www.elsevier.com/locate/yexcr

Experimental Cell Research

The mitochondrial ribosome-specific MrpL55 protein is essential in

Drosophila and dynamically required during development

Timofey V. Tselykha,*,1, Christophe Roosb, Tapio I. Heinoa,c,*

aInstitute of Biotechnology, Developmental Biology Program, University of Helsinki, FIN-00014 Helsinki, FinlandbMedicel Oy, Huopalahdentie 24, FIN-00350 Helsinki, Finland

cDepartment of Biological and Environmental Sciences, University of Helsinki, FIN-00014 Helsinki, Finland

Received 22 November 2004, revised version received 22 March 2005

Available online 13 May 2005

Abstract

We report on the essential Drosophila mRpL55 gene conserved exclusively in metazoans. Null mRpL55 mutants did not grow after

hatching, moved slowly and died as first instar larvae. MrpL55 is similar to mammalian MRPL55, a protein that, in a large-scale mass

spectrometry study, has been found as a mitoribosome-specific large subunit protein. We showed that MrpL55 was localised to the

mitochondrion in S2 cells and tissues and was enriched in cells with a higher protein synthesis activity. The MrpL55 protein contains a KOW-

like motif present in proteins with a role in transcriptional anti-termination and regulation of translation. Modulation of mRpL55 expression

level is critical for development. Somatic clonal analysis showed that MrpL55 was not required in larval eye imaginal discs but required in

pupal discs apparently during the second mitotic wave. Therefore, our results showed that the MrpL55 protein acts dynamically in the cell

during development. We propose that MrpL55 is involved in Drosophila mitochondrial biogenesis and G2/M phase cell cycle progression.

D 2005 Elsevier Inc. All rights reserved.

Keywords: CG14283; Mitochondria; Mitoribosome; Ribosomal protein; Mitochondrial biogenesis; KOW motif; Cell cycle; SIN3; E2F/RB

Introduction

The mitochondrion is a double-membrane cytoplasmic

organelle that plays a major role as an energy factory of the

cell. It contains its own specific set of mitochondrial

ribosomes, the mitoribosomes. All mitochondrial ribosomal

proteins (MRPs) are encoded by nuclear genes and

synthesised in the cytoplasm. Mitoribosomes are respon-

sible for the biosynthesis of the proteins, which produce

about 90% of ATP in the eukaryotic cell. In mammals, the

mitochondrial ribosome takes part in the synthesis of all 13

0014-4827/$ - see front matter D 2005 Elsevier Inc. All rights reserved.

doi:10.1016/j.yexcr.2005.03.037

* Corresponding authors. Fax: +358 9 191 59366.

E-mail addresses: timofei.tselykh@helsinki.fi (T.V. Tselykh),

tapio.heino@helsinki.fi (T.I. Heino).1 Present address: Molecular and Cancer Biology Research Program,

Institute of Biomedicine, Biomedicum Helsinki, P.O. Box 63, University of

Helsinki, FIN-00014 Helsinki, Finland.

proteins of the inner mitochondrial membrane involved in

oxidative phosphorylation [1,2].

The bovine mitochondrial ribosome has been used as a

model system for the study of human mitochondrial

ribosomes. The mitochondrial ribosomes represent the most

diverse group of ribosomes studied. Mammalian mitoribo-

somes have a lower percentage of rRNAs in comparison to

bacterial and eukaryotic cytoplasmic ribosomes and display

instead a compensating increase in the number of ribosomal

proteins [3,4]. Analysis of all the protein components of the

mammalian mitoribosome performed by different laborato-

ries revealed 78 proteins in the small (28S) and the large

(39S) subunits of the 55S mitochondrial ribosome [5–8]. Of

them, 15 proteins in the small subunit and 20 proteins in the

large subunit of the mammalian mitoribosome seem to be

specific to mitochondrial ribosome and display no homol-

ogy to other known types of ribosomal proteins (bacterial or

cytoplasmic). In addition, 20 of the specific mitoribosomal

proteins (9 in 28S small and 11 in 39S large subunit) have

307 (2005) 354 – 366

T.V. Tselykh et al. / Experimental Cell Research 307 (2005) 354–366 355

no homologs in yeast, and their role in translation remains to

be determined (reviewed in [9]).

Mitoribosomes are responsible for production of the

oxidative phosphorylation system proteins. Therefore, many

proteins involved in the mitoribosome function are expected

to be essential. Mutations in the genes encoding mitoribo-

somal proteins may lead to lethality or severe abnormalities.

A number of human nuclear genes encoding mitochondrial

ribosomal proteins have been mapped to the chromosomes

to investigate the possible involvement of mitochondrial

ribosomal defects in human disease [10]. The most

extensively studied human mitoribosomal gene MRPS12

[11–14] has been characterised as a candidate gene for

autosomal dominant sensorineural hearing loss [15]. Addi-

tionally, it has been found that certain mitoribosomal genes

are located in candidate regions for disorders involving

neural dysfunction such as Moebius syndrome (MRPL3)

and Hallervorden–Spatz syndrome (MRPS26) as well as for

retinitis pigmentosa (MRPL9, MRPS23) and Usher syn-

drome (MRPL39) [10]. The majority of the mammalian

MRPs have never been characterised in the laboratory. The

function of many mitoribosomal proteins in mammals has

been predicted only in accordance with the known functions

of homologous ribosomal proteins existing in bacteria or

yeast.

To date, only a small number of genes encoding for

mitoribosomal proteins have been extensively studied in

model organisms of higher eukaryotes. The fruit fly,

Drosophila melanogaster, offers a powerful environment

to study genes encoding mitochondrial ribosomal proteins.

The technical knockout (tko, mRpS12) gene has been

studied in detail in Drosophila. In tko mutants, the

mitochondrial synthesis apparatus is affected. The tko

mutant phenotype exhibits deficiency in respiratory chain

and various features of human mitochondrial disease

(developmental retardation, deafness etc.) [14]. In the

Drosophila bonsai (mRpS15) mutants, growth rate is

reduced. The mutant phenotype is characterised by a strong

reduction of mitochondrial activity in the gut and growth

retardation [16]. Also the null mutant cells for the

Drosophila ortholog of mammalian MRPL12, mRpL12,

show cell-autonomous growth defects [17].

The class of mitoribosome-specific ribosomal proteins

has not been much studied so far, but their functions are

expected to be quite intriguing. A few studies report that

some of the mitoribosomal proteins appear to be bifunc-

tional. For example, the MRPS29 protein has been shown to

be a GTP-binding protein identical to the death-associated

protein 3, DAP3 [18,19], while the MRPL41 protein

(BMRP) has been demonstrated to be a Bcl-2-binding

protein that induces apoptosis [20]. Finally, to our knowl-

edge, there have been only two studies related to character-

isation of metazoan MRPs, which are absent in yeast.

Mammalian MRPS30 has been implicated in apoptosis and

has been shown to be identical to the programmed cell death

protein 9 (PDCD9) [19,21]. Another protein, MRPS34,

interacts with the human homolog of the Drosophila disc

large tumor suppressor protein (hDLG) prior to its entry into

the mitochondria [22]. Therefore, there is a tendency for the

mitoribosome-specific proteins to function in the regulation

of cell death and interact with tumor suppressor proteins. To

our knowledge, none of the 11 large subunit MRPs, which

are specific exclusively for mitoribosome of multicellular

eukaryotes, have been characterised so far.

Here, we report the identification and characterisation of

the Drosophila mitochondrial ribosomal protein L55

(mRpL55) gene, which encodes 1 of 11 previously

uncharacterised large subunit MRPs specific for mitoribo-

some in multicellular organisms. Our study shows that the

mRpL55 gene is essential in Drosophila and conserved

exclusively in multicellular animals. This study also

demonstrates that the mRpL55 gene is dynamically

required in the cell during development and links mito-

chondrial biogenesis to the cell cycle. The present report is

the first in vivo characterisation of the mRpL55 gene and

protein using biochemical, cell biology and molecular

genetics techniques.

Materials and methods

Molecular methods

Screening of cDNA embryonic library. A 0.5 kb BamHI

fragment of genomic DNA from the enhancer trap strain

s2248 was used to probe Northern blots and isolate clones

from both the Drosophila EMBL4 genomic library (from R.

Blackman) and from a E-Zap embryonic (0–22 h after egg

laying) library. Isolated cDNA clones were subcloned into

the Bluescript SK vector.

The Northern blot was performed according to standard

protocol. Embryos and larvae were homogenised in Trizol

(Sigma), and total RNA was extracted using an RNeasy

Mini Kit (Qiagen) followed by poly (A)+ mRNA purifica-

tion using an mRNA DIRECT Kit (Dynabeads). 5 Ag of

mRNA for each sample was loaded and run on a 1.2%

agarose gel. RNA was transferred on Hybond-N membrane

(Amersham Pharmacia Biotech). A full cDNA sequence

corresponding to CG14283 (mRpL55) was radioactively

labelled and used as a probe for hybridisation.

Cloning, expression and purification of recombinant

proteins

The mRpL55 gene was cloned into pQE-30 (Qiagen)

and expressed in Escherichia coli strain M15[pREP4].

Isopropylthio-h-galactoside-induced bacterial cells express-

ing (His)6MrpL55 protein were grown overnight at 16-C,collected by centrifugation, and purification of the His-

tagged protein was performed in denaturing conditions using

HisTrap Chelating 1 ml columns (Amersham Pharmacia

Biotech AB, Sweden). The recombinant (His)6MrpL55 was

T.V. Tselykh et al. / Experimental Cell Research 307 (2005) 354–366356

used to raise polyclonal antiserum in two rabbits. Specificity

of anti-MrpL55 serum was confirmed by immunoblot

analysis on wild type and the mutant strain, mRpL55tmb13,

which totally lacks the coding sequence for the protein. This

serum was then used for detection of MrpL55 on Western

blots and for immunocytochemistry in S2 cells and live

tissues. Pre-immune serum was processed similarly and

used as a negative control in all experiments. V5- and His-

tagged MrpL55 for overexpression in S2 cells was

constructed by first amplifying the mRpL55 coding

sequence using primers designed to remove the stop codon

then subcloned directly into the pMT/V5-His TOPO vector

from a DES TOPO TA Cloning Kit (Version D, Invitrogen).

To bring the mRpL55 coding sequence in phase with the V5

and His epitope coding sequences, an extra amino acid,

alanine, was encoded in a designed forward primer directly

following Kozak sequence and methionine:

Forward: 5VACCATGGCCTTGCTGAAACAGTTGCCCC 3VReverse: 5V CTTCTTTTTGATGTACTTCATGTACTT 3V

All expression constructs described were sequenced to

confirm correct fusion of the open reading frames.

Cellular fractionation and larval protein extracts

preparation

For cell fractions preparations, S2 cells were sedimented

by centrifugation. Nuclear fraction was prepared from S2

cells following the protocol presented at http://www.

lamondlab.com/f5nucleolarprotocol.htm, which is a varia-

tion on a method described by Muramatsu and co-workers

in 1963 [23], skipping the final nucleolar separation step.

After the first nuclei-pull-down centrifugation (220 � g),

the supernatant was carefully transferred into a clean tube,

centrifuged again (700 � g) and used for the heavy

membrane (HM, mitochondria enriched) fraction isolation

according to the protocol published by Igaki et al. [24],

skipping the light membrane fraction isolation. Drosophila

larvae were homogenised with a Dounce homogeniser in

phosphate-buffered saline (PBS) on ice.

SDS-PAGE and Western blotting

All protein samples were solubilised at room temper-

ature in water and 1� SDS-PAGE sample buffer (2% (w/v)

SDS, 5% 2-mercaptoethanol, 10% glycerol, 0.05 M Tris–

HCl, pH 6.8), heated to 95-C and loaded on 15% (w/v)

SDS-polyacrylamide gels. For quantification experiments,

either loading controls were used or the total protein

amount in samples was measured by Bio-Rad DC Protein

Assay (Bio-Rad Laboratories). Standard immunoblotting

was performed onto polyvinylidene diflouride membranes

(Immubilon-P, Millipore Corp.). Membranes were blocked

for 2 h in phosphate-buffered saline containing 0.1%

Tween 20 and 5% (w/v) non-fat dry milk. Blots were

incubated with primary antibody in blocking solution

overnight at 4-C. Rabbit polyclonal anti-MrpL55 serum

was diluted 1/500, monoclonal mouse anti-V5 tag antibody

(Invitrogen) 1/5000, mouse anti-fibrillarin antibody (EnCor

Biotechnology Inc.) 1/1000, rabbit polyclonal anti-mtSSB

serum [25] (a gift from Dr. Laurie Kaguni) 1/500 and rabbit

polyclonal anti-twinfilin serum 1/2000 [26]. Horseradish-

peroxidase-coupled anti-rabbit IgG (diluted 1/5000) and

anti-mouse IgG (diluted 1/5000) were used to detect

primary antibodies. Immobilised proteins were visualised

on membranes with an ECL Western Blotting Analysis

System (Amersham Biosciences). Digital images were

obtained using a LAS 3000 CCD camera and edited in

Adobe Photoshop.

Generation of mRpL55 null mutations

mRpL55 was originally identified in a genomic analysis

of open reading frames flanking the insertion of a lethal

enhancer trap line s2248 at the cytological position 91F. The

lethality of the strain was not caused by the P(lacW)

insertion, and the lethal element was removed by recombi-

nation, and a homozygous viable strain (Q29) was

generated. Excisions of Q29 were generated by crossing

in a third chromosome carrying D2–3 to supply trans-

posase. 130 white-eyed (w) males from individual excision

events were crossed with Df(3R)Cha7/TM3 Sb lacZ females

to test lethality of the excision mutants. Genomic DNA

isolated from heterozygous flies was digested with various

restriction enzymes, separated on agarose gels, blotted and

probed with selected genomic fragments to define the limits

of the deletions. After this initial analysis, the exact limits of

deletions of the alleles mRpL55tmb13 and mRpL55tmb50 were

obtained by sequencing of the PCR products from the

genomic DNA of the mutants.

Generation of transformant fly stocks, ectopic expression

and rescue experiments

The 484 bp cDNA containing the full-length mRpL55

coding sequence was cloned with EcoRI and XhoI

restriction enzymes into a pUAST vector. The construct

was transformed into white-eyed flies by standard P-element

transformation technique, and 2 independent strains (UAS-

mRpL553 and UAS-mRpL5512) were obtained. The inser-

tion sites were determined on polytene chromosomes with

in situ hybridisation [27].

To rescue the first instar larval lethality, we used the

ubiquitously expressing daG79-GAL4 driver (kindly pro-

vided by Helen Skaer), which was recombined into the

mRpL55CL13 chromosome. Also the UAS-mRpL553 was

independently recombined into the mRpL55tmb13 chromo-

some. In the crosses between UAS-mRpL55; mRpL55tmb13/

TM6 Tb and daG79-GAL4; mRpL55tmb13/TM6 Tb, the

appearance of wild type third instar larvae and pupae was

monitored. Rescue experiments were done at 18-C, 23-C,

T.V. Tselykh et al. / Experimental Cell Research 307 (2005) 354–366 357

25-C and 29-C. The sgs3-GAL4 and tub-GAL4 lines were

used in the ectopic expression experiments.

Analysis of mosaic clones

Germline mosaics were generated using the autosoQ

mal FLP-DFS technique. For this purpose, we created

mRpL55tmb13 FRT82B recombinant chromosome, and the

generation of mosaics was done according to Chou and

Perrimon [28]. Somatic clones were generated into adult

eyes and eye imaginal discs using ey-GAL4 and UAS-FLP.

Cell culture and transfection

For intracellular protein localisation, Schneider 2 cells

(S2) were grown at room temperature in complete Schneid-

er’s Drosophila medium (Gibco) containing 10% (w/v) heat

inactivated fetal calf serum (Sigma), 50 units/ml of

penicillin G and 50 Ag/ml streptomycin sulfate (Sigma).

The recombinant mRpL55 construct in pMT/V5-His TOPO

vector was either transiently or stably transfected into S2

cells using standard calcium transfection protocol supplied

with a DES Expression System manual (Invitrogen). The

lacZ gene supplied with the DES TOPO TA Cloning Kit

and cloned into the pMT/V5-His TOPO vector was used as

a control in all overexpression experiments performed in

cell culture.

Immunohistochemistry analysis

S2 cells were fixed on cover slips using 4% (w/v)

paraformaldehyde (PFA) in phosphate-buffered saline

(PBS), washed and blocked in standard Dulbecco buffer

containing 0.2% (w/v) mammalian serum albumin. Cells

were permeabilised with 0.1% (w/v) Triton X-100 in PBS

(PBX) for 10 min and consequently incubated with primary

and secondary antibodies in 0.2% BSA Dulbecco buffer for

1 h at room temperature. Polyclonal anti-MrpL55 serum was

used at a 1/500 dilution both in S2 cells and tissue stainings,

and monoclonal anti-V5 antibodies in S2 cells were diluted

1/1000. Stained cells were placed in VectaShield mounting

medium for fluorescence (Vector Laboratories Inc.) con-

taining 0.5 Ag/ml Hoechst. For visualisation of mitochon-

dria, cells and tissues were stained for 45 min at 37-C before

fixation with MitoTracker Red CMXRos (Molecular

Probes). MitoTracker Red 1 mM stock solution was diluted

1/1000 in complete cell culture medium for S2 cells and 1/

200 in PBS for tissue stainings. Drosophila tissue was first

quickly dissected in PBS and fixed in 4% PFA for 30 min at

room temperature. Samples were then washed 3 � 10 min in

PBX and blocked for 2 h at room temperature in PBX

containing 1% (w/v) BSA. Tissues were incubated with

primary and secondary antibodies overnight and for 3 h,

respectively. Samples were washed 4 � 15 min in 1% BSA

PBX between primary and secondary antibodies treatment.

Finally, tissues were washed 4 � 15 min in PBX and

mounted in the VectaShield medium containing 0.5 Ag/ml

Hoechst. Secondary antibodies were pre-absorbed against

wild type tissues. Pre-immune serum was always used as

negative control at dilutions specified for anti-MrpL55

serum. Immunofluorescence analysis of stained samples

was performed using Olympus AX70 PROVIS microscope.

Cells and tissues were photographed using high resolution

Olympus DP70 camera. Eye imaginal discs were analysed

using a Bio-Rad Laser Confocal System equipped with a

Zeiss Axiovert 135 M microscope. Digital images were

manually edited with PhotoShop software.

Bioinformatics methods

Sequence similarity searches were performed using the

NCBI-BLAST server (http://www.ncbi.nlm.nih.gov/blast)

and the EBI WU-Blast server (http://www.ebi.ac.uk/blast2).

Motif searches were performed using the MEME/MAST

system at the San Diego supercomputing centre http://meme.

sdsc.edu). The secondary structure predictor Jpred was used

at the University of Dundee (http://www.compbio.dundee.

ac.uk/~www-jpred/).

Results

Cloning, structure and null mutant phenotype of the

mRpL55 gene

The mRpL55 (CG14283) gene is localised at 91F1 on the

third chromosome between the center divider (cdi ,

CG6027) and the ATP synthase subunit d (ATPsyn-d,

CG6030) genes. The cdi gene plays a role in embryonic

CNS midline cell development [29] and spermatogenesis

[30]. The ATPsyn-d is involved in hydrogen-exporting

ATPase activity and phosphorylative mechanisms in the

mitochondria [31]. Two cDNAs corresponding to the

mRpL55 gene were isolated from an embryonic cDNA

library using a genomic fragment as a probe. Sequencing of

the cDNAs revealed the presence of two exons separated by

a 70 bp intron. The longest open reading frame codes for a

protein of 107 amino acids (Fig. 1A).

We isolated deletion mutants of the mRpL55 gene by

excision of a P element (P[3R]Q29) inserted into the 3V endof mRpL55. Two deletions were analysed in more detail,

mRpL55tmb50, spanning the whole mRpL55 gene and the

first untranslated exon of cdi (data not shown), and a smaller

deletion, mRpL55tmb13, removing the mRpL55 gene and

only the beginning of the cdi first exon (Fig. 1A). The

mRpL55tmb50 and mRpL55tmb13 mutants were both larval

lethal at early larval stage. These alleles showed equivalent

levels of lethality, indicating that they are genetic null

alleles. This study focused on mRpL55tmb13 that did not

affect the coding regions of neighbouring genes. Null

mutant larvae did not grow, moved slowly and died as very

tiny first instar larvae 4–7 days after hatching. Because of

Fig. 1. Genomic map, null mutant phenotype and expression of the mRpL55 gene. (A) Chromosomal position of mRpL55 and two neighbouring genes. P-

element location and null mRpL55tmb13 deletion are specified. (B) Wild type mRpL55+/+ and mutant mRpL55�/� larvae 3 days after hatching with same

magnification. (C) Developmental Northern blot: 1— 0–2 h embryos; 2—2–6 h embryos; 3—6–11 h embryos; 4—11–22 h embryos; 5—1st and 2nd instar

larvae; 6—1st instar larvae; 7—2nd instar larvae; 8—wandering 3rd instar larvae. (D) Western blot of protein extract from mutant and wild type larvae 6 days

after hatching. Detection with polyclonal rabbit anti-MrpL55 serum.

T.V. Tselykh et al. / Experimental Cell Research 307 (2005) 354–366358

the larval mutant phenotype and the small protein, we

named the CG14283 allele tom thumb 13 (tmb13) (Fig. 1B).

The mRpL55 gene has a prominent maternal contribution,

is expressed throughout embryogenesis and is essential for

viability

We examined the amount of mRpL55 mRNA at different

developmental stages using Northern blotting (Fig. 1C). The

size of the mRpL55 transcript on the Northern blot was

about 500 bp, which is in accordance with the isolated 484

bp cDNA clones. The gene displayed a prominent maternal

contribution, and maternal mRpL55 mRNAwas detected up

to 2 h after egg laying. The zygotic expression of mRpL55

started approximately 6 h after egg laying. The strongest

mRpL55 expression was observed during the second instar

larval period, while it was absent at the late wandering third

instar larval stage. mRpL55 was also expressed during pupal

and adult stages (data not shown).

To better understand the reason for the lethality, we

quantified the MrpL55 protein close to the time point of

death in mutant larvae. For this purpose, total protein was

extracted from still moving larvae 6 days after egg laying.

At that time, the wild type GFP balanced larvae were in

early third instar, but the non-GFP mutants showed the

characteristics of early first instar larvae. A 13 kDa band

corresponding to the predicted protein of 107 aa was

detected in 2-day-old wild type larvae lysate by Western

blotting with rabbit polyclonal anti-MrpL55 serum. In the

mRpL55 mutant lysate, this band was not detected (Fig.

1D). First, this experiment confirmed that tmb13 is a null

allele. Second and most importantly, this result correlated

the lethality with the absence of MrpL55 protein, meaning

that MrpL55 is essential for viability.

The ubiquitous expression of mRpL55 cDNA can rescue the

larval mutant phenotype

To rule out the possible role of the neighbouring cdi and

ATPsyn-d genes in the mRpL55 null mutant phenotype, we

investigated whether the lethality of mutant larvae could be

rescued by the coding sequence of the mRpL55 gene. We

generated UAS-mRpL55 transgenic flies and crossed them

to flies expressing the Gal4 transcription factor under the

control of the daughterless (da) enhancer in homozygous

mRpL55 mutant background. The da gene is ubiquitously

expressed during Drosophila development. Therefore, it

will also drive the UAS-mRpL55 construct expression

during third larval instar, when mRpL55 transcript could

not be detected (Fig. 1C). In our experiment, the expression

of the mRpL55 cDNA rescued the mutant larvae, allowing

them to develop into pupae in expected numbers. Never-

theless, the da-GAL4-driven construct failed to rescue

development to the adult stage. This result showed that

the mutant phenotype depends only on the lack of mRpL55

function but not on the neighbouring cdi or the ATPsyn-d

genes.

MrpL55 is a conserved protein from nematode to humans

Protein sequences similar to MrpL55 were identified

using a BLAST search [32] on a non-redundant protein set

Fig. 3. Comparison of the most conserved part of MrpL55-related proteins.

The figure includes sequences with high similarity to MrpL55 (putative

orthologs) as well as ribosomal L26-related proteins. (A) The DGSTI motif

and its surroundings as discovered with the MEME tool. The histogram

shows the significance of every position measured in bits along the motif.

The colours of the amino acids reflect their physico-chemical properties.

(B) Alignment of the secondary structure prediction by Jpred emphasising

the pivotal position of glycine (G) in both the structure and the motif.

T.V. Tselykh et al. / Experimental Cell Research 307 (2005) 354–366 359

at NCBI and on species-specific genomes at ENSEMBL.

Putative orthologs (Blast E-value < 1e-8) were found (in

decreasing order of significance) in malaria mosquito

(ENSANGG00000017941 gene), in human (MRPL55),

in mouse (Mrpl55), in rat (ENSRNOG00000002943), in

cattle (BE237145), in chicken (LOC428400), in zebra fish

(ENSDARG00000008358), in honey bee (ENSAPMP00

000001344), in Caenorhabditis briggsae (CBG13496) and

in Caenorhabditis elegans (Y66H1A.3). In the frog

(Xenopus), only a sequence fragment similar to MrpL55

was found. This may be due to the fact that only a

preliminary genome draft was available. No similarity to

plant or yeast proteins was found at this level of

significance. All putative orthologs are in the same size

range as MrpL55 with the exception of the chicken protein,

which is 275 aa long. This peptide has been predicted by

automated computational analysis at NCBI and is derived

from an annotated genomic sequence (NW_060264) using

the GNOMON gene prediction method, so it might be

erroneous. The Drosophila MrpL55 has 42% identity and

71% similarity to the human MRPL55 protein over its full

107 aa length (Fig. 2).

Multiple sequence analyses were performed using both

ClustalW [33] as well as MEME, a tool for discovering

motifs in a group of related sequences [34]. They high-

lighted a conserved motif centered on the FDGSTI_sequence (Figs. 2, 3) perfectly conserved in all species with

the exception of Anopheles and Xenopus.

All the similar proteins were examined with the PSORT

II software (http://www.psort.ims.u-tokyo.ac.jp/), [35] and

putative nuclear localisation signals (NLS) were identified

in all of them (Fig. 2). The fruit fly MrpL55 protein contains

several conserved overlapping NLSs, and the mammalian

proteins were characterised by the presence of an absolutely

identical NLS of seven amino acids. The positions of the

predicted NLSs in the different species are conserved.

Using MitoProt and TargetP software [36,37], we

revealed that MrpL55 and its mammalian orthologs also

Fig. 2. Multiple sequence alignment of some putative MrpL55 orthologs. The mitoc

Putatively phosphorylated tyrosines are marked with stars. The most conserved pa

(CK II) site is marked. The conserved position of the nuclear localisation signal (N

is boxed with a dotted line.

contain an N-terminal mitochondrial targeting sequences

(MTS) (Fig. 2). Interestingly, SMART searches (http://

www.smart.embl-heidelberg.de) [38,39] show that the frog,

rat, mouse and bovine proteins also have a signal sequence

embedded in the MTS (data not shown).

PSORT II revealed that all analysed proteins contain one

positionally conserved casein kinase II (CKII) site close to

the NLS. Although some MrpL55 orthologs have additional

CKII sites, only one has been conserved in the process of

evolution (Fig. 2). MrpL55 and its orthologs also have a

number of conserved tyrosine residues available for

hondrial targeting sequence (MTS) position is boxed with a continuous line.

rt of the protein is emphasised with squares. The conserved casein kinase II

LS) is boxed with a dashed line, and the ER membrane retention signal (EP)

Fig. 4. Detection of the endogenous MrpL55 protein in mitochondrial-

enriched fraction of S2 cells. N—nuclear (nucleolar), M—mitochondrial-

enriched; C—cytoplasmic fraction. Anti-fibrillarin (Fib), anti-mitochondrial

single-stranded DNA binding protein (mtSSB) and anti-twinfilin (Twf)

antibodies were used as markers for nucleolus, mitochondria and

cytoplasm, respectively. Corresponding protein amounts from different

fractions were loaded on SDS-PAGE.

T.V. Tselykh et al. / Experimental Cell Research 307 (2005) 354–366360

potential phosphorylation. In addition, PSORT II also

predicts the existence of a C-terminal endoplasmic retic-

ulum retention signal (EP) in all analyzed orthologs.

The MrpL55 protein and orthologs’ secondary structure

display a resemblance to the KOW motif containing proteins

The WU-Blastp (2.0 MP-WashU) searches at EBI using

MrpL55 also identified a 60S ribosomal protein L26 in

several species: rat, human, bovine, macaque and mouse.

Although the quality (E-value) of the similarity was several

orders of magnitude lower than that of the previously

mentioned sequences, the similarity also centered over the

FDGSTI_ motif. Furthermore, the MAST analysis tool for

searching known motifs [40] also identified the ribosomal

L26 sequences when a position-specific scoring matrix

(PSSM) covering the MEME motif including the FDGSTI_kernel was used.

This approach revealed that the L26 proteins contained

the Interpro parent domain IPR011590, which in turn

contained four child domains: IPR003257 (Bacterial NusG

ribosomal protein), IPR006645 (NGN), IPR006646 (KOW-

Kyrpides, Ouzounis, Woese-motif), IPR008991 (Translation

protein SH3-like) [41]. The KOW domain is shared by

bacterial NusG transcription factors and the L24p/L26e

family of ribosomal proteins. It is the only close homolog of

eukaryotic L26e in archaeal genomes, although it is called

archaeal NusG in several publications. The KOW motif

belongs to a class of nucleic acid-binding domains.

Interestingly, the FDGSTI_ centered motif found by MEME

in MrpL55 and all putative orthologs was also found by the

same PSSM at the site of the KOW motif in the NusG

sequences (Fig. 3A).

The secondary structure of MrpL55 and its orthologs was

predicted with the Jpred consensus method [42]. Expect-

edly, all proteins showed high conservation in the secondary

structure especially nearby the conserved DGSTI domain. In

NusG and certain ribosomal proteins, the canonical KOW

motif contains an invariant glycine residue that follows the

first predicted h-strand and appears to be part of a conservedloop region ending up with another h-strand [43]. This type

of structure with h-strands flanking the glycine residue of

the KOW motif is also observed in the MrpL55 protein

DGSTI domain (Fig. 3B).

The MrpL55 protein is localised to mitochondria in

Drosophila Schneider (S2) cells

The mammalian MRPL55 protein has previously been

shown to be associated with the large subunit of the mito-

chondrial ribosome [6]. We used Drosophila S2 cells to

investigate the cellular localisation of MrpL55 protein.

Immunofluorescent microscopy of cultured S2 cells using

polyclonal rabbit anti-MrpL55 antibody showed that endog-

enous MrpL55 was not detected in mitochondria. Surpris-

ingly, the antibody gave a signal only in the nucleolus.

Although we were unable to detect MrpL55 protein in the

mitochondrion, we could not exclude that MrpL55 was

present at quantities below the immunofluorescence detec-

tion limit. Previously, Western blot staining showed that the

total levels of MrpL55 protein in the larval cells were low

(Fig. 1D). We decided to obtain cytoplasmic, mitochondrial

and nuclear (nucleolar)-enriched fractions of S2 cells to

investigate cellular distribution of the MrpL55 protein.

Fraction-specific markers were used as controls: anti-

twinfilin [26], anti-mtSSB [25] and anti-fibrillarin anti-

bodies, respectively. After this enrichment, a specific 13

kDa band corresponding to the predicted size of the MrpL55

protein was detected in the mitochondrial (heavy mem-

brane) fraction (Fig. 4). Additionally, we also detected

several mitochondrial and nuclear bands in the range 20–70

kDa (data not shown). Among them, a strong 70 kDa band

in nuclear (nucleolar)-enriched fraction was observed. This

apparently explains the presence of nucleolar immunofluor-

escence signal in S2 cells. As all the extra bands were also

seen in extracts from null mutant larvae, we assume that

they are cross-reactants.

In an attempt to detect the MrpL55 protein by immuno-

fluorescence in S2 cells and see a possible phenotype related

to the protein excess, we checked whether MrpL55 could be

found in mitochondria upon overexpression. We used

immunofluorescence microscopy with either polyclonal

rabbit anti-MrpL55 antibody or monoclonal anti-V5 tag

antibody. Cultured S2 cells overexpressing V5-tagged

MrpL55 protein revealed a granular distribution of the

recombinant MrpL55, typical for mitochondria (Figs. 5A,

B). Co-localisation of the MitoTracker dye with the V5-

epitope confirmed that MrpL55 accumulated in the mito-

chondria (Fig. 5A). Interestingly, the unspecific nucleolar

signal was not detected with polyclonal antibody after 24 h

overexpression (Fig. 5B).

Furthermore, using the stably transfected S2 cells

expressing recombinant MrpL55, we could confirm that

our polyclonal rabbit antibody can detect the protein in

mitochondrial-enriched fractions (Fig. 5C). Indeed, the

Fig. 5. Immunostainings of stably transfected S2 cells and detection of V5-tagged MrpL55 in mitochondrial-enriched fractions. (A) Using a V5 tag-specific

antibody, MrpL55 was detected in the mitochondria after 24 h of overexpression, as confirmed with MitoTracker dye. (B) Also using a polyclonal anti-MrpL55

serum, the overexpressed protein was detected in the mitochondria. (C) In opposition to pre-immune serum (lane 4), a single specific 13 kDa band was

observed in non-transfected control cells (lane 1), and 16 kDa V5-tagged MrpL55 band was detected with both polyclonal anti-MrpL55 (lane 2) and

monoclonal anti-V5 (lane 3) antibodies in stably transfected cells. (D) Pre-immune serum gave no signal in immunofluorescence stainings. Note: only a single

cell is presented on panels (A) and (B), but a number of cells at lower magnification is analysed on panel (D).

T.V. Tselykh et al. / Experimental Cell Research 307 (2005) 354–366 361

recombinant V5-tagged protein overexpressed for 24 h was

detected on the SDS-PAGE as a higher molecular weight 16

kDa band in comparison with the 13 kDa endogenous

MrpL55 protein (Fig. 5C, lanes 1–2). Moreover, the 16 kDa

band was also detected in mitochondrial-enriched fraction

with monoclonal anti-V5 antibody (Fig. 5C, lane 3).

The overexpression of MrpL55 did not seem to affect the

cell survival in general. S2 cells constantly expressing

MrpL55 in a second transfected cell line stayed alive for at

least 3 weeks.

The MrpL55 protein is localised to mitochondria in

Drosophila tissues

Salivary gland cells of the third instar larvae have a

number of advantages for assaying subcellular protein

localisation due to their large cytoplasm. Drosophila larvae

spend most of their time inside the food substrate as

foraging larvae. During the third instar stage, in response

to increased levels of ecdysone, they leave the food as

wandering larvae and search for an adequate site to pupate,

which in laboratory cultures are the walls of the culture

vial. To identify the localisation of MrpL55 in Drosophila

tissue cells, we performed immunohistochemical staining

using anti-MrpL55 antibody on foraging and wandering

larval salivary glands. In foraging third instar larvae

salivary glands, we could not detect any mitochondrial

signal. Similar to the case with S2 cells, the antibody

cross-reacted with some components in the nucleolus of

foraging larvae salivary glands. In wandering larvae, a

mitochondrial signal could be detected, but only in the

proximal cells of the salivary glands (Fig. 6A). Co-

localisation of the MitoTracker dye with the anti-MrpL55

antibody confirmed that the protein accumulated in the

mitochondria in secretory cells (Fig. 6A). This experiment

clearly showed that the intracellular localisation of MrpL55

protein was similar in tissues isolated from wandering

larvae and S2 cells.

We also checked expression of the MrpL55 protein in

the cells of other third instar larval tissues such as gut, fat

body, imaginal discs, brain, trachea as well as adult

ovaries. In all tissues examined, the MrpL55 protein was

found in the cytoplasm and had a faint granular,

mitochondrial-like distribution (data not shown). The

results demonstrate that MrpL55 is expressed in multiple

tissues.

Modulation of ectopic expression of the mRpL55 gene leads

to different responses during development

To get insights into the role of mRpL55, the gene was

overexpressed under three different tissue-specific en-

hancers using the UAS-Gal4 system. Using the salivary

gland secretion-3 (sgs-3) enhancer, the overexpression of

MrpL55 leads to accumulation of the protein in all salivary

gland cells of wandering larvae (Fig. 6B). This accumu-

lation of the protein had no effect on fly development.

Using the tubulin (tub) enhancer, the mRpL55 gene was

expressed ubiquitously, and mitochondrial accumulation of

the protein could be observed in cells of larval fat body,

imaginal discs, trachea, brain as well as adult ovaries (data

not shown). However, these animals (tub-Gal4 � UAS-

mRpL55) died as late third instar larvae or pupae. Using the

daughterless (da) enhancer, ubiquitous expression was also

achieved, and the mitochondrial accumulation of the

protein could again be observed in all studied cells.

Fig. 7. Somatic mosaic clones induced with FLP-FRT recombination: (A) in

anterior part of eye imaginal disc. Homozygous mutant clones are marked

with a star. Heterozygous and wild type clones carry one or two copies of a

GFP-balancer (TM3, Ser GFP) and are seen stained (left). There is no

difference in cell size as outlined using a phalloidin staining (middle); (B) in

adult eye. (Left) Clones of normal red eye colour were of genotype w+/w+;

mRpL55+/mRpL55+, while the pale red patches were w+/w�; mRpL55+/

mRpL55�. No white clones corresponding to the genotype w�/w�;

mRpL55�/mRpL55� were seen. (Middle) When no recombination takes

place, all cells were w+/w�; mRpL55+/mRpL55� and appeared pale red.

(Right) In a control experiment using Stubble (Sb) instead of mRpL55,

patches of all three types were generated, including mutant white clones.

Fig. 6. Immunohistochemical stainings of salivary gland cells from 3rd instar larvae. (A) MrpL55 was detected with a polyclonal anti-MrpL55 serum in

mitochondria of proximal secretory salivary gland cells of wandering larvae. The localisation was confirmed with the specific mitochondrial marker

MitoTracker Red. Proximal is on the left, distal is on the right. (B) sgs-3-driven mRpL55 overexpression. The MrpL55 protein was detected in mitochondria of

all salivary gland cells, as confirmed with MitoTracker Red. Note: a lower magnification was used for images on panel (A) to show proximal and distal parts of

the salivary gland.

T.V. Tselykh et al. / Experimental Cell Research 307 (2005) 354–366362

Interestingly, the da-Gal4 � UAS-mRpL55 animals sur-

vived and were fertile. Since the mRpL55 gene is normally

not expressed in third instar larvae (Fig. 1C), these results

show that the modulation of expression is a critical issue

for animal development.

Clonal analysis shows a dynamic autonomous requirement

for mRpL55 activity in the cell during development

Since we observed germline expression of mRpL55, we

wanted to study whether the gene had a function during

oogenesis. Therefore, we applied the FLP-FRT recombina-

tion technique to generate germline mosaic clones where

the maternal mRpL55 expression is eliminated. Upon

recombination, the females became sterile. This shows that

mRpL55 seems to be required for germline cell survival.

Based on our initial observations of tiny mRpL55 mutant

larvae arrested in growth, we postulated that mRpL55 could

be involved in cell growth or cell proliferation. However,

due to the possible cell-autonomous requirement for

mRpL55 in germline cells, we could not get any information

on the requirement for maternal mRpL55 during early

embryogenesis.

To understand the cellular basis for mRpL55 effects on

cell growth and proliferation, we also conducted a somatic

mosaic analysis with the FLP-FRT recombination techni-

que. We created patches of mosaic clones in eye imaginal

discs. FLP was expressed under the control of the eye-

specific eyeless (ey) enhancer. Clones of both mRpL55+/+

and mRpL55�/� genotypes were observed in anterior parts

of eye discs (Fig. 7A). Additionally, mutant clones were

sometimes detected in the area just posterior to the

morphogenetic furrow, a physical constriction in the apical

surface of the eye disc epithelium (data not shown). This

T.V. Tselykh et al. / Experimental Cell Research 307 (2005) 354–366 363

result shows that mRpL55 is not required in eye imaginal

disc cells at third instar larval stage. Indeed, the Northern

blotting results showed that the mRpL55 gene is not

expressed during this stage (Fig. 1C). Moreover, the

mRpL55�/� clones did not appear to be smaller than

mRpL55+/+ twin spot clones.

Knowing that mRpL55 is expressed during pupal and

adult stages, we extended the somatic clonal analyses to

adult eyes. No mutant clones appeared in the adult eyes,

and the heterozygous mRpL55+/� patches were smaller

than the mRpL55+/+ clones (Fig. 7B). Overall shape and

size of adult eyes were not affected. This experiment

showed that mRpL55 is essential for the survival of

developing eye cells at pupal stage. Taken together, these

results indicate that there is a dynamic requirement for

mRpL55 activity in the cell.

Discussion

In this study, we report the characterisation of the

essential Drosophila mRpL55 gene, which encodes 1 of

11 previously uncharacterised large subunit MRPs specific

for mitoribosome in multicellular organisms. The mRpL55

larval mutant phenotype was characterised by developmen-

tal arrest at early larval stage. The Drosophila MrpL55

protein is orthologous to the mammalian mitochondrial

ribosomal protein MRPL55, which belongs to a class of

proteins specific only for mitoribosomes and expressed

exclusively in metazoans. The Drosophila protein and its

orthologs also contain an N-terminal mitochondrial target-

ing sequence (MTS). Interestingly, the MrpL55 protein also

contains a nuclear localisation signal (NLS), the position of

which is highly conserved in MrpL55 orthologs from other

species. However, it is not clear whether this NLS has any

relation to the function of the protein. The pattern of

conservation in MrpL55 orthologs indicates that this protein

has evolved relatively recently.

Using biochemical, cell biology and genetics techniques,

we showed that the Drosophila MrpL55 protein is localised

to the mitochondrion both in S2 cells and various

Drosophila tissues. The localisation of MrpL55 in mito-

chondria is in agreement with the presence of a mitochon-

drial targeting sequence (MTS) in the protein. Our

observations of intracellular localisation of the protein are

in agreement with a report that the mammalian MrpL55

ortholog, MRPL55, is associated with the large subunit of

the mitochondrial ribosome [6].

The Drosophila MrpL55 protein and its orthologs display

a high similarity in secondary structure and amino acid

composition to the KOW motif [43]. The KOW (Kyrpides,

Ouzounis, Woese) motif is found in a variety of ribosomal

proteins and the bacterial transcription anti-termination

NusG proteins. It encodes a nucleic acid interaction motif

(Interpro entry IPR006646). The KOW-motif-containing

proteins have been shown to play a role in transcriptional

anti-termination and in the regulation of translation [44–47].

The crystal structure of a NusG transcription factor from

Aquifex aeolicus indicates that the KOWmotif is found to be

the core of an RNA-binding domain [48]. The most

conserved peptide sequence of the MrpL55 protein ortho-

logs, DGSTI, is found in the middle of the protein and

includes the conservation of a glycine amino acid separating

the two h-strands in the NusG protein. The KOW motif is

present in proteins with nucleic acid binding function:

bacterial NusG proteins are transcription factors, and L24/

26 are ribosomal proteins. The presence of a KOW-like motif

in MrpL55 indicates that the protein may bind mitochondrial

DNA (mtDNA), mitochondrial ribosomal RNAs (rRNAs) or

other RNA types located in the mitochondria. We suggest

that MrpL55 plays a role in the regulation of mitochondrial

rRNA transcription, protein translation or mitoribosomal

saturation.

The modulation of the mRpl55 gene expression level is

critical for development. Both absence and overexpression

of the gene can lead to lethality in vivo. The mutant larvae

without any endogenous zygotic expression could be

rescued until third instar/pupal stage using the daughterless

enhancer. Is the dosage of the gene expression especially

critical at the third instar larval stage where mRpL55 is

normally not expressed? Ectopic expression of the gene

using the daughterless enhancer on top of the endogenous

expression did not disturb the development of the animals,

showing that there is a certain tolerance for overexpression.

Thus, it appears that expression under the daughterless

enhancer is not strong enough (1) to bring the rescue of the

null phenotype beyond the early pupal stage or (2) to disturb

a normal development when cumulated to endogenous

expression. However, ectopic expression using the stronger

tubulin enhancer on top of endogenous expression exceeds

the tolerated expression level, and the animals die during

third instar/pupal stage. Therefore, it is possible that rescue

of mutants using tubulin-driven expression would extend

the rescue to a later stage than daughterless-driven

expression.

The requirement for MrpL55 in the cell varies during

larval development. We showed that mRpL55 expression

drops at third instar larval stage. However, the MrpL55

protein was detected enriched in the mitochondria of

secretory proximal salivary gland cells towards the very

end of the third larval instar stage (wandering larvae). It

appears that MrpL55 is enriched in the mitochondria of

cells with a higher protein synthesis activity (Fig. 6A).

Indeed, towards the end of larval development, the distal

salivary gland cells enter a phase of reduced protein

synthesis and less intense endomitosis. Thus, the amount

of MrpL55 protein changes dynamically depending on the

status of the cell. Taking into account that MrpL55 is a

mitoribosomal protein and that most larval tissues consist

of metabolically active polytene cells, the growth retarda-

tion and tiny size of mRpL55 mutant larvae might be a

consequence of disturbances in the mitochondrial produc-

T.V. Tselykh et al. / Experimental Cell Research 307 (2005) 354–366364

tion of ATP, which is required for general protein synthesis

in the cell.

The concept of dynamic requirement for MrpL55 in the

cell is further strengthened by somatic mosaic experiments.

We showed that mRpL55�/� cells do not survive in adult

eyes, while they do survive in eye imaginal discs of third

instar larvae. In wandering third instar larvae, mRpL55

transcripts are absent, but the protein is still present. The

survival of mRpL55�/� clones in eye imaginal discs could

be explained either by the possibility that the protein is

dispensable or is still present in sufficient amounts due to

the relatively long protein half-life. However, the absence of

mutant clones in adult eyes showed that MrpL55 was again

required during pupal stage.

In a set of experiments, Pile and colleagues have identified

genes, the expression of which is modified by the SIN3

deacetylase complex, essential for G2 phase cell cycle

progression [49]. The mRpL55 gene was identified as a

SIN3 target of repression together with other mitochondrial

ribosomal genes. In another high throughput study, per-

formed by Dimova et al., mRpL55 was, among other genes,

described as a likely direct target for E2F/RB transcription

factor regulation [50]. The E2F and pRB families are pivotal

regulators in cell division control (for a review, see [51,52]).

The E2F/RB transcription factors regulation of mRpL55

suggests that the MrpL55 protein links mitochondrial bio-

genesis to cell cycle progression. Nuclear and mitochondrial

genome functions have been shown to be interconnected in

several independent studies. For example, mitochondria can

modify nuclear gene expression levels by direct signalling to

nuclei [53,54] and, in Drosophila, a molecular link between

nuclear and mitochondrial DNA replication has been

established through the role of the mitochondrial single-

stranded DNA-binding protein gene (mtSSB) [55]. Finally,

the Drosophila mitoribosomal protein MrpL12 has been

shown to be required for Cyclin D/Cdk4-driven growth,

building a link between cellular growth rates and mitochon-

drial activity [17]. A possible involvement of the mRpL55

gene in cell cycle regulation is also supported by the fact that

about three quarter of rescued mRpL55 mutant third instar

larvae developed pigment-encapsulated cell clusters, which

lost their cellular appearance and transformed into black

inclusion bodies as seen in black pearl (blp) mutants [56].

The melanotic tumor-like bodies were found in mRpL55

rescue experiments almost in all dead pupae (Tselykh T.V.,

unpublished data). Inappropriate level of MrpL55 during the

third instar larval stage, when the mRpL55 gene is normally

not expressed (Fig. 1C), could have an influence upon cell

division, leading to melanotic Ftumor_ formation and,

consequently, death.

Dimova et al. [50] also proposed that the mRpL55 gene,

among other genes analysed, plays a role in progression

through G2/M cell cycle transition, which in Drosophila is

crucial during the patterning and specification of adult

tissues, when the precise number of cells may be important

[57]. Development of the Drosophila adult eye is an

example where G2/M cell cycle regulation is of paramount

importance.

Each Drosophila adult eye develops from the eye

imaginal disc and is composed of about 800 ommatidia,

special eye units. Differentiation and patterning of omma-

tidia begins at late third instar larval stage and continues in

pupa. Cell differentiation in eye discs is coordinated with

cell proliferation and cell death (for detailed review, see

[57]). The total cell number in adult eye depends on the

balance of these processes. The differentiation process in

eye imaginal disc initiates posterior to the morphogenetic

furrow (MF). All cells ahead of the MF are undiffer-

entiated and divide asynchronously. The cells just anterior

to the MF are transiently arrested in G1 phase. The

differentiation progresses as a wave marked by the MF

moving anteriorly. The process is followed by a ‘‘Second

Mitotic Wave’’ (SMW) cell cycle that is regulated at the

G2/M phase transition. Importantly, determination of exact

cell number in each adult eye ommatidia occurs at the G2/

M transition of the SMW cell cycle. The regulation of the

terminal cell divisions is coordinated by local intercellular

signals [58]. Dimova et al. [50] showed that there is a class

of genes with E2F-dependent transcription that requires

additional transcription factors and that is activated later in

the cell cycle. The mRpL55 gene belongs to this class.

Interestingly, the string (stg) gene also belongs to the same

class. In Drosophila, the stg gene is a limiting factor for

the cell cycle during Drosophila development and one of

the major components during G2/M in the SMW [59,60].

Interestingly, Pile and colleagues [49] reported that loss of

SIN3 in the cell repressed the string gene whereas it

induced mRpL55 expression. Our results reveal that

MrpL55 is not required in asynchronously dividing and

G1 phase arrested cells. However, the fact that mRpL55�/�

clones were not observed in adult eye suggests that G2/M

transition in the SMW at pupal stage was affected in

mutant cells. Therefore, our results suggest that mRpL55

has a role in the G2/M cell cycle transition, the more

precise molecular function, however, will be the subject of

future studies.

Acknowledgments

We thank Martyn James and Konstantin I. Ivanov for

critical review of the manuscript. We are grateful to

Laurie Kaguni (Michigan State University, USA) for

providing us with a rabbit polyclonal anti-mtSSB anti-

body. The authors are also grateful to Tiina Immonen,

Marja Mikkola, Johan Peranen, Mari Palgi, Mari Palviai-

nen and Gudrun Wahlstrom (University of Helsinki,

Finland) for technical support and especially to Christos

Samakovlis (Stockholm University, Sweden) for his help

at the early stages of this study. This work was supported

in part by a grant from the Centre for International

Mobility (CIMO, Finland).

T.V. Tselykh et al. / Experimental Cell Research 307 (2005) 354–366 365

References

[1] G. Attardi, Animal mitochondrial DNA: an extreme example of

genetic economy, Int. Rev. Cytol. 93 (1985) 93–145.

[2] A. Chomyn, M.W. Cleeter, C.I. Ragan, M. Riley, R.F. Doolittle, G.

Attardi, URF6, last unidentified reading frame of human mtDNA,

codes for an NADH dehydrogenase subunit, Science 234 (1986)

614–618.

[3] H. de Vries, R. Koogh-Schuuring, Physicochemical characteristics of

isolated 55-S mitochondrial ribosomes from rat-liver, Biochem.

Biophys. Res. Commun. 54 (1973) 308–314.

[4] T.W. O’Brien, D.E. Mathews, N.D. Denslow, in: T.I. Bucher, W.

Neupert, W.S. Sebald, S. Werner (Eds.), Genetics and Biogenesis of

Chloroplasts and Mitochondria, 1976, pp. 741–748.

[5] E.C. Koc, W. Burkhart, K. Blackburn, A. Moseley, L.L. Spremulli,

The small subunit of the mammalian mitochondrial ribosome,

Identification of the full complement of ribosomal proteins present,

J. Biol. Chem. 276 (2001) 19363–19374.

[6] E.C. Koc, W. Burkhart, K. Blackburn, M.B. Moyer, D.M. Schlatzer,

A. Moseley, L.L. Spremulli, The large subunit of the mammalian

mitochondrial ribosome. Analysis of the complement of ribosomal

proteins present, J. Biol. Chem. 276 (2001) 43958–43969.

[7] T. Suzuki, M. Terasaki, C. Takemoto-Hori, T. Hanada, T. Ueda, A.

Wada, K. Watanabe, Structural compensation for the deficit of rRNA

with proteins in the mammalian mitochondrial ribosome, Systematic

analysis of protein components of the large ribosomal subunit from

mammalian mitochondria, J. Biol. Chem. 276 (2001) 21724–21736.

[8] T. Suzuki, M. Terasaki, C. Takemoto-Hori, T. Hanada, T. Ueda, A.

Wada, K. Watanabe, Proteomic analysis of the mammalian mitochon-

drial ribosome, Identification of protein components in the 28 S small

subunit, J. Biol. Chem. 276 (2001) 33181–33195.

[9] T.W. O’Brien, Evolution of a protein-rich mitochondrial ribosome:

implications for human genetic disease, Gene 286 (2002) 73–79.

[10] N. Kenmochi, T. Suzuki, T. Uechi, M. Magoori, M. Kuniba, S. Higa,

K. Watanabe, T. Tanaka, The human mitochondrial ribosomal protein

genes: mapping of 54 genes to the chromosomes and implications for

human disorders, Genomics 77 (2001) 65–70.

[11] D.F. Johnson, M. Hamon, N. Fischel-Ghodsian, Characterization of

the human mitochondrial ribosomal S12 gene, Genomics 52 (1998)

363–368.

[12] P. Mariottini, Z.H. Shah, J.M. Toivonen, C. Bagni, J.N. Spelbrink, F.

Amaldi, H.T. Jacobs, Expression of the gene for mitoribosomal protein

S12 is controlled in human cells at the levels of transcription, RNA

splicing, and translation, J. Biol. Chem. 274 (1999) 31853–31862.

[13] Z.H. Shah, K.M. O’Dell, S.C. Miller, X. An, H.T. Jacobs, Metazoan

nuclear genes for mitoribosomal protein S12, Gene 204 (1997) 55–62.

[14] J.M. Toivonen, K.M. O’Dell, N. Petit, S.C. Irvine, G.K. Knight, M.

Lehtonen, M. Longmuir, K. Luoto, S. Touraille, Z. Wang, S. Alziari,

Z.H. Shah, H.T. Jacobs, Technical knockout, a Drosophila model of

mitochondrial deafness, Genetics 159 (2001) 241–254.

[15] Z.H. Shah, V. Migliosi, S.C. Miller, A. Wang, T.B. Friedman, H.T.

Jacobs, Chromosomal locations of three human nuclear genes

(RPSM12, TUFM, and AFG3L1) specifying putative components of

the mitochondrial gene expression apparatus, Genomics 48 (1998)

384–388.

[16] M. Galloni, Bonsai, a ribosomal protein S15 homolog, involved in gut

mitochondrial activity and systemic growth, Dev. Biol. 264 (2003)

482–494.

[17] C. Frei, M. Galloni, E. Hafen, B.A. Edgar, The Drosophila

mitochondrial ribosomal protein mRpL12 is required for Cyclin

D/Cdk4-driven growth, EMBO J. 24 (2005) 623–634.

[18] J.L. Kissil, O. Cohen, T. Raveh, A. Kimchi, Structure– function

analysis of an evolutionary conserved protein, DAP3, which mediates

TNF-alpha- and Fas-induced cell death, EMBO J. 18 (1999) 353–362.

[19] K.E. Cavdar, A. Ranasinghe, W. Burkhart, K. Blackburn, H. Koc, A.

Moseley, L.L. Spremulli, A new face on apoptosis: death-associated

protein 3 and PDCD9 are mitochondrial ribosomal proteins, FEBS

Lett. 492 (2001) 166–170.

[20] S.R. Chintharlapalli, M. Jasti, S. Malladi, K.V. Parsa, R.P. Ballestero,

M. Gonzalez-Garcia, BMRP is a Bcl-2 binding protein that induces

apoptosis, J. Cell. Biochem. 94 (2005) 611–626.

[21] L. Sun, Y. Liu, M. Fremont, S. Schwarz, M. Siegmann, R. Matthies,

J.P. Jost, A novel 52 kDa protein induces apoptosis and concurrently

activates c-Jun N-terminal kinase 1 (JNK1) in mouse C3H10T1/2

fibroblasts, Gene 208 (1998) 157–166.

[22] F. Ogawa, S. Adachi, K. Kohu, K. Shige, T. Akiyama, Binding of the

human homolog of the Drosophila discs large tumor suppressor

protein to the mitochondrial ribosomal protein MRP-S34, Biochem.

Biophys. Res. Commun. 300 (2003) 789–792.

[23] M. Muramatsu, H. Bush, Studies on nucleolar RNA of the Walker

256 carcinosarcoma and the liver of the rat, Cancer Res. 24 (1964)

1028–1034.

[24] T. Igaki, H. Kanuka, N. Inohara, K. Sawamoto, G. Nunez, H. Okano,M.

Miura, Drob-1, a Drosophila member of the Bcl-2/CED-9 family that

promotes cell death, Proc. Natl. Acad. Sci. U. S. A. 97 (2000) 662–667.

[25] C.L. Farr, Y. Wang, L.S. Kaguni, Functional interactions of mitochon-

drial DNA polymerase and single-stranded DNA-binding protein.

Template-primer DNA binding and initiation and elongation of DNA

strand synthesis, J. Biol. Chem. 274 (1999) 14779–14785.

[26] G. Wahlstrom, M. Vartiainen, L. Yamamoto, P.K. Mattila, P. Lappalai-

nen, T.I. Heino, Twinfilin is required for actin-dependent developmen-

tal processes in Drosophila, J. Cell Biol. 155 (2001) 787–796.

[27] T.I. Heino, Polytene chromosomes from ovarian pseudonurse cells of

the Drosophila melanogaster otu mutant: II. Photographic map of the

X chromosome, Chromosoma 103 (1994) 4–15.

[28] T.B. Chou, N. Perrimon, The autosomal FLP-DFS technique for

generating germline mosaics in Drosophila melanogaster, Genetics

144 (1996) 1673–1679.

[29] B.B. Matthews, S.T. Crews, Drosophila center divider gene is

expressed in CNS midline cells and encodes a developmentally

regulated protein kinase orthologous to human TESK1, DNA Cell

Biol. 18 (1999) 435–448.

[30] K. Raymond, E. Bergeret, A. Avet-Rochex, R. Griffin-Shea, M.O.

Fauvarque, A screen for modifiers of RacGAP(84C) gain-of-function

in the Drosophila eye revealed the LIM kinase Cdi/TESK1 as a

downstream effector of Rac1 during spermatogenesis, J. Cell Sci. 117

(2004) 2777–2789.

[31] C. Caggese, G. Ragone, B. Perrini, R. Moschetti, V. De Pinto, R.

Caizzi, P. Barsanti, Identification of nuclear genes encoding mitochon-

drial proteins: isolation of a collection of D. melanogaster cDNAs

homologous to sequences in the Human Gene Index database, Mol.

Gen. Genet. 261 (1999) 64–70.

[32] S.F. Altschul, T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W.

Miller, D.J. Lipman, Gapped BLAST and PSI-BLAST: a new

generation of protein database search programs, Nucleic Acids Res.

25 (1997) 3389–3402.

[33] J.D. Thompson, D.G. Higgins, T.J. Gibson, CLUSTALW: improving

the sensitivity of progressive multiple sequence alignment through

sequence weighting, position-specific gap penalties and weight matrix

choice, Nucleic Acids Res. 22 (1994) 4673–4680.

[34] T.J. Bailey, C. Elkan, Fitting a mixture model by expectation

maximization to discover motifs in biopolymers, Proceedings of the

Second International Conference on Intelligent Systems for Molecular

Biology, AAAI Press, Menlo Park, CA, 1994.

[35] K. Nakai, P. Horton, PSORT: a program for detecting sorting signals in

proteins and predicting their subcellular localization, Trends Biochem.

Sci. 24 (1999) 34–36.

[36] M.G. Claros, P. Vincens, Computational method to predict mitochond-

rially imported proteins and their targeting sequences, Eur. J.

Biochem. 241 (1996) 779–786.

[37] O. Emanuelsson, H. Nielsen, S. Brunak, G. von Heijne, Predicting

subcellular localization of proteins based on their N-terminal amino

acid sequence, J. Mol. Biol. 300 (2000) 1005–1016.

T.V. Tselykh et al. / Experimental Cell Research 307 (2005) 354–366366

[38] I. Letunic, R.R. Copley, S. Schmidt, F.D. Ciccarelli, T. Doerks,

J. Schultz, C.P. Ponting, P. Bork, SMART 4.0: towards genomic

data integration, Nucleic Acids Res. 32 (2004) D142–D144

(database issue).

[39] J. Schultz, F. Milpetz, P. Bork, C.P. Ponting, SMART, a simple

modular architecture research tool: identification of signaling domains,

Proc. Natl. Acad. Sci. U. S. A. 95 (1998) 5857–5864.

[40] T.L. Bailey, M. Gribskov, Combining evidence using p-values:

application to sequence homology searches, Bioinformatics 14

(1998) 48–54.

[41] N.J. Mulder, R. Apweiler, T.K. Attwood, A. Bairoch, D. Barrell, A.

Bateman, D. Binns, M. Biswas, P. Bradley, P. Bork, P. Bucher, R.R.

Copley, E. Courcelle, U. Das, R. Durbin, L. Falquet, W. Fleischmann,

S. Griffiths-Jones, D. Haft, N. Harte, N. Hulo, D. Kahn, A. Kanapin,

M. Krestyaninova, R. Lopez, I. Letunic, D. Lonsdale, V. Silventoinen,

S.E. Orchard, M. Pagni, D. Peyruc, C.P. Ponting, J.D. Selengut, F.

Servant, C.J. Sigrist, R. Vaughan, E.M. Zdobnov, The InterPro

Database, 2003 brings increased coverage and new features, Nucleic

Acids Res. 31 (2003) 315–318.

[42] J.A. Cuff, M.E. Clamp, A.S. Siddiqui, M. Finlay, G.J. Barton, JPred: a

consensus secondary structure prediction server, Bioinformatics 14

(1998) 892–893.

[43] N.C. Kyrpides, C.R. Woese, C.A. Ouzounis, KOW: a novel motif

linking a bacterial transcription factor with ribosomal proteins, Trends

Biochem. Sci. 21 (1996) 425–426.

[44] G.O. Bylund, B.C. Persson, L.A. Lundberg, P.M. Wikstrom, A novel

ribosome-associated protein is important for efficient translation in

Escherichia coli, J. Bacteriol. 179 (1997) 4567–4574.

[45] C.L. Squires, J. Greenblatt, J. Li, C. Condon, C.L. Squires, Ribosomal

RNA antitermination in vitro: requirement for Nus factors and one or

more unidentified cellular components, Proc. Natl. Acad. Sci. U. S. A.

90 (1993) 970–974.

[46] M. Torres, J.M. Balada, M. Zellars, C. Squires, C.L. Squires, In vivo

effect of NusB and NusG on rRNA transcription antitermination,

J. Bacteriol. 186 (2004) 1304–1310.

[47] M. Zellars, C.L. Squires, Antiterminator-dependent modulation of

transcription elongation rates by NusB and NusG, Mol. Microbiol. 32

(1999) 1296–1304.

[48] T. Steiner, J.T. Kaiser, S. Marinkovic, R. Huber, M.C. Wahl, Crystal

structures of transcription factor NusG in light of its nucleic acid- and

protein-binding activities, EMBO J. 21 (2002) 4641–4653.

[49] L.A. Pile, P.T. Spellman, R.J. Katzenberger, D.A. Wassarman, The

SIN3 deacetylase complex represses genes encoding mitochondrial

proteins: implications for the regulation of energy metabolism, J. Biol.

Chem. 278 (2003) 37840–37848.

[50] D.K. Dimova, O. Stevaux, M.V. Frolov, N.J. Dyson, Cell cycle-

dependent and cell cycle-independent control of transcription by the

Drosophila E2F/RB pathway, Genes Dev. 17 (2003) 2308–2320.

[51] N. Dyson, The regulation of E2F by pRB-family proteins, Genes Dev.

12 (1998) 2245–2262.

[52] J.M. Trimarchi, J.A. Lees, Sibling rivalry in the E2F family, Nat. Rev.,

Mol. Cell Biol. 3 (2002) 11–20.

[53] V.S. Parikh, M.M. Morgan, R. Scott, L.S. Clements, R.A. Butow, The

mitochondrial genotype can influence nuclear gene expression in

yeast, Science 235 (1987) 576–580.

[54] A. Traven, J.M. Wong, D. Xu, M. Sopta, C.J. Ingles, Interorganellar

communication. Altered nuclear gene expression profiles in a yeast

mitochondrial dna mutant, J. Biol. Chem. 276 (2001) 4020–4027.

[55] D.M. Ruiz, I.E. Lefai, R. Garesse, L.S. Kaguni, Regulation of

mitochondrial single-stranded DNA-binding protein gene expression

links nuclear and mitochondrial DNA replication in Drosophila,

J. Biol. Chem. 275 (2000) 13628–13636.

[56] S. Becker, A. Gehrsitz, P. Bork, S. Buchner, E. Buchner, The

black-pearl gene of Drosophila defines a novel conserved protein

family and is required for larval growth and survival, Gene 262

(2001) 15–22.

[57] N.E. Baker, Cell proliferation, survival, and death in the Drosophila

eye, Semin. Cell Dev. Biol. 12 (2001) 499–507.

[58] N.E. Baker, S.Y. Yu, The EGF receptor defines domains of cell cycle

progression and survival to regulate cell number in the developing

Drosophila eye, Cell 104 (2001) 699–708.

[59] B.A. Edgar, P.H. O’Farrell, Genetic control of cell division patterns in

the Drosophila embryo, Cell 57 (1989) 177–187.

[60] D.A. Lehman, B. Patterson, L.A. Johnston, T. Balzer, J.S. Britton, R.

Saint, B.A. Edgar, Cis-regulatory elements of the mitotic regulator,

string/Cdc25, Development 126 (1999) 1793–1803.