R E S EA RCH AR T I C L E

The N-terminal domain of the Flo11 protein fromSaccharomyces cerevisiae is an adhesin without

mannose-binding activity

Katty V.Y. Goossens & Ronnie G. Willaert

Laboratory of Structural Biology, Department of Bioengineering Sciences, Vrije Universiteit Brussel, Brussels, Belgium

Correspondence: Ronnie G. Willaert,

Laboratory of Structural Biology, Department

of Bioengineering Sciences, Vrije Universiteit

Brussel, Pleinlaan 2, B-1050 Brussel, Belgium.

Tel.: +32 2 6291846; fax: +32 2 6291963;

e-mail: ronnie.willaert@vub.ac.be

Received 13 September 2011; revised 11

November 2011; accepted 11 November

2011; Final version published online 22

December 2011.

DOI: 10.1111/j.1567-1364.2011.00766.x

Editor: Jens Nielsen

Keywords

Saccharomyces cerevisiae; flocculation; Flo11

protein; carbohydrate binding; self-

interaction.

Abstract

The expression of the Flo11 flocculin in Saccharomyces cerevisiae offers the cell

a wide range of phenotypes, depending on the strain and the environmental

conditions. The most important are pseudohyphae development, invasive

growth and flocculation. The mechanism of cellular adhesion mediated by

Flo11p is not well understood. Therefore, the N-terminal domain of Flo11p

was purified and studied. Although its amino acid sequence shows less similar-

ity with the other flocculins, Flo11p belongs to the flocculin family. However,

the N-terminal domain contains the ‘Flo11-domain’ (PF10181), but not the

mannose-binding PA14 domain, which is present in the other flocculins

(Flo1p, Flo5p, Flo9p and Flo10p). Structural and binding properties of the N-

terminal domain of Flo11p were studied. It is shown that this domain is O-gly-

cosylated and is structurally composed mainly of b-sheets, which is typical for

the members of the flocculin family. Furthermore, fluorescence spectroscopy

binding studies revealed that N-Flo11p does not bind mannose, which is in

contrast to the other Flo proteins. However, surface plasmon resonance analy-

sis showed that N-Flo11p self-interacts and explains the cell–cell interaction

capacity of FLO11-expressing cells.

Introduction

Saccharomyces cerevisiae shows different phenotypes

depending on its genetic background and its environmen-

tal condition. The yeast has been commonly studied as a

single-cell organism living freely in suspension. However,

in its natural environment, the cells frequently switch

over from a planktonic life style to complex multicellular

structures such as flocs, filaments, mats and flors (Palkova,

2004). These morphological transitions have been sug-

gested as a mechanism for this nonmotile species to permit

foraging for nutrients (Gimeno et al., 1992; Iserentant,

1996; Cullen & Sprague, 2000; Dickinson, 2008).

For example, haploid cells become adherent and invade

the surface of a semi-solid agar medium, so that they do

not wash off. This is called invasive growth, and this

morphological switch is caused by glucose depletion

around the growing cells (Roberts & Fink, 1994; Cullen &

Sprague, 2000). Diploid cells display a similar filamentous

transition by adhering to each other after cell division,

when sensing a low nitrogen concentration. In diploid

pseudohyphal growth, the cells adopt an elongated shape

and form long filaments that grow out from the colony

edge (Gimeno et al., 1992; Kron et al., 1994; Mosch,

2000). Pseudohyphal development of S. cerevisiae has fea-

tures in common with dimorphism of pathogenic fungi,

where the dimorphic transition is often correlated with

pathogenicity. Thus, the molecular models drawn from

studies of pseudohyphal development of S. cerevisiae

build a valuable basis for studying dimorphism in patho-

genic fungi that are experimentally less accessible and

therefore offer important insights into the mechanism

and control of fungal disease (Mosch, 2000).

Yeast cells exhibit these morphological transitions when

a class of genes, encoding flocculins, is present in their

genome. More specifically, the adhesion of the cells to

substrates, the pseudohyphal and the invasive growth are

S. cerevisiae phenotypes resulting from the expression of

ª 2011 Federation of European Microbiological Societies FEMS Yeast Res 12 (2012) 78–87Published by Blackwell Publishing Ltd. All rights reserved

YEA

ST R

ESEA

RC

H

the FLO11 (also known as MUC1) gene (Lambrechts

et al., 1996; Lo & Dranginis, 1998; Rupp et al., 1999).

Other phenotypes of S. cerevisiae associated with the

FLO11 expression are the formation of mats, complex

colony-like structures on low-density semi-solid medium

(Reynolds & Fink, 2001; Reynolds et al., 2008); the air–liquid interfacial cellular aggregation in the process of

sherry-like wine fermentations, called a flor or velum

(Zara et al., 2005; Ishigami et al., 2006); and the adher-

ence to a range of solid surfaces, such as glass, stainless

steel, agar and plastics, possibly leading to the develop-

ment of biofilms (Reynolds & Fink, 2001; Mortensen

et al., 2007). Biofilm formation is a severe problem in the

medical sector as they offer protection to the cells, for

example, by conferring resistance to antifungal drugs

(Bryers, 2008).

Furthermore, it was observed that the expression of the

FLO11 gene also controls cell–cell adhesion, which leads

to the aggregation of the yeast cells into clumps that sedi-

ment to the bottom of the fermentor (Lo & Dranginis,

1996; Bayly et al., 2005; Douglas et al., 2007). This phe-

nomenon occurs at the end of the beer fermentation,

when almost all fermentable sugars are converted into

ethanol and carbon dioxide and is called flocculation.

Remarkably, the flocculation phenotype caused by

Flo11p was observed only for Saccharomyces cerevisiae

var. diastaticus (Lo & Dranginis, 1996; Bayly et al., 2005;

Douglas et al., 2007), and also microscopic flocs consist-

ing of 6–30 cells could be observed under the microscope

for the laboratory strains BY4741 and BY4742 (S288C)

when Flo11p was overexpressed (Purevdorj-Gage et al.,

2007; Van Mulders et al., 2009). The other phenotypes,

such as invasive growth, pseudohyphal growth, develop-

ment of mats and biofilm formation, are mainly associ-

ated with S. cerevisiae strain Σ1278b, expressing Flo11p

(Lo & Dranginis, 1998; Cullen & Sprague, 2000; Douglas

et al., 2007). However, when overexpressed in S. cerevisiae

strain Σ1278b, a Flo11p-dependent, but calcium-indepen-

dent flocculation behaviour was observed (Guo et al.,

2000), indicating that an identical adhesin expressed in

different yeast strains can exhibit different FLO11-depen-

dent properties. Clearly, other factors must be involved in

these phenomena.

The FLO11 gene in S. cerevisiae encodes the Flo11 pro-

tein, which is a member of the flocculin family. However,

Flo11p is more distantly related to the other flocculins in

this family. Indeed, the predicted protein product of

FLO11 is 37% similar to the product of FLO1 (26% iden-

tical) (Lo & Dranginis, 1996), while the other members

of the flocculin family show a higher degree of similarity

(Jin & Speers, 1998). The FLO11 gene contains 4101 base

pairs and is located on chromosome IX. It encodes a

1367 amino acid cell wall protein assembled by three

major domains: a carboxy (C)-terminal domain possess-

ing a glycosylphosphatidylinositol (GPI) remnant to

anchor the protein in the cell wall, a central domain con-

taining a highly repeated threonine- and serine-rich

sequence and finally an amino (N)-terminal domain

located outside the cell wall (Lambrechts et al., 1996; Lo

& Dranginis, 1996, 1998).

The wide range of phenotypes that are directly attrib-

uted to the FLO11-encoded glycoprotein are based on

adhesion events, and therefore, the binding properties of

Flo11p were investigated in this study. As Flo11p is an

adhesin from the Flo family, where the adhesive proper-

ties are located in the N-terminus of the proteins, only

the N-terminal domain was examined. In the Pfam data-

base, a domain is associated with this part of Flo11p,

which is called the ‘Flo11-domain’ (PF10181), covering

residues 42–195. This domain is conserved in some

related species within the Saccharomycotina (Linder &

Gustafsson, 2008). Moreover, it is suggested that Flo11p

shows a lectin activity that is related to amino acids pres-

ent in the N-terminus, in particular the WQWGT motif

(Bayly et al., 2005; Douglas et al., 2007). The N-terminal

domain of Flo11p was expressed in S. cerevisiae, purified

and studied. The secondary structure of the domain was

evaluated as well as the presence of glycans on the pro-

tein. Our results show that N-Flo11p is not a mannose-

binding protein but can make homotypic interactions.

Materials and methods

Construction of N-FLO11 expression plasmid

The determination of the N-terminal domain of FLO11

was based on the results of Lambrechts et al. (1996). It

was proposed that the N-terminal domain stops where

the tandem repeats start (at aa 210). Two oligonucleo-

tides [Flo11_3, 5′-(TCCTTAGTCAAAAGGTTTCCAACTGCACTAGTTCCAAGA)-3′; and Flo11_4, 5′-(GGA-GATCGGA ATTCGTCAGTGATGGTGATGGTGATGCTT

CGTACCGCCACAATTATTGTCA)-3′] were designed to

amplify the N-terminal domain of Flo11p coding

sequence from the genomic DNA of S. cerevisiae strain

S288C. Primer Flo11_4 contains a sequence for 6 histi-

dines to add a histidine tag to the C-terminal part of the

protein, which will allow purifying the protein using a

Ni-NTA column. The predicted molecular weight of the

expressed protein is 22 kDa. The yeast-Escherichia coli

shuttle vector pYEX-S1 was used for cloning of the N-ter-

minal part of the FLO11 gene. Cloning was performed

using the In-FusionTM method (Clontech, Mountain

View, CA), which is based on the recombination between

identical sequences of the vector and the amplified gene

(Benoit et al., 2006; Zhu et al., 2007). The construction

FEMS Yeast Res 12 (2012) 78–87 ª 2011 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

S. cerevisiae Flo11p does not bind mannose 79

of the expression plasmid was confirmed by a combination

of PCR and DNA sequence analysis (Genetic Service

Facility, VIB, Belgium). In the pYEX-S1 vector, the

cloned gene is regulated by the strong constitutive phos-

phoglycerate kinase (PGK) promoter, and this vector

includes the b-lactamase gene for selection in E. coli and

the yeast-selectable marker URA3. The Flo11p secretion

sequence (aa 1–21) was not included during cloning, as

the pYEX-S1 vector contains the full-length leader

sequence from Kluyveromyces lactis to direct proteins

through the secretory pathway for secretion into the

growth medium. Transformation into E. coli strain DH5awas carried out using a heat shock as described previously

(Sambrook & Russel, 2001). The S. cerevisiae strain

S288C BY4741 was transformed using the lithium acetate

procedure (Ito et al., 1983; Gietz & Schiestl, 2007).

Expression and purification of the N-terminal

domain of Flo11p

Transformed S. cerevisiae cells were cultivated in shake

flasks. The cells were grown in yeast extract-peptone-dex-

trose (YPD) medium containing 1% (w/v) yeast extract,

2% (w/v) peptone and 2% (w/v) D-glucose. Overnight

cultures were grown by inoculating 90 mL YPD medium

with one pYEX-S1-containing S. cerevisiae colony. Cul-

tures were shaken and incubated at 30 °C. Subsequently,the overnight cultures were diluted into 2 L of YPD med-

ium and allowed to grow to an OD600nm of 10 by incuba-

tion at 30 °C for 64 h while shaking (110 r.p.m.). The

cells were separated from the medium by centrifugation

(12 000 g, 20 min, 4 °C), and the resulting supernatant

was adjusted to pH 7.2 to protonate the histidines of the

His-tag. The N-terminal domain of Flo11p was captured

from the growth medium by affinity chromatography

using a nickel-nitrilotriacetic acid (Ni-NTA) Sepharose

column (6 mL) and was eluted with 1 M imidazole in

phosphate-buffered saline. To further purify N-Flo11p,

the elution fractions were pooled, concentrated to 2 mL

(using an Amicon centrifugal filter unit with MWCO of

3000 Da; Millipore, Billerica, MA), and subjected to gel

filtration chromatography (Superdex 75 HR 10/30; GE

Healthcare) in 20 mM Tris, pH 7.5 and 150 mM NaCl.

The eluate of the Ni-column and the purified proteins

from gel filtration were analysed by sodium dodecyl sul-

phate-polyacrylamide gel electrophoresis (SDS-PAGE).

The concentration of pure N-Flo11p was estimated from

the absorption at 280 nm.

Detection of (glyco) proteins

After purifying the N-terminal domain of Flo11p, SDS-

PAGE was performed to visualize the protein and to esti-

mate its molecular mass. The gel (15% resolving gel) was

stained with Coomassie staining [1 g L�1 Coomassie Bril-

liant Blue R250, 50% (v/v) methanol, 10% (v/v) acetic

acid] for 30 min and destained with 50% (v/v) methanol

and 10% (v/v) acetic acid. To visualize glycans, the Pro-Q

Emerald 300 Glycoprotein Gel and Blot Stain kit (Invitro-

gen) was used.

Enzymatic deglycosylation

To remove the N-glycans, the protein was treated with

endo-b-N-acetylglucosaminidase H (Endo H; New Eng-

land Biolabs) at a concentration of 100 U lg�1 protein,

in 20 mM Na-acetate buffer (pH 5.0). The mixture was

incubated at 37 °C for 4 h.

Circular dichroism

Circular dichroism (CD) measurements were performed

with a J715 spectropolarimeter (Jasco) in the far-UV (200

–240 nm) region, using a cell with a path length of

0.1 cm. The protein was diluted in 400 lL phosphate buf-

fer (50 mM at pH 7.5) to obtain a final concentration of

0.3 mg mL�1. Data were acquired with a scanning speed

of 50 nm min�1, a 2-s integration time and a 1-nm band-

width at a constant temperature of 25 °C. Six spectra

were measured and averaged. The mean residual elliptic-

ity, [h], was calculated as follows: [h] = (100 9 hm)

(cL)�1, where h is the observed ellipticity, m is the mean

residual weight, c is the concentration (mg mL�1) and L

is the path length (cm). A quantitative estimation of the

secondary structure composition was facilitated by apply-

ing the K2D2 method and using the SELCON3, CONTINLL

and CDSSTR programs (Provencher & Glockner, 1981; And-

rade et al., 1993; Johnson, 1999; Sreerama et al., 1999;

Perez-Iratxeta & Andrade-Navarro, 2008).

Fluorescence spectroscopy

The binding of D-(+)-mannose to N-Flo11p was studied

by fluorescence spectroscopy. The measurements were

performed at 20 °C, using a luminescence spectrometer

(model LS55; PerkinElmer, MA). An excitation wave-

length of 277 nm, a scan speed of 100 nm min�1 and an

excitation and emission slit width of 5 nm were used

during the experiments. The initial sample volume was

500 lL, containing 2 lM N-Flo11p in flocculation buffer

(50 mM sodium acetate, pH 4.5, 100 mM NaCl and

7 mM CaCl2). One hundred millimolars of mannose

from a concentrated stock solution containing 2 M sugar

was added to the protein solution, then the sample was

mixed and the fluorescence was measured immediately.

As a positive control, 100 mM D-(+)-mannose was added

ª 2011 Federation of European Microbiological Societies FEMS Yeast Res 12 (2012) 78–87Published by Blackwell Publishing Ltd. All rights reserved

80 K.V.Y. Goossens & R.G. Willaert

to N-Flo1p, under exactly the same conditions. Emission

spectra were collected from 300 to 450 nm and corrected

relative to a buffer blank. Averages obtained from three

independent experiments were displayed on the graph.

Surface plasmon resonance

The interaction of the N-terminal domain of Flo11p to

another N-Flo11p was studied by surface plasmon reso-

nance (SPR) using a Biacore 3000TM instrument (GE

Healthcare, Upsalla, Sweden) at 25 °C. The covalent

immobilization of N-Flo11p in flow cell 2 (FC 2) on the

CM5 BIAsensor chip was accomplished via amine cou-

pling chemistry, using an amino coupling kit (BIAcore;

GE Healthcare) with 20 mM sodium acetate pH 4.0 as

immobilization buffer. Glycosylated N-Flo11p was immo-

bilized to a response around 95 resonance units (RU).

Flow cell 1 (FC 1) was treated in the same way as FC 2

except that it was blocked immediately after activation

and was used as the reference surface to subtract the RU

as a result of the refractive index of the protein solution

and any instrument noise.

Increasing concentrations ranging from 11 nM to

90 lM of glycosylated N-Flo11p were allowed to flow

across both flow cells FC 1 and FC 2 of the CM5 chip

containing N-Flo11p. The experiment was carried out in

HBS buffer [20 mM Hepes pH 7.4, 150 mM NaCl,

10 mM CaCl2 and 0.005% (v/v) Tween 20]. No binding

was detected in the control flow cells. Complete dissocia-

tion of N-Flo11p was performed with HBS buffer before

starting a new binding cycle. The association time was

3 min, and the dissociation time was 7 min. Additionally,

a zero concentration cycle of N-Flo11p (injection of run-

ning buffer) was run to determine the effect of the buffer.

All measurements were performed at a flow rate of

20 lL min�1 in HBS buffer, and the proteins were dialy-

sed to exactly the same buffer (Spectra/Por® Dialysis

membrane, 3500 Da MWCO; Spectrum Laboratories,

Inc., CA). The buffer was filtered through a 0.45-lm filter

(MF-MilliporeTM membrane filter) and degassed before

usage.

The results were analysed with the BIAevaluation soft-

ware version 4.1 (GE Healthcare). Binding was observed

by measuring the increase in RU when injecting different

concentrations of the analyte and after subtracting the

background response.

Results

Expression and purification of N-Flo11p

N-Flo11p was captured from the growth medium using a

nickel column and was eluted with imidazole. The eluate

was analysed by SDS-PAGE, and staining of the proteins

revealed two bands with different molecular masses

(Fig. 1a). N-terminal sequencing and mass spectrometric

analysis of the protein bands revealed that the upper

band corresponds to N-Flo11p. Four peptides belonging

to N-Flo11p were identified after trypsin digestion

(FPTALVPRG, KENIDLKY, KYLWSLKI and KIIGVTGPKG).

Fig 1. (a) SDS-PAGE of the eluted proteins after affinity

chromatography using a Ni-column. The Coomassie-stained gel shows

that two protein bands with different molecular masses were purified.

Mass spectroscopy revealed that the upper band corresponds to N-

Flo11p as indicated with an arrow. Lane 1, molecular mass marker;

lane 2, eluted fraction from the Ni-column. (b) SDS-PAGE of N-Flo11p

after gel-filtration chromatography. The gel is Coomassie-stained.

Lane 1, molecular mass marker; lane 2, pure N-Flo11p. (c) SDS-PAGE

of N-Flo11p treated with Endo H. The gel is Coomassie-stained. Lane

1, molecular mass marker; lane 2, untreated N-Flo11p; and lane 3, N-

Flo11p treated with Endo H to remove the N-glycans. (d) SDS-PAGE

of N-Flo11p. The gel was stained with the Pro-Q Emerald 300

Glycoprotein Gel and Blot Stain kit to visualize glycans on the

proteins. Lane 1, molecular mass marker; lane 2, glycosylated N-

Flo11p.

FEMS Yeast Res 12 (2012) 78–87 ª 2011 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

S. cerevisiae Flo11p does not bind mannose 81

To further purify N-Flo11p, the elution fractions were

subjected to gel filtration chromatography. The purified

protein was visualized with SDS-PAGE (Fig. 1b), and the

concentration was estimated from the absorption at

280 nm. The yield obtained with this purification proto-

col was about 0.5 mg L�1 culture.

The N-terminal domain of Flo11p

is O-glycosylated

The calculated molecular mass of the N-terminal domain

of Flo11p without glycosylation is 22 kDa. On the SDS

gel (Fig. 1b), it is observed that N-Flo11p corresponds to

this molecular mass, which indicates that the protein is

not N-glycosylated. This observation is in accordance

with the prediction of N-glycosylation sites based on the

amino acid sequence of the N-terminal domain of Flo11p

(data not shown). To confirm the absence of N-glycans

on N-Flo11p, the protein was treated with Endo H and

visualized with SDS-PAGE (Fig. 1c). No decrease in

molecular mass of N-Flo11p is observed. Hence, it is con-

cluded that no N-glycans are present on the N-terminal

domain of Flo11p.

O-glycosylation often occurs in a region of the protein

that contains a high proportion of serine and threonine,

with neighbouring proline residues (Lehle & Bause,

1984). In the amino acid sequence of the N-terminal

domain of Flo11p, several threonine (18), serine (14) and

proline (7) residues are found. To verify whether

N-Flo11p contains O-glycans, the SDS gel containing

N-Flo11p was stained with the Pro-Q Emerald 300 Glyco-

protein Gel and Blot Stain kit (Fig. 1d). This staining

procedure allows the visualization of glycans. As

N-Flo11p can be visualized on the SDS gel, it is con-

cluded that N-Flo11p is O-glycosylated.

N-Flo11p is mainly composed of b-sheets

A CD spectrum of N-Flo11p was recorded in the far-UV

spectrum to investigate its secondary structure (Fig. 2).

The observed spectrum is typical for folded proteins, and

its shape, exhibiting one minimum around 215 nm,

indicates a prevalence of b-sheets. The fitting of the CD

spectrum, using the method of Perez-Iratxeta and And-

rade-Navarro, indicates a b-sheet content of 48% and an

a-helix content of 4% (Perez-Iratxeta & Andrade-Navarro,

2008). In addition, secondary structure content deconvo-

lution of the spectrum, using the SELCON3, CONTINLL and

CDSSTR programs, suggested that the b-sheet content was

31%, 40.5% and 42.8%, respectively. The a-helix content

was also evaluated with the same programs. Values of

2%, 3% and 2.8% were found for the a-helix content

using SELCON3, CONTINLL and CDSSTR, respectively. On aver-

age, the secondary structure of N-Flo11p contains about

40.6% b-sheets and 3.0% a-helices.

N-Flo11p does not bind mannose

A pentapeptide in the N-terminal ligand-binding domain

of several yeast adhesins was identified to be involved in

sugar recognition (Kobayashi et al., 1998; Zupancic et al.,

2008). In the case of the epithelian adhesins proteins

from Candida glabrata, this pentapeptide is the EYDGA

motif (Zupancic et al., 2008). In the flocculin family from

S. cerevisiae, the amino acids interacting with the carbo-

hydrate are found in the VSWGT motif (Kobayashi et al.,

1998). This pentapeptide is well conserved among the

members of the flocculin family (Bayly et al., 2005; Van

Mulders et al., 2009; Veelders et al., 2010). The trypto-

phan residue at position 228, which is present in all the

studied adhesins with the exception of Lg-Flo1, was

shown to be involved in mannose recognition through

binding with the C-2 hydroxyl group of mannose

(Kobayashi et al., 1998; Veelders et al., 2010). Aligning

the binding region of the flocculins shows convincingly

that Flo11p also contains the crucial tryptophan residue

(Fig. 3). In binding studies using fluorescence spectros-

copy, the quenching of this residue upon binding with

mannose can be followed by measuring the intensity of

the emission peak at 350 nm (Goossens et al., 2011). For

N-Flo1p – a known mannose-binding protein – the fluo-

rescence intensity decreases to approximately 50% of the

initial value upon the addition of 100 mM mannose

(dashed line in Fig. 4). In contrast, no change in the

intensity of the emission peak at 350 nm was observed

upon addition of 100 mM mannose to N-Flo11p (Fig. 4).

This result indicates that mannose does not interact with

the N-terminal domain of Flo11p, in contrast to the other

flocculins (Flo1p, Flo5p, Flo9p and Flo10p).

Fig 2. Far-UV CD spectrum of N-Flo11p.

ª 2011 Federation of European Microbiological Societies FEMS Yeast Res 12 (2012) 78–87Published by Blackwell Publishing Ltd. All rights reserved

82 K.V.Y. Goossens & R.G. Willaert

N-Flo11p molecules self-interact

Recently, a homotypic adhesive mechanism has been

detected for Flo11p (Douglas et al., 2007). The whole

Flo11 protein was purified and covalently attached to

microscopic beads. The Flo11p-coated beads were able to

bind S. cerevisiae var. diastaticus expressing Flo11p, but

not to cells that do not express Flo11p. Therefore, Flo11p

itself was considered as an important adhesive target on

the cell wall for Flo11p, if not the only target (Douglas

et al., 2007).

In our study, we have assessed the homotypic interac-

tion of the N-terminal domain of Flo11p. SPR was used

to determine qualitatively the binding between N-Flo11

proteins. Therefore, N-Flo11p was coupled to a BIAsensor

chip, and increasing concentrations of N-Flo11p (11 nM,

88 nM, 350 nM, 5.6 lM, 11.2 lM, 22.5 lM, 45 lM and

90 lM) were flown over that chip allowing the proteins

to interact. The clear concentration-dependent increase in

signal indicates that N-Flo11p is able to bind to N-

Flo11p, which is called a homotypic interaction (Fig. 5).

Discussion

The flocculin encoded by the FLO11 gene is responsible

for a wide variety of phenotypes exhibited by S. cerevisiae

cells expressing this Flo11p. These include haploid inva-

sive growth (Roberts & Fink, 1994; Cullen & Sprague,

2000), development of pseudohyphae (Gimeno et al.,

1992; Kron et al., 1994; Mosch, 2000), biofilm formation

(Reynolds & Fink, 2001), mat formation (Reynolds &

Fink, 2001; Reynolds et al., 2008), flor formation (Zara

et al., 2005; Ishigami et al., 2006), adhesion to surfaces

(Lo & Dranginis, 1998; Reynolds & Fink, 2001; Morten-

sen et al., 2007) and flocculation (Lo & Dranginis, 1996;

Bayly et al., 2005). These cellular adhesion phenomena

are mediated by Flo11p, but the mechanism is not well

understood at the molecular level and very little is known

about the structure and function of the protein. There-

fore, in this study, this versatile flocculin was purified

and studied.

The members of the flocculin family are composed of

three domains, and the binding activity is located in the

N-terminal part (Bony et al., 1997; Kobayashi et al.,

1998; Goossens et al., 2011). Other adhesins from both

pro- and eukaryotic origin also possess their binding

Fig 4. Emission spectrum of N-Flo11p compared with the N-Flo11p

spectrum with the addition of mannose from a stock solution to a

final concentration of 100 mM. Averages of three independent

experiments are shown. As a positive control, the decrease of the

fluorescence signal upon addition of 100 mM mannose to a known

mannose-binding protein (N-Flo1p) is shown in the graph.

Fig 5. SPR sensorgram of N-Flo11p–N-Flo11p interactions N-Flo11p

was covalently coupled to a CM5 chip at 95 relative units (RU), and

an N-Flo11p solution with the indicated concentrations was injected.

A concentration-dependent interaction between immobilized N-

Flo11p and injected N-Flo11p at different concentrations (11 nM,

88 nM, 350 nM, 56 lM, 112 lM, 225 lM, 45 lM and 90 lM) was

observed.

Fig 3. Multiple sequence alignment of the amino acid sequences

involved in sugar recognition of the Flo1, Flo5, Flo9, Flo10 and Flo11

adhesins from Saccharomyces cerevisiae. The region corresponding to

the pentapeptide, containing the amino acids that interact with the

carbohydrate (Kobayashi et al., 1998; Zupancic et al., 2008), is

marked as a grey box. The conserved tryptophan residue is outlined

in red.

FEMS Yeast Res 12 (2012) 78–87 ª 2011 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

S. cerevisiae Flo11p does not bind mannose 83

domain at the distal tip of the protein. For example,

FimH is the lectin domain at the tip of type 1 pili from

E. coli and recognizes terminal mannose units of uropla-

kin Ia, a membrane glycoprotein that is abundantly

expressed on superficial epithelial umbrella cells of the

urinary tract (Zhou et al., 2001); the N-terminal part of

Als1p from Candida albicans interacts with extracellular

matrix proteins, epithelial and endothelial cells (Loza

et al., 2004; Sheppard et al., 2004; Donohue et al., 2011).

Also, it was suggested that Flo11p shows a lectin activity

that is related to amino acids present in the N-terminus

(Bayly et al., 2005; Douglas et al., 2007). For these rea-

sons, only the N-terminal domain of Flo11p was cloned,

expressed and purified from S. cerevisiae to study its

structural and binding properties.

In this study, the purified N-Flo11p was analysed by

SDS-PAGE, and it was found that this domain is deco-

rated with O-glycans and does not contain N-glycans.

Moreover, the secondary structure was evaluated by CD.

By analysing the spectrum, we calculated that the sec-

ondary structure of N-Flo11p contains about 40.6% b-sheets and 3.0% a-helices. These values are comparable

with the percentages found for N-Flo1p (37.7% b-sheetsand 6.5% a-helices) (Goossens et al., 2011). The preva-

lence of b-sheets in the N-terminal domain is typical for

flocculins. This part of most of the flocculins has been

assigned to a new domain family (PF07691) in Pfam

(Finn et al., 2010) (http://pfam.sanger.ac.uk), called the

PA14 domain (Rigden et al., 2004). The PA14 domain is

a conserved domain that has been discovered in a wide

variety of bacterial and eukaryotic proteins, which

include many glycosidases, glycosyltransferases, proteases,

amidases, bacterial toxins, such as anthrax protective

antigen (PA), and also yeast adhesins. Most of the exper-

imentally characterized PA14-containing proteins are

involved in carbohydrate binding and/or metabolism.

Therefore, the N-terminal domains of the member pro-

teins of the flocculin family were considered as one of

the many PA14 domain variants (Rigden et al., 2004).

The anthrax toxin PA also contains a PA14 domain, and

the crystal structure of this toxin revealed that this

domain consists of a series of antiparallel b-strands(Petosa et al., 1997). Although a PA14 domain was not

predicted for Flo11p (Goossens & Willaert, 2010), the

secondary fold of the N-terminal part of the protein is

also dominated by b-sheets.The fact that the Flo11 flocculin does not contain this

PA14 domain indicates that no lectin activity was pre-

dicted. Indeed, by fluorescence spectroscopy, it was

shown that N-Flo11p is not able to bind mannose

(Fig. 4). Glycan array screening for N-Flo11p confirmed

this result (Consortium for Functional Glycomics, www.

functionalglycomics.org, request 2078 and 1224, supplying

investigator: Lars-Oliver Essen, Department of Chemistry/

Biochemistry, Philipps-Universitat Marburg, Germany).

The Flo11 protein was tested for its interaction with 465

different glycan structures (version 4.1) printed on an

array (request 2078) and 377 glycan structures (version

3.1) (request 1224), but no conclusive data were obtained

for glycan interaction analysis of N-Flo11p with and with-

out the GST tag, N-Flo11p with a His-tag and after

dimerization of N-Flo11p. No binding to mannose or to

any other glycans from the array was detected. The detec-

tion was based on fluorescence as the adhesin was directly

labelled with the fluorophore ‘Alexa 488’. Other members

of the flocculin family, however, are able to bind man-

nose, and their N-terminal domains correspond to the

PA14 domain (Rigden et al., 2004). Indeed, a clear lectin

activity was demonstrated for N-Flo1p and N-Flo5p

(Veelders et al., 2010; Goossens et al., 2011).

In contrast, Douglas et al. (2007) indirectly detected

mannose-binding activity for Flo11p. The whole Flo11

protein was purified from the growth medium after over-

expression in S. cerevisiae var. diastaticus or in S. cerevisi-

ae Σ1278b. It was observed that beads coated with

Flo11p were able to bind S. cerevisiae var. diastaticus cells

expressing Flo11p. This interaction was inhibited by the

addition of a high (1 M) concentration of mannose,

which suggests that Flo11p is a member of the Flo1-type

flocculins and functions as a lectin in S. cerevisiae var.

diastaticus (Douglas et al., 2007). Moreover, by studying

the interaction between the coated beads and yeast cells,

it was put forward that Flo11p shows a homotypic inter-

action (Douglas et al., 2007). Indeed, the beads could

only interact with yeast cells that express Flo11p, suggest-

ing that Flo11p itself is an important part of the adhesive

target on the cell wall, if not the only target.

In this study, the homotypic binding of Flo11 proteins

was confirmed by SPR as a clear and concentration-

dependent interaction of N-Flo11p molecules was

observed (Fig. 5). The mechanism of this interaction can-

not be based on a lectin–carbohydrate interaction. The

protein–protein interaction could be based on electro-

static and hydrophobic interactions, and influenced by

the presence of the O-glycans (Fig. 1). Also, yeast cells

expressing Flo11p have a highly hydrophobic character

(Reynolds & Fink, 2001; Van Mulders et al., 2009),

although the link between the hydrophobicity of the cell

wall and the presence of expressed Flo11p on the cell wall

is not yet clear. Recently, it was suggested that the whole

Flo11 protein has a hydrophilic character (Karunanithi

et al., 2010).

Recently, it has been demonstrated that many adhesins

from budding yeasts contain amyloid-forming sequences

that can play a role in cell–cell interactions (Otoo et al.,

2008; Alsteens et al., 2010; Frank et al., 2010; Nobbs

ª 2011 Federation of European Microbiological Societies FEMS Yeast Res 12 (2012) 78–87Published by Blackwell Publishing Ltd. All rights reserved

84 K.V.Y. Goossens & R.G. Willaert

et al., 2010; Ramsook et al., 2010; Garcia et al., 2011).

These adhesins contain sequences with high b-aggregationpotential; VVSTTV and VTTAVTTTVV were indicated

for the full Flo11p (Ramsook et al., 2010) (these

sequences are, however, not present in the N-terminal

part of Flo11p). Experimental results indicate that amy-

loid formation leads to the bundling of adhesins into

nanodomains, which can greatly increase the intercellular

binding strength by increasing the avidity (Douglas et al.,

2007; Ramsook et al., 2010) and, consequently, can rein-

force the Flo11p homotypic interactions between cells. It

has been shown that an applied force can induce the for-

mation of these nanodomains (Alsteens et al., 2010) and

that they can be regulated by exogenous peptides (Garcia

et al., 2011). Experimental results also suggest that amy-

loids are formed between adhesion molecules on contact-

ing cells (Rauceo et al., 2004; Ramsook et al., 2010). Such

intercellular amyloids would also strengthen the protein–protein intercellular adhesive bonds.

In conclusion, this study describes for the first time the

purification and subsequent characterization of the N-ter-

minal domain of Flo11p, a flocculin exhibiting a plethora

of phenotypes. SPR analysis showed a homotypic interac-

tion. However, in contrast to the other Flo proteins, N-

Flo11p does not bind mannose. The exact mechanism of

this protein–protein interaction and the involvement of

the O-glycans have still to be revealed.

Acknowledgements

We thank Prof. J. E. Edwards (Division of Infectious Dis-

eases, Medicine Deptartment, Harbor-UCLA, CA, USA)

for providing us with the pYEX-S1 vector. We also

acknowledge Msc. Catherine Stassen and Prof. Dr. Bart

Devreese (L-Probe, Ghent University) for the mass spec-

trometry analysis. This work was supported by the Euro-

pean Space Agency (Prodex program), the Institute for

the promotion of Innovation by Science and Technology

in Flanders (IWT) and the Research Council of the VUB.

References

Alsteens D, Garcia MC, Lipke PN & Dufrene YF (2010) Force-

induced formation and propagation of adhesion

nanodomains in living fungal cells. P Natl Acad Sci USA

107: 20744–20749.Andrade MA, Chacon P, Merelo JJ & Moran F (1993)

Evaluation of secondary structure of proteins from UV

circular dichroism spectra using an unsupervised learning

neural network. Protein Eng 6: 383–390.Bayly JC, Douglas LM, Pretorius IS, Bauer FF & Dranginis AM

(2005) Characteristics of Flo11-dependent flocculation in

Saccharomyces cerevisiae. FEMS Yeast Res 5: 1151–1156.

Benoit RM, Wilhelm RN, Scherer-Becker D & Ostermeier C

(2006) An improved method for fast, robust, and seamless

integration of DNA fragments into multiple plasmids.

Protein Expr Purif 45: 66–71.Bony M, Thines-Sempoux D, Barre P & Blondin B (1997)

Localization and cell surface anchoring of the Saccharomyces

cerevisiae flocculation protein Flo1p. J Bacteriol 179: 4929–4936.

Bryers JD (2008) Medical biofilms. Biotechnol Bioeng 100: 1–18.

Cullen PJ & Sprague GF Jr (2000) Glucose depletion causes

haploid invasive growth in yeast. P Natl Acad Sci USA 97:

13619–13624.Dickinson JR (2008) Filament formation in Saccharomyces

cerevisiae – a review. Folia Microbiol (Praha) 53: 3–14.Donohue DS, Ielasi F, Goossens KY & Willaert RG (2011) The

Als1 protein from Candida albicans specifically binds

fucose-containing glycans. Mol Microbiol 80: 1667–1679.Douglas LM, Li L, Yang Y & Dranginis AM (2007) Expression

and characterization of the flocculin Flo11/Muc1, a

Saccharomyces cerevisiae mannoprotein with homotypic

properties of adhesion. Eukaryot Cell 6: 2214–2221.Finn RD, Mistry J, Tate J et al. (2010) The Pfam protein

families database. Nucleic Acids Res 38: D211–D222.Frank AT, Ramsook C, Otoo HN, Tan C, Soybelman G,

Rauceo JM, Gaur NK, Klotz SA & Lipke PN (2010)

Structure and function of glycosylated tandem repeats

from Candida albicans Als adhesins. Eukaryot Cell 9: 405–414.

Garcia MC, Lee JT, Ramsook CB, Alsteens D, Dufrene YF &

Lipke PN (2011) A role for amyloid in cell aggregation and

biofilm formation. PLoS ONE 6: e17632.

Gietz RD & Schiestl RH (2007) High-efficiency yeast

transformation using the LiAc/SS carrier DNA/PEG method.

Nat Protoc 2: 31–34.Gimeno CJ, Ljungdahl PO, Styles CA & Fink GR (1992)

Unipolar cell divisions in the yeast S. cerevisiae lead to

filamentous growth: regulation by starvation and RAS. Cell

68: 1077–1090.Goossens K & Willaert R (2010) Flocculation protein structure

and cell-cell adhesion mechanism in Saccharomyces

cerevisiae. Biotechnol Lett 32: 1571–1585.Goossens KV, Stassen C, Stals I, Donohue DS, Devreese B, De

Greve H & Willaert RG (2011) The N-terminal domain of

the Flo1 flocculation protein from Saccharomyces cerevisiae

binds specifically to mannose carbohydrates. Eukaryot Cell

10: 110–117.Guo B, Styles CA, Feng Q & Fink GR (2000) A Saccharomyces

gene family involved in invasive growth, cell-cell adhesion,

and mating. P Natl Acad Sci USA 97: 12158–12163.Iserentant D (1996) Practical aspects of yeast flocculation.

Cerevisiae 21: 30–33.Ishigami M, Nakagawa Y, Hayakawa M & Iimura Y (2006)

FLO11 is the primary factor in flor formation caused by cell

surface hydrophobicity in wild-type flor yeast. Biosci

Biotechnol Biochem 70: 660–666.

FEMS Yeast Res 12 (2012) 78–87 ª 2011 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

S. cerevisiae Flo11p does not bind mannose 85

Ito H, Fukuda Y, Murata K & Kimura A (1983)

Transformation of intact yeast cells treated with alkali

cations. J Bacteriol 153: 163–168.Jin Y-L & Speers RA (1998) Flocculation of Saccharomyces

cerevisiae. Food Res Int 31: 421–440.Johnson WC (1999) Analyzing protein circular dichroism

spectra for accurate secondary structures. Proteins 35: 307–312.

Karunanithi S, Vadaie N, Chavel CA, Birkaya B, Joshi J, Grell

L & Cullen PJ (2010) Shedding of the mucin-like flocculin

Flo11p reveals a new aspect of fungal adhesion regulation.

Curr Biol 20: 1389–1395.Kobayashi O, Hayashi N, Kuroki R & Sone H (1998) Region

of Flo1 proteins responsible for sugar recognition. J

Bacteriol 180: 6503–6510.Kron SJ, Styles CA & Fink GR (1994) Symmetric cell division

in pseudohyphae of the yeast Saccharomyces cerevisiae. Mol

Biol Cell 5: 1003–1022.Lambrechts MG, Bauer FF, Marmur J & Pretorius IS (1996)

Muc1, a mucin-like protein that is regulated by Mss10, is

critical for pseudohyphal differentiation in yeast. P Natl

Acad Sci USA 93: 8419–8424.Lehle L & Bause E (1984) Primary structural requirements for

N- and O-glycosylation of yeast mannoproteins. Biochim

Biophys Acta 799: 246–251.Linder T & Gustafsson CM (2008) Molecular phylogenetics of

ascomycotal adhesins–a novel family of putative cell-surface

adhesive proteins in fission yeasts. Fungal Genet Biol 45:

485–497.Lo WS & Dranginis AM (1996) FLO11, a yeast gene related to

the STA genes, encodes a novel cell surface flocculin. J

Bacteriol 178: 7144–7151.Lo WS & Dranginis AM (1998) The cell surface flocculin

Flo11 is required for pseudohyphae formation and invasion

by Saccharomyces cerevisiae. Mol Biol Cell 9: 161–171.Loza L, Fu Y, Ibrahim AS, Sheppard DC, Filler SG & Edwards

JE Jr (2004) Functional analysis of the Candida albicans

ALS1 gene product. Yeast 21: 473–482.Mortensen HD, Dupont K, Jespersen L, Willats WG &

Arneborg N (2007) Identification of amino acids involved in

the Flo11p-mediated adhesion of Saccharomyces cerevisiae to

a polystyrene surface using phage display with competitive

elution. J Appl Microbiol 103: 1041–1047.Mosch HU (2000) Pseudohyphal development of

Saccharomyces cerevisiae. Contrib Microbiol 5: 185–200.Nobbs AH, Vickerman MM & Jenkinson HF (2010)

Heterologous expression of Candida albicans cell wall-

associated adhesins in Saccharomyces cerevisiae reveals

differential specificities in adherence and biofilm formation

and in binding oral Streptococcus gordonii. Eukaryot Cell 9:

1622–1634.Otoo HN, Lee KG, Qiu W & Lipke PN (2008) Candida

albicans Als adhesins have conserved amyloid-forming

sequences. Eukaryot Cell 7: 776–782.Palkova Z (2004) Multicellular microorganisms: laboratory

versus nature. EMBO Rep 5: 470–476.

Perez-Iratxeta C & Andrade-Navarro MA (2008) K2D2:

estimation of protein secondary structure from circular

dichroism spectra. BMC Struct Biol 8: 25.

Petosa C, Collier RJ, Klimpel KR, Leppla SH & Liddington RC

(1997) Crystal structure of the anthrax toxin protective

antigen. Nature 385: 833–838.Provencher SW & Glockner J (1981) Estimation of globular

protein secondary structure from circular dichroism.

Biochemistry 20: 33–37.Purevdorj-Gage B, Orr ME, Stoodley P, Sheehan KB & Hyman

LE (2007) The role of FLO11 in Saccharomyces cerevisiae

biofilm development in a laboratory based flow-cell system.

FEMS Yeast Res 7: 372–379.Ramsook C, Tan C, Garcia MC et al. (2010) Yeast cell

adhesion molecules have functional amyloid-forming

sequences. Eukaryot Cell 9: 393–404.Rauceo JM, Gaur NK, Lee KG, Edwards JE, Klotz SA & Lipke

PN (2004) Global cell surface conformational shift mediated

by a Candida albicans adhesin. Infect Immun 72: 4948–4955.Reynolds TB & Fink GR (2001) Bakers’ yeast, a model for

fungal biofilm formation. Science 291: 878–881.Reynolds TB, Jansen A, Peng X & Fink GR (2008) Mat

formation in Saccharomyces cerevisiae requires nutrient and

pH gradients. Eukaryot Cell 7: 122–130.Rigden DJ, Mello LV & Galperin MY (2004) The PA14

domain, a conserved all-beta domain in bacterial toxins,

enzymes, adhesins and signaling molecules. Trends Biochem

Sci 29: 335–339.Roberts RL & Fink GR (1994) Elements of a single MAP

kinase cascade in Saccharomyces cerevisiae mediate two

developmental programs in the same cell type: mating and

invasive growth. Genes Dev 8: 2974–2985.Rupp S, Summers E, Lo HJ, Madhani H & Fink G (1999)

MAP kinase and cAMP filamentation signaling pathways

converge on the unusually large promoter of the yeast

FLO11 gene. EMBO J 18: 1257–1269.Sambrook J & Russel DW (2001) Preparation and

transformation of competent E. coli using calcium chloride.

Molecular Cloning: A Laboratory Manual (Sambrook J &

Russel DW, eds), pp. 1116–1118. Cold Spring Harbor

Laboratory Press, New York.

Sheppard DC, Yeaman MR, Welch WH, Phan QT, Fu Y,

Ibrahim AS, Filler SG, Zhang M, Waring AJ & Edwards JE Jr

(2004) Functional and structural diversity in the Als protein

family of Candida albicans. J Biol Chem 279: 30480–30489.Sreerama N, Venyaminov SY & Woody RW (1999) Estimation

of the number of alpha-helical and beta-strand segments in

proteins using circular dichroism spectroscopy. Protein Sci

8: 370–380.Van Mulders SE, Christianen E, Saerens SM, Daenen L,

Verbelen PJ, Willaert R, Verstrepen KJ & Delvaux FR (2009)

Phenotypic diversity of Flo protein family-mediated

adhesion in Saccharomyces cerevisiae. FEMS Yeast Res 9:

178–190.Veelders M, Bruckner S, Ott D, Unverzagt C, Mosch HU &

Essen LO (2010) Structural basis of flocculin-mediated

ª 2011 Federation of European Microbiological Societies FEMS Yeast Res 12 (2012) 78–87Published by Blackwell Publishing Ltd. All rights reserved

86 K.V.Y. Goossens & R.G. Willaert

social behavior in yeast. P Natl Acad Sci USA 107: 22511–22516.

Zara S, Bakalinsky AT, Zara G, Pirino G, Demontis MA &

Budroni M (2005) FLO11-based model for air-liquid

interfacial biofilm formation by Saccharomyces cerevisiae.

Appl Environ Microbiol 71: 2934–2939.Zhou G, Mo WJ, Sebbel P, Min G, Neubert TA, Glockshuber

R, Wu XR, Sun TT & Kong XP (2001) Uroplakin Ia is the

urothelial receptor for uropathogenic Escherichia coli:

evidence from in vitro FimH binding. J Cell Sci 114: 4095–4103.

Zhu B, Cai G, Hall EO & Freeman GJ (2007) In-fusion

assembly: seamless engineering of multidomain fusion

proteins, modular vectors, and mutations. BioTechniques 43:

354–359.Zupancic ML, Frieman M, Smith D, Alvarez RA, Cummings

RD & Cormack BP (2008) Glycan microarray analysis of

Candida glabrata adhesin ligand specificity. Mol Microbiol

68: 547–559.

FEMS Yeast Res 12 (2012) 78–87 ª 2011 Federation of European Microbiological SocietiesPublished by Blackwell Publishing Ltd. All rights reserved

S. cerevisiae Flo11p does not bind mannose 87