTCCCTACTATACATAGATGATAATACACAATGCAA

AAAAAAAAAAAATAGAAACCCAAAAGCTATACTGA

ACATCTCGACGTTAGTATCGAATCGACAGC

Tagging

Reverse

RT-PCR LUC F ACGTCTTCCCGACGATGA

RT PCR For

LUC

RT-PCR LUC R GTCTTTCCGTGCTCCAAAAC RT PCR For

LUC

RT-PCR TUP1 F CTTGGAGTTGGCCCATAGAA RT PCR For

TUP

RTPCR-TUP1 R TGGTGCCACAATCTGTTGTT RT PCR For

TUP

RT PCR EFG1 F CCCCCATACCTTCCAATTCT RT PCR For

EFG1

RT-PCR EFG1 R CTCGTGGTCTGATTCCTGGT RT PCR For

EFG1

RT-PCR PDE1 F ACAATTGGCGCATGAATGTA

RT PCR For

PDE1

RT-PCR PDE1 R GCCACTAAGGGCAATTGAAA RT PCR For

PDE1

RT-PCR HSP21 F CCGACAAATACGTGGTTTCC RT PCR For

HSP21

RT-PCR HSP21 R GATCGGCATGAACTTTTGGT RT PCR For

HSP21

RT-PCR TIF4631 F CAGCAACTCCAGGTCAACAA

RT PCR For

TIF4631

RT-PCR TIF4631 R GAGGAGATGCGACAGGAGTC

RT PCR For

TIF4631

108

3 Alcohols inhibit translation initiation in Candida albicans yet have

opposing effects on morphological transition

3.1 Introduction

In budding yeast, amino acid starvation elicits a well-characterised mechanism of

translational control involving phosphorylation of eukaryotic initiation factor 2α (eIF2α)

via activation of eIF2α (Gcn2p) kinases (Dever et al. 1992). Phosphorylated eIF2α

interacts tightly with eIF2B and inhibits its guanine nucleotide exchange function. This

ultimately leads to the translation of GCN4 mRNA while decreasing the rate of general

translation. GCN signalling (or general amino acid control) has been best characterized

in Saccharomyces cerevisae (Hinnebusch 1988), although the GCN response has been

described for Candida albicans where it is involved in both morphogenesis and biofilm

formation (Tripathi et al. 2002).

C. albicans gcn2/gcn2 null mutants exhibit no detectable eIF2α kinase activity

indicating that GCN2 encodes the major eIF2α kinase activity in this fungus (Tournu et

al. 2005). Moreover the eIF2α kinase activity increased in wild-type cells on exposure

to 3AT (3-Amino triazole) suggesting that this Gcn2p kinase is activated in response to

amino acid starvation (Tripathi et al. 2002).

In S. cerevisiae, fusel alcohols also target eIF2B to bring about an inhibition in

translation initiation. However this regulation of translation initiation by fusel alcohols

is independent of the Gcn2p kinase (Ashe et al. 2001). In fact fusel alcohols lead to a

Sit4p-dependent dephosphorylation of eIF2α in S. cerevisiae rather than an increase in

phosphorylation (Griffiths and Ashe 2006; Taylor et al. 2010).

Fusel alcohols as well as ethanol have also been shown to induce morphological

changes in specific strains of S. cerevisiae (Dickinson 1996; Lorenz et al. 2000) and C.

albicans (Pollack and Hashimoto 1985).

109

In contrast, farnesol, is a long chain quorum sensing or signalling alcohol that has been

shown to block the switch from yeast to pseudohyphae or hyphae in Candida albicans,

(Hornby et al. 2001). Therefore, farnesol elicits an opposing effect to butanol in terms

of morphological switching in this important human pathogen. An important question is

whether butanol and farnesol affect translation initiation in Candida albicans and if so,

is this inhibition is independent of Gcn2 kinase, as was observed in S. cerevisiae.

In this chapter, the translational response of C. albicans to fusel alcohols, ethanol and

farnesol is investigated, and the inhibitory effects of farnesol on filament formation in

C. albicans in the presence of serum and butanol are analysed.

3.2 Results

3.2.1 Different alcohols inhibit growth of both CAI4 and gcn2Δ strains of Candida

albicans

Fusel alcohols and ethanol have been shown to inhibit growth of Saccharomyces

cerevisiae in a dose dependent manner (Griffiths and Ashe 2006). This growth

inhibition was shown both in the CAI4 and gcn2 null mutant. Alcohols are the product

of fermentative growth and one possibility is that crabtree positive yeast species (yeast

that preferentially ferment glucose) might present different alcohol sensitivities to

crabtree negative yeast (species that preferentially respire carbon sources). On this

account we set out to investigate the impact of alcohols on the growth of the crabtree

negative yeast species Candida albicans, both the CAI4 strain and the gcn2Δ mutant.

Three different alcohols were selected. Firstly ethanol as the major product of

fermentative growth. Secondly, 1-butanol (n-butanol) as a fusel alcohol that induces

pseudohyphal and hyphal-like growth both in S. cerevisiae and C. albicans. Finally,

farnesol was selected as a quorum sensing long chain alcohol that inhibits filamentous

110

growth in both yeasts. Cultures of the CAI4 and gcn2Δ C. albicans strains were grown

to mid-log phase (OD600 of 0.7) in rich media. The cells were diluted into pre-warmed

media and varying concentrations of each of the alcohols were then added to the

cultures. As shown in figures 3.1, 3.2 and 3.3 each of the alcohols gave a concentration

dependent inhibition of growth. More specifically, in the CAI-4 strain of Candida

albicans, growth was mildly inhibited by butanol concentrations of 0.5% butanol (v/v),

while 2% (v/v) butanol completely prevented the growth of the strain (Figure 3.1).

Higher concentrations of ethanol (6% and 8% (v/v)) were required to bring the same

level of growth inhibition (Figure 3.2). Much lower farnesol concentrations, e.g.

100µM, were required to cause growth inhibition. Interestingly, it was observed that the

same degree of growth inhibition observed in the wild type was also evident in the

gcn2Δ mutant. Finally, at very high concentrations of alcohol, the OD600 even decreased

slightly. One possible explanation for this, is that the higher alcohol concentrations

could be chaotropic to cell membranes and hence cause cell lysis (Salgueiro et al. 1988;

Bhaganna et al. 2010).

0.1

1

10

0 2 4 6

Op

tica

l d

ensi

ty 6

00

nm

Time (hours)

control 0.50% 1% 2%

0.1

1

10

0 2 4 6

Op

tica

l d

ensi

ty 6

00

nm

Time (hours)

control 0.50% 1% 2%

CAI4 gcn2∆

Figure 3.1 Butanol inhibits growth of Candida albicans CAI4 and mutant

(gcn2Δ) strains in a dose dependent manner. The CAI4 strain and the

mutant gcn2Δ strain were grown to OD600 of 0.1 and were treated with various

concentrations of butanol as indicated, OD600 was taken hourly for 6 hr. (A)

Line graphs for CA14 and gcn2∆ strains, (B) Plot of growth rate versus

alcohol concentration.

A

B

0

0.1

0.2

0.3

0.4

0.5

0.6

0 0.5 1 1.5 2

Gro

wth

rate

(h

-1)

Butanol (%)

CAI4

gcn2∆

111

0.1

1

10

0 1 2 3 4 5 6

Op

tica

l d

ensi

ty 6

00

nm

Time (hours)

control 2% 4% 6% 8%

0.1

1

10

0 1 2 3 4 5 6O

pti

cal

den

sity

60

0n

m

Time (hours)

control 2% 4% 6% 8%

CAI4 gcn2Δ

Figure 3.2 Ethanol inhibits growth of Candida albicans CAI4 and mutant

(gcn2Δ) strains in a dose dependent manner. The CAI4 strain and the

mutant gcn2Δ strain were grown to OD600 of 0.1 and were treated with various

concentrations of ethanol as indicated, OD600 was taken hourly for 6 hr. (A)

Line graphs for CA14 and gcn2∆ strains, (B) Plot of growth rate versus

alcohol concentration.

A

B

0

0.1

0.2

0.3

0.4

0.5

0 2 4 6 8

Gro

wth

ra

te (

h-1

)

Ethanol (%)

CAI4

gcn2∆

112

0.1

1

10

0 2 4 6O

pti

cal

den

sity

60

0n

m

Time (Hours)

control 10μM 40μM

100μM 200μM

0.1

1

10

0 2 4 6

Op

tica

l d

ensi

ty 6

00

nm

Time (Hours)

control 10μ 40μM

100μM 200μM

CAI4 gcn2Δ

Figure 3.3 The quorum sensing molecule, farnesol inhibits growth of

Candida albicans CAI4 and mutant (gcn2Δ) strains in a dose dependent

manner. The CAI4 strain and the mutant gcn2Δ strain were grown to OD600

of 0.1 and were treated with various concentrations of farnesol as indicated,

OD600 was taken hourly for 6 hr. (A) Line graphs for CA14 and gcn2∆ strains,

(B) Plot of growth rate versus alcohol concentration.

A

B

113

0

0.1

0.2

0.3

0.4

0.5

0.6

0 50 100 150 200

Gro

wth

rat

e (

h-1

)

Farnesol (µM)

CAI4

gcn2∆

114

3.2.2 Fusel alcohol and ethanol induce pseudohyphae formation in C. albicans,

while farnesol blocks it.

In addition to causing inhibition of growth, alcohols have also been shown to induce

morphological changes (pseudohyphae and germtube formation) in various fungal

species including various strains of Saccharomyces cerevisiae and Candida albicans.

For instance, S. cerevisiae in the ∑1278B background exhibits filamentous growth in

the presence of fusel alcohols (Dickinson 1996; Lorenz et al. 2000). Ethanol has also

been shown to induce pseudohyphal formation in Candida albicans (Zeuthen et al.

1988). It has been suggested that the fusel alcohols might signal nitrogen scarcity to the

cell (Dickinson 1996). Hence, pseudohyphae and germtube formation may allow these

non-motile organisms to forage for limiting nutrients (Gimeno et al. 1992). In addition,

for Candida species, it has been suggested that such growth patterns may provide a

means of evading the immune responses of their host (Lorenz et al. 2000).

We studied the morphology of C. albicans in the presence of the selected exogenous

alcohols in both liquid and solid media. Resting phase cells were inoculated into rich

media (YPD) at 37oC, with butanol, ethanol or farnesol added to concentrations of 0.5%

(v/v), 2% (v/v) and 40µM respectively. As a positive control, 10% serum was used to

induce hyphae, whereas cells growing in YPD alone remained in the yeast form at 37oC

(Figures 3.4 and 3.5).

Interestingly, addition of butanol, and ethanol to the growth media of both the CAI4 and

gcn2∆ mutant C. albicans strains induced morphological differentiation both in liquid

and solid growth media as presented in figures 3.4 and 3.5. Furthermore, about 50% of

the cells exposed to ethanol or butanol formed pseudohyphae in less than 4 h of

incubation in the liquid media as presented in figure 3.5B. However, for the farnesol

treated cells no germ tubes or pseudohyphae were formed.

YPD Agar

YPDA +

10% serum

YPDA +

0.5% Butanol

YPDA +

2% ethanol

A

B

Day 1

Day 2

YPDA + 10%

serum + 150 µM F

YPDA +0.5%

Ethanol + 70µM F

YPD Agar

Figure 3.4 The effect of farnesol on filament formation in C. albicans

predominates that of serum, butanol or ethanol. Serial dilutions of

overnight cultures of the CAI4 strain was spread onto YPDA medium

containing 0.5% (v/v) butanol, 2% ethanol or 10% serum agar plates for

filamentation assay (A) and 10% serum agar supplemented with 150µM

farnesol or YPDA containing 0.5% (v/v) butanol or 2% (v/v) ethanol

supplemented with 70µM farnesol for competition assay (B). Day 1 and 2

colonies were examined by microscopy and representative images are shown

as in Panel A and B.

YPDA +0.5%

butanol + 70µM F

115

YPD YPD + serum YPD + butanol

YPD + serum/F YPD + butanol/F YPD

0

20

40

60

80

100

120

serum serum/f serum/f

% c

ells

yeast pseudohyphae hyphae

Serum /150µMF

Serum

A

B

D

Figure 3.5 The effect of farnesol on filament formation in C. albicans

predominates that of serum, butanol or ethanol. Overnight cultures of the CAI4

strain was inoculated into prewarmed YP medium containing 0.5% (v/v) butanol, 2%

ethanol or 10% serum for filamentation assay (A) and 0.5% (v/v) butanol or 2% (v/v)

ethanol supplemented with 70µM farnesol or 10% serum supplemented with 100µM

or 150µM farnesol for competition assay (B, C and D). Cultures were grown in

shaker incubator at 37oC for 6 hr. Samples were taken every 2 hr and 4 hr to count the

cells using a cell counting chamber. Percentages given are an average (±SE)

calculated from 3 different counts. F means farnesol.

0

20

40

60

80

100

120

% c

ells

yeast pseudohyphae

Butanol Butanol /70µMF

Ethanol Ethanol /70µMF Serum

/100µMF

YPD + ethanol

YPD + ethanol/F

C

116

117

3.2.3 Farnesol’s mode of action is predominant over butanol or serum

A number of previous studies have shown that farnesol blocks germ tube formation in

C. albicans (Hornby et al. 2001; Nickerson et al. 2006). We set out to test if the

morphogenetic signals generated by serum or butanol can override farnesol’s action and

vice versa. Cells were grown in 10% serum at 37oC for 4 h and the percentage of cells

exhibiting yeast, pseudohyphal and hyphal forms was quantified. 10% serum alone gave

over 90% hyphal growth, while the addition of farnesol blocked the switch from yeast

to hyphae (Figures 3.4A and 3.5A). However, the amount of farnesol required to inhibit

hyphal growth was dramatically increased in the presence of serum (from 40µM to

150µM) (Figure 3.5C). In contrast, for the butanol- farnesol competition assay 70µM

farnesol was sufficient to block pseudohyphal formation in the butanol supplemented

media. This shows that farnesol’s effect was dominant to that of butanol as the cells

remained in yeast morphology when farnesol is introduced. (Figure 3.4 and 3.5).

However, the serum farnesol signalling pathways appear to be competing more

intensely. Throughout these assays the gcn2∆ strain responded similar to the wild type

in terms of the effects of serum, farnesol and the alcohols (data not shown).

3.2.4 Inhibition of protein synthesis is a common response to alcohol

Cells respond to changes in the extracellular environment by adjusting the levels of

proteins in the cell. A variety of alcohols have been shown to impact on synthesis of

proteins. For instance, following the addition of 0.5% isoamyl alcohol or 1% butanol to

yeast cells, there was 2-to-3-fold decrease in the rate of incorporation of [35

S]

methionine (Ashe et al. 2001). The inhibition of growth of the CAI4 and gcn2∆ mutant

strains of C. albicans by the alcohols in this study (Figures 3.1, 3.2 and 3.3) prompted

us to examine the rate of protein synthesis following alcohol treatment. To assess

whether protein synthesis is inhibited upon treatment with butanol, farnesol or ethanol,

118

the incorporation of exogenously added radiolabelled methionine ([35

S]-methionine)

was evaluated in the CAI4 and mutant strains of C. albicans. The data obtained shows

that both butanol (2% v/v) and ethanol (8% v/v) caused a 10-fold inhibition in

methionine incorporation to protein in both the CAI4 and gcn2Δ strains (Figures 3.6A,

B and C). Intriguingly, farnesol (300µM) also caused a 10-fold inhibition of protein

synthesis in the wild type, but had a more drastic effect on the gcn2Δ strain; inhibiting

methionine incorporation up to 30-fold (Figure 3.6B and C). Overall, these results

suggest that all of the alcohols used in this study dramatically inhibit protein synthesis

at very early stages after addition.

Figure 3.6 Inhibition of protein synthesis is a common response to

alcohol CAI4 and gcn2Δ cells were grown to exponential phase in SC-Met

media and treated with various alcohols as above for 15 min. Protein

synthesis was measured by pulse labelling with [35]S methionine for 10 min

and sample was taken every 2 min and processed. Each treatment was

analysed in triplicate. A and B are representative graphs for butanol

treatment. The CPM has been normalised to 1 by dividing by the value of

the untreated sample at 10 min. C is a summary plot that shows the ratio of

the treated to the untreated. Error bars indicate ± SEM.

0

0.2

0.4

0.6

0.8

1

1.2

0 5 10 15

Time (min)

ut

t

0

0.2

0.4

0.6

0.8

1

1.2

0 5 10 15

Time (min)

CAI4 gcn2Δ

Norm

ali

sed

co

un

ts p

er m

inu

te (

cpm

)

Norm

ali

sed

co

un

ts p

er m

inu

te (

cpm

)

A B

C

0

5

10

15

20

25

30

35

40

ut 2% (v/v )butanol 8% (v/v) ethanol 300µM farnesol

mean

fo

ld in

hib

itio

n o

f tr

an

sla

tio

n r

ate

CAI4

gcn2Δ

119

Butanol

Figure 3.7 Translation initiation is inhibited by alcohols in the CAI4

strain. Figure shows polysome analyses assessing the effect of alcohols on

translation initiation in the CAI4 strain of C. albicans. Yeast were grown in

YPD and various concentrations of alcohols were added as indicated for 15

min prior to extract preparation. Extracts were sedimented on 15-50% sucrose

gradients and the absorbance at 254nm was continuously measured. The

position of 40S, 60S and 80S peaks are labelled and the direction of

sedimentation is indicated.

untreated

80S

40S polysomes 60S

8% 2% 4% 6% untreated Ethanol

Farnesol

sedimentation

0.5% 1% 2%

40S

60S

80S

polysomes

untreated 40µM 100µM 200µM 300µM

CAI-4 strain

120

121

3.2.5 Fusel alcohols and farnesol inhibit translation initiation in a process that is

independent of the eIF2α kinase.

To further investigate the stage of protein synthesis that is targeted by the alcohols used

above and the mechanism through which these alcohols inhibit protein synthesis in C.

albicans, polysome profiling was used (See section 2.4. Materials and Methods).

Polysome profiling not only allows the level of protein synthesis to be investigated, but

can also pinpoint the step where translation is regulated (Ashe et al. 2001; Taylor et al.

2010).

Analysis of polysome distribution across a sucrose gradient for extracts from the CAI4

strain revealed that with increasing concentrations of either butanol, farnesol or ethanol,

a change in the polysome profile was observed (Figure 3.7). The 80S peak increased

dramatically and the polysome peaks were reduced. This change in profile is

characteristic of an inhibition of the translation initiation step (Hartwell and

McLaughlin 1969; Ashe et al. 2001). As indicated by the redistribution of area under

the polysome peaks to the 80S peak, the addition of butanol and farnesol effectively

inhibit translation at 2% (v/v) and 300µM respectively, whereas concentrations of

ethanol up to 8% (v/v) are required to inhibit translation initiation in this strain. The

correlation between the concentrations of alcohol required to inhibit growth and

translation (Figures 3.1, 3.2 and 3.3) is suggestive that the inhibition of protein

translation at the initiation stage could be the cause of growth inhibition of C. albicans

cells exposed to alcohols. It is also possible based on disparity in the concentration of

the different alcohols required to cause an inhibition of translation initiation that these

agents act by different mechanisms.

Given that all of the alcohols target translation at the initiation step and a predominant

mechanism of translation regulation that is conserved across all eukaryotes is the

122

activation of eIF2α kinases, the role of the only eIF2α kinase in C. albicans, Gcn2p was

investigated.

The S. cerevisiae Gcn2p homologue has been shown to mediate a number of responses

to cellular stress (Palam et al. 2011). A number of cellular stress conditions including

amino acid starvation (Dever et al. 1992), purine starvation (Rolfes and Hinnebusch

1993) and rapamycin (Kubota et al. 2003) activate the Gcn2p kinase to phosphorylate

the α subunit of the eIF2. The phosphorylated eIF2 binds tightly to and sequesters

eIF2B (the guanine nucleotide exchange factor) thereby preventing guanine nucleotide

exchange on eIF2 and ultimately inhibiting translation initiation (Dever et al. 1995;

Hinnebusch 2000). It has been shown previously that the regulation of translation by

butanol in S. cerevisiae targets eIF2B but does so in a Gcn2p-independent manner

(Ashe et al. 2001; Taylor et al. 2010). By using the gcn2Δ mutant of C. albicans, the

requirement for the Gcn2p kinase for alcohol dependent inhibition of translation can be

assessed.

A comparison of the polysome profiles from the gcn2 mutant relative to the CAI4

strain shows that there is no obvious difference in terms of inhibition of translation by

butanol, farnesol and ethanol (Figures 3.7 versus 3.8). Quantitation of the

polysome/monosme ratios confirms that there is little difference in the polysome

profiles of the CAI4 and gcn2∆strains of C. albicans (Figure 3.9). This shows that the

Gcn2 kinase plays little or no role in the inhibition of translation initiation by alcohols

in C. albicans. In fact for farnesol, the gcn2Δ mutant was even more inhibited than the

wild type (cf Figure 3.8C with Figure 3.7C, Figure 3.9). This difference also highlights

the possibility that these alcohols act on cells in very different fashions.

2% 6% untreated Ethanol

Figure 3.8 Translation initiation is inhibited by alcohols in a

gcn2Δ strain. Figure shows polysome analyses assessing the effect of

alcohols on translation initiation in a gcn2Δ strain of C. albicans.

Yeast were grown in YPD and various concentrations of alcohols were

added as indicated for 15 min prior to extract preparation. Extracts

were sedimented and gradients collected as in Figure 3.7.

Butanol

Farnesol

gcn2Δ mutant strain

untreated 40µM 100µM 200µM 300µM

untreated 0.5% 1% 2%

4% 8%

123

0

0.1

0.2

0.3

0.4

0.5

0.6

0.7

0.8

0.9

0 0.5 1 1.5 2

Po

lyso

me/

mo

no

som

e ra

tio

Butanol (v/v)

CAI4 gcn2Δ

0

0.2

0.4

0.6

0.8

1

1.2

0 2 4 6 8

Po

lyso

me/

mo

no

som

e ra

tio

Ethanol (v/v)

CAI4 gcn2Δ

0

0.2

0.4

0.6

0.8

1

1.2

0 100 200 300

poly

som

e/m

on

oso

me

rati

o

Farnesol (µM)

CAI4 gcn2∆

Figure 3.9 Polysome/monosome ratio of CAI4 and gcn2∆ (mutant)

strains shows similar pattern of inhibition of translation for the two

strains. The areas within the monosomal and the polysomal regions

were measured using ImageJ software (NIH). The values calculated

were plotted as shown in the figures.

124

ut 0.5% 1.0% 2.0% ut 0.5% 1.0% 2.0%

efg1Δ cph1Δ

efg1Δ

ut 100µM 200µM 300µM ut 100µM 200µM 300µM

cph1Δ

Butanol

Farnesol

Figure 3.10 Effect of farnesol and butanol on different

transcriptional regulator mutants. Polysome analysis was used to

assess the effect of alcohols on translation initiation in a efg1Δ and

cph1∆ strains of C. albicans. Yeast were grown in YPD and various

concentrations of the various alcohols were added as indicated for 15

min. Extracts were sedimented on 15-50% sucrose gradients and the

absorbance at 254nm was continuously measured.

125

126

3.2.5 Does the signalling pathway that regulate morphogenesis also play a role in

translation initiation in C. albicans?

One of the key virulence factors of C. albicans is its ability to undergo reversible

morphological transitions from the vegetative form to the filamentous form (Odds 1994;

Lo et al. 1997). Several signalling pathways control this morphogenesis in C. albicans

(See Section 1.3 in the introduction). These include the MAPK pathway, which is

dependent upon Cph1p; a homlogue of S. cerevisiae Ste12p (Liu et al. 1994); and the

Ras-cAMP signalling pathway, which requires functional Efg1p (Bockmühl and Ernst

2001). Both pathways are thought to activate filamentous growth in response to

starvation or serum addition. Under most experimental conditions, the transition from

yeast to hyphae is blocked in the cph1 efg1 double mutant (Lo et al. 1997), indicating

that the transduction of most environmental signals that control morphogenesis is

dependent upon Ras-cAMP and/or MAPK signalling.

In order to probe whether there is a connection between these signal transduction

pathways and the translational response of C. albicans to alcohols, we exposed the

efg1Δ and the cph1Δ strains of C. albicans to varying concentrations of butanol or

farnesol and assessed the translational response using polysome profiling. In terms of

the response to butanol, neither mutant showed any difference to the CAI4 strain in

terms of the redistribution of polysomes (cf Figure 3.7 with Figure 3.10). Therefore it

appears that neither Efg1p nor Cph1p is involved in the translational response of

Candida albicans to fusel alcohols.

Interestingly for farnesol, the efg1Δ strain showed some translational resistance to the

effects (Figure 3.10), whereas the cph1∆ strain was inhibited in the same manner as the

wild type (See Figure 3.7 for comparison). This resistance highlights a role for the Ras-

cAMP pathway in the inhibition of translation initiation following farnesol treatment.

Indeed, farnesol has been shown to target the Ras1-Cdc35-PKA-Efg1 dependent

127

pathway to inhibit transition from yeast to hypha in C. albicans (Davis-Hanna et al.

2008). It has also been shown that farnesol directly targets the adenylyl cyclase, Cyr1p,

to repress hypha formation and that exogenous cAMP restored filamentation in response

to host environmental cues (Hall et al. 2011). It yet remains to be assessed the effect of

exogenous cAMP on the translational resistance exhibited by the efg1∆ strain to

farnesol. In summary though, the differential sensitivity of the mutants highlights a

distinction between the responses of C. albicans to the different alcohols used in this

study.

3.2.6 Dephosphorylation of eIF2α by fusel alcohols and farnesol in C. albicans

Fusel alcohols have been shown to bring about an inhibition of translation initiation in

S. cerevisiae and C. albicans in a Gcn2p-independent manner (Ashe et al. 2001),

(Figure 3.8). Paradoxically, it was reported by Taylor et al. (2010), that fusel alcohols

lead to a dephosphorylation of eIF2α in S. cerevisiae rather than an increase in

phosphorylation. Initially, an attempt was made to detect phosphorylated eIF2α in C.

albicans by probing the whole cell extracts with phosphospecific antibodies to

phosphoserine 51 on eIF2α, but no signal was detected on western blots (e.g. Figure

3.11A, upper panel). Upon longer exposure, however, a basal signal that could be

phosphorylated eIF2α is just detectable (Figure 3.11A, middle panel). In response to

butanol treatment the level of this signal did not increase, in fact it was reduced. This is

reminiscent of the situation in S. cerevisiae where fusel alcohol treatment leads to eIF2α

dephosphorylation.

A variety of conditions are known to induce phosphorylation of eIF2α at serine 51 via

the kinase Gcn2p; such as the addition of rapamycin, amino acid starvation and

treatment with various antioxidants (Dever et al. 1992; Kubota et al. 2003; Mascarenhas

et al. 2008). On account of the low basal level, and to further explore the possibility

128

that eIF2α is dephosphorylated in response to butanol, the cells were exposed to 1mM

cadmium sulphate to induce phosphorylation of eIF2α (Mascarenhas et al. 2008). Under

these conditions, a robust signal was observed on the western blot that was not observed

for gcn2∆ strains. This band was the same size as the weak band observed in untreated

cells, suggesting that the weak band is indeed phosphorylated eIF2α. To explore

whether butanol induces dephosphorylation of eIF2α, cultures of a CAI4 strain and

gcn2Δ strain were first treated with 1mM Cadmium sulphate for 60 min to induce

detectable eIF2α phosphorylation, then treated with butanol for 15 min. As shown in

figure 3.11, high concentrations of butanol cause dephosphorylation of eIF2α. These

same high concentrations of butanol are required to give the maximal inhibition of

protein synthesis as judged by the polysome analysis (Figure 3.7). Therefore, the

inhibition of translation initiation by fusel alcohols is accompanied by and correlates

with a dephosphorylation of eIF2α.

In stark contrast to the effects of butanol on eIF2α dephosphorylation, concentrations of

ethanol that inhibit protein synthesis do not cause eIF2α dephosphorylation either with

or without the pretreatment with Cadmium (Figure 3.12). Once again this highlights a

difference between the response to these alcohols and suggests that they probably act by

different mechanisms.

Finally, the impact of farnesol on eIF2α dephosphorylation was assessed (Figure 3.13).

Similar to butanol, in the experiment where cells are pretreated with Cadmium to induce

high levels of phospho-eIF2α, high concentrations of farnesol possibly cause some

dephosphorylation of eIF2α. It should be noted however, that only 300µM farnesol gave

any observable effect. In contrast, from the polysome profiling maximal inhibition of

protein synthesis was already evident at 200µM farnesol. This suggests that even though

farnesol has a potential weak effect on eIF2α dephosphorylation, it is not connected to

the inhibition of protein synthesis.

129

Overall, these results confirm the gcn2∆ mutant data, in that none of the alcohols tested

causes an inhibition of translation initiation as a result of inducing eIF2α

phosphorylation. In fact butanol and possibly farnesol act to induce dephosphorylation

of eIF2α. Therefore, the possibility exists that these alcohols may be activating some

phosphatase to dephosphorylate eIF2. Indeed, in S. cerevisiae a mutant in SIT4, that

encodes a type 2A-related phosphatase exhibited virtually no dephosphorylation after

exposure to fusel alcohols (Taylor et al. 2010). It is possible that a similar mechanism

exists in C. albicans. While this may be interesting in terms of signal transduction, it is

unlikely to have any bearing on translational regulation as dephosphorylation of eIF2 is

activatory in terms of translation (Ashe et al. 2001; Taylor et al. 2010). Therefore, it

appears butanol and farnesol induce an inhibitory mechanism that dominates the effects

of eIF2α dephosphorylation.

eIF2αp

Phospho-eIF2α

Phospho-eIF2α

Tef1p

UT 2% 0% 0.5% 1% 2%

- - + + + +

10 min exposure

30 min exposure

Butanol

Cd2+ pretreatment

CAI4

- - + + + + +

UT 2% 0% 0.5% 1% 2% WT

Phospho-eIF2α

Tef1p

Cd2+ pretreatment

Butanol

gcn2Δ

Figure 3.11 Butanol causes a dose dependent decrease in eIF2α serine

51 phosphorylation (eIF2α-P) in the CAI4 strain. Protein extracts from

the CAI4 and the gcn2Δ strains were blotted and probed with antibodies to

Tef1 and a phosphospecific antibody to phosphoserine 51 on eIF2α. Strains

were grown on YPD to OD6oo of 0.7, pretreated with 1mM Cadmium for 1

hr. Various concentrations of butanol (v/v) were then added for 15 min after

which protein extracts were made.

130

A.

B.

Figure 3.12 Ethanol seems to have no effect on the level of eIF2α serine

51 phosphorylation (eIF2α-P) in the CAI4 strain. Protein extracts from

the CAI4 and the gcn2Δ strains were blotted and probed with antibodies to

Tef1 and a phosphospecific antibody to phosphoserine 51 on eIF2α. Strains

were grown on YPD to OD6oo of 0.7, pretreated with 1mM Cadmium for 1

hr. Various concentrations of ethanol (v/v) were then added for 15 min after

which protein extracts were made.

Phospho-eIF2α

Tef1p

UT 8% 0 % 2% 4% 6% 8%

Cd2+ pretreatment

Ethanol

10min exposure

30 min exposure

- - + + + + +

CAI4

Tef1p

gcn2Δ

Cd2+ pretreatment

UT 2% 4% 6% 8% CAI4

- + + + + +

Ethanol

Phospho-eIF2α

Phospho-eIF2α

131

A.

B.

UT 300 0 10 40 100 200 300

- - + + + + + +

10 min exposure

30 min exposure

Farnesol (µM)

Cd2+ pretreatment

Phospho-eIF2α

Phospho-eIF2α

Tef1

Figure 3.13 Farnesol causes a dose dependent decrease in eIF2α serine

51 phosphorylation (eIF2α-P) in the CAI4 strain. Protein extracts from

the CAI4 and the gcn2Δ were blotted and probed with antibodies to Tef1

and a phosphospecific antibody to phosphoserine 51 on eIF2α. Strains were

grown on YPD to OD6oo of 0.7, pretreated with 1mM Cadmium for 1 hr.

Various concentrations of farnesol (v/v) were then added for 15 min after

which protein extracts were made.

CAI4

Tef1

Phospho-eIF2α

UT 0 10 40 100 200 300 CAI4

- + + + + + + +

gcn2Δ

Cd2+ pretreatment

Farnesol (µM)

132

A.

B.

133

3.3 Discussion

The results described in this chapter show that a range of alcohols inhibit growth and

protein synthesis in strains of C. albicans in a dose-dependent manner. The inhibition of

protein synthesis occurred at the level of translation initiation as shown by the

polyribosomal profiles. There is a correlation in the concentrations required to inhibit

growth and translation initiation in the two strains of Candida albicans studied, as

shown in the growth curves and the polyribosomal profiles. Gcn2p is not involved in

this regulation of translation both in C. albicans and S. cerevisiae; thus there is an

inhibitory pathway that is independent of the eIF2α kinases. Previous work in S.

cerevisiae has identified a rapid inhibition of translation initiation caused by fusel

alcohols, which is accompanied by a characteristic change in polysome profile (Ashe et

al. 2001). As initiation is inhibited, ribosomes can no longer load onto transcripts and

ribosomes completing a translational cycle dissociate. This leads to a decrease in heavy,

polysome peaks with a concommitant rise in free ribosomes (Hartwell and McLaughlin

1969). Fusel alcohols target eIF2B to cause inhibition of translation initiation in S.

cerevisiae and this occur in a Gcn2p- independent manner (Ashe et al. 2001).

Butanol and possibly farnesol cause a dose dependent dephosphorylation of eIF2α in C.

albicans. This observation mirrors what was previously described for S. cerevisiae

following butanol treatment (Griffiths and Ashe 2006). However, ethanol seems not to

cause dephosphorylation, this finding serves to separate distinct modes of action for the

alcohols on protein translation.

Finally, alcohols also cause a range of effects on the morphology of C. albicans.

Butanol and ethanol induce a switch from vegetative growth to filamentous (germ-tube

and pseudohyphal) growth. Farnesol blocks filament development initiated by any of

three chemical triggers used in this study (serum, butanol and ethanol). Pseudohyphal

134

formation in S. cerevisiae in response to fusel alcohols have been described (Dickinson

1996; Lorenz et al. 2000).

An assessment of the translational response of key transcriptional mutants in the

morphological differentiaton pathway to butanol and farnesol, revealed that cAMP-

PKA pathway could be playing a mojor role in response of C. albicans to farnesol.

Previously it has been shown that farnesol acts via RAS- cAMP-PKA pathway to inhibit

morphogenesis in C. albicans (Davis-Hanna et al. 2008; Hall et al. 2011).

135

Table 3.1 Summary of effects of various alcohols on the physiology of C. albicans

strains

Alcohols

136

4 Effects of various alcohols on the eukaryotic initiation factor 2B

(eIF2B)

4.1 Introduction

Eukaryotic initiation factor 2B is the guanine nucleotide exchange factor for eIF2. It

promotes the exchange of GDP for GTP on eIF2. The resulting eIF2.GTP has the

capacity to interact with the initiator methionyl tRNA to form the ternary complex that

is a critical part of the translation initiation process (Proud 2005). Recognition of the

AUG start codon results in eIF5-dependent GTP hydrolysis on eIF2. eIF2B is required

to recycle the resulting eIF2.GDP back to its translationally competent GTP bound

form. eIF2B is therefore a key target of translational control mechanisms, as a decrease

in its activity leads to a depleted pool of GTP bound active eIF2 in the cell and therefore

a decrease in the rate of translation initiation (Dever et al. 1995).

As a result, several cellular stress conditions that inhibit the activity of eIF2B lead to

reduced ternary complex and the inhibition of protein synthesis. Paradoxically, such

stress conditions lead to the activation of the translation of specific mRNAs via short

upstream open reading frames (uORFs) (see Introduction 1.8.3). For instance, in S.

cerevisiae amino acid starvation leads to the phosphorylation of eIF2α by Gcn2p, which

converts eIF2.GDP from a substrate to an inhibitor of eIF2B to impede the formation of

ternary complex. As a result global protein synthesis is inhibited, while GCN4 mRNA

translation is activated via a complex mechanism involving four uORFs (See Section

1.8.3) (Hinnebusch 1993).

Studies from the Ashe laboratory in S. cerevisiae have shown that fusel alcohols, such

as 1-butanol, inhibit protein translation and activate GCN4 mRNA translation by a

different mechanism (Ashe et al. 2001). Instead of activating the Gcn2p kinase to

indirectly regulate eIF2B, these alcohols appear to impact on eIF2B more directly in a

Gcn2p independent manner. This proposed mechanism of action for the alcohols has

137

stemmed from a number of key observations. Firstly, mutant strains such as SUI2-S51A

and gcn2Δ, that are translationally resistant to amino acid starvation, are still sensitive to

fusel alcohols. In addition, a mutation in the γ subunit of eIF2B (GCD1-P180 to GCD1-

S180) was identified that confers greater sensitivity to fusel alcohols (Ashe et al. 2001).

Subsequently, a number of other mutations in the different eIF2B sub-unit genes have

been shown to impact on the resistance and sensitivity of yeast to fusel alcohols;

(Richardson et al. 2004; Taylor et al. 2010). Finally, a direct evaluation of the precise

levels of ternary complex after treatment with butanol shows that ternary complex levels

are reduced in butanol sensitive strains but unaffected in butanol resistant strains

(Taylor et al. 2010).

Other studies from the Ashe lab have focussed on the cellular localisation of eIF2B and

its G-protein eIF2 (Campbell et al. 2005; Campbell and Ashe 2006; Taylor et al. 2010).

It appears that both eIF2B and eIF2 co-localise to a discrete cytoplasmic focus within

the cell that has been termed the eIF2B body (Campbell et al. 2005). This localisation is

specific to these two initiation factors, as other initiation factors are found dispersed

throughout the cytoplasm (Campbell et al. 2005). The eIF2B body is thought to provide

a locally increased concentration of eIF2B and thus serves as a site for focussed guanine

nucleotide exchange on eIF2 (Campbell et al. 2005). Intriguingly, butanol addition to S.

cerevisiae cells at concentrations sufficient to inhibit protein synthesis has a negative

effect on the movement of the eIF2B body. This effect was more severe in butanol

sensitive relative to resistant strains, suggesting a role for the movement of the eIF2B

body in the response to butanol (Taylor et al. 2010).

Attempts have also been made in the Ashe lab to identify fusel alcohol dependent

covalent modifications in yeast eIF2B via mass spectrometric analysis. Such analyses

have identified a number of potential phosphorylation sites in eIF2Bɛ, eIF2Bα and

138

eIF2Bγ and mutations in one of the eIF2Bδ phosphorylation sites altered the sensitivity

of yeast to butanol (Taylor et al. 2010).

Given the results described above for S. cerevisiae, this chapter describes the study of

the effects of butanol, ethanol and farnesol on the activation of GCN4 mRNA, the

integrity and modification status of the eIF2B complex, and the presence/ movement of

the eIF2B body in the related pathogenic yeast, C. albicans.

4.2 Results

4.2.1 Butanol and ethanol induce the translation of GCN4 mRNA in a Gcn2p

independent manner in C. albicans

In S. cerevisiae, cellular stresses that inhibit translation initiation by reducing ternary

complex also lead to the translational induction of the GCN4 mRNA. A similar system

has been identified in C. albicans (Tripathi et al. 2002; Sundaram and Grant 2014).

Therefore, as alcohols caused an inhibition of translation initiation in C. albicans

(Section 3.2.5), the possibility exists that these alcohols could also act via a reduction of

the ternary complex and hence induce translation of the GCN4 mRNA. In S. cerevisiae

a GCN4-lacZ reporter construct containing the GCN4 promoter and the 5′ -untranslated

region driving expression of the lacZ gene was previously used to test whether Gcn4p is

induced upon butanol treatment (Ashe et al. 2001). The expression of the GCN4-lacZ

reporter was observed to increase ~3 fold following butanol treatment for 2 h. This

experiment formed part of the evidence that fusel alcohols target eIF2B to reduce

ternary complex levels.

Reporter genes that encode bioluminescence proteins, like luciferases, have provided a

very rapid method for analysing the regulation of gene expression (Bronstein et al.

1994). Srikantha et al. (1996) reported the development of a reporter system for C.

139

albicans using the luciferase gene RLUC of the sea pansy Renilla reniformis. The

reporter contains no CUG codons in its open reading frame, as Candida albicans and

other members of the CTG clade exhibit non-traditional codon use (Rocha et al. 2011);

they decode CUG as serine rather than leucine. Furthemore, the choice of Renilla

Luciferase as the reporter for this assay was made based on the fact that the reporter is

ATP-independent (Lorenz et al. 1991; Wurdinger et al. 2008; Huang et al. 2011).

Therefore RLUC reporter is well suited for use in C. albicans considering that the

filamentation system is regulated by cAMP. As a result, this cassette has been adapted

in two reporter constructs for use in the study of GCN4 regulation in C. albicans.

Firstly, a reporter has been constructed with five copies of the GCRE (General Control

Response Element) upstream of a basal promoter and the RLUC reporter gene. This

reporter allows the induction of Gcn4p responsive genes to be followed (Sundaram and

Grant 2014). Secondly, a GCN4-RLUC reporter has been developed in which the 5′-

leader sequence of GCN4 was cloned upstream of a luciferase reporter gene. This

reporter more directly assesses the translational regulation of the GCN4 mRNA

(Sundaram and Grant 2014).

Previously both the GCRE and GCN4 reporters have been integrated specifically into

the Candida albicans genome of CAI4 and gcn2∆ strains (Sundaram and Grant 2014).

These strains have been used here to assess how alcohols (1% butanol, 6% ethanol and

100µM farnesol) impact on this pathway. The rationale behind the concentrations of

alcohols used was that at these concentrations the alcohols do not completely inhibit

translation initiation so any induction of GCN4 should be observable based on similar

observations in S. cerevisiae. Indeed for the ethanol and butanol treatments there was

~3.6 and ~2.6-fold increase in GCRE-Luc expression, respectively after two hours.

However, for farnesol, no significant alteration relative to the basal level of GCRE-Luc

expression was observed (Figure 4.1A). For the GCN4-Luc reporter strain, ethanol and

140

butanol treatment once again gave an induction of ~1.65 and ~2.4-fold respectively,

whereas farnesol treatment gave no induction (Figure 4.2A). All of the increases

observed following butanol and ethanol treatment were also observed in the gcn2∆

mutant strain (Figure 4.1B and 4.2B).

These results are suggestive that the inhibition of translation initiation by ethanol and

butanol results from a decrease in the level of ternary complex. One possible

explanation for this is that, in an analogous manner to the action of fusel alcohols on S.

cerevisiae, ethanol and butanol act to inhibit eIF2B directly in a mechanism that does

not involve eIF2α phosphorylation. In contrast, for farnesol, the mechanism of

translational regulation appears to not involve changes in the activity of eIF2B and the

levels of the ternary complex. As the results from the ethanol and butanol experiments

thus far are very similar, in subsequent experiments a decision was made to focus on

butanol and compare the results directly to the impact of farnesol.

0

0.5

1

1.5

2

2.5

3

3.5

4

GC

RE

::L

uc

0

0.5

1

1.5

2

2.5

3

3.5

4

GC

RE

::L

uc

Figure 4.1 Alcohols impact on the general control pathway in C.

albicans in a Gcn2p independent manner. The CAI4 (A) and the

gcn2∆ mutant (B) strains were treated with the indicated

concentrations of alcohol for 2 h, and luciferase activity was measured

from the GCRE-Luc reporter gene. Error bars indicate ± SE.

A B

141

A B G

CN

4::

Luc

0

0.5

1

1.5

2

2.5

3

GC

N4::

Luc

Figure 4.2 Alcohols induce GCN4 expression in C. albicans in a Gcn2p

independent manner. The CAI4 (A) and the gcn2∆ mutant (B) strains

were treated with the indicated concentrations of alcohol for 2 h, and

luciferase activity was measured from the GCN4-Luc reporter gene. Error

bars indicate ± SE.

0

0.5

1

1.5

2

2.5

3

142

143

4.2.2 Effect of alcohols on the cellular localisation of eIF2B

4.2.2.1 Generating strains

Recent findings from the Ashe laboratory have shown that eIF2B exists in a large

cytoplasmic body in S. cerevisiae, which has been termed the eIF2B body (Campbell et

al. 2005). This body is mobile within the cell traversing almost all regions of the

cytoplasm. Intriguingly, the addition of butanol to cells, at concentrations sufficient to

inhibit protein synthesis, prevents the movement of the eIF2B body (Taylor et al. 2010).

Furthermore, in a specific butanol resistant strain treated with the same concentration of

butanol, the eIF2B body moves freely. Moreover, in other butanol resistant eIF2B

mutant strains, the eIF2B body is absent (Taylor et al. 2010). These results suggest a

connection between the eIf2B body and the regulation of translation initiation by fusel

alcohols in S. cerevisiae.

Therefore, to investigate the localisation of the eIF2B, in the diploid C. albicans CAI4,

one copy of the gene for the γ subunit of eIF2B (GCD1) was C-terminally tagged with

GFP using a standard PCR-mediated epitope tagging strategy (Knop et al. 1999). In this

method a cassette is generated with long primers that direct GFP (or other epitope tags)

such that they are directly integrated by homologous recombination into the genome in

frame with appropriate open reading frames. Positive transformants are selected by

virtue of the marker gene also present on the cassette. In this case the nourseothricin

acetyltransferase (NAT1) gene from Streptomyces noursei was used which gives

resistance to the antibiotic nourseothricin. Integration of the GFP-tag into the genome at

the correct site was verified using a PCR strategy on genomic DNA prepared from

potential transformants. The outline of this diagnostic PCR scheme is shown in figure

4.3, along with a table of expected product sizes. PCR products of the expected size

were obtained, indicating that the integration of the GFP-tag had occurred at the correct

site (Figure 4.3).

144

Western blotting was also used to confirm the GFP-tagging of the GCD1 gene across a

number of different potential transformants. Protein extracts were made from the

transformants and compared to those from an untagged control strain, and the blot was

probed using an antibody against the GFP protein. The GFP signal was detected at the

correct size in the GFP-tagged strain but no signal was detected in the untagged CAI4

strain (Figure 4.4 A).

Epiflourescence microscopy was used to visualize the tagged strain and the image

shown in Figure 4.4 B clearly shows that the majority of the cells harboured an eIF2B

body. It was also observed that the body was motile under untreated conditions. These

results almost precisely parallel what has been found in S. cerevisiae (Campbell et al.

2005; Taylor et al. 2010).

400

200

600

800

1000

1500

2000 2500 3000 3500

CAI4

Figure 4.3 Verification of GFP tagged CAI4 strain. Strains

were generated harbouring a genomically GFP-tagged copy of

GCD1 using the standard PCR mediated epitope tagging

method. A. Schematic of PCR amplifications to verify the

correct integration of the GFP tagging cassette into the GCD1

locus. B. Expected PCR sizes and C. an agarose gel

electrophoresis of PCR products generated by the amplification

are shown.

Primers Expected fragment sizes (bp)

Tagged Untagged

VFCaGCD1& GFP-UP

VRCaGCD1 & CaNAT1F

VFCaGCD1 & VRCaGCD1

319

570

3000 520

- -

GCD1

VFCaGCD1

VRCaGCD1 VRCaGCD1

VFCaGCD1

GCD1 GFP NAT

CaNAT1F

GFP-UP

A

B

C

CAI4 GCD1/

GCD1-GFP-NAT1

145

6 4 2 1 wt

α Gfp

αTef1p

transformants

Figure 4.4 GFP tagging of GCD1 shows that eIF2Bγ is

present in an eIF2B body. A) Western analysis was probed

with antibodies raised against GFP to confirm the tagging

and Tef1p was used as a loading control. B) Strain bearing

the GFP-tagged GCD1 was visualised with an epifluorescent

microscope showing a single large cytoplasmic body.

A

B

146

147

4.2.3 Alcohols do not affect the localisation of eIF2B subunits to the eIF2B body

Previous studies of translational stresses, such as amino acid starvation, in S. cerevisiae

have shown that despite an effect on shuttling of eIF2 through eIF2B bodies, they do

not impact on the ability of eIF2 or eIF2B to localise to the foci (Campbell et al. 2005).

In contrast, mutants in the α subunit of eIF2B have been described that lead to a

complete loss of the eIF2B body in S. cerevisiae. These mutants are also resistant to

both fusel alcohols and amino acid starvation. In this section, the effect of alcohols on

the localisation of eIF2B to eIF2B bodies was investigated using the GCD1-GFP tagged

strain.

Live cell epifluorescent microscopy was performed on mid-log phase C. albicans strain

CAI4 bearing a GFP tag on one copy of GCD1, to count and score cells for the absence

or presence of an eIF2B body. Figure 4.5A shows representative images of the

localisation pattern of the eIF2B subunit. Quantitation of the average number of cells

which contained an eIF2B body in either untreated cells or cells treated with 1% (v/v)

butanol or 100µM farnesol for 15 min shows that the treatments have no significant

effects on the capacity of the eIF2Bγ subunit to localise to eIF2B bodies (Figure 4.5B).

These results suggest that the integrity of the eIF2B body is unaffected by

concentrations of either butanol or farnesol that inhibit translation initiation.

4.2.4 Effect of alcohols on the dynamics of the eIF2B body

To investigate the impact of alcohols on the movement of eIF2B bodies, cells were

grown to logarithmic phase and briefly treated with a concentration of the various

alcohols that has been previously shown to inhibit translation initiation (see Figure 3.7).

Epiflourescence microscopy time-lapse experiments were performed by acquiring

images every 5 sec over a 2 min period. The movement of the eIF2B body across the

images was tracked and the total distance (µ) moved was calculated. Figure 4.6 shows

148

individual stills from a single time lapse microscopy experiment and an overlay of the

images from all 25 time points; this gives a representation of the extent of movement

over the time course. Quantitation of the average displacement shows that 1% butanol

causes total eIF2B body movement to drop by approximately 50%, while farnesol does

not appear to impact on this movement (Figure 4.7). As the eIF2B body moves less after

exposure to concentrations of fusel alcohols that also inhibit translation initiation, it

seems possible that as has been suggested in S. cerevisiae (Taylor et al. 2010), at least

part of the translational inhibition relates to increased tethering of the eIF2B body. It is

possible that the capacity of the eIF2B body to move rapidly around the cell may allow

a sustained level of translation initiation by maximising levels of ternary complex

throughout the cell.

4.2.5 Purification of eIF2B and eIF2 subunits from C. albicans for Mass

spectrometry

The cell biological approach described above further implicates eIF2B and/ or eIF2 in

the regulation of translation initiation by butanol but not by farnesol. In order to further

explore the impact of butanol on eIF2B, a biochemical approach was attempted. In the

first instance, the goal was to purify eIF2B and/or eIF2 from Candida albicans cells,

and a variety of different strategies were attempted.

Figure 4.5 Alcohols do not affect the localisation of eIF2Bγ

subunits to eIF2B bodies. Cells bearing GFP-tagged GCD1 were

visualised with an epifluorescent microscope. Cells were either

untreated or treated with 1% (v/v) butanol or 100µM farnesol for 15

min and the number of cells with eIF2B body were counted against

a total of 100 cells. Data represents quantification from 3 biological

repeats. Error bars indicate ±SE.

untreated 1% butanol 100µM farnesol

0

10

20

30

40

50

60

untreated 1% butanol 100µM

farnesol

Num

ber

of

eIF

2B

bodie

s/100 c

ells

untreated

1% butanol

100µM farnesol

A

B

149

Figure 4.6 Butanol impedes the movement of eIF2B bodies.

Cells were grown to mid-log phase in YPD and either maintained

as untreated, or treated with 1% (v/v) butanol or 100µM farnesol

for 15 min. Epiflourescent real-time 2D deconvolved projections

were generated from continuous z-sweep acquisition. Images of

cells were taken every 5 s over a 2 min time period. Representative

images are shown on the left and an overlay showing the position

of the body over the 2 min time course is shown on the right.

UT

1%

butanol

100µM

farnesol

Individual stills from time lapse Time lapse merge

150

Figure 4.7 Butanol impedes movement of eIF2B bodies. Images

of cells were taken as described in 4.6 and used to calculate the total

distance moved by the eIF2B body over a 2 minute period using

ImageJ software package (NIH). A bar chart shows the mean total

distance moved by the eIF2B bodies in µ. Values shown are

calculated from ≥ 20 cells ± SE. (* denotes a significant difference

from untreated sample p<0.003)

0

2

4

6

8

10

12

14

16

18

untreated 1% butanol 100µM

farnesol

Dis

tance

moved

(µ

)

untreated

1%

butanol

100µM

farnesol

*

151

152

4.2.5.1 Strategy for V5S-His6x tagging of GCD1 in C. albicans

The first approach taken was the use of a combined V5-6xHis epitope tag (Milne et al.

2011) to tag the eIF2Bγ and eIF2β proteins encoded by the GCD1 and SUI3 genes,

respectively. The double epitope tag combines the benefits of efficient detection through

the V5 epitope and protein purification using the 6xHis epitope. The V5-6xHis-NAT1

cassette was targeted to the relevant position on the GCD1 and SUI3 genes via

homologous recombination in the CAI4 strain of C. albicans (Figure 4.8A). Correct

integration was confirmed by PCR screening (Figure 4.8A, B and C). Western blotting

was also used to confirm tagging of the correct genes in the strain. The protein blots

were probed using antibodies raised against the V5 epitope (Figure 4.7 D), and bands of

the expected size (56.8kDa and 33.6kDa for GCD1 and SUI3 respectively) were

detected while no signal was detected in extracts from the untagged parent strain.

4.2.5.2 Purification of proteins from V5-6xHis tagged strains.

Repeated attempts were made to purify the tagged proteins using the V5 purification

method. V5 resin was used to bind the tagged protein and elution was carried out by

competition with the V5 peptide (Figure 4.9A). As this did not yield the expected set of

bands, protein purification was also carried out using the 6xHis tag. Ni-NTA agarose

beads were utilised and bound proteins were eluted with high concentrations of

imidazole. Repeated purifications using this strategy also did not yield the expected

sized bands (Figure 4.9B). Furthermore none of the subunits of eIF2B or eIF2 was

detected by mass spectrometry from purified samples.

There are a number of possible explanations that could explain the difficulty in

purifying the eIF2B and eIF2 proteins including insufficient protein levels or

inaccessibility of the epitope tag. In S. cerevisiae, an eIF2B purification system has

been developed, where all five eIF2B subunits are overexpressed from two plasmids,

153

and FLAG epitopes on eIF2Bγ allow purification (Mohammad-Qureshi et al. 2007). C.

albicans is an obligate diploid and autonomous plasmid systems developed for routine

use are unstable in this organism (Goshorn et al. 1992). Therefore, tagging just a single

copy of a gene, as for the V5-6xHis system above, will not permit maximal protein

expression, as the organism will also be expressing the untagged allele of the gene of

interest.

In an attempt to circumvent some of these potential bottlenecks, a different tagging

system was designed, similar to that which has been previously described in S.

cerevisiae. Firstly, to maximise tagged protein expression levels, it was decided that

both copies of the eIF2Bγ gene should be tagged. Secondly, the purifying epitope was

switched to FLAG and four copies were used in order to increase the binding of the

Flag antibody to the gene of interest. In order to genomically tag both alleles, a strategy

was adopted making use of a mini URA3 blaster (URA3-dpl200) cassette. This mini

URA3 blaster has short flanking repeats that permit PCR amplification of the cassette

for transformation, as well as homologous excision of the URA3 marker gene, such that

reuse is possible. Although the mini URA3 cassette was initially designed for gene

deletions in C. albicans (Wilson et al. 2000), here it was adapted for the sequential

FLAG-epitope tagging of two alleles of the GCD1 gene in C. albicans.

transformants

Sui3p-V5s

Tef1p

1 wt

Gcd1p-V5s

Tef1p

8 2 1 wt

CAI4 (untagged)

GCD1-V5S tagged M blank

SUI3-V5S (tagged)

CAI4 (untagged) M blank

Figure 4.8 Verification of GCD1-V5-6xHis-tagged and SUI3 V5-

6xHis-tagged CAI4 strains. Strains were generated harbouring

genomically V5-6xHis tagged copy of GCD1and SUI3 using the

standard PCR mediated epitope tagging method. A. Schematic of PCR

amplifications to verify the correct integration of the GFP tagging

cassette into the GCD1 locus. B. Expected PCR sizes for GCD1 and

SUI3 tagged genes respectively and C. Agarose gel electrophoresis of

PCR products generated by amplification are shown. D. Western

analysis of the extracts from the tagged strain. The immunoblots were

probed with antibodies against V5.

GCD1

VFCaGCD1

VRCaGCD1 VRCaGCD1

VFCaGCD1

GCD1 V5S NAT

CaNAT1F

V5S-UP

A

B

C

D

800 600

400

2500 3000

3500

2000

1500

1000

Primers

Expected fragment sizes (bp)

Tagged Untagged

VFCaGCD1& V5S

VR GCD1/SUI3 & CaNAT1F

VF GCD1/SUI3 & VRGCD/SUI3

591

503

2064 459

- -

Untagged

- -

GCD1-V5S SUI3-V5S

Tagged

556

515

2049 436

400

600

2000

1500

1000

800

3000 2500

154

a2 a1

a1

d2

b1

c2 d1

a2

b2

b1

b2

c1

c1 c2

d2 d2 d1 d1

100kDa

75kDa

50kDa

37kDa

25kDa

Mol. weight eIF2B subunits

Gcd6 81.9kDa

Gcd2 55.9kDa

Gcd1 54.3kDa

Gcd7 41.0kDa

Gcn3 35.1kDa

Figure 4.9 Affinity purification of V5-6xHis tagged eIF2B.

Affinity purified eIF2B was separated by Polyacrylamide gel

electrophoresis and stained with Coomassie. Affinity purification

was done with (A) V5 resin and (B) Ni-NTA agarose beads.

Molecular weight of V5-6xHis tag is 2.4kDa.

37kDa

50kDa

75kDa

100kDa

A B M M eluate eluate

155

156

4.3.5.3 Construction of the 4X-FLAG-URA3dpl tagging cassette

A cassette was therefore designed with four FLAG epitopes and URA3 as the selectable

marker. The URA3 marker was flanked by a 200bp segment of C. albicans URA3 3′

sequences to allow marker removal via homologous integration between the repeats.

The cassette, 4X-FLAG-URA3dpl200, was synthesized commercially (by Biomatik,

USA) and cloned into a standard vector (pBMH). A standard PCR based epitope

tagging strategy was taken to tag the GCD1 gene with the 4X-FLAG-URA3dpl cassette.

In short, primers were designed with regions complementary to an appropriate region of

the GCD1 gene, as well as a region that allows amplification of the 4X-FLAG-URA3dpl

cassette. An overview of the strategy for tagging both alleles of the GCD1 gene is

shown in Figure 4.10, while the precise site of integration for the PCR products is

shown in Figure 4.11A.

For the first GCD1 allele, correct integration of the Flag-tag into the genome was

verified using PCR reactions on genomic DNA purified from potential transformants

(Figure 4.11B). In addition, Western blotting was used to verify that a tagged protein of

the correct size (60 kDa) is present in protein extracts from the transformed strain but

not in extracts from the parental strain (Figure 4.12B).

In order to facilitate tagging of the second allele of the GCD1 gene, the URA3 marker

gene was first excised through homologous recombination between the 200bp flanking.

URA3 is a counter-selectable marker in that its loss can be selected for using 5-fluoro-

orotic acid (5FOA). Therefore, single colonies where the URA3 gene has potentially

been excised were selected on 5FOA plates to yield Ura- strains and URA3 loss was

verified using PCR on genomic DNA (Figure 4.11B).

The resulting strain was used in a second transformation with the 4X-FLAG-

URA3dpl200 cassette. Selection of transformants and verification of the correct

integration of the Flag-tag in the second allele of the gene was again performed using

157

PCR on genomic DNA preparations from potential transformants. The expected PCR

products generated from strains having two Flag-tagged alleles of GCD1 were obtained-

the lane labelled ‘1st and 2

nd’ contains a DNA band for the first tagged allele, a DNA

band for the second tagged allele yet no DNA band where the untagged allele migrates

(Figure 4.12A). Western analysis using an antibody raised against Flag protein also

showed approximately 2-fold higher levels of protein from the strain in which the two

GCD1 alleles were tagged relative to the strain where only one allele of the gene is

tagged (Figure 4.12B).

GCD1

GCD1

URA3

GCD1

Repeat for second allele

GCD1

Target gene

Target gene URA3

Figure 4.10 Strategy for tagging the two alleles of C. albicans genes

using the mini Ura-blaster technique. (A) 4XFLAG-URA3-dpl200

cassette, the locations of the epitope tag (stripped box ), ScCYC1

terminator (grey box), URA ORF (white box) and duplicated 3′

sequences (hatched boxes) are shown. (B) The schematic of the

sequential tagging of the two alleles of a gene.

dpl200 4xFLAG

Tagging of first allele

and selection on 5FOA

158

A

B

Figure 4.11 Verification of genomic C-terminal FLAG tagging

of the first allele of GCD1 in CAI4 strain. A. Schematic of PCR

strategy used to verify genomic integration of the FLAG-tag and

the expected PCR product sizes. B. Agarose DNA electrophoresis

of PCR products from 3 transformants. (a). refers to the

transformants bearing the whole tagging cassette, while (b) refers

to transformants that have lost the URA3 gene.

URA3 Tagged gene

VF VR

A.

Tagged gene

VR VF

(b)

Gene Expected product size

GCD1 (untagged gene)

a GCD1-4XFLAG-URA3dpl200

b GCD1-4XFLAG-dpl200

520 bp

2400 bp

1000 bp

600

800

1000

1500

2000

2500

3000

400

600

800

1000

1500

Untagged allele

URA3

looped

out

Untagged

allele

1st round of transformation

After 5OA wt transformants

B.

a

b

(a)

159

Figure 4.12 Verification of genomic C-terminal 4X FLAG

tagging of the second allele of GCD1 in CAI4 strain. A.

Agarose DNA electrophoresis of PCR products generated by

amplification of genome extracts. Product sizes are as presented

in Figure 4.9. B. Immunoblots on extracts generated from the

indicated strains. Immunoblots were probed with antibodies

generated against Flag protein. (1/2 and 2/2 refer to one and two

alleles of genes tagged with 4xFLAG epitope).

2500

3000

2000

1500

1000

800

600

400

200

WT

(untagged) 1st allele

1st & 2nd

allele

1st allele after

URA3 removal

Untagged

copy

A

M WT 1/2 1/2 2/2

Gcd1p-4xFlag

Tef1p

B

40

30

25

50

60

80

100

160

161

4.2.5.4 FLAG affinity purification of eIF2B for analysis by mass spectrometry

Protein extracts were made from cultures of the Flag-tagged strain and an untagged

strain and affinity purified using a modification of the FLAG affinity purification

method (Mohammad-Qureshi et al. 2007). In brief, extracts were incubated with a

Flag-agarose resin, washed and bound proteins were eluted using a Flag peptide (for full

purification methodology see Materials and Methods, section 2.3.10). The purified

proteins were separated by SDS PAGE alongside whole cell extract samples from the

tagged and untagged strains and visualized by staining with coomassie blue (Figure

4.13). From the gel, some of the protein bands are of the correct size for subunits of

eIF2B. In particular, it seems possible that the bands at ~80kDa and ~55kDa could be

eIF2B and eIF2B, especially given that eIF2B is the tagged subunit and work across

eukaryotes has shown that this subunit forms a catalytic sub-complex with eIF2B

(Koonin 1995).

In order to clarify which eIF2B subunits were present in the samples,

immunoprecipitated samples were briefly run into an SDS PAGE gel, stained and

protein bands were excised from the gel and analysed by mass spectrometry. Table 4.1

shows that eIF2B subunits were enriched in the sample, as shown by the number of

peptides present in samples generated from the tagged strains relative to untagged. In

particular, the eIF2B and subunits, which are known to form the catalytic sub-

complex, are heavily enriched in the tagged samples. Therefore, these data shows that

the double tagging of the two GCD1 alleles with 4xFLAG epitope has successfully

allowed at least a sub-complex of eIF2B to be purified.

The initial goal of the eIF2B purification was to ascertain whether treatment with 1%

(v/v) butanol affected either the level of the eIF2B subunits or the interaction of the

eIF2B subunits with other factors. To this end, Flag affinity chromatography was

carried out on protein extracts from the Flag tagged strain either untreated or from a

162

culture to which 1% (v/v) butanol had been added for 15 min. The resulting purified

proteins were run a little into SDS PAGE gel and protein bands were excised then

analysed by mass spectrometry. Table 4.2 shows that butanol did not have any

observable effect on the level of the eIF2B subunits as the level of the subunits

remained the same in the untreated and the 1% (v/v) butanol treated samples.

Table 4.1 Identification of the eIF2B subunits by mass spectrometry (MS) analysis

Identified proteins (45/56) Mol.

weight

NE1 NE2

untagged tagged

Orf19.407 GCD6 82kDa 3 50

Orf19.481 GCD1 54kDa 2 31

Orf19.6776 GCD2 56kDa 3 7

Orf19.6904 GCN3 35kDa 4 3

Orf19.825 GCD7 41kDa 4

The values shown are the exclusive peptide count indicating the

confidence of the identification. It can be seen that there are

significantly more peptides identified in sample NE2 for GCD6

and GCD1 indicating these proteins are enriched in sample NE2

relative to sample NE1.

50kDa

60kDa

80kDa

40kDa

30kDa

25kDa

1/2 2/2

input eluate

2/2 1/2

Mol. weight eIF2B subunits Gcd6 ɛ 81.9kDa

Gcd2 δ 55.9kDa Gcd1 γ 54.3kDa

Gcd7 β 41.0kDa Gcn3 α 35.1kDa

Figure 4.13 FLAG affinity purification of eIF2B. Coomassie

stained gels of FLAG affinity purified eIF2B from strains bearing

one copy of the 4xFLAG tag and strains bearing two copies of the

4xFLAG tag.

C. albicans eIF2B

subunits protein extracts

163

164

Table 4.2 Quantitave measure of the total spectrum counts shows that the levels of

the various eIF2B subunits were not altered by butanol treatment

Identified proteins Mol weight untreated treated

Orf19.407 GCD6 84kDa 269 298

Orf 19.481 GCD1 54kDa 202 254

Orf 19.825 GCD7 41kDa 4 4

Orf 19.6776 GCD2 56kDa 0 6

The values shown are the total spectrum count of each protein, which

includes data from peptides that have been analysed multiple times and is the

most relevant value for relative quantification. To be considered significant,

there needs to be a difference of at least 2-fold change and an absolute

difference of 10 peptides between conditions.

165

4.3 Discussion

The data presented in this chapter show that fusel alcohol and ethanol most likely

inhibit protein synthesis in a mechanism that involves the regulation of eIF2B, whereas

farnesol appears to act via a different pathway. Firstly, ethanol and fusel alcohols both

induce in a Gcn2p independent manner the translation of GCN4 mRNA. This assay is

often used as an in vivo indicator of ternary complex alterations and the guanine

nucleotide exchange reaction facilitated by eIF2B is critical for ternary complex

formation. On the other hand, farnesol has no effect on the translational activity of

GCN4 mRNA. Additionally, fusel alcohols impede the movement of the eIF2B body by

about 50% compared to the untreated sample, while farnesol had no apparent effect on

these dynamics.

In an effort to characterise the impact of fusel alcohols on eIF2B a biochemical strategy

was used to purify the eIF2B subunits from C. albicans by tagging the two alleles of

GCD1 with a 4xFLAG epitope tag. While subunits of eIF2B were identified in the

purifications, little evidence for changes in subunit abundance or covalent modifications

of eIF2B as a response to fusel alcohols was obtained. However, the peptide coverage

of the eIF2B complex was sparse, especially for the eIF2Bα, β and δ subunits, which

form the regulatory sub-complex; so any alteration to a specific covalent modification

on eIF2B might easily have remained undetected.

The response of C. albicans to butanol treatment is therefore similar to what has been

observed in S. cerevisiae. For instance, using a GCN4-LacZ reporter construct in S.

cerevisiae, (Ashe et al. 2001), showed that butanol induces the expression of GCN4

mRNA independently of the Gcn2p kinase. Interestingly, in C. albicans, treatment with

4-6% ethanol also elicits a similar response to butanol, whereas farnesol does not seem

to induce the translation of GCN4 mRNA, highlighting the difference between the

action of farnesol and the other alcohols.

166

In S. cerevisiae, eIF2B is present in a large cytoplasmic body termed the ‘eIF2B body’

(Campbell et al. 2005). While the integrity of this body is not affected by butanol, the

dynamics of its movement around the cytoplasm are significantly reduced. In mutants

that are resistant at the level of growth and translation to butanol, either the eIF2B body

is absent or its movement is unaffected by butanol (Taylor et al. 2010). In the data

presented here, C. albicans was also shown to harbour an eIF2B body and its movement

was significantly reduced by butanol. Once again this suggests that the regulation of

eIF2B to inihibit translation as a response to fusel alcohols is conserved between S.

cerevisiae and C. albicans. In contrast, to the results with fusel alcohols, neither the

ability of eIF2B to localise to the eIF2B body nor the dynamics of the body are affected

by farnesol. Similarly, in S. cerevisiae other stresses that are known to inhibit

translation initiation, such as amino acid or glucose starvation, do not affect either the

integrity or movement of the eIF2B body (Taylor et al. 2010).

Previously, it has been suggested that the function of the eIF2B body could be to

provide a concentrated site of guanine nucleotide exchange. This hypothesis was

supported by FRAP data showing that eIF2 shuttles through the body but that the rate of

shuttling in response to stresses targeting eIF2B, such as amino acid starvation, decrease

this shuttling (Campbell et al. 2005). The mechanism by which the eIF2B body moves

through the cell under normal conditions is not well understood, however one

possibility is that a concentrated core of eIF2B moves through the cell by simple

diffusion from areas of low to high eIF2.GDP. The decrease in eIF2B activity seen in

response to butanol could be due to the inhibition of movement of the eIF2B body or

alternatively the decrease in the movement of the eIF2B body may be the consequences

of a decrease in eIF2B activity. For example if movement of the eIF2B body was

dependent in some way on eIF2B activity, a reduction in eIF2B activity in response to

butanol would lead to a decrease in eIF2B body movement.

167

Overall, it appears in C. albicans that butanol targets eIF2B to cause an inhibition in

translation initiation. However, the biochemical purifications do not reveal how this

regulation is brought about. For farnesol, it seems that the regulatory mechanism is

distinct from that of the other alcohols and does not appear to act via eIF2B or the

regulation of ternary complex.

168

5 Farnesol inhibits translation initiation in Candida albicans in a

pathway that targets some aspect of 48S preinitiation complex

formation

5.1 Introduction

The isoprenoid alcohol, farnesol, a C. albicans cell-signalling molecule that participates

in the control of morphology also affects protein synthesis at the level of translation

initiation in a Gcn2p-independent manner (as shown in chapters 3 and 4). So a gcn2Δ

mutant was equally responsive to the effects of farnesol both in S. cerevisiae and in C.

albicans. However while other alcohols such as butanol cause an up-regulation of

GCN4 translation by inhibiting the activity of the eukaryotic initiation factor 2B (Ashe

et al. 2001), farnesol does not lead to the translational up-regulation of GCN4.

Seemingly then, farnesol does not appear to target eIF2B to cause an inhibition in

translation (see chapter 4)

Highly conserved mechanisms allow eukaryotic cells to globally reduce the level of

protein synthesis (Jackson et al. 2010). Besides the key eIF2B control, another step

where translation initiation is regulated across eukaryotes is at the mRNA selection

stage (Pavitt 2005; Richter and Sonenberg 2005; Wek et al. 2006).

The selection of mRNA relies on the interaction of a closed loop complex on the mRNA

with the 43S complex to form the 48S preinitiation complex and this requires protein-

protein interactions between components of the closed loop and 43S complexes

(Jackson et al. 2010). A number of stress conditions have been shown to affect the

formation of the 48S preinitiation complex. For instance in S. cerevisiae, glucose

starvation leads to a loss of eIF4A from the translation initiation machinery and

translational inhibition at a step after 48S complex formation (Castelli et al. 2011).

Furthermore, one of the yeast eIF4E binding proteins, Eap1p was also shown to be

involved in global mechanism targeting translation initiation as a result of oxidative

stress (Mascarenhas et al. 2008).

169

The mechanism by which farnesol acts on the translational machinery is currently

unknown. Though Uppuluri et al. (2007), reported a down regulation of genes regulated

by Gcn4p following treatment with 40µM of farnesol, and the level of the transcription

factor ATF4 is increased in human lung carcinoma H460 cells treated with farnesol (Joo

et al. 2007). Both of these effects could relate to transcriptional regulation, but might

also be explained by effects of farnesol on translational regulation. As farnesol does not

appear to regulate translation via eIF2B, the most logical next step in the translation

initiation pathway to investigate is the formation of 48S preinitiation complex.

5.2 Results

5.2.1 MLY61 strain of S. cerevisiae exhibited similar translational responses to

fusel alcohol and farnesol as C. albicans

One of the limitations of molecular studies in C. albicans is that many of the reagents

for protein studies are not readily available. For instance, while many of the antibodies

for studies on protein synthesis are available for the model yeast, S. cerevisiae, most of

these antibodies do not cross react with C. albicans translation factors and hence are not

suitable for the study of protein synthesis in C. albicans. Therefore, in order to further

investigate the step in the translation pathway that is targeted by farnesol, a decision

was made to work initially in S. cerevisae. The MLY61 strain of S. cerevisiae is a wild

type a/α diploid of Ʃ1278b genetic background (Lorenz et al. 2000). The MLY61 strain

was selected for this investigation, as like C. albicans it is a diploid yeast that forms

pseudohyphae in the presence of butanol. However, in order to validate the use of this

strain, we first needed to compare the effects of farnesol on translation initiation in

MLY61 and C. albicans using a range of translation assays.

170

The sensitivity of the MLY61 S. cerevisiae strain to both butanol and farnesol was

investigated using polysome analysis. Similar to the C. albicans CAI4 strain, the

MLY61 S. cerevisiae strain was sensitive to butanol at 2% (v/v) and to farnesol at a

concentration of 100µM (Figure 5.1). Furthermore, an investigation of the impact of

these alcohols on the levels of phosphorylated eIF2α revealed a similar pattern of

dephosphorylation in the S. cerevisiae MLY61 strain to that observed in C. albicans

following treatment with 2% butanol or 100µM farnesol after preatreatment with CdSO4

to induce initial phosphorylation (Compare Figure 5.2 with Figures 3.11 and 3.13). As

both the inhibition of translation initiation and the dephosphorylation of eIF2α in S.

cerevisiae and C. albicans is similarly dependent on the dose of butanol or farnesol, it

seems reasonable that the translational responses to butanol and farnesol are

mechanistically conserved across these species.

Figure 5.1 Translational initiation is inhibited by farnesol similarly

in CAI4 strain of C. albicans and MLY61 strain of S. cerevisiae.

Polysome analysis was used to assess the effect of farnesol on

translation initiation a CAI4 and MLY61 strain. Yeast were grown in

YPD and various concentrations of farnesol were added as indicated for

15 min prior to extract preparation. Extracts were sedimented on 15-

50% sucrose gradients and the absorbance at 254nm was continuously

measured.

MLY61

ut 40μM 100μM 200μM 300μM

CAI-4

ut 40μM 100μM 200μM 300μM

171

MLY 61

Figure 5.2 Butanol and farnesol cause a dose dependent decrease in

eIF2α serine 51 phosphatase (eIF2α-P) in the wild type S. cerevisiae

MLY 61 strain. Protein extracts from the wild type were blotted and

probed with antibodies to Tef1p and a phosphospecific antibody to

phosphoserine 51 on eIF2α. Strains were grown in YPD to OD600 of 0.7,

treated with 1mM Cadmium for 1 h. Various concentrations of butanol

(v/v) or farnesol (µM) were then added for 15 min after which protein

extracts were made.

Cd2+ pretreatment

Butanol

30 min exposure

UT 2% 0% 0.5% 1% 2%

- - + + + +

Phospho-eIF2αp

Tef1p

Phospho-eIF2α

Farnesol (µm)

Phospho-eIF2α 10 min exposure

30 min exposure

UT 300 0 40 100 200 300

- - - + + + +

Tef1p

Cd2+ pretreatment

172

173

5.2.2 Farnesol causes resedimentation of specific translation factors in MLY61

strain of S. cerevisiae

The ‘formaldehyde-polysome’ method has been used previously for analysing

translation complexes involved in the initiation stage of protein synthesis within the cell

(Nielsen et al. 2004; Hoyle et al. 2007; Castelli et al. 2011). Here cross-linking with

formaldehyde prior to cell lysis ensures that protein factors are maintained in complexes

during the subsequent polysome analysis (Figure 5.3). This stabilisation of weakly

interacting proteins allows the resolution of complexes that might otherwise be

disrupted by cellular lysis and sedimentation.

Mid log phase MLY61 S. cerevisiae cells grown in YPD were analysed using this

formaldehyde-polysome analysis. Continuous A254 measurements reveal polysome

profiles similar to those obtained using the more classical cycloheximide-dependent

polysome profiling technique (compare Figure 5.1 and Figure 5.4). Similarly, the

treatment of the cells with 100µM of farnesol for 15 min caused the same degree of

polysome run-off that was observed previously. The gradients were separated into

fractions, which were used for the production of protein samples for Western blotting

(Figure 5.3). These blots were probed using specific antibodies for S. cerevisiae

translation initiation factors.

It was noted that across the gradients the degree to which the eIF4G associates with the

small ribosomal subunit (40S) decreases early after farnesol treatment (Figure 5.4

fractions 1-3 untreated and 100 µM farnesol). In previous studies from our laboratory,

glucose starvation caused an accumulation of eIF4G in this region of the gradient at

early time points, whereas longer stress periods caused eIF4G and other components of

the closed loop complex to fall away from the ribosomal subunits to the top of the

gradient (Hoyle et al. 2007; Castelli et al. 2011).

174

During translation initiation the eIF4F factors (eIF4E, eIF4G and eIF4A), the mRNA

and Pab1p are thought to form a closed loop complex (Wells et al. 1998) and promote

formation of the 48S preinitiation complex. The data presented here for farnesol suggest

that this alcohol causes an alteration in protein-protein interactions that lie upstream of

48S complex formation. It is entirely possible that the observed depletion of eIF4G

results in reduced 48S formation resulting and an inhibition of translation initiation.

Figure 5.3 Protocol overview for formaldehyde

crosslinking

Grow to mid-log

phase.

Exposed to environmental

stress or untreated and

crosslinked with

formaldehyde

Lysed by vortexing/

RNA extraction

Western analysis

Seperation of fractions

along 15-50% sucrose

gradients by

centrifugation at

40,000rpm for 2.5 hours

1 2 3 4 5 6 7 8 9 10 11 12 13 14 15

Run on polysome machine

and collect fractions

TCA precipitation

15%

50%

175

1 2 3 4 5 6 7 8 9 10 11 12 13

40s

80s

60s

polysomes

untreated

40s

80s

polysomes

60s

1 2 3 4 5 6 7 8 9 10 11 12 13

eIF4G (118kDa)

eIF4E (24.2kDa)

Rps3 (16.5kDa)

Figure 5.4 Farnesol affects the association of the specific translation

factors with the ribosomes.

Sucrose density gradient analysis on extracts from strain MLY61 treated

with 100µM farnesol for 15 min. Immunoblots on gradient fractions probed

using antibodies against the indicated proteins are shown below the traces.

100µM farnesol

176

177

5.2.3 Tandem affinity purification (TAP) of eIF4G1

In order to further investigate how farnesol affects the formation of the 48S complex

and investigate how eIF4G becomes depleted from this region of a polysome gradient,

we undertook a modified tandem affinity purification strategy using TIF4631-TAP

(eIF4G1-TAP) tagged strain of S. cerevisiae.

The TAP method was developed by the Seraphin lab to allow the affinity purification of

specific proteins from whole cell extracts (Puig et al. 2001). In this method extracts are

sequentially passed over an IgG column, then eluted with Tev protease and further

purified on a Calmodulin column. In our lab a minimised form of this purification,

where just the first column is used and elution relies upon a peptide (Castelli et al.

2011). This minimises the time of incubation preserving weaker interactions. This

method was used to purify eIF4G1-TAP and eIF4E-TAP from S. cerevisiae strains

where the endogenous genes are TAP-tagged. Affinity purified and input samples were

analysed by Western blotting using antibodies against Rps3p. The rabbit HRP-

conjugated secondary antibody also detects the TAP-tagged protein by virtue of the

protein A moiety. The levels of Rps3p over background observed co-purifying with

either eIF4G or eIF4E remained similar in both the untreated and 100µM treated

samples (Figure 5.5A and B). Therefore, there was little evidence from this

immunopurification to support the reduced association of eIF4G with the 48S complex,

as observed on the formaldehyde sucrose density gradients. However, a substantial

contamination of the eluted samples with heavy and possibly light chain antibody

proteins was also observed (Figure 5.5A and B), which makes interpretation of these

data very difficult.

Therefore, in order to resolve whether farnesol leads to reduced 48S complex formation,

the experimental strategy was modified. Immunopurified samples from the eIF4G1-

TAP tagged strain of S. cerevisaie were analysed by mass spectrometry. Figure 5.6

178

shows that the relative number of peptides observed in these samples for eIF4G, eIF4E,

eIF4A and Pab1p; factors involved in the formation of the closed loop complex, were

largely unaffected by farnesol treatment. Interestingly, however, the number of peptides

recovered for the ribosomal proteins as well as eIF3, which are only associated with the

closed loop complex as part of the 48S complex or 80S complex is reduced dramatically

after farnesol treatment. These data support a model where farnesol targets the

formation of the 48S preinitiation complex to inhibit protein synthesis.

25

37

50

75

100

150

250

25

37

50

75

100

150

wt ut 100µM

farnesol

4G1-TAP

wt ut 100µM

farnesol

4E-TAP

wt ut 100µM

farnesol

eluate input

wt ut 100µM

farnesol

eluate input

Figure 5.5 Effect of farnesol on translation factors eIF4G and eIF4E

was not observed in immunoprecipitations.

Protein extracts were made from 1 litre cultures of strains harbouring the

(A) eIF4G-TAP or (B) eIF4E-TAP gene grown to mid-log phase. Purified

samples were resolved by SDS-PAGE and electroblotted onto

nitrocellulose membrane. Blots were probed with antibodies raised

against (A and B) Rps3.

A

B

protein Mol.

weight

eIF4G

-TAP

127kDa

eIF4E

-TAP

44.2kDa

Rps3p 26.2kDa

heavy chain

Rps3/light chain

179

0.7 0.75

0.7

0.92

0.7

0.02 0 0

0.18

0.3

0

0.36

0

0.16

0 0

0.17

0

0.11

0 0

0.1

0 0 0

0.2

0.4

0.6

0.8

1

1.2

UT 100µM Farnesol

Figure 5.6 Farnesol causes the depletion of ribosome associated

translation factors in immunoprecipitation of eIF4G1. Protein

extracts from eIF4G1-TAP tagged strain treated with 100µM farnesol

or untreated were resolved on SDS-PAGE gels, stained with coomassie

and sent for mass spectrometry. The figure shows no of unique

peptides that have been matched to the identified protein in the

sample. Untreated is normalised to 1, treated is fold change.

PAB,eIF4E,4G,4A eIF3 Small ribosomal subunits Large ribosomal subunits

Rel

ati

ve

no o

f u

niq

ue

pep

tid

es

180

181

5.3 Discussion

The studies presented in this chapter have shown that farnesol produced by only a few

species of Candida (Hornby et al. 2001), also has a repressive effect on protein

synthesis in yeast. Various studies into the effects of farnesol in other organisms have

revealed that farnesol impacts upon various developmental processes across Candida

species and other pathogenic fungi including Aspergillus spp. (Langford et al. 2009). In

addition, farnesol has also been shown to lead to cell-cycle arrest and growth inhibition

(Machida et al. 1999), increased ROS production and effects on mitochondria (Machida

et al. 1999), and cell death (Fairn et al. 2007). These effects have also been

demonstrated in C. albicans (Shirtliff et al. 2009). Dichtl et al. (2010) further suggest

that farnesol intereferes with the cell wall integrity pathway and many of the

components of this pathway are conserved across the fungal kingdom. Therefore, it is

perhaps not surprising to discover that farnesol similarly inhibited translation initiation

in the MLY61 strain of the budding yeast, S. cerevisiae (Figure 5.1). Equally this strain

showed a similar response to the effect of farnesol on eIF2α dephosphorylation as was

previously described for C. albicans (Figure 3.13 relative to Figure 5.2). In addition to

exhibiting similar translational responses to farnesol, some key physiological attributes

of MLY61 strain are similar to that of C. albicans (see section 5.2.1). These properties

of the MLY61 provide justification for its use to further elucidate the target of farnesol

in terms of the translational machinery.

Using the MLY61 strain, the mechanism by which farnesol elicits a global down-

regulation of translation initiation appears to involve alterations in the formation of the

48S preinitiation complex. There are precedents for regulatory mechanisms targeting

this step. For instance glucose starvation in yeast led to a decrease in eIF4E, eIF4G and

Pab1p cosedimentation with ribosomal components, which could be interpreted to mean

a decrease in the association between closed-loop complex and ribosomal species

182

(Hoyle et al. 2007). More recently Castelli et al. (2011) also showed that glucose

starvation in yeast leads to the loss of eIF4A from the eIF4G-containing preinitiation

complex explaining the resulting translational inhibition. Therefore, the effects of

farnesol that are described above, suggest that any alteration in the formation of the 48S

complex or its interaction with the mRNA ultimately leads to rapid inhibition of

translation at the initiation stage.

Data from mass spectrometry analysis of the eIF4G affinity purified samples also

provided significant insight into the physiological consequences of farnesol treatment.

A significant number of proteins were differentially present in the affinity purified

eIF4G as demonstrated by the peptide count (Figure 5.6). While the factors of the

closed-loop complex (eIF4A, eIF4G, eIF4A and Pab1p) remain similar in level,

anything associated with the ribosome goes down. Given that the closed loop complex

is perceived to be associated with high levels of translation initiation and, therefore, is a

target for translational regulation (Richter and Sonenberg 2005), these observations

suggest that farnesol targets the association of the ribosome with the mRNA, most

likely at the 48S preinitiation complex formation step of translation initiation.

183

6 RNA sequencing reveals a global change in gene expression following

treatment with farnesol in C. albicans

6.1 Introduction

The previous results chapters have revealed that farnesol inhibits morphological growth

as well as protein synthesis at the level of translation initiation in C. albicans. The

global level of protein synthesis occurring in a cell can be investigated by carrying out

polyribosomal analysis. This technique can highlight the stage of translation that is

regulated (Ashe et al. 2001), but reveals nothing about the identity of the mRNAs that

are being translated under different conditions. Furthermore, it is well-established that

farnesol impacts upon the transcriptome of both C. albicans and S. cerevisiae, so an in

depth understanding of gene regulation requires both the transcriptional and

translational impact of farnesol to be monitored at the level of individual genes and

mRNAs.

The recently developed RNA sequencing (RNA-seq) technology is revolutionizing our

ability to analyse transcriptomes (Wang et al. 2009). It is based on next-generation

sequencing platforms that were initially developed for high-throughput sequencing of

genomic DNA (Westermann et al. 2012). Previously, both microarray analysis and

RNA sequencing have been applied in the analysis of differential gene expression in

hyphae and biofilm formation by C. albicans cells exposed to farnesol (Cao et al. 2005;

Uppuluri et al. 2007; Nobile et al. 2012). RNA-seq technology generates data that is

more reproducible and sensitive than the various microarray platforms, therefore

resulting in more accurate measurements in gene expression changes (Xiang et al.

2010). Moreover the gene expression studies previously undertaken in C. albicans

following farnesol treatment only considered the transcriptional landscape. In this

chapter, RNA-seq has been used to analyse the impact of farnesol treatment at both the

transcript and translation level. The data revealed that mRNAs involved in oxidative

stress and translation were upregulated, while mRNAs involved in positive regulation of

184

filamentation were downregulated. Furthermore, farnesol appears to co-ordinately

regulate the genes involved in these processes, either affecting their transcription or

translation; or sometimes leading to reciprocal regulation of these processes.

6.2 Results

6.2.1 RNA isolation from input and polysome samples

To study the transcriptional and translational impact of farnesol on C. albicans, cell

extracts were made from exponential C. albicans cultures either untreated or treated

with 100M farnesol for 15 min. From these, total and ribosome associated RNA

samples were generated. RNA purified from polysome-associated fractions from across

a polysome sucrose gradient was used as the ribosome associated RNA. This procedure

is outlined in figure 6.1 and was performed in triplicate.

6.2.2 Enrichment of mRNA and processing of enriched sample for RNA

sequencing

It is often necessary to enrich specific classes of RNA in the samples to be sequenced.

Total RNA recovered by cell lysis and extraction with organic solvents (trizol) consists

of at least 80% ribosomal RNA (Raz et al. 2011), so if rRNA were not removed, the

majority of the final sequence reads would be from rRNA. Therefore, in order to deplete

rRNA from the RNA samples, a method was adopted where non-target RNAs were

removed by hybridization. Although selection of target RNA via hybridization to oligo-

dT was the preferred method for mammalian systems, yeasts, including C. albicans

mRNA have shorter poly(A) tails than mammalian mRNAs (Keller and Minvielle-

Sebastia 1997), therefore hybridization to oligo-dT is not suitable for enriching yeast

mRNA for sequencing. Furthermore while the use of oligo-dT to recover mature

185

mRNAs reduces the proportion of RNA classes that do not have long poly-A stretches,

removal of ribosomal sequences via hybridization preserves non-polyadenylated RNAs

allowing one to investigate broader classes of RNAs.

The mRNA enrichment protocol used in this study is ribodepletion using the Ribo zero

rRNA removal kit (Epicentre, Illumina). This technique uses oligos that are

complementary to highly conserved ribosomal RNA sequences to bind and remove the

rRNA. As shown in Figure 6.2, the ribodepleted RNA samples were then fragmented

and converted to double stranded cDNA. Sequencing adapters were then ligated to both

the 3′ and 5′ ends of the double stranded cDNA and subsequently the cDNA library was

amplified by PCR using a primer cocktail that anneals to the ends of the adapters

(Illumina). The cDNA library was validated to check the purity of the sample by

running 1µg of sample on a DNA chip and then sequenced using high-throughput

illumina Hiseq sequencing.

Polyribosome separation

Total transcript

Level sequencing

Fractionated sample

sequencing

Bioinformatic Analysis

control

100µM

farnesol

control stress

Figure 6.1 Strategy of experiment for RNA sequencing of

polyribosomal fractions. Yeast were grown in YPD and treated with

100µM of farnesol or untreated for 15 min prior to cycloheximide

addition and extract preparation. Extracts were split into input and

polyribosomal fractions. Following polyribosome separation and RNA

extraction, the samples were ribodepleted and sent for illumina Hiseq

sequencing.

186

Figure 6.2 Flow chart for RNA sequencing Cells were grown to OD600 of

0.7 and treated with 100µM farnesol or untreated. Input and polysome

fractions from treated and untreated samples were processed for RNA. The

RNA samples were ribodepleted using Ribo zero kit and the purity checked

with Agilent Bioanalyzer. Ribodepleted samples were sent to the Genomic

facility of the University of Manchester for DNA library generation,

sequencing and initial analysis of sequencing data.

Polyribosomal

separation

RNA precipitation with trizol

Illumina deep

Sequencing

Ribodepleted

RNA

Fragmentation

Convert to cDNA and

add sequencing adapters

PCR and validate

Library

Fragmented RNA

DNA Library

Data

analysis

Purify RNA

187

188

6.3 Analysis of gene expression from the sequencing data

The sequencing data was analysed as described in materials and methods, section

2.9.4.3. RPKM (reads per kilobase per million mapped reads) values were determined

for all genes in each of the conditions tested. In order to assess the sequencing reads

mapping to different RNA types in the samples. Mapped reads per million per base pair

of RNA types in the sequenced data was calculated. The data as shown in table 6.1

suggests that the fractionation has been successful and gives evidence that the different

runs are reproducible. The input samples are highly enriched for the various RNA

species (snoRNA, ncRNA, tRNA and snRNA) compared to the polysome fractions

where these RNAs are more depleted.

Table 6.1 The depth of coverage per million sequenced reads for the RNA type.

Sample ID rRNA snoRNA ncRNA tRNA snRNA

InputUT1 20.6266 4.186745 11.85231 0.339016 15.87573

InputUT2 38.14159 3.136478 10.74961 0.290844 11.35054

InputUT3 21.94216 2.194619 10.24618 0.454221 7.34394

Input100uM-Farnesol1 39.14896 2.137437 12.54479 0.087663 9.903528

Input100uM-Farnesol2 42.3765 2.31221 14.19559 0.110736 10.62073

Polysome UT1 5.638171 0.705433 1.388306 0.010395 0.670995

Polysome UT2 2.697695 0.592301 1.062401 0.008674 0.592433

Polysome UT3 6.398139 0.880681 1.731622 0.013273 0.921996

Polysome 100uM-Farnesol2 8.23574 1.806252 2.371609 0.007332 2.010198

Polysome 100uM-Farnesol3 8.756714 2.041127 3.42422 0.009148 3.149637

This is the depth of coverage per million sequenced reads for the RNA type. The

mapped reads per million per bp of 𝑥RNA was calculated thus:

Reads mapping to 𝑥RNAs X 1,000,000/total reads in experiment.

The value was then divided by the total length of 𝑥RNAs in the genome

189

The normalisation to per million reads was done because the number of sequenced reads

varies from experiment to experiment.

In order to assess the impact of farnesol on gene expression, the sequencing data were

processed as described in materials and methods to generate two parameters: the change

in transcript level (log2[Total F/Total U]) and the change in translation state

(log2[polysome F/Total F]/log2[Polysome U/Total U]) following farnesol treatment. A

2-fold cut-off was applied to these ratios to define mRNAs that are significantly up

regulated or down regulated at the transcript level and/or at the translation level. At the

transcript level a total of 796 mRNAs were significantly altered, ≥2-fold with 330 up

regulated and 466 down regulated. In addition, at the translation level, a similar number

of mRNAs were significantly altered in their polysome association following treatment

with 100µM farnesol, ≥ 2-fold (477 up and 476 down) giving a total of 953 mRNAs that

were altered translationally. Scatter plots were used to visualise these data (Figure 6.3A

and B).

To further investigate the physiological consequence of farnesol treatment on C.

albicans, the Gene Ontology (GO) slim mapper (Candida Genome Database) tool was

used to provide functional classifications of the transcriptionally and translationally

altered mRNAs. This analysis revealed gene categories that were differentially altered.

Some of these gene categories exhibit responses at both transcriptional and translational

level, especially ‘the response to stress’, ‘translation’, ‘filamentous growth’, ‘cellular

respiration’, ‘cell cycle’, ‘signal transduction’ and ‘cytokinesis’. (Figure 6.3A,B and

6.4A and 6.4B).

Interestingly, as a functional class mRNAs involved in translation were upregulated

either transcriptionally or translationally. Given that in C. albicans farnesol inhibits

protein synthesis (see section 3.2.4) such that global protein production is repressed by

about 10-fold (see figure 3.6), the upregulation of mRNAs involved in translation may

190

serve as a feedback control mechanism. Such an idea has precedence in the literature:

for instance, under various stress conditions that inhibit global translation, cells up-

regulate the translation of specific mRNAs in order to overcome the inhibitory effect

(Natarajan et al. 2001).

Three other classes of mRNA were down-regulated at either the transcriptional or

translational level: those involved in filamentation, biofilm formation and cytokinesis

(Figure 6.4 A abd B). This observation perfectly correlates with the established effects

of farnesol on morphological transition and biofilm formation in C. albicans (Hornby et

al. 2001; Ramage et al. 2002; Uppuluri et al. 2007). Of particular interest is the effect of

farnesol on the TUP1 mRNA. Farnesol caused up-regulation of TUP1 mRNA at the

trancriptional level: an observation that has been made in previous studies using

microarrays (Cao et al. 2005; Kebaara et al. 2008). Tup1p is a transcriptional repressor

of filamentation genes, so the fact that the signalling molecule farnesol up-regulates this

gene is entirely consistent with the negative impact of farnesol on the transition to

filamentous growth in C. albicans. Other mRNAs that are required for morphological

differentiation were down-regulated transcriptionally by farnesol. For instance, mRNAs

encoding the secreted aspartyl proteinases (SAP8, SAP98), (also reported by Décanis et

al. (2011) and Cao et al. (2005)), the nucleotide phosphodiesterase (PDE1), the G-

protein receptor (GPR1), the transcription factor (TEC1,) and the adenylate cyclase

(CYR1). A complementary set of mRNAs that encode factors involved in filamentation

were down-regulated at the level of translation. For instance, mRNAs encoding the

cAMP dependent protein kinase catalytic subunit (TPK2), G-protein α subunit (GPA2),

agglutinins (ALS2 and ALS4) the transcriptional regulators (EFG1, FLO8 and CZF1)

Also the newly characterised gene, DEF1 or EED1, crucial for extension and

maintenance of filamentous growth and plays a role in epithelial cell escape,

dissemination in a tissue culture model and is regulated by Efg1p (Martin et al. 2011).

191

Interestingly, the EFG1 and EED1 mRNAs are translationally down-regulated along

with mRNAs involved in biofilm formation, cytokinesis and cell cycle. Farnesol

induced growth inhibition in S. cerevisiae cells has been characterised to consist of cell

cycle arrest concomitant with the downregulation of cell cycle gene expression

(Machida et al. 1999) . So the observation of the general downregulation of the mRNAs

involved in cytokinesis and cell cycle at the translation level could indicate that farnesol

affects cell cycle in C. albicans, as was previously observed in S. cerevisiae (Machida et

al. 1999). Also downregulation of mRNAs involved in signal transduction was observed

both at the transcriptional and translation level, this finding could be connected to the

effect of farnesol on filamentation. A puzzling aspect of the dataset is the fact that the

TUP1 mRNA appears translationally down-regulated even though transcript levels

increase. A further analysis of this mRNA is presented in section 6.5.

Among the mRNAs involved in stress response that were up-regulated transcriptionally

are those involved in oxidative stress response (SOD3, SOD4, SOD5, PRX1) and heat

shock proteins (HSP104, HSP12, HSP21 and HSP78) while the translation of the SOD4,

TRX1, and ATX1 mRNAs appears up-regulated. Farnesol has been shown to cause the

upregulation of proteins involved in protein folding and protection against

environmental and oxidative stress (Shirtliff et al. 2009). Exposure of cells to farnesol

causes the accumulation of reactive oxygen species (ROS) within 3 h (Shirtliff et al.

2009). Westwater et al. (2005) demonstrated that pre-treatment of C. albicans yeast cell

with farnesol led to increased survival to oxidative stress generated by H2O2 due to

increased expression of genes involved in oxidative stress resistance. C. albicans SODs

are the primary enzymatic antioxidants involved in protection against ROS (Zhu et al.

2011). Therefore, these data correlate well with the observation that farnesol induces the

up-regulation of mRNA involved in the oxidative stress response both at levels of

transcription and translation.

192

In addition, the upregulation of mRNAs involved in cellular respiration both at the level

of transcript and translation level could represent a response to the high levels of ROS

that have been described to result from farnesol treatment. For instance, the level of

ROS in farnesol-treated S. cerevisiae cells increases five to eight fold and this increase

was not observed in the respiration-deficient petite mutant ([rhoo]). These results

illustrate the role of the mitochondrial electron transport chain in facilitating growth in

the presence of farnesol (Machida et al. 1998).

Previous studies have shown that in response to stresses such as glucose starvation,

amino acid starvation and rapamycin treatment in S. cerevisiae (Castelli et al. 2011) a

specific subset of genes is co-regulated at both the transcriptional and the translational

level. This phenomenon has been termed ‘potentiation’ (Preiss et al. 2003). For the

farnesol experiments described here, however, only 6 such mRNAs were identified as

coregulated at both stages in the gene expression pathway, and many mRNAs were

increased transcriptionally while decreasing translationally (Figure 6.3A and B). One

possibility is that these transcriptionally induced mRNAs could serve as a store of

genetic material that could be rapidly mobilised should the cellular conditions improve.

Further analysis of these set of mRNAs using the CGD GO Slim mapper (Figure 6.4C)

shows that some of these mRNAs are those related to protein catabolic processes, drug

response, filamentation, stress response and biofilm formation: functions that are

consistent with the mRNA storage hypothesis.

Figure 6.3A Illumina Hiseq sequencing of input (total) RNA shows global

changes at the transcriptional level following farnesol treatment of C.

albicans culture. Figures show graphical plots depicting the transcript level

(log2[TF/TU]). A. Transcriptionally upregulated mRNAs in red and

transcriptionally downregulated mRNAs in green. A cutoff value of ±1.0 for

the change in transcript level was used. B. As A, except the mRNAs defined

as translationally regulated are highlighted on the plot: translationally up-

regulated in red and down-regulated in green.

Log

2 T

ota

l F

Log2 Total U

16.0

14.0

12.0

10.0

8.0

6.0

4.0

2.0

0.0 0.0 2.0 4.0 6.0 8.0 10.0 12.0 14.0 16.0

16.0

14.0

12.0

10.0

8.0

6.0

4.0

2.0

0.0 0.0 2.0 4.0 6.0 8.0 10.0 12.0 14.0 16.0

193

Log

2 [

Poly

som

e F

/Tota

l F

]

Figure 6.3B Illumina Hiseq sequencing of the input and polyribosomal

fractions shows global changes at the translation level following farnesol

treatment of C. albicans culture. Figure shows a graphical plots depicting the

change in translation state (log2[PF/TF]/log2[PU/TU]) following farnesol

treatment. A. Translationally upregulated mRNAs in red and downregulated

mRNAs in green. Cutoff value of 1.0 for the change in translation level was

used. B. As A, except the mRNAs defined as transcriptionally regulated are

highlighted on the plot: transcriptionally up-regulated in red and down-regulated

in green.

Log2[Polysome U/Total U]

194

0

5

10

15

20

25

30

org

anel

le o

rgan

isat

ion

tran

spo

rtR

esp

on

se t

o s

tres

sR

NA

met

abo

lic p

roce

sses

Re

spo

nse

to

ch

em

ical

Fila

me

nto

us

gro

wth

Pro

tein

mo

dif

icat

ion

pro

cess

esC

ell

cycl

eD

NA

met

abo

lic p

roce

ssR

esp

on

se t

o d

rug

Ve

scic

le m

edia

ted

tra

nsp

ort

Rib

oso

me

bio

gen

esis

Lip

id m

eta

bo

lic p

roce

ssC

arb

oh

ydra

te m

eta

bo

lism

Tran

slat

ion

Pat

ho

gen

esi

sP

rote

in c

atab

olic

pro

cess

Cyt

osk

ele

ton

org

anis

atio

nSi

gnal

tra

nd

uct

ion

Ce

ll w

all o

rgan

isat

ion

Ce

llula

r h

om

eo

stas

isB

iofi

lm f

orm

atio

nP

recu

rso

r m

etab

olit

es a

nd

…In

ters

pec

ies

inte

ract

ion

Ce

ll d

evel

op

men

tH

yph

al g

row

thC

yto

kin

esis

Ce

llula

r re

spir

atio

nP

rote

in f

old

ing

Thre

ad-l

ike

gro

wth

Co

nju

gati

on

Genes mapped to the GO Slim mapper

Total transcription up transcription down

Clu

ster

fre

qu

ency

Figure 6.4A Functional annotation of transcripts reveals differential

regulation of certain categories of genes. Data from RNA seq were

categorised based on differential regulation of transcription. The different

categories were annotated using the CGD Gene ontology Slim Mapper

according to functional categories for transcriptionally up and down regulated.

195

0

5

10

15

20

25

org

anel

le o

rgan

isat

ion

tran

spo

rtR

esp

on

se t

o s

tres

sR

NA

met

abo

lic p

roce

sses

Re

spo

nse

to

ch

em

ical

Fila

me

nto

us

gro

wth

Pro

tein

mo

dif

icat

ion

pro

cess

esC

ell

cycl

eD

NA

met

abo

lic p

roce

ssR

esp

on

se t

o d

rug

Ve

scic

le m

edia

ted

tra

nsp

ort

Rib

oso

me

bio

gen

esis

Lip

id m

eta

bo

lic p

roce

ssC

arb

oh

ydra

te m

eta

bo

lism

Tran

slat

ion

Pat

ho

gen

esi

sP

rote

in c

atab

olic

pro

cess

Cyt

osk

ele

ton

org

anis

atio

nSi

gnal

tra

nd

uct

ion

Ce

ll w

all o

rgan

isat

ion

Ce

llula

r h

om

eo

stas

isB

iofi

lm f

orm

atio

nP

recu

rso

r m

etab

olit

es a

nd

…In

ters

pec

ies

inte

ract

ion

Ce

ll d

evel

op

men

tH

yph

al g

row

thC

yto

kin

esis

Ce

llula

r re

spir

atio

nP

rote

in f

old

ing

Thre

ad-l

ike

gro

wth

Co

nju

gati

on

Genes mapped to the GO Slim mapper

Total Translation up Translation down

Clu

ster

fre

qu

ency

Figure 6.4B Functional annotation of genes at translational level reveals

differential regulation of certain categories of genes. Data from RNA seq

were categorised based on differential regulation of translation. The different

categories were annotated using the CGD Gene ontology Slim Mapper

according to functional categories for translationally up and down regulated.

196

0

2

4

6

8

10

12

14

16

Total transcription up/translation down

Figure 6.4C Functional annotation of mRNAs that are not

coregulated at the transcription and translation level.

mRNAs that were transcriptionally up regulated as well as

translationally downregulated were annotated according to

functional categories using the CGD Gene ontology Slim

Mapper.

197

198

6.4 Clarifying the translational regulation of TUP1 mRNA by q RT-PCR.

Of particular interest with regard to the impact of farnesol on filamentation is the

observation that TUP1 is up-regulated at the transcript level, yet appears down-

regulated at the level of translation. A quantitative real-time reverse transcriptase PCR

(qRT-PCR) analysis was used to further investigate the effect of farnesol on TUP1

mRNA across the polysome. The qRT-PCR data showed redistribution of the mRNA

from the polysomal region to the sub-polysomal region following treatment with

100µM farnesol (Figure 6.5). This agrees with the translational down-regulation of

TUP1 mRNA observed from the RNA-seq datasets. However, transcription of the TUP1

mRNA is increased 2.7-fold. It is possible this excess of mRNA in farnesol treated cells

is translated less well than the lower levels of mRNA in untreated cells simply as a

consequence of the overall level of mRNA. In this case, the transcriptional response

would play a more dominant role in determining the level of Tup1p protein in cells.

6.5 Validation of some of the transcriptional changes that are relevant to

filamentation and stress response using qRT-PCR

A qRT-PCR analysis was also used to further investigate the mRNAs that exhibited

altered profiles in the RNA-seq data at the transcript level. The analysis was performed

on a total of 6 genes and LUC mRNA was used as ‘spike-in’ control to allow

normalisation. TUP1 and EFG1 exhibited increased transcript levels following

treatment with 100µM farnesol, (Figure 6.6). PDE1 exhibited decreased transcript level,

whereas TRX1 and TIF4631 remained the same transcriptionally (Figure 6.6).

These data show that the trends evident in the RNA-seq datasets can be reproduced

using a qRT-PCR approach.

0

5

10

15

20

25

sedimentation

Untreated

Farnesol (100µM)

sedimentation

Sub-polysomal

Sub-polysomal

Polysomal

Polysomal

Figure 6.5 Farnesol causes redistribution of TUP1 mRNA from the polysome

to the submonosomal fraction. RNA was extracted from polyribosomal

fractions from A untreated sample and B sample treated with 100µM farnesol.

qRT-PCR was carried out on the cDNA samples using CFx Connect Real-Time

system with iTaq Universal SYBR Green Supermix (BioRad Laboratories). C

Percentage of mRNA in the monosome versus polysome fractions was quantified.

Error bars indicate ± SE.

0

5

10

15

20

% o

f m

RN

A

% o

f m

RN

A

A

B

40S 60S

40S 60S

80S

80S

0

10

20

30

40

50

60

70

80

90

100

untreated 100µMFarnesol

subpolysomal

polysomalC

% o

f R

NA

in

sam

ple

s

polysomes

polysomes

199

Figure 6.6 Verification of gene expression analysis by

quantitative real-time PCR (qRT-PCR). Data generated by RNA-

seq was plotted with calculations done for the same gene using qRT-

PCR. Values shown for the qRT-PCR are the means of three

determinations and error bars indicate ±SE.

200

-4

-3

-2

-1

0

1

2

3

4

5

TUP1 EFG1 PDE1 TIF4631

RNA seq

qRT-PCR

201

6.5 Discussion

C. albicans responds to farnesol, in part, by changing gene expression (Cao et al. 2005).

Extensive studies on the effects of farnesol on hyphal growth and biofilm formation

have generally focussed on the levels of mRNA transcripts (Cao et al. 2005; Cho et al.

2007; Uppuluri et al. 2007). However, as shown in Chapter 3, farnesol also impacts on

protein synthesis. Therefore in order to elucidate the likely impact of farnesol on cells

and provide insight into gene expression changes at both the transcript and translation

level following farnesol treatment, a global high throughput RNA sequencing analysis

of total and polysome associated RNA was undertaken.

RNA-seq analysis of C. albicans cells exposed to 100µM farnesol revealed a significant

number of mRNAs to be differentially expressed at the transcript and differentially

polysome associated. Most notable among the down-regulated mRNAs at both the

transcript (SAP8, SAP98, PDE1 GPR1, TEC1, CYR1) and polysome association (TPK2,

EFG1, FLO8, GPA2 CZF1, NDT80, DEF1, ALS2,ALS4) are those that play positive

roles in filamentation, and also biofilm formation reflecting the effect of farnesol as an

inhibitor of filament formation in C. albicans. This is consistent with previous findings

that farnesol prevents hyphal formation in a dose dependent manner (Hornby et al.

2001; Ramage et al. 2002). The results provide evidence that several hyphal associated

genes are differentially expressed both at the transcriptional and translational level. The

concept of potentiation was first described by Preiss et al. (2003) for S. cerevisiae.

Potentiation was not observed from the RNA seq data of the transcript and translation

state following farnesol treatment in C. albicans. Rather genes appear to be either

transcriptionally or translationally controlled. This perharps provides a flexible and co-

ordinated way to regulate the response to farnesol. Interestingly, TUP1 was observed to

be up-regulated at the level of transcription and it seems this may dominate over a

down-regualtion in polysome association. TUP1 encodes a global transcriptional co-

202

repressor. Deletion of the TUP1 gene causes hyper-filamentation under conditions that

favour yeast growth (Braun et al. 2000), therefore up-regulation of TUP1 may

contribute to the inhibition of filament formation in C. albicans.

mRNAs involved in protein synthesis were observed to be up-regulated both at the

transcriptional and at the level of polysome association. One possibility is that up-

regulation of the protein synthesis gene expression would serve an adaptive role

allowing cells to overcome the impact of farnesol as a translational inhibitor.

Overall, mRNAs involved in the response to stress were down-regulated, however,

some key mRNAs involved in the response to oxidative stress were up-regulated. This

is consistent with the observation that farnesol induces mild levels of oxidative stress in

C. albicans (Shirtliff et al. 2009; Zhu et al. 2011). Therefore, up-regulation of these

mRNAs could suggest that the farnesol treated cells are experiencing a specific

oxidative stress response and this could also account for the upregulation of mRNAs

involved in cellular respiration both at the level of transcript and translation level.

Overall, the results presented in this chapter suggest that as for many other stresses or

stimuli, the response to farnesol involves co-ordinate regulation of gene expression at

both the transcript level and at the level of translational control. Such a co-ordinated

response provides cells with greater flexibility in terms of the targeted regulation of

specific pathways or processes.

203

7 General discussion

A range of alcohols have been described as signalling molecules or metabolic end-

products across a variety of yeast species (Hornby et al. 2001; Chen et al. 2004; Chen

and Fink 2006). The aim of this research at the outset was to characterise the impact of

these alcohols on protein synthesis and filamentation in the pathogenic yeast species

Candida albicans. Once it became apparent that these alcohols all inhibit protein

synthesis yet have grossly different effects on filamentation, the precise mechanisms by

which these alcohols act became a priority study area.

The regulation of protein synthesis at the translation initiation stage, allows cells to

promptly modify protein levels and adapt to cellular stress. Previously it has been

shown that the target of fusel alcohols in S. cerevisiae is the eukaryotic initiation factor

2B, which is the guanine nucleotide exchange factor for eIF2 (Ashe et al. 2001; Taylor

et al. 2010). eIF2B has also been implicated in the translational inhibition caused by a

variety of cellular stress conditions such as amino acid starvation (Dever et al. 1992);

purine starvation (Rolfes and Hinnebusch 1993) and rapamycin (Kubota et al. 2003).

However, while these cellular stresses target eIF2B in a Gcn2p-dependent manner, the

mechanism by which fusel alcohols target eIF2B to inhibit translation initiation in S.

cerevisiae is Gcn2p-independent. The effect of fusel alcohols on translation initiation in

the human fungal pathogen, C. albicans therefore forms a key part of this thesis.

Another key regulated step in translation initiation is the formation of the 48S

preinitiation complex. eIF4E and Pab1p select mRNA via interaction with the 5ʹ cap and

3ʹ poly(A) tail, respectively. eIF4G interacts with both factors, promoting a closed loop

mRNP (Sachs 2000), which recruits the small ribosomal subunit via interactions with

eIF3, eIF5 and eIF1 to form the 48S preinitiation complex. A variety of stress

conditions have been shown to target these steps in the initiation pathway leading to

204

translational shut-off: for example glucose starvation (Hoyle et al. 2007) and

inactivation of mammalian target of rapamycin (Richter and Sonenberg 2005).

Investigations in this thesis into the impact of farnesol, a quorum sensing alcohol,

showed that farnesol caused an inhibition of translation initiation by a mechanism that

did not target eIF2B. Furthermore, mass spectrometry studies suggest that farnesol

targets formation of the 48S preinitiation complex. Finally, the consequences of farnesol

regulation in terms of both transcription and translation were investigated using next

generation sequencing technologies. These data suggest a co-ordinate regulation of

individual genes involved in processes such as filamentation and stress responses,

where genes are regulated either at the level of transcription or translation but not both,

or individual genes are reciprocally regulated such that when transcription is high

translation is low and vice versa.

7.1 Alcohols inhibit translation initiation in C. albicans in addition to exerting

opposing effects on growth morphology

After the initial observation that a variety of alcohols lead to the inhibition of translation

initiation (albeit at different concentrations) in C. albicans, a key question related to

how the alcohols were exerting these effects. A variety of stresses across eukaryotic

organisms lead to the inhibition of translation initiation via the activation of an eIF2

kinase. Like S. cerevisiae, C. albicans harbors a single eIF2 kinase, Gcn2p. This

kinase phosphorylates the α subunit of eIF2 in response to a range of stress conditions

including amino acid starvation in S. cerevisiae and the oxidative stress caused by the

addition of Cadmium in C. albicans (Sundaram and Grant 2014). Phosphorylated eIF2α

interacts tightly with and sequesters eIF2B causing it to become limiting and this is

ultimately inhibitory to protein synthesis. Even though fusel alcohol-dependent

205

translational inhibition in S. cerevisiae appears to target eIF2B, the process does not rely

upon Gcn2p or eIF2 phosphorylation (Ashe et al. 2001). So, both the SUI2 S5IA

strain, which is translationally resistant to amino acid starvation, and a gcn2Δ mutant

were still inhibited at the translational level by the addition of butanol (Ashe et al.

2001). Similarly in the present study, the CAI4 and gcn2Δ mutant strains of C. albicans

are both completely sensitive to butanol, farnesol and ethanol (Figures 3.6, 3.7, 3.8),

showing that the inhibition of translation initiation by alcohols in C. albicans does not

require the eIF2 kinase pathway. However, eIF2B has been demonstrated to be a key

player in the fusel alcohol response in S. cerevisiae. Firstly, various eIF2B mutants have

been shown to exhibit butanol-dependent phenotypes (Ashe et al. 2001; Richardson et

al. 2004; Taylor et al. 2010). Secondly, the level of a ternary complex that lies

downstream of eIF2B was reduced significantly by butanol in manner that correlated

with the relative sensitivity of eIF2B mutants (Taylor et al. 2010). Finally, butanol

caused increases in an eIF2B dependent GCN4-lacZ reporter system. A similar analysis

using GCRE-luciferase and GCN4-luciferase reporters shows that all of the alcohols

barring farnesol lead to increases in this system (Figures 4.1 and 4.2). Taken together,

these results are suggestive that short chain alcohols, particularly, butanol could be

targeting eIF2B to exert an effect on translation initiation in both S. cerevisiae and C.

albicans.

One possibility is that butanol and other alcohols could be exerting these effects via a

signalling pathway that involves eIF2B. Alternatively, it is possible that the alcohols are

acting in a more allosteric fashion by interacting directly with eIF2B to impact upon

activity.

206

7.1.1 Role of Sit4p in eIF2αP dephosphorylation

Studies from the Ashe laboratory have revealed some puzzling findings regarding the

dephoshorylation of eIF2α in the presence of fusel alcohols in S. cerevisaie (Taylor et

al. 2010). The effects observed run counter to the known mechanism by which eIF2

phosphorylation causes the inhibition of protein synthesis. The observed

dephosphorylation of eIF2α in response to alcohols occurs in a manner that correlates

with the inhibition of translation (Griffiths and Ashe 2006), so initially a link between

the two effects of the alcohols was considered. A deletion mutant in SIT4 (encoding a

type 2A-related phosphatase) was identified that exhibit virtually no eIF2α

dephosphorylation after cells have been exposed to fusel alcohols in S. cerevisiae

(Taylor et al. 2010). However, in this mutant the alcohols still cause the full inhibition

of protein synthesis. These data provided a direct demonstration that there is not a link

between the eIF2 dephosphorylation and the inhibition of protein synthesis (Taylor et

al. 2010).

In order to assess the level of similarity between the previous studies in S. cerevisiae

and the impact of alcohols in C. albicans, studies on the dephosphorylation of eIF2α

were undertaken. Butanol and farnesol were found to cause a dose-dependent

dephosphorylation of eIF2α in C. albicans (Figures 3.11 and 3.13), it is likely that this

effect could be either due to the inhibition of a kinase activity or the induction of a

phosphatase. Indeed given the homology of the C. albicans and S. cerevisiae SIT4

(89%), (Arndt et al. 1989; Lee et al. 2004) and the observation that C. albicans SIT4

complements a SIT4 deletion in S. cerevisiae (Lee et al. 2004), it is most likely that

Sit4p is involved in alcohol-induced dephosphorylation as was observed in C. albicans.

An intriguing correlation with the published literature lies in studies on the effects of

volatile anaesthetics on translation initiation in both yeast and mammalian cells (Palmer

et al. 2005), where striking similarities can be found to the observed effects of fusel

207

alcohols on C. albicans and S. cerevisiae. The volatile anaesthetic, isoflurane, was

observed to cause a 15-fold reduction in the level of phosphorylated eIF2α in the yeast

within 15 min of incubation. Also a decreased phosphorylation of the ribosomal protein

S6 (rpS6) and the kinase that phosphorylates rpS6 (p70s6k1

) was observed in mammalian

liver cells after exposure to the anesthetic, halothane (Palmer et al. 2006).

Intriguingly however, addition of ethanol concentrations that inhibit protein synthesis,

showed no dephosphorylation of eIF2α in C. albicans (Figure 3.12). This observation

provides further support for the interpretation that the dephosphorylation of eIF2 is

unrelated to the impact of the alcohols on translation initiation

7.1.2 Alcohols affect morphogenesis

Another observation with regard to the alcohols relates to their ability to impact upon

morphological transitions in C. albicans. A number of suggestions have been previously

made, regarding the physiological rationale underlying pseudohyphal growth and germ

tube formation. The altered growth pattern may allow yeast to forage for nutrients under

nutrient limiting conditions (Gimeno et al. 1992), it could facilitate escape from

accumulating toxic end-point metabolites (Gancedo 2001), 2001) and for Candida

species, it may provide a means to evade the host immune response. Here 0.25- 0.5%

(v/v) butanol was found to induce 50% pseudohyphae formation in C. albicans within 4

hours, while 1- 3% (v/v) of ethanol was required to elicit a similar effect (Figure 3.5B

and C). Studies presented here and elsewhere have shown that farnesol blocks germ

tube formation in C. albicans (Hornby et al. 2001; Ramage et al. 2002). One intriguing

question was whether the morphogenesis induced by serum, butanol or ethanol can

override farnesol’s inhibitory activity or vice versa. 150µM farnesol effectively blocked

the filamentation induced by serum, whereas lower concentrations were sufficient to

block ethanol- or butanol-induced filamentation (Figure 3.5B and C). These data are

208

consistent with previous work in C. albicans where morphogenesis induced by the

aromatic alcohol, tyrosol was blocked by farnesol in a dose-dependent manner (Ghosh

et al. 2008).

Intriguingly, deletion of the EFG1 gene, that encodes a transcriptional regulator

involved in the cAMP-PKA morphological differentiation pathway, exhibited some

resistance to the translational effects of farnesol in C. albicans. Previous studies have

found that the cAMP-PKA kinase and MAP kinase pathways are important for

pseudohyphal growth in response to aromatic alcohols in C. albicans (Ghosh et al.

2008). In addition, Sit4p was shown to play important roles during hyphal growth in C.

albicans by regulating protein translation (Lee et al. 2004). Therefore, it is at least

plausible that the translational and morphological impact of alcohols in C. albicans are

connected. However, it is important to note that for all of the alcohols used in this study,

the translational shut down occurs at higher concentrations than are required to cause

effects on the growth morphology. Therefore, key questions for the future will be how

alcohols induce morphological changes during growth and how this relates to their

effects on protein synthesis.

7.2 Movement of the eIF2B body is impeded by fusel alcohol, but not farnesol

In order to further investigate how the various alcohols bring about inhibition of

translation initiation, cell biological studies were initiated by comparison to what is

already known in S. cerevisiae. eIF2B and its G protein eIF2 have been shown to co-

localise to a discrete cytoplasmic foci in S. cerevisiae, termed the eIF2B body

(Campbell et al. 2005). In response to fusel alcohols the dynamic movement of this

body throughout the cell was inhibited in a manner that correlated both with the

concentration of the alcohol and the alcohol sensitivity of the strains at the level of

translation (Taylor et al. 2010). In this thesis, the data show that eIF2B also localises to

209

eIF2B bodies in C. albicans. Furthermore, the addition of butanol, ethanol or farnesol at

concentrations that inhibit translation initiation, did not impact on the ability of eIF2B

subunits to localise to these foci (Figure 4.5). However, butanol and ethanol both

affected the movement of the eIF2B body in a manner which correlated with their

effects on translation initiation (Figures 4.6 and 4.7). The mechanistic relationship

between alcohol dependent translational inhibition and the decreased movement of

eIF2B body remains unclear. One possibility is that the eIF2B serves as a centre for

guanine nucleotide exchange and inhibiting the movement of the body prevents the

factor being exposed to high concentrations of its substrate eIF2.GDP. Alternatively, as

the movement in S. cerevisiae has been found to occur as a result of diffusion and where

the 2B body remains static for periods it is likely due to tethering, it is possible that the

alcohols favour the tethered form of the 2B body, which for some reason precludes

guanine nucleotide exchange (Taylor et al. 2010). A similar pattern of movement has

been described for insulin granules (Ivarsson et al. 2004), movement of these granules

is sensitive to cooling, and a reduction in movement leads to a reduction in insulin

granule secretion, providing an example where the rate of movement of the granules

within the cell is necessary for cellular function (Ivarsson et al. 2004).

The inhibition of eIF2B body movement is not a general consequence of the

translational shut-down, as an inhibition was not observed following farnesol (Figures

4.6 and 4.7). The fact that farnesol treatment does not induce the expression of GCN4,

combined with its inability to regulate the movement of eIF2B bodies suggests that

farnesol does not target eIF2B to regulate translation initiation.

7.2.1 Biochemical analysis of eIF2B

To further investigate the possibility that butanol could be affecting the interaction of

eIF2B with other factors or that butanol treatment affected the level of eIF2B subunits,

210

strains of C. albicans wild type bearing a combined V5-6XHis epitopte tag on GCD1

and SUI3 genes were constructed. The aim of the epitope tagging was to purify eIF2B

and eIF2, but this strategy could not be pursued further as repeated attempts to purify

the tagged proteins failed. A tagging strategy to maximise the purification of the tagged

proteins by tagging the two copies of the gene (GCD1) with 4x FLAG epitope was

therefore designed largely based on purification schemes from S. cerevsiaie where Flag-

tagged eIF2B subunits are overexpressed from plasmids (Mohammad-Qureshi et al.

2007). Mass spectrometry on the immunopurified eIF2B samples identified the eIF2B

subunits, particularly the eIF2Bγ and ɛ subunits, which were over 30-fold enriched in

the tagged samples relative to samples from the untagged strain (Table 4.1). Therefore

the 4xFlag epitope tagging reagents for double tagging the two allelles of a gene

developed in this study could be adapted for epitope tagging of other genes in C.

albicans. However, because the other three subunits of eIF2B (α, β and δ) were not

consistently enriched, a biochemical analysis of the guanine nucleotide exchange

activity of the eIF2B complex was not possible. However, it may be possible in the

future to measure this activity for the / sub-complex and assess the impact of butanol

treatment on this activity. The finding that this catalytic sub-complex does not appear to

co-purify stiochiometrically with the regulatory sub-complex may also have biological

significance which could be explored in future experiments. For instance in S.

cerevisiae two of the three regulatory eIF2B genes are essential and the third is required

for translational control: Is this also true in Candida?

7.3 The formation of the 48S preinitiation complex is affected by farnesol

treatment.

The data in this thesis also provide insights into the mechanism by which farnesol elicits

an inhibition of translation initiation. As described above, the GCN4-luciferase reporter

211

experiments and 2B body studies are suggestive that eIF2B is not the regulatory target

for farnesol. Therefore, in an attempt to further understand the stage of translation

initiation regulated by farnesol, ribosomal complexes formed during translation

initiation were investigated using the formaldehyde-polysome analysis. For this analysis

a decision was made to switch to the MLY61 strain of S. cerevisae due to the absence in

Candida of antibodies with which to detect the components of the individual

translational complexes. Therefore, to validate this approach, experiments were

conducted showing that farnesol has a very similar impact on protein synthesis in the

MLY61 strain of S. cerevisiae (Figures 5.1 and 5.2). The subsequent formaldehyde-

polysome analysis revealed that the degree to which the eIF4G is associated with the

small ribosomal subunit (40S) decreases substantially following treatment with 100µM

farnesol (Figure 5.4). These data were verified and extended using an

immunoprecipitation strategy combined with a mass spectrometric analysis. More

specifically, following farnesol treatment immunopurified TAP-tagged eIF4G1 protein

co-purifies with many components of the closed loop complex, that interacts with

mRNA e.g. eIF4E and Pab1p, but fails to co-purify with the ribosomal proteins and

eIF3 (Figure 5.6), that are only associated with the closed loop complex as part of the

48S complex or 80S complex.

Many studies have reported translational control targeting steps upstream of mRNA

recruitment to the 43S ribosome complex to ultimately reduce 48S preinitiation

complex formation. For instance, glucose starvation causes a reorganisation of the

closed loop mRNP translation complex, whereby the cosedimentation of eIF4E, eIF4G

and Pab1p with ribosomal complexes is compromised (Hoyle et al. 2007). In addition,

phosphorylation of ribosomal protein L13a has been shown to inhibit 43S subunit

recruitment to mRNAs bearing the γ interferon inhibitor of translation element in rabbit

reticulocyte lysates (Kapasi et al. 2007). Patemine A (PatA) is a natural marine product

212

and has been shown to target eIF4A to disrupt the eIF4F complex by decreasing the

interaction between eIF4A and eIF4G while promoting the formation of a stable

complex between eIF4A and eIF4B. As a consequence, PatA blocks translation

initiation primarily by stalling the initiation complexes on mRNA (Low et al. 2005).

Furthermore another study showed that hippuristanol, another natural marine product,

inhibits translation initiation as a result of impaired eIF4A helicase activity and its

ability to interact with eIF4G (Lindqvist et al. 2008). Cruz-Migoni et al. (2011) recently

showed that the Burkholderia lethal factor 1, a toxin produced by the bacterium,

Burkholderia pseudomallei causes a translational block by inhibiting the helicase

activity of eIF4A and this manifests in the human disease melioidosis. Therefore, the

observed depletion of eIF4G from the 40S region of the gradient combined with the

mass spectrometric analysis of eIF4G containing complexes lend support to a model

where farnesol targets the formation of the 48S preinitiation complex to inhibit protein

synthesis.

7.4 Transcriptomic analysis reveals a global change in gene expression following

farnesol treatment of C. albicans

Advances in transcriptomic technology offer great promise in understanding the

molecular basis of stress responses in living cells. Previous global studies on the effect

of farnesol exposure at the level of gene expression have been based on alterations in

the level of transcripts alone (Cao et al. 2005; Uppuluri et al. 2007). As part of this

thesis, farnesol has been shown to cause a rapid inhibition of protein synthesis. This

means that in order to understand the changes in gene expression caused by farnesol a

decision was made to assess the level of polysome association as well as the level of

each transcript.

213

The data obtained from the transcriptomic and polysomal sequencing revealed that

genes associated with the functions in hyphal growth, biofilm formation and cell cycle

were down-regulated in response to farnesol (Figure 6.4A and B). One intriguing aspect

of these data is that many genes implicated in these functions appear to be either

regulated at the translational level or at the level of the transcript but not both. For some

genes there is even a reciprocal regulation of these processes. This contrasts with data

in S. cerevisiae for heat shock, rapamycin treatment, amino acid starvation and glucose

starvation where individual genes have been viewed as co-ordinately regulated in a

process that has been termed ‘potentiation’ (Preiss et al. 2003; Smirnova et al. 2005;

Castelli et al. 2011). The reason for this distinction is unclear, but may relate to the fact

that farnesol is more of a signalling molecule where a programmed response might be

required, whereas nutritional stresses require a ‘knee-jerk’ instantaneous and robust

response.

The TUP1 gene proved particularly interesting as it appeared up-regulated at the level

of transcription but down-regulated in terms of polysome association. These rather

puzzling data were confirmed using qRT-PCR. It seems possible that the increases at

the level of transcription overwhelm the translational machinery such that not all of the

new mRNA can be simultaneously assimilated for the production of protein. Hence, it

may appear that polysome association has been down-regulated. The anticipated

outcome under such circumstances would still be higher levels of the global

transcriptional co-repressor Tup1p protein. Previous studies have found that TUP1

deletion causes hyper-filamentation under conditions that favour yeast growth (Braun et

al. 2000), therefore an up-regulation of TUP1 in response to farnesol may contribute

significantly to the inhibition of filament formation in C. albicans by repressing

transcription of a range of filamentation genes. However, it remains unclear how genes

are regulated at the translational level in response to farnesol.

214

Three other functional classes of mRNA; those whose gene products are involved in

translation, cellular respiration and the response to oxidative stress were also up-

regulated in response to farnesol (Figure 6.4A and B). Once again, the mRNAs are

regulated either at the transcript level or at the level of polysome association, but rarely

both. As farnesol causes a 10-fold decrease in protein synthesis (see section 3.2.4), the

up-regulation of genes involved in protein synthesis could represent part of an adaptive

response by the cells to overcome the effect of farnesol on translation. In terms of

oxidative stress, Shirtliff et al. (2009) and Westwater et al. (2005), have previously

shown that exposure of C. albicans cells to farnesol caused the accumulation of reactive

oxygen species (ROS). Therefore, once again the up-regulation of genes involved in the

response to oxidative stress could represent an adaptive response to farnesol treatment.

Upregulation of mRNAs, whose gene products are involved in cellular respiration, both

at the transcript and translation level shows that farnesol could be impacting on the

respiratory machinery of C. albicans as was previously observed in S. cerevisiae

(Machida et al. 1998) .

.

7.5 Concluding remarks and future perspectives

The data presented in this study show that alcohols inhibit translation initiation in C.

albicans via different mechanisms. Fusel alcohols and ethanol appear to target eIF2B,

whereas 48S preinitiation complex formation is the likely target of farnesol. These

range of alcohols also differentially impact on one of the key virulence factors of this

important human fungal pathogen: morphological transition from yeast to hyphae or

pseudohyphae. Farnesol blocks the transition from yeast to hyphae even in the presence

of serum, whereas fusel alcohols and ethanol promote pseudohyphae and germ tube

formation. Future studies to investigate the connection between alcohol-induced

inhibition of protein synthesis and morphological differentiation will involve screening

215

deletion mutants in the morphological differential pathway or in translation initiation

factors for their translational or growth responses respectively in the presence of the

alcohols.

Farnesol has been shown to target some virulence features of C albicans and as such has

been studied as a possible agent for antifungal therapy. Data obtained here from RNA

sequencing has revealed that genes involved in filamentation were down-regulated at

either the transcriptional or translational level. Part of this regulation could be due to the

up-regulation of the TUP1 gene, which explains the transcriptional response, however,

an explanation for the translational regulation of these genes is still outstanding.

Mapping strategies will be required to precisely define the RNA sequences that dictate

the regulation of translation. These sequences can then be used to identify either based

on prior knowledge of RNA binding specificity, or experimentally via affinity

chromatography the proteins that interact with the sequence. Deletion mutation would

then allow the regulatory impact of these factors to be assessed following farnesol

treatment.

Interestingly the range of alcohols studied in this work are produced by C. albicans and

could be playing various in vivo roles in the adaptation, survival and perhaps virulence

of this opportunistic pathogen. Therefore elucidating mechanisms by which this range

of alcohols affect protein synthesis and morphological transition may help to advance

research on the development of novel antifungal agents that switch on endogenous cell

inhibitory mechanisms in this human pathogen.

216

Figure 7.1 Model for the impact of various alcohols on protein synthesis in C.

albicans and S. cerevisiae. The various alcohols had similar impact on protein

synthesis in C. albicans and S. cerevisiae. However S. cerevisiae being a Crabtree

positive yeast exhibited more tolerance to the translational effects of ethanol. In

addition while mild inhibition of translation initiation seems to induce pseudohyphal

formation, farnesol inhibited the process.

Ethanol/Butanol Farnesol

Phenotypic effects

e.g.

morphological

differentiation

40S

eIF2

GTP Met

5

3

1A

1 GDP

eIF2

GTP

eIF2

GDP GTP

eIF2B

eIF2B 48S complex

Protein synthesis

217

8. Bibliography

Alonso-Monge, R., Navarro-Garcia, F., Molero, G., Diez-Orejas, R., Gustin, M., et al. (1999).

"Role of the mitogen-activated protein kinase Hog1p in morphogenesis and virulence of

Candida albicans." J Bacteriol 181(10): 3058-3068.

Altmann, M., Handschin, C. and Trachsel, H. (1987). "mRNA cap-binding protein: cloning of

the gene encoding protein synthesis initiation factor eIF-4E from Saccharomyces

cerevisiae." Mol Cell Bio 7(3): 998-1003.

Altmann, M., Schmitz, N., Berset, C. and Trachsel, H. (1997). "A novel inhibitor of cap-

dependent translation initiation in yeast: p20 competes with eIF4G for binding to

eIF4E." Embo J 16(5): 1114-1121.

Anderson, P. and Kedersha, N. (2006). "RNA granules." J Cell Biol 172(6): 803-808.

Arana, D. M., Nombela, C., Alonso-Monge, R. and Pla, J. (2005). "The Pbs2 MAP kinase

kinase is essential for the oxidative-stress response in the fungal pathogen Candida

albicans." Microb 151(Pt 4): 1033-1049.

Arndt, K. T., Styles, C. A. and Fink, G. R. (1989). "A suppressor of a HIS4 transcriptional

defect encodes a protein with homology to the catalytic subunit of protein

phosphatases." Cell 56(4): 527-537.

Asano, K., Clayton, J., Shalev, A. and Hinnebusch, A. G. (2000). "A multifactor complex of

eukaryotic initiation factors, eIF1, eIF2, eIF3, eIF5, and initiator tRNA(Met) is an

important translation initiation intermediate in vivo." Genes Dev 14(19): 2534-2546.

Asano, K. and Hinnebusch, A. G. (2001). "Protein interactions important in eukaryotic

translation initiation." Methods Mol Biol 177: 179-198.

Asano, K., Krishnamoorthy, T., Phan, L., Pavitt, G. D. and Hinnebusch, A. G. (1999).

"Conserved bipartite motifs in yeast eIF5 and eIF2Bepsilon, GTPase-activating and

GDP-GTP exchange factors in translation initiation, mediate binding to their common

substrate eIF2." Embo J 18(6): 1673-1688.

Ashe, M. P., De Long, S. K. and Sachs, A. B. (2000). "Glucose depletion rapidly inhibits

translation initiation in yeast." Mol Biol Cell 11(3): 833-848.

Ashe, M. P., Slaven, J. W., De Long, S. K., Ibrahimo, S. and Sachs, A. B. (2001). "A novel

eIF2B-dependent mechanism of translational control in yeast as a response to fusel

alcohols." Embo J 20(22): 6464-6474.

Astrom, S. U., von Pawel-Rammingen, U. and Bystrom, A. S. (1993). "The yeast initiator

tRNAMet can act as an elongator tRNA(Met) in vivo." J Mol Biol 233(1): 43-58.

Bahn, Y. S., Staab, J. and Sundstrom, P. (2003). "Increased high-affinity phosphodiesterase

PDE2 gene expression in germ tubes counteracts CAP1-dependent synthesis of cyclic

AMP, limits hypha production and promotes virulence of Candida albicans." Mol

Microbiol 50(2): 391-409.

Baierlein, C. and Krebber, H. (2010). "Translation termination: new factors and insights." RNA

Biol 7(5): 548-550.

Banerjee, M., Thompson, D. S., Lazzell, A., Carlisle, P. L., Pierce, C., et al. (2008). "UME6, a

novel filament-specific regulator of Candida albicans hyphal extension and virulence."

Mol Biol Cell 19(4): 1354-1365.

Bhaganna, P., Volkers, R. J. M., Bell, A. N. W., Kluge, K., Timson, D. J., et al. (2010).

"Hydrophobic substances induce water stress in microbial cells." Microbial Biotech

3(6): 701-716.

Biswas, K. and Morschhauser, J. (2005). "The Mep2p ammonium permease controls nitrogen

starvation-induced filamentous growth in Candida albicans." Mol Microbiol 56(3):

649-669.

Biswas, S., Van Dijck, P. and Datta, A. (2007). "Environmental sensing and signal transduction

pathways regulating morphopathogenic determinants of Candida albicans." Microbiol

Mol Biol Rev 71(2): 348-376.

Biswas, S., Van Dijck, P. and Datta, A. (2007). "Environmental sensing and signal transduction

pathways regulating morphopathogenic determinants of Candida albicans."

Microbiol Mol Biol R 71(2): 348-376.

218

Blum, S., Schmid, S. R., Pause, a., Buser, P., Linder, P., et al. (1992). "Atp Hydrolysis by

Initiation Factor-4a Is Required for Translation Initiation in Saccharomyces-

Cerevisiae." Proc Natl Acad Sci USA 89(16): 7664-7668.

Bockmühl, D. P. and Ernst, J. F. (2001). "A potential phosphorylation site for an A-type kinase

in the Efg1 regulator protein contributes to hyphal morphogenesis of Candida

albicans." Genet 157(4): 1523-1530.

Bockmuhl, D. P., Krishnamurthy, S., Gerads, M., Sonneborn, A. and Ernst, J. F. (2001).

"Distinct and redundant roles of the two protein kinase A isoforms Tpk1p and Tpk2p in

morphogenesis and growth of Candida albicans." Mol Microbiol 42(5): 1243-1257.

Bolger, A. M., Lohse, M. and Usadel, B. (2014). "Trimmomatic: a flexible trimmer for Illumina

sequence data." Bioinformatics.

Bradford, M. M. (1976). "A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding." Anal Biochem

72(1–2): 248-254.

Braun, B. R., Head, W. S., Wang, M. X. and Johnson, A. D. (2000). "Identification and

characterization of TUP1-regulated genes in Candida albicans." Genetics 156(1): 31-

44.

Braun, B. R. and Johnson, A. D. (1997). "Control of filament formation in Candida albicans by

the transcriptional repressor TUP1." Science 277(5322): 105-109.

Braun, B. R., Kadosh, D. and Johnson, A. D. (2001). "NRG1, a repressor of filamentous growth

in C.albicans, is down-regulated during filament induction." EMBO J 20(17): 4753-

4761.

Bronstein, I., Fortin, J., Stanley, P. E., Stewart, G. S. and Kricka, L. J. (1994).

"Chemiluminescent and bioluminescent reporter gene assays." Anal Biochem 219(2):

169-181.

Brown, A. J. and Gow, N. A. (1999). "Regulatory networks controlling Candida albicans

morphogenesis." Trends Microbiol 7(8): 333-338.

Bushell, M., Stoneley, M., Kong, Y. W., Hamilton, T. L., Spriggs, K. A., et al. (2006).

"Polypyrimidine tract binding protein regulates IRES-mediated gene expression during

apoptosis." Mol Cell 23(3): 401-412.

Calderone, R. A. and Fonzi, W. A. (2001). "Virulence factors of Candida albicans." Trends

Microbiol 9(7): 327-335.

Campbell, S. G. and Ashe, M. P. (2006). "Localization of the Translational Guanine Nucleotide

Exchange Factor eIF2B: A Common Theme for GEFs?" Cell Cycle In press.

Campbell, S. G., Hoyle, N. P. and Ashe, M. P. (2005). "Dynamic cycling of eIF2 through a

large eIF2B-containing cytoplasmic body: implications for translation control." J Cell

Biol 170(6): 925-934.

Cao, F., Lane, S., Raniga, P. P., Lu, Y., Zhou, Z., et al. (2006). "The Flo8 transcription factor is

essential for hyphal development and virulence in Candida albicans." Mol Biol Cell

17(1): 295-307.

Cao, Q., Huang, Y. S., Kan, M. C. and Richter, J. D. (2005). "Amyloid precursor proteins

anchor CPEB to membranes and promote polyadenylation-induced translation." Mol

Cell Biol 25(24): 10930-10939.

Cao, Y. Y., Cao, Y. B., Xu, Z., Ying, K., Li, Y., et al. (2005). "cDNA microarray analysis of

differential gene expression in Candida albicans biofilm exposed to

farnesol." Antimicrob Agents CH 49(2): 584-589.

Cassola, A., Parrot, M., Silberstein, S., Magee, B. B., Passeron, S., et al. (2004). "Candida

albicans lacking the gene encoding the regulatory subunit of protein kinase A displays a

defect in hyphal formation and an altered localization of the catalytic subunit." Eukaryot

Cell 3(1): 190-199.

Castelli, L. M., Lui, J., Campbell, S. G., Rowe, W., Zeef, L. A. H., et al. (2011). "Glucose

depletion inhibits translation initiation via eIF4A loss and subsequent 48S preinitiation

complex accumulation, while the pentose phosphate pathway is coordinately up-

regulated." Mol Biol Cell 22(18): 3379-3393.

Chen, H. and Fink, G. R. (2006). "Feedback control of morphogenesis in fungi by aromatic

alcohols." Genes Dev 20(9): 1150-1161.

Chen, H., Fujita, M., Feng, Q., Clardy, J. and Fink, G. R. (2004). "Tyrosol is a quorum-sensing

molecule in Candida albicans." Proc Natl Acad of Sci USA 101(14): 5048-5052.

219

Chen, J., Chen, J., Lane, S. and Liu, H. (2002). "A conserved mitogen-activated protein kinase

pathway is required for mating in Candida albicans." Mol Microbiol 46(5): 1335-1344.

Cheung, Y.-N., Maag, D., Mitchell, S. F., Fekete, C. A., Algire, M. A., et al. (2007).

"Dissociation of eIF1 from the 40S ribosomal subunit is a key step in start codon

selection in vivo." Genes Dev 21(10): 1217-1230.

Cho, T., Aoyama, T., Toyoda, M., Nakayama, H., Chibana, H., et al. (2007). "Transcriptional

Changes in Candida albicans Genes by Both Farnesol and High Cell Density at an

Early Stage of Morphogenesis inN-acetyl-D-glucosamine Medium." Nippon Ishinkin

Gakkai Zasshi 48(4): 159-167.

Cho, T., Aoyama, T., Toyoda, M., Nakayama, H., Chibana, H., et al. (2007). "Transcriptional

changes in Candida albicans genes by both farnesol and high cell density at an early

stage of morphogenesis in N-acetyl-D-glucosamine medium." 48(4): 159-167.

Clarkson, B. K., Gilbert, W. V. and Doudna, J. A. (2010). "Functional overlap between eIF4G

isoforms in Saccharomyces cerevisiae." PLoS One 5(2): e9114.

Cosentino, G. P., Schmelzle, T., Haghighat, A., Helliwell, S. B., Hall, M. N., et al. (2000).

"Eap1p, a novel eukaryotic translation initiation factor 4E-associated protein in

Saccharomyces cerevisiae." Mol Cell Biol 20(13): 4604-4613.

Cougot, N., Babajko, S. and Seraphin, B. (2004). "Cytoplasmic foci are sites of mRNA decay in

human cells." J Cell Biol 165(1): 31-40.

Cruz-Migoni, A., Hautbergue, G. M., Artymiuk, P. J., Baker, P. J., Bokori-Brown, M., et al.

(2011). "A Burkholderia pseudomallei toxin inhibits helicase activity of translation

factor eIF4A." Science 334(6057): 821-824.

Csank, C., Makris, C., Meloche, S., Schroppel, K., Rollinghoff, M., et al. (1997). "Derepressed

hyphal growth and reduced virulence in a VH1 family-related protein phosphatase

mutant of the human pathogen Candida albicans." Mol Biol Cell 8(12): 2539-2551.

Cullen, P. J. and Sprague, G. F., Jr. (2000). "Glucose depletion causes haploid invasive growth

in yeast." Proc Natl Acad Sci U S A 97(25): 13619-13624.

Cutler, J. E. (1991). "Putative virulence factors of Candida albicans." Ann Rev Microbil 45(1):

187-218.

D'Souza, C. A. and Heitman, J. (2001). "Conserved cAMP signaling cascades regulate fungal

development and virulence." FEMS Microbiol Rev 25(3): 349-364.

Davis-Hanna, A., Piispanen, A. E., Stateva, L. I. and Hogan, D. A. (2008). "Farnesol and

dodecanol effects on the Candida albicans Ras1-cAMP signalling pathway and the

regulation of morphogenesis." Mol Microbiol 67(1): 47-62.

De Filippi, L., Fournier, M., Cameroni, E., Linder, P., De Virgilio, C., et al. (2007). "Membrane

stress is coupled to a rapid translational control of gene expression in

chlorpromazine-treated cells." Curr Genet 52(3-4): 171-185.

Décanis, N., Tazi, N., Correia, A., Vilanova, M. and Rouabhia, M. (2011). "Farnesol, a fungal

quorum-sensing molecule triggers Candida albicans morphological changes by

downregulating the expression of different secreted aspartyl proteinase genes." The

open microbiol journ 5: 119.

Dever, T. E. (2002). "Gene-specific regulation by general translation factors." Cell 108(4): 545-

556.

Dever, T. E., Feng, L., Wek, R. C., Cigan, A. M., Donahue, T. F., et al. (1992).

"Phosphorylation of initiation factor 2 alpha by protein kinase GCN2 mediates gene-

specific translational control of GCN4 in yeast." Cell 68(3): 585-596.

Dever, T. E., Yang, W., Astrom, S., Bystrom, A. S. and Hinnebusch, A. G. (1995). "Modulation

of tRNA(iMet), eIF-2, and eIF-2B expression shows that GCN4 translation is inversely

coupled to the level of eIF-2.GTP.Met-tRNA(iMet) ternary complexes." Mol Cell Biol

15(11): 6351-6363.

Dichtl, K., Ebel, F., Dirr, F., Routier, F. H., Heesemann, J., et al. (2010). "Farnesol misplaces

tip-localized Rho proteins and inhibits cell wall integrity signalling in Aspergillus

fumigatus." Mol Microbiol 76(5): 1191-1204.

Dickinson, J. R. (1996). "'Fusel' alcohols induce hyphal-like extensions and pseudohyphal

formation in yeasts." Microbiol 142 ( Pt 6): 1391-1397.

Dickinson, J. R. (2000). "Branched-chain keto acid dehydrogenase of yeast." Method Enzymol

324: 389-398.

220

Diez-Orejas, R., Molero, G., Navarro-Garcia, F., Pla, J., Nombela, C., et al. (1997). "Reduced

virulence of Candida albicans MKC1 mutants: a role for mitogen-activated protein

kinase in pathogenesis." Infect Immun 65(2): 833-837.

Dobin, A., Davis, C. A., Schlesinger, F., Drenkow, J., Zaleski, C., et al. (2013). "STAR:

ultrafast universal RNA-seq aligner." Bioinformatics 29(1): 15-21.

Dobrikov, M. I., Dobrikova, E. Y. and Gromeier, M. (2013). "Dynamic regulation of the

translation initiation helicase complex by mitogenic signal transduction to eukaryotic

translation initiation factor 4G." Mol Cell Biol 33(5): 937-946.

Doedt, T., Krishnamurthy, S., Bockmühl, D. P., Tebarth, B., Stempel, C., et al. (2004). "APSES

proteins regulate morphogenesis and metabolism in Candida albicans." Mol Biol Cell

15(7): 3167-3180.

Dominguez, D., Kislig, E., Altmann, M. and Trachsel, H. (2001). "Structural and functional

similarities between the central eukaryotic initiation factor (eIF)4A-binding domain of

mammalian eIF4G and the eIF4A-binding domain of yeast eIF4G." Biochem J 355(Pt

1): 223-230.

Dunyak, D. S., Everdeen, D. S., Albanese, J. G. and Quinn, C. L. (2002). "Deletion of

individual mRNA capping genes is unexpectedly not lethal to Candida albicans and

results in modified mRNA cap structures." Eukaryot Cell 1(6): 1010-1020.

Ernst, J. F. (2000). "Transcription factors in Candida albicans - environmental control of

morphogenesis." Microbiol 146 ( Pt 8): 1763-1774.

Fairn, G. D., MacDonald, K. and McMaster, C. R. (2007). "A Chemogenomic Screen in

Saccharomyces cerevisiae Uncovers a Primary Role for the Mitochondria in Farnesol

Toxicity and Its Regulation by the Pkc1 Pathway." J Biol Chem 282(7): 4868-4874.

Farruggio, D., Chaudhuri, J., Maitra, U. and RajBhandary, U. L. (1996). "The A1 x U72 base

pair conserved in eukaryotic initiator tRNAs is important specifically for binding to the

eukaryotic translation initiation factor eIF2." Mol cell biol 16(8): 4248-4256.

Feketova, Z., Masek, T., Vopalensky, V. and Pospisek, M. (2010). "Ambiguous decoding of the

CUG codon alters the functionality of the Candida albicans translation initiation factor

4E." FEMS Yeast Res 10(5): 558-569.

Fernandez-Arenas, E., Cabezon, V., Bermejo, C., Arroyo, J., Nombela, C., et al. (2007).

"Integrated proteomics and genomics strategies bring new insight into Candida albicans

response upon macrophage interaction." Mol Cell Proteomics 6(3): 460-478.

Fogli, A., Dionisi-Vici, C., Deodato, F., Bartuli, A., Boespflug-Tanguy, O., et al. (2002). "A

severe variant of childhood ataxia with central hypomyelination/vanishing white matter

leukoencephalopathy related to EIF21B5 mutation." Neurology 59(12): 1966-1968.

Fogli, A., Schiffmann, R., Hugendubler, L., Combes, P., Bertini, E., et al. (2004). "Decreased

guanine nucleotide exchange factor activity in eIF2B-mutated patients." Eur J Hum

Genet 12(7): 561-566.

Fonzi, W. A. and Irwin, M. Y. (1993). "Isogenic strain construction and gene mapping in

Candida albicans." Genet 134(3): 717-728.

Forche, A., Alby, K., Schaefer, D., Johnson, A. D., Berman, J., et al. (2008). "The parasexual

cycle in Candida albicans provides an alternative pathway to meiosis for the formation

of recombinant strains." PLoS Biol 6(5): e110.

Gancedo, J. M. (2001). "Control of pseudohyphae formation in Saccharomyces cerevisiae."

FEMS Microbiol Rev 25(1): 107-123.

Garcia, M., Meurs, E. and Esteban, M. (2007). "The dsRNA protein kinase PKR: virus and cell

control." Biochimie 89(6): 799-811.

Gasch, A. P., Spellman, P. T., Kao, C. M., Carmel-Harel, O., Eisen, M. B., et al. (2000).

"Genomic Expression Programs in the Response of Yeast Cells to Environmental

Changes." Mol Biol Cell 11(12): 4241-4257.

Gaspar, N. J., Kinzy, T. G., Scherer, B. J., Hümbelin, M., Hershey, J. W., et al. (1994).

"Translation initiation factor eIF-2. Cloning and expression of the human cDNA

encoding the gamma-subunit." Journ Biol Chem 269(5): 3415-3422.

Gebauer, F. and Hentze, M. W. (2004). "Molecular mechanisms of translational control." Nat

Rev Mol Cell Biol 5(10): 827-835.

Ghosh, S., Kebaara, B. W., Atkin, A. L. and Nickerson, K. W. (2008). "Regulation of Aromatic

Alcohol Production in Candida albicans." Appl Environ Microbiol 74(23): 7211-7218.

221

Gillum, A., Tsay, E. H. and Kirsch, D. (1984). "Isolation of the Candida albicans gene for

orotidine-5′-phosphate decarboxylase by complementation of S. cerevisiae ura3 and E.

coli pyrF mutations." Mol Gen Genet 198(1): 179-182.

Gimeno, C. J., Ljungdahl, P. O., Styles, C. A. and Fink, G. R. (1992). "Unipolar cell divisions in

the yeast S. cerevisiae lead to filamentous growth: Regulation by starvation and RAS."

Cell 68(6): 1077-1090.

Gomez, E., Mohammad, S. S. and Pavitt, G. D. (2002). "Characterization of the minimal

catalytic domain within eIF2B: the guanine-nucleotide exchange factor for translation

initiation." EMBO J 21(19): 5292-5301.

Gomez, E. and Pavitt, G. D. (2000). "Identification of domains and residues within the epsilon

subunit of eukaryotic translation initiation factor 2B (eIF2B epsilon) required for

guanine nucleotide exchange reveals a novel activation function promoted by eIF2B

complex formation." Mol Cell Biol 20(11): 3965-3976.

Goshorn, A. K., Grindle, S. M. and Scherer, S. (1992). "Gene isolation by complementation in

Candida albicans and applications to physical and genetic mapping." Infect Immun

60(3): 876-884.

Goyer, C., Altmann, M., Lee, H. S., Blanc, a., Deshmukh, M., et al. (1993). "Tif4631 and

Tif4632 - 2 Yeast Genes Encoding the High-Molecular-Weight Subunits of the Cap-

Binding Protein Complex (Eukaryotic Initiation Factor-4F) Contain an RNA

Recognition Motif-Like Sequence and Carry out an Essential Function." Mol Cell Biol

13(8): 4860-4874.

Grant, C. M. and Hinnebusch, A. G. (1994). "Effect of sequence context at stop codons on

efficiency of reinitiation in GCN4 translational control." Mol cell biol 14(1): 606-618.

Griffiths, C. D. and Ashe, D. S. (2006). Translational Regulation in Saccharomyces Cerevisiae

in Response to Fusel and Amino Alcohols, University of Manchester.

Gross, T., Siepmann, A., Sturm, D., Windgassen, M., Scarcelli, J. J., et al. (2007). "The DEAD-

Box RNA Helicase Dbp5 Functions in Translation Termination." Science 315(5812):

646-649.

Guthrie, C. and Fink, G. R. (1991). Guide to yeast genetics and molecular biology. San Diego,

California, Academic Press.

Hall, R. A., Turner, K. J., Chaloupka, J., Cottier, F., De Sordi, L., et al. (2011). "The quorum-

sensing molecules farnesol/homoserine lactone and dodecanol operate via distinct

modes of action in Candida albicans." Eukaryot Cell 10(8): 1034-1042.

Han, A. P., Yu, C., Lu, L., Fujiwara, Y., Browne, C., et al. (2001). "Heme-regulated eIF2alpha

kinase (HRI) is required for translational regulation and survival of erythroid precursors

in iron deficiency." Embo J 20(23): 6909-6918.

Harding, H. P., Novoa, I., Zhang, Y., Zeng, H., Wek, R., et al. (2000). "Regulated translation

initiation controls stress-induced gene expression in mammalian cells." Mol Cell 6(5):

1099-1108.

Harding, H. P., Zhang, Y., Zeng, H., Novoa, I., Lu, P. D., et al. (2003). "An integrated stress

response regulates amino acid metabolism and resistance to oxidative stress." Mol Cell

11(3): 619-633.

Hartwell, L. H. and McLaughlin, C. S. (1969). "A mutant of yeast apparently defective in the

initiation of protein synthesis." Proc Natl Acad Sci U S A 62(2): 468-474.

He, H., von der Haar, T., Singh, C. R., Ii, M., Li, B., et al. (2003). "The yeast eukaryotic

initiation factor 4G (eIF4G) HEAT domain interacts with eIF1 and eIF5 and is involved

in stringent AUG selection." Mol Cell Biol 23(15): 5431-5445.

Hellen, C. U. and Sarnow, P. (2001). "Internal ribosome entry sites in eukaryotic mRNA

molecules." Genes Dev 15(13): 1593-1612.

Hernandez, G., Altmann, M., Sierra, J. M., Urlaub, H., del Corral, R. D., et al. (2005).

"Functional analysis of seven genes encoding eight translation initiation factor 4E

(eIF4E) isoforms in Drosophila." Mech Dev 122(4): 529-543.

Hershey, J. W. and Merrick, W. C. (2000). "Pathway and mechanism of initiation of protein

synthesis." Cold Spring Harbor monograph series 39: 33-88.

Hibbett, D. S., Binder, M., Bischoff, J. F., Blackwell, M., Cannon, P. F., et al. (2007). "A

higher-level phylogenetic classification of the Fungi." Mycolog Res 111(5): 509-547.

Hinnebusch, A. G. (1988). "Mechanisms of gene regulation in the general control of amino acid

biosynthesis in Saccharomyces cerevisiae." Microbiol Rev 52(2): 248-273.

222

Hinnebusch, A. G. (1993). "Gene-specific translational control of the yeast GCN4 gene by

phosphorylation of eukaryotic initiation factor 2." Mol Microbiol 10(2): 215-223.

Hinnebusch, A. G. (1994). "The eIF-2 alpha kinases: regulators of protein synthesis in

starvation and stress." Semin Cell Biol 5(6): 417-426.

Hinnebusch, A. G. (2000). Mechanisms and regulation of initiator methionyl-tRNA binding to

ribosomes. Translational control of gene expression. N. Sonenberg, J. W. B. Hershey

and M. B. Mathews. Cold Spring Harbor, New York, Cold Spring Harbor Laboratory

Press: 185-244.

Hinnebusch, A. G. (2005). "Translational regulation of GCN4 and the general amino acid

control of yeast." Annu Rev Microbiol 59: 407-450.

Hinnebusch, A. G., Asano, K., Olsen, D. S., Phan, L., Nielsen, K. H., et al. (2004). "Study of

translational control of eukaryotic gene expression using yeast." Ann N Y Acad Sci

1038: 60-74.

Hornby, J. M., Jensen, E. C., Lisec, A. D., Tasto, J. J., Jahnke, B., et al. (2001). "Quorum

sensing in the dimorphic fungus Candida albicans is mediated by farnesol." Appl

Environ Microbiol 67(7): 2982-2992.

Hornby, J. M., Kebaara, B. W. and Nickerson, K. W. (2003). "Farnesol biosynthesis in Candida

albicans: cellular response to sterol inhibition by zaragozic acid B." Antimicrob Agents

Chemother 47(7): 2366-2369.

Hoyle, N. P., Castelli, L. M., Campbell, S. G., Holmes, L. E. and Ashe, M. P. (2007). "Stress-

dependent relocalization of translationally primed mRNPs to cytoplasmic granules that

are kinetically and spatially distinct from P-bodies." J Cell Biol 179(1): 65-74.

Huang, R., Vider, J., Serganova, I. and Blasberg, R. G. (2011). "ATP binding cassette

transporters modulate both coelenterazine- and D-luciferin- based bioluminescence

imaging." Mol imaging 10(3): 215-226.

Hull, C. M., Raisner, R. M. and Johnson, A. D. (2000). "Evidence for mating of the" asexual"

yeast Candida albicans in a mammalian host." Science 289(5477): 307-310.

Ibrahimo, S., Holmes, L. E. and Ashe, M. P. (2006). "Regulation of translation initiation by the

yeast eIF4E binding proteins is required for the pseudohyphal response." Yeast 23(14-

15): 1075-1088.

Imataka, H. and Sonenberg, N. (1997). "Human eukaryotic translation initiation factor 4G

(eIF4G) possesses two separate and independent binding sites for eIF4A." Mol Cell

Biol 17(12): 6940-6947.

Ingram, L. (1981). "Mechanism of lysis of Escherichia coli by ethanol and other chaotropic

agents." J Bacteriol 146(1): 331-336.

Ingram, L. (1986). "Microbial tolerance to alcohols: role of the cell membrane." Trends Biotech

4(2): 40-44.

Ivarsson, R., Obermuller, S., Rutter, G. A., Galvanovskis, J. and Renstrom, E. (2004).

"Temperature-sensitive random insulin granule diffusion is a prerequisite for recruiting

granules for release." Traffic 5(10): 750-762.

Jackson, R. J., Hellen, C. U. and Pestova, T. V. (2010). "The mechanism of eukaryotic

translation initiation and principles of its regulation." Nat Rev Mol Cell Biol 11(2): 113-

127.

Jackson, R. J., Hellen, C. U. and Pestova, T. V. (2010). "The mechanism of eukaryotic

translation initiation and principles of its regulation." Nat Rev Mol Cell Biol 11(2): 113-

127.

Jan, E. and Sarnow, P. (2002). "Factorless Ribosome Assembly on the Internal Ribosome Entry

Site of Cricket Paralysis Virus." J Mol Biol 324(5): 889-902.

Jarvis, W. R. (1995). "Epidemiology of nosocomial fungal infections, with emphasis on

Candida species." Clin Infect Dis 20(6): 1526-1530.

Jennings, M. D. and Pavitt, G. D. (2010). "eIF5 has GDI activity necessary for translational

control by eIF2 phosphorylation." Nature 465(7296): 378-381.

Jiang, H.-Y. and Wek, R. C. (2005). "Phosphorylation of the α-subunit of the eukaryotic

initiation factor-2 (eIF2α) reduces protein synthesis and enhances apoptosis in response

to proteasome inhibition." J Biol Chem 280(14): 14189-14202.

Johannes, G., Carter, M. S., Eisen, M. B., Brown, P. O. and Sarnow, P. (1999). "Identification

of eukaryotic mRNAs that are translated at reduced cap binding complex eIF4F

223

concentrations using a cDNA microarray." Proc Natl Acad Sci U S A 96(23): 13118-

13123.

Joo, J. H., Liao, G., Collins, J. B., Grissom, S. F. and Jetten, A. M. (2007). "Farnesol-Induced

Apoptosis in Human Lung Carcinoma Cells Is Coupled to the Endoplasmic Reticulum

Stress Response." Cancer Res 67(16): 7929-7936.

Jung, W. H., Warn, P., Ragni, E., Popolo, L., Nunn, C. D., et al. (2005). "Deletion of PDE2, the

gene encoding the high-affinity cAMP phosphodiesterase, results in changes of the cell

wall and membrane in Candida albicans." Yeast 22(4): 285-294.

Kadosh, D. and Johnson, A. D. (2001). "Rfg1, a protein related to the Saccharomyces cerevisiae

hypoxic regulator Rox1, controls filamentous growth and virulence in Candida

albicans." Mol cell biol 21(7): 2496-2505.

Kadosh, D. and Johnson, A. D. (2005). "Induction of the Candida albicans filamentous growth

program by relief of transcriptional repression: a genome-wide analysis." Mol Biol Cell

16(6): 2903-2912.

Kapasi, P., Chaudhuri, S., Vyas, K., Baus, D., Komar, A. A., et al. (2007). "L13a blocks 48S

assembly: role of a general initiation factor in mRNA-specific translational control."

Mol Cell 25(1): 113-126.

Kapp, L. D. and Lorsch, J. R. (2004). "GTP-dependent recognition of the methionine moiety on

initiator tRNA by translation factor eIF2." J Mol Biol 335(4): 923-936.

Kapp, L. D. and Lorsch, J. R. (2004). "The molecular mechanics of eukaryotic translation."

Annu Rev Biochem 73: 657-704.

Kebaara, B. W., Langford, M. L., Navarathna, D. H., Dumitru, R., Nickerson, K. W., et al.

(2008). "Candida albicans Tup1 is involved in farnesol-mediated inhibition of

filamentous-growth induction." Eukaryot Cell 7(6): 980-987.

Kedersha, N., Stoecklin, G., Ayodele, M., Yacono, P., Lykke-Andersen, J., et al. (2005). "Stress

granules and processing bodies are dynamically linked sites of mRNP remodeling." J

Cell Biol 169(6): 871-884.

Kedersha, N. L., Gupta, M., Li, W., Miller, I. and Anderson, P. (1999). "RNA-binding proteins

TIA-1 and TIAR link the phosphorylation of eIF-2 alpha to the assembly of mammalian

stress granules." J Cell Biol 147(7): 1431-1442.

Keller, W. and Minvielle-Sebastia, L. (1997). "A comparison of mammalian and yeast pre-

mRNA 3′-end processing." Cur Opin Cell Biol 9(3): 329-336.

Kessler, S. H. and Sachs, A. B. (1998). "RNA recognition motif 2 of yeast Pab1p is required for

its functional interaction with eukaryotic translation initiation factor 4G." Mol Cell Biol

18(1): 51-57.

Khoshnevis, S., Gross, T., Rotte, C., Baierlein, C., Ficner, R., et al. (2010). "The iron-sulphur

protein RNase L inhibitor functions in translation termination." EMBO Rep 11(3): 214-

219.

Kim, J. and Sudbery, P. (2011). "Candida albicans, a major human fungal pathogen." J

Microbiol 49(2): 171-177.

Kim, W. J., Kim, J. H. and Jang, S. K. (2007). "Anti-inflammatory lipid mediator 15d-PGJ2

inhibits translation through inactivation of eIF4A." Embo J 26(24): 5020-5032.

Klengel, T., Liang, W. J., Chaloupka, J., Ruoff, C., Schroppel, K., et al. (2005). "Fungal

adenylyl cyclase integrates CO2 sensing with cAMP signaling and virulence." Curr Biol

15(22): 2021-2026.

Knop, M., Siegers, K., Pereira, G., Zachariae, W., Winsor, B., et al. (1999). "Epitope tagging of

yeast genes using a PCR‐based strategy: more tags and improved practical routines."

Yeast 15(10B): 963-972.

Kolupaeva, V. G., Unbehaun, A., Lomakin, I. B., Hellen, C. U. and Pestova, T. V. (2005).

"Binding of eukaryotic initiation factor 3 to ribosomal 40S subunits and its role in

ribosomal dissociation and anti-association." RNA 11(4): 470-486.

Koonin, E. V. (1995). "multidomain organization of eukaryotic guanine-nucleotide exchange

translation initiation-factor eif-2b subunits revealed by analysis of conserved sequence

motifs." Protein Sci 4(8): 1608-1617.

Korneva, E. A., Barabanova, S. V., Golovko, O. I., Nosov, M. A., Novikova, N. S., et al.

(2000). "C-fos and IL-2 Gene Expression in Rat Brain Cells and Splenic Lymphocytes

after Nonantigenic and Antigenic Stimuli." Ann N Y Acad Sci 917(1): 197-209.

224

Kozak, M. (1991). "Structural features in eukaryotic mRNAs that modulate the initiation of

translation." J Biol Chem 266(30): 19867-19870.

Kozak, M. (2005). "Regulation of translation via mRNA structure in prokaryotes and

eukaryotes." Gene 361: 13-37.

Krishnamoorthy, T., Pavitt, G. D., Zhang, F., Dever, T. E. and Hinnebusch, A. G. (2001). "Tight

binding of the phosphorylated alpha subunit of initiation factor 2 (eIF2alpha) to the

regulatory subunits of guanine nucleotide exchange factor eIF2B is required for

inhibition of translation initiation." Mol Cell Biol 21(15): 5018-5030.

Kron, S. J., Styles, C. A. and Fink, G. R. (1994). "Symmetric cell division in pseudohyphae of

the yeast Saccharomyces cerevisiae." Mol Biol Cell 5(9): 1003-1022.

Kruppa, M. (2009). "Quorum sensing and Candida albicans." Mycoses 52(1): 1-10.

Kruppa, M. and Calderone, R. (2006). "Two-component signal transduction in human fungal

pathogens." FEMS Yeast Res 6(2): 149-159.

Kruppa, M., Krom, B. P., Chauhan, N., Bambach, A. V., Cihlar, R. L., et al. (2004). "The two-

component signal transduction protein Chk1p regulates quorum sensing in Candida

albicans." Eukaryot Cell 3(4): 1062-1065.

Kubota, H., Obata, T., Ota, K., Sasaki, T. and Ito, T. (2003). "Rapamycin-induced translational

derepression of GCN4 mRNA involves a novel mechanism for activation of the eIF2

alpha kinase GCN2." J Biol Chem 278(23): 20457-20460.

Kumamoto, C. A. (2005). "A contact-activated kinase signals Candida albicans invasive growth

and biofilm development." Proc Natl Acad Sci U S A 102(15): 5576-5581.

Kusch, H., Engelmann, S., Bode, R., Albrecht, D., Morschhäuser, J., et al. (2008). "A proteomic

view of Candida albicans yeast cell metabolism in exponential and stationary growth

phases." Int Journ Med Microbiol 298(3–4): 291-318.

Kwon-Chung, K. J. and Bennett, J. E. (1992). "Medical mycology." Revista do Instituto de

Medicina Tropical de São Paulo 34: 504-504.

Lachance, P. E., Miron, M., Raught, B., Sonenberg, N. and Lasko, P. (2002). "Phosphorylation

of eukaryotic translation initiation factor 4E is critical for growth." Mol Cell Biol 22(6):

1656-1663.

Laemmli, U.K. (1970) "Cleavage of structural proteins during the assembly of the head of

bacteriophage T4" nature 227:680-685.

Lamphear, B. J., Kirchweger, R., Skern, T. and Rhoads, R. E. (1995). "Mapping of functional

domains in eukaryotic protein synthesis initiation factor 4G (eIF4G) with picornaviral

proteases. Implications for cap-dependent and cap-independent translational initiation."

J Biol Chem 270(37): 21975-21983.

Langford, M. L., Atkin, A. L. and Nickerson, K. W. (2009). "Cellular interactions of farnesol, a

quorum-sensing molecule produced by Candida albicans." Future Microbiol 4(10):

1353-1362.

Larroy, C., Rosario Fernandez, M., Gonzalez, E., Pares, X. and Biosca, J. A. (2003). "Properties

and functional significance of Saccharomyces cerevisiae ADHVI." Chem Biol Interact

143-144: 229-238.

Latreille, M. and Larose, L. (2006). "Nck in a complex containing the catalytic subunit of

protein phosphatase 1 regulates eukaryotic initiation factor 2alpha signaling and cell

survival to endoplasmic reticulum stress." J Biol Chem 281(36): 26633-26644.

Leberer, E., Harcus, D., Broadbent, I. D., Clark, K. L., Dignard, D., et al. (1996). "Signal

transduction through homologs of the Ste20p and Ste7p protein kinases can trigger

hyphal formation in the pathogenic fungus Candida albicans." Proc Natl Acad Sci

93(23): 13217-13222.

Leberer, E., Harcus, D., Dignard, D., Johnson, L., Ushinsky, S., et al. (2001). "Ras links cellular

morphogenesis to virulence by regulation of the MAP kinase and cAMP signalling

pathways in the pathogenic fungus Candida albicans." Mol Microbiol 42(3): 673-687.

Leberer, E., Ziegelbauer, K., Schmidt, A., Harcus, D., Dignard, D., et al. (1997). "Virulence and

hyphal formation of Candida albicans require the Ste20p-like protein kinase CaCla4p."

Curr Biol 7(8): 539-546.

Lee, C. M., Nantel, A., Jiang, L., Whiteway, M. and Shen, S. H. (2004). "The serine/threonine

protein phosphatase SIT4 modulates yeast-to-hypha morphogenesis and virulence in

Candida albicans." Mol Microbiol 51(3): 691-709.

225

Lee, J. H., Pestova, T. V., Shin, B.-S., Cao, C., Choi, S. K., et al. (2002). "Initiation factor

eIF5B catalyzes second GTP-dependent step in eukaryotic translation initiation." Proc

Nat Acad Sci 99(26): 16689-16694.

Lee, K. H., Jun, S., Hur, H. S., Ryu, J. J. and Kim, J. (2005). "Candida albicans protein analysis

during hyphal differentiation using an integrative HA-tagging method." Biochem

Biophys Res Commun 337(3): 784-790.

Lee, S. B., Melkova, Z., Yan, W., Williams, B. R., Hovanessian, A. G., et al. (1993). "The

interferon-induced double-stranded RNA-activated human p68 protein kinase potently

inhibits protein synthesis in cultured cells." Virol 192(1): 380-385.

LeFebvre, A. K., Korneeva, N. L., Trutschl, M., Cvek, U., Duzan, R. D., et al. (2006).

"Translation initiation factor eIF4G-1 binds to eIF3 through the eIF3e subunit." J Biol

Chem 281(32): 22917-22932.

Lengeler, K. B., Davidson, R. C., D'Souza, C., Harashima, T., Shen, W. C., et al. (2000).

"Signal transduction cascades regulating fungal development and virulence." Microbiol

Mol Biol Rev 64(4): 746-785.

Li, B., Nierras, C. R. and Warner, J. R. (1999). "Transcriptional elements involved in the

repression of ribosomal protein synthesis." Mol Cell Biol 19(8): 5393-5404.

Lindqvist, L., Oberer, M., Reibarkh, M., Cencic, R., Bordeleau, M.-E., et al. (2008). "Selective

pharmacological targeting of a DEAD box RNA helicase." PLoS One 3(2): e1583.

Liu, H. (2001). "Transcriptional control of dimorphism in Candida albicans." Curr Opin

Microbiol 4(6): 728-735.

Liu, H., Kohler, J. and Fink, G. R. (1994). "Suppression of hyphal formation in Candida

albicans by mutation of a STE12 homolog." Science 266(5191): 1723-1726.

Livak, K. J. and Schmittgen, T. D. (2001). "Analysis of relative gene expression data using real-

time quantitative PCR and the 2(-Delta Delta C(T)) Method." Methods 25(4): 402-408.

Lo, H.-J., Köhler, J. R., DiDomenico, B., Loebenberg, D., Cacciapuoti, A., et al. (1997).

"Nonfilamentous C. albicans Mutants Are Avirulent." Cell 90(5): 939-949.

Lo, H. J., Kohler, J. R., DiDomenico, B., Loebenberg, D., Cacciapuoti, A., et al. (1997).

"Nonfilamentous C. albicans mutants are avirulent." Cell 90(5): 939-949.

Lorenz, M. C., Bender, J. A. and Fink, G. R. (2004). "Transcriptional Response of Candida

albicans upon Internalization by Macrophages." Eukaryot Cell 3(5): 1076-1087.

Lorenz, M. C., Cutler, N. S. and Heitman, J. (2000). "Characterization of alcohol-induced

filamentous growth in Saccharomyces cerevisiae." Mol Biol Cell 11(1): 183-199.

Lorenz, W. W., McCann, R. O., Longiaru, M. and Cormier, M. J. (1991). "Isolation and

expression of a cDNA encoding Renilla reniformis luciferase." Proc Natl Acad Sci USA

88(10): 4438-4442.

Low, W.-K., Dang, Y., Schneider-Poetsch, T., Shi, Z., Choi, N. S., et al. (2005). "Inhibition of

Eukaryotic Translation Initiation by the Marine Natural Product Pateamine A." Mol

Cell 20(5): 709-722.

Lu, L., Han, A. P. and Chen, J. J. (2001). "Translation initiation control by heme-regulated

eukaryotic initiation factor 2alpha kinase in erythroid cells under cytoplasmic stresses."

Mol Cell Biol 21(23): 7971-7980.

Lu, L., Han, A. P. and Chen, J. J. (2001). "Translation initiation control by heme-regulated

eukaryotic initiation factor 2alpha kinase in erythroid cells under cytoplasmic stresses."

Mol cell biol 21(23): 7971-7980.

Luthe, D. S. (1983). "A simple technique for the preparation and storage of sucrose gradients."

Anal Biochem 135(1): 230-232.

Machida, K., Tanaka, T., Fujita, K.-i. and Taniguchi, M. (1998). "Farnesol-Induced Generation

of Reactive Oxygen Species via Indirect Inhibition of the Mitochondrial Electron

Transport Chain in the Yeast Saccharomyces cerevisiae." J Bacteriol 180(17): 4460-

4465.

Machida, K., Tanaka, T., Yano, Y., Otani, S. and Taniguchi, M. (1999). "Farnesol-induced

growth inhibition in Saccharomyces cerevisiae by a cell cycle mechanism."

Microbiology 145 ( Pt 2): 293-299.

Madhani, H. D. and Fink, G. R. (1997). "Combinatorial control required for the specificity of

yeast MAPK signaling." Science 275(5304): 1314-1317.

Majumdar, R. and Maitra, U. (2005). "Regulation of GTP hydrolysis prior to ribosomal AUG

selection during eukaryotic translation initiation." EMBO J 24(21): 3737-3746.

226

Marsden, S., Nardelli, M., Linder, P. and McCarthy, J. E. G. (2006). "Unwinding Single RNA

Molecules Using Helicases Involved in Eukaryotic Translation Initiation." J Mol Biol

361(2): 327-335.

Martin, R., Moran, G. P., Jacobsen, I. D., Heyken, A., Domey, J., et al. (2011). "The Candida

albicans-specific gene EED1 encodes a key regulator of hyphal extension." PLoS One

6(4): e18394.

Martinez-Anaya, C., Dickinson, J. R. and Sudbery, P. E. (2003). "In yeast, the pseudohyphal

phenotype induced by isoamyl alcohol results from the operation of the morphogenesis

checkpoint." J Cell Sci 116(Pt 16): 3423-3431.

Martins, M., Henriques, M., Azeredo, J., Rocha, S. M., Coimbra, M. A., et al. (2007).

"Morphogenesis control in Candida albicans and Candida dubliniensis through

signaling molecules produced by planktonic and biofilm cells." Eukaryot Cell 6(12):

2429-2436.

Mascarenhas, C., Edwards-Ingram, L. C., Zeef, L., Shenton, D., Ashe, M. P., et al. (2008).

"Gcn4 is required for the response to peroxide stress in the yeast Saccharomyces

cerevisiae." Mol Biol Cell 19(7): 2995-3007.

Mathews, M., Sonenberg, N. and Hershey, J. W. (2007). Translational control in biology and

medicine, CSHL Press.

Matsuo, H., Li, H., McGuire, A. M., Fletcher, C. M., Gingras, A. C., et al. (1997). "Structure of

translation factor eIF4E bound to m7GDP and interaction with 4E-binding protein." Nat

Struct Biol 4(9): 717-724.

McCarthy, J. E. G. (1998). "Posttranscriptional Control of Gene Expression in Yeast."

Microbiol Mol Biol Rev 62(4): 1492-1553.

Merrick, W. C. (2004). "Cap-dependent and cap-independent translation in eukaryotic systems."

Gene 332(0): 1-11.

Miller, M. B. and Bassler, B. L. (2001). "Quorum sensing in bacteria." Ann Rev Microbiol

55(1): 165-199.

Miller, M. G. and Johnson, A. D. (2002). "White-Opaque Switching in Candida albicans Is

Controlled by Mating-Type Locus Homeodomain Proteins and Allows Efficient

Mating." Cell 110(3): 293-302.

Milne, S. W., Cheetham, J., Lloyd, D., Aves, S. and Bates, S. (2011). "Cassettes for PCR-

mediated gene tagging in Candida albicans utilizing nourseothricin resistance." Yeast

28(12): 833-841.

Miwa, T., Takagi, Y., Shinozaki, M., Yun, C. W., Schell, W. A., et al. (2004). "Gpr1, a putative

G-protein-coupled receptor, regulates morphogenesis and hypha formation in the

pathogenic fungus Candida albicans." Eukaryot Cell 3(4): 919-931.

Mohammad-Qureshi, S. S., Haddad, R., Palmer, K. S., Richardson, J. P., Gomez, E., et al.

(2007). "Purification of FLAG-tagged eukaryotic initiation factor 2B complexes,

subcomplexes, and fragments from Saccharomyces cerevisiae." Methods Enzymol 431:

1-13.

Mohammad-Qureshi, S. S., Haddad, R., Palmer, K. S., Richardson, J. P., Gomez, E., et al.

(2007). "Purification of FLAG-Tagged eukaryotic initiation factor 2B complexes,

subcomplexes, and fragments from Sacchoromyces cerevisiae." Translation Initiation:

Cell Biology, High-Throughput Methods, and Chemical-Based Approaches 431: 1-13.

Monge, R. A., Roman, E., Nombela, C. and Pla, J. (2006). "The MAP kinase signal transduction

network in Candida albicans." Microbiology 152(Pt 4): 905-912.

Mosel, D. D., Dumitru, R., Hornby, J. M., Atkin, A. L. and Nickerson, K. W. (2005). "Farnesol

concentrations required to block germ tube formation in Candida albicans in the

presence and absence of serum." Appl Environ Microbiol 71(8): 4938-4940.

Murad, A. M., d'Enfert, C., Gaillardin, C., Tournu, H., Tekaia, F., et al. (2001). "Transcript

profiling in Candida albicans reveals new cellular functions for the transcriptional

repressors CaTup1, CaMig1 and CaNrg1." Mol Microbiol 42(4): 981-993.

Natarajan, K., Meyer, M. R., Jackson, B. M., Slade, D., Roberts, C., et al. (2001).

"Transcriptional profiling shows that Gcn4p is a master regulator of gene expression

during amino acid starvation in yeast." Mol Cell Biol 21(13): 4347-4368.

Navarro-Garcia, F., Alonso-Monge, R., Rico, H., Pla, J., Sentandreu, R., et al. (1998). "A role

for the MAP kinase gene MKC1 in cell wall construction and morphological

transitions in Candida albicans." Microbiology 144 ( Pt 2): 411-424.

227

Navarro-Garcia, F., Eisman, B., Fiuza, S. M., Nombela, C. and Pla, J. (2005). "The MAP kinase

Mkc1p is activated under different stress conditions in Candida albicans."

Microbiology 151(Pt 8): 2737-2749.

Navarro-Garcia, F., Sanchez, M., Pla, J. and Nombela, C. (1995). "Functional characterization

of the MKC1 gene of Candida albicans, which encodes a mitogen-activated protein

kinase homolog related to cell integrity." Mol cell biol 15(4): 2197-2206.

Nemecek, J. C., Wüthrich, M. and Klein, B. S. (2006). "Global Control of Dimorphism and

Virulence in Fungi." Science 312(5773): 583-588.

Nickerson, K. W., Atkin, A. L. and Hornby, J. M. (2006). "Quorum sensing in dimorphic fungi:

farnesol and beyond." App Environ Microbiol 72(6): 3805-3813.

Nielsen, K. H., Szamecz, B., Valasek, L., Jivotovskaya, A., Shin, B. S., et al. (2004). "Functions

of eIF3 downstream of 48S assembly impact AUG recognition and GCN4 translational

control." EMBO J 23(5): 1166-1177.

Nobile, C. J., Fox, E. P., Nett, J. E., Sorrells, T. R., Mitrovich, Q. M., et al. (2012). "A Recently

Evolved Transcriptional Network Controls Biofilm Development in Candida albicans."

Cell 148(1): 126-138.

Novoa, I., Zhang, Y., Zeng, H., Jungreis, R., Harding, H. P., et al. (2003). "Stress-induced gene

expression requires programmed recovery from translational repression." EMBO J

22(5): 1180-1187.

O'Connor, L., Caplice, N., Coleman, D. C., Sullivan, D. J. and Moran, G. P. (2010).

"Differential filamentation of Candida albicans and Candida dubliniensis is governed

by nutrient regulation of UME6 expression." Eukaryot Cell 9(9): 1383-1397.

Oberer, M., Marintchev, A. and Wagner, G. (2005). "Structural basis for the enhancement of

eIF4A helicase activity by eIF4G." Genes Dev 19(18): 2212-2223.

Odds, F. C. (1988). Candida and Candidosis, Elsevier Science Health Science Division.

Odds, F. C. (1994). "Pathogenesis of Candida infections." J Am Acad Dermatol 31(3, Part 2):

S2-S5.

Ogle, J. M., Brodersen, D. E., Clemons, W. M., Jr., Tarry, M. J., Carter, A. P., et al. (2001).

"Recognition of cognate transfer RNA by the 30S ribosomal subunit." Science

292(5518): 897-902.

Oh, K. B., Miyazawa, H., Naito, T. and Matsuoka, H. (2001). "Purification and characterization

of an autoregulatory substance capable of regulating the morphological transition in

Candida albicans." Proc Natl Acad Sci U S A 98(8): 4664-4668.

Otero, L. J., Ashe, M. P. and Sachs, A. B. (1999). "The yeast poly(A)-binding protein Pab1p

stimulates in vitro poly(A)-dependent and cap-dependent translation by distinct

mechanisms." EMBO J 18(11): 3153-3163.

Palam, L. R., Baird, T. D. and Wek, R. C. (2011). "Phosphorylation of eIF2 facilitates

ribosomal bypass of an inhibitory upstream ORF to enhance CHOP translation." J Biol

Chem 286(13): 10939-10949.

Palmer, L. K., Rannels, S. L., Kimball, S. R., Jefferson, L. S. and Keil, R. L. (2006). "Inhibition

of mammalian translation initiation by volatile anesthetics." Am J Physiol-Endocrinol

Metabol 290(6): E1267-E1275.

Palmer, L. K., Shoemaker, J. L., Baptiste, B. A., Wolfe, D. and Keil, R. L. (2005). "Inhibition of

translation initiation by volatile anesthetics involves nutrient-sensitive GCN-

independent and -dependent processes in yeast." Mol Biol Cell 16(8): 3727-3739.

Pavitt, G. D. (2005). "eIF2B, a mediator of general and gene-specific translational control."

Biochem Soc T 33(Pt 6): 1487-1492.

Pavitt, G. D., Ramaiah, K. V., Kimball, S. R. and Hinnebusch, A. G. (1998). "eIF2

independently binds two distinct eIF2B subcomplexes that catalyze and regulate

guanine-nucleotide exchange." Genes Dev 12(4): 514-526.

Pestova, T. V., Hellen, C. U. and Shatsky, I. N. (1996). "Canonical eukaryotic initiation factors

determine initiation of translation by internal ribosomal entry." Mol cell biol 16(12):

6859-6869.

Pestova, T. V., Lorsch, J. R. and Hellen, C. U. (2007). "4 The Mechanism of Translation

Initiation in Eukaryotes." Cold Spring Harbor Monograph Archive 48: 87-128.

Pestova, T. V., Shatsky, I. N., Fletcher, S. P., Jackson, R. J. and Hellen, C. U. (1998). "A

prokaryotic-like mode of cytoplasmic eukaryotic ribosome binding to the initiation

228

codon during internal translation initiation of hepatitis C and classical swine fever virus

RNAs." Genes Dev 12(1): 67-83.

Pfaller, M. A. and Diekema, D. J. (2007). "Epidemiology of invasive candidiasis: a persistent

public health problem." Clin Microbiol Rev 20(1): 133-163.

Piskur, J., Rozpedowska, E., Polakova, S., Merico, A. and Compagno, C. (2006). "How did

Saccharomyces evolve to become a good brewer?" Trends Genet 22(4): 183-186.

Pittet, D. and Wenzel, R. P. (1995). "Nosocomial bloodstream infections. Secular trends in

rates, mortality, and contribution to total hospital deaths." Arch Intern Med 155(11):

1177-1184.

Pollack, J. H. and Hashimoto, T. (1985). "Ethanol-induced germ tube formation in Candida

albicans." J Gen Microbiol 131(12): 3303-3310.

Preiss, T., Baron-Benhamou, J., Ansorge, W. and Hentze, M. W. (2003). "Homodirectional

changes in transcriptome composition and mRNA translation induced by rapamycin and

heat shock." Nat Struct Biol 10(12): 1039-1047.

Pronk, J. T., Yde Steensma, H. and Van Dijken, J. P. (1996). "Pyruvate Metabolism in

Saccharomyces cerevisiae." Yeast 12(16): 1607-1633.

Proud, C. G. (2005). "The eukaryotic initiation factor 4E-binding proteins and apoptosis." Cell

Death Differ 12(6): 541-546.

Puig, O., Caspary, F., Rigaut, G., Rutz, B., Bouveret, E., et al. (2001). "The tandem affinity

purification (TAP) method: a general procedure of protein complex purification."

Methods-a Companion to Methods in Enzymology 24(3): 218-229.

Qin, X. and Sarnow, P. (2004). "Preferential translation of internal ribosome entry site-

containing mRNAs during the mitotic cycle in mammalian cells." J Biol Chem 279(14):

13721-13728.

Quinlan, A. R. and Hall, I. M. (2010). "BEDTools: a flexible suite of utilities for comparing

genomic features." Bioinformatics 26(6): 841-842.

Ramage, G., Bachmann, S., Patterson, T. F., Wickes, B. L. and Lopez-Ribot, J. L. (2002).

"Investigation of multidrug efflux pumps in relation to fluconazole resistance in

Candida albicans biofilms." J Antimicrob Chemother 49(6): 973-980.

Ramage, G., Saville, S. P., Wickes, B. L. and Lopez-Ribot, J. L. (2002). "Inhibition of Candida

albicans biofilm formation by farnesol, a quorum-sensing molecule." Appl Environ

Microbiology 68(11): 5459-5463.

Ramage, G., VandeWalle, K., Bachmann, S. P., Wickes, B. L. and Lopez-Ribot, J. L. (2002).

"In vitro pharmacodynamic properties of three antifungal agents against preformed

Candida albicans biofilms determined by time-kill studies." Antimicrob Agents Ch

46(11): 3634-3636.

Raudonis, B. M. and Smith, A. G. (1982). "Germination of the chlamydospores of Candida

albicans." Mycopathologia 78(2): 87-91.

Raz, T., Kapranov, P., Lipson, D., Letovsky, S., Milos, P. M., et al. (2011). "Protocol

dependence of sequencing-based gene expression measurements." PLoS One 6(5):

e19287.

Richardson, J. P., Mohammad, S. S. and Pavitt, G. D. (2004). "Mutations causing childhood

ataxia with central nervous system hypomyelination reduce eukaryotic initiation factor

2B complex formation and activity." Mol Cell Biol 24(6): 2352-2363.

Richardson, M. D. (2005). "Changing patterns and trends in systemic fungal infections." J

Antimicrob Ch 56 Suppl 1: i5-i11.

Richter, J. D. and Sonenberg, N. (2005). "Regulation of cap-dependent translation by eIF4E

inhibitory proteins." Nature 433(7025): 477-480.

Richter, J. D. and Sonenberg, N. (2005). "Regulation of cap-dependent translation by eIF4E

inhibitory proteins." Nature 433(7025): 477-480.

Rocha, C. R., Schröppel, K., Harcus, D., Marcil, A., Dignard, D., et al. (2001). "Signaling

through adenylyl cyclase is essential for hyphal growth and virulence in the pathogenic

fungus Candida albicans." Mol Biol Cell 12(11): 3631-3643.

Rocha, R., Pereira, P. J. B., Santos, M. A. S. and Macedo-Ribeiro, S. (2011). "Unveiling the

structural basis for translational ambiguity tolerance in a human fungal pathogen." Proc

Natl Acad Sci 108(34): 14091-14096.

Rodnina, M. V. and Wintermeyer, W. (2001). "Fidelity of aminoacyl-tRNA selection on the

ribosome: kinetic and structural mechanisms." Annu Rev Biochem 70: 415-435.

229

Rolfes, R. J. and Hinnebusch, A. G. (1993). "Translation of the yeast transcriptional activator

GCN4 is stimulated by purine limitation: implications for activation of the protein

kinase GCN2." Mol Cell Biol 13(8): 5099-5111.

Roman, E., Alonso-Monge, R., Gong, Q., Li, D., Calderone, R., et al. (2009). "The Cek1

MAPK is a short-lived protein regulated by quorum sensing in the fungal pathogen

Candida albicans." FEMS Yeast Res 9(6): 942-955.

Ross, I. K., De Bernardis, F., Emerson, G. W., Cassone, A. and Sullivan, P. A. (1990). "The

secreted aspartate proteinase of Candida albicans: physiology of secretion and

virulence of a proteinase-deficient mutant." J Gen Microbiol 136(4): 687-694.

Russell, P. J. (2010) Structure of eukaryotic ribosomes iGenetics 3rd

ed.

Sabie, F. and Gadd, G. (1992). "Effect of nucleosides and nucleotides and the relationship

between cellular adenosine 3′∶ 5′-cyclic monophosphate (cyclic AMP) and germ tube

formation in Candida albicans." Mycopath 119(3): 147-156.

Sachs, A. B. (2000). Physical and functional interactions between the mRNA cap structure and

the poly(A) tail. Translational control of gene expression. N. Sonenberg, J. W. B.

Hershey and M. B. Mathews. Cold Spring Harbor, New York, Cold Spring Harbor

Laboratory Press: 447-465.

Sachs, A. B. and Davis, R. W. (1989). "The poly(A) binding protein is required for poly(A)

shortening and 60S ribosomal subunit-dependent translation initiation." Cell 58(5): 857-

867.

Salgueiro, S. P., Sa-Correia, I. and Novais, J. M. (1988). "Ethanol-Induced Leakage in

Saccharomyces cerevisiae: Kinetics and Relationship to Yeast Ethanol Tolerance and

Alcohol Fermentation Productivity." Appl Environ Microbiol 54(4): 903-909.

Sambrook, J. and Russel, D.W. (2001). Molecular Cloning A Laboratory Manual. Vol. 3. J.

Argentine, editor. Cold Spring Harbour Laboratory Press, New York.

Sasikumar, A. N. and Kinzy, T. G. (2014). "Mutations in the chromodomain-like insertion of

translation elongation factor 3 compromise protein synthesis through reduced ATPase

activity." J Biol Chem 289(8): 4853-4860.

Sato, T., Watanabe, T., Mikami, T. and Matsumoto, T. (2004). "Farnesol, a Morphogenetic

Autoregulatory Substance in the Dimorphic Fungus Candida albicans, Inhibits Hyphae

Growth through Suppression of a Mitogen-Activated Protein Kinase Cascade." Biol

Pharmaceut Bulletin 27(5): 751-752.

Schmid, S. R. and Linder, P. (1991). "Translation Initiation Factor-4a from Saccharomyces-

cerevisiae - Analysis of Residues Conserved in the D-E-a-D Family of RNA Helicases."

Mol Cell Biol 11(7): 3463-3471.

Schmid, S. R. and Linder, P. (1992). "D-E-A-D protein family of putative RNA helicases." Mol

Microbiol 6(3): 283-292.

Schweizer, A., Rupp, S., Taylor, B. N., Rollinghoff, M. and Schroppel, K. (2000). "The

TEA/ATTS transcription factor CaTec1p regulates hyphal development and virulence

in Candida albicans." Mol Microbiol 38(3): 435-445.

Searfoss, A., Dever, T. E. and Wickner, R. (2001). "Linking the 3' poly(A) tail to the subunit

joining step of translation initiation: relations of Pab1p, eukaryotic translation initiation

factor 5b (Fun12p), and Ski2p-Slh1p." Mol Cell Biol 21(15): 4900-4908.

Shchepin, R., Dumitru, R., Nickerson, K. W., Lund, M. and Dussault, P. H. (2005).

"Biologically active fluorescent farnesol analogs." Chem Biol 12(6): 639-641.

Shchepin, R., Hornby, J. M., Burger, E., Niessen, T., Dussault, P., et al. (2003). "Quorum

sensing in Candida albicans: probing farnesol's mode of action with 40 natural and

synthetic farnesol analogs." Chem Biol 10(8): 743-750.

Shenton, D., Smirnova, J. B., Selley, J. N., Carroll, K., Hubbard, S. J., et al. (2006). "Global

translational responses to oxidative stress impact upon multiple levels of protein

synthesis." J Biol Chem 281(39): 29011-29021.

Sheth, U. and Parker, R. (2003). "Decapping and decay of messenger RNA occur in cytoplasmic

processing bodies." Science 300(5620): 805-808.

Shibagaki, Y., Itoh, N., Yamada, H., Nagata, S. and Mizumoto, K. (1992). "mRNA capping

enzyme. Isolation and characterization of the gene encoding mRNA guanylytransferase

subunit from Saccharomyces cerevisiae." J Biol Chem 267(14): 9521-9528.

230

Shine, J. and Dalgarno, L. (1975). "Terminal-sequence analysis of bacterial ribosomal RNA.

Correlation between the 3'-terminal-polypyrimidine sequence of 16-S RNA and

translational specificity of the ribosome." Eur J Biochem 57(1): 221-230.

Shirtliff, M. E., Krom, B. P., Meijering, R. A., Peters, B. M., Zhu, J., et al. (2009). "Farnesol-

induced apoptosis in Candida albicans." Antimicrob Agents Ch 53(6): 2392-2401.

Si, H., Hernday, A. D., Hirakawa, M. P., Johnson, A. D. and Bennett, R. J. (2013). "Candida

albicans white and opaque cells undergo distinct programs of filamentous growth."

PLoS Pathog 9(3): e1003210.

Simpson, C. and Ashe, M. (2012). "Adaptation to stress in yeast: to translate or not?" Biochem

Soc T 40(4): 794.

Slobin, L. I. and Moller, W. (1978). "Purification and properties of an elongation factor

functionally analogous to bacterial elongation factor Ts from embryos of Artemia

salina." Eur J Biochem 84(1): 69-77.

Slutsky, B., Staebell, M., Anderson, J., Risen, L., Pfaller, M., et al. (1987). "" White-opaque

transition": a second high-frequency switching system in Candida albicans." J Bacteriol

169(1): 189-197.

Smirnova, J. B., Selley, J. N., Sanchez-Cabo, F., Carroll, K., Eddy, A. A., et al. (2005). "Global

gene expression profiling reveals widespread yet distinctive translational responses to

different eukaryotic translation initiation factor 2B-targeting stress pathways." Mol Cell

Biol 25(21): 9340-9349.

Sohn, K., Urban, C., Brunner, H. and Rupp, S. (2003). "EFG1 is a major regulator of cell wall

dynamics in Candida albicans as revealed by DNA microarrays." Mol Microbiol 47(1):

89-102.

Sonneborn, A., Bockmuhl, D. P., Gerads, M., Kurpanek, K., Sanglard, D., et al. (2000). "Protein

kinase A encoded by TPK2 regulates dimorphism of Candida albicans." Mol Microbiol

35(2): 386-396.

Sprecher, E. and Hanssen, H.-P. (1983). "Distribution and strain-dependent formation of volatile

metabolites in the genus Ceratocystis." Antonie van Leeuwenhoek 49(4-5): 493-499.

Srikantha, T., Klapach, A., Lorenz, W. W., Tsai, L. K., Laughlin, L. A., et al. (1996). "The sea

pansy Renilla reniformis luciferase serves as a sensitive bioluminescent reporter for

differential gene expression in Candida albicans." J Bacteriol 178(1): 121-129.

Staab, J. F. and Sundstrom, P. (2003). "URA3 as a selectable marker for disruption and

virulence assessment of Candida albicans genes." Trends Microbiol 11(2): 69-73.

Staib, P. and Morschhäuser, J. (2007). "Chlamydospore formation in Candida albicans and

Candida dubliniensis– an enigmatic developmental programme." Mycoses 50(1): 1-12.

Sudbery, P., Gow, N. and Berman, J. (2004). "The distinct morphogenic states of Candida

albicans." Trends Microbiol 12(7): 317-324.

Sudbery, P. E. (2011). "Growth of Candida albicans hyphae." Nat Rev Microbiol 9(10): 737-

748.

Sundaram, A. and Grant, C. M. (2014). "Oxidant-specific regulation of protein synthesis in

Candida albicans." Fung Genet Biol 67: 15-23.

Sundaram, A. and Grant, C. M. (2014). "A single inhibitory upstream open reading frame

(uORF) is sufficient to regulate Candida albicans GCN4 translation in response to

amino acid starvation conditions." RNA.

Sundaram, A. and Grant, C. M. (2014). "A single inhibitory upstream open reading frame

(uORF) is sufficient to regulate Candida albicans GCN4 translation in response to

amino acid starvation conditions." RNA 20(4): 559-567.

Tanner, N. K., Cordin, O., Banroques, J., Doère, M. and Linder, P. (2003). "The Q Motif: A

Newly Identified Motif in DEAD Box Helicases May Regulate ATP Binding and

Hydrolysis." Mol Cell 11(1): 127-138.

Tarun, S. Z., Jr. and Sachs, A. B. (1995). "A common function for mRNA 5' and 3' ends in

translation initiation in yeast." Genes Dev 9(23): 2997-3007.

Tarun, S. Z., Jr. and Sachs, A. B. (1996). "Association of the yeast poly(A) tail binding protein

with translation initiation factor eIF-4G." Embo J 15(24): 7168-7177.

Taylor, D. J., Nilsson, J., Merrill, A. R., Andersen, G. R., Nissen, P., et al. (2007). "Structures

of modified eEF2· 80S ribosome complexes reveal the role of GTP hydrolysis in

translocation." EMBO J 26(9): 2421-2431.

231

Taylor, E. J., Campbell, S. G., Griffiths, C. D., Reid, P. J., Slaven, J. W., et al. (2010). "Fusel

alcohols regulate translation initiation by inhibiting eIF2B to reduce ternary complex in

a mechanism that may involve altering the integrity and dynamics of the eIF2B body."

Mol Biol Cell 21(13): 2202-2216.

Tournu, H., Tripathi, G., Bertram, G., Macaskill, S., Mavor, A., et al. (2005). "Global role of the

protein kinase Gcn2 in the human pathogen Candida albicans." Eukaryot Cell 4(10):

1687-1696.

Tripathi, G., Wiltshire, C., Macaskill, S., Tournu, H., Budge, S., et al. (2002). "Gcn4 co-

ordinates morphogenetic and metabolic responses to amino acid starvation in Candida

albicans." Embo J 21(20): 5448-5456.

Tsukamoto, T., Shibagaki, Y., Imajoh-Ohmi, S., Murakoshi, T., Suzuki, M., et al. (1997).

"Isolation and characterization of the yeast mRNA capping enzyme beta subunit gene

encoding RNA 5'-triphosphatase, which is essential for cell viability." Biochem

Biophys Res Commun 239(1): 116-122.

Uppuluri, P., Mekala, S. and Chaffin, W. L. (2007). "Farnesol-mediated inhibition of Candida

albicans yeast growth and rescue by a diacylglycerol analogue." Yeast 24(8): 681-693.

Valasek, L., Mathew, A. A., Shin, B. S., Nielsen, K. H., Szamecz, B., et al. (2003). "The yeast

eIF3 subunits TIF32/a, NIP1/c, and eIF5 make critical connections with the 40S

ribosome in vivo." Genes Dev 17(6): 786-799.

van den Elzen, A. M., Schuller, A., Green, R. and Seraphin, B. (2014). "Dom34-Hbs1 mediated

dissociation of inactive 80S ribosomes promotes restart of translation after stress."

EMBO J 33(3): 265-276.

van der Knaap, M. S., Leegwater, P. A., Konst, A. A., Visser, A., Naidu, S., et al. (2002).

"Mutations in each of the five subunits of translation initiation factor eIF2B can cause

leukoencephalopathy with vanishing white matter." Ann Neurol 51(2): 264-270.

Vattem, K. M. and Wek, R. C. (2004). "Reinitiation involving upstream ORFs regulates ATF4

mRNA translation in mammalian cells." Proc Natl Acad Sci U S A 101(31): 11269-

11274.

von der Haar, T. and McCarthy, J. E. (2002). "Intracellular translation initiation factor levels in

Saccharomyces cerevisiae and their role in cap-complex function." Mol Microbiol

46(2): 531-544.

Wang, X., Paulin, F. E., Campbell, L. E., Gomez, E., O'Brien, K., et al. (2001). "Eukaryotic

initiation factor 2B: identification of multiple phosphorylation sites in the epsilon-

subunit and their functions in vivo." Embo J 20(16): 4349-4359.

Wang, X. L., Cai, H. P., Ge, J. H. and Su, X. F. (2012). "Detection of eukaryotic translation

initiation factor 4E and its clinical significance in hepatocellular carcinoma." World J

Gastroenterol 18(20): 2540-2544.

Wang, Z., Gerstein, M. and Snyder, M. (2009). "RNA-Seq: a revolutionary tool for

transcriptomics." Nat Rev Genet 10(1): 57-63.

Webb, A. D. and Ingraham, J. L. (1963). "Fusel oil." Adv. Appl. Microbiol 5: 317-353.

Wek, R. C., Cannon, J. F., Dever, T. E. and Hinnebusch, A. G. (1992). "Truncated protein

phosphatase GLC7 restores translational activation of GCN4 expression in yeast

mutants defective for the eIF-2 alpha kinase GCN2." Mol Cell Biol 12(12): 5700-5710.

Wek, R. C., Jiang, H. Y. and Anthony, T. G. (2006). "Coping with stress: eIF2 kinases and

translational control." Biochem Soc T 34(Pt 1): 7-11.

Wek, S. A., Zhu, S. and Wek, R. C. (1995). "The histidyl-tRNA synthetase-related sequence in

the eIF-2 alpha protein kinase GCN2 interacts with tRNA and is required for activation

in response to starvation for different amino acids." Mol cell biol 15(8): 4497-4506.

Wells, S. E., Hillner, P. E., Vale, R. D. and Sachs, A. B. (1998). "Circularization of mRNA by

Eukaryotic Translation Initiation Factors." Mol Cell 2(1): 135-140.

Wells, S. E., Hillner, P. E., Vale, R. D. and Sachs, A. B. (1998). "Circularization of mRNA by

eukaryotic translation initiation factors." Mol Cell 2(1): 135-140.

Welsh, G. I., Miller, C. M., Loughlin, A. J., Price, N. T. and Proud, C. G. (1998). "Regulation of

eukaryotic initiation factor eIF2B: glycogen synthase kinase-3 phosphorylates a

conserved serine which undergoes dephosphorylation in response to insulin." FEBS

Letters 421(2): 125-130.

Westermann, A. J., Gorski, S. A. and Vogel, J. (2012). "Dual RNA-seq of pathogen and host."

Nat Rev Microbiol 10(9): 618-630.

232

Westwater, C., Balish, E. and Schofield, D. A. (2005). "Candida albicans-conditioned medium

protects yeast cells from oxidative stress: a possible link between quorum sensing and

oxidative stress resistance." Eukaryot Cell 4(10): 1654-1661.

Whiteway, M. (2000). "Transcriptional control of cell type and morphogenesis in Candida

albicans." Curr Opin Microbiol 3(6): 582-588.

Williams, D. D., Pavitt, G. D. and Proud, C. G. (2001). "Characterization of the initiation factor

eIF2B and its regulation in Drosophila melanogaster." J Biol Chem 276(6): 3733-3742.

Wilson, R. B., Davis, D., Enloe, B. M. and Mitchell, A. P. (2000). "A recyclable Candida

albicans URA3 cassette for PCR product-directed gene disruptions." Yeast 16(1): 65-

70.

Wilson, R. B., Davis, D. and Mitchell, A. P. (1999). "Rapid Hypothesis Testing with Candida

albicans through Gene Disruption with Short Homology Regions." J Bacteriol 181(6):

1868-1874.

Wurdinger, T., Badr, C., Pike, L., de Kleine, R., Weissleder, R., et al. (2008). "A secreted

luciferase for ex-vivo monitoring of in vivo processes." Nat Methods 5(2): 171-173.

Xiang, H., Zhu, J., Chen, Q., Dai, F., Li, X., et al. (2010). "Single base-resolution methylome of

the silkworm reveals a sparse epigenomic map." Nat Biotech 28(5): 516-520.

Yamasaki, S. and Anderson, P. (2008). "Reprogramming mRNA translation during stress." Curr

Opin Cell Biol 20(2): 222-226.

Yoon, H. J. and Donahue, T. F. (1992). "The suil suppressor locus in Saccharomyces cerevisiae

encodes a translation factor that functions during tRNA(iMet) recognition of the start

codon." Mol cell biol 12(1): 248-260.

Zakikhany, K., Naglik, J. R., Schmidt‐Westhausen, A., Holland, G., Schaller, M., et al. (2007).

"In vivo transcript profiling of Candida albicans identifies a gene essential for

interepithelial dissemination." Cell microbiol 9(12): 2938-2954.

Zeuthen, M. L., Dabrowa, N., Aniebo, C. M. and Howard, D. H. (1988). "Ethanol tolerance and

the induction of stress proteins by ethanol in Candida albicans." J Gen Microbiol

134(5): 1375-1384.

Zhao, X., Mehrabi, R. and Xu, J.-R. (2007). "Mitogen-activated protein kinase pathways and

fungal pathogenesis." Eukaryot Cell 6(10): 1701-1714.

Zheng, X., Wang, Y. and Wang, Y. (2004). "Hgc1, a novel hypha‐specific G1 cyclin‐related

protein regulates Candida albicans hyphal morphogenesis." EMBO J 23(8): 1845-1856.

Zhu, J., Krom, B. P., Sanglard, D., Intapa, C., Dawson, C. C., et al. (2011). "Farnesol-induced

apoptosis in Candida albicans is mediated by Cdr1-p extrusion and depletion of

intracellular glutathione." PLoS One 6(12): e28830.

233

9. Appendix

Transcriptionally up regulated genes

GO-Slim term Cluster

frequency Genes annotated to the term

response to

stress

34 out of 312 genes, 10.9%

APR1, C1_02390W_A, C1_06600W_A, C1_07980C_A, C2

_10470C_A, C3_02290W_A, C3_04810C_A, C4_00390W_

A,C4_01720C_A, C4_07010C_A, C5_02110W_A, C5_0506

0C_A, CHT2, EAF7, EFG1, HMS1, HSP104, HSP12, HSP

21, HSP78,MAL2, MDJ1, MEP2, PGA14, PGA4, PRX1, R

PB4, SOD4, SOD5, SPT6, TIF34, TUP1, VID27, VRP1

response to

chemical

31 out of 312 genes, 9.9%

ACH1, C1_14190C_A, C5_02110W_A, C5_02480W_A, C6

_01400W_A, C7_00250C_A, CCS1, COQ5, EFG1, GAR1,

HMS1,HSP104, HSP21, LAC1, LEU4, MDG1, MEP2, ME

T4, NAG6, PGA14, PGA31, PGA4, PGA62, PRX1, RCA1, SOD4, SOD5,SPT6, TIF34, TUP1, VID27

filamentous

growth

27 out of 312

genes, 8.7%

AAF1, C1_05980W_A, C1_14190C_A, C3_02290W_A, C3

_06700C_A, C7_00120W_A, CDC11, CHT2, EFG1, HMS

1, HSP21,LAC1, LPD1, MAL2, MEP2, MNT2, PDA1, PG

A13, PGA59, RCA1, RPB4, SLR1, SPT6, SUN41, TUP1, V

ID27, VRP1

generation of

precursor

metabolites and

energy

22 out of 312

genes, 7.1%

ACO1, ACO2, C1_14190C_A, C2_07190C_A, C3_06700C

_A, C5_05230C_A, C6_00920W_A, CIT1, COQ5, CYT1, ETR1, FUM12,IDH2, KGD1, KGD2, MAM33, MDH1-

1, MRPS9, PDA1, QCR9, RIP1, SDH12

RNA metabolic

process

21 out of 312

genes, 6.7%

C2_09040W_A, C2_10560C_A, C3_00130C_A, C3_00730

W_A, C3_05150W_A, C4_00390W_A, C5_02480W_A, C7

_00070C_A,C7_00250C_A, C7_04290W_A, CR_01120C_

A, CR_10820W_A, DTD2, GAR1, HTS1, MSF1, NPL3, R

PB4, RPS24, SPL1, SPT6

cellular

respiration

20 out of 312

genes, 6.4%

ACO1, ACO2, C2_07190C_A, C3_06700C_A, C5_05230C

_A, C6_00920W_A, CIT1, COQ5, CYT1, ETR1, FUM12, IDH2, KGD1,KGD2, MAM33, MDH1-

1, MRPS9, QCR9, RIP1, SDH12

translation

20 out of 312 genes, 6.4%

C1_13060C_A, C2_07190C_A, C3_00450C_A, C3_04810C

_A, C4_03410W_A, C5_00030W_A, C5_00130C_A, CIC1,

HTS1,IMG2, MRPS9, MSF1, NPL3, RPL13, RPS19A, RP

S24, TIF34, TIF35, TUF1, YML6

pathogenesis

18 out of 312

genes, 5.8%

BGL2, CDC11, CRG1, EFG1, HET1, HMS1, HSP104, HS

P21, MNT2, NAG6, NCE102, RHD3, SAM37, SAP3, SLR

1, SOD5,SUN41, TUP1

carbohydrate

metabolic

process

17 out of 312

genes, 5.4%

BGL2, C1_14190C_A, C2_10200W_A, C6_04340W_A, C7

_00150W_A, CHT2, CIT1, HSP104, HSP21, INO4, MAL2

, MDH1-1,MNN11, MNT2, PDA1, PGA4, SRB1

cellular protein

modification

process

17 out of 312

genes, 5.4%

C1_14460W_A, C2_10200W_A, C4_01720C_A, C5_03640

W_A, C5_03700C_A, C5_05060C_A, C6_04340W_A, C7_

00070C_A,CR_01120C_A, EAF7, KNS1, MNN11, MNT2,

PTC7, PTP2, SRB1, TEP1

response to

drug

16 out of 312 genes, 5.1%

C1_14190C_A, C5_02480W_A, C6_01400W_A, C7_00250

C_A, COQ5, EFG1, GAR1, LAC1, LEU4, NAG6, PGA31,

PGA4,PGA62, TIF34, TUP1, VID27

234

cell

cycle

15 out of 312

genes, 4.8%

C1_00090W_A, C1_06600W_A, C1_07980C_A, C1_13290

W_A, C1_14190C_A, C2_10670W_A, C5_02110W_A, CD

C11, HSP12,PGA4, SEC13, SPT6, SUN41, TEP1, VRP1

cell wall

organization

14 out of 312 genes, 4.5%

BGL2, C1_00090W_A, C1_13290W_A, HWP1, MNT2, PGA13, PGA31, PGA4, PGA59, PGA62, RCA1, RHD3, SU

N41, TEP1

protein

catabolic

process

13 out of 312

genes, 4.2%

APR1, C1_14460W_A, C2_09930W_A, C2_10670W_A, C

4_01720C_A, C5_03570W_A, CIC1, CR_05800C_A, DDI1

, MDJ1,PRE5, SAP3, SEC13

interspecies

interaction

between

organisms

13 out of 312

genes, 4.2%

AAF1, ACO1, BGL2, C6_00920W_A, CYB2, EFG1, HWP

1, MNT2, SAP3, SOD4, SOD5, SUN41, TUP1

cellular

homeostasis

13 out of 312

genes, 4.2%

C1_00100C_A, C1_14190C_A, C2_10560C_A, C4_05890

W_A, C7_04010W_A, CCS1, CRG1, LAC1, LPD1, PDI1,

PRX1, SPL1,TEP1

DNA metabolic

process

12 out of 312

genes, 3.8%

C1_02390W_A, C1_07980C_A, C3_04810C_A, C4_00390

W_A, C4_01720C_A, C4_07010C_A, C5_00150C_A, C7_0

2420C_A,EAF7, RCA1, SPT6, TUP1

biofilm

formation

8 out of 312 genes, 2.6%

BGL2, C3_06700C_A, EFG1, HSP104, HWP1, MET4, MNT2, SUN41

Transcriptionally down regulated genes

response to

stress

53 out of 338

genes, 15.7%

ADAEC, APN2, BRG1, C1_02700C_A, C1_03870C_A, C

1_06040W_A, C1_11910W_A, C3_05010C_A, C3_07670

W_A, CCW14,CDR1, CDR2, CHK1, CR_01790C_A, CR

_03440W_A, CR_03590C_A, CSC25, CYR1, FET33, FG

R24, FGR46, GCR3, GCS1,GLN1, GPH1, GPR1, GPX2,

HGT1, HGT4, LIG4, MEC3, MEP1, NUP188, OSM2, PCD1, PCL1, PDS5, PHO112, PTC8, RAD32,RAD50, RH

B1, SIR2, SRR1, SSU1, SSU81, TAC1, TEC1, VPS15, VP

S52, WH11, WSC1, ZCF20

response to

chemical

49 out of 338

genes, 14.5%

AGO1, APN2, BMS1, C1_00830W_A, C2_02570W_A, C

2_06040C_A, C4_01090C_A, C4_03700W_A, C5_04610

W_A,C6_03050C_A, C7_01430C_A, CDR1, CDR2, CDR

235

3, CHK1, CLN3, CR_09830W_A, CR_10640W_A, CSC2

5, CYR1, DIP5, DOA4,FET33, FLU1, GCS1, GPR1, HG

T1, HGT4, HGT7, KAP120, MSI3, NOG1, OSM2, PCL1,

PRR2, RAD50, RHB1, SEN2, SIR2,SIT1, SSU81, SSY5,

SUV3, TAC1, TEC1, TPO4, UTP20, YCF1, ZCF20

filamentous

growth

42 out of 338

genes, 12.4%

BMT8, BRG1, C1_03870C_A, C1_07220W_A, C1_14040

W_A, C2_05770W_A, C3_05110W_A, C3_07670W_A, C

3_07680W_A,C4_06880C_A, CDC53, CHK1, CLN3, CR

_03260W_A, CSC25, CUP9, CYR1, DBR1, ENA2, FGR2

4, FGR46, GPR1, HGT1,HGT4, HOS2, LIG4, PCL1, PD

E1, PTC8, RHB1, SRR1, SSU1, SSU81, STT4, SUV3, TA

C1, TEC1, TOM22, UTR2, VPS52,WSC1, ZCF39

response to

drug

31 out of 338

genes, 9.2%

BMS1, C1_00830W_A, C2_02570W_A, C2_06040C_A, C

4_01090C_A, C4_03700W_A, C7_01430C_A, CDR1, CD

R2, CDR3,CLN3, CR_09830W_A, CR_10640W_A, CYR

1, DIP5, FLU1, HGT1, HGT7, KAP120, MSI3, NOG1, P

CL1, PRR2, RAD50, RHB1,SEN2, SIT1, SUV3, TAC1, TPO4, UTP20

pathogenesis 18 out of 338

genes, 5.3%

ARV1, BRG1, CHK1, CYR1, DUR1,2, GCS1, HEM3, H

GT4, HOS2, LIG4, MSI3, PDE1, RBE1, SRR1, TEC1, UTR2, VPS15,WH11

cellular protein

modification

process

17 out of 338

genes, 5.0%

ARV1, C1_02440C_A, C4_02960W_A, C5_01020C_A, C

5_01170W_A, C5_05150C_A, CDC53, CHK1, CR_01430

W_A, HHF1,HHF22, HOS2, KTI11, PRR2, PTC8, RAD

32, VPS15

signal

transduction

16 out of 338

genes, 4.7%

ARF3, C1_10140C_A, C4_01090C_A, CHK1, CSC25, C

YR1, GPR1, HGT4, PDE1, PIKA, RHB1, SRR1, SSU81, STT4, SYG1,VPS15

carbohydrate

metabolic

process

11 out of 338 genes, 3.3%

BMT4, C4_01220C_A, C6_02420W_A, CDA2, CRH12, CYR1, GPH1, HGT4, PHR3, RHD1, UTR2

ribosome

biogenesis

9 out of 338 genes,

2.7%

BMS1, C1_14080W_A, C3_04370C_A, CR_06980W_A,

KRR1, NOG1, RAT1, RRP42, UTP20

cell wall

organization

8 out of 338 genes,

2.4%

C2_08920W_A, C3_07470W_A, CDA2, CRH12, PHR3,

RHB1, SSU81, UTR2

biofilm

formation

8 out of 338 genes,

2.4%

BRG1, CHK1, CYR1, PIKA, SUV3, TEC1, WH11, ZCF3

9

cellular

homeostasis 8 out of 338 genes, 2.4%

ABC1, AMO1, C1_13840W_A, C6_03800C_A, CRP1, CSC25, DOA4, GPR1

cytoskeleton

organization

7 out of 338 genes,

2.1%

C1_07360W_A, C2_08920W_A, CR_06740W_A, DAD3,

DUO1, PCL1, SPC98

translation 5 out of 338 genes, 1.5%

C1_02330C_A, CR_06980W_A, CR_08480C_A, MTG1,

RPS30

cellular 4 out of 338 genes, COX2, MCT1, NAD3, SUV3

236

respiration 1.2%

hyphal

growth

4 out of 338 genes,

1.2%

CLN3, ENA2, TOM22, WSC1

Translationally up regulated genes

translation 45 out of 476

genes, 9.5%

C1_00980W_A, C1_01580W_A, C1_02330C_A, C1_03620

C_A, C1_04820C_A, C1_06470W_A, C2_05410W_A, C3_

06240C_A,C4_00660W_A, C4_04390W_A, C5_00320W_

A, C5_05250C_A, C7_01020C_A, CR_02950C_A, CR_04

580W_A, CR_08480C_A,MRPL6, MTG1, RPL10A, RPL

11, RPL12, RPL14, RPL17B, RPL20B, RPL23A, RPL29,

RPL32, RPL37B, RPL38, RPL39, RPL42,RPL9B, RPP1A

, RPP2A, RPP2B, RPS12, RPS13, RPS21B, RPS22A, RPS

28B, RPS3, RPS30, RPS6A, SUI1, UBI3

response to

stress

42 out of 476

genes, 8.8%

ADE1, AHP1, AQY1, ARC40, ATX1, BIG1, C1_01300W_

A, C1_02700C_A, C1_07280C_A, C1_11160C_A, C1_128

40W_A,C2_05060C_A, C2_07200W_A, C3_04590W_A, C

3_06860C_A, C3_07670W_A, C6_00850W_A, CIP1, ELC

1, ESS1, FET33,FGR24, FGR39, FGR46, GCN4, GLN1,

GLX3, GPX1, HSP21, HTA1, NCE4, PHHB, PHO112, R

AD51, RDI1, RHB1, SKP1, SMT3,SOD4, TRX1, WH11,

WSC1

RNA metabolic

process

40 out of 476

genes, 8.4%

C1_05230W_A, C1_05420W_A, C1_07280C_A, C1_08660

C_A, C1_11000C_A, C1_11160C_A, C1_14410W_A, C2_

03880C_A,C2_06300W_A, C2_07200W_A, C3_04380C_A

, C4_03040W_A, C5_00920W_A, C6_03210C_A, C6_0391

0C_A, CR_01780W_A,CR_06690C_A, CR_07080W_A, E

SS1, HHF1, HHF22, HTA3, KTI11, MSS116, NHP6A, PZ

F1, REX2, RPA12, RPB8, RPC10,RPF2, RPS13, RPS21B,

RPS28B, RPS6A, RRP42, SMD2, SMX4, SUV3, UBI3

237

response to

chemical

38 out of 476

genes, 8%

ADE1, ADO1, AHP1, ATX1, C1_00830W_A, C1_01300W

_A, C1_11000C_A, C1_11160C_A, C2_05060C_A, C3_06

860C_A,C6_00850W_A, C7_02080W_A, CIP1, CR_00430

C_A, CUP5, ERG11, FET33, FLU1, GCN4, GLX3, HGT7

, HSP21, PGA23,PRS1, RBP1, RHB1, RLP24, RPB8, RPF

2, RPL17B, SIT1, SKP1, SOD4, SST2, SUV3, TIP1, TRX1

, YCF1

cellular protein

modification

process

31 out of 476 genes, 6.5%

ANP1, ARV1, C1_03600W_A, C1_07280C_A, C1_08690

W_A, C1_09480W_A, C1_11160C_A, C3_03310C_A, C3_

06410C_A,C5_01020C_A, C5_01440C_A, C6_00270W_A,

CR_01430W_A, CYP1, ELC1, ESS1, GPI8, HHF1, HHF

22, HRT1, HTA1, KTI11,LTP1, OST1, RUB1, SKP1, SM

T3, TRX1, UBI3, VRG4, WBP1

filamentous

growth

26 out of 476

genes, 5.5%

ABG1, ARC40, BIG1, C1_11160C_A, C3_07670W_A, C4

_06880C_A, CUP5, DFG10, ESS1, FGR24, FGR39, FGR4

6, GCN4,HSP21, PHHB, RAD51, RDI1, RHB1, RHO2, S

MT3, SUV3, TOM22, TRX1, UTR2, VRG4, WSC1

cell

cycle

23 out of 476

genes, 4.8%

ABG1, AQY1, ARC40, C1_04690C_A, C1_08690W_A, C

2_01440C_A, C2_08160C_A, C3_07130W_A, C5_00920W

_A, CYP1,ESS1, FET33, HHF1, HHF22, HRT1, MLC1, NCE4, PHHB, RAD51, RHB1, SKP1, SMT3, WBP1

response to

drug

18 out of 476

genes, 3.8%

ADO1, C1_00830W_A, C1_11000C_A, ERG11, FLU1, H

GT7, PGA23, PRS1, RBP1, RHB1, RLP24, RPB8, RPF2, RPL17B, SIT1,SKP1, SUV3, TIP1

carbohydrate

metabolic

process

16 out of 476

genes, 3.4%

ANP1, BGL2, BIG1, C1_03600W_A, C2_04340C_A, C3_0

6410C_A, C3_06860C_A, C6_02420W_A, HSP21, MDH1,

MDH1-3,OST1, PMM1, UTR2, VRG4, WBP1

DNA metabolic

process 16 out of 476 genes, 3.4%

C1_02310C_A, C1_04690C_A, C1_07280C_A, C2_07200

W_A, C3_04590W_A, C4_06880C_A, C7_03650W_A, EL

C1, HHF1,HHF22, HTA1, HTA3, NCE4, RAD51, SMT3,

SUV3

protein

folding

15 out of 476

genes, 3.2%

C1_14090W_A, C4_05860W_A, C4_06160W_A, C5_0434

0W_A, C7_02470C_A, CPR3, CR_02380C_A, CYP1, ESS

1, HCH1,PHB2, PHO86, RBP1, TRX1, YKE2

cellular

respiration 14 out of 476 genes, 2.9%

C1_06050C_A, C1_08690W_A, C1_11880W_A, COX2, COX5, COX6, MDH1, NAD3, NAD4, NAD5, NAD6, PET10

0, QCR8, SUV3

cellular

homeostasis

12 out of 476

genes, 2.5%

AHP1, AMO1, ATX1, C1_01300W_A, C1_10750C_A, C5

_04340W_A, C7_02080W_A, CRD2, CR_10280W_A, CU

P5, SKP1,TRX1

signal

transduction

11 out of 476

genes, 2.3%

ARF3, C3_07130W_A, C4_02720C_A, HTA1, RBP1, RDI

1, RHB1, RHO2, SAR1, SST2, YPT7

protein catabolic

process

10 out of 476

genes, 2.1%

C1_01300W_A, C4_02470C_A, C4_06880C_A, ELC1, HR

T1, PRE10, PRE3, PUP3, SCL1, SKP1

cell wall

organization

8 out of 476 genes,

1.7%

ABG1, BGL2, C3_07470W_A, PHHB, PRS1, RHB1, RH

O2, UTR2

238

hyphal

growth

7 out of 476 genes,

1.5%

ABG1, RDI1, RHO2, SMT3, TOM22, VRG4, WSC1

biofilm

formation 7 out of 476 genes, 1.5%

ADH5, AQY1, BGL2, GCN4, SUV3, TRY3, WH11

Translationally down regulated genes

GO-Slim term Cluster

frequency Genes annotated to the term

response to

stress

83 out of 476

genes, 17.4%

ARP4, ATG9, BNA4, BNI4, C1_02390W_A, C1_0798

0C_A, C2_06530W_A, C2_08630C_A, C2_10850C_A,

C3_00570C_A,C3_05970C_A, C3_06630W_A, C4_00

030C_A, C4_01720C_A, C4_03810W_A, C4_03850W

_A, C4_05350W_A, C4_07220C_A,C7_00810W_A, C

7_01360C_A, CAS1, CAS5, CCT8, CDC27, CKA2, CNH1, CPP1, CRZ2, CR_00060C_A, CR_06780W_A,

CZF1,EAF3, EAF7, ECM25, EFG1, EPL1, ESC4, FG

R47, FGR50, GPA2, GSG1, GUP1, GZF3, HAP43, HAP5, HMS1, HRR25, LTV1,MEP2, NBP2, NDT80, O

PI1, PHO23, PIN4, PSY2, RAD3, RCN1, RFG1, RGD

1, RIM8, RPB4, RPG1A, RVS161, SET1, SET3,SFU1, SGS1, SKO1, SNT1, SPT20, SPT5, SPT6, SSN6, TC

O89, TFG1, TPK2, TUP1, UEC1, VID21, VID27, VR

P1, WAL1, YAF9

filamentous

growth

76 out of 476

genes, 16%

AAF1, ALS2, ALS4, ARG81, ARG83, BAS1, BEM1,

BNA4, BNI4, C1_06090C_A, C1_14190C_A, C3_0057

0C_A, C3_00790W_A,CAS5, CCN1, CCT8, CPP1, C

ZF1, DBF2, DEF1, ECM25, EFG1, ESC4, FGR44, F

GR47, FGR50, FLO8, GPA2, GUP1, GZF3,HAP5, HMS1, HXK1, KEL1, KIN2, KIS1, MEP2, MFG1, MS

S11, MSS4, NBP2, NDT80, PCL5, PEA2, PGA59, PIN

4, RFG1,RGD1, RGT1, RIM8, ROB1, RPB4, RVS161

, SET1, SET3, SFL1, SGS1, SKO1, SLR1, SNT1, SPT

5, SPT6, SSN6, TCC1, TEA1,TFG1, TPK2, TUP1, U

EC1, VID27, VRP1, WAL1, WHI3, YAK1, ZCF7, ZC

F8

RNA metabolic

process

67 out of 476

genes, 14.1%

BUD31, BUR2, C1_06090C_A, C1_07660W_A, C1_12

630C_A, C1_12750C_A, C1_13380W_A, C1_14470W

_A, C2_00410C_A,C2_02500W_A, C2_02770W_A, C

2_08630C_A, C2_09040W_A, C2_09650W_A, C2_101

40W_A, C3_00130C_A, C3_05800W_A,C3_06820C_

A, C4_00940W_A, C4_05230C_A, C4_05650W_A, C4

_06410W_A, C5_02480W_A, C7_00070C_A, C7_0025

0C_A,C7_00830C_A, C7_01400C_A, C7_02110W_A, C7_02660C_A, C7_03850W_A, C7_04260W_A, C7_0

4290W_A, CBF1,CR_01120C_A, CR_03230W_A, CR

_03910C_A, CR_09480W_A, CR_09800C_A, DAL81, EAF3, EST1, FYV5, GAR1, GTR1,HRR25, MED15,

239

MPP10, NDT80, NOP1, NOP8, NPL3, NSA2, PRP22,

RAD3, RMP1, ROB1, RPB4, RPP1, RRN3, SPT20,SP

T5, SPT6, SSF1, TEA1, TFG1, TIF4631, TRM9

response to

chemical

59 out of 476

genes, 12.4%

ARC18, ARG81, BEM1, C1_06090C_A, C1_14190C_

A, C2_10850C_A, C3_00790W_A, C3_01800C_A, C4

_00780C_A,C4_05230C_A, C5_02480W_A, C6_01400

W_A, C6_02430W_A, C7_00250C_A, C7_01360C_A,

C7_03850W_A, CAS5, CBF1,CCN1, CCT8, CKA2, CPP1, CRZ2, CR_02510W_A, DAL81, EFG1, FLO8, G

AR1, GAT1, GCN5, GPA2, GZF3, HAP5, HMS1,KIS

1, LTV1, MEP2, MET4, NAG6, NDT80, NRM1, OPI1

, PGA62, RGD1, RPG1A, SFL1, SFU1, SKO1, SPT20

, SPT6, SSN6,SWE1, TCO89, TEA1, TIF11, TPK2, T

RM9, TUP1, VID27

cell

cycle

58 out of 476

genes, 12.2%

AMN1, ARP4, ASK1, AXL1, BEM1, BNI4, BNR1, B

UD31, BUR2, C1_00090W_A, C1_06090C_A, C1_079

80C_A, C1_10350C_A,C1_12750C_A, C1_13380W_A

, C1_14190C_A, C2_06530W_A, C2_08020C_A, C2_0

8630C_A, C4_00030C_A, C4_02400C_A,C4_03850W

_A, C4_05230C_A, C4_07220C_A, C6_00260W_A, C6_03420W_A, C6_04120C_A, C7_03850W_A, CCN1,

CDC27,CR_02680W_A, DBF2, GCN5, GPA2, GSG1,

HRR25, HST1, KIN2, KIN3, KIP1, MBP1, MSS4, ND

T80, PEA2, PIN4, PSY2,RIM8, RVS161, SEC6, SET1

, SGS1, SPC19, SPT6, SWE1, VPS27, VRP1, WAL1,

ZDS1

response to

drug

33 out of 476

genes, 6.9%

ARC18, ARG81, C1_06090C_A, C1_14190C_A, C3_0

0790W_A, C4_05230C_A, C5_02480W_A, C6_01400

W_A, C7_00250C_A,C7_03850W_A, CAS5, CCN1, CCT8, CKA2, CR_02510W_A, EFG1, GAR1, GCN5, G

ZF3, HAP5, KIS1, NAG6, NDT80, PGA62,RPG1A, S

FL1, SSN6, SWE1, TEA1, TIF11, TRM9, TUP1, VID

27

cytoskeleton

organization

22 out of 476

genes, 4.6%

ARC18, ARP4, ASK1, BNR1, BUD14, C4_02400C_A,

C4_07220C_A, C6_00260W_A, C6_04120C_A, C7_0

0810W_A,CR_02680W_A, CR_08980C_A, DBF2, HR

R25, KIN2, KIN3, KIP1, MSS4, RVS161, SPC19, VR

P1, WAL1

signal

transduction

22 out of 476

genes, 4.6%

CKA2, CPP1, CR_06520C_A, DBF2, ECM25, GCN5,

GPA2, HMS1, KIN3, KIS1, MEP2, MSS4, OPI1, PK

H3, PSY2, RCN1,RGD1, RVS161, SAC7, SKO1, SPT

20, TPK2

biofilm

formation

18 out of 476

genes, 3.8%

ALS2, ARG81, CAS5, CRZ2, CZF1, DAL81, DEF1, E

FG1, FLO8, GUP1, MET4, MFG1, MSS11, NDT80, ROB1, TPK2, YAK1,ZCF8

cytokinesis

16 out of 476 genes, 3.4%

AXL1, BEM1, BNI4, BNR1, BUD31, C1_13380W_A, C2_08020C_A, C6_00260W_A, DBF2, KIN2, KIN3, P

EA2, RVS161, SEC6,VRP1, WAL1

hyphal

growth

16 out of 476

genes, 3.4%

ALS2, ALS4, BEM1, C1_06090C_A, CCN1, CPP1, D

BF2, EFG1, HXK1, KIN2, NBP2, NDT80, SLR1, TP

K2, TUP1, UEC1

carbohydrate

metabolic

process

12 out of 476

genes, 2.5%

C1_00810W_A, C1_14190C_A, C3_00790W_A, FGR

44, GPA2, GUP1, HXK1, MNN11, RGT1, TCO89, TP

K2, ZCF7

growth of

unicellular organism

as a thread of

attached

cells

11 out of 476

genes, 2.3%

C3_00790W_A, EFG1, GPA2, KIS1, MEP2, MSS4, P

EA2, RIM8, TEA1, TPK2, WHI3

240

pseudohyphal

growth

6 out of 476

genes, 1.3%

C3_00790W_A, EFG1, GPA2, MEP2, PEA2, WHI3