The 7th National and International Graduate Study ...

A Study of Factors Affecting the Ability to Work-based Learning of

Student at Panyapiwat Institute of Management

Chompunoot Putinatr1, Jariya Neanchaleay

2

1 Learning Innovation and Technology, Faculty of Industrial Education

and Technology, King Mongkut’s University Of Technology Thonburi,

Bangkok 2 Learning Innovation and Technology, Faculty of Industrial Education

and Technology, King Mongkut’s University Of Technology Thonburi,

Bangkok

Corresponding author: [email protected]

Abstract

The objective of this research was to study factors affecting

learning competence and real practice of the students in Faculty of

Education, Panyapiwat Institute of Management. The sample groups were

70 students in Chinese Teaching, Faculty of Education, Panyapiwat

Institute of Management. The random was used for the students with

internship experience. Survey questionnaire was used for data collection

five rating scale. The reliability of scale was found to be 0.875. The

statistics used analysis mean, standard deviation and experimentation on

factors affecting competence in learning and internship of the students

from Faculty of Education, Panyapiwat Institute of Management were

studied using multiple regression with Enter. The research results were as

follows it is found that the factors affecting competence in learning and

internship of the students the most are internship interaction, followed by

internship attitude and internship adaptation, respectively. The mean

values are 4.23, 4.11 and 3.92, respectively. The result on competence in

learning and internship of the students from Faculty of Education,

Panyapiwat Institute of Management is in moderate level with the meal

value of 3.28. the independent variables with the significance on the

dependent variables, also known as, the factors affecting competence in

learning and internship of the students, are internship interaction and

internship attitude (B = 0.339 and 0.217, respectively) predicting the

variables on competence in learning and internship of the students at the

percentage of 42. The multiple regression analysis result explains that the

prediction variables enabling the predictibility of criterion variables

The 7th National and International Graduate Study Conference 2017

" Thailand 4.0 Creative Innovation for Sustainable Development "

I1

mailto:[email protected]

(competence in learning and internship of the students) are internship

interaction and internship attitude prediction variables.

Key words (s) : Study of Factors, Competence in learning and internship,

Student at Panyapiwat Institute of Management

Introduction

At present, higher education management must be done to improve

Thai people towards physical, intelligent, ethical and cultural perfection in

order to live with others happily. Moreover, education management must

follow the concept stating all learners have capabilities to learn and

improve themselves. Learners are the most important as well. Education

management process must encourage learners so that they can naturally

improve with their full potential. Education management process has

various learning processes (Panthasak Polsaram, 2016). Producing

ethical and smart graduates is crucial for all higher education institutes.

Education in the twenty-first century has changed from the past. It is the

education to formulate knowldge and develop learners’ potentiality.

Graduates in the twenty-first century must put efforts persistently, work

hard and determine their performance. A major requirement of a graduate

follows self-efficacy theory to determine which level or capability he/she

can reach. An individual with high self-efficacy is able to pursue success.

When he/she confronts problems or challenges, he/she can solve them

with full attempt. When a failure occurs, he/she usually perceives the

situation as a result from insufficient attempt or lack of knowledge/skill.

On the other hand, an individual with low self- efficacy usually perceives

that he/she has low competence and thinks that difficult tasks are threats.

Thus, he/she escapes or gives up doing them. When a failure occur, he/she

usually perceives to be abortive. Kriangsook Fuengfupong (2011) stated

that an individual with high self-efficacy was high competent. He/she was

not afraid of hard work. Instead, challenging tasks were preferred for

hard-working practice. When any problems occurred, solutions were

sought out. Work-Based Learning (WBL) is a learning through internship

with the same work proportion as of real employees. Real work is used

instead of in-class learning. This type of learning is the combination

between theoretical learning and practical learning. In other words,

knowledge and real experience is obtained through learning process,

analysis and learning sharing. Importantly, learning and internship must

be concurrent so that new knowledge is synthesized for further

advantages. Besides, Work-Based Learning (WBL) is a tangibly



I2

extensible and applicable learning process. It is a world of learning and

competition in working society. Learners can become aware of what they

like and dislike so that they can modify or develop themselves. Also, it

promotes multi-competency in the selected field of study. Hence, they are

more ready than those who receive regular learning. The learning method

and experience from WBL may be more demanded for business sectors in

knowledge-based economy era from knowledge accumulation and

knowledge creation for quick business performance or organizational

mission. Core knowledge is a tacit knowledge, rather than explicit

knowledge. Explicit knowledge is always ready for sharing from

cooperation or direct interaction, rather than in-class learning. Work

Based Learning (WBL) is a conventionally practical learning with trainer

program and systematical follow-up system. Learning management is an

alternating one between in-class learning and internship learning

according to the curriculum. Also, it is designed to match the institution’s

demand for the integration between theoretical and practical aspects

(Lertchai Suthammanon, 2016). Pichit Ritcharoon (2015) stated about the

assessment result on the students’ characteristics, both self-assessment

and advisor’s assessment ones for post-internship. The students had seven

aspects of qualifications including discipline, responsibility, honesty,

service-mind, communication skill, cooperation and tentative solving. The

finding revealed that learning management from real experience could

enhance the students’ qualifications. The development process allowed

the students to learn from real experience, matched work-based learning.

The students’ attitude adjustment was done because it was important for

performing tasks. The unique education model of Panyapiwat Institute of

Management arranged learning format according to the standard of

Ministry of Education with the number of working hours added. The

students were to study and work alternately during 4-5 years. It was a

work-based learning so the students were able to think and do things. So,

they could work effectively after graduation. The institute tried to make

the students become proficient, both theoretically and practically. The

most important objective is to cultivate good morale (Somphob

Manarangsan, 2016). During pre-internship, some of the students still

lacked of confidence because they never worked in real workplace before

so they did not know their duties. Also, the students did not want to do

perform their tasks far from their accommodations as they were worried

that they might be late for work and they might have to face increased

expense. These causes occurred because they were not ready in many

aspects. This research reveals factors affecting competence in learning and

internship for effective learning management guidelines according to the

curriculum’s objectives and the students’ quality development.



I3

Objectives

1) To study factors affecting learning competence and real

practice of the students in Faculty of Education, Panyapiwat

Institute of Management

Research Methodology

Participants

The population were 104 students in Chinese Teaching,

Faculty of Education, Panyapiwat Institute of Management.

The sample groups were 70 students in Chinese Teaching,

Faculty of Education, Panyapiwat Institute of Management. The random

was used for the students with internship experience.

Table 1 The sample groups in Chinese Teaching, Faculty of Education,

Panyapiwat Institute of Management.

Grade level Amount Percentage

Third-year students 44 62.85

Second-year students 26 37.14

Total 70 100.00

Procedures

The data collection steps were as follows;

1) The researcher submitted written request form for data

collection in order to perform the research. The request form was

submitted by Faculty of Industrial Education and Technology,

KMUTT to the Dean of Faculty of Education, Panyapiwat Institute

of Management for permission and support in research data

collection from 70 post-internship students in Chinese Teaching

Field, Faculty of Education, Panyapiwat Institute of Management.

2) The researcher brought the questionnaires and the

written request form to Panyapiwat Institute of Management via

the Secretary of Faculty of Education for research data collection

time log.

3) The researcher collected the research data alone at

Faculty of Education, Panyapiwat Institute of Management. The

questionnaires returned were 70 copies, accounted for 100 percent.



I4

Instrument

The questionnaire was used. Each questionnaire is divided

into three parts as follows;

Part 1: General Information (gender, age, pre-university

educational degree(s), GPA)

Part 2: Questionnaire on factors affecting competence in


Panyapiwat Institute of Management. Each questionnaire had of five-

rating scale questions in the total of 30. It reflected factors affecting

competence in learning and internship of the students and was divided

into three aspects – internship adaptation, internship interaction and

internship attitude.

Part 3: Opinions and Suggestions

The research brought the revised questionnaires for trying out with

30 post-internship students from Panyapiwat Institute of Management.

Then, the result was analyzed for its reliability using Cronbach’s alpha.

The questionnaire’s reliability value was 0.875.

Statistical Analysis

The mean, standard deviation and experimentation on factors

affecting competence in learning and internship of the students from

Faculty of Education, Panyapiwat Institute of Management were studied

using multiple regression with Enter.

Results/ Conclusion

According to the data analysis on factors affecting competence in


Panyapiwat Institute of Management, the results show that :



I5

Table 2 The result study factors affecting learning competence and real

practice of the students in Faculty of Education, Panyapiwat Institute of

Management

Variable ( ) (S.D.) level

Internship adaptation (x1) 3.92 0.61 High

Internship interaction (x2) 4.23 0.68 High

Internship attitude (x3) 4.11 0.72 High

Competence in learning and internship (y) 3.28 0.91 Medium

From Table 2, it is found that the factors affecting competence in

learning and internship of the students the most are internship interaction,

followed by internship attitude and internship adaptation, respectively.

The mean values are 4.23, 4.11 and 3.92, respectively. The result on

competence in learning and internship of the students from Faculty of

Education, Panyapiwat Institute of Management is in moderate level with

the meal value of 3.28.

Table 3 The Statistics of Multiple Regression variables

Variable B SE B Beta t

Constant 2.020

Internship adaptation -0.129 0.089 -0.135 -1.446

Internship interaction 0.339 0.088 0.452 3.837*

Internship attitude 0.217 0.096 0.266 2.263*

R2 = 0.428

F = 16.509

Table 3, it is found that the independent variables with the

significance on the dependent variables, also known as, the factors

affecting competence in learning and internship of the students, are

internship interaction and internship attitude (B = 0.339 and 0.217,

respectively) predicting the variables on competence in learning and



I6

internship of the students at the percentage of 42. The multiple regression

analysis result explains that the prediction variables enabling the

predictibility of criterion variables (competence in learning and internship

of the students) are internship interaction and internship attitude

prediction variables. The prediction equation can be written below.

Y= 2.020 -.13x1 + .33x2 + .21x3

Discussion

Faculty of Education, Panyapiwat Institute of Management used

Work-Based Learning (WBL) - a learning through internship with the

same work proportion as of real employees. This type of learning is the

combination between theoretical learning and practical learning. Because

most of the students had never experienced any internship in any real

work places, they were anxious and lacked of confidence.

Hence, the researcher was curious in studying factors affecting

competence in learning and internship of the students. The studied factors

include internship adaptation, internship interaction and internship

attitude. They have impacts on competence in learning and internship of

the students at the significance level of 0.05, consistent with the study of

Theerawat Imprakongsilp (2013) which examined the internship’s

requirements in Hotel Housekeeping Departments in Bangkok. The study

found that the opinions towards the internship students’ requirements

revealed that interaction was the most important quality. Moreover, it was

consistent with the study of Kelvarin Chantanasuksilpa et. al. (2015)

which examined internship problems and factors affecting the internship

effectiveness of the students in Chinese Teaching, Faculty of Education,

Panyapiwat Institute of Management. It was found that most of them had

positive attitudes towards internship leading to achievement. Also, they

were practised in discipling, conscientious and tentative problem-solving.

The results emphasized the importance of internship interaction and

internship attitude. Both should be embedded in the students’ minds for

quality development of all prospect graduates.

Recommendations

According to the study on factors affecting competence in learning

and internship of the students from Faculty of Education, Panyapiwat

Institute of Management, the researcher provides the following

suggestions;

^



I7

1. The factors affecting competence in learning and internship of

the students are internship interaction and internship attitude. The research

results are appropriate for development planning in term of pre-internship

training.

2. This research is a quantitative one. Thus, qualitative research

sections should be added including group conversations and interviews for

better completeness.

References

Panthasak Polsaram.(2016). Reform learning and teaching in graduate

study and development learning process in undergraduate.

Accessed September 7, 2016. Available from ProQuest

www.edu.chula.ac.th/eduinfo/ed_resch/pansak.pdf

Kriangsook Fuengfupong. (2011). “Perception of Self-Efficacy, Optimism

and Job Engagment : A Case Study of Employees of Personal and

Health Care” Master dissertation, Faculty of Liberal Arts,

Thammasat University.

Lertchai Suthammanon.(2016). Panyapiwat Institute of Management

with Education management Work Based Education model .

Accessed September 9, 2016. Available from ProQuest

http://www.mua.go.th/users/he-commission/t-visit%20project/t-

visit%20book%202/22--g2--15-1.pdf

Pichit Ritcharoon. (2015). “Desirable traits study of Panyapiwat Institute

Of Management’s Studennts by using Work-based Learning

pedagogy in Convenience Stores." Panyapiwat Journal 8,

1(January- April): 200-212.

Somphob Manarangsan.(2016). Work-based Education real leran and real

internship at PIM. Accessed September 6, 2016. Available from

ProQuest www.pim.ac.th/th/

pages/student-life

Theerawat Imprakongsilp. (2013). “Desirble Characteristics of Student

Trainee in Housekeeper Department of The Hotels in Bangkok."

University of the Thai Chamber of Commerce Journal 36, 1(July-

September): 44-69.

Kelvarin Chantanasuksilpa et. al. (2015). “The study of practicum

problems and factors influencing the performance of Business



I8

Chinese Students at Panyapiwat Institute Of Management."

Panyapiwat Journal 7, 1(January- April): 127-135.



I9

Appendix

Author Chompunoot Putinatr, Jariya Neanchaleay (Advisor)

Program Doctor of Philosophy Learning Innovation and Technology,

Faculty of Industrial Education and Technology

Institute King Mongkut’s University Of Technology Thonburi

Tel 081-0117997 e-mail [email protected]



I10

THE FACTORS OF CUSTOMER WHO CHOOSE CREDIT CARD OR DEBIT

CARD FOR PAYMENT WHEN THEY ARE GO ABOARD

Researcher: Ms. Nathida Rernggasettakorn, Master of Business Administration Program in

International Business, International College Silpakorn University Email:

[email protected]

Adviser 1: KEATKHAMJOHN MEEKANON, Ph.D., Master of Business Administration

Program in International Business, International College Silpakorn University Email:

[email protected]

Abstract

At present, Credit card and debit card are the first choice of customers to choose when

they are payment. Credit card is one of the first thing that people are carrying when they are

travel aboard or purchasing but it is not only in oversea. People usually use in their daily

similar as in other countries as well. Debit card is one type of payment that customer choose

for purchase. Debit card is using as similar as credit card but debit card will cut the money

directly from their own account.

This research is mention about customer who are interesting in credit card and debit card

when they are traveling aboard. Nowadays, lifestyle of people have been changed a lot so

they carry credit card and debit card rather than cash. Thus, this research is to finding about

how people use and problem of credit card and debit card. Credit card and debit card have so

many types and brands in Thailand such as Kasikorn bank, Bangkok bank or Siam

Commercial bank. Furthermore, co-branding is one of the brand that Thai people usually

have such as Citi bank, Aeon or KTC. They are also separate into 5 types of credit and debit

card including MasterCard, Visa, JCB, Union pay and AMEX.

Keywords: credit card, debit card, and go aboard, payment

Introduction

Background

Nowadays, people have high demand to spend their money by using a credit card or a

debit card rather than using cash when they are going aboard because of the convenience of

credit card or debit card. Credit card and debit card are the best choice for customers who are

traveling abroad. Credit card is one of the first thing that people are carrying when they are

traveling or purchasing but it is not only in oversea. People are also using as usual for daily

life as similar as in other countries such as Sweden and their neighbors including Norway,

Denmark and Finland. Sweden is fast becoming an almost entirely cashless society as similar

as Nordic neighbors Norway, Denmark and Finland. They said that they do not use cash

anymore, for anything and other said that Shops do not need cash even they would like to buy

candy bar. They use a card or phone to purchase (Henley, 2016). On the other hand, Korea



I11

and China common to use credit card and debit card rather than use cash. Korea has Alipay

so it is an online payment service which provided by China. They have been opened first in

Seoul. Alipay comes to Korea to help Chinese traveler when they come oversea such as

online payment service to luggage storage and business lounge services (Yonhap, 2016).

However, it is not only Alipay that Korean people are using but they are also using Samsung

Pay and T-Money as well even there are going to GS25, Minishop, Seven-Eleven shop or

public transport. They are common using their mobile to pay rather than carry cash or card

(Traitanin, 2016). Moreover, in the metropolitan of China in huge area such as Beijing and

Shanghai. In China, they don’t need to carry a lot of cash to traveling because they can use

credit card. Furthermore, tourist who use credit card that don’t need to pay fees for change a

foreign transaction during their trip. China Union Pay is a China’s national bank payment

network which popular for Chinese. However, this is not Union pay that China has been

accepted but Discover also one of the brand that there are using in this country. Discover is

support their customer by programmed which called wallet-sized instruction card. This can

support in both languages as Chinese and English. Discover also withdraw money pass Union

Pay ATM machine in central of China in Advance and also have no foreign transection fees.

Many hotels, chain stores and tourist attractions accept other international credit cards,

including Visa, MasterCard, Diners Club and American Express. A number of cards don’t

charge foreign transaction fees and may offer other incentives that benefit frequent travelers.

The Bank America and travel Rewards credit card, for example, has no annual fee, charges

no foreign transaction fees and offers 1.5 points for every dollar you spend. The points can be

redeemed as a statement credit for any travel purchase including airfare, baggage fees and

hotels. Other cards that currently don’t charge foreign transaction fees include Capital One

Venture Rewards, Chase Sapphire Preferred, American Express Platinum and the

Barclaycard Arrival Plus World Elite MasterCard. Thus, Credit card and Debit card are

important nowadays for people in daily life. People are getting a lot of benefit for the credit

cards and debit card however, debit card and credit card also make a negative side.

Nevertheless, consumer has so many factors to choose about the payment methods and they

are also face a problem of payment during their journey when they are traveling such as

stores are not accept their card because issue of the card, type of card or some policy. There

are two type of card that people choose so one of them is debit card and another type is credit

card. People have many factor using the cards. For instance, people who chooses credit card

because they will gain a lot of benefits for credit card such as received a point of reward or

privilege for using in the future or in currently, pay later within 4 to 12 months or more, get

cash back promotion for person who use credit card so they will gain a lot of benefit from the

banks and cash back after used the credit card so consumer can use the voucher in the future.

In contrast, debit card that is a good ways for some consumer who doesn’t need to be

indebted. Thus, I have a lot of question about people who spend money from credit card why

they choose and their opinion about credit card. In my point of view, I thought credit card has

both side in positive side and negative side. Moreover, Credit card totally can change lifestyle

of people who addict to shopping or other reason to use. Credit card are not effect to financial

only it can effect to some of lifestyle such as traffic Jam, Change the job or promotion,

emotional of people. It is also have a lot of reason that can effect to people. That’s why I

would like to do research about Credit can change lifestyle of people.

Credit card



I12

Credit card is separate into 4 types of credit card and debit card including Visa, Master,

JCB and Union pay. Firstly, Visa has 5 categories so it divided into Visa Classic, Visa Gold,

Visa Platinum, Visa Signature and Visa Infinite. However, all of them are also gain benefit in

separately depend on type of card. Secondly, MasterCard has 5 categories as similar as VISA

so there are separate into MasterCard Standard, MasterCard Gold, Master Card Platinum,

MasterCard world and MasterCard World Elite. Third, JCB (Japan Credit Bureau) is the one

of credit card’s Company that came from Japan. The main point of card is focus on traveling

including booking hotel, plane ticket, rent a car and many shops in Japan. In Thailand, people

know them in the name of AEON and KTC. Then, Union pay or China Union Pay establish

since 2002 so they have been cooperate with China bank They have 141 countries in

worldwide. In Thailand, the shops that accept Union Pay are Central, Siam Paragon, The

Emporium, Robinson, King Power and Boots. Lastly, AMEX has 2 type of issuer so he first

is issuer from AMEX Thai and other one is from Bangkok bank. Both of them gain discount

from AMEX select in worldwide. However, AMEX Credit card from Bangkok bank has no

charge card that customer has to purchase them all of total every month. They are also collect

mile to get a privilege from Thai airway.

Debit card

Debit card is one type of payment that customer choose for purchase. There is

convenient way for people to do not carry cash. Debit card is using as similar as credit card

but there is a bit different when purchase money back. This is because debit card will cut the

money directly from their own account. Normally, debit card has 2 types of transection use

which PIN-based and signature-based. First, PIN-based use the same technology as ATM

cards to withdrawal money from your own account. Thus, customer have to enter your

personal identification number (PIN) at the time of purchase as well as Signature transaction

is so similar to credit card transection so it can used only the place that credit cards are

accepted and then requires a signature. Moreover, debit card usually bear a VISA rather than

MasterCard.

Significant of the study

This research is researching about factor of customer who using credit card or debit

card during traveling aboard. This is focus on customer behavior of people’s lifestyle and

reason why people choose credit card and debit card for purchasing. In this research are focus

on four factors that may influence on customer who use credit card and debit card. Thus, the

factors that research is mentioning including convenient, security, brand and acceptance.

By definitions, “Credit card” is the card that issue by a bank or company which have

connection with the bank. The reason of credit card is to support customer when they are

would like to purchase product or service. Thus, this may safe for customer by do not need to

carry a lot of cash. Credit card is common for people around the world especially in Europe

and the United State. Business man usually use the credit card when they are traveling aboard

but it is not only go board. There are also using in their own country. However, travelers are

prefer to use credit card as similar as business man. This is because it is safety and convenient



I13

for them during the journey. The credit card that is not for payment but people can withdraw

money from credit card as well (REF.) Credit card is so common for every generation.

“Debit card” is a plastic card as similar as credit card. This can use fraudulently and

should be protect similar to cash. Whether a thief takes your PIN, fakes your signature or

steals your card or card info, the person could use the card up to your everyday spending limit

and if you do not discover the fraud immediately, the thief could wipe out all the money in

your checking account.

Credit card and Debit card looks similar but they work differently so you can’t use

them to charge a purchase and pay it back over time as you can with a credit card. For the

debit card to work, so it must has enough money in the account to cover transactions, unless

you have overdraft protection. Debit cards are issued by banks to customers with checking

accounts. Moreover, debit cards can be used at cash machines (ATMs) to withdraw money

from the account and, like a check, they can be used to make purchases. The process of debit

card that processed over the same worldwide networks (MasterCard, Visa, etc.) used to

process credit card payments. The way to use debit card that has two ways so firstly, use PIN

or a personal identification number (PIN) to withdraw cash from an ATM or to request “cash

back” at stores when making a purchase and other way is use signature or PIN to pay for

goods, meals, gas and services by Consumer Action’s Managing Money Project (2007).

Credit card gain a lot of benefit and privileges to support their customer so every

banks have promotion to make customer interesting in their brand. Nowadays, people prefer

use card rather than cash to make them convenience, fast for payment. To keep yourself from

liability if your card is used fraudulently so, you have to performance with reasonable care

whenever you use it. This includes reporting a lost or stolen card straightaway. How to

protect your information is be careful position of sensitive paperwork and containing personal

or credit card information, such as receipts and credit card statements, Never share sensitive

financial information online, and keep other personal details to a minimum, do not email your

credit card details in case the message is intercepted, keep your credit card provider informed

of address changes and consider using a mail redirection service for a few months after

moving If you notice that a new / replacement card, statement or any other important

communication has not arrived, let your card provider know at once, delete emails or text

messages asking for financial details, without responding, do not open attachments from

unknown senders or any emails that strike you as suspicious, avoid updating financial details

by following links or calling numbers supplied via email or text message and only give your

card details over the phone if you have called a company you know to make a transaction by

Sainsbury’s bank (2015). Credit card can gain a lot of benefit and to make people convenient

but customer should learn how to protect their card. So many customer faces a lot of problem

about credit card. Mansfield, Pinto and Robb found that over 20 years ago, the use of credit

card were the problem that consumer concern in social and economic. The credit card gain an

opportunities for consumer to making a purchased. However, so many consumers are able to

purchase by credit card but there are seem to be capable to control their earnings habits.

The problem of credit card that usages had created by credit card were caused

apprehension among an educators, consumer and advocates and public policy administrators.

Kurtulus and Nasir (2006) found that the credit card companies had been expanded the

emerging market in order to exploit the opportunities which can provided by the emerging

market. The pattern emerging markets of the credit card also different from the well-

developed markets in the important ways. For example, Zafar U. Ahmed Ishak Ismail M.

Sadiq Sohail Ibrahim Tabsh Hasbalaila Alias, (2010) found that the proliferation of credit

cardholders take an indiscriminate to credit card’s user with negative effects. The consumer



I14

in Malaysian seem likes to excessive buying behavior or called “compulsive buying”.

Compulsive buying gain adverse to customer to make them addiction to shopping and

excessive debt.

Around the world at the moment, tradition of debit cards is increasing as consumers

determine the value they provide in terms of convenience and money management so the

researcher found that “contrary to conventional wisdom, what most defined each of those

steps was the number of categories in which consumers were comfortable using the debit

card, rather than the actual quantity of transactions completed”,

Thus, this result of the research on this section found the keys about mature market

including Merchant trust and individual approaches to money management is one of the keys

that make customer confident to use debit card in different categories, Necessity is about

online payment that customer can use because they have no other type of payment that is

available, Grocery and fuel including insurance premiums or electronics home furnishing are

the categories that frequently prompt early card usage Bunn, Colvin, Pittier and Zanghi

(2012).

According to Borzekowski, Kiser and Ahmed (2006) found that “Respondents are

more likely to use debit cards if they have negative expectations about their future financial

condition, and are more likely to use credit cards rather than debit cards if their financial

situation has worsened recently. Thus, consumers appear to have an underlying preference for

spending from liquidity, and use credit as a source of liquidity during periods of financial

stress”. Zinman (2004) mention in Security and acceptance of debit card and credit card that

both of them is the factors on this research, Acceptance of Debit and credit enjoy similarly

widespread acceptance as payments device that will treat them as equivalent and also the

difference has come about due to the rise of “offline” debit, whereby an ATM card with a

Visa or MasterCard. The debit card and the credit card brand is accepted. Consequently debit

and credit are essentially equivalent along this margin when compared to cash or check.

Next, security of debit and credit now offer essentially identical fraud protection, and

hence offer similar protection against theft compared to cash or check. Noknoim Ngowsiri

and Boripunt (2009) found that customer are frequently used their debit card at department

store and also paid for their infrastructures. Debit card is change a little it when they are

expense behavior especially in food and drink consumption. Moreover, most of customers

well perceived on the service quality in all dimension of tangible, reliability, responsiveness,

assurance, and empathy. This research found that service marketing mixes influenced on

using debit card behavior are debit card, promotion, process, physical evidences, and

productivity and quality control. Moreover, all services about marketing mix influenced on

quality perceiving on using debit card. Debit card gain beneficial to set debit card marketing

mix strategy policy to stimulate consumer behavior on using debit card. Furthermore, most of

the consumer had only one debit card and used it for spending more than withdrawing money

from ATM so it is different form in the past that consumer used the debit card as ATM.

Purchase intentions have often been theorized and as a dimension of customer loyalty in

the line of setting. In the same method, various studies show that service quality is directly

proportionate to the purchase intention and risk is inversely proportionate to the purchase

intention. Purchase intentions are influenced by expectations of service quality. As

consumers’ expectations of a service seller increase, their probability of purchasing a service

from that seller or provider increases too. In addition, purchase risks are reduced if

expectations of service quality are high. This risk will be reduced, in turn, increase purchase

intentions. Product quality and price directly influence value, it is no surprise that the efforts



I15

of marketers have focused on improving product quality and reducing price in order to

enhance perceptions of value, and consequently purchase intentions Khandelwal, Bajpai,

Sharma (2012). This research focuses on debit card and credit card purchasing intention.

A credit card is a kind of card that is owned by a bank or financial institution. Customers

are using used in buying products and services in domestic and foreign countries. It is also

withdrawing cash from ATM within a certain credit. Credit cards are highly complex

financial instruments. There is finding of credit card logo can associate with spending and so

influences spending. Credit card logo did not affect spending behavior Yilmaz (2013).

Furthermore, Khan (2011), said that credit card is not impacted on purchase behavior. In

France so use grocery store data, and show that the payment mode choice is related to total

amount of the transactions, with card use dominating in high-cost transactions.

Payment mode choice is directed by the cost of the transaction. So the purchase decisions

may not be directed by the card, but the final cost at the checkout may be the choice of

payment that is a function of the amount of cash available to the person at the point of

payment. Sriyalatha (2016) found that card holder intension is an important factor that should

be considered by banks offering credit cards. Most of the respondent use credit cards to

purchase day to day necessities and foreign purchases and they prefer these cards mostly for

online purchases.

Moreover, in the results suggest that perceived helpfulness and availability of information

concerning credit card have an important influence on attitude in the direction of credit card

usage. A number of methods can be utilized to increase the available information concerning

credit cards. For example, banks can afford more specific data with more transparency about

interest rates charge by banks on late payment, registration fees, annual renewal fees, etc.

Banks also can publish the latest information about credit cards, which should help to take the

decision regarding the holder of credit card which manner they have to use their credit cards.

The study revealed that majority of the respondents are been using credit cards intelligently

thus, the use of credit card will not lead to serious financial problems or heavy debt problem.

Debit cards are more frequently used if compared to other types of payment in non-food

retail, petrol, supermarket purchases and public transport use and that fast-food purchases be

present mostly paid for by cash. The mean purchase intention scores for an additional

purchase in a certain group was higher if previous expenses in that group were paid for by a

mechanism that did not allow performance and when payments were still in process Soman

(2001).

Objectives

This study aims to find factors that are influencing on customer behavior when they

use credit card or debit card.

This study aims to focus on problem of customer when they use credit card or debit

card in other countries.




I16

The research is mention about customer behavior which gives precedence to credit

card and debit card when they are traveling aboard. This chapter will explain the way to

answer requirement that pertinent of research question. This research is collect primary and

secondary data to analysis and support the research question. There is also do an individual

interview and group interview. In some situation of interview is informal interview. The

purpose of this research is to identify customer behavior which uses credit card and debit card

when they are traveling aboard. This is because at the present a lot of people are traveling

aboard and they are common to use credit card and debit card rather than cash. Other purpose

of this research that they are also to study tangible and intangible of credit card and debit card

which support demand of household nowadays. However, household is facing so many

problems from credit card and debit card when they were using the card. Then, the researcher

would like to study with their case and the opinion of household.

Research question

Research Questions have been determined after reviewing the existing literature. The data

span from December 2015 to May 2016. The data collected by interview about 20 household

including consumer of bank in Thailand such as Bangkok bank, Kasikornthai bank, Siam

Commercial bank, Krung Thai, Krungsri and other co-branding including AEON, KTC and

Citibank etc. This research is finding the about customer behavior and purchase intention of

customer who used credit card and debit card from Thai’s bank and find how customer

determine to use credit card and debit card, how to use or how to decide to choose the

companies and problem of them that may face when they are traveling aboard.

The population

The population of this research is a customer of bank of Thailand and co-branding which

came from other countries. All of them were traveling aboard and also use credit card or debit

card in Oversea. The age of interviewees is start from 25 to 49 years old. Their Job are

severally such as Accountant, programmer, Employees of Mahidol University, own business

and customer service.

Sampling

A sample size of this research is 10 interviewees who use credit card and debit card when

they are traveling aboard. Sample size of this research has been selected from their

experience and using the interview to collect the data. This research was interview individual

customer and group interview. Most of them which had an interview are informal interview.

This is because researcher would like to collect data and observe customer behavior to make

them comfortable to describe the information.

Data Collection



I17

The process of interview was collected in a group during a meal and some of

customer collected by give them a phone called. It is take about 10 minute per each to collect

the data. Interview is quite informal because researcher would like to get an information that

a bit usual not formal. Almost all of the group are employees at the office or have own

businesses and a few people are unemployment. Their degree is Bachelor degree and Master

degree in University in Thailand. Only three people are graduated Master degree from

Oversea and living there for longtime over 2 years so they have a lot of experience from other

bank from oversea but this research are not mention much about it. A few interviewees are

living aboard and there are use credit card and debit card which issue in Thailand. This

survey is start from December 2015 to May 2016.

Result and Conclusion

Finding

As a result of this research, customer who is over 28 years old prefer using credit card

rather than debit card. Male and female also have similar lifestyle of payment in credit card

and debit card in currently. The income is one of the huge gaps of the research because they

have different rate of income to support themselves about credit card or debit card. However,

occupation is not be indicator that people who working in high position can support their

demand or benefit pass credit card and debit more than other. Moreover, education is

depending on the occupation rather than education as well. The age start from 28 years old

also have credit card and debit card more than 2 cards. There are choose credit card rather

than debit card when they are traveling aboard because they do not need to spend all of their

money for the trip and they do not prefer to withdraw money in oversea. Customers who have

income over 10,000 baht are prefer using debit card only and the customer who have income

more than 20,000 baht and over 30,000 baht or more Social are carry more than 2 credit

cards and debit card. They use both. The reason of respondents why they are choose credit

card because it is convenient and safe. Moreover, credit card can pay by installment for 3

months, 6 months, 12 months or more than 1 year depend of their choices. They also collect

point to exchange to be cash back or plane ticket in the future. In contrast, the respondent

who choose debit card because they can control their budget when they are traveling aboard

and has no liabilities when they are come back to Thailand. Siam commercial bank (SCB) has

the highest figure that customer are using both between debit card and credit card. The

second is Kasikorn Bank and Bangkok bank which customer use and another co-branding

that do not directly from the bank is Aeon, Citibank, Firstchoice or KTC are the brand that

customer use as well because of promotion from the card. It is not so many customers face a

problem of credit card and debit card. It is just a few people that are faced problem about

credit card such as OTP or issuer of the card. Nowadays they have an electronic-signature to

make people more convenient rather than in the past to finish their payment. In other

countries, it is not difficult to find card-reading machine in almost every shops because it is

common to use card rather than cash. ATM machine is also easy to find in oversea but they

do not prefer to withdraw in oversea. Almost everyone is aware of theft or lose their wallet,

handbag or fraudulent but they are trust in their bank so it may not a huge problem for them.

MasterCard and Visa are common in Thailand for longtime until now. In currently, a lot of

brands come to Thailand such as Union Pay, JBC or AMEX but they are not as popular as

similar as Visa and MasterCard. Visa is the most popular than MasterCard in Thailand



I18

because almost every bank gives the types cards is Visa but Siam Commercial Bank that use

MasterCard on Credit card and Debit card.

Discussion

This research has four factors that researcher is separate into two categories such as

customer behavior and purchase intention. Researcher are given some an example of other

countries such as Malaysia that give some example of customer behavior. As you can see

customer behavior between Thailand and other countries are not a huge different the

customer behavior quite similar with some Thai’s people but their also have a gap that

different from each other. Thus, the process of payment that is different because of the

system and technology of those countries. Uncertainty, research is mention about system that

Thailand is one of the low-technology if compare with other countries that developed such as

Australia, Singapore or The United states. Next, purchase intention has often been theorized

and as a dimension of customer loyalty in line of setting. Purchase intentions are influenced

by expectations of service quality that make a service seller increase. Some journal found that

credit card logo cannot affect to customer but in this section service of bank and loyalty in

brand may affect to customer rather than logo. Furthermore, promotion also can affect to

customer as similar as service of the bank. Most of respondent use credit cards to purchase

day to day necessities and foreign purchases and they prefer these cards mostly for online

purchases because it is more convenient for them if they pay by card but it depends on

product or service. For example, people usually use it for grocery store data or other type

online in France. However, Debit cards are more frequently used if compared to other types

of payment in non-food retail, petrol, supermarket purchases and public transport use and

those fast-food purchases are present mostly paid by cash. Overall, customer behavior and

purchase intention are affect to determine of customer when they are choose the types of

card.

References



I19

Ben Colvin, Carlos Pittier and Anna Zanghi Martin Bunn. (2012). Understanding

How Consumers Adopt A Debit Card Payment Preference. Global insights.

DILIP SOMAN. (2001). Effects of Payment Mechanism on Spending Behavior: The

Role of Rehearsal and Immediacy of Payments. JOURNAL OF CONSUMER

RESEARCH.

Elizabeth K. Kiser, Shaista Ahmed Ron Borzekowski. (2006). Consumers’ Use of

Debit Cards: Patterns, Preferences and Price Response. Washington DC: Finance

and Economics Discussion Series Divisions of Research & Statistics and Monetary

Affairs Federal Reserve Board.

Great Wall International UnionPay. (ม.ป.ป.). from bank of china:

http://www.bankofchina.com/th/th/pbservice/pb4/201210/t20121010_2005594.html

Guide to credit card security. (3 september 2015). Sainsbury's bank, pages 3-8.

Helen Russell. (12 November 2014 ). Welcome to Sweden - the most cash-free society

on the planet. from theguardian:

https://www.theguardian.com/world/2014/nov/11/welcome-sweden-electronic-

money-not-so-funny

Jean Folger. (23 February 2015). Best Credit Cards For Travel In China . เfrom

investopidia: http://www.cnto.org/best-credit-cards-for-use-when-traveling-in-china/

Jon Henley. (4 June 2016). Sweden leads the race to become cashless society. from

theguardian: https://www.theguardian.com/business/2016/jun/04/sweden-cashless-

society-cards-phone-apps-leading-europe

Jonathan Zinman. (2004). Why Use Debit Instead of Credit? New York: Federal

Reserve Bank of New York.

Mallika Appuhamilage Kumudini Sriyalatha. (2016 ). Determinants of Customers’

Attitude towards Credit Card Usage: Lessons Learned from Academics in Sri Lanka.

Sri Lanka: Macrothink Institute.

Michel Tuan Pham, Gita Venkataramani Johar Eric J. Johnson. (2004). Consumer

Behaviur and Marketing .

Miriam Caldwell. (15 December 2016). What Is the Difference Between a Credit

Card and a Debit Card. from thebalance: https://www.thebalance.com/difference-

between-a-credit-card-and-a-debit-card-2385972

Muthu Velayutham, Phli Abdul Brosekhan. (ม.ป.ป.). Consumer Buying Behaviour.

IOSR Journal of Business and Management.

Sutee Ngowsiri, Wannaporn Boripunt, Chetsada Noknoi. (2009). Have Debit Cards

Changed Thai Consumer Shopping Behavior. Thailand: International Journal of

marketing studies.



I20

Traitanit. (9 January 2017). บทบาทของ Alipay ส าหรบ Cashless Society ในเกาหลใต. from

Ascend Developers:

https://developers.ascendcorp.com/%E0%B8%9A%E0%B8%97%E0%B8%9A%E0

%B8%B2%E0%B8%97%E0%B8%82%E0%B8%AD%E0%B8%87-alipay-

%E0%B8%AA%E0%B8%B3%E0%B8%AB%E0%B8%A3%E0%B8%B1%E0%B8

%9A-cashless-society-

%E0%B9%83%E0%B8%99%E0%B9%80%E0%B8%81%E0%B8%B2%E0%B8%A

B%E0%B8%A5%E0%B8

Understanding debit cards. (2007). from Managing Money: http://www.consumer-

action.org/downloads/english/debit_cards.pdf

University of pretoria. (ม.ป.ป.). CONSUMER BEHAVIOUR THEORY . University of

pretoria.

World's Top 10 Credit Card Issuers. (2009). from CNBC:

http://www.cnbc.com/2010/04/13/Worlds-Top-10-Credit-Card-Issuers.html?slide=11



I21

AN EMPIRICAL STUDY OF THE FACTORS INFLUENCING CUSTOMERS’

PURCHASE INTENTION OF DIGITAL CAMERA

Authors: Tattep Sinjanakhom and Jantima Banjongprasert, Ph.D.

Program: Master of Business Administration in International Business

Institute: Silpakorn University International College

Abstract

The aim of this study is to explore marketing mix and characteristics of buyers

influencing purchase intention of digital cameras. The study addresses its research objective

through an empirical investigation adopting quantitative survey in digital camera sector. Data

were collected using an online survey (280 respondents). The results, analyzed through

multiple regression analysis, demonstrate positive impact of marketing mix and

characteristics of buyers on customers’ purchase intention. The research findings provide

guidance to managers as to how customers’ purchase intention is influenced by marketing

mix and characteristics of buyers. The theoretical and managerial implications of this

research are articulated.

Keywords: Marketing mix / Characteristics of buyers / Purchase intention

Introduction

Consumers’ purchase intention represents how efficiently a company implements its

strategies to satisfy market demands. This view is supported by Alipour et al. (2012) that a

relationship between corporate strategy and consumers’ purchase intention is very crucial as

successful marketing strategies are dependent upon profound and genuine understandings of

influential factors pertinent to purchase intention of consumers. To achieve this, companies

need a good grasp of preferences their customers have towards products and services

(Karbala and Wandebori, 2012). Kuyram (2013) states that the purchase intention of

consumers is a complicated issue as there are various factors involving in purchase decision.

Thus, enterprises need to understand how consumers respond to the factors affecting

purchase intention especially marketing factors. Moreover, customers’ characteristics are

considered as critical factors for understanding customers’ purchase intention. Therefore, this

study endeavors to investigate marketing mix, customers’ characteristic, and customers’

purchase intention.

Digital Camera

Digital camera has increasingly become one of the most popular segments of

consumer electronic products, as people have used cameras more frequently than ever. They

are now taking photographs for a wider range of purposes. Growing popularity in tourism and

fashion photography, for example, has led to increasing demand for digital cameras. Lodi

(2016) argues that with the introduction of mirrorless cameras, we have experienced a

dramatic increase in digital camera sales, which has, in turn, driven the overall growth of this



I22

market over the years. Mirrorless camera, frequently accompanied by a slim body design, is a

combination of DSLR camera and compact camera. A product of this type offers

interchangeability of lenses, and is user friendly in terms of simpler menus and controls. One

widely accepted advantage of digital cameras over smartphones is higher image quality (Stirr,

2016). Other features of digital cameras, superior to those of smartphones, include a larger

sensor to ensure a better image quality, a usually longer battery life, a more powerful flash,

and their greater compatibility with a more variety of lenses with different focal lengths and

resolutions. Esser (2014) demonstrated that a lifecycle of digital camera is much longer that

of smartphone and laptop as it allows users to replace a lens as per their needs. These

qualities play a crucial role in impacting demands for interchangeable lens cameras over the

coming years (Lodi, 2016). Hence, this study focuses on digital camera customers.

Consumers’ purchase intention

Consumers' purchase intention is one important process that takes place in decision-

making which can be defined as a consumer’s tendency to buy a product. Mirabi et al. (2015)

defines purchase intention as a kind of decision making that focuses on the reason to buy a

particular product which is usually related to the behaviors, perceptions and attitudes of

consumers. According to Xie (2012), it can also be understood as the potentiality that a

consumer intends to purchase a product. Further, purchase intention can be employed as a

forecasting instrument for market research of future purchase decision. In short, purchase

intention has long become an important concept in marketing field as not only can it, as a

predicting tool, help marketers to evaluate the purchasing power of consumers, but it also

represents a degree of willingness of purchasing (Linh, 2014). As argued by Jaafar et al.

(2012), purchase intention can hint at a purchasing process of consumers, and helps

companies to better understand a market situation. However, there is a difference between the

intention to buy a product and the actual purchase as purchase intention involves a

considerable number of factors which affect a purchase decision. Mirabi et al. (2015) in their

study found that it may be interrupted by internal impulse and external environmental factors

during purchasing process such as their lifestyles or the recommendation form their family.

Moreover, unanticipated situational factors such as disliking a salesperson in a store are the

other reason why consumers often might change their mind about an intended purchase

decision (Kokoi, 2011). Mirabi et al. (2015) found that purchase intention may be interrupted

by internal impulse and external environmental factors during purchasing process. In many

situations, for instance, promotion can act as an unanticipated circumstance which causes a

different brand to become more desirable (Teunter, 2002).

Marketing mix

Marketing mix refers to a set of tactical marketing tools which comprises of four

elements: product, price, promotion, and place (The 4Ps) companies always use to

incorporate into their marketing strategies (Alipour et al., 2012). According to Domie (2013),

each element cannot be employed alone as all elements are, in all dimensions, equally

important; each element ideally supports the others. This process usually involves

considerations of how to create a successful mix of a right product or service, with a right

price, place and promotion (Munusamy and Hoo, 2008). In reality, there are discrepancies

among companies when it comes to using marketing mix, in part, due to availability of

resources, market conditions, and different needs and wants of customers.



I23

Product refers to a goods or services for a consumer. Souar et al. (2015) defines a

product as anything that can be offered to a market for attention, use, or consumption in order

to satisfy needs and wants of customers, and most of the time, is used to predict that given

market. According to Kuyram (2013), and Karbala and Wandebori (2012), to develop

products with the right quality to meet the needs of target market, every company should

consider quality of product as one of the crucial factors. For the digital camera market, Lodi

(2016) comments that technology advancements have contributed to improvement of product

quality by offering more features, such as larger sensors and higher image quality. According

to Karbala and Wandebori (2012) and Deng (2009), for example, many brands such as Apple,

Target, and Nike, have become a leader in their respective industry as they have strategically

used a design as a differentiator to set themselves apart from competitors. After-sales service

play not less important role in creating positive feelings towards a certain product (Karbala

and Wandebori, 2012). Mirabi et al. (2015) asserts this concept that more and more

companies have offered their customers better problem solving, thereby winning heart of

their customers. For example, if customers are not satisfied with functionality, of a product

they have just bought, the purchased product can, according to many companies’ return

policy, be claimed within 7-14 days. According to Mirabi et al. (2015), and Ali et al. (2016)

showed that intention of customers can be influenced by the product with good quality, image

of the brand and attractive design. As a result, according to above discussions, the first

hypothesis is proposed: Product factors has positive impact on customers’ purchase

intention.

Price refers to any amount consumers have to pay to receive the offering goods or

services (Kuyram, 2013).Prior to price setting, companies need to understand its important

roles in determining value of their products in targeted markets (Gilaninia et al., 2013). In a

larger number of industries, especially consumer products, companies establish their pricing

policy using the competition-based strategy (Dang, 2014). Price can be consider as the most

sensitive element of all market mix elements because price can be fluctuating, depending

upon various factors: demand of customer, competition, government regulations. Such

factors, thus, are very crucial, and need to be taken into account in price setting. In many

cases, consumers tend to change their decision on buying a product when they perceive that

the value they would receive is not worth with the amount they have to spend. According to

Khan (2011), and Tolušić et al. (2002) also found that consumers will consider about price as

the important factor which can change their purchase intention. Thus, the second research

hypothesis is proposed: Price factors has positive impact customers’ purchase intention.

Place strategy can refers to a location where products and services are to be displayed

and made available to the customers, and also focuses on distribution channel and logistics

management which products will flow from company to consumers (Kuyram, 2013).

Consumers are now not only focusing on availability of products, but also paying more

attention to accessible location. Yasanallah and Bidram (2012) also confirms that customers

always search for convenience; and, thus, they expect to receive products and services

anywhere and anytime they like. Retailers and middleman play important roles in bridging

producers and consumers with a strong personal relationship by holding a variety of products

and also offers other services like promotion as well as after-sale services (Munusamy and

Hoo, 2008). Furthermore, new technologies have allowed companies to provide their

products without customers coming to their facilities. Companies can sell more products to

different geographically markets; and customers can carry out transactions through online

payment. However, there are many situations where contact between the provider and the

customer is still essential. Yasanallah and Bidram (2012) and Dang (2014), in their study also

confirmed that customers nowadays also expected the convenience place and the suitable



I24

distribution channel can increase their purchase intention. Thus, the third hypothesis is

proposed: Place factors has positive impact on customers’ purchase intention.

Promotion is the set of methods concerning with bringing products to the awareness

of customers and persuading them to buy through various activities, advertising, personal

selling and sales promotion, for example. Kamsuwan (2015) points out that companies should

focus on sales promotion and communication strategies and on identifying who their

customers are, how they can be contacted, and what messages should be delivered. Free

samples, prize contests, premium on sale, shows and exhibitions are some illustrations of

sales promotion techniques. Rajalingam and Pushpanathan (2013) suggests that advertising is

so far the best tool to increase public awareness of both existing and new products as it can

communicate, through mass media, such as television, radio, newspapers, magazines, web

pages, posters, brochures, etc., with a vast number of people. Advertising is the component of

the promotion strategies which requires several decisions with regard to the theme of

advertising, media to be used, budget, and so on. Personal selling is the effective

communication process of presenting the products to customer by the company’s sales force

in order to make sales and create relationships between buyers and sellers (Dang, 2014). The

effectiveness of sales force depends upon performance appraisal which can estimated form

the call reports, customer feedback and invoices (Chand, 2016). However, no single method

of promotion is effective alone, there is no one ideal methods that fits all situations (Chand,

2016). The promotional campaign usually involves a combination of two or more

promotional methods because of the increasing competition of market. Mirabi et al. (2015) in

their study also investigated the impact of promotion on consumer buying behavior. As a

result, the fourth hypothesis is proposed: Promotion factors has positive impact on

customers’ purchase intention.

The characteristics of buyers

Apart from marketing mix, consumer purchase intention itself is also influenced by

characteristics of buyers, including personal, social, and psychological factors. These

characteristics are those beyond control of companies, such as, personality or economic

situations (Oancea, 2015). Since companies cannot change or control these factors, they need

to be aware of affecting factors so as to design their offerings in a way that draw their

customers’ attention (Sarker et al., 2013). They, thus, need to analyze how these stimuli

transform into responses inside the customers’ purchase intention (Sandu, 2014). As Kim and

Hyun (2011) suggests, companies must, by their nature of business, determine which factors

can most influence their customers’ purchase intention, which will, in turn, and triggers their

purchase decision.

Personal factor Personal factor can refer to wholeness of behavior with different

characteristics in different circumstances which can influence consumers’ purchase intention,

and simultaneously shapes their whole pattern of interacting. Sandu (2014) describes

personality as a combination of physical and mental characteristics of a person which varies

from one to another; and it reflects how one thinks, acts, and feels. Therefore, companies

need to gain an insight into customer personality in order to understand how they make a

decision because most, if not all, consumers choose a product that fits their personality

(Kowel, 2015). Lifestyle is another important factor that affects consumers’ purchase

intention. It refers to a way people live in a society which represents their surrounding that

determines their interests, opinions, activities. It shapes the whole pattern of consumers’



I25

interacting responses (Vijayakshmi and Mahalakshmi, 2013). For this reasons, Muniady et al.

(2014) suggests that companies should, and must, pay close attention to the global trend as

the reflection of intention of customers. Further, EconEconomic situation is one of the

personal factors that influence consumers’ purchase intention because if income and savings

rise, customers will have more purchasing power, and therefore consumption and spending.

On the other hand, a lowered level of income and savings will inevitably limit purchasing

power, and, in many cases, people can become more price sensitive and seek to compare

goods of the same types and select what they perceive the best based on price, compromising

on the quality (Vijayakshmi and Mahalakshmi, 2013). Vijayakshmi and Mahalakshmi, (2013)

in their study showed that personal factors has great influence on customer purchase

intention. As a result, according to the above discussions, the fifth hypothesis is proposed:

Personal factor has positive impact on customers’ purchase intention.

Social factor such as friends, family members, social organizations, affect a selection

of specific brand heavily (Mirzaei and Ruzdar, 2010). Khan and Rohi (2013) notes that, in

many situations, people want to be part of a particular group, therefore, options and

preferences from family members or friends are an important influencing factor in product

selection, especially for an individual who lives alone. Furthermore, family is the factor that

plays an important role in shaping individuals’ attitudes and perceptions towards products,

because many people have a habit of choosing products and services they are familiar with

from their childhood. Social status throughout one’s life depends on family, friends,

organizations to which they belong. Each social status, and its roles, has a dignity which is

the respect that society has towards. As a result, people like to choose products that are

compatible with their roles and places in the society (Sandu, 2014). Thus, in the context of

consumers purchase intention, people will tend to purchase product when their social

environment encouraged them to purchase (Mirzaei and Ruzdar, 2010 and Sarker et al.,

2013), therefore, the sixth hypothesis is proposed: Social factor has positive impact on

customers ‘purchase intention.

Psychological factor consists of perception, motivation, and learning has a

significant, direct impact on the consumers’ purchase intention (Domie, 2013). Perception is

the process in which people perceive, select, organize, and interpret information surrounding

them in a way to produce a meaningful experience. Difference in opinions on a product

depends on how customers perceive information of that product (Furaiji et al., 2012).

Motivation is a psychological factors that starts within individuals when an individual wants

to get what they need. The nature of the needs is varied among individuals in terms of both

biological and social factors (Vijayakshmi and Mahalakshmi, 2013). Learning, in a marketing

sense, refers to the process described as changes in an individual's purchase intention after

obtaining product information or gaining experience with a product (Furaiji et al., 2012). This

can cause consumers to either buy a product for the second time, or to give up buying on that

product, or to seek more information on the product. In addition, Domie (2013), and

Lautiainen (2015), in their researches examined that psychological factors has a significant

effect on the purchase intention of customers. Therefore, the seventh research hypothesis is

proposed: Psychological factor has positive impact on customers’ purchase intention.



I26

Objectives of the Study:

• To explore the impact of marketing mix factors on customers’ purchase intention.

• To investigate the impact of characteristics of buyers’ factors on customers’ purchase

intention.

Figure 1. Theoretical Framework


Research Design

To satisfy the research objectives, this study is based on a quantitative approach; and

a structural design was drawn upon previous study by Vijayalakshmi and Mahalakshmi

(2013), and Furaiji et al. (2012), which employed both marketing mix factors and

characteristics of buyers’ factors as they offered the findings in more various dimensions, as

compared to a focus on one group of contributing factors. The primary data were collected

through the use of online survey. The survey instrument was a self-administered

questionnaire containing closed-ended scales questions. The data obtained were, then,

analyzed to determine the impact of marketing mix and customers’ characteristic on

customers ‘purchase intention of digital cameras.

Sample size

A target population here refers to digital camera users; and yet the survey aims at

online-based groups because of the appeal of this particular market as these groups tend to

receive new trends and appear to provide quick responses to new products. According to



I27

Khan and Rohi (2013), non-probability sampling has been widely applied, owing to its ability

to gather data quickly and inexpensively. Another reason behind a focus on online-based

groups was that there were some certain circumstances in which collecting data from the

entire population in reality was not possible, the distribution of a survey in digital camera

exhibitions was not allowed. Despite of this, the total number of 280 completed

questionnaires is considered effective as the most effective sample size, as Roscoe (1975)

suggests, between 30 and 500.

Data collection and analysis

In this research, the questionnaire distribution targeted on 6 digital camera user

groups: Sony Alpha Club Thailand, Fuji X Series Club Thailand, Canon Club Thailand,

Nikon Club Thailand, OLYMPUS Club Thailand, and Panasonic Lumix Mirrorless Club

Thailand. To ensure complete understanding of the entire questionnaire, there were both Thai

and English version, and an explanation for any potential confusion was also available upon

request.

In order to obtain data from digital camera users, Google Docs, a free online survey

service provided by Google, is utilized; and the effectiveness of this process was confirmed

by Ling et al. (2014). The questionnaire comprised two sections in which the first section

contained 43 items about marketing mix (product factors, price factors, place factors, and

promotion factors), characteristics of buyers (personal factors, social factors, and

psychological factors), and purchase intention. All questionnaire items were based on a

Likert’ five scale to scaling responses with five scale point descriptors: “Strongly Disagree”,

“Disagree”, “Neutral”, “Agree”, and “Strongly Agree”. The questionnaire codes the

responses accordingly: Strongly Disagree = 1, Disagree = 2, Neutral = 3, Agree = 4, and

Strongly Agree = 5. The second section contained 11 items about demographics: gender, age,

marital status, occupation, highest educational attainment, and basic questions about making

use of digital camera.

Upon completion of data collecting, the Statistical Package for Social Sciences

(SPSS) version 21 was used for an analysis. To validate the data and to determine a

relationship between the independent variables and the dependent variable, an analysis was

performed through three tests: Descriptive Statistics, Reliability Analysis using Cronbach’s

Alpha, and Hypothesis testing using Pearson’s Correlation and multipleregression Analysis.

Also, all statistical data are presented in pie charts and tables.

Results

Demographic Information

Of 280 completed questionnaires, 138 respondents are male (49.3%), 139 are female

(49.6%), and the rest of 3 (1.1%) specified as ‘Other’. The majority of respondents age

between 21-25 years old (39.3%); are single (75%); earned a bachelor degree (78.6%); and

work for a private organization (40.7%). Respondents with at least 5-year experience in using

a digital camera represent the largest proportion of the population (28.6%), and 159

respondents (56.8%) possess only one camera. Of the total, 47.1% use a mirrorless camera,

while 26.1% prefer Fujifilm. Most respondents bought a digital camera at retailers, such as

Big Camera, and suggest an acceptable price range of 25,001-30,000 baht. When purchasing



I28

digital camera, most respondents (179 respondents or 63.9%) relied on their own. Prior to

their purchase, they tend to look for information on their own, while recommendations from

family, friends, salesperson and reviewers are not as significant. What is interesting is that the

main purpose of a purchase of digital camera is for travel / recording memories. For the

payment method, the result showed that payment through a credit card (Non-Down payment)

is most popular.

Reliability Analysis

By using structural equation models, the composite reliability needs to be verified

through Cronbach's α which, as proposed by Nunnally (1978) should exceed the

recommended threshold of 0.7. In this study, the Cronbach alpha coefficients indexes are

above the threshold value of 0.7, therefore indicating the reliability of the questionnaire

items.

Table 1: Cronbach’s alpha

Item Number of Item Cronbach’s Alpha

Product 7 0.79

Price 3 0.70

Place 6 0.84

Promotion 5 0.82

Personal 6 0.77

Social 5 0.77

Psychological 5 0.85

Purchase intention 5 0.75

Correlation Analysis

The outputs indicate a strong relationship in the correlation matrix for the 7 variables:

product factors, price factors, place factors, promotion factors, personal factors, social

factors, psychological factors, and consumers’ purchase intention. The Pearson correlation

coefficients of all items are positively correlated with the dependent variable, at a

significance level of 0.01. The analysis results of Pearson’s correlations between the

independent variables and the dependent variable are 0.411, 0.472, 0.405, 0.385, 0.661,

0.436, and 0.628, respectively. Personal factors and psychological factors demonstrating the

strongest relationship on consumer purchase intention. Also, the results demonstrated that all

independent variables have a strongly correlation with one another, at a significance level of

0.01. Therefore, .a correlation analysis was performed to measure a direction and strength of

a relationship between the independent variables and the dependent variable.



I29

Table 2: Correlations between the independent variables and the dependent variable

Correlations

Product

Average

Price

Average

Place

Average

Promotion

Average

Personal

Average

Social

Average

Psychological

Average

Purchase

Intention

Average

Pearson

Correlation .411** .472** .405** .385** .661** .436** .628**

Sig. (2-

tailed) 0 0 0 0 0 0 0

N 280 280 280 280 280 280 280

Multiple Regression Analysis

A multiple regression was used to predict customers’ purchase intention based on

product factors, price factors, place factors, promotion factors, personal factors, social

factors, and psychological factors. The result the overall multiple regression model with the

adjusted R² value of independent variables at 0.518. This suggests that 51.8% of variance in

the dependent variable (purchase intention) is explained by independent variables. The

significant value of the four independent variables (place factor, personal factor, social factor,

and psychological factor), affects the dependent variable (purchase intention) at a statistical

significance level of 0.05 (p < 0.05). This can be concluded that place factor, personal factor,

social factor, and psychological factor add statistical significance to the prediction, p <0.05.

However, there are three independent variables that do not affect the dependent variable, at a

statistical significance level of 0.05 (sig > 0.05), these being: product factor (0.453), price

factor2 (0.183), and promotion factor (0.059). This thus demonstrates that product factor,

price factor and promotion factor do not have a significant impact on customers’ purchase

intention.

Table 3: R-square value for a relationship between the independent variables and the

dependent variable

Model Summary

Model R R Square Adjusted R

Square

Std. Error of the

Estimate

1 .728a .530 .518 .55946



I30

Table 4: the Coefficients of the relationship between the independent variables and the

dependent variable

Model Unstandardized

Coefficients

Standardized

Coefficients

t Sig. Collinearity

Statistics

B Std. Error Beta Tolerance VIF

1

(Constant) .103 .243 .421 .674

Product Average -.058 .077 -.044 -.752 .453 .514 1.945

Price Average .081 .061 .076 1.335 .183 .526 1.902

Place Average .116 .052 .118 2.214 .028 .606 1.649

Promotion Average -.119 .063 -.115 -

1.895

.059 .473 2.115

Personal Average .421 .078 .356 5.392 .000 .397 2.519

Social Average .128 .052 .125 2.447 .015 .664 1.506

Psychological

Average

.372 .063 .348 5.945 .000 .504 1.983

Conclusion

This research is a study of factors that influence consumers' purchase intention of

digital cameras. Two determinants of purchase intention identified and examined in this study

are marketing mix factors and characteristics of buyer’s factors. There are seven contributing

elements employed to run an analysis for this research in order to determine factors that

affect purchase intention of consumers of digital cameras. Of all survey questionnaires

distributed online, a total number of 280 questionnaires were completed; and the data

obtained were analyzed using SPSS. Four factors (place factors, personal factors, social

factors, psychological factors) have significant impact on consumers’ purchase intention,

while product factors, price factors, and promotion factors do not have significant impact on

consumers’ purchase Intention.

Discussion

In sum, price, for this particular business, is so important to customers not much in its

own influencing role as in its relation with product quality: high price with high quality. This

is consistent with the descriptive analysis, in that most respondents always paid attention to

the association between quality and price, while making a purchase decision. In addition, the

majority of respondents preferred buying a product at retailers to through online services as

they can try out a product.

However, a reason for which product has no significant impact on customers’

purchase intention is that manufacturers of digital cameras is now present in a small number,

and that they have been offering products with the same level of quality as well as compatible



I31

functions, albeit a wide range of products. As for promotion, also with no significant impact

on customers’ purchase intention, it could be that promotional campaigns are not normally

given to products of this type, and that they are, if any, known within limited groupings.

Further, sale promotion is usually determined by retailers, tending to lower prices, to the

same level, of products with the same quality. Accordingly, purchase decision making of

customers is largely dependent upon their own preference, personalities, lifestyles and

recommendations from people around them. The main reasons for purchasing a digital

camera are travelling, memory recording, and relaxation, respectively. As they are likely to

search for information before purchasing, they usually make their own decision. When

accompanied by a product tryout, this helps facilitate consumers in terms of product

selection. As for statistical aspects, place factor, personal factor, social factor, and

psychological factor have an impact on customers’ purchase intention at a statistical

significance level of 0.05 (p < 0.05), where these factors can be used to explain purchase

intention, for 51.8%, respectively. Such figures, therefore, are useful also for predicting

future purchase intention.

Implication

Based on the results of this study, there are a number of implications that might be

useful in assisting digital camera manufacturers and distributors to better understand factors

influencing purchase intention of customers of digital cameras, so they will be able to pay

more accurate and precise attention to desirable target markets, and address issues they are

facing in current marketing situation. According to the research analysis, digital camera

manufacturers and distributors should pay more attention to personal factors as a key element

for an overall marketing strategy. For instance, companies may focus on products that suit

best to lifestyles of digital camera users, especially young adults (aged between 21 and 30) as

these two groups, when combined, represent the largest market segment through offering

products that serve their preferences, such as user-friendliness, functionality, and high quality

images. As seen from the Descriptive statistics, although, as an individual factor, digital

camera users may not give much importance to prices they always associate price with

product quality. Accordingly, all camera companies should allow for product attributes,

including warrantee and after-sales services, when setting a pricing policy. Finally,

companies should provide powerful information about their products through a variety of

sources, websites, televised advertising, printed media, salespersons, etc. to ensure that

consumers have sufficient access to their desired product information. This will, in turn, will

further facilitate their purchase decision, as when consumers obtain enough information and

experiences, they are more likely to purchase a product.

Limitation

Even though the objectives of this research is met, there were two main limitations in

this research. The first limitation involves distribution of a survey questionnaire. According

to exhibition's policies, any kind of survey conducting by students at exhibitions is not

permitted. Data collection, was, thus, carried out through online-based survey, instead. Upon

completion of data collecting, there were only 280 questionnaires which provided valid data

for research analysis. This, as a result, might not represent digital camera consumers’

purchase intention as a whole. The other limitation is that this research relied heavily on the

data collected from a questionnaire. One obvious problem regarding filling out a



I32

questionnaire is that a there might be a number of respondents who do not regard the process

as seriously; therefore, they may randomly select an answer to a questionnaire item, thereby

reducing accuracy of the results.

Recommendation

For future studies concerning this topic, it is advisable that a research should be

conducted with a larger sample size so as to enable generalization of potential finding with

higher confident and alert the probability of uncertainty of invalid data and un-return

questionnaires (Ling et al., 2014). A larger size of target samples can cover and also represent

a more reliability of the results, as regards possibilities of finding relationships with a wider

range of correlation tests. Although this study proposed that ‘marketing mix’ and

‘characteristics of buyers’ can influence customers’ purchase intention of digital camera,

elements in other areas, consumer behavior in particular, may as well be crucial in describing

of customers’ purchase intention in other industries. Further study should, therefore, take into

account such elements. As this research suggests that most factors with significant impact on

customers’ purchase intention are those uncontrolled by companies, it is advisable for further

research to take into account controllable factors, which will, in turn, enable companies to

adopt and apply to their business more practically. Lastly, Chew et al. (2012) comments that

to ensure effectiveness of a research, an interviewing method should be incorporated into a

survey because it will help to produce more in-depth data and improve analysis outcomes in

terms of qualitative aspects.

References

Ali, M., Ilyas, M., & Rehman, C. A. (2016). IMPACT OF CONSUMER CENTRIC

MARKETING MIX ELEMENTS ON CONSUMER BUYING BEHAVIOR; AN

EMPIRICAL INVESTIGATION IN CONTEXT OF FMCG INDUSTRY OF

PAKISTAN. Kuwait Chapter of the Arabian Journal of Business and Management

Review, 5(5), 30.

Alipour, M., Moniri, S. M., Shareghi, B., & Zolali, A. (2012). Ranking the Marketing Mix

Elements Effect on the Behaviors of Industrial Electrical Heaters Consumers (Case

Study: Kaveh Industrial City). Middle-East Journal of Scientific Research 12 (11),

1560-1565.

Chand, S. (2016). Marketing-Mix: Definition, Nature and Determining the Marketing-Mix.

Retrieved from http://www.yourarticlelibrary.com/marketing/marketing-

management/marketing-mix-definition-nature-and-determining-the-marketing-

mix/27951/

Chew, J., Lee, J., Lim, C., Loke, W., & Wong, T. (2012). Exploring the factors affecting

purchase intention of smartphone: A study of young adults in Universiti Tunku Abdul

Rahman. Perak Campus, Malaysia.

Dang, T. (2014). The success of applying marketing mix 4Ps in Vietnamese dairy industry:

Vinamilk–a typical case.

Deng, X. (2009). Consumer response to visual aspects of packaging and product

design (Order No. 3363279). Available from ABI/INFORM Collection; ProQuest

Dissertations & Theses Global. (304978699). Retrieved from

http://search.proquest.com/docview/304978699?accountid=50150



I33

http://www.yourarticlelibrary.com/marketing/marketing-management/marketing-mix-definition-nature-and-determining-the-marketing-mix/27951/



http://search.proquest.com/docview/304978699?accountid=50150

Domie, S. P. (2013). ASSESSING THE FACTORS INFLUENCING CONSUMER

SWITCH FROM LOCAL TO IMPORTED PRODUCTS: A case study of Kasapreko

Company Limited-Ghana.

Esser, F. (2014). Mirrorless cameras and premium compacts are on the rise, despite a

shrinking camera market. Retrieved fromhttp://www.imaging-

resource.com/news/2014/06/09/mirrorless-cameras-and-premium-compacts-are-on-

the-rise-despite-a-shrinking

Furaiji, F., Łatuszyńska, M., & Wawrzyniak, A. (2012). An empirical study of the factors

influencing consumer behaviour in the electric appliances market. Contemporary

Economics, 6(3), 76-86.

Jaafar, S. N., Lalp, P. E., & Naba, M. (2012). Consumers’ perceptions, attitudes and purchase

intention towards private label food products in Malaysia. Asian Journal of Business

and Management Sciences, 2(8), 73-90.

Karbala, A., & Wandebori, H. (2012). Analyzing the factors that affecting consumers

purchase intention in Toimoi store, Indonesia. Paper presented at the 2nd

International Conference on Business, Economics, Management and Behavioral

Sciences.

Khan, S. (2011). MARKETING MIX STRATEGY ADAPTATION: A RETAIL

ORGANISATION’S RESPONSE TO THE GLOBAL ECONOMIC DOWNTURN. Cape

Peninsula University of Technology.

Khan, S., & Rohi, S. (2013). Investigating The Factors Affecting Youth Brand Choice For

Mobile Phones Purchase-A Study Of Private Universities Students Of Peshawar.

Management & Marketing, 8(2), 369.

Kim, J.-H., & Hyun, Y. J. (2011). A model to investigate the influence of marketing-mix

efforts and corporate image on brand equity in the IT software sector. Industrial

Marketing Management, 40(3), 424-438.

Kokoi, I. (2011). Female buying behaviour related to facial skin care products.

Kuyram, N. (2013). An investigation of the marketing mix factors influencing the purchasing

behavior of Thai hair salon owners regarding hair color products. Journal RMUTSB

Acad. J. 1(2): 138-147.

Lautiainen, T. (2015). Factors affecting consumers' buying decision in the selection of a

coffee brand.

Ling, L. P., Lang, P. K., Fong, T. C., & Perinpajothi, T. S. (2014). Factors Affecting

Purchase Intention Towards Smartphone Brand: A Study Of Young Female Adult

Consumers. UTAR.

Linh, L. T. (2014). Factors affecting consumers' purchase intention of safe vagetables in Ho

Chi Minh city. International University HCMC, Vietnam.

Lodi, E. (2016). The Best Mirrorless Camera for Beginners. Retrieved

fromhttp://thewirecutter.com/reviews/best-mirrorless-camera-for-beginners/

Mirabi, V., Akbariyeh, H., & Tahmasebifard, H. (2015). A Study of Factors Affecting on

Customers Purchase Intention. marketing, 2(1).

Mirzaei, H., & Ruzdar, M. (2010). The impact of social factors affecting consumer behavior

on selecting characteristics of purchased cars. Journal of Payame Noor University, 1-

11.

Munusamy, J., & Hoo, W. C. (2008). Relationship between marketing mix strategy and

consumer motive: an empirical study in major Tesco stores. Unitar e-journal, 4(2),

41-56.

Nunnally, J. C. (1978). Psychometric Theory (2nd Edit.) McGraw-Hill. Hillsdale, NJ.



I34

http://www.imaging-resource.com/news/2014/06/09/mirrorless-cameras-and-premium-compacts-are-on-the-rise-despite-a-shrinking



http://thewirecutter.com/reviews/best-mirrorless-camera-for-beginners/

Oancea, O. (2015). The Model of Integrated Marketing Communication: Who has the Role to

Influence Consumer Behaviour. Acta Universitatis Danubius. Œconomica, 11(1).

Roscoe, J. T. (1975). Fundamental research statistics for the behavioral sciences [by] John T.

Roscoe.

SANDU, M. C. (2014). IMPORTANT ELEMENTS IN CONSUMER’S DECISION-

MAKING PROCESS. Quality of Life (1018-0389)/Calitatea Vietii, 25(4).

Sarker, S., Bose, T., Palit, A., & Haque, E. (2013). Influence of Personality in Buying

Consumer Goods: A Comparative Study between Neo-Freudian Theories and Trait

Theory Based on Khulna Region. International Journal of Business and Economics

Research, 2(3), 41-58.

Souar, Y., Mahi, K., & Ameur, I. (2015). The Impact of Marketing Mix Elements on

Customer Loyalty for an Algerian Telecommunication Company. Expert Journal of

Marketing, 3(1), 1-10.

Stirr, T. (2016). A Few Thoughts About the Camera Market. Retrieved

fromhttps://photographylife.com/a-few-thoughts-about-the-camera-market

Tolušić, Z., Zmaić, K., & Deže, J. (2002). „Marketing-mix in the function of the organic food

of eastern croatia “. Ekonomski pregled, 53(7-8), 782-794.

Vijayakshmi, S., & Mahalakshmi, V. (2013). An impact of Consumer Buying Behavior in

Decision Making Process in Purchase of Electronic Home Appliances in Chennai

(India) - An Empirical Study. Elixir International Journal on Marketing

Management(59 (2013)), 15267-15273.

Xie, B. (2012). Factors Affecting Purchase Intention of Electric Cooking Appliance in

Thailand. University of the Thai Chamber of Commerce.



I35

https://photographylife.com/a-few-thoughts-about-the-camera-market

Title MEASURING SERVICE QUALITY OF FOREIGN AND THAI CUSTOMERS TOWARD LUXURIOUS SHOPPING MALLS IN BANGKOK THROUGH SERVQUAL Author: Nattaphol bangviroonrag

Program Faculty of International Business Institute Silpakorn University International College

Abstract

Purpose – At this moment, luxury shopping malls in Bangkok, Thailand had been popular for both Thai and foreign customers, leading this study to pay attention on service quality of these luxury shopping malls to improve customer satisfaction. Nowadays, Service quality and customer’s satisfaction maintenance became the important part, challenging for every shopping mall to respond the customer’s need. Therefore, this study would like to 1) identify whether there is a gap between customer’s expectation, perception towards Thai luxury shopping malls, 2) identify whether there is difference on customers’s expectation, perception between foreigner and Thai towards Thai luxury shopping malls, and 3) search for ways of improvement for Thai luxury malls to increase their service quality.

Design/ Methodology: The research used the quantitative research because it is explaining phenomenon by collecting numerical data that are analysed by using mathematics-based methods. It has collected 286 respondents from both foreigners and Thais shoppers at these luxury shopping malls through distributing questionnaires at the malls and also through online questionnaire.

Findings: There are two objectives that this study would like to find out. The results of SERVQUAL showed that there are gaps between expectation and perception of customers who visited the Thai luxury malls. This showed that there are rooms that Thai luxury malls could still improve themselves. The second objective of this study also wants to find out whether there is a significant difference between Thais' and foreigners' expectation and perception towards the Thai luxury shopping malls. Results from T Test also showed that there was a significant difference



I36

between Thais and foreigners regarding their expectation, perception and satisfaction.

Keywords: SERVQUAL/ Service quality

Introduction

At present, tourism has been substantially considered as the one of the most noticeable industries that vastly drives the economy for a lot of countries. The term of tourism has been variously defined because tourism is a temporary movement of people to any destination which is not the common place or residence of tourists to leisure, business or other purposes. In theory, the duration of visit must not surpass one consecutive year. The associated service sectors that highly support and necessarily related with tourism are accommodation, transportation, recreation, food and beverage and entertainment like shopping malls sectors. All these sectors have helped the destinations visited by tourists to be substantially more efficient in being achieve the tourists’s experience (Thiumsak and Ruangkanjanases, 2016). Shopping is becoming one of the reasons in attracting tourists to travel because of expanding the shopping malls spaces which are more sprouting up and their improvement about the service quality in term of any convenience and comfortability in the downtown area to attract more customers (Ipsos loyalty, 2011). Also, the prices are low when compare with the quality which is generally high and the range and variety of products are amazing (Wiesmann, 2016). The unique shopping malls brings the dream of travelling in variety style such as they are a host of international high-end fashion brands, a giant movie theatre and bowling alley, concert hall and aquarium, and can get around easily. Therefore, shopping malls nowadays become the one of choices for tourists (huffpost.com: 2016).



I37

http://huffpost.com

Objectives

1) To identify whether there is a gap between customer’s expectation, perception towards Thai luxury shopping malls.

2) 2) To identify whether there is difference on customers’s expectation, perception between foreigner and Thai towards Thai luxury shopping malls.

3) 3) To search for ways of improvement for Thai luxury malls to increase their service quality.


The research use the quantitative research because it is explaining phenomenon by collecting numerical data that are analysed by using mathematics-based methods (Aliaga & Gunderson, 2000) including surveys and customer satisfaction questionnaires can assist small firms to improve their products and services by enabling them to make informed decisions. In term of this study, use SERVQUAL dimensions which are tangible, reliability, responsiveness, assurance and empathy to evaluate customer satisfaction. Therefore, the study will use quantitative research by using the questionnaire to collect the data to know whether there is different between customer’s expectation and perception of service quality at luxury shopping malls in Bangkok, Thailand. Population: The characteristic of population is Thai and foreign people who have been visited Thai luxury shopping malls which are Siam Discovery, Siam Centre, Siam Paragon, Central World, Central Chidlom, Central Embassy, Terminal 21, The Emquatier or others in Bangkok, Thailand at that period of time. Using the quantitative research for 54 questions including demographic and opinion parts throughout those shopping malls and also use online research questionnaire to collect the data, so people who have visited those Thai luxury shopping malls are the respondents.

Sample size: The questionnaires’s target are 300 but researcher can get them back for 286 questionnaires which are divided for foreigners of 143 and 143 of Thai respondents. The ordinary way to spread the



I38

questionnaires is giving them on travellers’s hand at shopping malls around Siam district and also take online google form to spread questionnaires to get faster answer.

Results/ Conclusion

This study uses SPSS analysis to analyse the data which are composed of frequencies techniques to analyse about personal data of the respondents which are gender, age, nationality, occupation, education, purpose of visiting Bangkok and the favourite shopping malls. To answer the objectives, it uses means, correlation and T- test techniques to analyse the data in term of opinion parts. In term of SERVQUAL dimensions, researcher can summarise to be 5 dimensions to answer the objective as following:

Tangibility: Customers both Thai and foreign expect more on the tangibles aspects of Thai luxury malls and having the highest gap of difference about a modern looking equipment which should be improved and the lowest gap is about physical facilities. Also, there is a significant difference between Thai and foreign customers which shows that foreign respondents has more expectation and perception of the luxury shopping malls than the Thai respondents’s expectation. Therefore, if Thai luxury shopping malls focuses on foreigners, they should provide a modern and outstanding layout and equipments that are more convenient and convinced them to keep a standardisation get more satisfaction. Furthermore, if Thai luxury shopping malls focus on Thai people, they should do about a physical or equipment that is more interesting to attract them and providing some gimmick to make a shopping malls more unique to get more interesting satisfaction.

Reliability: Both Thai and foreign customers expect more on the reliable aspects of Thai luxury malls. Having the highest gap of difference about right performance at the first time which should be improved that and the lowest gap is about promising to do something by a certain time is noticeably. Besides, there is a significant difference between Thai and foreign customers which displays that foreign respondents has more expectation and perception of the luxury shopping malls than the Thai respondents’s



I39

expectation. Hence, Thai luxury shopping malls should more do and concern about performance of employees by providing the training and development class to make them more reliability and performance to increase customers satisfaction for both foreigner and Thai people because more reliable employees are, more satisfied customers are too.

Responsiveness: Respondents both Thai and foreign have more expectation on responsiveness aspects of perceptions of Thai luxury malls and having the highest gap of difference about giving an exact information to customers which should be improved that and the lowest gap is about being willing to help customers is remarkably. In addition, there is a significant difference between Thai and foreign customers which shows that foreign respondents has more expectation and perception of the luxury shopping malls than the Thai respondents’s expectation. Therefore, Thai luxury shopping malls should pay attention to employees by concerning about their performance and ability to respond to customers since first time of service because it can create more customer satisfaction in a long term.

Assurance: Both Thai and foreign customers have expected more on assurance aspects of perceptions of Thai luxury malls. The highest gap of difference about having a knowledge to answer customers which should be enhanced that and the lowest gap is about being confident in behaviour of customers is noticeably. Also, there is a significant difference between Thai and foreign customers which shows that foreign respondents has more expectation and perception of the luxury shopping malls than the Thai respondents’s expectation. Thai luxury shopping malls should more concentrate in term of employees’s behaviour and performance to respond to customer need which bring to get more customer satisfaction and loyalty because they have to make sure in an confidence of employees behaviour.

Empathy: Customers both Thai and foreign expect more on the empathy aspects of perceptions of Thai luxury malls and the highest gap of difference is about understanding the specific needs of customers which should be concerned. The lowest gap is about giving customers personal attention which is noticeably. Then, there is a significant difference between Thai and foreign



I40

customers which shows that foreign respondents has more expectation and perception of the luxury shopping malls than the Thai respondents’s expectation. Thai luxury shopping malls need a service mind of employees to respond to customer because it can show that employees have more empathy to be willing help them. Therefore, employees should be taught by specialise people who can give them more energy and fulfil the service with heart from Thai luxury shopping malls management team to make customer more satisfaction in term of empathy aspect.

Discussion

In Thai luxury shopping malls industry, there are many services and facilities that Thai luxury shopping malls can offer to their customers. All of these features can either attract the customers or affect their decision when looking for a shopping malls to visit for their trip. Customer’s decision depends on the products that the service providers offer to their customers. Moreover, to attract customers (Alpert 1971) stated that the destination should differentiate their product along with the competition offers. To increase customer’s satisfaction, Thai luxury shopping malls have to understand what factors influence their customer because all customers have different expectations which require shopping malls to respond differently. Thai luxury shopping malls should try to make improvement in these critical areas, so they can have high customer satisfaction and gain more repeat customers. There are two objectives that this study would like to find out. The results of SERVQUAL showed that there are gaps between expectation and perception of customers who visited the Thai luxury malls. This showed that there are rooms that Thai luxury malls could still improve themselves. The second objective of this study also wants to find out whether there is a significant difference between Thais' and foreigners' expectation and perception towards the Thai luxury shopping malls. Results from T Test also showed that there was a significant difference between Thais and foreigners regarding their expectation, perception and satisfaction.

Recommendations

There are the suggestions in each five dimensions SERVQUAL as following: According to the data analysis, all of factors are very important



I41

for Thai luxury shopping malls but some factors must be done perfectly in order to keep customers satisfied. There are some recommendations for Thai luxury shopping malls as following:1.Tangibility Modern equipment is the most influent that respondents expect towards Thai luxury shopping malls. Therefore, Thai luxury shopping malls should concern about something physical that customers can see and react. The recommendation is to develop the equipment more modern or attractive by using more technologies and some techniques to create customer’s perception in the future.2.Reliability Customers are the most satisfied with promising to do something of Thai luxury shopping malls. This becomes an advantage of Thai luxury shopping malls because they can make customers reliable. Therefore, Thai luxury shopping malls should keep this benefit to sustain customer reliability and being attractive new customers in the future. Thai luxury shopping malls should enhance about service being right at the first time by providing a course of training to employees to have more knowledges or skills to deal with customers.3.Responsiveness Thai luxury shopping malls should give the training to employees about an exact knowledge and information in communicating with customers to create a good responsiveness. Therefore, always up to date and information should be more concerned for employees in Thai luxury shopping malls. Employees of Thai luxury shopping malls are always willing to help the customers requests and it becomes an advantage for Thai luxury shopping malls in creating the good perception towards customers’s eyes.4.Assurance Thai luxury shopping malls have more confident of employees behaviour in creating the personal image to customers. Therefore, Thai luxury shopping malls should keep and continue to build the confident behaviour of employees to create more customers’s guaranty. Thai luxury shopping malls should give a development and training about the product knowledges and important information to employees in order to give the correct information to customers. At least, Thai luxury shopping malls should provide a supervisor or concierge who can deal with customers very well to help in an accidental case.



I42

5.Empathy Thai luxury shopping mall has employees who take a good care of customers for personal attention at the best level in term of empathy aspects. Besides, this shows the feedback of customers whether they like kind of personal attention, so employees in Thai luxury shopping malls need to attend them to motivate their purchase and show the sympathy. Thai luxury shopping malls should improve and give employees a skill about how to understand the specific needs of customers by let’s get smalltalk with them first and ask them what are you looking for something special. It can help employees to get more easier to reach to customers need and come up with purchasing.

References

Cronin J.J., Steven Jr., Taylor A. (1992): Measuring service quality: A reexamination and extension, Journal of marketing, Vol. 56, July, pp. 55-68.

Buttle F. (1996): SERVQUAL: review, critique, research agenda, European journal of marketing, Vo. 30, No. 1, pp. 8-32.

Parasuraman A., Zeithaml V.A., Berry L.L. (1991): Refinement and reassessment of the SERVQUAL scale, Journal of retailing, Vol. 67, No. 4, pp. 420-450.

Parasuraman A., Zeithaml V.A., Berry L.L. (1994): Alternative scales for measuring service quality: A comparative assessment based on psychometric criteria, Journal of retailing, Vol. 70, No. 3, pp. 201-230.

Lee H, Lee Y, Yoo D. (2000): The determinants of perceived service quality and its relations with satisfaction, Journal of services marketing, Vol. 14, No. 3, pp. 217-231.

Kulašin Dž, Horvat J. (2004): Using the SERVQUAL for the customer satisfaction measurement process in Tecnical high school Bugojno,

Proceeding of 8th "

TMT 2004", 15-19.September, 2004, Neum, BiH.

Oliver R.I (1980): A cognitive model of the antecedents and consequences of satisfaction decisions, Journal of marketing research, Vol. 17. November, pp. 460-9.



I43

Department of Tourism, Ministry of Tourism and Sports, “Statistic of international tourism in Bangkok,” 2012, Available: http://www.tourism.go.th .

D. George and P. Mallery, “SPSS for windows step by step: A simple guide and reference,” Boston: Allyn & Bacon, 11.0 update, 4th ed. 2003.

Boulding, W. (1993), “A dynamic process model of service quality: from expectations to behavioural intentions”, Journal of Marketing Research, Vol. 30, February, pp. 7-27.

Baker, D.A. (2000), “Quality, satisfaction and behavioral intentions”, Annals of Tourism Research Vol. 27 No. 3, pp. 785-804.



I44

Title: Service provider’s perception of Chinese tourist behavior

Author: Miss Manassavee Jarurojpakorn and Keatkhamjorn Meekanon, Pd. D.

Program: International Business Management Institute: Silpakorn University International

College

Abstract

The purpose of this study is to approach service provider’s perception of Chinese

tourist behavior while increase the number of Chinese tourist travel abroad particularly in

Thailand. It is superior to understand service provider’s perception because perception and

attitudes of the service provider may influence their behavior in serving customers. This

study conducted an interview with 10 respondents which is service provider in different

career path for diverse of opinions and experiences. Result shows that most respondent have

neutrally to positive perception to Chinese tourist because Chinese tourist ameliorates

economic and financial benefits. However, respondent share experience and perception

toward Chinese tourist and defined that is personal behavior not every Chinese tourist have

bad manner. It is recommended that cross-cultural training and communication, such as basic

Chinese language, would be helpful for service provider.

Keywords: Service provider’s perception; Chinese tourist; Chinese tourist behavior

Introduction

Background

China recently became the largest economy and powerful country of the world.

Growing of economic and population make Chinese become well-being and better quality of

live. Website of Worldometers informs that the current population of China is 1,386,297,614

based on the latest United Nations estimates (www.worldometers.info, March 4, 2017). China

growing by leaps and bounds from the past, notice from high speed train, technology and

innovation, growth of building and structure, etc.

Today China is the biggest tourism in the world and The United Nations World

Tourism Organization (UNWTO) announced that the Chinese overtook Americans and

Germans as the world's top-spending tourists in 2013. In 2012, China is number one on top

international tourism spender amount at US 102 billion (edition.cnn.com, April 12, 2013).



I45

http://www.worldometers.info/

Chinese tourist travel around the world mostly in Asian, European and American cities

respectively (Market Research Report on Chinese Outbound Tourist (City) Consumption,

2015). Purpose to travel in each country are different so behavior of Chinese tourist will be

different. China's economy has grown so international travel has become more common.

Many Chinese were new travelers and Chinese tourists consider travel as an important, it is

indicate quality of life and well-being.

For Chinese tourist, travel in Thailand more easier because Chinese passport may

apply for visa on arrival period of stay 15 days so this can increase number of Chinese tourist

(www.consolar.go.th, May 25, 2016). Thailand becomes one of popular destination for tourist

including Chinese traveler because of low cost of living, a variety of attraction, smile of Thai

people, etc. and travel becomes a major economic factor of Thailand. Thailand business news

release that from January to July 2016, Chinese visit to Thailand totaled 5,764,839, or a year-

on-year increase of 20.54 percent (www.thailand-business-news.com, September 12, 2016).

From north to south of Thailand especially tourist attraction are crowded with Chinese tourist

which is include group tour and individual tourist, this is interesting of difference Chinese

behavior between group tour and individual tourist.

According to increase of Chinese tourist the effects that come with Chinese tourist

behavior are renowned and Thailand also gets this effects. The media disseminate a variety of

Chinese tourist manner and different of demographic such as age, education level, gender,

etc. have influence to manner. There are many manners recognize from Chinese tourist but

not perception from service provider that contact with Chinese tourist directly so it is

interesting to study about service provider attitude to Chinese tourist.

Statement of problem

Increase numbers of Chinese tourist in Thailand affect to local in term of uncivilized

behavior in some group of people that the social focus on and different type of Chinese

tourist lead to several tourist behaviors. Service providers, who have to deal with several of

culture and communication problem, are the important person that organizations need to

understand their attitude to Chinese tourist behavior.

In each country have face with different problem from Chinese tourist such as number

of Chinese tourist in 2016 drop by more than 12% in the last quarter because Thai

government suppress zero dollar tour which is oversea control entire supply chain



I46

http://www.thailand-business-news.com/

(www.channelnewsasia.com, 28 Dec 2016), tour agencies use unlicensed guide for Chinese

tourist and another problem is Chinese tourist manner that service provider have directly face.

The different of Chinese tourist behavior that come with group tour and individual are affect

the local people especially attitude of service provider that directly communicate and deal

with the tourist. The problem found in service provider attitude to Chinese tourist behavior

that may affect with operation how Chinese tourist behavior affecting service provider

attitude. The existing studies about Chinese outbound tourist generally focus on travel

behavior of Chinese so the important cannot ignore and attention should be paid to attitude of

service provider to Chinese tourist behavior to understand how service provider have

viewpoint to Chinese tourist.

Significant of study

Nowadays Chinese tourist is the center of public attention because the tourism

countries have to grapple with tourist behavior problems. Many of problems in each area that

can found from media and comment form local mean to some group of Chinese tourist.

Chinese tourist behaviors become affecting to local people including service provider so

service provider attitude to Chinese tourist behavior is the important that organization should

concern to and studies have provided some useful information for understanding Chinese

outbound tourist.

The finding of this study will redound to the benefit of organization considering that

attitude of service provider to Chinese tourist. Organization that has main Chinese as

customer including hotels and stores may use the result of factor affecting employee attitude

for introduce employee. It is necessary to understand service provider attitude, the feeling on

behaved tourist and customer behavior, this is an important with work flow and operation.

More understand of employee are beneficial for organization using in training or adjust

employee attitude because organization cannot change customer behavior.

Literature review

Necessary to accept that Chinese tourist boost local tourism and the economy around the

world. Mohsin’s (2007) and Pan & Laws (2001) analyze that Chinese tourist increasing their

interested in tourism for knowledge by discovering new places and ideas. Local and foreigner

relationship are tenuous, it will take time for attitude to change although some group of

people do wrong. Chinese tourists are relatively lack of travel experienced so problems those



I47

http://www.channelnewsasia.com/

come with Chinese tourist is language barrier and local culture knowledge, its generate

widespread complaint about Chinese outbound tourist have hurt image of China (Seng Ooi,

2007). Not only Chinese that has this problem when become a new tourist but also happen

with American and Japanese were also criticized of their behavior when they became wealthy

enough and traveled abroad for the first time (Li, 2016; 2baht.com, March 21, 2016). Many

organizations respond the boom of Chinese tourist by employ the employee who has potential

speak Mandarin to communicate with them such as The Ritz Paris has a Chinese concierge,

Shangri-La and the Peninsula have restaurants serving Chinese breakfast, luxury store in

Paris have Chinese speaking staff (Cripps, 2013).

Factor that affect attitude of service provider to Chinese tourist behavior

Attitude of service provider generate from many factor which is positive or negative also

effect with operation. From the Cripps (2013) report that Chinese tourist often say that

service provider treat them like second class people even they spend a lot of money, service

provider do not treat the same way as westerner, this mean service provider face the

challenge of make Chinese tourist feel welcoming and Chinese tourist always discussing and

sharing their experiences on social media. Yeung and Leung (2007) said the perception and

attitudes of the service provider may influence their operate in serving customers so their

study investigated the perception and attitude of Hong Kong hotel guest-contact employees

toward Mainland Chinese tourists and the result expose that most of the hotel guest-contact

employees feel negatively with Mainland Chinese tourists to their appearance, personalities,

and behavior and positively perception in part of economic and financial they bring to Hong

Kong.

1. Chinese tourist ignorance of local rules

Manager Online reveal that Chinese tourists are new travelers on international stage so

they have lack of knowledge in part of culture, international law and regulation. Sometime

they do not realize that are not appropriate, they just do familiarity like home although

Chinese tourist have better manner but still have negative image (www.manager.co.th,

February 24, 2017) and from Chetanont (2015) also talk about Chinese tourism behavior that

tourist did not obey laws nor follow rules and regulations of visiting places, lack of

consciousness and tourism disciplines and disregard of local customs or visiting places. That

is consistent with Li (2014) which is disregard for customs and local rules created increase

tensions between Chinese tourist and host.



I48

http://www.manager.co.th/

2. Uncivilized behavior

A lot of Chinese tourist is visiting major tourist attractions abroad, but their manners have

not leave a good impression of people from the destination, some Chinese tourists abroad is

inappropriate and embarrassed (Qian, 2006). China has launched a campaign to educate

Chinese outbound tourists to control the tourists that damage the image of china. The

complaints about uncivilized behavior found in many international media report and many

destination service providers such as Chinese tourists clear their throats loudly, littering,

spitting, smoke in public places, how they remove their shoes aboard planes and trains and

how they jump queues, taking off shoes and socks in public, speaking loudly, bad temper and

cursing, etc. (Seng Ooi, 2007, Agrusa et al, 2011). The other examples come from 15-year-

old Chinese tourist destroy a stone sculpture in a 3,500-year-old Egyptian temple with

graffiti, this generate many Chinese shame and embarrassment on them (Li, 2014).

3. Stinginess

Chinese traveler is a biggest spender as the world's top-spending tourists in 2013 that the

Chinese spent US$128.6 billion on international travel (www.scmp.com, December 31,

2014). But the other side Guide Linda Li shares her experience that some Chinese tourists

were on their first over sea trip reject to pay 0.7 euro for toilet and pee in public even though

they spent a thousand of euros on a watch (Li, 2014). Verot (2016) written on Chinahush

about top 10 Chinese tourists’ bad behaviors, one of that stories are talking about Chinese

tourist women who own $160,000 of luxury products have to pay a fee which is normal US

regulation but Chinese tourist women did not want to pay the fee so she offered a strange

service for undeclared products to the US customs official but US customs official did not

take that and decided to report her (www.chinahush.com, June 25, 2016). Chinese tourist are

not all about spend money in some case Chinese tourist are consider cheap like they do not

tip in restaurant and hotel because in China are lack of tipping culture and they not aware of

culture different when visit other country (InternshipChina, July 15, 2016).

4. Arrogance

Mainland Chinese are fond of shopping; they love all luxury brand and also enjoy the

local product such as luxury bags and products are particular fashionable from Europe,

Australia wool, Gold & Silver Hong Kong, fabrications crocodile skin Thailand, etc.

(Nasolomampionona, 2014) that why Chinese are the biggest international spender and WP



I49

http://www.scmp.com/

http://www.chinahush.com/

(2017) said that new Chinese generation, who prefers own trip or free and independent

traveler (FIT) more than join group tour, are high purchasing power group. InternshipChina

said that Chinese tourist just travelling to buy and show off luxury goods more than explore

historical and learn culture of destination country, they not concern about what they buy but

just concern that famous brand name or not (InternshipChina, July 15, 2016).

Objectives

1. To examine the attitude of service provider to Chinese tourist how service provider

have viewpoint to Chinese tourist behavior

2. To gain an understanding of Chinese tourist behavior and identified which factor that

affect employee attitude

3. The result may useful in human resources or manager for more understand service

provider attitude to Chinese tourist


This research conducted to describe the perception of service provider to Chinese

tourist behavior when travel in Thailand and understand the attitude of service provider. It is

interesting that the perception and attitudes of service provider may influence their behavior

in provide service to customers or not. The methodology in this research use to explored the

relationship between service provider and Chinese tourist.

Research Design

This research designed to get in-depth information from service provider who is

guest-contact employees for get to know attitude of them. The qualitative research is the

proper way to get the information of service provider attitude for interpret and better

understand the reality of a given situation and give experience. The study designed to collect

information from service provider or guest-contact employee’s attitude and respondent

should be a person who provides service to Chinese tourist or have an experience with

Chinese tourist.

Data collection method

The process of collect information of service provider by interview help researcher

receives depth information. In-depth interview can get unexpected answer from respondent’s

experience so the research will get more interesting process to next research.



I50

The question that use in this research will cover all factor that concern with attitude of

service provider to Chinese tourist and focus on how service provider have attitude to

Chinese tourist. To avoid ambiguity in the questions, this research require pre-interview for

avoid respondent ignore because too much question and unclear question. This research will

be use total 17 questions divided to 4-5 questions per factor and take around 20 minutes per

person. The method to collect information during interview is record by using paper,

notebook or voice recorder if respondent not allow all the equipment, interviewer have to

remember as much as possible and back to record within 24 hours for protect information

lost.

Population and sample characteristic

The population for the study is service provider work in Bangkok. The characteristic

of respondents need to communication and provide service to Chinese customer directly. This

research has interview 10 respondents who are service provider that has experience with

Chinese tourist for collect information. The selection of population mostly in hospitality

industry because Chinese tourist stay overnight at hotel and employee will face problem more

than other section especially front office and some respondent are not in hospitality industry

but will be guest-contact employees such as cabin crew and shopper assistance in luxury

shop. Difference work section of respondent, the research will get variety attitude of service

provider to Chinese outbound tourist.

Result/ Conclusion

After collect data from 10 respondents who work as service provider, finding from

interview show that most of respondent understand the nature of Chinese tourist and have

service mind as a service provider could do. Chinese tourist is main driver tourism economic

in Thailand so besides Chinese tourist adapt themselves to be international addition service

provider also get ready with Chinese tourist. To conclude finding from respondent,

categorized in each factor as following are easier to understand;

Ignorance of local rules

Each respondent have difference experience with Chinese tourist that ignorance of

local rules and violence of problem depend on situation. Most of the respondents cannot

accept who ignore the local rules because everybody should respect rules of visiting place but

some of respondent can accept in case of not too terrible. Every workplace of respondent has



I51

rule to handle tourist who ignore the local rule so this may alleviate problem. Feeling of

respondent to Chinese tourist who ignore local rules are displeased and quite boring but

accustomed because they are customer. Base on respondents’ information, problem of

Chinese tourist ignorance of local rules can categorize in 3 parts;

1. Communication with Chinese tourist; Some of Chinese tourist will follow the rules

when they know so communication can reduce ignore local rules problem.

2. Personal behavior; Some of Chinese tourists understand everything but still ignore the

rules so it is personal behavior that difficult to fix and how much they respect the

local rules.

3. Acknowledgment local rule of Chinese tourist before travel; information from guide

or tour leader help Chinese tourist to understand the local rules.

Uncivilized behavior

Most of respondents think that some of Chinese tourist has uncivilized behavior but

cannot judge which generation are good or bad because every generation have good and bad

manner it depend on how much they can adapt themselves to international, culture and

personal behavior. From all respondent, they can accept uncivilized behavior of Chinese

tourist in some case that not affect surround people and some of respondent cannot accept

that uncivilized behavior because they feel misbehave and if one person does uncivilized

behavior, another will follow. Base on respondents’ information, to conclude uncivilized

behavior of Chinese tourist come from main 2 factors below;

1. Culture and personal behavior; their culture and behavior in daily life are difference

from Thai and the habits of doing thing in their own country so it may improper when

do the same thing in Thailand.

2. Lack of destination country knowledge; educate tourist by guide or tour leader before

travelling such as do/do not thing, culture, traditional and characteristic of destination

country, important is communication properly may reduce problems.

Stinginess

Stringiness mean in this factor is do not want to waste with something that should to

waste and opinion of each respondent are difference. Some do not have experience with

stringy Chinese tourist and most of respondent think that Chinese tourist are stingy but lesser

part and it is personal behavior. Opinion of respondent to stinginess of Chinese tourist is



I52

various such as Respondent X said that is normal because everybody wants to get highest

benefit and Respondent IV said that it is personal behavior. Most of respondent said that

some stinginess behavior affect work that it waste time to explain, answer the same question

and if tourist did not pay fine, employee have to pay instead. Base on respondents’

information, to conclude stinginess behavior of Chinese tourist come from personal behavior

so communications to Chinese tourist understand reason.

Arrogance

This factor not found from hospitality employee respondent because Respondent V

provide the information that amount of money that Chinese tourist spend for hotel not too

high when compare with luxury shop which is Respondent VI, who work in luxury shop, said

that they have higher confident than the past so it seem like they have arrogance personality

which same opinion with Respondent VIII. So arrogance are depend on personal behavior not

every Chinese tourist are arrogance and it is not affect with operation because does not make

anyone suffer and service mind need to have in service provider so service provider need to

do is patient, these are information by all respondent.

Discussion

Discussion from previous research and respondent found that;

Communication barrier

Seng Ooi (2007) mention that Chinese tourists are relatively lack of travel

experienced so problems those come with Chinese tourist is language barrier also same

opinion with Respondent II that Chinese tourist ignorance of local rule because Chinese

tourist has communication barriers and Respondent V said that everything depend on

communication but problems is number of who can speak Chinese less than Chinese tourist

so when they do wrong, nobody provide suggestion in their language. Nasolomampionona

(2014) told that mostly Chinese tourist prefers to rely on travel agent not only for the

convenience and travel agent also help untie cultural difference, language barrier.

Lack of destination country knowledge

Zhou (2017) found that it is necessary to educate good manner to people start from

young age and Respondent IV found in same thing that Chinese tourist do not have much

experience traveling oversea and destination country knowledge so they do not realize their



I53

behavior not suitable in host country culture because some act they do the same way at home.

Respondent V and Seng Ooi (2007) have same opinion that Chinese tourist do not have

destination country knowledge such as culture and traditional, it is generate widespread

complaint about Chinese outbound tourist have hurt image of China. Most of respondent have

same opinion with 2baht.com describe that not all of Chinese tourist have uncivilized

manner, it is only some group of people especially group tour that different from new

Chinese tourist who are better educate so uncivilized manner from package tourist may

because of they do not know destination culture which is similarly with Chetanont (2015)

said that well-educated Chinese tourists would not be as rude as the lower-educated and

disregard of local customs or visiting Places.

Respondent III said that some of Chinese tourist try to adapt themselves to be

international which is match with Zhou (2017) report in Chinese tourists’ manner improving

that Indonesia, France, Singapore, United Kingdom and the United States have positive reply

on Chinese tourists behavior. And Respondent VIII adds that they should improve and adapt

themselves to be international for change perception from other country.

Service provider’s perception

From Yeung and Leung (2007) report the perception and attitudes of the service

provider may influence their operate in serving customers so their study investigated the

perception and attitude of Hong Kong hotel guest-contact employees toward Mainland

Chinese tourists and the result expose that most of the hotel guest-contact employees feel

negatively with Mainland Chinese tourists to their appearance, personalities, and behavior

and positively perception in part of economic and financial they bring to Hong Kong.

Respondent V also unwilling with uncivilized behavior of Chinese tourist because tourism

industry can survives because of them.

Chetanont (2015) talk about Chinese tourism behavior that tourist did not obey laws

nor follow rules and regulations of visiting places, lack of consciousness and tourism

disciplines and disregard of local customs or visiting places. That is consistent with Li (2014)

which is disregard for customs and local rules created increase tensions between Chinese

tourist and host. From Most of the respondent cannot accept for who ignore the local rules

because everybody should respect rules of visiting place but some of respondent can accept in

case of not too terrible and feeling of respondent to Chinese tourist who ignore local rules are

displeased and quite boring but accustomed because they are customer. Respondent II said



I54

that when traveling, tourist supposed to follow the rules strictly according to Respondent X

said that if not ready to respect the destination rules, they should travel inland and displeased

feeling can affect service quality are support by Respondent VIII.

Educate tourist by guide or tour leader before travelling such as do/do not thing,

culture, traditional and characteristic of destination country, important is communication

properly may reduce problems (Respondent II and V) and China has launched a campaign to

educate Chinese outbound tourists to control the tourists that damage the image of china. The

complaints about uncivilized behavior found in many international media report and many

destination service providers such as Chinese tourists clear their throats loudly, littering,

spitting, smoke in public places, how they remove their shoes aboard planes and trains and

how they jump queues, taking off shoes and socks in public, speaking loudly, bad temper and

cursing, etc. (Seng Ooi, 2007, Agrusa et al, 2011).

Recommendation

From interview and data analyzed help researcher more understand service provider

perception and realized a recommendation for organization especially training department

and manager. Understand service provider’s perception could be beneficial for training part

and manager, this may help smoothly operation and help service provider realize with

appearance and behavior of Chinese customer, this may help smoothly operation. Understand

service provider and training in right way help organization create service quality from

employee.

Based on information from service provider interview, because service provider

cannot change Chinese tourist behavior so can conclude for training part and manager that

recommendation for service provider as following;

To improve in perception of good relationship with people from different culture,

First service providers require to understand basic characteristic of Chinese is essential, it is

greater understanding of other culture because different of culture affect social practice so

this produce conflict between service provider and Chinese tourist. Service provider generally

recognized base behavior of Chinese tourist for additional cross-cultural training such as play

role help service provider in increasing their ability to be more tolerant of other people's

behavior.



I55

To understand Chinese tourist requirement and build good relationship, Second

communication is the most important and now Chinese language require as third language

which is increase ability to solve problem and decrease misunderstanding. Communication

can reduces misunderstand between service provider and Chinese tourist so learn Chinese

language are necessary. Now a day some organization require employee need to be speak at

least basic Chinese such as hospitality industry, airline, mid-town department store, etc. In

hospitality industry, some hotels have Chinese class for their employee and teach about

vocabulary and conversations in daily operate.

References

Agrusa, J. (2011). Mainland Chinese tourists a logical target for Hawaii. Retrieved from

http://www.eturbonews.com/21239/mainland-chinese-tourists-logical-target-hawaii

China Population (LIVE). Retrieved from http://www.worldometers.info/world-

population/china-population/

Chetanont, S. (2015). Chinese Tourists’s Behaviors towards Travel and Shopping in

Bangkok. International Journal of Social, Behavioral, Educational, Economic, Business and

Industrial Engineering, 9(5), 1676-1681.

Cripps, K. (2013). Chinese tourism: The good, the bad and the backlash. Retrieved from

http://edition.cnn.com/2013/04/09/travel/chinese-tourism-impact/index.html?hpt=hp_mid

Cripps, K. (2013). Chinese travelers the world's biggest spenders. Retrieved from

http://edition.cnn.com/2013/04/05/travel/china-tourists-spend/

Dam-young, H. (2016). South Korean airport battles garbage dumped by Chinese tourists.

Retrieved from http://www.scmp.com/news/asia/east-asia/article/2042994/south-korean-

airport-battles-garbage-dumped-chinese-tourists

Dung, B. (2016). Chinese arrivals reach record numbers in Thailand. Retrieved from

https://www.thailand-business-news.com/tourism/54229-chinese-arrivals-reach-record-

numbers-thailand.html

Interships China. (2016, July 15). Badly Behaved Tourists and the Implications for China.

Retrieved from http://internshipschina.com/what-chinese-tourists-do-for-china/



I56

Ipsos (2015), Market Research Report on Chinese Outbound Tourist (City) Consumption

2015. 1-6. Retrieved from https://www.ipsos.com/sites/default/files/2016-06/021.1-Chinese-

Outbound-Tourist.pdf

Jerome, A., Kim, S., & Wang, K. (2011). MAINLAND CHINESE TOURISTS TO HAWAII:

THEIR CHARACTERISTICS AND PREFERENCES. Journal of Travel & Tourism

Marketing, 28, 261–278. doi: 10.1080/10548408.2011.562853

Li, A. (2014). Rude awakening: Chinese tourists have the money, but not the manners.

Retrieved from http://www.scmp.com/news/china/article/1671504/rude-awakening-chinese-

tourists-have-means-not-manners

Li, A. (2016). Why are Chinese tourists so rude? A few insights. Retrieved from

http://www.scmp.com/news/china/article/1251239/why-are-chinese-tourists-so-

rude#U2YO7Iup0wqZ0QiQ.99

MGR online (2013). จนใชกฎหมายยกระดบการทองเทยว แกไขพฤตกรรมนกทองเทยว. Retrieved from

http://www.manager.co.th/China/ViewNews.aspx?NewsID=9560000127768

MGR online (2017). ผลส ารวจช พฤตกรรมนกทองเทยวจนดขน แมภาพลกษณยงตดลบ. Retrieved from

http://www.manager.co.th/china/ViewNews.aspx?NewsID=9600000019101

Mohsin, A. (2007). Analysis of Chinese travellers’ attitudes toward holidaying in New

Zealand: The impact of socio-demographic variables. Journal of Hospitality & Leisure

Marketing, 16(1–2), 21–40.

My2baht (2016). พฤตกรรมนกทองเทยวจน ท าไมถงท าตวแยสรางความวนวายไปทวโลก. Retrieved from

https://2baht.com/chinese-tourists-behavior/

Nasolomampionona, R. F. (2014). Profile of Chinese Outbound Tourists: Characteristics and

Expenditures. American Journal of Tourism Management, 3(1), 17-31. doi:

10.5923/j.tourism.20140301.03

Nation TV (2014, December 13). หนมสาวจนปวนแอรเอเชย หลงไมไดทนงตดกน. Retrieved from

http://www.nationtv.tv/main/content/social/378436431/



I57

Pan, G. W., & Laws, E. (2001). Tourism marketing opportunities for Australia in China.

Journal of Vacation Marketing, 8(1), 39–48.

Qian, L. (2006). Chinese tourists expected good-mannered. Retrieved from

http://www.chinadaily.com.cn/china/2006-08/22/content_671181.htm

Seng-Ooi, C. (2007). Chinese Tourists in Denmark, 1-19. Retrieved from

https://www.researchgate.net/publication/238075834_Chinese_Tourists_in_Denmark

Tataski, M. (2017). The good, the bad and the ugly of Chinese tourists in Vietnam. Retrieved

from http://www.scmp.com/week-asia/society/article/2058279/good-bad-and-ugly-chinese-

tourists-vietnam#mzEkXTyIjrrfCH4q.99

Verot, O. (2016). Top 10 Chinese tourists’ bad behaviors. Retrieved from

http://www.chinahush.com/2016/06/25/top-10-chinese-tourist-bad-behaviors/

Wang, J. (2014). Mixed Feelings about Chinese Tourists. China Today, 62-63.

WP. (2017). เจาะลกทกมม “นกทองเทยวจนสไตล FIT” โอกาสมหาศาลของ “แบรนดไทย” ทไมควรมองขาม!!.

Retrieved from https://www.brandbuffet.in.th/2017/05/chinese-tourist-trends-and-

opportunities-for-thai-brand/

Yeung, S., & Leung C. (2007). Perception and attitude of Hong Kong hotel guest‐contact

employees towards tourists from Mainland China. International Journal of Tourism Research,

9(6), 395-407.

Zhou, S. (2017). Chinese tourists' manners improving. Retrieved from

http://usa.chinadaily.com.cn/epaper/2017-02/23/content_28320647.htm



I58

The Development of a Social Media Experience-Based Instructional System

in Information Technology Course for the Lower Secondary Students

in Bangkok Metropolis and Surrounding Area

Author :

Rachata Dachathornvorapol1

Associate Professor Dr.Wasana Taweekulasup2

Associate Professor Dr.Sansanee Sungsunanun3

Associate Professor Dr.Thanit Poosiri4

1Educational Doctoral Program, Department of Educational Technology and Communications,

Sukhothai Thammathirat Open University, Thailand. e-mail: [email protected] 2,3,4

Department of Educational Technology and Communications, Sukhothai Thammathirat Open

University, Thailand

Abstract

The objectives of this research were (1) to develop a Social Media Experience-Based

Instructional System in Information Technology Course (SMEBA-IT) for the Lower Secondary

Students in Bangkok Metropolis and Surrounding Area; (2) to evaluate the try-out results of the

developed SMEBA-IT.

The research process comprised two stages. The first stage was the development of the

SMEBA-IT which consisted of the following steps: the first step was the study of documents,

texts, and related research studies; the second step was the study of the needs for SMEBA-IT; the

third step was the development of conceptual framework of the SMEBA-IT; the fourth step was

the interviews of experts concerning the conceptual framework of the system; the fifth step was

the system development based on conceptual framework as certified by the experts; the sixth step

was quality evaluation of the drafted version of the SMEBA-IT; and the seventh step was the

improvement of the first drafted system to system to obtain the complete version system for try-

out. The research sample consisted of 340 teachers and students in secondary schools in

Bangkok Metropolis and surrounding area, classified into 167 teachers and 173 secondary

students in the 2017 academic year, all of which were obtained by multi-stage random sampling;

seven experts for verification of conceptual framework of the system; and five specialists to

evaluate quality of the drafted version of the system. The employed research instruments were

questionnaires on the needs for the SMEBA-IT of teachers and students, an interview structure

for the experts, a system quality evaluation form for the specialists, and the developed SMEBA-

IT. The second stage was the evaluation of the try-out results of the developed SMEBA-IT. It

consisted of the following two activities: (1) the preliminary try-outs to determine efficiency of

the system, which comprised the individual try-out, small group try-out, and field try-out; and (2)

organizing a focus group seminar involving secondary school information technology teachers

concerning the developed SMEBA-IT. The research sample consisted of 40 Mathayomsuksa II

students studying in the academic year 2016, Rattanathibet school and 20 information

technology teachers at the secondary level. The employed research instruments in the second



I59

stage were the developed SMEBA-IT, a learning achievement test, a questionnaire on student’s

satisfaction, and a questionnaire on teacher’s opinions. Research data was analyzed using the

frequency, percentage, E1/E2 efficiency index, t-test, mean, standard deviation, and content

analysis.

Research findings were as follows: (1) the developed SMEBA-IT was composed of the

input components consisting of philosophy, vision, policy, objectives, curriculum and

infrastructure; the process components consisting of Experience-Based Instructional, knowledge

center, social media channel and social media; and the output components consisting of the

evaluation and the following-up of the Experience-Based Instructional; meanwhile, the SMEBA-

IT comprised eight steps: the first step, the defining of ideology; the second step, the developing

of experience-based curriculum; the third step, the developing of experience facing approaches;

the fourth step, the developing of knowledge center; the fifth step, the producing of social media

Experience-Based Instructional; the sixth step, the developing of the infrastructure; the seventh

step, the facing of the experience with social media; and the eight step, the evaluating and

following-up of facing the experience. Then, this developed system was verified by the

specialists as having ‘high’ quality; and (2) regarding the evaluation of try-out results of the

developed SMEBA-IT, it was found that the developed SMEBA-IT was efficient at 79.80/79.13,

thus meeting the 80/80 efficiency criterion; the learning achievement of students who learned

from the SMEBA-IT increased significantly at the .01 level of statistical significance; and the

students were satisfied with SMEBA-IT at the ‘highest’ level; also the teachers’ opinions toward

the system were at the ‘highest’ level too.

Keywords: Systems, Social Media Experience-Based Instructional System, social media, Lower

Secondary

Introduction

The system approach is important for teaching and learning as follows: (1) It is a tool for

planning and teaching, responding the needs of the students; (2) To ensure success in teaching

and solving problems of students learning and teaching of teachers; (3) To follow the identified

teaching and learning process; (4) Teachers can evaluate, monitor, and solve problems in

teaching and learning; and (5) To use as a guideline for the development of teaching and learning

systems (Taweekulasup, 2012, p.6-7). Teachers need to set up teaching systems in each subject

area such as information technology courses. According to, information technology is used in

teaching and learning, using social media. In order to be a learning society, along with the

National Education Plan (2012-2016) and the policy by the Ministry of Education to use

information technology in the primary and the secondary education. Thus, social media is an

important innovation tool used to convey knowledge to learners. (Ministry of Education, 2008, p.

3)



I60

From the importance of system approach, The researcher studied the information and

teaching technology in secondary education and found many problems: (1) The problem of

learning achievement of secondary education students from the ONET test by the National

Institute of Educational Testing Service, (2015) found that the score in IT subject was 45.42%

lower than the criteria; (2) The problem about limitation of skill and expertise, students lack of

the use of information technology knowledge because they lack of the learning process that

emphasizes them to do and focus on learning from knowledge rather than action. (Institute for

the Promotion of Teaching Science and Technology, 2015). In addition to the 21st century

education, it is important for learners to learn from doing, or learn by doing and use of ICT

literacy as much as possible; and (3) The problems of limitations of direct teaching only in the

classroom are not enough, electronic media is required using to encourage interaction and

practicing in virtual situations in the classroom. (Ministry of Information and Communication

Technology, 2015, p.3)

From the above mentioned problems, the researcher studied the concept of Experience-

Based approach which enable the student to practice. The study found that Experience-Based

approach was a teaching method that giving learners obtain the experience and observe what

happened, then bringing things up to think together until the students can create ideas or

assumptions to apply in new situations. (Khamanee, 2011, p.131). And also found that,

Experience-Based approach is the appropriate teaching methodology for information technology

and suitable for using with social media. Professor Chaiyong Bhramawong (2010, p. 8) said that

"Social media experience-based instructional is a study where students can learn by studying at

home or work place instead of having to sit in the classroom, execution an experience in the lab

which will practice in Virtual Labs through an interactive screen (On Screen Interactive-OSI), or

social media rather than allowing students to practice anytime"

It was evidence that Experience-Based approach will enable students to practice their

skills and expertise. In addition, students should learn through social media. The important of the

SMEBA-IT were as follows: (1) Helping teachers to plan and steps with appropriate instruction

to students provided quality teaching and effective teaching; (2) Helping students to understand

more about information technology; and (3) Allowing teachers and students to learn anywhere,

anytime through social media.

Objectives

1) To develop a Social Media Experience-Based Instructional System in Information

Technology Course for the Lower Secondary Students

2) To evaluate a Social Media Experience-Based Instructional System in Information

Technology Course for the Lower Secondary Students



I61


The research process comprised two stages. The first stage was the development of the

SMEBA-IT which consisted of the following steps: the first step was the study of documents,

texts, texts and related research studies; the second step was the study of the needs for SMEBA-

IT; the third step was the development of conceptual framework of the SMEBA-IT; the fourth

step was the interviews of experts concerning the conceptual framework of the system; the fifth

step was the system development based on conceptual framework as certified by the experts; the

sixth step was quality evaluation of the drafted version of the SMEBA-IT; and the seventh step

was the improvement of the first drafted system to system to obtain the complete version system

for try-out; and the second stage was the evaluation of the try-out results of the developed

SMEBA-IT. It consisted of the following two activities: (1) the preliminary try-outs to

determine efficiency of the system, which comprised the individual try-out, small group try-out,

and field try-out; and (2) organizing a focus group seminar involving secondary education

information technology which the teachers concerning the developed SMEBA-IT.

1. Research format: Research and Development (R&D)

2. Population and Sample

Population and Sample comprised two stages, following the research process. The first

stage was the development of the SMEBA-IT comprised three groups: First group for studying

requirements of the SMEBA-IT, the population was 11,339 teachers and 229,248 secondary

school students in Bangkok Metropolitan Area. The sample, totaling 340, consisted of 167

teachers and 173 secondary level students, obtained from the table of Krejcie & Morgan and

multi-stage random sampling technique; Second group for interviewing the conceptual

framework of SMEBA-IT. This study interview seven (7) experts consisting of three (3) experts

on Experience-Based approach, two (2) experts on Information Technology and one (1) expert

on Secondary education school; and third group for evaluating the quality of the developed

SMEBA-IT. The research has five specialists to evaluate quality of the drafted version of the

system; and the second stage was the evaluation of the try-out results of the developed SMEBA-

IT comprised to two groups. The sample was a 30 students Mathayomsuksa II student in

Rattanathibet school in the second semester of academic year 2015; and the second group was

information technology in secondary education conducted the seminar and questioned the

teachers’ opinions about the SMEBA-IT.

3. Research Instruments

Research Instruments comprised two stages, following the research process. The first

stage was the development of the SMEBA-IT, the research instrument were employed: (1) Two

questionnaires to teachers and students about the requirement of the SMEBA-IT for teachers and

Mathhayomsuksa I, II, III students by using five rating scale, multiple choices and open-ended

questions; The reliability of these questionnaires were 0.97 and 0.92 as following; (2) Structured



I62

interview form, used for expert to give opinion on the conceptual framework of the system by

using multiple choice and open-ended questions; (3) Evaluated form of the quality of the

SMEBA-IT by specialists by using five rating scale, and open-ended questions with quality level

of very good, good, moderate, low and lowest; and (4) The SMEBA-IT; and the second stage

was the evaluation of the try-out results of the developed SMEBA-IT consisted of (1) a learning

package of SMEBA-IT developed according with the steps and processes; (2) 20 Pre-test and

post-test were the difficulty value (p) of the pre-test was 0.47-0.83 and the difficulty value (p) of

the post-test was 0.40-0.80 and the discriminative value (r) of the pre-test was 0.28-0.71 and the

post-test was 0.28-0.85. The reliability of the pre-test was 0.78 and the post-test was 0.81; (3)

The student satisfaction questionnaire of five rating scale (highest, high, medium, low, lowest)

and open-ended questions about the using of SMEBA-IT consisted of 5 parts; Part I was the

quality of SMEBA-IT’s content; Part II was the quality of the design of SMEBA-IT; Part III was

the knowledge gained from the SMEBA-IT; Part IV was the benefits of the SMEBA-IT; and Part

V was comments. The reliability of this questionnaire was 0.98; and (4) The teacher

questionnaire of five rating scale (highest, high, medium, low, lowest) and open-ended questions

giving their opinion about SMEBA-IT consisted of 4 parts; Part I was general information of the

respondents; Part II was the opinion on the main steps and sub steps; Part III was the using of the

SMEBA-IT; and Part IV was the comments. The reliability of this questionnaire was 0.95.

4. Data collection

Data collection comprised two stages, following the research process. The first stage was

the development of the SMEBA-IT, the data collection were employed: (1) Via post for

collecting data on questionnaires from teachers and students on SMEBA-IT; (2) Interviewing for

collecting data from experts on conceptual framework of the system; and (3) Collecting for the

system quality evaluation from specialists of the SMEBA-IT; and the second stage of evaluating

the use of SMEBA-IT consisted of (1) trail run on the quality assessment of SMEBA-IT with

Mathayomsuksa II students through three stages; individual testing, group testing, and field

testing to determine the students’ progress on learning achievement obtained from pretest and

posttests; (2) collecting data of students’ satisfaction which learn by using SMEBA-IT; and (3)

collecting data of teachers’ opinion questionnaires about SMEBA-IT.

5. Data Analysis

Data Analysis was conducted through statistical tools comprising frequency, percentage,

efficiency, E1 / E2, t-test, means, standard deviation and content analysis.



I63

Results

1. Results on the development of SMEBA-IT were as follows.

1.1 On the needs of secondary education teachers regarding to the needs of the SMEBA-

IT which had the ‘highest’ level were as follows: (1) To study any time, any place to meet the

needs, interests and ease of learning; (2) To determine the ideology of the system, focusing on

the student's objectives; (3) To develop an experience-based curriculum, studying the nature of

the learners; (4) To develop a facing experience plan by identifying the format of experience; (5)

To develop a knowledge center; (6) to produce social media for social media experience; (7) To

develop an infrastructure by developing a networking; (8) to face the experience by doing a post-

test after facing experience; and (9) to evaluate and follow up the result of experience facing by

doing a trail-run testing SMEBA-IT’s learning package.

1.2 On the needs of secondary school students regarding to the needs of the SMEBA-IT

which had the ‘highest’ level were as follows: (1) The reason that students wanted to study in

SMEBA-IT because they could learn in many ways for example; Teacher Directed Learning,

Self Directed Learning and Peer Directed Learning; (2) To require orientation through social

media learning; (3) to require knowledge centers that contain text, images, animation and

narrative, and (4) to require a Facebook as a social media tools in the SMEBA-IT.

1.3 On the experts’ comment on conceptual framework of the SMEBA-IT were as

follows: (1) They agreed with all components consisting of inputs processes and outputs which is

appropriated and practical; and (2) They agreed with overall steps and sub-steps which

associated with main steps completely and practically to be implemented further.

1.4 On the specialists’ evaluation of the quality assessment on the draft of SMEBA-IT.

Overall, the specialist evaluated the quality of system at ‘good’ level.

1.5 On the development of SMEBA-IT was found that (1) The SMEBA-IT components

comprised of the components of inputs consisting of philosophy, vision, policy, objectives,

curriculum and infrastructure; the process components consisting of Experience-Based

Instructional, knowledge center, social media channel and social media; and the output

components consisting of the evaluation and the following up of experiences; (2) the SMEBA-IT

comprised eight steps: the first step, the defining of ideology; the second step, the developing of

experience based curriculum; the third step, the developing of experience facing approaches; the

fourth step, the developing of knowledge center; the fifth step, the producing of social media

Experience-Based Instructional; the sixth step, the developing of the infrastructure; the seventh

step, the facing the experience with social media; and the eight step, the evaluating and

following-up of facing the experience as Figure 1.



I64

Figure 1 A model of the SMEBA-IT

2. Results on the evaluation of the SMEBA-IT

2.1 On the efficiency of the SMEBA-IT:

From the Trial Run of SMEBA-IT was conducted under ‘Data Communication’

subject. It was found that (1) The Efficiency of Process (E1) and the Efficiency of Product (E2)

of this subject obtained the E1/E2 values of 79.80/79.13; (2) The students’ learning achievement

was significantly increased at the .01 level, and (3) the satisfaction of the students towards the

SMEBA-IT was at the ‘Highest’ level as follows: (1) The content perspective, students satisfied

that ‘Facebook’ which offered students better understanding of content; (2) The design

perspective, students satisfied to have an interaction by using ‘Lines’; (3) The knowledge

perspective, students were enabled to practice by bringing their existing experiences intergrated

with new experiences enabling they understand more; and (4) The practicle of using perspective,

the students could apply the experiences to their daily lives.

2.2 On the quality of the SMEBA-IT for teachers:

After the Trial Run of the SMEBA-IT was conducted by seminar with teachers. It was

found that the satisfaction of the teachers toward the SMEBA-IT was at the ‘Highest’ level

indicating that the SMEBA-IT was useful and practical for teaching in secondary educational

schools.



I65

Discussions

1. The SMEBA-IT was developed by studying the teachers and students’ requirement and

interviewing the experts according to the conceptual framework of the system. Overall the

experts they rated the quality of the SMEBA-IT conceptual Framework at the ‘Good’ level; then

the draft of the system through the evaluation of the quality of the system from specialists at the

‘Good’ level with clearly, completely and practically to use. From the reasons that; Firstly, the

process of developing this system has been verified by twelve (12) experts and specialists

confidently that this system has quality. Secondly, the SMEBA-IT had system components, the

steps of the system were the main steps and sub-steps which had inputs, processes and outputs.

Each of the main steps had a continuous relationship. There were also sub-steps in the main steps

that related to inputs, processes, and outputs supporting each other which is the outstanding point

making the operation of the system more controllable, systematic, simplified. The

implementation of the system could be easily understood which corresponding to the teachers’

opinions in seminars that the system could be applicable, easy to understand because there were

steps sequentially. The summarization from the study was corresponded to the importance of

system approach by Professor Chaiyong Bhramawong (2012) said, "The components and

system steps must be coordinated to support the various parts from collaboration enables the

elements in the process by providing the correct information, enabling them to function as

required" and Thirdly, the main steps of the eight steps: the first step, the defining of ideology;

the second step, the developing of experience based curriculum; were the steps of inputs which

similar to the first step was the identifying philosophy and vision of STOU PLAN (Distance

learning and distance learning process, p.6-7) and the experience-based learning system

(Bhramawong, 2013, p.2-3); moreover, the opinion of the teachers which had ‘highest’ level was

Step II, the developing experience based curriculum because the users were teachers. About the

third step, the developing experience facing approaches; the fourth step, the developing of

knowledge center; the fifth step, the producing of social media Experience-Based Instructional;

the sixth step, the developing of the infrastructure; the seventh step, the facing the experience

with social media were the steps of processes which (1) especially the fourth step, the developing

of knowledge center; the fifth step, the producing of social media Experience-Based

Instructional; the sixth step, the developing the infrastructure were allowed the users to develop

and produce social media themself. The school should develop the network to support the

teaching of information technology which corresponding to the opinion of the teachers which

had ‘highest’ level in step 4, step 5, and step 6 that it was applicable to use and (2) the seventh

step, the facing the experience with social media which was the important step to bring the

students obtaining the experience from the doing assigned task which corresponding to the

learning theory of Knowles (Kaemanee, 2002, pp. 70-74). This principle is shared by learners in

the learning process, helping students learned well with bringing the experience, knowledge,

skills, attitudes, values, and values they used to understand new things and new experiences.

Organizing learning experiences for learners was the opportunity for learners to choose what

they wanted to study and what they wanted to learn by themselves which is corresponding with



I66

the experience-based teaching approached of Professor Chaiyong Bhramwong (2002), pp. 151-

152 said, "Experience-Based Approach is an international instructor system and was a system for

the future that aimed to the students having experiences that can be used to daily live. Therefore,

the experience based approach, it was necessary to have the process of facing the experience.

About the eight step, the evaluating and following-up of facing the experience which was the

output step in order to collect the results to continue to improve the system which is

corresponding with the thirteen step of The overall Evaluation” Briggs' Integrated Teaching

System (Gagne & Briggs, 1979, p.23) and is corresponding with the tenth step of the monitor

and evaluation of context and situation (Bhramawong, Chaiyong, 2013, p.23) and they ninth step

of evaluation in distance learning system. (Distance learning system, pp.4-7)

2. Evaluating the use of SMEBA-IT

From the research revealed that the Mathayomsuksa II students who learned with the

experience-based teaching package through social media ‘Data Communication’ subject. The

students’ learning achievement was significantly increased at the .01 level because SMEBA-IT

was designed by direct experience from the practicing to make students remembered longer,

especially the facing experience which need to completed tasks, students must bring their

existing experience and integrate with new experiences that students had learned from the

Knowledge Center which is the important step. The teacher had to produce social media, which

is the main media of the experience learning package by using Facebook, Lines and Youtube as a

main social media designed to be easy to access; grouping and interacting with friends to work

together. The assignment through social media bringing the students understanding the content

better from the completing assignments students got score 80%, resulting in post test scores was

higher than pretest.

From the students’ satisfaction. Students are satisfied towards the SMEBA-IT was at the

‘Highest’ level of working as a group because mostly Mathayomsuksa II had own smart phone.

They could select thier group to work with, create surveys and models. From the ‘high’ level of

statisfaction was the principle in learning because most of the tasks and assignment designed for

students are Peer Directed Learning (PDL), less in Self Directed Learning (SDL) because there

was an education only in the knowledge center.

Recommendations

1. Recommendations for Application of the Research Findings

1) Preparing for the network and the broadcasting of Social Media Experience-Based

Instructional Package for learning from schools and testing the networking before facing the

experiences making the experience of the students more faster and more convenient.

2) Preparing the tools and communication devices of smart phones for both student and

school effectively.



I67

3) Preparing for the development of the knowledge center, teachers must gather relevant

content, bringing to the experience, analyze and categorize content. Due to the student had to

face the major and minor experiences, also doing the tasks and assignments as assigned from the

teacher.

4) Implementing the SMEBA-IT for Mathayomsuksa II students, the researcher educated

school management, administrators, teachers, staff members about processes, steps and applied

experience learning package through social media. Moreover, interaction with students in order

to clearly communication.

5) The SMEBA-IT was direct instructional by unit; therefore, Social Media Experience-

Based Instructional Package ‘Data Communication’ subject also directly as a unit instruction.

2. Recommendations for Further Research

1) Research should be done by researching and developing an Experience-Based

Approach to enhance student learning principles.

References

Bhramawong, Chaiyong (2012). Unit I: Systems and Systems Approach in Education, Systems

Approach in Education. Nontaburi: STOU Press.

Bhramawong, Chaiyong (2013). Distance Learning and Distance Learning Process. Nontaburi:

STOU Press.

Gayne R.M & Briggs. (1979). Principles of instructional design, New York: Halt Rinehart and

Winston.

Ministry of Education [MOE] (2008). The Basic Education Core Curriculum B.E. 2551 (A.D. \

2008).

National Institute of Educational Testing (2015). Learning Area of Information Technology.

Bangkok: Kurusapa Printing.

Thissana Khamanee (2011). The science of teaching knowledge for effective learning process.

Bangkok: Chulalongkorn Printing.

Wasana Taweekulasup (2012). Unit II System and System Approach in Education. Nontaburi:

STOU Press.



I68

A Short Survey for Thai Teenager’s Attitudes towards Game-Play Learning

Author: Thanakorn Uiphanit, Kwanrat Suanpong, Pattarasinee Bhattarakosol

Program Technopreneurship and Innovation Management Program. Institute Graduate School,

Chulalongkorn University

Program Department of Commerce Institute Chulalongkorn Business School, Chulalongkorn

University

Program Department of Mathematics and Computer Science Institute Faculty of Science,

Chulalongkorn University

Abstract

Computer game has been applied to the learning system for a decade. However, there are

researches point out that using games cause negative impacts more than positive impacts.

Nevertheless, these studies have been processed in various countries except Thailand. Thus, in

this research, the investigation on game-play in Thai teenagers is survey using questionnaire.

Samples of 1017 students in a university are randomly selected. The results uncover that Thai

teenagers like playing the action game. Although Thai teenagers love playing game, they hardly

play for long times but play often. As a consequence, the negative impact in their point of view

do not exist.

Keywords: Game Genres, Undergraduate Students, Computer games, Behavior

Introduction

Computer games industry is the fastest growing in the entertainment industry because

computer games can be found everywhere, any places, with any types of devices. Recently, most

people in all ages are playing games as their hobby. This can be confirmed in (Entertainment

Software Association, 2017) that the best-selling game genres in U.S. was the strategy game with

36.4% from all responders. The second and third orders are the casual game and the role-playing

game, with 25.8% and 18.7% respectively. For the other types of games, such as shooting,

adventure, action, compilations, flight, racing, sport and arcade games have the playing rate less

than 10%. Based on types of games, different games provide different concepts and experiences

for players (Gose, 2014; Gros, 2007).

Consider the situation of the game industry in Thailand; Software Industry Promotion

Agency(SIPA) (Digital Economy Promotion Agency, 2016) informed that in the year 2015, the

growth rate of the Thai digital content industries reached 12,745 million Baht, which grew by

12.4% from the previous year. Since the digital content can be classified into two types, the



I69

animation sector, and the game sector, so within 12.4% of the growth rate of the digital content,

there is 13.5% growth rate of the game sector, higher than the animation sector. Moreover, the

report of Electronic Transactions Development Agency(ETDA) said that the Internet usage in

Thailand has grown up rapidly, especially in the transgender and Generation Y groups (The

Millennial). The survey can inform that the category of downloading programs/series/music/game

is in the fourth rank, 45.6%, of activities of users that access the Internet via their desktops

(Electronic Transactions Development Agency, 2017).

The perceptions of playing games in the past decades are mainly in the negative impact,

such as behavioral addiction (Ferguson, Colwell, Mlačić, Milas, & Mikloušić, 2011), degrade

their academic performance (grade point average, GPA) (Jackson, Von, Fitzgerald, Witt, & Zhao,

2011; Ventura, Shute, & Zhao, 2013), hamper their interpersonal relationships with friends and

family (Jackson, Von, Fitzgerald, Witt, & Zhao, 2011; Ferguson, 2011), and some physical

problems. There are many medical records indicate that long-time playing over the Internet cause

some serious physical problems, such as insomnia, and psychological characteristics (Hasan,

Bègue, Scharkow, & Bushman, 2013; Jackson, Von, Fitzgerald, Witt, & Zhao, 2011; Lenhart,

Kahne, Middaugh, Macgill, Evans, & Vitak, 2008). Nevertheless, there was a research in a

Malaysian University that university students who play games do not have low GPA; or it can be

said that there is no relationship between GPA and the frequency of the game plays (Ventura,

Shute, & Zhao, 2013). On the other hand, this does not imply to students in the primary school

because the result showed that students who love to play games have low GPA than students

who hardly play games (Jackson, Von, Fitzgerald, Witt, & Zhao, 2011).

Though, many negative impacts are identified by researches, there are also some positive

views to be existed, such as promoting prosocial skills (Ferguson, Colwell, Mlačić, Milas, &

Mikloušić, 2011; Lenhart, Kahne, Middaugh, Macgill, Evans, & Vitak, 2008), visual-spatial

skills (Green, & Bavelier, 2007), and reduce violent behavior (Ferguson, Colwell, Mlačić, Milas,

& Mikloušić, 2011). These games are applied in different areas: Mathematics (Kebritchi, Hirumi,

& Bai, 2010), Health (Bartholomew, L. K., et al., 2000), and Foreign Language (Ferguson, Colwell,

Mlačić, Milas, & Mikloušić, 2011; Lenhart, Kahne, Middaugh, Macgill, Evans, & Vitak, 2008).

Since the culture and social life of teenagers in Thailand are much differences than other

countries, the results mentioned above may or may not be the same for young Thai students.

Therefore, this research has an aim to classify Thai teenager’s behavior and attitudes towards

playing game in their lives. In addition, this study is also able to identify the preference in the

type of games in Thai teenagers. Nonetheless, this study will randomly select samples from

undergraduate students of Suan Sunandha Rajabhat University because this place has students



I70

from all parts of Thailand. Thus, the samples can be used to represent teenagers of Thailand as

good as selects from other places.

Objectives

1) To study the computer game players’ behavior

2) To study the attitudes of the computer game players towards its impacts: positive and

negative impacts.

3) To identify the game genres preference of Thai teenagers.

Population and Sample

This research focuses in the teenagers’ behavior, attitudes, and preferences towards game

playing in Thailand; so, the population is all Thai teenagers. Since Suan Sunandha Rajabhat

University has been opened for Thai people who wants to continue their knowledges in specific

areas in both undergraduate and graduate levels, most students, coming from several home

towns, in this university are in the age range of 17-25 years old as same as teenagers in Thailand.

Therefore, the samples of 1,017 students can be randomly selected from this university and it can

be representative of Thai teenagers as needed.

Data Collection Method

In this research, the collection method is performed using a questionnaire. This

questionnaire was distributed to the sample size of 1,017 students from every faculty. The

measurement topics are divided into 3 parts: demographic information, game playing attitude,

and game preference.

The demographic information consists of Gender, Faculty, GPA, playing frequency, and

playing duration time.

The measurement unit in the game playing attitude is Likert scale with 5 levels: 1 to 5

scores, where 1 means “strongly disagree”, and 5 means “strongly agree”.

The preference in each type of games is measured using 11-scale units: -1 means dislike

game in the list, 0 means don’t know the game in the list, 1 means extremely dislike this game

type, and 9 means extremely like the game type.



I71

Data Analysis

The data from all questionnaires are analyzed using SPSSv22.0, license of Chulalongkorn

University. The objectives to calculate all statistical values, both descriptive and inferential, are

to answer the following questions.

1. What is the most popular game that Thai teenagers love to play?

2. What are the main characteristics of game players after they decide to play games?

3. How do teenagers feel about impacts of games?

4. Are there any similarities among faculties under the classification of games?

5. Are there any similarities between genders when they choose a game?

6. Is it possible to spend times less than before with family or friends because of games?

7. Is game the main cause of irresponsibility of the game players?

8. Can the game cause bad learning skill?

9. Do negative perceptions of the players come from games?

10. Is the mood of the game players always sensitive?

The result from this study indicates that the action-game is the most popular among

students in this university, 23.8% from all samples. The second place is simulation-game, 16.6%.

In addition, the players’ behavior for all games is that they generally play their games

more than one time per day, 40.3%, but each time they spend less than one hour, 39.2%. This

information is very interesting because this result should be able to indicate that teenagers in

Thailand mostly play games whenever they are available according to the short time play. Thus,

this result is consistent with the collected data that they have positive attitude towards the game

plays.

When focusing to the action-game, it is obviously found that faculties in this university

can be grouped into two different subgroups. The first subgroup consists of Faulty of Humanities

and Social Science, Faculty of Science and Technology, while another subgroup consists of

Faculty of Industrial Technology, Faculty of Management Science, Faculty of Education, and

Faculty of Fine Arts. Moreover, the action players indicate that the playing this game can affect

to their study while other game players cannot conclude to the same issue.

The depth statistical analysis was also performed, such as Analysis of Variance, and Chi-

Square; this statistical analysis uses 95% confidence level. So, another interesting issue has been

uncovered that the attitude of playing games between faculties is significantly difference, mostly

sig=0.00<0.05=α. Although the overall attitudes are positive, the attitudes of students from Faculty

of Industrial Technology is significant different from other students from other faculties.

When comparing between male and female for their appreciation of the game types,

using Chi-Square analysis with 95% confident level, it has been found that these two genders have

dissimilarity in the game types. The outcomes from this analysis can classify that male students



I72

love to play games that they must make plans to win the game, such as strategy, role play, sports,

shooting, and fighting games. While the results show that female love to play games just for fun,

without or small stress, such as puzzle, action, and simulation games.

In this research, some negative impacts that have been mentioned in other researches,

such as the game player may leave their live away from their family or friends, playing game is

the main cause of irresponsibility of the players, have been investigated. Using a simple statistical

method, descriptive statistics, it can show that all investigate cases that mentioned in questions 6

to 10 above do not have any negative results. For examples, it shows that the samples do not

agree that playing game can cause problem in their studies, or playing game has nothing to do

with irresponsibility of the players.

Discussion

Currently, the learning styles of students have been changed and improved by various

methods. One of these techniques is the game-play method that students in the class learn the

contents of subjects by playing games. There are various researches show that using game can

have both positive and negative impacts to students, Nevertheless, this study shows that the

negative impacts mentioned in other researches do not arise in Thai teenagers; this might be Thai

culture is different from others. Moreover, students from different faculties may like different

game types. However, the popular game in this survey is the action games. Thus, choosing game

types for creating content for a subject should consider for students’ area and, also their

appreciations because both can lead to succeed or failure of their study as same as lead them to

win the game.

Conclusion

This research has shown that Thai teenagers have dissimilar to other game players of

other countries because the results disclose that all negative impacts that have been mentioned in

other research papers do not exist in Thai samples. Additionally, the result shows that action

game is the most popular game in the age range of Thai citizen. However, the appreciation of

games between different genders is dissimilar. Therefore, creating a game in this teenagers in

Thailand, the implementers should consider for the players’ specialties and interest.



I73

References

Anand, V. (2007). A study of time management: The correlation between video game

usage and academic performance markers. CyberPsychology & Behavior.

Vol.10(4), 552-559.

Bartholomew, L. K., Gold, R. S., Parcel, G. S., Czyzewski, D. I., Sockrider, M.

M., Fernandez, M., & Swank, P. (2000). Watch, Discover, Think, and Act:

evaluation of computer-assisted instruction to improve asthma self-management in

inner-city children. Patient education and counseling. Vol.39(2), 269-280.

Digital Economy Promotion Agency. (2016). Retrieved May 12, 2017, The Software

Industry Promotion Agency (Public Organization) (SIPA) revealed that the survey

results of Thailand’s digital content industry in 2015 includes animation and

games,Digital Economy Promotion Agency website,

http://www.depa.or.th/en/news/sipa-announced-thai-digital-content-industry-

2015-grew-1241-percent

Dye, M. W., Green, C. S., & Bavelier, D. (2009). The development of attention skills in

action video game players. Neuropsychologia. Vol.47(8), 1780-1789.

Electronic Transactions Development Agency.(2017). Retrieved May 15, 2017,

Thailand Internet User Profile 2016,

Electronic Transactions Development Agency website,

http://www.theesa.com/wpcontent/uploads/2017/04/EF2017_FinalDigital.pdf

Entertainment Software Association.(2017). Retrieved May 15, 2017, Essential facts

about the computer and video game industry,

Entertainment Software Association website,

https://www.etda.or.th/publishing-detail/thailand-internet-user-profile-2016-

th.html

Ferguson, C. J. (2011). The influence of television and video game use on attention and

school problems: A multivariate analysis with other risk factors

controlled. Journal of psychiatric research. Vol.45(6), 808-813.

Ferguson, C. J., Colwell, J., Mlačić, B., Milas, G., & Mikloušić, I. (2011). Personality

and media influences on violence and depression in a cross-national sample of

young adults: Data from Mexican–Americans, English and Croatians. Computers

in Human Behavior. Vol27(3), 1195-1200.

Gose, E. G. (2014). What video game genres are teaching us(Doctoral dissertation,

University of Hawaii at Manoa).

Retrieved from http://scholarspace.manoa.hawaii.edu/handle/10125/100511

Green, C. S., & Bavelier, D. (2007). Action-video-game experience alters the spatial

resolution of vision. Psychological science. Vol.18(1), 88-94.



I74

Gros, B. (2007). Digital games in education: The design of games-based learning

environments. Journal of research on technology in education.

Vol.40(1), 23-38.

Hasan, Y., Bègue, L., Scharkow, M., & Bushman, B. J. (2013). The more you play, the

more aggressive you become: A long-term experimental study of cumulative

violent video game effects on hostile expectations and aggressive

behavior. Journal of Experimental Social Psychology. Vol.49(2), 224-227.

Jackson, L. A., Von Eye, A., Fitzgerald, H. E., Witt, E. A., & Zhao, Y. (2011).

Internet use, videogame playing and cell phone use as predictors of children’s

body mass index (BMI), body weight, academic performance, and social and

overall self-esteem. Computers in Human Behavior. Vol.27(1), 599-604.

Kebritchi, M., Hirumi, A., & Bai, H. (2010). The effects of modern mathematics

computer games on mathematics achievement and class motivation.

Computers & education. Vol.55(2), 427-443.

Lenhart, A., Kahne, J., Middaugh, E., Macgill, A. R., Evans, C., & Vitak, J. (2008).

Teens, video games, and civics: teens' gaming experiences are diverse and

include significant social interaction and civic engagement. Washington DC :

Pew internet & American life project.

Ventura, M., Shute, V., & Zhao, W. (2013). The relationship between video game use

and a performance-based measure of persistence. Computers & Education.

Vol.60(1), 52-58.



I75

The Effects of Drama Techniques in developing Students’ Speaking Ability

Ramanya Wongworapitak, and Phnita Kulsirisawad

Program: Teaching English as a Foreign Language, Faculty of Humanities,

Srinakharinwirot University, Thailand

Abstract

Drama techniques have been widely used in a language classroom. Drama

techniques are beneficial in a speaking classroom because they integrate language

skills in a natural way through verbal and nonverbal aspects of communication

(Maley & Duff, 2005). The present study investigates the effect of using drama

techniques to increase students’ speaking ability. It explores the effects of using

drama techniques in developing students’ speaking ability and the students’

satisfaction towards the use of drama techniques. The study involves 35 students who

were in the 10th grade studying English 31101 Course at Suankularb Wittayalai

Nonthaburi School. The students’ speaking abilities were measured by comparing

their pre-speaking test with their post-speaking test by using dependent T-test. At the

end of the course, the students were asked to complete a questionnaire in order to find

out their views towards the use of drama techniques in the classroom. A group

interview was also conducted in order to gain more detailed information about their

opinions. The findings revealed that teaching English through drama techniques had

a statistically significant influence on the students’ speaking ability. Their post-

speaking test scores were significantly higher than those of their pre-speaking test at

0.01 level. Moreover, the students had positive views toward the use of drama

techniques and they enjoyed learning through drama techniques.

Keywords: Drama techniques, English speaking

Introduction

The Thai government has long realized the importance of English

language as a core subject in school, and it has been a compulsory subject for several

decades (Nanthaboot, 2012). One of the goals of learning English is

‘communication’. Students should be able to communicate and connect with people

around the world (Minister of Education, 2008). Therefore, speaking proficiency is

necessary in both secondary and tertiary levels.

Even though Thai students have learnt English since they are in grade one,

most of them have low English proficiency and cannot communicate in English. It is

probably because they have no opportunities to practice speaking in English and use

language outside the classroom (Wiriyachitra, 2002). According to Khamkhien

(2010), the poor English speaking abilities among Thai EFL learners derive from the

problematic instruction in the classroom. Most teachers still use Thai as a medium of

instruction. They spend most of the class time practicing grammatical structures.

When teachers use traditional teaching approaches focusing on grammatical

structures, students will rarely get a chance to speak English and interact with other

students in the target language (Suraswadee, 1993). As a result, students have

minimal opportunity to actually use the language in a meaningful way. In addition,



I76

Wanthanasut (2008) found that Thai students were afraid of making mistakes while

speaking English and were not confident to speak English.

There are several components that contribute to the development of

students’ English speaking ability. The memorization of linguistic forms is not

enough to enhance their speaking ability. It requires the knowledge of

communication contexts, the ability to interpret through verbal and nonverbal cues

(Janudom & Wasanasomsithi, 2009). Vygotsky (1987) similarly points out that

language learning development depends entirely on social interaction because it

enables the learners to construct knowledge which is meaningful to them. Therefore,

any learning activities that involve a meaningful and purposeful social interaction

may help the students develop their speaking skills.

Drama techniques are one of the effective pedagogical practices to develop

students’ speaking skill (Gomez, 2010). According to Maley and Duff (2005), drama

activities allow students to use language meaningfully and creatively. They integrate

language skills in a natural way through verbal and nonverbal aspects of

communication. They also bring about classroom interactions and also increases self-

esteem as well as confidence (Maley & Duff, 2005). Moreover, using drama

techniques in the English language classroom makes the language appear in context

and makes it come to life (Boudreaut, 2013). In addition, drama techniques are not

only good for encouraging students’ linguistic and emotional development but also

promoting creative thoughts simultaneously (Zafeiriadou, 2009).

Maley and Duff (2005) explain that drama techniques are helpful in an

English language class because these techniques can balance the physical and

intellectual aspects of learning by integrating language skills and verbal and non-

verbal aspects of communication. For cognitive domain, drama techniques can fully

contextualize the language which help learners focus on the meaning rather than the

structure only through classroom interactive activities. The students are more

motivated and they can see for themselves that language has a purpose. In addition,

Miccoli (2003) found that language comes alive through drama in an oral skill

development class. The confrontation of fears, and willingness to take risks, lead to

an improvement in students’ communication skills, as a consequence of

understanding the aspects that underlie oral communication (Kyriakopoulos, 2008).

To sum up, drama techniques are the teaching strategies which promote

communication competence and motivate students to feel more confident to speak

English. They also bridge the gap between the classroom and real life situations.

Given the benefits of drama techniques in a language classroom, this study aims to

use drama activities in developing students’ speaking ability.

Drama techniques consist of various activities which can be used in a

language classroom. Holden (1981), Dougil (1987) and Scrivener (2005) have divided

drama techniques into five to six categories including mime, role-play, improvisation,

simulations, drama games and acting play scripts. Role-play is the acting out or

performing a particular role (Rober and Rober, 2001). Simulation is an oral

communicative activities involving decision making, in which the participants may

act as themselves or in social roles (Bygate, 1993). Drama games refer to short games

with both verbal and non-verbal activities which involves movement and imagination

(Maley & Duff, 2005). Improvisation is a group activity which allows learners

understand the character they will act out and the teacher provides information about



I77

a situation for students to improvise. Acting play scripts is based on acting out short

scenes or sketches by students (Scrivener, 2005).

In this study, the researcher adopted drama activities introduced by

Scrivener (2005) and Maley and Duff (2005) including drama games, role-play and

improvisation. These three activities are relevant to the lessons and are suitable for

the level of the students.

Drama techniques have been widely used in a language classroom. Several

researchers have employed drama activities in their language classrooms and found

that their students’ speaking abilities had improved significantly. Miccoli (2003) did

a study on a value of using drama activities in an oral skill class and found that drama

techniques created an atmosphere where students learned the language with fun and

no stress. In addition, Nofiadri (2015) did a study on implementing three types of

drama activities which consisted of mime, scripted play and unscripted play on

increasing ESL students’ speaking ability. It was found that students’ confidence

public speaking was increasing because the chronological procedures accommodate

their social awareness. Similar findings were found in the study of Al-Barri, Alqadi,

Al-Wa’ely, Khodair and Alshawashreh (2014). They did a study on the effectiveness

of the dramatic role-playing upon the linguistic achievement and the development of

verbal expressive performance among the basic 4th grade students. They found that

verbal expressive performance of 25 students were improved through the use of

dramatic and role playing methods. Furthermore, Gill (2013) did a similar study on

the effects of drama on oral English and found that 10 non-native students’ speaking

ability had improved after learning through drama-based lessons for twelve weeks.

Even though drama techniques are beneficial in English language teaching,

it is quite rare that a research study is done in an EFL context. Hence, this research

aims to fill the gap in previous research and the findings of this research will add to

the body of knowledge in English speaking development.

With regard to the context of this study, the participants are tenth graders.

They are taking English 31101 Course. Grounded on my 5-year teaching experience, I

have found that the students have difficulties in English speaking the most. They

cannot utter simple sentences correctly. They do not have enough confidence to

speak because they do not want to lose face in the classroom. Moreover, most of the

class time is devoted to drills and grammatical exercises. Therefore, this study aims

to address this problem, i.e. the lack of an opportunity for students to actually engage

in a meaningful social interaction.

Objectives 1. To examine the effect of using drama techniques in developing students’

speaking ability.

2. To determine the level of students’ satisfaction towards the use of drama

techniques in a language classroom.


Participants

The participants were 35 tenth grade students at Suankularbwittayalai

Nonthaburi School in the first semester of 2016. They enrolled in English 33101



I78

Course. The selection of the participants was conducted via a convenience sampling

method (as the researcher was assigned by the headmaster to teach grade 10 students)

Research Instruments

1) Lesson plans

There were three lesson plans which are going shopping, ordering food,

and asking and giving direction. These three topics that students in Mathayomsuksa 4

(Grade 10) had to study in the first semester of English 33101 Course. In each lesson

plan, drama techniques were designed to suit each topic. Experts in English language

teaching and learning examined the lesson plans in terms of the correctness of the

content, and relevancy to the course objectives. Then, the lesson plans were used to

pilot with another class of 40 students in Mathayomsuksa 4 (Grade 10). Each lesson

covered 2 periods (50 minutes in each period). The teaching processes were based on

three phases of drama-based instruction; introduction, development and quieting

started and along with oral principles of teaching speaking: pre-speaking, while-

speaking, and post speaking. For teaching Ordering Food, drama games were used to

motivate students and reduce the anxiety at the introduction phase. Then new

vocabulary and expressions were introduced at the development phase including the

practice of speaking through improvised role-play. During the quiet phase, the

students performed what they had learned. Below are the topics and details for each

lesson.

Table 1

Drama Techniques in each lesson

Lesson Plan Length Language Functions Drama Techniques

1 2 weeks Ordering food

Drama games

Role-play

Guided

Improvisation

2 2 weeks Shopping Drama games

Role-play

3 2 weeks Asking and giving

directions

Role-play

Guided

Improvisation

2) Learner’s Satisfaction Questionnaire

A 10-item using Likert’s 5 rating scales, adapted from Kulsirisawad

(2017) and Phisutthangkoon (2012), were used to evaluate the students’ satisfaction



I79

toward the use of drama techniques. The participants answered the questionnaire

which was in the form of statements on a 5-point scale with 1: representing lowest

satisfaction; 2: low satisfaction; 3: moderate satisfaction; 4: high satisfaction; 5: very

high satisfaction.

The 10-item questionnaire was classified into three themes. Usefulness

(items 1-4), acceptance (items 5-7), and affect (items 8-10). The original

questionnaire was constructed in English and then translated into Thai to ensure the

participants’ understanding.

3) English Speaking Tests

The English speaking test comprised pre-tests and post-tests. The aim is to

assess students’ English speaking ability. Those two tests were identical. The test

consisted of 10 questions and three improvised situations including going shopping,

ordering food, and asking for and giving directions. The criteria for evaluation

involve fluency, accuracy, and comprehension. The pretest was conducted at the first

week of the class. The post-test was conducted at the final week of the class. To

examine the content validity of the test, three experts were asked to examine the pre-

test and post-test through the Index of Item-Objective Congruence (IOC). The

researcher used holistic scoring by using rubric of speaking test which was adapted

from Rcampus and Cambridge English. The three raters rated students’ performance.

Their scores from the pre-test and post-test were statistically compared via dependent

T-test to find out the mean scores and standard deviation.

Data collection

To answer the first research question, the students’ speaking ability was

measured. At the first week of the experiment, the students were asked to take a pre-

speaking test. The test comprised two parts. The first part included 10 questions.

The second part was an improvisation which the students were required to role play.

After that, the students were taught through drama techniques for four weeks. Each

lesson plan was carried out for four periods per week.

At the final week, the post-test was administered. The post-test was

identical to the pre-test, but in random order. Both tests were rated by three raters.

The total scores of the two tests were 15 points each based on holistic scoring method.

To answer the second research question, the students were asked to

complete a set of questionnaire. It was followed by a group interview.

Data Analysis In order to investigate whether the students’ speaking ability has increased

after learning through drama techniques, the students’ pre and post speaking tests

scores were analyzed by using SPSS program (Statistical Package for the Social

Sciences) in order to obtain descriptive statistics; means and standard deviations. The

average mean scores and standard deviations of the pre and post-tests were calculated

and then compared using a dependent T-test. To determine the level of students’

satisfaction toward the use of drama techniques in the classroom, the 10-item Likert

scales questionnaire was analyzed by using SPSS program (Statistical Package for the

Social Sciences) in order to obtain descriptive statistics; mean and standard

deviations.



I80

Results

Research Question 1: Do Mathayomsuksa 4 (Grade 10) students at

Suankularbwittayalai Nonthaburi school develop their English speaking ability after

learning through drama techniques? Overall, it was found that the English speaking ability of Matthayomsuksa

4 students was significantly higher after learning through drama techniques activities

at the 0.01 level. The participants had significantly higher mean scores on the post-

test (M= 6.19, SD= 1.76) compared to that of the pre-test (M= 5.63, SD= 1.47).

Table 2 The Average Mean Score of Pre-Post Speaking Tests

N Score Mean Std. Deviation p-value

Pre-test 35 15 5.63 1.47 0.0014196

Post-test 35 15 6.19 1.76

From Table 2, it can be seen that the students performed better in the post-

speaking test.

Research Question 2: What are the students’ satisfaction towards drama techniques

in a language classroom? At the end of the study, all participants were asked to complete a

questionnaire. The questionnaire was adapted from Kulsirisawad (2017) and

Phisutthangkoon (2012). The students rated each item based on their satisfaction

towards drama techniques by using five points scale ranging from ‘very high

satisfaction’ to ‘very low satisfaction’ (4.21-5.00 = very high satisfaction, 3.41-4.20 =

high satisfaction, 2.61-3.40 = moderate satisfaction, 1.81-2.60 = low satisfaction and

1.00-1.80 = very low satisfaction). The checklist interpretation was adapted from

Phisutthangkoon (2012). The findings revealed that the participants had positive

views toward the use of drama techniques. The satisfaction of the students toward the

use of drama techniques were at ‘a very high satisfaction’ level with a mean score of

4.24 and the standard deviation of 0.69. The highest mean score was item 10 (I enjoy

learning through drama techniques) which was 4.40 and the standard deviation was

0.65. The second highest mean score was item 1 (Learning through drama

techniques increase motivation in speaking English) which had the mean score of

4.31 and the standard deviation of 0.76. The third highest mean score were item 2

and item 8 (Learning through drama techniques has increased my speaking fluency

and I feel no pressure when I speak with my friends in the class). They both had a

mean score of 4.29 with the S.D. of 0.62 and 0.71 respectively. It can be argued that

students had positive views toward the use of drama techniques in the English

language classroom. The findings were presented in Table 3.



I81

Table 3 Findings of Students’ Satisfaction toward the Use of Drama Techniques.

Questionnaire Items Mean Std. Level of response

Section I : Usefulness

1. Learning through drama techniques

increase motivation in speaking English.

4.31 0.76 Very high

satisfaction

2. Learning through drama techniques has

increased my speaking fluency.

4.29 0.62 Very high

satisfaction


make me feel more confident to speak

English in the class.

4.23 0.60 Very high

satisfaction

4. Learning through drama techniques help

to promote solving skill.

4.23 0.81 Very high

satisfaction

Section II : Acceptance


promote engaging and positive learning

environment.

4.23 0.73 Very high

satisfaction

6. Learning through drama techniques was

a valuable and worthwhile experience.

4.23 0.69 Very high

satisfaction

7. I have more interaction with friends and

teachers in class.

4.09 0.74 high satisfaction

Section III : Affect

8. I feel no pressure when I speak with my

friends in the class.

4.29 0.71 Very high

satisfaction

9. I do not worry about making

grammatical mistakes after learning through

drama techniques.

4.14 0.60 high satisfaction

10. I enjoy learning through drama

techniques.

4.40 0.65 Very high

satisfaction

Totals 4.24 0.69 Very high

satisfaction

Conclusion

To sum up, it can be concluded that the students’ speaking ability

significantly increased after learning through drama techniques. In addition, they had

positive views toward the use of drama techniques. Furthermore, they enjoyed

learning English through role-plays, drama games and improvisation. From the group

interview, it was found that the students were happy and were willing to participate in

the role-plays, games and improvisation. One of them stated that all activities were

fun and relaxing, many students said that role-play was the best because it gave them

opportunities to practice speaking English with friends in a fun way.

Discussion

In this study, the researcher used drama activities to teach English

speaking to 35 tenth graders. Such activities involved role-plays, drama games and

guided improvisation. The classroom observation data revealed that the classroom



I82

atmosphere was relaxing and the student had fun. Unlike the traditional language

classrooms where the focus was solely on grammatical forms, this classroom

emplasized on communication and the ability to get the message acrossed. The

researcher found that the students were more confident and motivated.

The quantitative analysis revealed that the students did better at the end of

the course which suggested that the drama techniques had positive impact on their

speaking performance. In addition, the students liked it when the teacher use drama

techniques. They stated that they found the enjoyable because they had a chance to

interact with their peers and they were at ease. They considered the learning

experience worthwhile and valuable.

The findings of this study were in line with the studies of El-Nady (2000),

Fabio (2015), and Nofiadri (2015) which also found that the students performed

significantly better through the use of drama activities. Such positive outcomes could

probably come from the fact that the students liked the activities and were not

reluctant to participate.

Recommendations for further studies On the basis of the research findings, the researcher would like to offer

some general thoughts of how to develop students’ speaking abilities. The intention is

also to further develop the communicative language teaching approach which has

begun to be implemented in Thailand.

To help students become more confident and motivated in speaking

English, the researcher would like to argue for the continual practice of teaching

English speaking through drama techniques. As supported by Maley and Duff (2005),

drama activities help students use the language in a meaningful and creative way. It

also increases self-esteem and confidence.

The positive impact that the drama techniques had on the students’

speaking abilities suggests that drama techniques could be an alternative method in

teaching English to Thai EFL learners. Moreover, drama activities such a role-plays

provide the students the opportunities to engage in classroom interactions.

References

Abu, R. (2010). Drama in chalk and talk classroom. Journal of Language Teaching

and Research, 1(4), 378-381.

Akdag, N., & T, O. F. (2010). The effect of drama method on achievement level in

English teaching: knowledge, comprehension and application levels.

International Journal of Human Sciences, 7(1), 824-835.

Al-Barri, Q., Alqadi, H., Al-Wa’ely, S., Khodair, R. & Alshawashreh, O. (2014). The

effectiveness of dramatic role-playing on the linguistic achievement and the

development of verbal expressive performance among the basic4th Grade

students in Jordan. Research on Humanities and Social Sciences, 4(21), 1-9.

Retrieved from http://www.iiste.org/journals/ Angwattanakul, S. (1994). English teaching methods. Bangkok: Chulalongkorn

University Press.

Boudreault, C. (2010). The benefits of using drama in the ESL/EFL classroom. The

Internet TESL Journal, 16(1). Retrieved from

http://iteslj.org/Articles/Boudreault-Drama.html



I83

Bygate, M. (1993). Language teaching speaking. Oxford: Oxford University Press.

Dougil, J. (1987). Drama activities for language learning. London. Macmillan

Publishers.

El-Nady. (2000). Drama as a teaching techniques in the second language classroom.

Dialog on Language Instruction, 14(1&2), 41-48.

Fraenkel, J. R., & Wallen, N. E. (2006). How to Design and Evaluate Research in

Education (5th ed.). New York: McGraw-Hill Publishing.

Gill, C. (2013). Enhancing the English-Language OralSkills of International Students

through Drama. English Language Teaching, 6(4), 29-41.

Gomez, D. I. (2010). Using drama to improve oral skills in the ESL classroom.

International school Journal, 30 (1), 29-37.

Harmer, J. (2007). The practice of English language teaching. Essex: Pearson

Education.

Heaton, J. B. (1989). Classroom testing: testing speaking skills. London: Longman.

Holden. (1981). Drama in language teaching. London. Longman

Hughes, A. (2003). Testing for language teachers. Cambridge: Cambridge University

Press.

Iamsaard, P. & Kerdpol, S. (2015). A study of effect of dramatic activities on

improving English communicative speaking skill of Grade11th students.

English Language Teaching, 8(11), 69-78. Retrieved from

www.ccsenet.org/elt

Janudom, R., & Wasanasomsithi, P. (2009). Drama and questioning techniques:

Powerful tools for the enhancement of students’ speaking abilities and positive

attitudes towards EFL learning. Retrieved from http://www.esp

world.info/Articles_26/Original/Drama.pdf

Khamkhien, A. (2010). Teaching English speaking and English speaking tests in the

Thai context: A reflection from Thai perspective [Electronic version]. English

Language Teaching, 3, 184-190. Retrieved from

www.ccsenet.org/journal/index.php/ elt/ article/ download/ 5253/4351

Kulsirisawad, P. (2017). The Study on the Use of Journal Writing Activity in a Basic

Writing Classroom to Enhance Writing Fluency and the Students‟ Perceptions

towards Journal Writing. Manutsat Paritat: Journal of Humanities, 39(1). In

process.

Kyriakopoulos, P. (2008). Using practiced improvisation and role-play to improve

oral communication skills for English second language learners. Master

thesis, M.A. (Master of Arts). Quebec, Concordia University.

Maley, A., & Duff, A. (2005). Drama Techniques: A resource book for

communication activities for language teachers. Cambridge: Cambridge

University Press.

Miccoli, L. (2003). English through drama for oral skills development. ELT Journal,

57(2), 122-129.

Minister of Education. (2008). Basic Education Curriculum 2008. Bangkok:

Kurusapa Ladprao Publishing.

Nanthaboot, P. (2012). Using communicative activities to develop English speaking

ability of Mathayomsuksa three students. Master thesis, M.A. (Teaching

English as a Foreign Language). Bangkok: Graduate School, Srinakharinwirot

University.



I84

http://www.ccsenet.org/elt

http://www.esp/

http://www.ccsenet.org/journal/index.php/

Nofiadri, N. (2015). Drama techniques: A solution for improving students’ speaking

skill. RiELT Journal, 1(1), 37-48

Noom-ura, S. (2013). English-teaching problems in Thailand and Thai teachers’

professional development needs. Language Institute, Thammasat University,

Thailand. English Language Teaching, 6 (11), 139-147. Retrieved from http://www.ccsenet.org/journal/index.php/elt/article/viewFile/31115/18208

Nuktong, P. (2010). The effects of drama-based instruction on English oral

communication ability and motivation in learning English of eleventh grade

students. Master thesis, M.ED. (Teaching English as a Foreign Language).

Bangkok: Graduate School, Chulalongkorn University.

Phisutthangkoon, K. (2012). The use of communicative activities to develop English

speaking ability of the first year diploma vocational students. Master thesis,

M.A. (Teaching English as a Foreign Language). Bangkok: Graduate School,

Srinakharinwirot University.

Pongsawang, G. (2012). Using task-based language learning activities to enhance

speaking abilities of Prathomsuksa 5 students. Master thesis, M.A. (Teaching

English as a Foreign Language). Bangkok: Graduate School, Srinakharinwirot

University.

Punsiri, B. (2011). The Effectiveness of Drama Techniques on Foreign Language

Classroom Anxiety Reduction of Thai EFL Students. Master thesis, M.A.

(Teaching English as a Foreign Language). Bangkok: Graduate School,


Rober, A. & Rober, E. (2001). The penguin dictionary of psychology. Lonndon:

Penguin.

Sae-ong, U. (2010). The use of task-based learning and group work incorporating to

develop English speaking ability of Mattayomsuksa 4 students. Master thesis,

M.A. (Teaching English as a Foreign Language). Bangkok: Graduate School,


Scrivener, J. (2005). Learning teaching: A guidebook for English language teachers.

Macmilan Education, Macmillan Publishers Limited.

Seidlhofer, B. (2005). Key concepts: English as a lingua franca. ELT Journal 59(4),

339-341.

Sirisrimangkorn, L., & Suwanthep, J. (2013). The effects of integrated drama-based

role play and student teams achievement division (STAD) on students’

speaking skills and affective involvement”, Suranaree University of

Technology, Thailand. Retrieved from

http://research.ucc.ie/journals/scenario/02/05-SirisrimangkornSuwanthep-

2013-02-en.pdf

Sulaiman, K. A. (2013). Using educational drama and role-playing teaching English

in Gaza governorates. The Isalamic University of Gaza, Gaza, Palestine. Asian

journal of Education and e-learning, 1(1), 34-46.

Suraswadee, P. (1993). Human relation and English teaching: Bangkok

Chulalongkorn University Press.

Torrico, F. (2015). Drama techniques to enhance speaking skills and motivation in the

EFL secondary classroom. Retrieved from

http://eprints.ucm.es/32553/1/TFM%20%281%29.pdf

Thornbury, S. (2008). How to teach speaking. Malaysia: Pearson Education.



I85

http://www.ccsenet.org/journal/index.php/elt/article/viewFile/31115/18208

http://research.ucc.ie/journals/scenario/02/05-SirisrimangkornSuwanthep-

Underhill, N. (2000). Testing spoken language: A handbook of oral testing

techniques. Cambridge University Press.

Vygotsky, L.S. (1987). Mind in Society: The Development of Higher Psychological

Processes. Cambridge: Cambridge University Press.

Wanthanasut, L. (2008). The problems of English speaking of Mathayom suksa 1

students at Phosai Pittayakarn school, Ubonratchathani Education service

area 2. ( Unpublised master’s thesis). Ubonrachathani Rajabhat University,

Ubonrachathani, Thailand.

Weir, C. (1993). Understanding and developing language test. New Jersey: Prentice

Hall.

Wiriyachitra, A. (2002). English language teaching and learning in Thailand in this

decade. Thai Tesol Focus, 15(1), 4-9.

Zafeiriadou, N. (2009). Drama in language teaching: a challenge for creative

development. Retrieved from http://www.finchpark.com/courses/grad-

dissert/articles/drama.

Zyoud, M. (2012). Using drama activities and techniques to foster teaching English

as a foreign language: a theoretical perspective. Retrieved from

http://www.qou.edu/english/conferences/firstNationalConference/pdfFiles/mu

ntherZyoud.pdf



I86

http://www.finchpark.com/courses/grad-

http://www.qou.edu/english/conferences/firstNationalConference/pdfFiles/mu



I87

Problems and Difficulties of Overseas Chinese studying in Northeastern Thailand

Liu Xuefeng

1

Pennee Narot2

Abstract

This research surveyed problems and difficulties of Chinese international students

encounter while living and studying in the Northeastern of Thailand. The purposes of the study

were: 1) To learn and understand problems and difficulties oversea Chinese students facing while

studying in Northeastern Thailand universities. 2) To analyze the expectation before and after

coming to study in Thailand. 3) To propose policy suggestions.

The data collection was conducted by structured questionnaire. The in-depth interview was

administered with 20 oversea Chinese students studying at Khon Kaen University and

Mahasarakham University in the Northeastern of Thailand. The samples were drawn by snow

ball technique. The obtained data were analyzed by content analysis and summarized report in

descriptive manner according to the research objectives.

The findings can be summarized as follows: 1) The problems and difficulties faced by the

students including academic, economic, culture, law and regulation, daily life aspects.

Specifically, there are communication barriers, high monthly spending, unfamiliar with Thai’s

Buddhist practice, and some Thai laws as well as university regulations. The problem of not

being able to adjust to warm weather and food were also reported. 2) As they have been studying

in Thailand, the most of Chinese students found that the academic aspect meet their expectation

but not in living condition. Their cultural and economic expectations are inconsistent so it is

difficult to conclude. 3) The policy suggestions proposed to universities or related education

organizations and local government where the universities are located should be as follows: (1)

An establishment of well- developed strategic plan to accommodate overseas students, (2)

development and up-date of collaboration program between Thai and Chinese universities, (3)

provide actual information related to every aspect of the university and ways of living in each

university and locality not just a public relation for business purpose.

Key words: problems; difficulties; overseas students; cross-cultural; policy

Introduction

Research Background and Rationale

Having international students benefit the countries in many ways, especially economic

benefits to the host country. Per the Open Doors Report (2012) published by the Institute of

International Education, the international students contributed approximately $22.7 billion in one

academic year through tuition fees and living expenses. In Australia, the Department of Foreign

Affairs and Trade ranked education services the third largest export earner after iron and coal.

(AEI, 2012) International Education industry stands for 15% of the revenue of Australian

universities (Becker and Lolster, 2012). In additional to the economic benefit foreign students

1MPA. Candidate in Public Administration, College of Local Administration, Khon Kaen University. 2Associate Professor, College of Local Administration, Khon Kaen University.



I88

bring, they also bring a positive social, cultural, and education impact on their host country

(ASEAN Economist, 2013). Ozturgust (2013) stated that international students can transfer their

knowledge and skills to scientific and technical field of the host country. According to a

Universities Scotland (2013), the considerable presence of international students on campus

helps in at least in four areas. First, international students will promote the learning of language

in more sociable and natural ways. Second, by having students of different cultures and

nationalities have a positive impact on multiculturalism and it help increasing domestic students’

global perspectives. Third, international students help by sharing knowledge and skills from their

own experience. Finally, international students as alumni in a school will promote global

connection. Undeniably, international students provide a significant economic benefit to the host

country.

With the rise of the Chinese economy, Chinese students studying abroad has become

common practice. In the past three decades, more and more Chinese students chose to pursue

higher education abroad. The number of Chinese students going study oversea rose sharply from

2,124 in 1980 to 523,700 in 2015 (National Bureau of Statistics of China, n.d.). Undoubtedly,

China has become the biggest consumer of overseas education in the world. (UNESCO, 2013)

When going abroad to study, international students from different countries are often facing

with challenges and difficulties both before and after entering their new schools or universities.

As it is evident that Chinese students are the majority of foreign students in Thailand, especially

in the Northeastern region of the country, so the investigation of their situations related to

studying overseas should provide body of knowledge for the future planning to accommodate

and preparation approach for the policy makers and new coming students.

International Students and International Market

According to the UNESCO Institute for Statistics, an “international student” refers to

students who left their countries or territories of origin and crossed national borders for the

specific purpose of studying. (University World News, 2015)

According to the Organization of Economic Cooperation and Development (OECD),

international students are those who travel to a country different from their own for the purpose

of tertiary study. However the definition of "international student" varies in each country in

accordance to their own national education system.

Previous research literatures revealed that the US, the UK, and Australia have been the key

players in the international student market because of their English-speaking environment,

international reputation in higher education and strong financial incentives (Verbik and

Lasanowsky, 2007). The study of Verbik and Lasanowsky (2007) further stated that Germany

and France as well as Canada have also successfully attracting international students because of

their close geographical and cultural tie with other European countries. While in Asian, many

countries and regions such as Hong Kong, South Korea, China have targeted themselves to

become higher education hubs, and within ASEAN, Singapore, Malaysia, Vietnam, and Thailand

are in competition (Jaroensubphayanont, 2014). Regarding recruiting international students

strategy of those countries, more or less practiced what Becker and Kolster (2012) have been

found; using tuition fee and scholarships, student visa and employment regulations, program

taught in other languages, and promotion instruments.



I89

Education as a tool for economics implication, diplomacy approaches and culture

Wang Hengan, Zhao Lina, Zhang Qixin (2016) studied the instrumental value of education

represents the satisfaction of education to social development. From the point of view of the

subject, the subject of social development must be creative and dynamic person. The tool value

of education is realized by its people in culture, education through labor reproduction, cultivate

subjective initiative, creative people into various subsystems of society, have various effects. In

this study, there are three main subsystems of the social system: the cultural subsystem,

economic subsystem and political subsystem.

Wang Hengan, Zhao Lina, Zhang Qixin (2016) introduced the education cannot directly

generate value for the various subsystems of society, but it can produce value to the social

subsystem indirectly through the cultivation of certain people.

The cultural value of education is the value of education to the development and change of

human culture. Education and culture are two important areas of mutual development and mutual

integration of social undertakings. Education influences the development of culture, and culture

also affects the development of education.

The economic value of education refers to the value of education to promote the development

of social economy and the value of its own development.

The political value of education is accompanied by the emergence of class society, with a

very distinct class nature. In the process of being controlled by politics and politics, education

also fully embodies the political value of education. The political value of education means that

education can safeguard the interests of the ruling class, maintain social and political stability,

and realize the improvement and development of political system.

Through the introduction of the value of the above three kinds of education, we can sum up

the value of education to the macro society, which can promote the development of society and

the transformation of society.

Wang Hengan, Zhao Lina, Zhang Qixin (2016) concluded the value, task and purpose of

education are the guiding factors of education to exert its function. Therefore, the research of the

value of education, with the identity itself on the existence and development of education and

point to the role, this is where the significance of this study: (1) the essence of cognitive

education, this study plays an important role in people's understanding of education and

educational research; (2) return to education itself, to provide direction the development of micro

body in education or education; (3) make the function more perfect, so that the value of more

value, to promote the harmonious development of man and society, in order to adapt beyond,

research is in order to better development, the education itself the most basic theory to research

the problems can promote the development of education.

The research on the historical change of educational value and the value orientation of

education in the future is the key problem that cannot be ignored in order to develop.

Cross-cultural communication

The significance of cross - cultural communication

Cross-cultural communication usually refers to the communication behavior between people

of different cultural backgrounds. Cross-cultural communication may occur internationally as

well as between different cultural groups because of differences in region and ethnicity. To

observe the cultural perspective: communication and language, self-consciousness and space,



I90

dress and dress up, time and time of food and eating habits, consciousness, seasonal concepts,

relationships, values and norms, beliefs and attitudes, thinking process and learning, work habits

and practice etc.. Understanding cultural systems can examine the systems of kinship,

educational systems, economic systems, political systems, religious systems, associations,

systems, health care systems, recreation systems, etc.. Cross-cultural communication occurs in

such a situation: the sender of information is a member of a culture, and the receiver is a member

of another culture. (Baidu library 2014)

Trend of Chinese students study overseas

Shawn Kelly (2010) studied China has become Thailand's largest student source country

(China news agency 2010) in the recent years, more and more Chinese families choose to send

their children study overseas. Thailand, being a new hot destination of Chinese oversea students,

we all knew that the internal factors Chinese oversea student choose higher education of

Thailand because of the Chinese economy growth, but know less the external factor is Thailand’s

higher education has a quite good quality with international recognition, and the Thailand’s

education system is complete and healthy.

Paweena Songsathaphorn, Chenin Chen, and Athapol Ruangkanjanases (2014) studied the

trend of students study overseas: The rapid economic growth in Asia has been a main cause of

the growth of trade in education as Asian countries have proved the importance of education in

accelerating economic growth. Development continues to fuel Asia’s demand for education. The

demand for higher education will continue to grow. Governments across the region welcome

trade in education intended for higher quality education and greater choice of studies.

In 2009, according to a survey conducted by Office of the Higher Education Commission,

there were 19,052 international students, from 124 countries, studying in 103 Thai higher

education institutions. The highest number of international students studying in Thailand was

Chinese students with 8,993 students or 47.2% of the total. As Chinese student is a majority and

the main source of international students in Thailand, thus, it seems to be the most critical target

group and is one of Thai’s prominent export markets for education services. International

education industry is growing and having intense competition. In order to attract more potential

Chinese students to come and study in Thailand, word-ofmouth or buzz marketing will pay an

important role. Satisfying students will be good and effective advertisers for promoting Thai

education for services. Thus, it is vital to recognize crucial factors that influence Chinese

students’ satisfaction toward Thai higher education. (Office of the Higher education, 2009)

The Chinese Ministry of Education reports that 523,700 Chinese students went abroad to

study in 2015. This represents a new record but also a second consecutive year in which year-

over-year growth has fallen short of long-term averages. The Ministry notes as well that Chinese

student are also being drawn back to the country’s attractive job market in greater numbers, with

roughly 70-80% of students abroad returning to China in recent years. (IECF monitor 2016)

. Miao Lyu,Zheng Jinlian,Wang Jianfang and Dong Qingqian(2015) studied that in the era of

globalization, China has already become the biggest international students exporting country,

Chinese international students accounts for a quarter of the total number of international students

in the world. Wang Huiyao, Miao Lyu and Zheng Jinlian (2015) studied the major choices had

become more diversification.

Miao Lyu, Zheng Jinlian, and Wang Jianfang(2016) studied in recent years, Chinese

returnees have increased rapidly. Most of them are choose go to the eastern developed cities,



I91

which makes a result that in these cities have a market job competition has intensified. It makes

much more difficult for these returnees find a job totally match up with the major they learn in

universities.

Cao Chen and Bi Xi(2016) studied the oversea postgraduates returning rate remains stable,

and the ratio is about 60%, among which nearly 50% of the returnees choose to live in the

municipal cities directly under the central government. Miao Lyu, Zheng Jinlian and Wang Jiayu

(2016) studied with the increasing number of Chinese students studying abroad, Chinese

overseas students’ organizations are also developing rapidly. Miao Lyu, Li Qing and Zheng

Jinlian(2016) studied oversea returnees is an important force in representing China’s modern

image globally since they can better integrate the latest western management concept and

Chinese management model. More and more government stuff in China have a background have

a oversea study background, they can better integrate latest western management concept to and

Chinese management model, to improve local government system.

Zheng Jinlian, Zhang Qiran and Yangfei (2015) studied the overview of Chinese oversea

students all around the world follows: The United States and Canada have attracted a large

number of overseas students by virtue of high-quality educational resources and a sound

educational system.

Zhang Qiran, Yang Fei and Zhu Hua (2015) studied with the implementation of China

“the Belt and Road (B&R)”strategy, the exchange and cooperation in culture and education

between China and Europe has been further strengthened, and the choice of countries and majors

for Chinese students studying in Europe is more diversified. Dong Qingqian and Sun Xiaomeng

(2016) studied Australia and New Zealand have always been the main destinations for Chinese

students studying abroad.

Miao Lyu, Zheng Jinlian and Zhang Qiran(2016) found Japan, South Korea, and other

“the Belt and Road (B&R)” Asian countries such as Singapore and Malaysia, are “hot”

destinations for studying abroad with high levels of internationalization in education.

Previous research related to reasons of Chinese student study in overseas

Huicai You (2006) believed that Chinese students studying in Thailand for many reasons,

mainly summarized as 3 points: The smooth development of Sino Thai relations is a prerequisite

for Chinese students to study in Thailand; The stable development of politics, economy and

society in Thailand provides a good environment for Chinese students to study in Thailand; The

advantages of Thailand education are the decisive factors for Chinese students studying in

Thailand.

Hongzhi Yin, Athapol Ruangkanjanases, and Chenin Chen (2015) studied the five main

reasons: Acceptance of the degree from Chinese Ministry of Education; Family affiliation;

National Matriculation Exam ; Language skill ; Self-knowledge of the destination country are

significantly influential to Chinese students’ decision making toward continuing their higher

education in Thailand.

Paweena Songsathaphorn, Chenin Chen, and Athapol Ruangkanjanases (2014) studied the

satisfaction level of each students are different, it could influenced by following factors:

education, safety, image and prestige of institution, and student’s preparation, have significant

positive influence on overall Chinese students’ satisfaction toward Thai higher education, the

four main factors are influencing Chinese graduated student in Thai universities.



I92

Liu Yingxiu and Dr. Sayamol Noungbunnak (2015) found that a significant relationship

between the demographic profiles of undergraduate Chinese students who study in Bangkok,

Thailand, such as gender, age, and education level. The study revealed that Chinese students with

different gender, age and education level have different levels of customer satisfaction about

student administration, the dormitory and the teachers. Such consistent results imply that Chinese

students with different demographic profiles tend to have different levels show different

customer satisfaction when they study in Thailand.

The most important factors of the marketing mix focused on by the Chinese students are that

Thailand's degrees are internationally recognized, it is not hard to apply for a scholarship in

Thailand, Thai universities have much international cooperation, studying in Thailand has good

employment prospects, the cost of living is lower than China, the price of air tickets from

Thailand to China is low, and it is convenient to go home and Bangkok has convenient

transportation.

Chinese students who study in Bangkok, Thailand pay more attention to the activities of the

university, the dormitory, the teachers and student administration.

Yi Lin, Pridi Banomyong (2014) found the results show that middle to lower classes

represented by the rural origins more intentionally capitalized on overseas education for new

opportunities abroad, while students from state cadre families were more inclined to return and

work in the home country.

At a stage near graduation, students with rural origins were more likely to be in a state of

looking for jobs while students from state cadre families were more likely to have plans for a

master degree. For the latter group of students, given the lack of drive for studying, it is probably

a decision or advice given by their parents rather than made by themselves. Among those who

were in a state of looking for jobs, students from state cadre and private owner families could not

wait to go back home, compared with others.

It is argued that institutional arrangements, formal or informal alike, play a critical role in

defining people’s opportunity structure and thus people’s rational actions. Overseas education

does not benefit everybody through an homogenous mechanism, rather, as shown in this article,

it both presents an upward (also geographically outward) mobility road for the middle-lower

classes in China, and serves equally well as a vehicle of inequality reproduction for those vested

with institutional advantages who plan to return and work in China.

To be specific, rational, constructive or reflective actors in practice are brought back to life.

After all, barring some complaints about unfairness from time to time, many Chinese never

hesitate to take chances to change their fates and indeed most people are living better lives in the

post-reform years.

Just like other new opportunities that emerged in the reforming years, overseas education can

either serve as a mechanism of maintaining inequality, or provide new opportunities for the

disadvantaged.

Known problems and difficulties of Chinese students studying in Thailand

Yi Lin and Worapinya Kingminghae (2014) studied with the backdrop of globalization,

increasing attention is being paid to international students’ experiences. In a sense, while

loneliness is intrinsic to the overseas experience for international students, failing to overcome it

may go hand in hand with mal adaptations. By analyzing data collected from a recent survey on

Chinese international students in Thai universities, the present study examined the roles played



I93

by different types of social support on alleviating international students’ loneliness. Huicai

You(2006) found that Chinese students studying in Thailand, the main problems are the

following: Understanding of Thailand's higher education is not clear, the purpose of studying

abroad is not clear; Foreign language foundation is not solid; Do not understand Thailand's

national conditions; Economic considerations are not considered. Yan Ye (2014) found the

students with low satisfaction after come study in Thai universities could affect by following

reasons: Most of the university in Thailand used a strategy of “easy-entry, hard-graduation” for

international students’ admission and education; The students may not get used to the learning

styles in universities of Thailand in a short time; Some agent or agency exaggerated the

advantages of studying at universities of Thailand in order to recruit more Chinese students in

marketing competitions; Still lack of good channels for both Chinese and Thais to understand

more about mutual culture and real educational information.

Ye Yan (2014) also found the difficulties faced by Chinese students in Thailand are mainly

including to: Language but off; Learning method is not suited; Poor coordination of learning and

work; Learning is easy to distract; Not suited to the diversity of the atmosphere.

From the above literature reviewed, the author came to the development of conceptual

framework as shown below.

Research Objective

1. To learn and understand problems and difficulties oversea Chinese students facing while

study in Northeastern Thailand universities

2. To analyze the expectation before and after coming to study in Thailand

3. To propose policy suggestions


This research is mainly based on qualitative research.

The key informants of this study including 20 oversea Chinese students come from two

universities whom study in northeastern of Thailand. Purposive sampling: 10 students from

Khon Kaen and 10 students Mahasarakham province.

The tool of this study is semi-structured in-depth interview forms. The researcher will draft

an interview outline with some open questions, which around the main question “What are the

problems and difficulties oversea Chinese students come across while studying in the

Northeastern region or Esan region of Thailand”.

This research will collect information with documentations and the semi-structured in-depth

interview.

Documentations include books and periodicals, academic journals, papers, news reports,

etc.



I94

The data were also obtained from interview records. The questions will be ask followed by

the interview outline, but author will choose to the order of questions based on the progress of

the interview, and also may ask questions about the issues that are derived from the interview.

Through the interview researcher is not trying to define these problems and difficulties that must

happened to any single Chinese oversea student who study in northeastern Thailand, but trying to

analysis the common factors that causes these problems and difficulties happen, and give some

feasible suggestions to improve these problems.

Analyzing qualitative data from research is a challenging but necessary task in the

innovation process. In this paper, the obtained data would be analyzed by thematic analysis

method. Thematic analysis is one of the most common forms of analysis in qualitative research.

The method has been widely used across the social, behavioural and more applied for (clinical,

health, education, etc.) sciences. It emphasizes pinpointing, examining, and recording patterns

(or "themes") within data. Thematic analysis goes beyond simply counting phrases or words in a

text and moves on to identifying implicit and explicit ideas within the data. This approach

emphasizes the participants' perceptions, feelings and experiences as the paramount object of

study.

Thematic analysis can be used to make sense of seemingly unrelated material. It can be used

to analyze qualitative information and to systematically gain knowledge and empathy about a

person, an interaction, a group, a situation, an organization or a culture.

From the analysis of data related to problems and difficulties of overseas Chinese students

studying in the Northeastern Thailand. The proposed policies can be presented as following.

Fig

Identify issues

Problems and

difficulties of

Chinese overseas

students study in

northeastern

universities in

Thailand.

Analyze the issues

-Academic problems

-Economic problems

-Cultural problems

-Law and regulation

problems

-Daily life problems

Agenda setting

1.academic and

learning environment

problems

2.language and

cultural problems

Possible solutions

1. The university should set a unique stagey plan to accommodate overseas

students

( well structure student activities, language courses, distribution information

related to university courses, etc.）

2. Develop close and continuous relationship between Chinese and Thai

university

3. Develop a customized program to better fit the need of international

student market

4. Diplomatic development in terms of visa issue for overseas students

studying in Thai university. The 7th National and International Graduate Study Conference 2017


I95

Result

In this research, data collection was conducted with 10 students from each university using

snow ball technical by random sampling. They were 5 female and 5 male students from MSU, 6

female and 4 male students from KKU. Most of them are first year or second year to come to

study in Thailand. Only two students from KKU are third year and fourth year to come to study

in Thailand. The searcher wrote the code for the 20 interviewees, as MSU-1 to MSU-10 and

KKU-1 to KKU-10.

The interview form with four points rating score was used to ask 20 students to rate. The

result can be shown in Table as follow. The score 1, 2 counting as not satisfy and low satisfy and

score 3, 4 counting as high and highly satisfy.

Level of satisfaction in various aspects

Items Level of Satisfaction

4-high 3-rather high 2-rather low 1-low

Academic (5)25％ (5)25％ (8)40％ (2)10％

Economic (7)35％ (3)15％ (4)20％ (4)20％

Culture (5)25％ (5)25％ (6)30％ (4)20％

Law and regulations (16)80％ (2)10％ (0)0％ (2)10％

Daily life (2)10％ (4)20％ (11)55％ (3)15％

According to the interview results, we can see that the academic expectation met the

expectation of majority of student (50％).The daily life showed the lowest expectation

percentage (70％) which indicated that the students found this issue did not meet their

expectation. The expectation in law and regulations showed the highest expectation percentage

(90%) which indicated that most of students were satisfaction for this issue. The expectation in

economic and culture showed that each item is average close percentage, which indicated that in

economic and cultural, Chinese students according to their own circumstances have different

experiences. The obtained data revealed the situation related to problems and difficulties of overseas

Chinese studying in the Northeastern Thailand can be concluded as follows:

1) Problems and Difficulties of overseas Chinese studying in the Northeastern Thailand, it

was found that language problem was the biggest problem. The next issue was academic

problem. Some students were doing part-time job for their supplementary income while

studying. The next issue was cultural problem. Some students reported the difficulty of practice

and participation in Buddhist cultural environment. The next difficulty was related to laws and



I96

regulations. It was interesting to learn about the situations where students facing some illegal

situation without know it. It was the case where students playing card in the university ‘dorm and

showed the picture in their Facebook. Then, they were called by their teacher and asked to delete

such a picture. Because playing card in Thailand is illegal. In this issue, there were many

situation seemingly to be minor cases, such as smoking in the campus, not wearing uniform to

the classes, the class attendant score was cut because the class absent due to students traveling

back home for Chinese New Year without notifying professor. The last minor case was the VISA

extension procedure was not well facilitated by the University.

2) The level of satisfaction of studying in the Northeastern Thailand, it was found that the

academic aspect was rather at the low level due to the difficulty in language. The daily-life

aspect, such as, hot weather, learning environment, recreation and entertainment as well as

student activities were also found to be low to very low in satisfaction.

3) Policy suggestions, the possible policy suggested should be as following: The university

should set a unique stagey plan to accommodate overseas students; Develop close and

continuous relationship between Chinese and Thai university; Develop a customized program to

better fit the need of international student market; Diplomatic development in terms of visa issue

for overseas students studying in Thai university.

Discussion

Academic problems and difficulties

It was found that English communication skill is a problem in studying in Thai university

classroom. At the same time in case of attending the class using Thai language as a medium of

instruction, the Chinese students also have insufficient background and level to meet the

proficiency level. So it is difficult to understand the contents instructed and lectured by the

teachers. This problem is in the same line as Ye Yan (2014) found that Chinese students in

Thailand had language problems.

Economic problems and difficulties

It was found that cost per month and they do not have enough to spend has become economic

problems for some students. The survey found that the cost of living per month of Chinese

students is in range of 10000baht to 25000baht. The accommodation cost is in range of 3000baht

to 5000baht.Through the study, the rest of cost is for food and entertainment. According to the

survey，the most popular entertainment activity of Chinese student in northeastern Thailand is

drink with friends in the bar. As the analysis of researcher, this is the main reason of Chinese

student meet the problem of economic as cost per month and they do not have enough to spend.

Rosenberg (2016) also found that the international students had financial problems.

Culture problems and difficulties

It was found that Thailand’s Buddhist cultural environment is a culture problem in culture

problems and difficulties. As everyone knows，Thailand is a Buddhist country, almost 90

percent of Thai population is Buddhist, so we can see that Buddhist Cultural is a very important

part of Thailand cultural environment. So adapt on the Thailand’s Buddhist cultural environment,

should be a serious problem for Chinese students.Hu Wenhua, Zhang Zhe (2013) also found



I97

socio-cultural issues is a kind of international students’ adjustment problems at university.

Law and regulation problems and difficulties

(1) Playing cards in Public which is illegal in Thailand.

Playing cards is a very popular entertainment activity in China. Families and friends like to

play cards together when meet. We can say that it is part of Chinese culture (including to

mahjong). But it is an illegal issue that playing card in public, so Chinese student should focus

on this serious cross-cultural problem.

(2) Smoking is a violation of rules and regulations of the university in the campus area.

China has a large population of smoking. Many young people are addicted to smoking.

Thailand’s smoking population is far apart from China, Thailand also has a law prohibiting

smoking in public places, especial in the campus area. Chinese students should be strict with

themselves in this behavior.

(3) Thailand holidays and vacation are different from China. And the university does not

allow overseas students to take vacation on their holiday without getting the class attendance

subtracts.

(4) Students are required to wear uniforms every day.

In Chinese universities, they don’t have to wear uniforms. But this is important regulation

of Thai universities for undergraduate students.

(5) Immigration visa problem

Thailand’s basic process of education visa for Chinese students is 1) the universities send

necessary documents to the Chinese students in China.2) Chinese students go to the embassy to

take 3 months education visa of Thailand .3) Chinese students go to Thailand’s immigration

office to change it to a 1 year education visa.4) do the 90 days report during the year. It looks like

a little bit complicated but remember the process will help Chinese students a lot. But one

Chinese student mentioned that the officers in the immigration office sometimes are not friendly.

She thought a complaint mechanism will help improve this problem just like in China.

The above mentioned problems were not clearly stated in the previous research. But they

were aspects that should be considered as important factors.

Daily life problems and difficulties

(1) The hot weather in northeastern Thailand.

Thailand is a subtropical country. The temperature is high year after year. Chinese

students who are really afraid of hot weather or have related skin disease should take this factor

for make decision to come study in Thailand.

(2) The inconvenient traffic in northeastern Thailand.

A big part of interviewee Chinese students talked about this problem. They are not

satisfied with road conditions and traffic management in northeastern Thailand. They think

Thailand traffic system need to be improved.

(3) There are too few entertainment activities and places in the northeastern Thailand.

In case of the hot weather in Thailand, people like indoor activities much more than

outdoor activities much in the day time, which make the night life activities much more

interested.

(4) Adapt to different food flavors between China and Thai.

In many places in China, people like the salty, oiled and spicy food. In Thailand, people like

the sweet, acid and light food much. For the Chinese people who take a short time in Thailand,



I98

they may love Thai food. But for the Chinese students, it could be a problem. As I know, many

Chinese students choose to take some sauce and flavoring when they came back from China.

The above problems seem to agree with Huicai You (2006) found similar problems

Chinese students studied in Thailand.

Recommendation

Suggestions for policy implementation cooperation

The university should develop the strategic plan to accommodate the overseas students in

every aspect.

The university should develop the institutional improvement for foreign students, such as

more reasonable course arrangement and teaching context for overseas students, to help them

better adapt to the life of studying abroad.

The university in Thailand and China should strengthen information exchange and

cooperation, to help a better understanding for each other as well as their students’ basic

information and statues.

The university in Thailand should provide warn learning and living environment for overseas

students by organizing activities while the Thai students and Chinese students can share and

cooperate their time.

At the present, the communication and cooperation between Thai universities and Chinese

universities are increasingly close, such as the “2+2” or “3+1” project. This is a great thing that

Chinese students and Thai students can experience the both side culture and environment during

the university life. But it is worth noting that the cooperation quality is declining. Some of

education cooperation is more and more close to the business model. Therefore the universities

should base their emotional management for oversea students separate from economic or

business scheme. Thai university should pay more attention to the overseas Chinese students,

understanding their problems and difficulties in academic, economic, culture, politics and daily

life，and make the effective solutions.

Suggestion for future research

Due to the limitation of this study in terms of coverage of the area, so the future research

should conduct the study of in every region of Thailand in order to obtain more constructive

body of knowledge related to the problem and difficulties of Chinese study in Thai universities.



I99

References

Baidu Wenku (2014 Jan 3). The significance of cross - cultural communication. Retrieved from

https://wenku.baidu.com/view/f5cc95f16137ee06eff918ff.html?from=search

Chen, C., & Xi, B. (2016). An analysis of three years later the status quo of postgraduates

studying abroad after graduation. In C. f. Globalization, Annual Report on the Development of

Chinese Students Studying Abroad. Beijing: Center for China & Globalization.

China news agency. (2014, January 18). China has become Thailand’s largest student source

country. Retrieved March 16, 2015, from http://news.xinhuanet.com/edu/2014-

01/18/c_119028045.htm

Douglas, W. R. (2002). Cross-Cultural Research: An Introduction for students. Retrieved from

eclectic.ss.uci.edu/~drwhite/courses/Cross-Cultural_Research.pdf

Hengan, W., Lina, Z., Qixin, Z., & Jin, W. (2016, January 11). Educational instrumental value

and educational value. Retrieved May 16, 2015, from

https://wenku.baidu.com/view/66cf87fd5a8102d277a22f72.html

Hongzhi, Y., Ruangkanjanases, A., & Chen, C. (2015). Factors Affecting Chinese Students'

Decision Making toward Thai Universities. International Journal of Information and Education

Technology , 5 (3), 189.

Hsiao-ping, W., Garza, E., & Guzman, N. (2015). International student’s challenge and

adjustment to college. Education Research International , 2015, 1-10.

Huicai, Y. (2006). Issues on Chinese Students for Overseas Studies in Thailand. Around

Southeast Asia .

Huiyao, W., Lyu, M., & Jinlian, Z. (2016). The development of China’s studying abroad in an

era of globalization: characteristics and suggestions. In C. f. Globalization, Annual Report on the

Development of Chinese Students Studying Abroad. Beijing: Center for China & Globalization.

ICEF monitor (2016 Apr 6) A record number of Chinese students abroad in 2015 but growth is

slowing

From:http://monitor.icef.com/2016/04/a-record-number-of-chinese-students-abroad-in-2015-but-

growth-is-slowing/

Jaroensubphayanont, N. (2014). The International Student Policy in Thailand and the Implication

of the 2015 ASEAN Economic Community. Southeast Asian Studies in Asia from

Multidisciplinary Perspective International Conference. Kunming: China.

Jinlian, Z., Lyu, M., & Feiyi, W. (2016). An analysis of chinese returnees returned overseas and

the circulation. In C. f. Globalization, Annual Report on the Development of Chinese Students

Studying Abroad. Beijing: Center for China & Globalization.



I100

https://wenku.baidu.com/view/f5cc95f16137ee06eff918ff.html?from=search

http://monitor.icef.com/2016/04/a-record-number-of-chinese-students-abroad-in-2015-but-growth-is-slowing/

http://monitor.icef.com/2016/04/a-record-number-of-chinese-students-abroad-in-2015-but-growth-is-slowing/

Jinlian, Z., Qiran, Z., & Fei, Y. (2016). Chinese students studying in North America: current

situation and prospects. In C. f. Globalization, Annual Report on the Development of Chinese

Students Studying Abroad. Beijing: Center for China & Globalization.

Kelly, S. (2016, November 16). Chinese Keen on Thai studies. Retrieved January 10, 2015, from

Bangkok Post: http://www.bangkokpost.com/learning/education-features/206591/chinese-keen-

on-thai-studies

Lin, Y. (2014). Family Background and Overseas Education of Chinese Students in Thai

Universities. Thammasat Review , 17 (1), 122-149.

Lin, Y., & Kingminghae, W. (2014). Social Support and Loneliness of Chinese International

Students in Thailand. Journal of Population and Social Studies , 22 (2), 141-157.

Lyu, M., Jinlian, Z., & Jianfang, W. (2016). Investigating current situation of Chinese returnees

in 2016. In C. f. Globalization, Annual Report on the Development of Chinese Students Studying

Abroad. Beijing: Center for China & Globalization.

Lyu, M., Jinlian, Z., & Jiayu, W. (2016). The development of overseas Chinese students

organizations under the craze of studying abroad—A case of all-china students’ federation

(ACSF). In C. f. Globalization, Annual Report on the Development of Chinese Students Studying


Lyu, M., Jinlian, Z., & Qiran, Z. (2016). Chinese students studying in East Asian and other “the

belt and road (b&r)” countries: current situation and prospects. In C. f. Globalization, Annual

Report on the Development of Chinese Students Studying Abroad. Beijing: Center for China &

Globalization.

Lyu, M., Jinlian, Z., Jianfang, W., & Qingqian, D. (2016). Investigating university graduates

studying abroad in 2015. In C. f. Globalization, Annual Report on the Development of Chinese

Students Studying Abroad. Beijing: Center for China & Globalization.

Lyu, M., Qing, L., & Jinlian, Z. (2016). A study on the phenomenon of returnees participated in

politics. In C. f. Globalization, Annual Report on the Development of Chinese Students Studying


Office of the Higher Education Commission. (2009). Bureau of International Cooperation

Strategy. Ministry of Education.International Programmes in Higher Education Institutions.

Retrieved from

http://inter.mua.go.th/main2/list.php?id=fa02

Qingqian, D., & Xiaomeng, S. (2016). Chinese students studying in oceania: current situation

and prospects. In C. f. Globalization, Annual Report on the Development of Chinese Students




I101

Qiran, Z., Fei, Y., & Hua, Z. (2016). Chinese students studying in Europe: current situation and

prospects. In C. f. Globalization, Annual Report on the Development of Chinese Students


Selvarajah, C. (2006). Cross-cultural study of Asian and European student perception: The need

to understand the changing educational environment in New Zealand. Cross cultural

management: An international Journal , 13 (2), 142-155.

Songsathaphorn, P., Chen, C., & Ruangkanjanases, A. (2014). A Study of Factors Influencing

Chinese Students’ Satisfaction toward Thai Universities. Journal of Economics, Business and

Management , 2 (2), 105-111.

Universities Scotland. (2013, September 3). Universities Scotland takes positive case for

overseas students studying in Scotland to UK Parliament with launch of new report. Retrieved

March 5, 2015, from http://www.universities-scotland.ac.uk/news/universities-scotland-takes-

positive-case-for-overseas-students-studying-in-scotland-to-uk-parliament-with-launch-of-new-

report/

University World News. (2009, September 20). GLOBAL: What defines an international

student? Retrieved January 2, 2015, from

http://www.universityworldnews.com/article.php?story=20090917182725104

Verbik, L., & Lasanowski, V. (2007). International student mobility: Patterns and trends. World

Education News and Reviews , 20 (10), 1-16.

Yan, Y. (2014). A Study on Factors Affecting Chinese Students’ Decision-making of Studying at

Universities in Thailand. Bangkok: Graduate School of Education, Assumption University.

Yan, Y. (2014). An Analysis of the Causes, Difficulties and Countermeasures of Chinese

Students Studying in Thailand. Retrieved May 23, 2015, from

https://wenku.baidu.com/view/cb22189ede80d4d8d05a4f0b.html

Yingxiu, L., & Noungbunnak, S. (2016). Factors affecting the decision of Undergraduate

Chinese students in Bangkok, Thailand. DPU graduate studies journal , 4 (3).



I102

Study of larvicidal efficacy and insecticide synergistic effect of Piper longum extracts

against Aedes aegypti mosquitoes

Author: Yemane Gebremeskal*1

, Panida Duangkaew1, Chaowanee Laosutthipong

1, and

Nuananong Jirakanjanakit2

Program: Master of Science in Bioscience for Sustainable Agriculture. Institute: 1Faculty

of Animal Sciences and Agricultural Technology, Silpakorn University, Phetchaburi IT

campus, Cha-am, Phetchaburi 76120, Thailand. 2

Institutes of Molecular Biosciences,

Mahidol University, Phuttamonthon 4 Road, Salaya, Nakhon Pathom 73170, Thailand *Corresponding author : [email protected]

Abstract

Aedes agypti mosquitoes (Diptera: Culicidae) are a key threat for millions of people

and animals worldwide since they act as vectors for devastating pathogens and parasites,

including dengue, yellow fever Japanese encephalitis, filiariasis, and Zika virus. Mosquito

young instars are usually targeted using insecticide. However, these chemicals have negative

effects on human health and the environment and induce resistance in a number of vectors. In

this context, newer and safer tools have been recently implemented to enhance mosquito

control. The potential of screening plant species as sources of metabolites for entomological

and parasitological purposes is worthy of attention. Here we investigated the toxicity of

Piper longum extracts and chemical insecticides (deltamethrin, permethrin, and temephos)

against fourth instar of Aedes agypti mosquitoes. The Salaya stain showed the highest

resistance to deltamethrin and lowest resistance to the P. longum extracts, with the RR50

13.75 and 1.75 respectively. The biochemical enzyme assays; α-esterase, β-esterase, GSTs,

and MFOs of Salaya strain was elevated by 4.13, 3.92, 2.0 and 1.94 folds, respectively,

compared to the Bora-Bora reference strain. In our study, combined application of P. longum

extracts and deltamethrin revealed the synergistic action of the extract, the SR50 of Salaya

stain was increased by 3.24 fold. Overall, this study highlights that P. longum extracts

individual and/or combinations with deltamethrin are a promising source of eco-friendly and

cost effective larvicides against the important Ae. agypti mosquito.

Keywords: Aedes aegypti; Insecticide resistance; Deltamethrin; Piper longum; Synergism.



I103


Introduction

Mosquitoes are well known as vectors of disease-causing agents to humans and

other animals (Mgbemena, 2016). Aedes aegypti is a predominately human-biting mosquito,

an important vector for most of the life threatening diseases such as dengue fever, yellow

fever, chikungunya fever and Zika virus (Mackenzie et al., 2004; Govindarajan and

Sivakumar, 2014; Dusfour I. et al., 2015). Of all the viral diseases carried by Ae. aegypti,

dengue fever has been reported to increase dramatically around the world in recent years.

The World Health Organization (WHO) estimates that there may be 50–100 million dengue

infections worldwide every year (WHO, 2012).

Vector control is the most widely used option to interrupt the transmission of the

disease as long as an effective, safe and affordable vaccine is not available for these arboviral

diseases. The control of this Aedes insect remains an important issue in agriculture and public

health in urban and countryside (Lima et al., 2011; Bisset et al., 2013). Disease preventive

operation still solely depends on the anti-vector measures using conventional chemical

insecticides (Kumar, 2010) such as carbamate (propoxur), organophosphate (temephos),

chlorinated hydrocarbons (DDT and chlordane), and pyrethroids (deltamethrin and

permethrin). Nevertheless, the extensive and widespread use of synthetic insecticides has led

to the emergence of resistance in mosquitoes globally and prompted an uncontrolled increase

in the mosquito population (Hemingway, 2000). Recent studies indicate that over 500 insects

and mite species are currently resistant to pesticides (Mann and Kaufman, 2012). In

Thailand, many synthetic insecticides have been applied for controlling of Aedes mosquito

for decades. Up to date, the resistance of Ae. aegypti to insecticides, including temephos,

DDT, permethrin, deltamethrin, have been reported from several areas of Thailand

(Pimsamarn, 2009; Huaycharoensuk et al., 2011). The resistance to temephos was found in

Ae. aegypti larvae from some areas of Thailand, such as Nakhon Sawan,Tak (Mae Sot), and

Mukdahan (Ponlawat et al., 2005). One of the recognized mechanisms is an overproduction

of detoxifying enzymes, also known as metabolic resistance. These enzymes are naturally

involved in the degradation or transformation of toxic compounds into non-toxic products

before elimination from the insect body. Three large enzyme families, the cytochrome P450

monooxygenases (P450s), Glutathione-S-transferases (GSTs) and carboxy/cholinesterases

(CCEs) have been implicated in the metabolism of insecticides in insects have been reported

(Li and Schuler, 2007).

Chemical insecticides for controlling mosquito-borne diseases are enhancing not

only problems like vector resistance to insecticides but also the insecticides themselves

present threats to the ecosystem and human health (WHO, 1995). In light of such trends the

urgent needs for the development of mosquito control alternatives that are eco-friendly and

cost effective should be addressed adequately and promptly. To this end, explorations of

natural products from plant origin with insecticidal properties are in the current trend.



I104

Plant extracts have drawn a great deal of attention because they are considered to

be a potential source of bioactive chemical compounds that are relatively safe with few side

effects on the environment and human health (Sukumar et al.,1991; Ahn et al., 2006; Isman,

2006). Plants have been the traditional source of natural pesticides, as they often act at

various novel target sites (Kostyukovsky et al., 2002; Priestley et al., 2013) and thus

significantly retard the possibility of resistance development in mosquitoes. In literature

sources, only 344 of these plant species out from approximately 1200 species tested

exhibited mosquitocidal activity (Ghosh et al., 2012). Among plant tested, extract from Piper

species produced potent larvicidal activity against Ae. aegypti (Ghosh et al., 2012). Piper

longum and their bioactive constituents are reported to have remarkably larvicidal activity

against various mosquito species such as Culex pipiens pallens, Ae. aegypti, Aedes togoi, and

Aedes atropalpus (Pereda-Miranda et al., 1997, Lee, 2000; Park et al., 2002).

Since the resistance problem has been identified, besides using a single compound

in control of mosquito vectors, the idea of using a synergistic combination of biological and

chemical insecticides yields a promising alternative for insect pest management (Morales-

Rodriguez and peck, 2009; Nelson Grisale et al., 2013). Synergism provides similar control

at reduced concentrations of the two compounds relative to individually applied compounds,

then cost and toxic to mammalian and non-target organisms may be substantially reduced.

Synergism strategy is based on the probability that if resistance to one of the two insecticides

is a rare and independent event, then the probability that resistance will occur simultaneously

to both insecticides of the mixture could be extremely low (Curtis, 1985). Based on the

strategy that if detoxification is inhibited, the effectiveness of insecticides will increase due

to the prolong bioavailability of insecticides in the insect body.

In this context, the present investigation was carried out with the aim to determine

the effect of plant extract in both killing potential and synergism effect in control of a field-

collected pyrethroid-resistant Ae. aegypti. The Ae. aegypti population collected from the

suburban area, Salaya, Nakorn Pathom province, Thailand was investigated for insecticide

resistance status and assess for the underlying metabolic resistance mechanisms. Monitoring

insecticide resistance in mosquito populations and understanding the mechanisms involved is

a prerequisite to efficient implementation of vector control strategies. Larvicidal effect of P.

longum extracts alone and synergistic activity to pyrethroid insecticide were determined

against fourth instar larvae of this pyrethroid-resistant Ae. agypti population in order to

establish the use of this plant as an alternative in the control of Ae. aegyti mosquito. This

study is immensely important to develop future resistance management strategies.

Objectives

1) Evaluate the status of insecticide resistance/susceptibility of field-collected Ae. aegypti

2) Determine the detoxification enzymes potentially play a role in the resistance



I105

3) Investigate larvicidal activity of P. longum extracts against field-collected Ae. Aegypti

4) Evaluate insecticide synergistic effect of P. longum extract against Ae. Aegypti


Mosquito strains and rearing conditions

The test insect used in this study is mosquito of the species of Aedes aegypti

population collected from Salaya, Nakorn Pathom province, Thailand during 2014. The

reference for the susceptible population used in this study was Bora Bora (French Polynesia)

Ae. aegypti strain, obtained from Laboratories Lutte controls Insects Nuisibles (LIN/IRD),

WHO Collaborating Center for Vector Control, Montpellier, France (Jirakanjanakit et al.,

2007). Mosquito colonies were maintained in the insectarium at the Institute of Molecular

Biosciences, Mahidol University, Salaya campus, Nakhon Pathom province, Thailand, under

laboratory-controlled conditions at 28±2 °C, 70˗80% RH to the adult stage. Egg colony was

obtained and reared in the laboratory of Faculty of Animal Science and Agricultural

Technology, Silpakorn University, Thailand. In order to obtain synchronized larvae, eggs

were soaked in dechlorinated tap water for hatching larvae and maintained at 28±2°C. The

larvae were kept in the white basins half-filled dechlorinated tap water and were fed once a

day. Water in rearing container was refreshed every day. Care was taken to prevent

overcrowding until development to fourth instar larvae required for the study then larvae

were submitted to the bioassays.

Piper longum extraction

The dried fruits of P. longum fruit obtained from local market were powdered

coarsely. The method of (Gueye et al., 2011) was used for the process; 500 grams of powder

of P. longnum were macerated in 5 L of 95% ethanol for 72 h at room temperature avoiding

from the sunlight. The filtrate was pooled and subjected to the rotary evaporator apparatus

for the removal of ethanol solvent to obtain a crude extract. The crude extracts obtained are

finally weighed and kept in a refrigerator at -20oC until bioassays (Bhan et al., 2013).

For bioassay, 10g of residues were dissolved in ethanol to get stock solutions. A

range (1.25-30 mg/ml) of test concentrations was prepared from the crude extract by further

dilution from the stock solution using an absolute ethanol as a diluent.

Larvicidal toxicity bioassay

The technical materials of many organic compounds are insoluble in water. The

insecticides were dissolved in absolute ethanol to dilute solutions for laboratory testing.



I106

Different working test concentrations were prepared by diluting the stock solution for the

exposure to mosquito larvae according to WHO (WHO, 2005).

Larvicidal bioassays were done according to the procedure recommended by WHO

(WHO, 2005). Batches of 20 fourth instar larvae were transferred to a disposable plastic

cups, each containing 100 ml of water. After 1 h, the unhealthy or damaged larvae were

removed and replaced. The appropriate volume of test insecticide or P. longum extract was

added to the cups to obtain the desired target dosage. Initially, the mosquito larvae were

exposed to a wide range of test concentrations and a control to find out the activity range of

the materials under test. After determining the mortality of larvae in the wide range of

concentrations, a narrower range of deltamethrin (0.0004-0.2ppm), permethrin and temephos

(0.000625-0.4 ppm), and P. longum extract (2.5-20ppm) concentrations yielding between

10% and 95% mortality in 24 h exposure was used. Four replicates were set up for each

concentration and an equal number of vehicle control cups were set up simultaneously. Each

test was run three times on different days. During the assay, the larval food was not added.

After 24 h exposure, larval mortality was recorded. Larva with abnormal morphology

and moribund larvae were counted and added to dead larvae for calculating percentage

mortality. Dead larvae are those that cannot be induced to move when they probed with a

needle in the siphon or the cervical region. Moribund larvae are those incapable of rising to

the surface or not showing the characteristic diving reaction when the water is disturbed.

Larvae that have pupated during the test period were neglected. If more than 10% of the

control larvae pupate in the course of the experiment, the test was discarded and repeated.

Percent larval mortality from all replicated was pooled for analysis of 50% lethal

concentration (LC50) values by a log dosage–probit analysis using StatPlus program (Analyst

Soft Inc., USA). Resistance ratios (RR50) were calculated by divided LC50 value of the

respective insecticide against Salaya population by those of Bora-Bora.

Synergist bioassays

To assess the role of the main detoxification enzyme families in deltamethrin

resistance, either PBO (piperonylbutoxide 90%, Sigma-Aldrich, Italy) or DEF (S.S.S-

tributylphosphorotrithioate 98.1%, Chem service, USA) which is the inhibitor of P450s and

esterases, respectively, was used in synergist bioassays. Before proceeding to the synergism

assay, different concentrations of test synergists were determined for larvicidal toxicity using

larvicidal bioassay as described in section c in order to obtain appropriate sub-lethal

concentrations (Riaz et al., 2013). Standard deltamethrin larval toxicity bioassays as

described in Larvicidal toxicity bioassay test with doses ranging from 0.0006–0.0354 ppm

were carried out with and without the addition of a specified sub-lethal concentration of

synergist: either PBO at 7.5 ppm, DEF at 2 ppm and Piper extract at 5 ppm. Synergism ratios



I107

were calculated as the ratio between the LC50 obtained without synergist and the LC50

obtained with each test synergist.

Biochemical enzyme assay

Activity levels of α-esterases, β-esterases, glutathione-S-transferases (GSTs) and

mixed function oxidases (MFOs) were tested in Salaya larvae, with larvae from the Bora-

Bora strain used as a susceptible reference. Procedures were based on mosquito-specific

biochemical assay protocols reported elsewhere (Brogdon WG, 1984 and 1988; Polson et al.,

2011). Briefly, 30 individual larvae were homogenized in 100 µL of 0.1 M potassium

phosphate buffer pH 7.2 and then the volume was diluted to 1 mL. The homogenate was

centrifuged at 10,000 rpm for 5 min and the supernatant used as enzyme sources. Fifty

microliters of each sample was transferred by triplicate to a 96-well microtiter plate

(Microplate reader “Spectro Star Nano”, Germany). The reaction was performed in a total

volume of 300 µL per reaction adjusted by addition of reaction buffer. For nonspecific α- and

β-esterase assay, 100 µL of α- or β -naphthyl acetate were added to each well. After 10 min

incubation at room temperature, 100 µL of dianizidine were then added, followed by 2 min

incubation and then absorbance was read at a wavelength of 540 nm. For GSTs assay, 100

µL of reduced glutathione and 100 µL of 1-chloro-2, 4–dinitrobenzene (CDNB) were added

to each well. Absorbance readings were taken at time zero to 5 min at a wavelength of 340

nm with a one minute interval. The assay measure MFOs activity relied on detection of the

amount of haem. Tetra methyl-benzidine dihydrochloride (TMBZ) (200 µL) were added to

each well, followed by 25 µL of 3% hydrogen peroxide (H2O2). The microplate was

incubated at room temperature for 10 minutes before absorbance was reading at a wavelength

of 620 nm. To avoid bias due to natural variations in the size of the larvae, the total protein

content of each sample was determined. In triplicate, 200 µL of Bradford H reagent was

added to 20 µL of homogenate. The mixture was incubated at room temperature for 5 min

and the microplate was read at 595 nm. A standard bovine serum albumin calibration curve

was done for comparison of protein concentrations. Mean absorbance values of replicate

wells for each test were converted into enzyme activity and divided by the protein values.

The fold-changes in enzyme activity of Salaya population were calculated by the ratio of

enzyme activity of Salaya over those of Bora-Bora reference strain.

Statistical analysis

The LC50 values and other statistics including 95 % confidence of upper confidence

limit and lower confidence limit, P values, and chi-squared values were estimated by Probit

analysis using the Statistical software. Student t-test was performed using Graphpad Prism

ver. 5.0 (GraphPad Software, San Diego, CA).



I108

Results

Assessment of insecticide resistance status and larvicidal efficacy of Piper longum

extract

The susceptibility status of Ae. agypti to insecticides was shown in Table 1. The

larvicidal bioassays with temephos, permethrin, deltamethrin and P. longum extract treatment

indicated that the Salaya strain was resistant to those insecticides with RR50 of 5.3, 7.0, 13.75

and 1.75, respectively, compared to Bora-Bora reference strain. The data revealed that Salaya

strain was highly resistant to deltamethrin pyrethroid insecticide and lowest resistance to P.

longum extract.

The present study showed that the extract of the fruit of P. longum expressed

larvicidal activity against the fourth-instar larvae of Ae. aegypti. The mortality of the

mosquito larvae was noted in the various concentrations (5.157–26.372 ppm) of the plant

extracts after 24 hours of exposure. The data presented in Table 1 revealed that P. longum

extract was effective with LC50 of 11.66 ppm for Salaya strain and 6.66 ppm for lab strain

(Bora-Bora strain).

Table 1 Bioassay of chemical insecticides and P. longum extract against fourth-instar Ae.

aegypti larvae.

Strain Treatment LC50a, ppm (95% CI) RR50

b

Salaya Temephos 0.0179 5.3

(0.0075–0.0426)

Permethrin 0.019 7.0

(0.0029–0.1243)

Deltamethrin 0.0055 13.75

(0.0006–0.0354)

P. longum extract 11.66 1.75

(5.157–26.372)

Bora- Bora Temephos 0.0034

(0.009–0.0126)

Permethrin 0.0027

(0.001–0.0072)

Deltamethrin 0.0004

(0.0001–0.0021)

P. longum extract 6.66

(2.55– 12.6) aLC50: Lethal concentration at which 50% of the population is killed.

bRR50: Resistance ratio at LC50, calculated as the ratio between Salaya and Bora-Bora LC50.



I109

Biochemical assay

The results of the biochemical assays of detoxifying enzymes from different study

sites are presented in Figure 1.The investigations indicated the elevated levels of α- and β-

esterases, (MFOs), and glutathione –S-transferase (GST) enzymes in the Salaya population

compared with the susceptible Bora-Bora strain.

The greatest increase was observed in the α- and β-esterase assays with mean

activity in the Salaya strain 4.13, 3.92 times greater than the Bora-Bora strain respectively.

The corresponding fold changes for GST and MFOs activity are 2.0 and 1.94, respectively.

Figure 1 Fold-changed (mean ± SD) in enzymatic activity of Salaya populations

compared to Bora-Bora reference strain. * Indicates significant different between Bora-Bora

and Salaya within the same enzyme test by Student’s t-test (P<0.05).

Synergist bioassays

From insecticide susceptibility assessment, Salaya was manifested highly resistant to

deltamethrin (Table 1) therefore it was selected for synergism study.The results reveal that

deltamethrin treatment against resistant Salaya larvae in the presence of test synergist at the

sub-lethal concentration (7.5, 2 and 5 ppm for PBO, DEF and P. longum extract respectively)

showed lower LC50 values compared to treatment with deltamethrin alone (Table 2). The

synergism ratio (SR50) of P. longum extract, DEF and PBO is approximately 3.24, 11 and

18.33, respectively.

∗

∗

∗

0

1

2

3

4

5

6

α-esterase β-esterase GST MFO

fold

ch

ange

d a

ctiv

ity

Bora- Bora

Salaya

∗

∗

∗



I110

Table 2 Deltamethrin Synergist bioassays with PBO, DEF and P. longum extract against Ae.

aegypti Salaya population.

Strain Treatment LC50a, ppm (95% CI) RR50

b

Salaya Deltamethrin alone 0.0055

(0.0016–0.0295)

Deltamethrin + P. longum extract 0.0017 3.24

(0.003–0.011)

Deltamethrin + DEF 0.0005m 11

(0.0001–0.0062)

Deltamethrin + PBO 0.0003 18.33

(0.0001-0.002) aLC50: Lethal concentration at which 50% of the population is killed.

bSR50: Synergism ratio at an LC50, calculated for each strain as the ratio between the LC50 of

the deltamethrin without synergist and the LC50 using each synergist.

Discussion

Mosquitoes are important vectors of parasitic, viral pathogens and serious offensive

pests to humans and animals. Therefore, the management of mosquito populations and

control of mosquito-borne disease transmission are of prime importance. The most widely-

used mosquito control strategies at present are the use of various formulations of chemical

insecticides to kill larvae and adults (Conn JE, 2002). However, these tools are not always

efficient, applicable, or available. Increased resistance of mosquitoes to chemical insecticides

and their effect to the environment make them prohibitive in many settings (Hemingway et

al., 2006; Lacey, 2007).

In this study the resistance status of Ae. agypti in Salaya district, Nakorn Pathom

province, Thailand was investigated compared to susceptible reference Bora-Bora strain.

Toxicological results showed that Ae. aegypti populations of Salaya were resistant to

temephos, permethrin and deltamethrin (Table 1) with RR50 of 5.5, 7.0 and 13.75,

respectively, The highest resistant level observed from deltamethrin followed by permethrin

suggesting pyrethoid resistance in these Ae. aegypti population. A similar study was carried

out and reported high levels of insecticides resistance in Ae. aegypti in different parts of the

world including Thailand (Ponlawat et al., 2005; McAllister et al., 2012).

Early detection and knowledge of the resistance status, as well as the underlying

mechanisms in vector mosquitoes are essential for effective long-term control of dengue

vectors. Larvicidal bioassays along with biochemical assays could be used together to

improve the surveillance of resistance and monitoring of the efficacy of insecticides. Based

on the results of the biochemical assays employed here, it is most evident that insecticide

resistance especially high deltamethrin resistance is mediated by detoxifications. The

biochemical profiling of general detoxification enzyme systems from the site showed

evidence of α- and β-esterase, MFOs and GSTs activity elevation. The presence of clear



I111

correlations between enzyme levels and resistance phenotypes indicate that detoxification

could be an underlying mechanisms contributing to resistance.In Thailand showed that

increased MFOs, α- and β-esterase activities in Ae. aegypti strains were associated with

pyrethroid (deltamethrin and permethrin) resistance (Paeporn et al., 2004). Thus our study

suggests that continuous resistance monitoring should be conducted in the Salaya to identify

the efficacy of compounds for dengue control and to facilitate selection of compounds with

the greatest promise for halting or minimizing dengue infections.

The pesticides of plant origin are biodegradable, efficient and suitable alternative for

mosquito control (Shaalan et al. 2005). Plant compounds have been reviewed for growth

retarding, reproduction inhibiting, ovicides, larvicides, synergistic, additive, and antagonistic

activities of the botanical mixture. Various other workers have reported botanicals as

effective mosquito larvicides (Kovendan and Murugan, 2011; Ghosh et al., 2012; Raveen et

al., 2014). In the present study, the ethanol extracts of P. longum was shown effective against

Salaya Ae. aegypti larva with LC50 value of 11.66 ppm. os compared to the previos reports ,

LC50 11.66 ppm of this study, was comparatively more effective than the acetone extracts of

P. longum LC50 15.64 ppm (Madhu et al, 2011), however less effective than the ethanol

extracts of P. longum LC50 8.13 ppm (Chaithong et al., 2006).The difference in the activity

and components may be due to the environment and nature of the plants and test organisms

used in the experiments. It is important to note that the bioactivity of the plant extracts

mainly depend on the number of compounds present, chemistry of photoproduct and nature

of the solvent and procedure followed for extraction.

The synergistic effect of various control agents has proved very advantageous in the

control of various pests (Seyoum et al., 2002). The joint action using a combination of

botanical extracts and different synthetic insecticide against several vectors have been

supported by several previous studies (Shaalan et al., 2005; Mohan et al., 2006 and 2007). In

our study, combined application of deltamethrin and the P. longum extracts revealed the

synergistic action of the extract against Salaya Ae. agypti. The binary mixture proved to be

more effective than deltamethrin or P. longum extracts when applied individually. The

synergistic activity may be due to the plant extract inhibiting some factors which can act

against synthetic chemicals as reported in Ae. aegypti such as detoxification systems

(Thangam and Kathiresan, 1991). Thus far, studies on synergistic/toxic effects of binary

mixtures involving phytochemicals and synthetic insecticides have been conducted on

agricultural pests (Mesbah et al., 2006 and 2007). For instance, Solanum xanthocarpum

extract induced synergism with cypermethrin against larvae of Culex quinquefasciatus

(Mohan et al., 2006).

Conclusion

Exploration of natural products from plants can be considered as an important

alternative insecticide for the control of mosquito larvae. Overall, our results showed that P.

longum extracts showed moderate larvicidal activity and synergistic activity with

deltamethrin against Ae. agypti larvae. Mixtures of phytochemicals and insecticides were

found to be more effective than insecticides or phytochemicals alone and could be a good

eco-friendly approach to reducing the dose of chemicals to be applied in vector control



I112

programs. Active plant-derived compounds from P. longum with both larvicidal and

synergistic activity should be further determined.

Recommendations

Eco-friendly combination of insecticide and synergists are essential to achieve

effective, safety, environmental and economic benefits in vector control. This should be

taken into account when devising future vector control and insecticide resistance

management strategies.

Acknowledgements

This work was supported by National Research Council of Thailand (NRCT) grant

number 2559A11402070 and partially supported by Faculty of Animal Sciences and

Agricultural Technology, Silpakorn University, Thailand. Acknowledgement is extended to

Thailand International Corporation Agency (TICA) for the financial assistance. I would like

to express my grateful to Dr. Suphavadee Chimtong and Ms. Supawadee Suebsai for

technical assistance.

References

Ahn Y.J., Kim S.I., Kim H.K., and Tak J.H. (2006). “Naturally occurring house dust mites control agents: development and commercialization.” Advances Phytomedicine 3, 2 (October): 269-289.

Bhan S., Shrankhla, Sharma P., Mohan L., and Srivastava C.N. (2013). “Larvicidal toxicity of temephos and entomopathogenic fungus, Aspergillus flavus and their synergistic activity against malaria vector, Anopheles stephensi.” Journal of Entomol and Zoo Studies 1, 6 (November) 55-60.

Bisset J.A., Marín R., Rodríguez M.M., Severson D.W., Ricardo Y., French L, Díaz M., and Pérez O. (2013). “Insecticide resistance in two Aedes aegypti (Diptera: Culicidae) strains from Costa Rica.” Journal of Medical Entomology 50, 2 (March):352-61.

Chaithong U., Choochote W., Kamsuk K, Jitpakdi A., Tippawangkosol P., Chaiyasit D., Champakaew D., Tuetun B., and Pitasawat C.B. (2006). “ Larvicidal effect of pepper plants on Aedes aegypti (L.) (Diptera: Culicidae). Journal of the Society for Vector Ecology 31, 1 (June):138-144.

Conn J,E., Wilkerson R.C., Segura M.N., de Souza R.T., Schlichting C.D., Wirtz R.A., and Póvoa M. M. (2002). “Emergence of a new neotropical malaria vector facilitated by human migration and changes in land use.” The American Journal of Tropical Medicine and Hygiene 66, 1(January): 18–22.

Curtis C.F. (1985). “Theoretical models of the use of insecticide mixtures for management of resistance.” Bulltein of Entomological Research 75, 2 (June): 259–266.

Dusfour I., Zorrilla P., Guidez A., Issaly J., Girod R., Guillaumot L., Robello C., and Strode C. (2015). “Deltamethrin Resistance Mechanisms in Aedes aegypti Populations from Three French Overseas Territories Worldwide. PLOS Neglected Tropical Diseases 9, 11 (November) : e0004226

Ghosh A., Chowdhury N., and Chandra G. (2012). “Plant extracts as potential mosquito larvicides.” Indian Journal of Medical Research 135, 5 (May): 581–598.



I113

Govindrajan M., and Sivakumar R. (2014). “Larvicidal, ovicidal, and adulticidal efficacy of Erythrina indica (Lam.) (Family: Fabaceae) against Anopheles stephensi, Aedes aegypti,and Culex quinquefasciatus (Diptera: Culicidae).” Parasitology Research 113, 2 (February) 777-791.

Gueye S., Diop M.T., and Seck D. (2011). “Sembene M. Biochemical fractions activity of Annona senegalensis pers. Extract leaves to protect groundnut against the seed-beetle Caryedon serratus Ol (Coleoptera, Chrysomelidea,Bruchinae).” International Journal of Plant, Animal and Environmental Science 1, 2 (January):122-130.

Hemingway J., Beaty B.J., Rowland M., Scott T.W., and Sharp B.L. (2006). “The innovative vector control consortium: improved control of mosquito-borne diseases.” Trends Parasitology 22, 7 (July): 308–312.

Hemingway J.,and Ranson H. (2000). “Insecticide resistance in insect vectors of human diseases.” Annual Review Entomology 45, 1 (January): 371-391.

Isman M.B. ( 2006). “Botanical insecticides, deterrents, and repellents in modern agriculture and an increasingly regulated world.” Annual Review of Entomology 51, (January): 45 – 66.

Jirakanjanakit N., Rongnoparut P., Saengtharatip S., Chareonviriyaphap T., Duchon S., Bellec C., and Yoksan S. (2007). “Insecticide susceptible/ resistance status in Aedes (Stegomyia) aegypti and Aedes (Stegomyia) albopictus (Diptera: Culicidae) in Thailand.” Journal of Economic Entomology 100, 2(April): 545-550.

Komalamisra N., Srisawat R., Phanbhuwong T., and Oatwaree S. (2011).“Insecticide susceptibility of the dengue vector, Aedes aegypti (L.) in metropolitan Bangkok.” Southeast Asian Journal of Tropical Medicine Public Health 42, 4 (July): 814-823.

Kostyukovsky M., Rafaeli A., Gileadi C., Demchenko N., and Shaaya E. (2002). “Activation of octopaminergic receptors by essential oil constituents isolated from aromatic plants: Possible mode of action against insect pests.” Pest Management Science 58, 11 (November): 1101-1106.

Kumar K., Singh P.K., Tomar J., and Baijal S. (2010). “Dengue: epidemiology, prevention and pressing need for vaccine development.” Asian Pacific Journal of Tropical Medicine 3, 12 (December): 997-1000.

Lacey L.A. (2007). “Bacillus thuringiensis serovariety israelensis and Bacillussphaericus for mosquito control.” Journal of the American Mosquito Control Association 23, sp2 (July): 133-163.

Lee S.E. (2000). “Mosquito larvicidal activity of pipernonaline, a piperidine alkaloid derived from long pepper, Piper longum.” Journal of the American Mosquito Control Association 16, 3 (September): 245-247.

Li X., Schuler M.A., and Berenbaum M.R. (2007). “Molecular mechanisms of metabolic resistance to synthetic and natural xenobiotics.” Annual Review of Entomology 52, (January): 231-253. DOI: 10.1146/annurev.ento.51.110104.151104.

Lima Estelita Pereira, Paiva M. H. S., Silva U. M., Oliveira L.N., Santana A.E., Barbosa C.N., Neto C.P., Ayres C.F.J., and Santos M.A.M. (2011). “Insecticide resistance in Aedes aegypti populations from Ceará, Brazil.” Parasites and Vectors. http://www.parasitesandvectors.com/content/4/1/5.

Mackenzie J. S., Gubler D. J., and Peterson L. R. (2004). “Emerging flaviviruses the spread and resurgence of japanese encephalitis, west nile and dengue viruses.” Journal of Natural Medicines 10, 12 (December): 98-109.

Madhu S.K., Vijayan V.A., and Shaukath A.K., (2011). “Bioactivity guided isolation of mosquito larvicide from Piper longum.” Asian Pacific Journal of Tropical Medicine 4, 2 (February): 112-116. 2011, Pages 112-116.



I114

Mann R.S., and Kaufman P.E. (2012). “Natural product pesticides: their development, delivery and use against insect vectors.” Mini-reviews in Organic Chemistry 9, 2 (May): 185-202.

McAllister J.C., Godsey M.S., and Scott M.L. (2012).“Pyrethroid resistance in Aedes aegypti and Aedes albopictus from port-au-Prince, Haiti.” Journal of Vector Ecology 37, 2 (December): 325-332.

Mesbah H.A., Mourad A.K., and Rokaia A.Z. (2006). “Efficacy of some plant oils alone and combined with different insecticides on the cotton leaf worm Spodoptera littoralis (Boisd) (Lepidoptera) in Egypt.” Communications in Agricultural and Applied Biological Sciences 71, 2: 305–328.

Mesbah H.A., Saad A.S., Taman F.A., and Mohamed I.B. (2007). “Joint action of quercetin with four insecticides on the cotton leaf worm larvae Spodoptera littoralis (Boisd) (Lepidoptera) in Egypt.” Communications in Agricultural and Applied Biological Sciences 72, 3:455–457.

Mgbemena I. C. (2016). “The Synergistic Larvicidal Activities of Three Local Plants on Aedes aegypti. Global Journal of Science Frontier Research: Biological Science 16, 3 Version 1.0 USA, Online ISSN: 2249-4626 and Print ISSN: 0975-5896.

Mohan L., Sharma P., and Srivastava C.N. (2006). “Evaluation of solanum xanthocarpum extract as a synergist for cypermethrin against larvae of the filarial vector Culex quinquefasciatus.” Entomological Research 36, 4 (November): 220–225.

Mohan L., Sharma P., and Srivastava C.N. (2007). “Comparative efficacy of Solanum xanthocarpum extracts alone and in combination with a synthetic pyrethroid, Cypermethrin against malaria vector, Anopheles stephensi.” Southeast Asian Journal of Tropical Medicine Public Health 38, 2 (November) :256–260.

Morales-Rodrigue A., Peck D.C. (2009). “Synergies between biological and neonecotinoid insecticides for the curative control of white grubs Amphimallon majale and Popillia japonica.” Biological Control 51, 1 (October): 169–180.

Nelson Grisale, Rodolphe Poupardin, Santiago Gomez, Idalyd Fonseca-Gonzalez, Hilary Ranson, and Audrey Lenhart. (2013). “Temephos Resistance in Aedes aegypti in Colombia Compromises Dengue Vector Control.” PLOS Neglected Tropical Diseases 7, 9 (September): e2438.doi:10.1371/journal.pntd.0002438.

Paeporn P., K. Supaphathom, R. Srisawat., N. Komalamisra, V. Deesin, P. Ya-umphan, and S. Leeming Sawat. (2004). “Biochemical detection of pyrethroid resistance mechanism in Aedes aegypti in Ratchaburi province. Thailand.” Asian Pacific Journal of Tropical Biomedicine 21, 2 (December): 145–51.

Park I.K., Lee S.G., Shin S.C., Park J.D., and Ahn Y.J. (2002). “Larvicidal activity of isobutylamides identified in Piper nigrum fruits against three mosquito species.” Journal of Agriculture and Food Chemistry 50: 7(February): 1866-1870.

Pereda-Miranda R., C.B. Bernard, T. Durst, J.T. Arnason., P. Sánchez-Vindas, L. Poveda, and L. San Román (1997). “Methyl 4-hydroxy-3-(3´-methyl-2´-butenyl) benzoate, major insecticidal principle from Piper guanacastensis.” Journal of Natural Products 60, 3(March): 282-284.

Pimsamarn S., Sornpeng W., Akksilp S., Paeporn P. and Limpawitthayakul M. (2009). “Detection of insecticide resistance in Aedes aegypti to organophosphate and synthetic pyrethroid compound in the north-east of Thailand.” Dengue Bulletin 33, 194-202.

Ponlawat A., Scott J.G., and Harrington L.C. (2005). “ Insecticide susceptibility of Aedes aegypti and Aedes albopictus across Thailand.” Journal of Medical Entomology 42, 5 (September): 821-825.

Riaz M.A., Chandor-Proust A., Dauphin-Villemant C., Poupardin R., Jones C.M., Stode C., and Regent-Kleockner M. (2013). “Molecular mechanisms associated with increased



I115

tolerance to the neonicotinoid insecticide imidacloprid in the dengue vector Aedes aegypti.” Aquatic Toxicology 126, 15 (January): 326–337.

Seyoum A., Palsson K., Kung’a S., Kabiru EW., Lwande W., Killeen G.F., Hassanali A., and Knols B.G. (2002). “Traditional use of mosquito repellent plants in western Kenya and their evaluation in semi-field experimental huts against Anopheles gambiae: ethnobotanical studies and application by thermal expulsion and direct burning.” Transactions of the Royal Society of Tropical Medicine and Hygiene 96, 3 (June): 225-231.

Shaalan E.A., Canyon D.V., Younges M.W.F., Abdel-Wahab H., and Mansour A. (2005). “A review of botanical phytochemicals with mosquitocidal potential.” Environment International Journal 31, 8 (October):1149-66.

Sukumar K.,Perich M.J., and Boobar L.R. (1991). “Botanical derivatives in mosquito control: Review.” Journal of the American Mosquito control Association 7, 2 (June) 210-237.

Thangam T.S., and Kathiresan K. (1991). “Mosquito larvicidal activity of marine plant extracts with synthetic insecticides.” Botanica Marina 34, 6 (October): 537–539.

World Health Organization (2005). “Guidelines for laboratory and field testing of mosquito larvicides.”WHO/CDS/WHOPES/GCPP/13.Geneva,Switzerland.World Health Organization.

World Health Organization (1995). Vector control for malaria and other mosquito–borndiseases WHO Tech Rep Ser; 857: 1-91.

World Health Organization (2012).World Health Organization, Geneva, Switzerland. Accessed July 2012. Available from http://www.who.int/whopes/Insecticides.



I116

Constructed functional sheet scaffolds of coated silk fabric with silk fibroin

solution for soft tissue regeneration in cleft palate surgery

Supaporn Sangkert, Assoc. Prof. Jirut Meesane, Assoc. Prof. Suttatip

Kamonmattayakul, Prof. Michael Gelinsky

Institute of Biomedical Engineering, Faculty of Medicine, Prince of Songkla

University

Abstract

Cleft palate is a congenital malformation of the soft and hard tissue at the oral

cavity. An attractive treatment is an operation by substitution of scaffolds to induce

tissue regeneration at the defect area. This research proposes constructed silk fabric

coated in silk fibroin solutions for soft tissue regeneration of cleft palate. In this

research, silk fabrics were coated with 3% and 6% silk fibroin solutions. The

morphological structure of the silk fibroin fabric was observed by scanning electron

microscopy. The swelling behavior and protein release of the coated silk fabric was

used for evaluation of physical performance. L929 fibroblast cells were cultured on

the coated silk fabrics. Cell proliferation and viability were used to evaluate the

biological performance. The morphological structure of the coated silk fabric showed

fibers that were covered and glued with silk fibroin. The coated silk fabric had lower

swelling behavior than the non-coated silk fibroin fabric. Protein release and cell

proliferation of the coated silk fabric was higher than the non-coated silk fabric. The

results indicated that the coated silk fabric from silk fibroin solutions had good

performance for soft tissue regeneration for cleft palate surgery.

Key words: Silk fibroin fabric, Tissue engineering, Silk fibroin, Soft tissue



I117

Introduction

Cleft palate is a congenital deformity that appears at the oral and maxillofacial

area and results from incomplete fusion of the palate. Cleft palate often leads to

problems with breast feeding and speech development. This birth defect presents with

incomplete layer formation of bone and soft tissue. Surgery is the method to treat cleft

palate. In the surgical approach, children need performance biomaterials implanted

into the defect area for tissue regeneration (Sheena et al.,2013; Cesar et al.,2012).

Some research presented the scaffolds as performance biomaterials for soft tissue

engineering (Jianjun et al.,2006; Steven et al.,2013). The scaffolds showed that the

sheet structure was suitable for the soft layer of the defect area (Richard et al.,2010).

In this research, sheet scaffolds for soft tissue engineering in cleft palate is proposed.

Silk fabric is a performance material which has high mechanical strength,

physical stability, and biocompatibility. The main component of silk fabric is silk

fibroin (SF) which is composed of glycine (43%), alanine (30%) and serine (12%)

(Leng-Duei Koha et al.,2015). SF also has the RGD amino acid sequence that has a

specific binding site for cells (Chinmoy Patra et al.,2012). In addition, SF can

promote cell proliferation and can control the rate of degradation (Sang-Hyug Park et

al.,2010). Some reports showed that silk fabric was suitable for fibroblast migration

and proliferation since the unique structure of silk fabric promotes fibroblast

attachment (Hanna Wendt et al.,2011). Therefore, silk fabric was selected as sheet

scaffolds for soft tissue engineering in cleft palate patients.

The main functions of the sheet scaffolds for cleft palate include inducing

fibroblast proliferation and shielding fibroblast migration that disturbs tissue

formation in the bone layer (Sasima et al.,2016). Therefore, coating silk fabric with

SF is suitable to complete those main functions.

In this research, the silk fabric was coated in SF solutions at different

concentrations. The morphologies and physical and biological performances of the

coated silk fabrics were then evaluated for soft tissue regeneration in cleft palate

surgery.

Objectives

1. To improve the SF fabric by coating in an SF solution



I118

2. To compare the morphologies and performances of SF fabric between

different coating concentrations and without coating.

3. To develop SF fabric scaffolds for soft tissue engineering in cleft palate.


Coating silk fibroin fabric

The SF fabric was provided by the Research Unit and Queen Sirikit Seri

Culture Centre, Narathiwat, Thailand. The SF fabric was cut into 1×1 cm pieces and

then coated with 3% and 6% SF solutions. The SF solutions were prepared by

dissolving the degummed SF fiber in 9.3 M LiBr in dH2O for 4 h at 70 C. After that,

the SF solution was dialyzed for 72 h and the water was changed every 30 min during

the first 4 h (B.Mandal et al.,2009). The SF solution was centrifuged to separate the

protein precipitate. The precipitate was weighed to calculate the SF concentration.

After coating with the 3% and 6% SF solutions, the SF fabric was kept at room

temperature for 24 h for water evaporation. Finally, all groups of the SF fabric were

soaked in 80% methanol to induce the beta-sheet structure (Qiang Lu et al.,2010).

Modification of silk fibroin fabric scaffolds

The SF fabric was modified by the 3%and 6% SF solutions. The silk fabric

scaffolds were dipped in the silk solutions and left at room temperature for 24 h.

There were 3 groups of different SF solutions (Table 1).

Table 1. Experiment groups.

Measurement of silk fabric thickness

The thicknesses of the SF fabrics in each group were measured at 3 random

points by a micrometer (Mitutoyo, USA).

Scanning electron microscopy (SEM) observation

The morphological structure of the SF fabric in all groups was observed by an

SEM machine (Quanta400, FEI, Czech Republic). The SF fabric was coated with gold

Groups Detail

A Silk fibroin fabric scaffold

B Coated 3% silk fibroin fabric scaffold

C Coated 6% silk fibroin fabric scaffold



I119

using a gold sputter coater machine (SPI Supplies, Division of STRUCTURE PROBE

Inc., Westchester, PA, USA) before the investigation.

Swelling property

The SF fabric was immersed in a phosphate-buffered saline (PBS) solution at

37 °C and evaluated at 0.5, 1, 2, and 4 h. The weights of the SF fabrics were measured

before and after immersion. The swelling ratio was calculated from this equation.

Swelling ratio = (Ws – Wd)/Wd × 100

where Ws and Wd are the weight of the swollen scaffold and weight of the dry

scaffold, respectively (Nicholas et al.,2011).

Protein release

Protein release from the fabric was evaluated in all SF fabric groups by the

BCA Protein Assay Kit (Pierce BCA Protein Assay Kit, Thermo Scientific, USA).

The SF fabric in all groups was soaked in a PBS solution for different time durations:

15, 30, 60, 120 and 240 min. According to the instructions of the BCA Protein Assay

kit, 20 µL of solution was used for the assay.

Cell Culturing

The L929 fibroblast cell line was used in this study. The L929 cells were

cultured in alpha-MEM medium (α-MEM, GibcoTM

, Invitrogen, Carlsbad, CA, USA)

with the addition of 1% penicillin/streptomycin, 0.1% Fungizone and 10% fetal

bovine serum at 37 °C in a humidified 5% CO2/95% air incubator. The L929 cells

were seeded in the SF fabric with 2×104 cells and the media was changed every 3-4

days (M.C. Serrano et al.,2004; B Thonemann et al.,2002).

Cell proliferation assay (PrestoBlueTM

on days 1, 3 and 5)

Cell proliferation of the L929 cells was evaluated at days 1, 3, 5, and 7 using

the PrestoBlue (PrestoBlue® Cell Viability Reagent, Invitrogen, USA) assay. The

media was removed and 1/10th volume of PrestoBlue reagent was added directly into

the complete media and incubated for 1 h at 37 °C. The proliferation rate of the cells

was measured by monitoring the wavelength absorbance at 600 nm emission.

Cell viability (fluorescence microscope on days 3 and 5)

The cell viability and cell morphology of the L929 cells in the SF fabric was

observed by staining with fluorescein diacetate (FDA). The FDA compound embeds

into the cellular cluster and extracellular matrix. Acetone was used to dissolve the



I120

FDA at a ratio of 5 mg/ml. In the staining process, the media was removed and 1 mL

of fresh media was added. Next, 5 µL of the FDA solution was added and kept at 37

°C for 5 min and protected from the light. The SF fabric was rinsed with 1X PBS and

cell viability was observed by fluorescence microscope (John A. Mcdonald et

al.,1982).


The samples were measured and statistically compared by one-way ANOVA

and Tukey’s HSD test (SPSS 16.0 software package). Statistical significance was

defined at p < 0.05 and all data are shown as mean ± standard deviation.

Results/conclusion

Morphological structure of the silk fibroin fabric scaffolds

The non-coated SF fabric was whiter than the coated SF fabric. Moreover, a

looser arrangement of the fiber structure was found in the non-coated SF fabric

compared to the coated SF fabric. In addition, the SF fibers in the non-coated SF

fabric were facile to unbound with other fibers. The coated SF fabric had more

compact and tight features, particularly the coated 6% SF fabric, compared to the non-

coated SF fabric

Figure 1. Coated SF fabrics from different SF solution concentrations: (A) non-coated

SF fabric; (B) coated 3% SF fabric; (C) coated 6% SF fabric.

The thickness of the non-coated SF fabric was thinner than the coated 3% and

6% SF fabrics. The coated SF fabrics increased in thickness as the percentage of SF

solution increased. However, there was little difference between the 3% and 6% SF

fabrics (Figure 2).

A B C



I121

Figure 2. Thicknesses of the SF Fabrics: (A) non-coated SF fabric; (B) coated 3% SF

fabric; (C) coated 6% SF fabric.

The morphological structures of the SF fabrics are shown in Figure 3. The

patterns of silk fiber arrangement were similar in all groups of the non-coated SF and

coated SF fabrics. In the case of the coated SF fabric, the fibers in bundles showed

denser spaces than the non-coated SF fabric. The 6% SF fabric had the densest space.



I122

Figure 3. Surface morphologies of silk fabrics by scanning electron microscope(SEM)

with different magnifications: non-coated SF fabric (A-C); coated 3% SF fabric (D-

F); coated 6% SF fabric (G-I).

Swelling property

The percentage of swelling was tested at different time points from 30 min to

240 min. The results showed that the percentage of swelling increased as time

increased. The non-coated SF fabric had the highest swelling percentage in the first 30

min and continued to increase in 60, 120, and 240 min. After coating, the percentage

of swelling decreased. The coated 3% SF fabric had a higher swelling percentage than

the coated 6% SF fabric in all time points. As the percentage of SF solution increased,

the swelling percentage of the coated fabric decreased. The results indicated that the

SF coating solution had the effect of decreasing the swelling behavior. These results

A C B

1 mm 200 µm 500 µm

F E D

1 mm 500 µm 200 µm

I H G

1 mm 500 µm 200 µm



I123

ly physical stability and the barrier function of coated SF fabrics that make the

scaffolds suitable as soft tissue layers in cleft palate.

Figure 4. Swelling properties of SF fabrics: non-coated SF fabric (black line); coated

SF fabrics (red [3%]/orange [6%] lines).

Protein release

Within the first 15-30 min of soaking the SF fabrics in the PBS solution,

protein release was not found. However, at 60 min protein release was observed in the

coated SF fabrics but decreased at 120 min. The non-coated SF fabric did not show

any protein activity at any of the time points. The SF protein that coated the SF fiber

surface easily released into PBS solution. The 6% SF fabric showed the highest

protein release.

Figure 5. Amount of BCA release in 15-120 min in PBS solution.



I124

Cell proliferation

Cell proliferation in all groups showed an increasing trend from day 1 through

day 5. On days 1 and 3, the results were not significantly different between the non-

coated SF fabric and the coated 3% SF fabric. The coated 6% SF fabric had

significantly higher cell proliferation than the non-coated SF fabric on days 3 and 5.

An increased percentage of SF solution on the SF fabric can promote cell

proliferation.

Figure 6. Cell proliferation in the SF fabrics at days 1, 3, and 5: non-coated SF fabric

(A); coated 3% SF fabric (B); coated 6% SF fabric (C).

Cell viability

Cell viability was observed on days 3 and 5. Cell attachment in the non-coated

SF and coated SF fabric was considerable. On day 1, the non-coated and coated SF

fabric showed slight cell attachment but increased on day 3. On day 5, the coated SF

fabrics revealed a greater amount of cell attachment compared to the non-coated SF

fabric. The results showed that the coated SF fabric was biologically suitable for cell

viability.



I125

Figure 7. Cell viability on the SF fabric after staining with FDA: non-coated SF fabric

at day 3 (A); coated 3% SF fabric at day 3 (B); coated 6% SF fabric at day 3 (C); non-

coated SF fabric at day 5 (D); coated 3% SF fabric at day 5 (E); coated 6% SF fabric

at day 5 (F).

Discussion

In this study, SF fabric was modified by coating in SF solutions. Coating SF

fabric with 3% and 6% SF solutions resulted in physical and biological properties that

are suitable for soft tissue regeneration. The morphological assessment of the coated

SF fabric indicated that the SF solution could diffuse and penetrate into the spaces.

The SF solution fulfilled the role as a welding glue. The glue could bind the fibers

into bundles. An evaluation of the physical performance by observing the swelling

behavior indicated that the SF solutions decreased the extent of swelling of the SF

Day 3 Day 5

A D

B E

C F

200 µm 200 µm

200 µm

200 µm

200 µm

200 µm



I126

fabrics which implied sufficient physical stability and barrier function to serve as

scaffolds for soft tissue layer in cleft palate. The biological performance assessment

of the coated SF fabric revealed higher cell proliferation than the non-coated SF

fabric. This demonstrated that the coated SF fabric had the bioactive ability to induce

cell proliferation. Some research reported that the SF particles could induce cell

adhesion and proliferation (Jing Qu et al.,2013). Therefore, the high protein release of

the coated SF was possibly due to the active particles which induced the cell

proliferation. The results demonstrated that the coated SF fabric showed a suitable

performance for use as scaffolds for soft tissue engineering in cleft palate.

Recommendations

The concept of coating SF fabric with a silk fibroin solution and the results of

this research can be used for modification of other materials. Moreover, modified SF

fabric can be used at other sites of soft tissue.

References

Sheena Reilly, Julie Reid, Jemma Skeat, Petrea Cahir, Christina Mei, Maya Bunik.

(2013). ABM Clinical Protocol #18: Guidelines for Breastfeeding Infants

with Cleft Lip, Cleft Palate, or Cleft Lip and Palate. Australia :

Breastfeeding Medicine.

Cesar A. Guerrero. (2012). Cleft lip and palate surgery: 30 years follow-up.

Venezuela : Annals of Maxillofacial Surgery.

Jianjun Guan, John J. Stankus, William R. Wagner. (2006). Soft Tissue Scaffolds.

United States : Wiley Encyclopedia of Biomedical Engineering.

Steven Maude, Eileen Ingham, Amalia Aggeli. (2013). Biomimetic self-assembling

peptides as scaffolds for soft tissue engineering. United Kingdom :

Nanomedicine.

Richard T. Tran, Paul Thevenot, Yi Zhang, Dipendra Gyawali, Liping Tang, Jian

Yang. (2010). Scaffold Sheet Design Strategy for Soft Tissue Engineering.

USA : NIH Public Access.

Leng-Duei Koha, Yuan Cheng, Choon-Peng Tenga, Yin-Win Khina, Xian-Jun Loh,

Si-Yin Tee, Michelle Low, Enyi Ye, Hai-Dong Yu, Yong-Wei Zhang, Ming-

Yong Han. (2015). Structures, mechanical properties and applications of

silk fibroin materials. Singapore : Progress in Polymer Science.

Chinmoy Patra, Sarmistha Talukdar, Tatyana Novoyatleva, Siva R. Velagala,

Christian Mühlfeld, Banani Kundu, Subhas C. Kundu, Felix B. Engel. (2012).

Silk protein fibroin from Antheraea mylitta for cardiac tissue

engineering. Germany : Biomaterials.



I127

Sang-Hyug Park, Eun Seok Gil, Hai Shi, Hyeon Joo Kim, Kyongbum Lee, David L.

Kaplan. (2010). Relationships Between Degradability of Silk Scaffolds and

Osteogenesis. USA : NIH Public Access.

Hanna Wendt, Anja Hillmer, Kerstin Reimers, Joern W. Kuhbier, Franziska Scha¨fer-

Nolte, Christina Allmeling, Cornelia Kasper, Peter M. Vogt. (2011). Artificial

Skin – Culturing of Different Skin Cell Lines for Generating an Artificial

Skin Substitute on Cross-Weaved Spider Silk Fibres. France : PLoS One.

Sasima Puwanun, Frazer J. Bye, Moira M. Ireland, Sheila MacNeil, Gwendolen C.

Reilly, Nicola H. Green. (2016). Production and Characterization of a

Novel, Electrospun, Tri-Layer Polycaprolactone Membrane for the

Segregated Co-Culture of Bone and Soft Tissue. Thailand : Polymers.

Biman B.Mandal, Sonia Kapoor, Subhas C.Kundu. (2009).

Silkfibroin/polyacrylamide semi-interpenetrating network hydrogels for

controlled drug release. India : Biomaterials.

Qiang Lu, Xiao Hu, Xiaoqin Wang, Jonathan A. Kluge, Shenzhou Lua, Peggy Cebe,

David L. Kaplan. (2010). Water-Insoluble Silk Films with Silk I Structure.

USA : NIH Public Access.

Nicholas Guziewicza, Annie Besta, Bernardo Perez-Ramireza, David L. Kaplan.

(2011). Lyophilized silk fibroin hydrogels for the sustained local delivery

of therapeutic monoclonal antibodies. United States of America :

Biomaterials.

M.C. Serrano, R. Pagani, M. Vallet-Regi, J. Pena, A. Ramila, I. Izquierdo, M.T.

Portoles. (2004). In vitro biocompatibility assessment of poly(ε-

caprolactone) films using L929 mouse fibroblasts. Spain : Biomaterials.

B Thonemann, G Schmalz, K.-A Hiller, H Schweikl. (2002). Responses of L929

mouse fibroblasts, primary and immortalized bovine dental papilla-

derived cell lines to dental resin components. Germany : Dental Materials.

John A. Mcdonald, Diane G. Kelley, Thomas J. Broekelmann. (1982). Role of

Fibronectin in Collagen Deposition : Fab' to the Gelatin-binding Domain

of Fibronectin Inhibits Both Fibronectin and Collagen Organization in

Fibroblast Extracellular Matrix. United States : Cell Biology.

Jing Qu, Lu Wang, Yongpei Hu, Lingshuang Wang, Renchuan You, Mingzhong Li.

(2013). Preparation of Silk Fibroin Microspheres and Its

Cytocompatibility. China : Journal of Biomaterials and Nanobiotechnology.



I128

Appendix

Author: Supaporn Sangkert

Program: Biomedical Engineering

Institute: Faculty of Medicine, Institute of biomedical Engineering, Princes of

Songkla University.

Tel. 087-8363770 e-mail. [email protected]

Author: Associate Professor Jirut Meesane

Program: Biomaterials for tissue engineering


Songkla University.


Author: Associate Professor Suttatip Kamolmatyakul

Program: Preventive Dentistry

Institute: Faculty of Dentistry, Department of Preventive Dentistry, Prince of

Songkhla University.


Author: Professor Michael Gelinsky

Program: Bioengineering and Materials Engineering for tissue engineering.

Institute: Medical Faculty and University Hospital Carl Gustav Carus, TU Dresden.

Tel. +49 351 458 6694 e-mail. [email protected]



I129


Biomedical performance scaffolds based on silk fibroin films for bone tissue

regeneration in maxillofacial surgery; Physical and biological performance

Jutakan Thonglam, Assoc. Prof. Thongchai Nanthanaranont, Assoc. Prof. Jirut

Meesane,


University.

Abstract

Some cases for maxillofacial surgery have to use biomedical performance

scaffolds to promote bone tissue regeneration at the interfacial area between bone and

mucosa. In this research, silk fibroin was selected and fabricated into films which

were treated with 20% and 100% methanol. Then their morphology was observed

with Scanning Electron Microscopy (SEM). Physical performance was tested based

on their swelling behavior and protein release. Afterward, the films were cultured

with osteoblast cells (MG-63). Biological performance was evaluated in terms of cell

proliferation and viability. The results demonstrated that the treated films showed

more surface roughness than non-treated films. Regarding physical performance, the

treated films exhibited a lower rate of swelling behavior and protein release than non-

treated films. Furthermore, the treated films showed suitable biological performance

as they possessed better cell proliferation and viability than non-treated silk fibroin.

Especially, the films treated with 100% methanol had a suitable physical and

biological performance, which has promise in them serving as biomedical

performance scaffolds for bone regeneration in maxillofacial surgery.

Key word (s): Silk fibroin, Bone tissue regeneration



I130

Introduction

Currently, there are many patients suffering bone tissue defect from traumas

and diseases in maxillofacial areas. In severe cases, such patients have to undergo an

operation with biomedical substitution into the defect areas [1]. Constructing

biomedical performance materials is still a challenging issue for materials scientists

and surgeons. Therefore, in this research, performance biomedical materials were

created to be used in corrective surgery for tissue defect in maxillofacial areas.

Notably, some defect parts which contact areas between the mucosa and bone

tissue require the use of performance films for substitution [2]. The main function of

these films is to induce bone tissue regeneration [3]. Furthermore, these films must

possess a barrier function to shield the invasion of mucosa tissue during bone

formation [4]. Because of their unique performace, the biomedical performance films

for bone tissue regeneration at such defect areas in maxillofacial surgery is

emphasized in this research.

Scaffolds are attractive materials, which have been used for tissue engineering

into two and three dimensions (2D and 3D) [5,6]. Principally, scaffolds show good

both physical and biological performance in maintaining the contour shape of tissue

defects and inducing new tissue formation [7]. Therefore, constructed scaffolds must

emphasize on these performances to complete new tissue formation. Due to their

unique performance, 2D scaffolds were selected and fabricated into films as

biomedical performance materials for bone tissue engineering in this research.

Silk fibroin is a natural protein, which has been used in many applications [8].

Especially, silk fibroin has been used in biomedical applications because it has the

unique physical performance of hight mechanical strength [9]. Furthermore, silk

fibroin has a biological performance which can enhance bone tissue regeneration [10].

Therefore, silk fibroin was selected to fabricate biomedical performance scaffold

films for bone tissue regeneration in maxillofacial surgery.

In this research, silk fibroin was facricated into films which were treated with

different concentrations of methanol. Then the physical and biological performance of

the films were evaluated for potential promise to be used in bone tissue regeneration

in maxillofacial surgery.



I131

Objectives

1. To compare the morphology, properties and functionalities of silk fibroin

films after treatment with methanol in different concentrations.

2. To developed silk fibroin films for maxillofacial tissue engineering.


Preparation of silk fibroin films

The silk fibroin scaffolds were prepared by cutting the silk cocoon into small

pieces and then boiling them in 0.02 M sodium carbonate (Na2CO3) at 90 ๐C for 20

min then rinsing with distilled water to remove sericin and drying in a hot air oven at

60 ๐C for 24 hr. During the next step, the silk fibers were dissolved in 9.3 M lithium

bromide (LiBr) at 70 ๐C for 3-4 hr; this solution was dialyzed against in distilled

water using a dialysis membrane for 3 days (changing the distilled water every 6 hr).

After that, the silk fibroin solution was centrifuged at 9000 rpm at 4 ๐C for 20 min.

That solution was then stored at 4 ๐C until used in the study [11]. To fabricate the silk

fibroin film, the silk fibroin solution was poured into plastic plates, and after that, the

silk film was dried at room temperature.

Modification of silk fibroin films

The experiment was designed in 3 groups: untreated silk fibroin films, silk

fibroin films treated with 20% methanol, and silk fibroin films treated with 100%

methanol (Table 1.)

Table 1. Experiment groups.

Groups Details

A Silk fibroin film

B Silk fibroin film treated with 20% methanol

C Silk fibroin film treated with 100% methanol



I132

Scanning Electron Microscopy (SEM) Observation

The surface structure of the silk films from each group were observed using

Scanning Electron Microscopy (SEM), (Quanta400, FEI, Czech Republic). The

samples were pre-coated with gold using a gold sputter coater machine (SPI supplies,

Division of STRUCTURE PROBE Inc., Westchester, PA, USA).

Swelling properties

The films of all groups were soaked in PBS at different time points—30 min,

and 1, 6, 12, and 24 hr to check their swelling properties. The silk film weight was

recorded before and after soaking with PBS to calculate the weight increase. Finally,

the swelling (%) in each group was calculated using the following equation [12]:

Swelling (%) =

where Ws = film wet weight

Wd = film dry weight

Protein analysis

The protein release was measured with BCA Protein Assay Kit [Pierce BCA

Protein Assay Kit, Thermo Scientific, USA]. The silk fibroin film was immersed in

PBS for 0.5, 1, 6, 12 and 24 hr, then 20 µl of the solution were drained for protein

detection with the BCA Protein Assay Kit [Pierce BCA Protein Assay Kit, Thermo

Scientific, USA].

Cell Culture

The biocompatibility of each silk fibroin film was assessed using MG-63

osteoblast cells. The experiment cell cultures were maintained in an α-minimum

essential medium (Gibco BRL Life Technologies, Grand Island, NY) containing 10%

fetal bovine serum (Gibco BRL Life Technologies), 100 U/ml penicillin and 100

U/ml streptomycin. The cells were cultured under 100% humidity and 5% CO2 at 37

°C, changing the medium every 3 days. The size of the scaffold used a diameter of

1x1 cm for the culture cells. All of the silk films were seeded with MG-63 osteoblast

( Ws - Wd ) x 100

Wd



I133

cells at a density of 2 x 104 cell/ml. The proliferation of cells on the silk fibroin films

was measured by a PrestoBlueTM

assay 1, 3, 5 and 7 days after the culture

commencement [13].

Cell proliferation assay (PrestoBlueTM

on days 1, 3, 5, and 7)

The cell proliferation was evaluated with PrestoBlueTM

on days 1, 3, 5, and

7. The color of resazurin in PrestoBlueTM

was changed to red by live cell activity; the

MG-63 was cultured in the silk fibroin films of all groups. The scaffold was rinsed

with PBS and 10% of PrestoBlueTM

was added in the completed media. An incubation

at 37 C for 1 h followed, and the cell proliferation was detected using 570 nm

emissions.

Cell viability (Fluorescence Microscope on Day 7)

Cell attachment and cell viability on the silk fibroin film were evaluated by

fluorescence staining with fluorescein diacetate (FDA) after 7 day of culture cell. The

silk fibroin film was washed three times with PBS, and then incubated in 4%

formaldehyde with PBS for 10 min. The samples were stained with 5 µg/ml of

fluorescein diacetate (FDA) for 10 min at room temperature, and then washed with

PBS. The fluorescence images after staining were observed by a confocal laser

scanning microscope [14].


All data are presented as mean ± standard deviation (n=5). The differences

between various test samples was examined using an analysis of variance and

multiple-comparison test created by Turkey HSD. P < 0.05 was accepted as statistical

significance.

Results

Morphological structure of silk fibroin films

In this research, we modified silk fibroin films using methanol treatment: 20%

and 100% methanol concentrations. Morphologically, the silk fibroin films, both



I134

50 µm

50 µm 50 µm

A B C

untreated and treated with methanol, were smooth and transparent. The silk fibroin

films are shown in Fig 1.

Figure 1. Untreated silk fibroin film; (A). Silk fibroin film treated with 20%

methanol; (B). Silk fibroin film treated with 100% methanol; (C).

In addition, the morphologies of the silk fibroin films were observed using

SEM measurements.(Fig. 2A) The non-treated silk fibroin films showed a smooth

surface, and the silk fibroin films treated with 20% and 100% methanol exhibited a

rough surface. However, the degree of roughness in the group of silk fibroin films

treated 20% methanol was greater than that of the group treated with 100% methanol.

This result indicated that the concentration of methanol affected the structure of the

silk fibroin films.

Figure 2. Scanning electron microscopy image of scaffolds. Untreated silk fibroin

film; (A). Silk fibroin film treated with 20% methanol; (B). Silk fibroin film treated

with 100% methanol; (C).

A B C



I135

Swelling behavior

To investigate the impact of methanol on the swelling behavior of silk fibroin

films, they were analyzed at 0.5, 1, 6, 12, and 24 hrs in PBS (Fig. 3). The swelling

percentage graph showed a correlation with time—the swelling percentage increased

as the time increased. At 0.5 h, the silk fibroin films treated with 20% methanol had

the highest percentage of swelling when compared with those from other groups. The

untreated films and those treated with 100% methanol showed an nonsignificant

difference at 0.5, 1, 6, and 12 hrs, except at 24 hrs where the untreated films

expressed a higher swelling percentage than the 100% methanol treated ones. The

group of silk fibroin films treated 20% with methanol still showed the highest

swelling percentages at all time points

Figure 3. Swelling properties at 0.5, 1, 6, 12, and 24 hr on the silk films untreated and

treated with methanol

Protein release

The protein release from the silk films was evaluated by a BCA assay kit. The

results showed that the untreated silk fibroin films released more protein than the

other groups at 5 min. At the 10 min mark, the untreated silk fibroin films revealed a

significantly higher release rate than the films treated with 20% methanol, but a



I136

statistically insignificant difference with the ones treated with 100% methanol. At 0.5

to 3 hrs, the untreated silk fibroin films showed a higher protein releasing rate than the

other groups at all time points.

Figure 4. Protein release from the silk fibroin films at different time points detected

by a BCA assay kit.

Cell proliferation

The biofunctionality of silk fibroin films in every groups was evaluated by means

of a PrestoBlueTM

assay. Osteoblast cells (MG-63) were used for cell proliferation

analysis. The osteoblast cell proliferation showed the increasing trend from day 1 to

day 7. On day 1, the 20%- and 100%-methanol treated silk fibroin films showed

significantly higher proliferation rates than the films that were not treated with

methanol. The 100%-methanol treated films revealed a significantly higher cell

proliferation when compared with the other groups on day 3, 5 and 7. Among the

20%-methanol treated films, cell proliferation was higher than in the untreated films,

but not in a statistically significant manner.



I137

Figure 5. Cell proliferation rate at days 1, 3, 5, and 7 on silk films untreated and

treated with methanol using a PrestoBlueTM

assay. The symbol (*) represents a

significant conversion of the resazurin-based PrestoBlueTM

metabolic assay (P <

0.05).

Cell viability

The cell attachment and cell viability on the silk fibroin films were evaluated by

fluorescence staining with fluorescein diacetate (FDA) after 7 days of cell culture.

This results indicated that all three groups of silk fibroin films can support cell

attachment and cell migration to cover the surface of the silk fibroin films (Fig. 6).

Moreover, the fluorescence images indicated higher cell densities in silk fibroin films

treated with 100% methanol (Fig. 6C).



I138

Figure 6. Cell viability on silk fibroin films with FDA labeling. Untreated silk fibroin

film; (A). Silk fibroin film treated with 20% methanol; (B). Silk fibroin film treated

with 100% methanol; (C). Scale bare 500 µm

Discussion

In this research, the modification of silk fibroin films using methanol treatment

was studied in order to determine their suitability to be used in maxillofacial tissue

engineering. The treatment with methanol can enhance the biofunctionality of the silk

fibroin film. Our findings showed that the concentration of methanol had an effect on

the structural organization of silk fibroin due to the substitution of water molecules by

methanol ones [15]. This structural organization lead to the induction of molecular

interaction between SF molecules [16]. Furhtermore, this increased the physical

stability of silk fibroin when it was treated with methanol [17]. The surface of SF film

treated with 20% methanol showed a greater degree of roughness than SF film treated

with 100% methanol because the low methanol concentration caused a phase



I139

separation between SF molecules, leading to a more irregular surface [18]. The

highest level of the swelling property was obsevered in silk fibroin films treated with

20% methanol because the structure arrangement was more irregular than those of the

films in the other two groups, enabling a higher swelling percentage compared with

the others.

The silk fibroin films treated with 100% methanol showed the highest rates of

cell proliferation due to their suitable surface roughness, which can support both cell

attachment and proliferation on the film. Interestingly, the morphology of the cells

was spread out, covering the surface of the silk fibroin films treated with 100%

methanol. Our results indicate that silk fibroin film treated with methanol are suitable

for bone tissue engineering, which show some promise in being used in biomedical

performance scaffolds for maxillofacial surgery.

Conclusion

This research demonstrated that silk fibroin films treated with ethanol showed

suitable physical properties; low swelling behavior and protein releasing. Importantly,

the treated silk fibroin films exhibited a biological performance that induces both cell

proliferation and viability. Especially, the silk fibroin film with 100% methanol

showed enough suitable performance, indicating some promise in its application as a

material to create biomedical performance scaffolds for bone tissue regeneration in

maxillofacial surgery.

Recommendation

Methanol-treated silk fibroin films can be used to regenerate other tissues. The

modification of the biological functions of silk fibroin films is an important issue that

may enhance their performance in bone regeneration.



I140

References

1. Leila Ghorbaniana, Rahmatollah Emadia, Seyed Mohammad Razavib,

Heungsoo Shinc, Abbas Teimourid. (2013). Fabrication and

characterization of novel diopside/silk fibroin nanocomposite scaffolds for

potential application in maxillofacial bone regeneration. Iran :

International Journal of Biological Macromolecules.

2. Lin Zhao, Junli Zhao, Shuanke Wang, Junsheng Wang, Jia Liu. (2011).

Comparative study between tissue-engineered periosteum and structural

allograft in rabbit critical-sized radial defect model. China : Biomedical

Materials Research Part B: Applied Biomaterials.

3. Seong-Gon Kim1, Min-Keun Kim, HaeYong Kweon, You-Young Jo, Kwang-

Gill Lee, Jeong Keun Lee. (2016). Comparison of unprocessed silk cocoon

and silk cocoon middle layer membranes for guided bone regeneration.

Korea : Maxillofacial Plastic and Reconstructive Surgery.

4. Yurong Cai, Junmao Guo, Cen Chen, Chenxue Yao, Sung-Min Chung,

Juming Yao, In-Seop Lee, Xiangdong Kong. (2017). Silk fibroin membrane

used for guided bone tissue regeneration. China : Materials Science and

Engineering.

5. Taek Gyoung Kim, Heungsoo Shin, Dong Woo Lim. (2012). Biomimetic

Scaffolds for Tissue Engineering. South Korea : Adv. Funct. Mater.

6. Banani Kundu, Nicholas E. Kurland, Subia Bano, Chinmoy Patra, Felix B.

Engel, Vamsi K. Yadavalli, Subhas C. Kundu. (2014). Silk proteins for

biomedical applications: Bioengineering perspectives. India : Progress in

Polymer Science.

7. Naresh Kasoju, Utpal Bora. (2012). Silk Fibroin in Tissue Engineering.

India : Adv. Healthcare Mater.

8. Gregory H. Altman, Frank Diaz, Caroline Jakuba, Tara Calabro, Rebecca L.

Horan, Jingsong Chen, Helen Lu, John Richmond, David L. Kaplan. (2003).

Silk-based biomaterials. USA : Biomaterials.

9. Hyeon Joo Kim, Ung-Jin Kim, Hyun Suk Kim, Chunmei Li, Masahisa Wada,

Gary G. Leisk , David L. Kaplan. (2008). Bone tissue engineering with

premineralized silk scaffolds. USA : Bone.

10. Banani Kundu, Rangam Rajkhowa, Subhas C. Kundu, Xungai Wang. (2013).

Silk fibroin biomaterials for tissue regenerations. India : Advanced Drug

Delivery Reviews.

11. Biman B.Mandal, Sonia Kapoor, Subhas C.Kundu. (2009).

Silkfibroin/polyacrylamide semi-interpenetrating network hydrogels for

controlled drug release. India : Biomaterials.

12. Nicholas Guziewicza, Annie Besta, Bernardo Perez-Ramireza, and David L.

Kaplanb. (2011). Lyophilized Silk Fibroin Hydrogels for the Sustained

Local Delivery of Therapeutic Monoclonal Antibodies. USA :

Biomaterials.

13. Ung-Jin Kim, Jaehyung Parka, Hyeon Joo Kima, Masahisa Wada, David L.

Kaplan. (2005). Three-dimensional aqueous-derived biomaterial scaffolds

from silk fibroin. United States : Biomaterials.



I141

14. John A. Mcdonald, Diane G. Kelley, Thomas J. Broekelmann. (1982). Role of

Fibronectin in Collagen Deposition : Fab' to the Gelatin-binding Domain

of Fibronectin Inhibits Both Fibronectin and Collagen Organization in

Fibroblast Extracellular Matrix. United States : Cell Biology.

15. Brian D. Lawrence, Scott Wharram, Jonathan A. Kluge,Gary G. Leisk,

Fiorenzo G. Omenetto, Mark I. Rosenblatt, David L. Kaplan. (2010). Effect of

Hydration on Silk Film Material Properties. USA : Macromol Biosci.

16. Dohiko Terada, Yoshiyuki Yokoyama, Shinya Hattori , Hisatoshi Kobayashi,

Yasushi Tamada. (2016). The outermost surface properties of silk fibroin

films reflect ethanol-treatment conditions used in biomaterial

preparation. Japan : Materials Science and Engineering C.

17. Sandra Hofmann, Kathryn S. Stok , Thomas Kohler , Anne J. Meinel, Ralph

Muller. (2014). Effect of sterilization on structural and material properties

of 3-D silk fibroin scaffolds. Switzerland : Acta Biomaterialia.

18. Mashro Tsukada, Yoko Cotoh, Masanobu Nacura, Norihiko Minoura,

Nobutami Kasai, Ciuliano Freddi. (1994). Structural Changes of Silk

Fibroin Membranes Induced by Immersion in Methanol Aqueous

Solutions. Japan : Polymer Science: Part B: Polymer Physics.



I142

Appendix

Author: Jutakan Thonglam



Songkla University.


Author: Assistant Professor Jirut Meesane



Songkla University.


Author: Assoc. Prof. Thongchai Nanthanaranont

Program: Oral & Maxillofacial Surgery

Institute: Faculty of Dentistry, Department of Oral & Maxillofacial Surgery, Prince

of Songkhla University.

Tel. 0874777015 e-mail. [email protected]



I143


Constructed electro-spun fibers based on thermoplastic polyurethane to design tissue engineering scaffolds; Fabrication, morphological formation

Nattawat Watcharajittanont, Chatchai Putson, Prisana Paripattananon, Jirut Meesane


University.

Abstract

Electro-spinning, is a famous method for small fiber fabrication. In this research, construct electro-spun fibers were presented as guidance to design scaffolds for tissue engineering.

Thermoplastic polyurethane (TPU) 10% w/v was dissolved in a mixing ration between; N,N-dimethylformide (DMF) and Tetrahydrofuran (THF) as 100:0, 70:30 and 50:50. Then, these TPU solutions were fabricated into small fibers, via the use of electro-spinining. The rheology of the polymer solution, fabrication parameters as well as the morphological formation was then evaluated. Results of rheology analysis exhibited that the storage modulus (G’) and loss modulus (G”) of all PU solution increased with an increasing THF amount in the solvent.

As to the fabrication parameter, nozzle gab and feeding flow rate these were then evaluated. Increasing the feeding flow rate made a large fiber diameter and uninform of the fibers. Increasing the nozzle gab distance brought about small fiber and uniform fibers, once the solvent completely evaporated from the polymer solution.

The results indicated that rheology and fabrication parameters had an effect on various morphological formations. Such formations were important in the design performance of the scaffolds for tissue engineering.

Key words : electrospinning fiber,polyurethane, DMF,THF, solvent ratio

1. Introduction

Currently, there are many patients, who have defective tissue from either having been involved in some sort of serious accident or the suffering of a disease. For clinic treatments, there are many processes to assist or cure such patients, and treatments often show that one of the main roles is to enhance as well as to regulate the formation function of new tissue at the defect site. Creating an attractive approach is, therefore, a challenge for researchers.



I144

Interestingly, is one such attractive approach, as it has been used to induce new tissue formations (1,2). Tissue engineering consists of three crucial parts including; cells, growth factors along with scaffolds. Those crucial parts have the role of inducing new tissue regeneration (3). This is especially true for scaffolds, which contour with the structure and physical performance, so as to maintain the overall contour (Furthermore, scaffolds have a biological performance role in the promotion of cell adhesion, proliferation, and migration (4,5). Those structures and functions lead to enhanced and regulated tissue regeneration. Therefore, the creation of performance scaffolds has been emphasized in this research.

An Electro-spinning technique is widely used for the fabrication of tissue engineering scaffolds (6,7).This technique is an attractive technique, which uses electrical force to form polymer solution into fibers. Such fibers are produced into various sizes from micro to nano scale. According to its unique potential, electro-spinning was selected to fabricate a performance scaffold, which has certain fibrous structures for tissue engineering within this research.

Thermoplastic polyurethane (TPU) consists of two segments in the molecule, which includes both a soft and hard segment. The soft segment displays flexibility, whilst the hard segment supports the stiffness of the molecule. Interestingly, some research has reported that the connection as well as interaction of these two segments has an influence on its molecular behavior (8). Such molecular behavior has an effect on various structural formations and characteristic of electro-spun fibrous, which in turn makes it possible to design performance scaffolds.

In this research, electro-spun TPU fibers were created and presented as tissue engineering scaffolds. Those fibers were fabricated into various structures. Then the fabrication parameters and morphological formations were evaluated.

Objective

1. To fabricate electro-spun TPU fibers from solvents of DMF/THF. 2. To evaluate morphological formation of fibers from varying processes

parameters (flow rate, distance between nozzle tip and collector plate, Applied voltage).

3. To characterize physical performance of fibers.


Solution preparation.

Thermoplastic polyurethane (TPU DP9370A, Bayer) (10% w/v) was dissolve in dimethylformamide (DMF) and tatrahydrfurane (THF) mixed solvents at different rations of 100/0, 70/30 and 50/50 at 80 o C for 6hrs with a magnetic stirrer. This work used PU 100, PU 70 and PU 50 in tread of PU 100/0, PU 70/30 and PU 50/50



I145

because, it was easily to exhibit and explain the results (table 1). The rheology properties of all the polymer solutions were examined by Rheometer (Thermo Rheowin, HAAKE RheoWin)

Table 1 Parameters used in preparing electrospinning scaffold

Electrospinning process

The polymer solutions were filled in 20 ml syringes, then the applied voltage +15 kV was applied to the process from a high voltage power supply (Genvolt, UK). The flow rates, studied in this work, were varied: 0.1 ml/hr,0.3ml/hr,0.5ml/hr,0.7ml/hr and 0.9 ml/hr. the last parameter is the varying distance. The distances between nozzle tip and the collector plate, studied in this research, were detected at: 12 cm, 15cm,18cm 21cm and 25cm . The apparatus of electrospining is shown as: Fig.1



I146

Fig. 1 Apparatus of electrospining

SEM analysis of electrospining fiber.

The morphological structure of the PU fibers, in all groups, was observed by a SEM machine (TM3030Plus, Hitachi). The PU fibers were coated with gold using a gold sputter, coater machine (SPI Supplies, Division of STRUCTURE PROBE Inc., Westchester, PA USA) before the investigation. The fiber diameters were investigated with an Image J program.

Water contact angle analyses

The hydrophilic properties of the fibers were exhibited by the contact angle result. It was investigated by; optical system device (OCA 15CE, Dataphysics). 1ml. was dropped on every surface of the fibers membrane, then left for a time of; 5mins, 10mins, 15mins, 20mins and finally 25mins for contact angle studying.

Results/conclusion

Rheology results

Rheology is defined as an important parameter of material deformation and flow during

electro spinning from the nozzle (9). The parameters; storage and loss modulus were

presented rheological characteristic of the TPU solution in this research. Principally, G’

implies to the stiffness of molecules, which is presented into the store energy within

their structure. G” generally shows the viscous characteristic of said molecules, which

are presented into the loss of energy within their structure.

The results showed that the storage modulus of all PU solution expresses in the

Fig 2. The storage modulus increased when increasing the THF ratio in the mixing

solvent. This might come from hard segments, which can form as part of the molecular

interaction and self-organize into regularity within the solution, when increasing the

amount of THF (10).



I147

http://www.azom.com/ads/abmc.aspx?b=18214

Fig 2. Effect of Volume Fraction of the Polymer solution from different mixing rations

on storage modulus (G’)

Notably, in the case of loss modulus, increasing the THF amount in the solvent

had an effect on increasing the loss of modulus within the TPU solution (Fig 3). This

possibly comes from the dissolved soft segment, which can induce the mobility of the

TPU chains within the solution. The molecular mobility of TPU chains led to the

inducing of loss modulus.



I148

Fig 3. Effect of Volume Fraction of the Polymer solution with different mixing rations

on loss modulus (G”)

Effect of distance between nozzle tip and collector on fiber morphology

The distance between the nozzle tip and the collector plate is another import

parameter, which directly has an impact on the fiber diameter. The results, from Fig 4,

showed that increasing the distance between nozzle tip and plate affected the fiber

morphology, as in it is more homogenous with a smaller diameter.

The rough, film polymer occurred at a short distance of 12cms and 15cms, owing to the

polymer solution fusing together before the solvent evaporated, absolutely. At distances

of 18cms to 24cms, all PU fibers had more fiber morphology. Comparison between the

morphology of three fibers, fabricated from different polymer solutions, found that the

fiber morphology, which produced for PU 100 composed of both large and the small

fibers, whereas, fiber produced from PU 50 were more homogenous than those fibers

produced from PU 50 and PU 70.



I149

Fig 4. Scanning electron microscopy (SEM) images of electrospining 10 wt.%

Polyurethane fibers obtained from different mixing ration solvent, between DMF and

THF, at different collecting gap distances, (a) 12cms, 15cms, 18cms, 21cms and 24

cms, using electric power 15 kV and solution flow rate of 0.3 ml/hr constantly.

Increasing the distance between the nozzle tip and collector plate not only

decreased film feature on the fiber membrane, induced homogenous fibers in the fiber

membrane, but also had an effect on the fiber diameter. Fig. 5 shows the diameter of

the three fibers from difference PU solutions, decreased with increasing distance. Long

distances permitted a long time for the solvent used in the polymer solutions to

evaporate. PU 50 was solved in the mixing solvent between DMF and THF at a ratio

of: 50:50. THF has a low boiling point, it can, therefore, be easily evaporated (11). Due

to this factor, PU 50 solution, which solved with easily evaporated solvent, formed the

fiber feature with a short distance and exhibited in the 15cms, while PU 50 at 12 cms

still had a film feature occurring in the membrane.



I150

Fig 5. Exhibited the impact of the distance between nozzle tip and collector on the all

PU fibers at different diameters. (12 cm, 15 cm, 18cm, 21 cm and 24 cm.)

Effect of feeding flow rate on the fiber morphology

The feeding flow rate must also be explained for the characterization of electro-

spun fiber diameters. Solution flow rate, which were varying, were used in order to

maintain a stability Taylor cone during the electro spinning process (12).Increasing the

feeding flow rate, during the process, while the maintaining the Taylor cone produces a

large fiber diameter (13). Increasing the flow rate too much causes the polymer solution

to move faster towards the collector plate (14).The solvent cannot completely evaporate

in the fiber regeneration, leading to flattened of the fiber, or a polymer film forming on

the collector plate (15.)

Fig.6 exhibited the effects of the flow rate on the fiber diameter of all PU

fibers. The studied flow rates in this work are: 0.1 ml/hr, 0.3 ml/hr, 0.5ml/hr, 0.7ml/hr

and 0.9 ml/hr. SEM images showed that with the low flow rate at 0.1 ml/hr and 0.3

ml/hr. Uniformed fibers were produced. PU 100 fibers began to become less

uniformed uninform at 0.5 ml/hr, because some solvent showed incomplete

evaporation. Therefore, there were some occurrences of molten fibers. Generally,

DMF has a higher boiling point than THF. The increasing amount of the THF in the

solvent had an effect on inducing of the evaporation rate of the solvent. Therefore,

evaporation of solvent in PU 50 and PU 70 were better than that of PU 100. PU 50 and



I151

PU 70 began melting the fiber at 0.7 ml/hr, as well as which it showed partially

formation of polymer film at 0.9 ml/hr.

Fig 6. Scanning electron microscopy (SEM) images of electrospining 10 wt.%

Polyurethane fibres obtained via different mixing ration solvent between DMF and

THF along with different feeding flow rates: 0.1ml/hr, 0.3ml/hr, 0.5ml/hr, 0.7ml/hr and

0.9 ml/hr electric power 15 kV and a collecting gap distance of 24cms, constantly.

At a low flow rate (about 0.1-0.5 ml/hr) the electro-spun fibers were uniform.

At higher flow rates (about 0.7- 0.9 ml/hr) the fiber surface had more roughness than

the others. Notably, at those flow rates there was a partial formation of polymer film.

All PU fiber diameters increased with an increasing feeding flow rate. Comparison to

all PU diameters, demonstrated that the fiber of PU 50 was bigger than that of the other

polymer fibers. It is possible that this was caused by the THF solvent having more

interaction inside the polymer chain than that of DMF. While, PU 50 solution was

maintaining jet, the interaction inside the polymer chain within the solution produced a

large stream polymer. Once, the solvent completely evaporated, large fibers occurred

on the collector Fig 7.



I152

Fig 7. Relationship between the fibers diameter and the feeding flow rate, showing the

average fiber diameter for: 0.1 ml/hr, 0.3 ml/hr, 0.5 ml/hr,0.7ml/hr and 0.9 ml/hr.

Discussions

This work studied the effects of the mixing ratio of; DMF and THF, which are

both solvents for PU solution. Each solvent directly impacted on the PU structure,

which is composed of two segments, noted as a soft and hard segment.

Increasing the THF amount in the solvent could increase storage modulus and loss

modulus of the PU solution. This possibly came from the THF having an effect on

regular formation and mobility of TPU molecules. The polymer solution property is an

important factor for PU fiber fabrications in the electro-spining process. The structure

inside the polymer solution dissolved in different solvents causing, different segment

interaction inside said polymer molecules in addition to having an effect on the fiber

morphology.

Furthermore, the electro-spinning process parameters such as; nozzle gap

distance and the feeding flow rate had an influence on both the fiber diameters and fiber



I153

morphology. Increasing the nozzle gap, reduced the fibers diameter whereas, the fiber

diameter increased with an increasing of the feeding flow rate. The fiber sizes and

morphology of the all PU fibers was strongly, dependent on solvent evaporation within

the polymer solutions, which were jetted from the syringe.

Recommendations

Thermoplastic polyurethane is widely used for scaffolds, in tissue engineering research.

In this work, the effects of the mixing solvent on the polymer solution properties

coupled with the electro-spinning process parameters were considered.

The fiber sizes as well as the fiber morphology of these electro-spun fibers are

important factors for cell behavior, which in turn leads to inducing of tissue

regeneration. Those parameters of fabrication, which had an effect on the

morphological formation of said fibers, might be of continued guidance in the future

design and performance of scaffolds for various types of tissue engineering.

Interestingly, performance of TPU fibers might be developed by bioactive molecules

for future works.

Reference

1. Ceccaldi Caroline, Bushkalova Raya, Cussac Daniel, Duployer Benjamin, Tenailleau Christophe, Bourin Philippe, Parini Angelo, Sallerin Brigitte, Girod Fullana Sophie.(2017). Elaboration and evaluation of alginate foam scaffolds for soft tissue engineering.France: International Jounal of Phamaceutics.

2. Ming Li ,Susumu Ikehara.(2013). Bone-Marrow-Derived Mesenchymal Stem Cells forOrgan Repair.Japan: Stem Cells International.

3. Fergal J. O’Brien.(2011). Biomaterials & scaffolds for tissue engineering. Ireland:Materialstodays.

4. Hao-Yang Mi, SunMi Palumbo,Xin Jing, Lih-Sheng Turng,Wan-Ju Li,Xiang-Fang Peng.(2014).Thermoplastic polyurethane/hydroxyapatite electrospun scaffolds for bone tissue engineering: effects of polymer properties and particle size.China: Society of Biomaterials.

5. Jun-Hyeog Jang, Oscar Castano, Hae-Won Kim. (2009). Electrospun materials as potential platforms for bone tissue engineering.Korea : Advanced drug delivery reviews.



I154

6. L. Wang. J. Ryan.(2011). Introduction to electrospinning. UK: Woodhead Publishing Limited.

7. Seema Agarwal, Joachim H. Wendorff, Andreas Greiner.(2008).Use of electrospinning technique for biomedical applications. Germany: Polymer

8. K.M.Lem, J.R. Haw , S. Curran, S. E. Sund , C. Brumlik, G.S. Song and D.S. Lee .(2013). Effect of hard segment Molecular Weight on Dilute Solution Properties of Ether Based Thermoplastic Polyurethanes.USA : Nanoscience and Nanaengineering.

9. V. Lisy, J. Tothova , B. Brutovsky.(2007). Rheology of Dilute Polymer Solutions with Time-Dependent Screening of Hydrodynamic Interactions. Slovakia :Physics/cond-mat.soft.

10. K.M.Lem, J.R. Haw , S. Curran, S. E. Sund , C. Brumlik, G.S. Song and D.S. Lee .(2013). Effect of hard segment Molecular Weight on Concentrated and bulk properties of Ether Based Thermoplastic Polyurethanes.USA : Nanoscience and Nanaengineering.

11. G. Tetteh, A.S. Khan, R. M. Delaine –smith, G.C. Reilly, I.U. Rehman.(2014). Electrospun polyurethane /hydroxyapatide bioactive Scaffold for bone tissue engineering: The role of solvent and hydroxyapatite particles.UK : Journal of the mechanical behavior of biomedical material.

12. A M Ga˜ n´an-Calvo1, N Rebollo-Mu˜noz, J M Montanero.(2013). The minimum or natural rate of flow and droplet size ejected by Taylor cone–jets: physical symmetries and scaling laws. Spain: New Journal of Physics.

13. Greory C. Rutledge, Sergey V. Fredlikh.(2007).Formation of fiber by electrospinning. USA: Advance Drug delivery reviews.

14. Travid J. Still, Horst A. Von Recom.(2008). Electrospinning: Application in drug delivery and tissue engineering.USA: Biomaterials.

15. Mohammad Chowdhury ,George Stylios. (2010). Effect of Experimental Parameters on the Morphology of Electrospun Nylon 6 fibres.UK: International Journal of Basic & Applied Sciences IJBAS-IJENS.



I155

Title Quantitative Analysis of Lactobacillus in Infected Root Canals of Primary Teeth

Author: Miss Pim Khererat

Program Master of Science program in Dentistry (International program)

Institute Mahidol University

Abstract

Introduction: The primary dentition is important for childhood in term of speaking,

chewing and their appearance. Root canal infection is the main reason in premature loss

of primary teeth in children. Consequently, it is important to identify bacteria which act

as pathogens to improve an effective therapy of root canal treatment in children.

Objective: To analyze and compare Lactobacillus spp. levels in infected root canal

samples of primary teeth between two clinical situations; Group1; irreversible pulpitis,

and Group2; pulp necrosis, as well as evaluate the relationships with the history of

spontaneous pain and clinical abscess.

Research Methodology: 51 root canal samples (41 samples in Group1 and 10 sampels

in Group 2) were obtained from Thai children aged 2.9-8.8 years. After DNA from

samples were extracted, Real-time PCR by using specific primers of Lactobacillus

species and SYBR green were performed to quantify bacterial level. For each sample,

total CFU count was converted to a log10 count to normalize the data. Independent

Sample T-Test and Mann-Whitney U test were used for statistical analysis. The value

of p < 0.05 was accepted as statistically significant difference.

Results: The levels of Lactobacillus in primary teeth diagnosed with pulp necrosis was

significantly higher than irreversible pulpitis. In addition, Lactobacillus level in root

canal samples from subjects who had a history of spontaneous pain was significantly

higher than subjects who had no history. However, the presence of clinical abscess was

not related with the bacterial level of Lactobacillus in root canal infection.

Conclusion: The significantly high levels of Lactobacillus were found in root canal

infection of primary teeth that diagnosed with pulp necrosis and had a history of

spontaneous pain.

Keywords: LACTOBACILLUS/ REAL-TIME PCR/ ROOT CANALS INFECTION/

PRIMARY TEETH

Introduction

The primary dentition is important for childhood. They work as guides for

the eruption of permanent dentition and contribute to the development of jaws and

chewing process to promote nutrient assimilation. Premature loss of primary teeth can

produce change in the eruption of permanent teeth, which can cause phonetic

disturbances and harmful oral habit, such as tongue interposition and esthetic

consequences. Dental caries is considered as endogenous bacterial infected disease,



I156

caused by oral cavity bacterial flora with have latent pathogenic potential. If caries is

not treated, the complications occur with endodontic infection.

Root canal infection which is commonly a consequence to dental caries can

cause premature loss in primary dentition. The pulp in primary dentition is histologically

similar to permanent teeth and could be affected by caries, restorative procedure and

trauma. The etiology and pathogenesis of dental infection in children are similar in the

primary and permanent dentition, but they are different in the process because the

primary teeth have specific anatomical and physiological conditions.

The accomplishment of endodontic treatment depends on several factors.

Nonetheless, the most important key is to reduce or eliminate the infection of

microorganisms. Therefore, the knowledge of variety in microorganism in root canal

infection should be explored for more understanding to improve an effective therapeutic

strategy in root canal treatment in primary teeth.

The method which rapidly detect and identify the microorganism have been

developed which is Quantitative PCR (Real-time PCR) with species-specific primers. It

can provide an accurate and sensitive method for detection and quantification of

individual species and bacterial populations. The ability to quantify the bacteria in a

sample has advantages to previous approaches in that it not only identifies a presence or

absence but also the amount of bacteria that could be related to clinical conditions.

Bacterial biology of root canal infection

In the way of invasive is via caries; the bacteria in the front of the carious

process may be the primary microorganisms to reach the pulp and initiate endodontic

infection. A study identified bacteria isolated from carious lesion biofilms and vital

carious exposures of pulps of deciduous teeth and observed that the microbiota of the

carious lesions exposed pulps were similar in composition to those of carious lesion

biofilms except that fewer species were identified from the pulps. Recent molecular

biology methods have established that the diversity and complexity of the microbiota

associated with caries are greater than the variety of microorganisms were found by

cultural method. Microbiological research using molecular method found that about 40-

60% of the microorganisms occurring in carious lesions consists of uncultatived species.

Several studies investigated the microbiota associated with endodontic infection in

adults and indicated that they were dominated with the presence of obligate and

facultative anaerobe bacteria on microbial composition. As the caries lesion advances

to deep into dentine, the composition of the involved microbiota shifts from a

predominance of facultative and saccharolytic Gram-positive bacteria in shallow lesions

to a predominance of proteolytic anaerobic bacteria in deep dentinal lesions.

Rocas IN et al studied and evaluated deep dental caries in permanent teeth

in term of the prevalence of bacterial species which associated with pulp exposures by

Quantitative PCR (qPCR). In this study, they found the presence and levels of

Streptococci and Lactobacilli which are high prevalent and they also associated with

dental caries. While both of bacterial groups were found in a high frequency, but they



I157

comprised only 0.09% and 2% in the whole bacterial population, respectively. From

this results, researchers suspected that the bacteria which found in high prevalence in

deep carious lesion that resulted in pulp exposure may be important pathogens in

evoking pulp inflammation and initiating endodontic infection.

If the pulp is freely exposed to the caries biofilm, the inflammation of the

dental pulp usually develops to irreversible pulpitis. Even though the pulp is still alive,

the approach of bacteria into the pulp will not allow the pulp to heal and it will ultimately

result in necrosis, or death, of the pulp tissue, consequently. The bacterial effects on the

pulp are caused either by bacterial virulence factors and antigens that diffuse through

the dentinal fluid or by the bacterial cells themselves which may reach the pulp via

dentinal tubules. Due to differences of availability of nutrients and oxygen, the root

canal is unique site of infection in oral cavity. Once the pulp is necrotic, only a restricted

subset of species can colonize it. While the infectious or necrotic pulp extents to

periapical area, an acute periapical abscess which induces bone and tissue necrosis and

accumulation of purulence will occur. Furthermore, the previous study which compared

the bacterial community profiles between symptomatic and asymptomatic primary

infection by molecular fingerprinting techniques has found marked differences between

these conditions.

Diversity of bacteria in infected root canal in primary teeth

Studies about the bacteriology in infected root canals of primary teeth has

been reported since 1960. Due to a wide variety of organisms in infected root canals of

permanent teeth, researchers have questions about the difference of microorganism

between primary and permanent teeth.

Using bacterial culture, a few studies reported that the microorganism in the

root canal infection with pulp necrosis and periapical lesions in human deciduous teeth

are polymicrobial, and they are predominance with anaerobic microorganisms of 96.7-

100 %. According to the results of these studies, they hypothesized that predominance

of anaerobic microorganisms were affected by the occurrence of natural selection. The

proper microorganism selection of the microbial shift depends on many factors such as

gradual decreasing in oxygen tension in root canals, together with the nutritional needs

of microorganisms and the food chain.

After molecular techniques were introduced for the identification of bacteria

as more specific, accurate, sensitive and rapid technique especially uncultivable and

fastidious type. A pilot study in children with severe early childhood caries about the

microbiota of carious exposures of dental pulps had been made for a better

understanding of pulp pathogens. This study focused on bacteria in the exposed vital

coronal pulp and used combined cultural and molecular methods for analysis. The

bacteria samples from carious biofilm and pulp chambers were collected to identify

bacteria species by using sequences of 16S rRNA. From the results of this study, the

dominant species detected were S. mutans. Moreover, Parascardovia, Veillonella,



I158

Actinomyces and Lactobacillus species in pulps suggests that these species might play

direct or supporting roles in pulp pathology in children.

The study from Qiu-Bo Yang, et al observed bacteria associated with acute

apical abscesses in children by PCR-DGGE technique. Purulence samples from infected

primary teeth diagnosed as acute apical abscess were analyzed. The most dominate

bacteria genera were Prevotella, Fusobacterium, Porphyromonas and Lactobacillus

spp. The findings in this study presented the predominant microorganisms as strict and

facultative anaerobic bacteria, which is in agreement with previous studies.

Relationship of Lactobacillus species and root canal infection

Lactobacilli are rod-shaped, Gram-positive, none spore forming, highly

acidogenic and acid-tolerant bacteria, which grows under anaerobic, facultative

anaerobic or microaerophillic conditions. They are generally considered nonpathogens,

except their association with dental caries. These bacteria are primarily associated with

dental caries progression due to their ability to produce lactic acid which can decalcify

enamel and dentine. A study in Thai children showed relationship between the

prevalence of Lactobacillus and caries status. The previous quantitative analysis by real-

time PCR in Thai children reported that the amount of Lactobacillus fermentum in

plaque from children with severe early childhood caries was significantly higher than

caries free group. Some studies reported the prevalence of Lactobacillus species in

infected root canal in primary and permanent dentition. The most common species found

in infected root canals are L. casei, L. salivarius, L. acidophilus, L. plantarum and L.

fermentum. The prevalence of Lactobacilli in infected root canals was scarcely reported

in previous studies. Some of them revealed that this microorganism was dominated over

other Gramm-positive rods, so the presence of Lactobacilli may have an important role

in root canal infection and associate with ecological change in the affected tissue.

By cultural method, one of microbiological studied isolated aerobic and

anaerobic microorganism from extracted teeth in different parts of deep carious lesions

with irreversible pulpitis to investigate the microbial changes between shallow dentinal

caries and infected pulp. The results were divided into two main groups consisting of

high and low level of Lactobacilli which are the most frequent organism in this study.

The results showed that, in high Lactobacilli group, gradually increasing level of

Lactobacilli was presented when the sampling moved down to the pulp. As a result, they

concluded that an extremely acidic environment in deep carious lesions and inside

infected dentine of the root canals tends to be more preferable for Lactobacilli. This

situation seems to be associated with root canal infection and pulpal death. Further study

might require to fully understand the issue.

By using microbiological technology, some researchers tried to contribute

the knowledge of the bacteria taxa occurring at the forefront layer of deep dentinal caries

associated with pulp exposure with symptomatic irreversible pulpitis by using the next-

generation of sequencing approach. The finding of this study reported the similar results

to the previous studies. Half of deep caries samples were heavily dominated by



I159

Lactobacillus, while in the other half Lactobacilli were very low abundance but

dominated by the other bacteria species which was commonly detected in infected root

canals such as Pseudoramibacter, Olsenella, Streptococcus and Stenotrophomonas. The

researchers suspected that the difference in Lactobacilli abundance may represent a

transition from cariogenic microbiota to the one that participates in the initial infection

of the pulp tissue.

According to findings of previous studies, the high prevalence of

Lactobacillus related with in advanced caries and infected pulp in permanent teeth.

However, no study has ever reported the bacterial quantity of Lactobacillus spp. in root

canal infection of primary teeth. This study hypothesized that Lactobacillus level in root

canal infection of primary might relate with root canal infection diagnosed as pulp

necrosis and some of clinical signs and symptom of root canal infection.

Objectives

1) To identify and compare the levels of Lactobacillus spp. in root canal

samples of primary teeth diagnosed as irreversible pulpitis and pulp necrosis

in Thai children aged 2 to 10 years

2) To investigate the relationships between the levels of Lactobacillus spp.

and clinical signs and symptoms of root canal infection in primary teeth.


Subjects and sample collection

This study was approved by the Ethical Institutional Review Board, Faculty

of Dentistry and the Faculty of Pharmacy, Mahidol University (MU-DT/PY-IRB

2016/014.0809) and it was under the consideration of the Ethical Institutional Review

Board, Faculty of Dentistry and the Faculty of Pharmacy, Mahidol University for the

annual extension.

The infected primary teeth which needed pulpectomy treatment from fifty-

three children (2-10 years old) who came to pediatric dental clinic, Mahidol University

were included in this study. All children had to have normal physical growth, no

systemic disease and cooperative. Those who had received any antibiotic therapy during

the last 3 months were excluded from the study. The informed consent was obtained

from the parents. Samples were collected by using strict asepsis according to Siqueira

et al. with slightly modification in term of agents that used for sterilization of operative

field. Briefly, the tooth was cleansed with pumice and isolated with a rubber dam. The

tooth and the surrounding field were sterile by Iodine solution. Complete access

preparations were made by using sterile burs with sterile normal saline solution.

Samples were initially collected by means of a #15 K-file. The files were introduced to

a level approximately 1 mm short of the tooth apex, then two to three sequential paper

points were placed to the same level and use to soak up the fluid in the canal. Leave the

paper points in wet canal for 60 seconds and then transfer to tubes containing 1.0 ml of

TE buffer. Then, samples were immediately frozen at -20°C.



I160

DNA extraction and Real-time PCR

The bacterial strain of Lactobacillus fermentum (ATCC 14931) was used in

this study for the specificity and sensitivity tests of primers in PCR technique. Bacterial

DNAs were extracted from fluid in paper points by using FavorPrepTM Tissue Genomic

DNA Extraction kit (Favorgen®, Taiwan) according to the manufacturer’s instructions.

Species-specific primers for Lactobacillus were referred from the study of Mcorist et al.

in 2002. (Primer F; 5’-TGGAAACAGGTGCT AATACCG-3’, primer R; 5’-

CCATTGTGGAAGA TTCCC-3’) Real-time PCR was performed with KAPA SYBR®

qPCR Master Mix (KAPA Biosystems, USA). Quantities of bacterial DNAs in each

sample were calculated by comparing with Standard curve that was generated from

serial dilution of known bacterial DNA concentration in Real-time PCR. Each reaction

mixture in Real-time PCR consisted of 10 µL KAPA SYBR, 0.4 µL of each diluted

forward and reverse primer 1:10 mM and 9.2 µL of nuclease free water and DNA

volume. All amplifications and detections were carried out in Thermocycler (C1000™

Thermal cycler and CFX 96 Real-time System). Amplification was carried out as

follows: initial denaturation for 3 min at 95 °C, 40 cycles of denaturation for 10 s at 95

°C, primer annealing and extension for 30 s at 53.6 °C. The PCR products were

separated and confirmed by electrophoresis on agarose gel, stained with ethidium

bromide dye, and detected by UV box (Hoefer Inc., USA)

Results/conclusion

Fifty-one infected primary teeth from 51 children, who came to Mahidol

University for root canal treatment by pulpectomy procedure, were incorporated to this

study followed by inclusion and exclusion criteria. Real-time PCR using specific

primers was performed to detect bacterial levels of Lactobacillus. The bacterial levels

of Lactobacillus spp. were showed in Table 1. The prevalence of Lactobacillus spp. in

root canal samples was 100% (51/51 samples). Mean and median of bacterial quantities

were 1.87x105 CFU (± 4.70x105 CFU) and 1.87x105 CFU, respectively.

Table 1 The data of bacterial quantities in this study.

Group N Mean ± SD (CFU)

Of Lactobacillus level

Mean log10 CFU

count ± SD p-value*

Pulpal status

Irreversible

pulpitis 41 1.33 x 105±3.71 x 105 4.039 ± 1.054

0.031*,a

Pulp necrosis 10 4.11 x 105±7.37 x 105 4.865 ± 1.062

History of

spontaneous

pain

Yes 28 2.44x105 ± 5.84x105 4.47 ± 0.92

0.047*,b

No 23 1.18x105 ± 2.70x105 3.87 ± 1.22



I161

*p-value < 0.05, a Independent Samples t-test, b Mann-Whitney U-test

Comparison of bacterial quantities between irreversible pulpitis and pulp necrosis

Due to purposive sampling in this study, samples were categorized into two

main groups depended on clinical presence of infected pulpal status.

Group1; Irreversible pulpitis group (41 teeth), primary teeth which

diagnosed with irreversible pulpitis were clinical presence of infected pulpal tissue such

as excessive hemorrhage in root canal that could not control with a damp cotton pellet

applied for several minutes.

Group2; Pulp necrosis group (10 teeth), primary teeth which diagnosed with

pulp necrosis were clinical presence of infected pulpal tissue such as suppuration or

purulence.

For each sample, total CFU count was converted to a log10 count to

normalize the data. The results showed that the bacterial levels of Lactobacillus spp. in

pulp necrosis group were significant higher than the bacterial levels in irreversible

pulpitis group. (Figure 1)

Figure 1 showed the relationship between the bacterial levels in Group: 1 Irreversible

pulpitis and Group2: Pulp necrosis

The relationships between Lactobacillus levels and clinical signs and symptoms

This study showed the significant relationship between the Lactobacillus

level and pain history. Figure 2 demonstrated that the history of spontaneous pain from

the infected primary teeth was found remarkable association with the high level of

Lactobacillus species. However, this study showed no significant difference of

Lactobacillus levels between presence and absence of clinical abscess.

Clinical

abscess

Presence 6 1.72x105±2.55x105 4.45 ± 1.02

0.513 b

Absence 45 1.89x105±4.93x105 4.17 ± 1.11



I162

Figure 2 demonstrated the differences of bacterial level of Lactobacillus spp. between

presence and absence of spontaneous pain history.

Specificity and sensitivity tests of the primers

Specificity and sensitivity tests of the primers were tested by conventional

PCR. The results showed that the Lactobacillus primers were specific to standard strain

of Lactobacillus fermentum (ATCC 14931) and sensitive to detecte 101 CFU of DNA

template from standard bacteria of Lactobacillus fermentum.

Figure 3 showed the result agarose gel electrophoresis of 247 bp amplified product

using Lactobacillus primers (forward and reverse). Only PCR products from

Lactobacillus fermentum (Lf) made band on agarose gel electrophoresis at 247 bp.



I163

Figure 4 showed the result of agarose gel electrophoresis from real-time PCR product

of 10-fold serially dilution to detect Lactobacillus primers from 108-101 CFU.

Discussion

Due to limited number of studies in microorganisms of infected root canal

in primary teeth, no previous study reported quantitative data of Lactobacillus spp. by

using real-time PCR technique.

This study reported that Lactobacillus spp. was found in all of root canal

samples and mean bacterial level was 1.87x105 CFU. In this study, the level of this

microorganism is similar to the previous study that examine the microbiota in advanced

caries lesions associated with irreversible pulpitis in permanent teeth. Rocas, et al found

that Lactobacilli and Streptococci were high prevalence of advanced caries with

exposed pulp samples. Mean of Lactobacillus spp. in their study was 2.32 x 106 (8.2

percent of total bacterial level).

In term of comparing the level of Lactobacillus spp. between irreversible

pulpitis and pulp necrosis groups, no previous studies reported the difference of

Lactobacillus spp. between these two conditions. However, the specific bacterial level

in pulp necrosis group might represent the predominant bacteria which relate to the

progression of root canal infection. In this study, the level of Lactobacillus spp. in

necrotic pulp samples was significantly greater level than irreversible pulpitis samples.

This finding was in a line to previous study. From the study by Ruviere et al, they

showed the significantly larger total bacterial cell numbers in pulp necrosis group than

in irreversible pulpitis group. The remarkably high level of Lactobacillus spp.in pulp

necrosis in this study might support the hypothesis that this bacteria take an important

role as one of pulpal pathogens to induce pulp inflammation and initiate endodontic

infection. Some of studies also supported this hypothesis. Hahn et al, investigated this

microorganism from teeth with irreversible pulpitis in permanent teeth. By cultural

method, high number and gradually increasing level of Lactobacilli were presented

when the sampling moved down to the pulp. They suggested that an extremely acidic

environment in deep carious lesions and inside infected dentine of the root canals tends

to be more preferable for Lactobacilli. Previous studies in primary teeth also identified

Lactobacillus species as predominant bacterial species in root canal infection of primary



I164

teeth. Chalmers et al reported the presence of high bacterial level of Lactobacillus spp.

in pulp necrosis samples. Yang, et al also found that this species was the most dominant

bacteria in purulence samples in acute apical abscess. The finding in this study combined

with previous studies support that Lactobacillus spp. might play direct or assistant role

in pulp pathology in children.

According to the results of relationships between the levels of Lactobacillus

spp. with clinical signs and symptoms, they showed that the level of Lactobacillus spp.

in subjects who have history of spontaneous pain was significantly greater than the

subjects who have no history of spontaneous pain. This result was similar with the result

of previous study in permanent teeth. Rocas et al detected the significant association

between continuous pain and prevalence of Lactobacillus spp. in permanent teeth

diagnosed as irreversible pulpitis. According to this findings, clinicians should be more

consider about taking history of pain in children because it might influence to treatment

outcome in term of bacteria elimination. Although the success of endodontic treatment

depends on many factors, the reduction of bacteria is the important key. The finding in

this study assumed that history of spontaneous pain presence associated with highly

remarkable bacterial level in infected root canal, two visit pulpectomy treatment with

proper medication and antimicrobial irrigation should be considered. However, the

result of this study showed no significant difference between this bacterial level and the

presence of clinical abscess both of acute and chronic abscess. The amount of

Lactobacillus spp. in samples with abscess presence were higher than the samples which

have absence of clinical abscess, but no significant difference. The small sample size of

abscess group might affect in statistical analysis. Moreover, the previous studies by Qiu-

Bo Yang, et al showed that acute apical abscess samples in primary teeth with root canal

infection presented the predominance of other bacterial species such as Prevotella,

Fusobacterium and Porphyromonas.

This study concluded that the significantly high levels of Lactobacillus were

found in root canal infection of primary teeth that diagnosed with pulp necrosis and had

a history of spontaneous pain. However, the relationships between the bacterial levels

and the presences of abscess or symptomatic cases were not found in this study.

The limitation of this current study was small sample size. The appropriate

sample size will produce studies capable of identifying clinically relevant differences.

Further study in this topic should be more sample size to reach proper sample size for

each group of pulpal status.

Recommendations

For improvement of root canal treatment in children, further microbiological

studies are recommended to explore and identify pulp pathogens in infected root canals

in primary teeth.



I165

References

Byun, R., Nadkarni, M. A., Chhour, K. L., Martin, F. E., Jacques, N. A., andHunter, N.

(2004). "Quantitative analysis of diverse Lactobacillus species present in

advanced dental caries." J Clin Microbiol 42, 7 (Jul):3128-3136.

Chalmers, N. I., Oh, K., Hughes, C. V., Pradhan, N., Kanasi, E., Ehrlich, Y., Dewhirst,

F. E., andTanner, A. C. (2015). "Pulp and plaque microbiotas of children with

severe early childhood caries." J Oral Microbiol 7:25951.

Chavez de Paz, L. E., Molander, A., andDahlen, G. (2004). "Gram-positive rods

prevailing in teeth with apical periodontitis undergoing root canal treatment."

Int Endod J 37, 9 (Sep):579-587.

Chhour, K. L., Nadkarni, M. A., Byun, R., Martin, F. E., Jacques, N. A., andHunter, N.

(2005). "Molecular analysis of microbial diversity in advanced caries." J Clin

Microbiol 43, 2 (Feb):843-849.

Cogulu, D., Uzel, A., Oncag, O., Aksoy, S. C., andEronat, C. (2007). "Detection of

Enterococcus faecalis in Necrotic Teeth Root Canals by Culture and

Polymerase Chain Reaction Methods." Eur J Dent 1, 4 (Oct):216-221.

Cogulu, D., Uzel, A., Oncag, O., andEronat, C. (2008). "PCR-based identification of

selected pathogens associated with endodontic infections in deciduous and

permanent teeth." Oral Surg Oral Med Oral Pathol Oral Radiol Endod

106, 3 (Sep):443-449.

Cohen, M. M., Joress, S. M., andCalisti, L. P. (1960). "Bacteriologic study of infected

deciduous molars." Oral Surg Oral Med Oral Pathol 13, (Nov):1382-1386.

da Silva, L. A., Nelson-Filho, P., Faria, G., de Souza-Gugelmin, M. C., andIto, I. Y.

(2006). "Bacterial profile in primary teeth with necrotic pulp and periapical

lesions." Braz Dent J 17, 2:144-148.

Diaz, P. I., Chalmers, N. I., Rickard, A. H., Kong, C., Milburn, C. L., Palmer, R. J., Jr.,

andKolenbrander, P. E. (2006). "Molecular characterization of subject-

specific oral microflora during initial colonization of enamel." Appl Environ

Microbiol 72, 4 (Apr):2837-2848.

Fabris, A. S., Nakano, V., andAvila-Campos, M. J. (2014). "Bacteriological analysis of

necrotic pulp and fistulae in primary teeth." J Appl Oral Sci 22, 2 (Apr):118-

124.

Fouad, A. F., Zerella, J., Barry, J., andSpangberg, L. S. (2005). "Molecular detection of

Enterococcus species in root canals of therapy-resistant endodontic

infections." Oral Surg Oral Med Oral Pathol Oral Radiol Endod 99, 1

(Jan):112-118.

Hahn, C. L., Falkler, W. A., Jr., andMinah, G. E. (1991). "Microbiological studies of

carious dentine from human teeth with irreversible pulpitis." Arch Oral Biol

36, 2:147-153.

Hata, S., Hata, H., Miyasawa-Hori, H., Kudo, A., andMayanagi, H. (2006).

"Quantitative detection of Streptococcus mutans in the dental plaque of

Japanese preschool children by real-time PCR." Lett Appl Microbiol 42, 2

(Feb):127-131.

Leonardo, M. R., Rossi, M. A., Silva, L. A., Ito, I. Y., andBonifacio, K. C. (2002). "EM

evaluation of bacterial biofilm and microorganisms on the apical external root

surface of human teeth." J Endod 28, 12 (Dec):815-818.



I166

Marsh, S. J., andLargent, M. D. (1967). "A bacteriological study of the pulp canals of

infected primary molars." J Dent Child 34, 6 (Nov):460-470.

Martin, F. E., Nadkarni, M. A., Jacques, N. A., andHunter, N. (2002). "Quantitative

microbiological study of human carious dentine by culture and real-time

PCR: association of anaerobes with histopathological changes in chronic

pulpitis." J Clin Microbiol 40, 5 (May):1698-1704.

Mitrakul, K., Vongsavan, K., andSuratanachaikul, P. (2013). "Prevalence of

Streptococcus mutans and Lactobacillus fermentum and their association

with caries and dietary habits in preschool Thai children." Eur Arch

Paediatr Dent 14, 2 (Apr):83-87.

Munson, M. A., Banerjee, A., Watson, T. F., andWade, W. G. (2004). "Molecular

analysis of the microflora associated with dental caries." J Clin Microbiol

42, 7 (Jul):3023-3029.

Munson, M. A., Pitt-Ford, T., Chong, B., Weightman, A., andWade, W. G. (2002).

"Molecular and cultural analysis of the microflora associated with endodontic

infections." J Dent Res 81, 11 (Nov):761-766.

Nadkarni, M. A., Caldon, C. E., Chhour, K. L., Fisher, I. P., Martin, F. E., Jacques, N.

A., andHunter, N. (2004). "Carious dentine provides a habitat for a complex

array of novel Prevotella-like bacteria." J Clin Microbiol 42, 11 (Nov):5238-

5244.

Pazelli, L. C., Freitas, A. C., Ito, I. Y., Souza-Gugelmin, M. C., Medeiros, A. S.,

andNelson-Filho, P. (2003). "Prevalence of microorganisms in root canals of

human deciduous teeth with necrotic pulp and chronic periapical lesions."

Pesqui Odontol Bras 17, 4 (Oct-Dec):367-371.

Ricucci, D., Loghin, S., andSiqueira, J. F., Jr. (2014). "Correlation between clinical and

histologic pulp diagnoses." J Endod 40, 12 (Dec):1932-1939.

Rocas, I. N., Alves, F. R., Rachid, C. T., Lima, K. C., Assuncao, I. V., Gomes, P. N.,

andSiqueira, J. F., Jr. (2016). "Microbiome of Deep Dentinal Caries Lesions

in Teeth with Symptomatic Irreversible Pulpitis." PLoS One 11, 5:e0154653.

Rocas, I. N., Lima, K. C., Assuncao, I. V., Gomes, P. N., Bracks, I. V., andSiqueira, J.

F., Jr. (2015). "Advanced Caries Microbiota in Teeth with Irreversible

Pulpitis." J Endod 41, 9 (Sep):1450-1455.

Rocas, I. N., Siqueira, J. F., Jr., andSantos, K. R. (2004). "Association of Enterococcus

faecalis with different forms of periradicular diseases." J Endod 30, 5

(May):315-320. Ruviere, D. B., Leonardo, M. R., da Silva, L. A., Ito, I. Y., andNelson-Filho, P. (2007).

"Assessment of the microbiota in root canals of human primary teeth by checkerboard

DNA-DNA hybridization." J Dent Child (Chic) 74, 2 (May-Aug):118-123.

Sakamoto, M., Rocas, I. N., Siqueira, J. F., Jr., andBenno, Y. (2006). "Molecular

analysis of bacteria in asymptomatic and symptomatic endodontic

infections." Oral Microbiol Immunol 21, 2 (Apr):112-122.

Sassone, L., Fidel, R., Figueiredo, L., Fidel, S., Faveri, M., andFeres, M. (2007).

"Evaluation of the microbiota of primary endodontic infections using

checkerboard DNA-DNA hybridization." Oral Microbiol Immunol 22, 6

(Dec):390-397.

Sassone, L. M., Fidel, R., Faveri, M., Fidel, S., Figueiredo, L., andFeres, M. (2008).

"Microbiological evaluation of primary endodontic infections in teeth with

and without sinus tract." Int Endod J 41, 6 (Jun):508-515.



I167

Siqueira, J. F., Jr., Rocas, I. N., Souto, R., de Uzeda, M., andColombo, A. P. (2000).

"Checkerboard DNA-DNA hybridization analysis of endodontic infections."

Oral Surg Oral Med Oral Pathol Oral Radiol Endod 89, 6 (Jun):744-748.

Siqueira, J. F., Jr., Rocas, I. N., Souto, R., de Uzeda, M., andColombo, A. P. (2002).

"Actinomyces species, streptococci, and Enterococcus faecalis in primary

root canal infections." J Endod 28, 3 (Mar):168-172.

Sundqvist, G., andCarlsson, J. (1974). "Lactobacilli of infected dental root canals."

Odontol Revy 25, 3:233-238.

Triches, T. C., de Figueiredo, L. C., Feres, M., de Freitas, S. F., Zimmermann, G. S.,

andCordeiro, M. M. (2014). "Microbial profile of root canals of primary teeth

with pulp necrosis and periradicular lesion." J Dent Child (Chic) 81, 1 (Jan-

Apr):14-19.

Vineet, R., Nayak, M., andKotigadde, S. (2016). "Association of endodontic signs and

symptoms with root canal pathogens: A clinical comparative study." Saudi

Endodontic Journal 6, 2 (May 1, 2016):82-86.

Yang, Q. B., Fan, L. N., andShi, Q. (2010). "Polymerase chain reaction-denaturing

gradient gel electrophoresis, cloning, and sequence analysis of bacteria

associated with acute periapical abscesses in children." J Endod 36, 2

(Feb):218-223.



I168

Gelatin-based hybrid hydrogels as mimicked extracellular matrix scaffolds for bone

healing in maxillofacial defects

Atsadaporn Tangprasert, Assoc. Prof Jirut Meesane, Dr. Chittreeya Tansakul,

Assist. Prof Nuttawut Tuengsubun

Institute of Biomedical Engineering, Faculty of Medicine, Prince of Songkla University.

Abstract

Many patients suffer from maxillofacial defects and in some cases those defects require

performance biomaterials for treatments. In this research, gelatin based hybrid hydrogels were

mimicked as extracellular matrix to perform as biomaterials for bone healing. Gelatin was mixed

with methylcellulose (MC), poly (vinyl alcohol), and silk fibroin (SF) before fabrication into

hybrid hydrogel by freeze-thawing. Morphological formation was observed by scanning Electron

Microscopy. Then, the hybrid hydrogels were evaluated for physical performance by testing the

swelling behavior and protein release. The hybrid hydrogels were also tested with cultured MG-

63 cells. Afterward, the biological performance was evaluated for cell proliferation, viability, and

calcium deposition. The results demonstrated that hybrid hydrogel had small pore size. The hybrid

hydrogel of gelatin/MC demonstrated more protein release at a later stage than the other hybrid

hydrogels. Hybrid hydrogels of gelatin/MC and PVA exhibited suitable cell proliferation, cell

viability, and calcium deposition. The performance of those hybrid hydrogels is similar to

extracellular matrix in native tissue. This research demonstrated that gelatin/MC and PVA are

promising for bone healing in maxillofacial defects.

Keywords: Hydrogels, Gelatin, Bone Tissue Engineering, Extracellular matrix, Biomaterials,

maxillofacial defects

Introduction

Currently, many patients suffer from bone defects in maxillofacial area. Many research

studies have focused on functional biomaterials as the treatment to induce bone healing at those

defects [1]. Functional biomaterials perform as extracellular matrix (ECM) in native tissues [2].

Generally, ECM shows functionality as a native scaffold which has biological signal to induce cell

adhesion and proliferation [3] which enhance new tissue formation. Therefore, functional

biomaterials which perform as ECM scaffolds were fabricated in this research.

Mimicking is an attractive approach which has been used to build scaffolds for bone tissue

engineering [4]. Mimicked scaffolds such as hydrogels have the structure and functionality similar

to native ECM which can enhance bone healing [5]. The scaffolds were fabricated into many

forms, such as membranes, sponges, fibers, and hydrogels [6]. Therefore, hydrogels are presented

in this research as mimicked ECM scaffolds.



I169

Hydrogel-based scaffolds are utilized in biomedical regeneration since they can replace or

degenerate defect tissues in animals. Hydrogels are crosslinked network of polymers that can

absorb a high volume of water in their structure. Mimicked hydrogels are attractive for tissue

regeneration because they can be generated in term of the function and structure that are similar to

native tissues. The natural and synthetic polymer can be used to fabricate hydrogels by physical or

chemical crosslinking network.

Gelatin is a natural polymer protein obtained from the hydrolysis of collagen, which is the

main component in skin, bone, and connective tissues. Due to the biocompatibility,

biodegradability, and non-immunogenic properties, gelatin is often fabricated into hydrogels for

pharmaceutical and medical applications [7]. Further, molecules of gelatin have the RGD amino

sequence which is the main trigger part in ECM components. The RGD has the important role of

inducing cell adhesion and proliferation. Hence, gelatin was selected as a based material to create

hydrogel as mimicked ECM scaffold.

Poly (vinyl alcohol) or PVA is a hydrophilic synthetic polymer that has excellent water

retention, biocompatibility, and good mechanical strength [8]. Therefore, it is widely used in

biomedical and pharmaceutical applications such as cartilage replacement, corneal implant, heart

valves, wound dressing, and drug delivery [9]. Since PVA shows good mechanical strength, it can

be blended with other water soluble polymers to form hydrogels. Therefore, PVA was selected as

a component of hydrogels in this research.

Methylcellulose (MC) is a modified cellulose in which methyl (-CH3) groups substitute for

the hydroxyl groups. Because of its biocompatibility with a good cell adhesion and gelling

properties, MC has been used for biomedical applications [10]. Further, the viscosity of MC is

similar to glycosaminoglycan in ECM of native tissues. Therefore, MC was chosen as a component

to mimic ECM scaffolds.

Silk fibroin (SF) is a protein which is a component of natural tissues. SF consists of the

important amino acids, such as alanine, glycine, serine, and tyrosine. The major structures of SF

are crystalline β-sheet, random coil, and alpha helical structure [11]. SF shows biodegradation,

biocompatibility, good mechanical properties, and low immunogenicity. SF-based biomaterials

have been utilized in the regenerations of many tissues such as vascular, skin, bone, and cartilage

tissue regenerations. In addition, SF has a biological and physical performances for cell adhesion

and structure maintenance, respectively. Those properties are similar to the functions of collagen

in ECM of native tissues. Therefore, SF was used as component to mimic ECM scaffolds.

In this research, gelatin was selected as the basic materials to fabricate hybrid hydrogels.

The gelatin was mixed with PVA, MC, and SF to mimic ECM scaffolds. The physical and

biological properties of hydrogels were evaluated for the promising goal of healing bone in

maxillofacial defects.

Objective

To develop and study the physical and biological behaviors of gelatin-based hydrogels

combined with MC, PVA, and SF for the healing of bone tissue in maxillofacial defects.



I170


Preparation of SF solution

The SF solution was prepared following the method from G. Chang et al [12]. Briefly,

cocoons were degummed by boiling in 0.02 M Na2CO3 for 30 min and rinsed with distilled water

to remove the sericin fraction. The SF without sericin was dissolved in 9.3 M LiBr solution at 70oC

for 30 min, dialyzed against water for 3 days to remove LiBr, and then centrifuged for 20 min at

4oC and 3500 RPM to separate the silk sediments. Finally, the SF solution was adjusted to a 5%

concentration for this experiment.

Preparation of gelatin, gelatin/PVA, gelatin/methylcellulose, and gelatin/silk fibroin

hydrogels

Gelatin (from porcine skin for microbiology), MC (Mn = 40000, viscosity 400.00 cps), and

PVA (Mw = 85,000-124,000 and 87-89% hydrolysis) solution were prepared by dissolution in

distilled water at 5% concentration. The 5% gelation solution was blended with the 5% PVA

solution, stirred, and poured into a 48-well plate. Then, the gelatin/PVA hydrogel was physically

crosslinked by freeze-thaw cycles and frozen at -20oC for 12 h and thawed at room temperature

for 12 h. The freeze-thaw procedure was carried out in 5 cycles. Gelatin/MC and gelatin/SF

hydrogels were prepared in a similar procedure as the gelatin/PVA hydrogels. However, after

freeze-thaw cycles, the gelatin/SF hydrogels were immersed in methanol to generate the β-sheet

structure and then washed with distilled water. The groups of hydrogels were shown in Table 1.

Table 1. Groups of hydrogels

Group Detail

A Gelatin hydrogel

B Gelatin/MC hydrogel

C Gelatin/PVA hydrogel

D Gelatin/SF hydrogel

Abbreviations: MC, methylcellulose; PVA, poly (vinyl alcohol); SF, silk fibroin.

Characterizations of the hydrogels

- Swelling testing

The swelling analysis of the hydrogels were performed by immersing hydrogels into

phosphate-buffer saline (PBS) solution at 37 C with different time periods. The samples were

taken out of the PBS, excess water was removed by filter paper, and they were weighed

immediately to obtain the wet weight (Wt). The dried weight (Wd) of the hydrogels was obtained

from the freeze dried hydrogels. The swelling ratio was calculated as following formula [13].

Swelling ratio = (Wt – Wd)/Wd

When Wt and Wd were defined as the weight of swollen and dried hydrogels, respectively.



I171

- Hydrogel morphologies and Pore size distribution

The scanning electron microscope (SEM, Hitachi TM3030) was carried out to observe the

hydrogel morphologies. The pore size of these hydrogels obtained by SEM images were measured

by ImageJ program and the pore size distribution was calculated by Origin8.1 program.

- Protein release of the hydrogels

The protein release of the hydrogels was measured according to the manufacturer's

instructions (Pirece BCA protein assay kit, Thermo Scientific, USA). 1xPBS was added into

hydrogels and incubated at 37oC with different time periods. After incubated, 20 µL of PBS and

200 µL of BCA solution were added into a 98-well plate and then incubated again for 30 min. The

color of the sample solution changed from green to purple, which related to protein concentration

and was measured at a wavelength of 562 nm.

- MG-63 Cell culture

MG-63 cells were cultured in a 75 cm3 flask with alpha-MEM medium (Gibco, Invitrogen,

Carlsbad, CA, USA) containing 1% penicillin/streptomycin, 0.1% fungizone, and 10% fetal

bovine serum. The MG-63 cell cultures were kept in a 37oC incubator with 5% CO2 and the media

was changed every 2-3 days. An osteogenic medium containing 10 mM β-glycerophosphate, 50

mg/mL ascorbic acid, and 100 nM dexamethasone was prepared for MG-63 osteoblast

differentiation.

- Cell proliferation (PrestoBlue at day 1, 3, 5, and 7)

Cell proliferation of the hydrogels was measured on day 1, 3, 5, and 7 using PrestoBlue

(PrestoBlue® Cell Viability Reagent, Invitrogen, USA) reagent. The hydrogels were washed

twice with 1xPBS solution. The PrestoBlue solution was prepared by mixing with the media at a

ratio of 1:10 and then added into the hydrogels. The hydrogels were then incubated at 37oC for 1

h and the absorption was measured at a wavelength of 570 nm.

- Cell viability (Fluorescent microscope on day 1, 3, and 5)

The MG-63 osteoblast cell viability in the hydrogels was measured by staining the

hydrogels with fluorescein diacetate (FDA). FDA was converted from non-fluorescence to green

fluorescence in viable cells. To observe cell viability, FDA was dissolved in acetone at a

concentration of 5 mg/ml and added to fresh media of the hydrogels. The hydrogels were kept

away from light for 5 min, washed with PBS, and observed by fluorescent microscopy.

- Alizarin red staining for mineralization assay

Alizarin red was used to detect the mineralized bone matrix after osteogenic differentiation.

After cell culturing for 7 days, the cells were fixed in 4% formaldehyde for 10 min, and alizarin

red solution (2% in distilled water) was added into hydrogels. After staining for 20 min at room

temperature in the dark, the hydrogels were washed twice with distilled water to remove excess

stain and the mineralization on the hydrogels was observed under microscope.



I172

- Statistical analysis

All data were statically analyzed using one-way ANOVA, Turkey’s HDS test (SPSS

20.0 software package). The data were presented as mean ± standard deviation was shown. P

values less than 0.05 were considered to be significant.

Results/Conclusion

- Morphological structure of hydrogels

After freeze-thawing, the appearances of all sample hydrogels were shown in Figure 1. The

pure gelatin (A) hydrogels were more transparent than other gels. When gelatin was combined

with MC, PVA, and SF, they showed the high turbidity.

Figure 1. (A) Gelatin, (B) Gelatin/MC, (C) Gelatin/PVA, and (D) Gelatin/SF hydrogels

The morphologies of the hydrogels were observed by (Figure 2). The pure gelatin

hydrogels had larger pore size than the other groups. The result showed that the pore size decreased

when the pure gelatin was blended with MC, PVA, and SF. Moreover, all of these hydrogels

exhibited interconnecting pores which are important for cell proliferation and attachment [14]. The

result showed the pore size distribution of the pure gelatin and hybrid gelatin hydrogels were in

the range 50-100 µm (Figure 3).



I173

Figure 2. SEM morphologies of hydrogels: (A) gelatin, (B) gelatin/MC, (C)

gelatin/PVA, and (D) gelatin/SF hydrogels

Figure 3. Pore size distribution of hydrogels: gelatin, gelatin/MC, gelatin/PVA, and

gelatin/SF hydrogels

- Physical performance of the hydrogels

In this research, the swelling behavior and protein release were used to demonstrate the

physical performance of the hydrogels. First, the swelling behavior of the hydrogels is an important

factor that is influenced by the pore size of hydrogels which has an effect on the cellular behavior

[15]. In this work, the swelling ratios of these hydrogels were measured at the different time

periods (Figure 4). The gelatin/MC hydrogels showed the highest swelling behavior at the start

time, and reached to the equilibrium state near the initial start time. This was possibly due to the



I174

porous structure and the high water absorption of MC which could synergize the high swelling

behavior [16].

Figure 4. Time line of the swelling behavior of the hydrogels: gelatin; gelatin/MC;

gelatin/PVA; gelatin/SF hydrogels

Second, protein release is related to the biological ability to induce new tissue formation

[17]. Protein release from the hydrogels in a PBS solution at an incubation temperature of 37oC

was studied at different times by the bicinchoninic acid (BCA) assays (figure 5). The burst release

was observed as a function of time for all groups of hydrogels. Pure gelatin showed the highest

protein release. On the other hand, the protein release of the gelatin/MC, gelatin/PVA, and

gelatin/SF hydrogels in the time range of 5-60 min were not significantly different. However, at

3 h, the protein release of the gelatin/MC hydrogels had significant increased compared to the

gelatin/PVA and gelatin/SF hydrogels.

The protein release of the pure gelatin hydrogels was the highest and it increased steadily

from the beginning. Protein release is an important factor that has an effect on the cell attachment.

Gelatin is a protein that can react with BCA reagent on its own. Hence, the pure gelatin showed

the highest level of protein release.

1 10 100 1000

4

6

8

10

12

14

Gelatin

Gelatin/MC

Gelatin/PVA

Gelatin/SF

Sw

elli

ng r

atio

Time (min)



I175

Figure 5. Protein release over time: gelatin; gelatin/MC; gelatin/PVA; and gelatin/SF

hydrogels

- Biological performances of hydrogels

The cell proliferation and viability, and calcium deposition was used to evaluate

biological performance of hydrogel in this research. For the cell proliferation, the biological

behavior of gelatin-based hydrogels were evaluated at day 1, 3, 5, and 7 using PrestoBlue reagent

(Figure 6). The cell proliferations of the hydrogels increased from day 1 to day 7. At day 1 and

day 3, the gelatin/SF hydrogels showed the highest cell proliferation compared the other groups.

The gelatin and gelatin/SF hydrogels dissolved in the media at day 5, and day 7, respectively.

Therefore, the gelatin hydrogel and gelatin/SF had no cell proliferation at those time points. At

day 7, cell proliferation of the gelatin/MC hydrogels was higher than the gelatin/PVA hydrogels.



I176

Figure 6. The cell proliferation with different groups of hydrogels at day 1, 3, 5, and 7. The

symbol (*) presented significant changes (*p < 0.05).

Cell viability of the hydrogels was observed at day 1, 3, and 5 after staining the osteoblast

cells with FDA (Figure 7). The results showed that the osteoblasts could attach to the surface of

all types of hydrogels. The osteoblasts penetrated and spread into the emerged pores which

possibly came from the dissolved parts of the gelatin/MC and SF at day 3 and 5. Those pores can

promote cell migration and proliferation [18]. A dense aggregation of cells covered the whole

surface of the gelatin/PVA hydrogels at day 5. This was possible because the gelatin/PVA could

maintain the contour shape of the pores which had no dissolved parts of the hydrogel.

.



I177

Figure 7. FDA cell staining of the gelatin, gelatin/MC, gelatin/PVA, and gelatin/SF hydrogels

at day 1, 3, and 5.

In this research, alizarin red staining was used to demonstrate calcium deposition on the

hydrogels. The calcium deposition (red color) on the gelatin/MC and the gelatin/PVA hydrogels

at day 7 and day 14 of cell culturing are shown in Figure 8. Those two types of hydrogels exhibited

high calcium deposition. Therefore, the gelatin/MC and gelatin/PVA hydrogels could promote

calcium synthesis from the osteoblast.

Figure 8. Alizarin red of the (A, B) gelatin/MC and (C, D) gelatin/PVA hydrogels at day

7 and day 14, respectively.

Discussion

The gelatin-based hydrogels with different polymers of MC, PVA, and SF were presented

as mimicked extracellular matrix scaffolds for healing of bone tissue in maxillofacial defect.

For the morphological formation, the results demonstrated that the pure gelatin hydrogel

displayed large pore size. This indicated that the gelatin had hydrophilic characteristics. The

hydrophilic characteristic of gelatin could hold a high amount of water which led to the formation

of large pore size [19]. On the other hand, the hybrid hydrogel had smaller pore size. This

demonstrated that the hybrid hydrogel had a low capacity to maintain water in their structure. That

low capacity effectively formed small pore size.

This research demonstrated that gelatin with MC had unique physical performance

swelling behavior and protein release. Gelatin/MC showed higher swelling ratio and protein

releasing than other hybrid hydrogels. The results demonstrated that the porous structure of the

hybrid hydrogels might have an effect on the prolonged swelling behavior to reach the steady state.

The higher protein release was also influence by hydrogel degradation. Therefore, the protein

release rate can be modulated by varying the gelatin ratio with other materials and it can be

improve cell behavior [20].



I178

Interestingly, some reports demonstrated that extracellular matrix showed swelling

behavior and protein releasing from degradation during tissue regeneration [21]. This indicated

that gelatin/MC were similar to the physical functionality of extracellular matrix in native tissue

[22].

The results indicated that the dissolution of the gelatin hydrogels possibly came from the

low density structure and the high temperature sensitivity of the gelatin. The dissolution of the

gelatin/SF hydrogels was due to the phase separation between the dissolved gelatins and the

undissolved SF molecules in the water. The higher cell proliferation of gelatin/MC possibly came

from some parts of the hydrogel which dissolved. That dissolved parts led to higher porosity which

could enhance cell proliferation. Previous studies reported that some enzymes degraded the ECM

during new tissue formation [23]. The degraded ECM leads to a porous structure which can

enhance cell migration and proliferation [24]. Therefore, the result indicated that gelatin with MC

showed performance similar to ECM in native tissue.

Furthermore, the gelatin with MC demonstrated biological performance which could

promote cell proliferation, viability, and calcium deposition. That hydrogel exhibited physical and

biological performance similar to ECM in native bone tissue. This research indicated that hybrid

hydrogel of gelatin with MC have promise in healing bone tissue in maxillofacial surgery.

Recommendations

The low mechanical and water solubility of gelatin are the weakness of gelatin hydrogels.

Therefore, the modification of the gelatin with other materials or nanoparticles can be used to

improve the physical and biological properties of these hydrogels. Modified gelatin hydrogels

should be appropriate for treatments and they can generate the new tissue.

References

[1] R. Schmelzeisen, R. Schimming, M. Sittinger. (2003). Making bone: implant insertion into

tissue-engineered bone for maxillary sinus floor augmentation—a preliminary report.

Germany: Journal of Cranio-Maxillofacial Surgery.

[2] F. J. O'Brien. (2011). Biomaterials & scaffolds for tissue engineering. Ireland:

Materialstoday.

[3] C. M. Murphy, M.G. Haugh, F. J. O'Brien. (2010). The effect of mean pore size on cell

attachment, proliferation and migration in collagen–glycosaminoglycan scaffolds for bone

tissue engineering. Ireland: Biomaterials.

[4] E. Palin, H. Liu, T.J. Webster. (2005). Mimicking the nanofeatures of bone increases bone-

forming cell adhesion and proliferation. USA: Nanotechnology.

[5] S. Badylak, S. Arnoczky, P. Plouhar, R. Haut, V. Mendenhall, R.Clarke, C. Horvath. (1999).

Naturally Occurring Extracellular Matrix as a Scaffold for Musculoskeletal Repair. USA:

Clinical Orthopaedics & Related Research.



I179

http://www.sciencedirect.com/science/article/pii/S136970211170058X

http://www.sciencedirect.com/science/article/pii/S0142961209009958



[6] R. C. Thomson, M. J. Yaszemski, J. M. Powers, A. G. Mikos. (1998). Hydroxyapatite fiber

reinforced poly (a-hydroxy ester) foams for bone regeneration. USA: Biomaterials.

[7] S. V. Vlierberghe, P. Dubruel, E. Schacht. (2011). Biopolymer-Based Hydrogels As

Scaffolds for Tissue Engineering Applications: A Review. Belgium: Biomacromolecules.

[8] J. A. Stammen, S. Williams, D.N. Ku, R. E. Guldberg. (2001). Mechanical properties of a

novel PVA hydrogel in shear and unconfined compression. USA: Biomaterials.

[9] M. I. Baker, S. P. Walsh, Z. Schwartz, B. D. Boyan. (2012). A review of polyvinyl alcohol

and its uses in cartilage and orthopedic applications. Georgia: Society for biomaterials.

[10] L. Klouda, A. G. Mikos. (2008). Thermoresponsive hydrogels in biomedical applications.

USA: European Journal of Pharmaceutics and Biopharmaceutics.

[11] Y. Qi, H. Wang, K. Wei, Y. Yang, R.Y. Zheng, I. S. Kim, K. Q. Zhang. (2017). A Review of

Structure Construction of Silk Fibroin Biomaterials from Single Structures to Multi-Level

Structures. China: Molecular Sciences.

[12] G. Chang, H.J. Kim, D.L. Kaplan, G. V. Novakovic, R. A. Kandel. (2007). Porous silk

scaffolds can be used for tissue engineering annulus fibrosus. Canada: European Spine Journal.

[13] J. Shi, M.M.Q. Xing, W. Zhong. (2012). Development of Hydrogels and Biomimetic

Regulators as Tissue Engineering Scaffolds. Canada: Membranes.

[14] M. Mastrogiacomo, S. Scaglione, R. Martinettie, L. Dolcinie, F. Beltrame, R. Cancedda, R.

Quarto. (2006). Role of scaffold internal structure on in vivo bone formation in macroporous

calcium phosphate bioceramics. Italy: Biomaterials.

[15] S. Lin, N. Sangaj, T. Razafiarison, C. Zhang, S. Varghese. (2011). Influence of Physical

Properties of Biomaterials on Cellular Behavior. USA: Pharmaceutical Research.

[16] S. J.Kim, S. J. Park, S. I. Kim. (2003). Swelling behavior of interpenetrating polymer

network hydrogels composed of poly (vinyl alcohol) and chitosan. South Korea: Reactive &

Functional Polymers.

[17] B. Li, T.Yoshii, A. E. Hafeman, J.S. Nyman, J. C. Wenke, S. A. Guelcher. (2009).The effects

of rhBMP-2 released from biodegradable polyurethane/microsphere composite scaffolds on

new bone formation in rat femora. USA: Biomaterials.

[18] B. B. Mandal, S. C. Kundu. (2009). Cell proliferation and migration in silk fibroin 3D

scaffolds. India: Biomaterials.

[19] Z.A. Nur Hanani, Y.H. Roos, J.P. Kerryc. (2014). Use and application of gelatin as potential

biodegradable packaging materials for food products. Ireland: International Journal of

Biological Macromolecules.

[20] Y. Liu, N. E. Vrana, P. A. Cahill, G. B. McGuinnes. (2008). Physically Crosslinked

Composite Hydrogels of PVA With Natural Macromolecules: Structure, Mechanical

Properties, and Endothelial Cell Compatibility. Ireland: Journal of biomedical materials

research.

[21] Joerg K. Tessmar, Achim M. Göpferich. (2007). Matrices and scaffolds for protein delivery

in tissue engineering. Germany: Advanced Drug Delivery Reviews.



I180

https://www.google.co.th/url?sa=t&rct=j&q=&esrc=s&source=web&cd=2&cad=rja&uact=8&ved=0ahUKEwiX4ObYoIHUAhVLsY8KHSUnCd0QFgg0MAE&url=http%3A%2F%2Fwww.springer.com%2Fmedicine%2Forthopedics%2Fjournal%2F586&usg=AFQjCNE6J8_fmjAplCljyx0pLD5m25xoWg&sig2=X97-Ir_wm-_u2O09XIAx4g

https://link.springer.com/journal/11095

[22] S.A. Sell, P. S. Wolfe, K. Garg, J.M. McCool, I. A. Rodriguez, G.L. Bowlin. (2010). The Use

of Natural Polymers in Tissue Engineering: A Focus on Electrospun Extracellular Matrix

Analogues. USA: Polymers.

[23] B. K. Mann, A. S. Gobin, A. T. Tsai, R. H. Schmedlen, J. L. West. (2001). Smooth muscle

cell growth in photopolymerized hydrogels with cell adhesive and proteolytically degradable

domains: synthetic ECM analogs for tissue engineering. USA: Biomaterials.

[24] B. A. C. Harley, H.D. Kim, M.H. Zaman, L. V. Yannas, D. A. Lauffenburger, and L. J.

Gibson. (2008). Microarchitecture of Three-Dimensional Scaffolds Influences Cell

Migration Behavior via Junction Interactions. USA: Biophysical Journal.



I181

Appendix

Author: Atsadaporn Thangprasert


Institute: Faculty of Medicine, Institute of biomedical Engineering, Princes of Songkla

University.


Author: Associate Professor Jirut Meesane


Institute: Faculty of Medicine, Institute of biomedical Engineering, Princes of Songkla

University.


Author: Dr. Chittreeya Tansakul

Program: Organic chemistry

Institute: Faculty of Science, Department of Chemistry and Center of Excellence for Innovation

in Chemistry, Prince of Songkla University. Tel. 081-9901534 e-mail. [email protected]

Author: Assistant Professor Nuttawut Tuengsubun

Program: Bioengineering and Materials Engineering for tissue engineering.

Institute: Faculty of Dentistry, Department of Oral and Maxillofacial Surgery, Prince of Songkla

University.




I182


Title Effects of thickness and materials on mechanical behaviors in a

sandwich structure under compression using a computational simulation

Author: Kittipong Phetnui and Surapong Chatpun

Program Institute of Biomedical Engineering, Faculty of Medicine Institute Prince

of Songkla University, Songkhla 90110, Thailand

Abstract

High impact load can cause fractures or damages to our body. Several studies

have applied a concept of multi layers or laminated layers to reduce shock load in some

products such as footwear, mouthguard and helmet. It is interesting to apply this

concept for a body protector using a sandwich structure. This study used a computer

simulation to investigate the mechanical changes of the constructed sandwich specimen

with different materials and thickness in the middle layer. The specimen was

constructed and the simulation was performed using SolidWorks software. Initial and

boundary conditions were applied regarding to the compression. Titanium alloy

(Ti6A), polycarbonate urethane (PCU) and ultra-high molecular weight polyethylene

(UHMWPE) were assigned as the middle layer whereas both top and bottom layers

were Ti6A. It was found that the maximum von Mises stress and maximum

compressive stress in the PCU middle layer decreased as the thickness of middle layer

reduced. There was a slight change in maximum von Mises stress and compressive

stress when the middle layer thickness decreased for Ti6A and UHMWPE specimens.

Strain in the middle layer tentatively decreased when PCU was used whereas strain in

the Ti6A middle layer and UHMWPE middle layer was quite unchanged. Therefore,

the thickness and material of middle layer in the sandwich structure play a role in the

mechanical behaviors of a specimen.

Keywords: Shock absorption, Impact load, Sandwich structure, von Mises Stress,

Strain

Introduction

There are many people who suffer from unexpected events such as accidents or

extreme daily activities that are related with both static and dynamic forces including

impact forces. These forces, especially high impact loads, cause wear and breakage in

any parts of our body. If these forces cannot be avoided, a protector is necessary to

reduce or relieve the excessive force. Impact load is considered as a high force or shock

applied over a short period which can cause damage or failure to objects. Therefore, the

reduction on impact load is an important concern to prevent the failure. There are



I183

several studies that investigate about shock absorption in many aspects such as footwear

materials, mouthguard and human knee joints (Shimazaki et al.,2016; Hoshino et al.,

1987; Handa et al.,2011). The idea to reduce shock load or impact load can be easily

found in a motorbike helmet by using aluminum honeycomb structure as reinforcement

(Caserta et al.,2011). The other study has showed a multi-layer plate composed of

aluminum, rubber and foam as a sandwich model can protect the underwater shock

wave mitigation better than a triple aluminum plate (Hawass et al.,2015). Furthermore,

it was laboratory found that the new design on shock absorption with pre-laminated

material for mouthguard showed significant buffer capacity than a conventional design

in term of tooth distortion (Handa et al., 2011). Therefore, a sandwich model or

laminated model with an elastic middle layer might be interesting in shock absorption

for human body application.

Generally, metal materials have highly comparative mechanical properties such

as hardness and tensile strength. Furthermore, metals are very good for energy transfer

and fracture toughness. On the other hand, elastic materials are high energy absorption

because of their viscoelasticity. Therefore, it is interesting to improve the load

absorption by using different elastic materials as a body protector.

Objective

1) This study applied the sandwich structure with different middle layer

materials to improve load absorption. We therefore investigated the

mechanical changes of the constructed sandwich model using a computer

simulation such as von Mises stress, compressive stress and strain.


1. Testing specimen model

The specimen was designed using a SolidWorks software version 2012. There

are 4 models which are different in thickness of three layers as showed in Table 1. The

total thickness of the specimen is 9 mm and the dimensions of the specimen are

presented in Figure 1. Top and bottom layer of the specimen were assigned as titanium

alloy (Ti6A). Furthermore, there were three materials at the middle layer to be selected

(Ti6A, polycarbonate urethane (PCU) and ultra-high molecular weight polyethylene

(UHMWPE)). The material properties were taken from the literature reviews and

commercial material datasheets (Elsner et al.,2010; Bergschmidt et al., 2016; Kluess et

al.,2011; Cournapeau et al.,2015; Nguyen et al., 2015; DSM Biomedical.,2011; Plastic

Products, Inc; ASM Aerospace Specification Metals Inc). The properties of materials

used in this study were showed in Table 2.



I184

Table 1 The thicknesses of constructed specimen for each model

Layer Model #1 Mode #2 Model #3 Model #4

Top 1 mm 2 mm 3 mm 4 mm

Middle 7 mm 5 mm 3 mm 1 mm

Bottom 1 mm 2 mm 3 mm 4 mm

Figure 1 Dimensions of a constructed specimen.

Table 2 Material properties using for a constructed specimen

Materials

Yield

Strength

(N/m2)

Elastic

Modulus

(N/m2)

Poisson’s

ratio

Mass

Density

(kg/m3)

Ti6A 8.80x108 9.50 x108

0.34 4,430

PCU 6.32 x107 6.32 x107

0.45 1,220

UHMWPE 2.10 x107 6.90 x108

0.35 934



I185

2. Computer simulation method

The condition setting of this study was a linear static simulation function. The

specimen was constrained without moving downward in a y-axis. The applied force

was 750 N pressing on the top surface of the specimen as showed in Figure 2 to simulate

the situation as the load bearing condition (Elsner et al.,2010; Hoshino et al., 1987).

The simulation was performed using a SolidWorks software version 2012. The mesh

conditions were set up as presented in Table 3.

Figure 2 Constrain and compressive load applied on the specimen.



I186

Table 3 The mesh information details

Mesh type Solid Mesh

Mesher Used: Standard mesh

Automatic Transition: Off

Include Mesh Auto Loops: Off

Jacobian points 4 Points

Element Size 1.05244 mm

Tolerance 0.0526222 mm

Mesh Quality High

Remesh failed parts with incompatible

mesh Off

Total Nodes 75960

Total Elements 52443

Maximum Aspect Ratio 3.8684

% of elements with Aspect Ratio < 3 99.9

% of elements with Aspect Ratio > 10 0

% of distorted elements(Jacobian) 0

Results/ Conclusion

The generated meshes of the specimen are presented in Figure 3a. After

computation, the results were graphically represented in the color plot and color bar as

showed in Figure 3b. Maximum von Mises stress, maximum compressive stress and

maximum strain occurred on the specimen in each model are presented in Figure 4-6,

respectively.



I187

Figure 3 (a) Generated meshes of the specimen and (b) von Mises stress occurred

on the specimen.

(a)

(b)



I188

Figure 4 Maximum von Mises stress occurred in three layers for each model.

Figure 5 Maximum compressive stress occurred in three layers for each model.



I189

Figure 6 Maximum strain occurred in three layers for each model.

It has been found that the specimen assigned with PCU in every model had

higher mechanical changes compared with the other materials. The maximum von

Mises stress and maximum compressive stress in the PCU middle layer decreased as

the thickness of middle layer reduced. In contrast, there was a slight change in

maximum von Mises stress and compressive stress when the middle layer thickness

decreased for Ti6A and UHMWPE specimens. As the top and bottom layers were Ti6A,

it noticed that maximum von Mises stress decreased when these layers’ thickness

increased in the specimen with PCU middle layer whereas this trend was not found in

the specimens with either Ti6A or UHMWPE middle layers. Strain in the middle layer

tentatively decreased when PCU was used whereas strain in the Ti6A middle layer and

UHMWPE middle layer was quite unchanged.



I190

Discussion

All models were not broken because the maximum von Mises stress and

maximum compressive stress were not over the yield strength of material in each layer.

Our study also showed that thickness and material of middle layer in the sandwich

structure play a role in the mechanical behaviors of a specimen. There was the study

using 3-D finite element analysis to analyze bonded joint under impact load by looking

at the effect of adhesive thickness and elastic modulus on the stress distribution (You

et al.,2010). They found that an increase of adhesive thickness led to a stress increment

along the upper edge of the adhesive but it decreased the stress along the lower edge

near the loading face. Their finding partly supports our results that an increase of

thickness of middle layer increased the stresses in the specimen especially, within

bottom layer when using PCU. In this study at the same thickness, compressive

distributed load was equally applied which implies that the differences in the

computational results should be regards to the properties of middle layer material. It

notices that PCU has lowest elastic modulus but the maximum von Mises stress was

highest in the specimen which has PCU as the middle layer. This finding was different

from the work done by You et al. (You et al.,2010). Their study reported that all stresses

increased along either the upper or the lower edge when the elastic modulus of adhesive

increased.

Our results showed that the strain in the PCU middle layer was highest

compared with other materials. In general, strain is a measure of the deformation of

material by comparing the change in length to the original length. Not only elastic

modulus of material but also Poisson’s ratio can affect the material deformation

(Greaves et al.,2011). Furthermore, increasing thickness of higher Poisson’s ratio and

lower elastic modulus materials (PCU and UHMWPE) increased the deformation as the

increment of maximum strain. There were several works studied on energy absorption

demonstrated that thickness, density and type of material can influence on peak load,

crushing and absorbed energy (Nemat-Nasser et al.,2007; Di Landro et al.,2002; Cui et

al.,2009). Furthermore, the number of layers of sandwich structure can also influence

on the energy absorption. Therefore, many factors are necessary to consider in the shock

absorber sandwich structure.

Recommendations

Using a computer simulation, this study demonstrated how the thickness and

material properties influence the mechanical behavior of sandwich structure which may

be beneficial to the design of shock or impact load absorber for medical application.

However, the experimental study is necessary to performed in order to verify these

simulation results.



I191

References

ASM Aerospace Specification Metals Inc., Titanium Ti-6Al-4V (Grade 5). Pompano

Beach, Florida. Available from ProQuest .

http://asm.matweb.com/search/SpecificMaterial.asp?bassnum=mtp641.

Bergschmidt, P., Ellenrieder, M., Bader, R., Kluess, D., Finze, S., Schwemmer, B., &

Mittelmeier, W. (2016). "Prospective comparative clinical study of ceramic and

metallic femoral components for total knee arthroplasty over a five- year follow-

up period." The Knee 23, 5: 871-876. .

Caserta, G. D., Iannucci, L., & Galvanetto, U. (2011). "Shock absorption performance

of a motorbike helmet with honeycomb reinforced liner." Composite Structures

93, 11: 2748-2759. .

Cournapeau, J., Klouche, S., Bauer, T., & Hardy, P. (2015). "Survival and functional

results after a mean follow- up of 9years with the Ceragyr® highly congruent

mobile-bearing TKA." Orthopaedics & Traumatology: Surgery & Research

101, 4: 455-460. .

Cui, L., Kiernan, S., & Gilchrist, M. D. (2009). “Designing the energy absorption

capacity of functionally graded foam materials.” Materials Science and

Engineering 507, 1: 215-25. .

Di Landro, L., Sala, G., & Olivieri, D. (2002). “Deformation mechanisms and energy

absorption of polystyrene foams for protective helmets.” Polymer Testing 21, 2:

217-28.

DSM Biomedical. Bionate® Thermoplastic Polycarbonate Polyurethane (PCU). DMS

Company, Netherlands. 2011. Available from ProQuest .

https://www.dsm.com/content/dam/dsm/medical/en_US/documents/bionate(r)-

pcu-product-sheet.pdf.

Elsner, J. J., Portnoy, S., Zur, G., Guilak, F., Shterling, A., & Linder-Ganz, E. (2010).

"Design of a free-floating polycarbonate-urethane meniscal implant using finite

element modeling and experimental validation." Journal of biomechanical

engineering 132, 9: 095001. .

Greaves, G. N., Greer, A. L., Lakes, R. S., & Rouxel, T. (2011). “Poisson's ratio and

modern materials.” Nature Materials 10, 11: 823-37. .

Handa, J., Takeda, T., Kurokawa, K., Ozawa, T., Nakajima, K., & Ishigami, K.

(2011). "Influence of pre-laminated material on shock absorption ability in

specially designed mouthguard with hard insert and space." Journal of

prosthodontic research 55, 4: 214-220. .

Hawass, A., Mostafa, H., & Elbeih, A. (2015). "Multi-layer protective armour for

underwater shock wave mitigation." Defence Technology 11, 4: 338-343.

Hoshino, A., & Wallace, W. A. (1987). "Impact-absorbing properties of the human

knee." Bone & Joint Journal 69, 5: 807-811. .



I192

.

Kluess, D., Mittelmeier, W., & Bader, R. (2010). "Intraoperative impaction of total

knee replacements: An explicit finite-element-analysis of principal stresses in

ceramic vs. cobalt–chromium femoral components." Clinical Biomechanics 25,

10: 1018-1024. .

Nemat-Nasser, S., Kang, W. J., McGee, J. D., Guo, W. G., & Isaacs, J. B. (2007).

“Experimental investigation of energy-absorption characteristics of components of

sandwich structures.” International Journal of Impact Engineering 34, 6: 1119-

46.

Nguyen, L. C. L., Lehil, M. S., & Bozic, K. J. (2015). "Trends in total knee

arthroplasty implant utilization." The Journal of arthroplasty 30, 5: 739-742.

Plastic Products, Inc., technical Product Data Sheets UHMWPE (ultrahigh molecular

weight polyethylene). Bessemer City .NC. Available from ProQuest

http://www.plastic- products.com/spec11.htm .

Shimazaki, Y., Nozu, S., & Inoue, T. (2016). "Shock-absorption properties of

functionally graded EVA laminates for footwear design." Polymer Testing 54:

98-103.

You, M., Yan, J. L., Zheng, X. L., Zhu, D. F., & Hu, J. R. (2010). "3-D Finite

Element Analysis of Bonded Joints under Impact Loading." Advanced Materials

Research 97, 101: 763-766.



I193

Title: Cardiac functions assessed by 2D-echocardiography in older obese adolescents.

Author: Thamonwan Imerbtham, Teerapat Yingchonchareon, Teonchit Nuamchit, and

Duangduan Siriwittayawan

Abstract

The purpose of this study is to assess cardiac functions in older obese adolescents

comparing to that of non-obese participants by 2D-conventional echocardiography in Thai

adolescents. Eighty-one participants aged between 16-19 years old were divided into non-obese

group and obese group depending on their BMI. The participants were interviewed about their

demography and history of illness using a questionnaire. Anthropometric data were collected

by measuring weight, height, waist circumference, body mass index (BMI) and body fat

percentage by a trained cardio-thoracic technologist. All participants were tested for standard

blood analyses including complete blood count and lipid profile after an overnight fasting

(>12h). After that, they were investigated for resting heart rate, blood pressure, and 2D-

echocardiography. The comparison of these parameters between two groups was performed

using statistical analysis. The results showed that there was a significant increase in the LV

mass, LVMI, RWT, IVSDd, LVIDd and LVPWd in the obese adolescents comparing to the

non-obese adolescents (103.20 ± 4.60 vs. 140.80 ± 5.04 g, p < 0.001 for LV mass, 65.30 ±

2.27 vs. 74.35 ± 2.63 g/m2 and 0.32 ± 0.01 vs. 0.36 ± 0.00 cm, for LVM and RWT,

respectively, p < 0.05, 0.77 ± 0.02 vs. 0.90 ± 0.02 cm, 4.43 ± 0.06 vs. 4.82 ± 0.05 cm and

0.72 ± 0.02 vs. 0.85 ± 0.01 cm, for IVSd, LVIDd and LVPWD, respectively, p < 0.001).

However there was no significant difference in main systolic and diastolic function indices.

This study demonstrated significantly changes in cardiac morphology of older obese

adolescents but not in cardiac functions.

Keyword: cardiac functions, cardiac morphology, echocardiography, obesity, adolescents

Introduction

Obesity in adolescents is a major public health problem of Thailand and worldwide.

(Daniels, 2009; van Dam, Willett, Manson, & Hu, 2006). In the United States, prevalence of

overweight and obesity in teenagers has almost tripled in the last two decades (Ogden, Flegal,

Carroll, & Johnson, 2002). In Thailand, the National Statistical Office reported the increased

prevalence of obese adolescents from 22.2% in 2009 to 36.5% in 2010. It has been reported



I194

that overweight adolescents tend to be obese when they are grown-ups (Serdula et al., 1993).

Obesity in adolescence is associated with risks of hypertension, stroke, sleep apnea, type 2

diabetes mellitus, metabolic syndrome, cancers, disability, liver disease, and cardiovascular

disease (Daniels, 2006). It was found that overweight was strongly correlated with coronary

artery and aorta atherosclerosis in children (Berenson et al., 1998; McGill et al., 2001).

Clinically, assessment of cardiac morphology and also cardiac function is routinely

performed by one of accurate non-invasive tools, 2D-conventional echocardiography. In

children and adolescents, there was evidence supporting the effects of obesity on cardiac

morphology and function. Previous studies have reported that obesity affected left atrial

dimension (Dhuper, Abdullah, Weichbrod, Mahdi, & Cohen, 2011; Koopman et al., 2012;

Mehta, Richards, Lorber, & Rosenthal, 2009; Ozdemir, Hizli, Abaci, Agladioglu, & Aksoy,

2010; J. J. Yu, Yeom, Chung, Park, & Lee, 2006), left ventricular (LV) dimension (Chinali et

al., 2006; Dhuper et al., 2011; Harris et al., 2012; Koopman et al., 2012; Mehta et al., 2009;

Ozcetin et al., 2012; Ozdemir et al., 2010; Saltijeral et al., 2011; Schuster et al., 2009; Van

Putte-Katier et al., 2008), and LV mass (Atabek, Akyuz, Selver Eklioglu, & Cimen, 2011;

Chinali et al., 2006; de Jonge et al., 2011; Dhuper et al., 2011; Di Bonito et al., 2008; Harris

et al., 2012; Koopman et al., 2012; Saltijeral et al., 2011; Schuster et al., 2009; Sharpe et al.,

2006; Van Putte-Katier et al., 2008). These cardiac geometry changes cause alterations in

cardiac function, both systolic and diastolic functions (Chinali et al., 2006; Dhuper et al.,

2011; Harada, Orino, & Takada, 2001; Harris et al., 2012; Ingul, Tjonna, Stolen, Stoylen, &

Wisloff, 2010; Lorch & Sharkey, 2007; Mahfouz, Dewedar, Abdelmoneim, & Hossien, 2012;

Mehta et al., 2009; Schuster et al., 2009; Sharpe et al., 2006; Van Putte-Katier et al., 2008).

Furthermore, previous studies reported systolic dysfunction at rest (Mahfouz et al., 2012) and

during exercise in obese children and adolescents (Schuster et al., 2009). However, the

effects of obesity on cardiac function are controversial since some studies indicated normal or

even supernormal LV function in obese subjects (Avelar et al., 2007; Grandi et al., 2000;

Wikstrand, Pettersson, & Bjorntorp, 1993). Erick et al found a normal LV endocardial

fractional shortening (%FS) with mildly decreased midwall fractional shortening in severely

obese participants (Avelar et al., 2007). In addition, some studies found normal LV systolic

function with reduced LV diastolic function in obese subjects (Grandi et al., 2000).

Moreover, supernormal LV systolic function was also demonstrated (Wikstrand et al., 1993).

Most studies about the impact of obesity on cardiac function were performed in

Caucasian subjects who have different structure and different BMI cut off point for obesity

from those of Asian population. Furthermore, there was limited data about the impact of



I195

obesity on cardiac function in specific teenager stage, older adolescents (age 16-19).

Therefore, the purpose of this study is to assess cardiac function in older obese adolescents

comparing to that of non-obese participants by 2D-conventional echocardiography in Thai

adolescents.

Objectives: To assess cardiac function in older obese adolescents comparing to that of non-

obese participants by 2D-conventional echocardiography in Thai adolescents.

Research methodology

1. Participants

Eighty-one participants were recruited from the community around Naresuan

University. This study was approved by the Ethical Review Board, Naresuan University,

Phitsanulok, Thailand. All participants were informed about the purposes and procedures. A

written informed consent must be obtained from participants before concur into the study. The

data were collected between March and July 2016. Regarding to Asia-Pacific obesity

classification, the participants were classified into two groups as non-obese (BMI< 25 kg/m2)

and obese (BMI ≥ 25 kg/m2). The participants were male or female adolescences aged 16-19

years old without current illness. All participants must not exercise regularly. The participants

with structural cardiac abnormality and poor echocardiography window, and also who refused

echocardiography assessment were excluded.

1.1) Sample size calculation

The sample size was calculated using small sample size formula as shown below.

n=

When n is the required sample size, N is the population size,

e is the degrees of freedom of the error component (e = 0.05), Z is the value that specifies the

level of confidence (from 95% confidence interval, Z = 1.96), P and Q are the population

proportions (P = 0.1), (Q = 0.9) and the population size is 300. The calculated sample size

was 91. However, four participants had to be excluded due to poor echocardiographic image

quality and six participants drop out of the study for unknown reasons. Therefore, the sample

size (n) used in this study was 81 participants, 30 for non-obese group and 51 for obese

group.



I196

2. Experimental design

The participants were interviewed about their demography and history of illness

using a questionnaire. Anthropometric data were collected by measuring weight, height, waist

circumference, body mass index (BMI) and body fat percentage by a trained cardio-thoracic

technologist. All participants were tested for standard blood analyses including complete

blood count and lipid profile after an overnight fasting (>12h). After that, they were

investigated for resting heart rate, blood pressure and 2D- echocardiography.

The data of non-obese and obese groups were then compared using unpaired t-test.

3. Blood pressure and laboratory test

The participants were measured for resting blood pressure and heart rate using

HEM-8712 (OMRON, Vietnam) for three times in sitting position after they had rest for 5

minutes in a quiet environment. Waist circumference, weight, height, and body fat percentage

were measured by a well-trained cardiothoracic technologist. Blood sample collection was

performed in the morning after overnight fasting. Complete blood count (CBC) and lipid

profile were analyzed using commercial kits (Human Diagnostics Worldwide, Germany).

4. Two-Dimensional Echocardiographic measurement

2D- echocardiographic measurements were performed using a Vivid S6 commercial

ultrasound scanner (GE Vingmed Ultrasound AS, Horten, Norway) with an active matrix

single-crystal phased-array transducer (GEM5S-D; GE Vingmed Ultrasound AS). Intra- and

inter-observer variability were tested before collecting the data. All participants were

measured by the same observer in the left side-lying position, after 5 minutes resting.

Grayscale images were recorded at a mean frame rate of ≥50 frames/s. Images were acquired

in the standard tomographic views of the LV (parasternal long- and short-axis, apical four-

chamber (A4C), apical three-chamber (A3C) and two-chamber views (A2C)). All

measurements were repeated three times and averaged value was used. 2D-echocardiographic

measurements were performed along with the criteria of the American Society of

Echocardiography (Sahn, DeMaria, Kisslo, & Weyman, 1978). Left ventricular systolic

function was measured including ejection fraction by Teichholz’s method (LVEF (Teicholz))

and fractional shortening (%FS) measured in the parasternal long axis views, using M mode,

left ventricular end diastolic volume (LVEDV (biplane)), end systolic volume (LVESV

(biplane)), and ejection fraction (LVEF (biplane) measured in the apical two chamber and

apical four chamber views. Diastolic function was measured by integrating Doppler

measurements of the mitral valve and tissue Doppler of the septal and lateral mitral annulus



I197

velocity. The following parameters were obtained: mitral inflow velocities, peak early

diastolic velocity (MV E velocity), peak late diastolic velocity (MV A velocity), MV E/A

Ratio, E deceleration time (MV DecT), E’ septal, E’ lateral, E/E’ septal and E/E’ lateral. Left

ventricular dimension and geometric indices, interventricular septal at end diastole and end

systole (IVSDd and IVSDs), left ventricular internal diameter at end diastole and end systole

(LVIDd, LVIDs), left ventricular posterior wall at end diastole and end systole (LVPWd and

LVPWs) were evaluated using M mode. LV mass, LV mass index, and relative wall

thickness (RWT) were determined. Left atrium to aorta ratio (LA/Ao ratio) was measured,

Also, right ventricle systolic pressure (RVSP), right atrial pressure (RAP) were investigated,

aortic valve max velocity (AV Vmax) including pulmonic valve max velocity (PV Vmax)

were evaluated.

5. Statistical analysis

The data were presented as mean ± S.D. The distribution of sample mean was

analyzed using Shapiro-Wilk test. The data with normal distribution were analyzed with

unpaired t-test to compare the difference of parameters between obese group and non-obese

group. P-value <0.05 indicates to a statistical significance.

Results

1. Basic characteristics

Table 1 shows basic characteristics of the participants. Out of 81 participants, there

was no significant difference between numbers of male/female in obese and non-obese

groups (73% female in obese group vs. 61% female in non-obese group). The data showed

that mean age of the participants was significantly higher in the non-obese group compared

with that in the obese group (18.4 ± 0.1 vs. 17.8 ± 0.1 years, p < 0.05). Mean BMI was

significantly lower in the non-obese group when compared with that in the obese group (20.6

± 0.3 vs. 29.0 ± 0.5 km/m2, p < 0.001). Other indices related to body composition such as

weight, height, waist circumference, and body fat percentage were significantly lower in the

non-obese group when compared with those in the obese group. Mean SBP and DBP were

significantly lower in the non-obese group when compared with those in the obese group

(113.4 ± 2.5 vs. 123.5 ± 1.4 mmHg, p < 0.001 for SBP and 67.7 ±1.4 vs. 74.7 ± 1.1 mmHg, p

< 0.001 for DBP). However, there were no significant differences between the non-obese and

the obese groups regarding to sex, mean PP, and mean HR.



I198

2. Laboratory findings

Table 2 shows the laboratory findings of the non-obese and the obese group.

Biochemical data showed that there was significantly lower of serum triglyceride in the non-

obese group as compared to that of the obese group (126.3 ± 6.9 vs. 159.6 ± 7.7 mg/dL, p <

0.05). Whereas serum HDL was significantly higher in the non-obese group compared to that

in the non-obese group (46.4 ± 1.9 vs. 41.4 ± 1.0 mg/dL, p< 0.05). Significantly, Hb and Hct

level was significantly lower in the non-obese group when compared with those in the obese

group (12.3 ± 0.2 vs. 13.1 ± 0.2 x106 g/dL, p < 0.05, and 38.9 ± 0.6 vs. 41.3 ± 0.6%, p <

0.05). Monocyte level was also significantly higher in non-obese group when compared with

obese group (5.9 ± 0.3 and 4.4 ± 0.2%, p < 0.001). There were no significant differences

between groups with regard to cholesterol, LDL, WBC, RBC, MCV, MCH, MCHC, RDW,

platelet count, neutrophil, lymphocyte, eosinophil and basophil level.

3. Cardiac function assessed by 2D-conventional echocardiography

Inter and intra observer test demonstrated a good intra-observer agreement (ranged

between 0.883 to 0.996) and an excellent inter-observer agreement in all parameters (ranged

between 0.801 to 0.997). Regarding to left ventricular systolic function, the result presented

that there were no significant differences between the two groups with regard to mean LVEF

(biplane), mean %FS and mean LVEF (Tei). Significantly, mean LVEDV and mean LVESV

differed between the two groups (89.13 ± 3.32 vs. 120.10± 3.53 ml, 30.44 ± 1.35 vs. 42.29±

1.67 ml, respectively, p < 0.001).

Left ventricular diastolic function study showed that there were no significant

differences between the two groups regarding to mean MV E/A ratio, mean MV DecT, MV

E velocity, mean MV A velocity, mean E’ lateral, mean E/E’ sepal and mean E/E’ lateral.

However, mean E’ septal was significantly higher in non-obese group when compared with

obese adolescents (0.16 ± 0.00 vs. 0.15 ± 0.00, p < 0.05).

Left ventricular dimensions was assessment demonstrated that, mean IVSDd, mean

LVIDd and mean LVPWd was significantly lower in non-obese group when compared with

obese group (0.77 ± 0.02 vs. 0.90 ± 0.02 cm, 4.43 ± 0.06 vs. 4.82 ± 0.05 cm and 0.72 ± 0.02

vs. 0.85 ± 0.01 cm, respectively, p < 0.001). Mean LV mass, mean LV mass index and mean

RWT was significantly lower in non-obese participants when compared with obese group

(103.20 ± 4.60 vs. 140.80 ± 5.04 g, p < 0.001 for LV mass, 65.30 ± 2.27 vs. 74.35 ± 2.63

g/m2 and 0.32 ± 0.01 vs. 0.36 ± 0.00 cm, for LVM and RWT respectively, p < 0.05 ).

Additionally, it was shown that, there were no significant differences between groups

regarding to mean LA/Ao ratio, mean AV Vmax and mean PV Vmax, only mean RVSP was



I199

significantly higher in non-obese group (19.74 ± 0.79 vs. 17.07 ± 0.62 mmHg, p < 0.05). All

2D-conventional echocardiographic data are reported in Table 3.

Table 1 baseline characteristics of the non-obese and obese group

Parameters Non-obese (n=

30)

Mean ± SD

Obese (n=51)

Mean ± SD

p-value

Age (years)

Sex (%)

Weight (kg)

Height (cm)

BMI (km/m2)

WC (cm)

Body fat (%)

SBP (mmHg)

DBP (mmHg)

PP (mmHg)

HR (beats/min)

Family history (%)

Hyperlipidemia

DM

Hypertension

Cardiovascular disease

18.4 ± 0.1

F = 73

55.3 ± 1.5

163.4 ± 1.3

20.6 ± 0.3

72.8 ± 1.1

22.8 ± 1.3

113.4 ± 2.5

67.7 ±1.4

45.70± 2.1

77.4 ± 1.7

3.3

30

6.6

0

17.8 ± 0.1*

F = 61

79.6 ± 1.8**

165.3 ± 1.0

29.0 ± 0.5**

92.6 ± 1.2**

28.9 ± 0.8**

123.5 ± 1.4**

74.7 ± 1.1**

48.7 ± 1.4

80.9 ± 1.6

1.9

9.8*

9.8

3.9

0.03

0.25

<0.001

0.27

<0.001

<0.001

<0.001

<0.001

<0.001

0.22

0.17

0.70

0.02

0.63

0.68

* = p < 0.05, ** = p < 0.001



I200

Table 2 laboratory parameters of the non-obese and obese group.

Factors

Non-obese

(n= 30)

mean ± SD

Obese

(n=51)

mean ± SD

p-value

Laboratory parameters

Triglyceride (mg/dL)

Cholesterol (mg/dL)

HDL (mg/dL)

LDL (mg/dL)

WBC (cell/cumm.)

RBC (x106 cell/µL)

Hb (g/dL)

Hct (%)

MCV (fL)

MCH (pg)

MCHC (g/dL)

RDW (%)

Platelet count (cell/cumm.)

Neutrophil (%)

Lymphocyte (%)

Monocyte (%)

Eosinophil (%)

Basophil (%)

126.3 ± 6.9

167.0 ± 8.8

46.4 ± 1.9

95.4 ± 7.5

5,530 ± 261.3

5.0 ± 0.1

12.3 ± 0.2

38.9 ± 0.6

78.6 ± 1.4

24.7 ± 0.5

31.5 ± 0.2

14.9 ± 0.1

305,200 ± 10430

59.5 ± 1.4

31.3 ± 1.7

5.9 ± 0.3

2.0 ± 0.2

0.1 ± 0.0

159.6 ± 7.7*

171.0 ± 4.4

41.4 ± 1.0*

97.5 ± 4.2

5,898 ± 217.2

5.3 ± 0.0

13.1 ± 0.2*

41.3 ± 0.6*

78.2 ± 0.9

24.5 ± 0.4

31.3 ± 0.2

14.8 ± 0.1

323,900 ± 10240

60.4 ± 0.8

32.4 ± 0.8

4.4 ± 0.2**

2.7 ± 0.2

0.1 ± 0.0

0.004

0.65

0.01

0.79

0.29

0.05

0.03

0.01

0.81

0.76

0.62

0.79

0.23

0.58

0.51

<0.001

0.07

0.23

* = p < 0.05, ** = p < 0.001



I201

Table 3 2D-conventional echocardiographic results of the non-obese and obese group.

Factors

Non-obese

(n= 30)

mean ± SD

Obese

(n=51)

mean ± SD

p-value

2D-mode

LVEDV (biplane) (ml)

LVESV (biplane) (ml)

LVEF (biplane) (%)

89.13 ± 3.32

30.44 ± 1.35

65.79 ± 0.87

120.10± 3.53 **

42.29± 1.67 **

64.96 ± 0.82

<0.001

<0.001

0.51

M-mode

FS (%)

LVEF (Teicholz) (%)

LA/Ao ratio

IVSDd (cm)

LVIDd (cm)

LVPWd (cm)

LV mass (g)

LVMI (g/m2 )

RWT

38.82 ± 0.76

69.17 ± 0.93

1.20 ± 0.02

0.77 ± 0.02

4.43 ± 0.06

0.72 ± 0.02

103.20 ± 4.60

65.30 ± 2.27

0.32 ± 0.01

37.64± 0.66

67.32± 0.83

1.28 ± 0.02

0.90 ± 0.02 **

4.82 ± 0.05**

0.85 ± 0.01 **

140.80 ± 5.04**

74.35 ± 2.63*

0.36 ± 0.00*

0.26

0.15

0.07

<0.001

<0.001

<0.001

<0.001

0.02

0.03

* = p < 0.05, ** = p < 0.001

Table 3 (cont.) 2D-conventional echocardiographic results of the non-obese and obese

group.

Factors

Non-obese

(n= 30)

mean ± SD

Obese

(n=51)

mean ± SD

p-value

Doppler-mode

MV E velocity (ms)

MV A velocity (m/s)

MV E/A Ratio

MV DecT (ms)

E’ septal (m/s)

0.99 ± 0.02

0.46 ± 0.01

2.19 ± 0.09

184.80 ± 6.63

0.16 ± 0.00

0.96 ± 0.01

0.47 ± 0.01

2.11 ± 0.07

187.80 ± 5.18

0.15 ± 0.00*

0.50

0.65

0.56

0.72

0.03



I202

E’ lateral (m/s)

E/E’ sep

E/E’ lat

RVSP (mmHg)

AV Vmax (m/s)

PV Vmax (m/s)

0.20 ± 00

5.93 ± 0.18

4.97 ± 0.16

19.74 ± 0.79

1.10 ± 0.02

0.99 ± 0.03

0.20 ± 00

6.36 ± 0.18

4.88 ± 0.13

17.07 ± 0.62*

1.10 ± 0.02

1.00 ± 0.02

0.91

0.12

0.66

0.01

0.92

0.83

* = p < 0.05, ** = p < 0.001

Discussion

The recent study found that, there were significant differences in SBP, DBP

LV mass, LVMI, RWT, IVSDd, LVIDd and LVPWd between obese and non-obese

adolescents. These results indicated the morphological changes induced by obesity. This

finding supports previous studies (Kinik, Varan, Yildirim, & Tokel, 2006; Koebnick et al.,

2013; Kono et al., 1994; Ozdemir et al., 2010; Van Putte-Katier et al., 2008) demonstrating

that obesity was associated with a higher prevalence of hypertension, LV hypertrophy and

increased LVM in children and adolescents. The structural changes may be due to higher

vascular resistance, presented as higher SBP, or may be involved in hormonal changes i.e.,

leptin or adiponectin (Chiolero, Cachat, Burnier, Paccaud, & Bovet, 2007; Rajapurohitam,

Javadov, Purdham, Kirshenbaum, & Karmazyn, 2006; Xu et al., 2004; Zeidan, Hunter,

Javadov, & Karmazyn, 2011). In the current study, global LV systolic function was assessed.

It was of found that there were increased LV end diastolic volume and end systolic volume

(LVEDV and LVESV) in obese subjects, although almost all within the normal range. The

evaluation of global LV systolic function assessed by LVEF and %FS was not different from

that of non-obese teenagers. This finding is relevant to many studies showing normal systolic

function in obese subjects (Alpert, Terry, & Kelly, 1985; Grossman, Oren, & Messerli;

Lauer, Anderson, & Levy, 1992). However, some studies indicated impaired systolic function

in obese adolescents (Chinali et al., 2006; Pascual et al., 2003). This discrepancy may be

explained by Chinali et al (Chinali et al., 2006) and Pascual et al (Pascual et al., 2003) who

reported that a reduction of indices of systolic function was only found in subjects with a

considerable degree of obesity suggesting that left ventricular function is affected late in the

course of obesity. It is possible that the alteration of cardiac function might be subclinical

heart disorder.



I203

In the present study, there was no significant difference in main diastolic function

indices, E/A, Dec T, mitral early or late diastolic flow between the obese and non-obese

adolescents. Diastolic function by tissue Doppler imaging has been shown to be a more

sensitive marker of diastolic function in subclinical heart disease (Kadappu & Thomas; C.-M.

Yu, Sanderson, Marwick, & Oh, 2007) and in this study e’ was initially reduced when

compare to that of the non-obese adolescents. Few studies (Kinik et al., 2006; Levent,

Goksen, Ozyurek, Darcan, & Coker, 2005; Tei, 1995) have specifically investigated the

impact of obesity on diastolic function in children. In contrast to most results, Harada et al

(Harada et al., 2001) found altered transmitral and pulmonary venous velocities in 21 obese

children using pulse wave Doppler, suggesting a reduction in early diastolic filling. And one

recent study investigated diastolic function using TDI in 25 obese and overweight children

(Chinali et al., 2006) providing unique insights into the effects obesity on LV diastolic

function. They observed impaired early diastolic function (E′) in the overweight and obese

group. The relation between obesity and diastolic filling is not well understood. Although the

association of myocardial fatty infiltration with obesity is well recognized, it is not a

prominent finding at autopsy. However, altered LV relaxation could be related to early

alterations in the myocardial collagen-to-muscle ratio that are secondary to insulin resistance

and commonly seen in obese patients (Rabkin, 2007).The limitations of this study small

number of participants and also the single-center study. The strength of this study is the

proper cut off value for obesity for Asian population which can truly classify subjects as non-

obese or obese.

In conclusion, this study demonstrated that older obese adolescents had significant

changes in cardiac morphology but not in cardiac function.

Recommendations

It is recommended that mechanisms of cardiovascular changes in older adolescents

should be further investigated. The correlation between metabolic parameters, such as insulin

or leptin, and cardiac function of obese adolescents needs to be explored. High sensitive tool

for assessment of cardiac function i.e., speckle tracking, may be useful to detect subclinical

disorders.



I204

References Alpert, M. A., Terry, B. E., & Kelly, D. L. (1985). Effect of weight loss on cardiac chamber

size, wall thickness and left ventricular function in morbid obesity. Am J Cardiol,

55(6), 783-786.

Atabek, M. E., Akyuz, E., Selver Eklioglu, B., & Cimen, D. (2011). The relationship between

metabolic syndrome and left ventricular mass index in obese children. J Clin Res

Pediatr Endocrinol, 3(3), 132-138. doi: 10.4274/jcrpe.v3i3.26

Avelar, E., Cloward, T. V., Walker, J. M., Farney, R. J., Strong, M., Pendleton, R. C., . . .

Litwin, S. E. (2007). Left ventricular hypertrophy in severe obesity: interactions

among blood pressure, nocturnal hypoxemia, and body mass. Hypertension, 49(1),

34-39. doi: 10.1161/01.hyp.0000251711.92482.14

Berenson, G. S., Srinivasan, S. R., Bao, W., Newman, W. P., 3rd, Tracy, R. E., & Wattigney,

W. A. (1998). Association between multiple cardiovascular risk factors and

atherosclerosis in children and young adults. The Bogalusa Heart Study. N Engl J

Med, 338(23), 1650-1656. doi: 10.1056/nejm199806043382302

Chinali, M., de Simone, G., Roman, M. J., Lee, E. T., Best, L. G., Howard, B. V., &

Devereux, R. B. (2006). Impact of obesity on cardiac geometry and function in a

population of adolescents: the Strong Heart Study. J Am Coll Cardiol, 47(11), 2267-

2273. doi: 10.1016/j.jacc.2006.03.004

Chiolero, A., Cachat, F., Burnier, M., Paccaud, F., & Bovet, P. (2007). Prevalence of

hypertension in schoolchildren based on repeated measurements and association with

overweight. J Hypertens, 25(11), 2209-2217. doi: 10.1097/HJH.0b013e3282ef48b2

Daniels, S. R. (2006). The consequences of childhood overweight and obesity. Future Child,

16(1), 47-67.

Daniels, S. R. (2009). Complications of obesity in children and adolescents. Int J Obes

(Lond), 33 Suppl 1, S60-65. doi: 10.1038/ijo.2009.20

de Jonge, L. L., van Osch-Gevers, L., Willemsen, S. P., Steegers, E. A., Hofman, A.,

Helbing, W. A., & Jaddoe, V. W. (2011). Growth, obesity, and cardiac structures in

early childhood: the Generation R Study. Hypertension, 57(5), 934-940. doi:

10.1161/hypertensionaha.110.163303

Dhuper, S., Abdullah, R. A., Weichbrod, L., Mahdi, E., & Cohen, H. W. (2011). Association

of obesity and hypertension with left ventricular geometry and function in children

and adolescents. Obesity (Silver Spring), 19(1), 128-133. doi: 10.1038/oby.2010.134

Di Bonito, P., Capaldo, B., Forziato, C., Sanguigno, E., Di Fraia, T., Scilla, C., . . . Moio, N.

(2008). Central adiposity and left ventricular mass in obese children. Nutr Metab

Cardiovasc Dis, 18(9), 613-617. doi: 10.1016/j.numecd.2007.09.002

Grandi, A. M., Zanzi, P., Piantanida, E., Gaudio, G., Bertolini, A., Guasti, L., & Venco, A.

(2000). Obesity and left ventricular diastolic function: noninvasive study in

normotensives and newly diagnosed never-treated hypertensives. Int J Obes Relat

Metab Disord, 24(8), 954-958.

Grossman, E., Oren, S., & Messerli, F. H. Left ventricular filling in the systemic hypertension

of obesity. American Journal of Cardiology, 68(1), 57-60. doi: 10.1016/0002-

9149(91)90710-3

Harada, K., Orino, T., & Takada, G. (2001). Body mass index can predict left ventricular

diastolic filling in asymptomatic obese children. Pediatr Cardiol, 22(4), 273-278. doi:

10.1007/s002460010228

Harris, K. C., Al Saloos, H. A., De Souza, A. M., Sanatani, S., Hinchliffe, M., Potts, J. E., &

Sandor, G. G. (2012). Biophysical properties of the aorta and left ventricle and

exercise capacity in obese children. Am J Cardiol, 110(6), 897-901. doi:

10.1016/j.amjcard.2012.05.019



I205

Ingul, C. B., Tjonna, A. E., Stolen, T. O., Stoylen, A., & Wisloff, U. (2010). Impaired cardiac

function among obese adolescents: effect of aerobic interval training. Arch Pediatr

Adolesc Med, 164(9), 852-859. doi: 10.1001/archpediatrics.2010.158

Kadappu, K. K., & Thomas, L. Tissue Doppler Imaging in Echocardiography: Value and

Limitations. Heart, Lung and Circulation, 24(3), 224-233. doi:

10.1016/j.hlc.2014.10.003

Kinik, S. T., Varan, B., Yildirim, S. V., & Tokel, K. (2006). The effect of obesity on

echocardiographic and metabolic parameters in childhood. J Pediatr Endocrinol

Metab, 19(8), 1007-1014.

Koebnick, C., Black, M. H., Wu, J., Martinez, M. P., Smith, N., Kuizon, B., . . . Jacobsen, S.

J. (2013). High blood pressure in overweight and obese youth: implications for

screening. J Clin Hypertens (Greenwich), 15(11), 793-805. doi: 10.1111/jch.12199

Kono, Y., Yoshinaga, M., Oku, S., Nomura, Y., Nakamura, M., & Aihoshi, S. (1994). Effect

of obesity on echocardiographic parameters in children. Int J Cardiol, 46(1), 7-13.

Koopman, L. P., McCrindle, B. W., Slorach, C., Chahal, N., Hui, W., Sarkola, T., . . .

Mertens, L. (2012). Interaction between myocardial and vascular changes in obese

children: a pilot study. J Am Soc Echocardiogr, 25(4), 401-410.e401. doi:

10.1016/j.echo.2011.12.018

Lauer, M. S., Anderson, K. M., & Levy, D. (1992). Separate and joint influences of obesity

and mild hypertension on left ventricular mass and geometry: the Framingham Heart

Study. J Am Coll Cardiol, 19(1), 130-134.

Levent, E., Goksen, D., Ozyurek, A. R., Darcan, S., & Coker, M. (2005). Usefulness of the

myocardial performance index (MPI) for assessing ventricular function in obese

pediatric patients. Turk J Pediatr, 47(1), 34-38.

Lorch, S. M., & Sharkey, A. (2007). Myocardial velocity, strain, and strain rate abnormalities

in healthy obese children. J Cardiometab Syndr, 2(1), 30-34.

Mahfouz, R. A., Dewedar, A., Abdelmoneim, A., & Hossien, E. M. (2012). Aortic and

pulmonary artery stiffness and cardiac function in children at risk for obesity.

Echocardiography, 29(8), 984-990. doi: 10.1111/j.1540-8175.2012.01736.x

McGill, H. C., Jr., McMahan, C. A., Zieske, A. W., Malcom, G. T., Tracy, R. E., & Strong, J.

P. (2001). Effects of nonlipid risk factors on atherosclerosis in youth with a favorable

lipoprotein profile. Circulation, 103(11), 1546-1550.

Mehta, S. K., Richards, N., Lorber, R., & Rosenthal, G. L. (2009). Abdominal obesity, waist

circumference, body mass index, and echocardiographic measures in children and

adolescents. Congenit Heart Dis, 4(5), 338-347. doi: 10.1111/j.1747-

0803.2009.00330.x

Ogden, C. L., Flegal, K. M., Carroll, M. D., & Johnson, C. L. (2002). Prevalence and trends

in overweight among US children and adolescents, 1999-2000. Jama, 288(14), 1728-

1732.

Ozcetin, M., Celikyay, Z. R., Celik, A., Yilmaz, R., Yerli, Y., & Erkorkmaz, U. (2012). The

importance of carotid artery stiffness and increased intima-media thickness in obese

children. S Afr Med J, 102(5), 295-299.

Ozdemir, O., Hizli, S., Abaci, A., Agladioglu, K., & Aksoy, S. (2010). Echocardiographic

measurement of epicardial adipose tissue in obese children. Pediatr Cardiol, 31(6),

853-860. doi: 10.1007/s00246-010-9720-y

Pascual, M., Pascual, D. A., Soria, F., Vicente, T., Hernandez, A. M., Tebar, F. J., & Valdes,

M. (2003). Effects of isolated obesity on systolic and diastolic left ventricular

function. Heart, 89(10), 1152-1156.

Rabkin, S. W. (2007). Epicardial fat: properties, function and relationship to obesity. Obes

Rev, 8(3), 253-261. doi: 10.1111/j.1467-789X.2006.00293.x



I206

Rajapurohitam, V., Javadov, S., Purdham, D. M., Kirshenbaum, L. A., & Karmazyn, M.

(2006). An autocrine role for leptin in mediating the cardiomyocyte hypertrophic

effects of angiotensin II and endothelin-1. J Mol Cell Cardiol, 41(2), 265-274. doi:

10.1016/j.yjmcc.2006.05.001

Sahn, D. J., DeMaria, A., Kisslo, J., & Weyman, A. (1978). Recommendations regarding

quantitation in M-mode echocardiography: results of a survey of echocardiographic

measurements. Circulation, 58(6), 1072-1083.

Saltijeral, A., Isla, L. P., Perez-Rodriguez, O., Rueda, S., Fernandez-Golfin, C., Almeria, C., .

. . Zamorano, J. (2011). Early myocardial deformation changes associated to isolated

obesity: a study based on 3D-wall motion tracking analysis. Obesity (Silver Spring),

19(11), 2268-2273. doi: 10.1038/oby.2011.157

Schuster, I., Karpoff, L., Perez-Martin, A., Oudot, C., Startun, A., Rubini, M., . . . Vinet, A.

(2009). Cardiac function during exercise in obese prepubertal boys: effect of degree

of obesity. Obesity (Silver Spring), 17(10), 1878-1883. doi: 10.1038/oby.2009.197

Serdula, M. K., Ivery, D., Coates, R. J., Freedman, D. S., Williamson, D. F., & Byers, T.

(1993). Do obese children become obese adults? A review of the literature. Prev Med,

22(2), 167-177. doi: 10.1006/pmed.1993.1014

Sharpe, J. A., Naylor, L. H., Jones, T. W., Davis, E. A., O'Driscoll, G., Ramsay, J. M., &

Green, D. J. (2006). Impact of obesity on diastolic function in subjects < or = 16 years

of age. Am J Cardiol, 98(5), 691-693. doi: 10.1016/j.amjcard.2006.03.052

Tei, C. (1995). New non-invasive index for combined systolic and diastolic ventricular

function. J Cardiol, 26(2), 135-136.

van Dam, R. M., Willett, W. C., Manson, J. E., & Hu, F. B. (2006). The Relationship

between Overweight in Adolescence and Premature Death in Women. Annals of

Internal Medicine, 145(2), 91-97. doi: 10.7326/0003-4819-145-2-200607180-00006

Van Putte-Katier, N., Rooman, R. P., Haas, L., Verhulst, S. L., Desager, K. N., Ramet, J., &

Suys, B. E. (2008). Early cardiac abnormalities in obese children: importance of

obesity per se versus associated cardiovascular risk factors. Pediatr Res, 64(2), 205-

209. doi: 10.1203/PDR.0b013e318176182b

Wikstrand, J., Pettersson, P., & Bjorntorp, P. (1993). Body fat distribution and left ventricular

morphology and function in obese females. J Hypertens, 11(11), 1259-1266.

Xu, F. P., Chen, M. S., Wang, Y. Z., Yi, Q., Lin, S. B., Chen, A. F., & Luo, J. D. (2004).

Leptin induces hypertrophy via endothelin-1-reactive oxygen species pathway in

cultured neonatal rat cardiomyocytes. Circulation, 110(10), 1269-1275. doi:

10.1161/01.cir.0000140766.52771.6d

Yu, C.-M., Sanderson, J. E., Marwick, T. H., & Oh, J. K. (2007). Tissue Doppler Imaging: A

New Prognosticator for Cardiovascular Diseases. J Am Coll Cardiol, 49(19), 1903-

1914. doi: https://doi.org/10.1016/j.jacc.2007.01.078

Yu, J. J., Yeom, H. H., Chung, S., Park, Y., & Lee, D. H. (2006). Left atrial diameters in

overweight children with normal blood pressure. J Pediatr, 148(3), 321-325. doi:

10.1016/j.jpeds.2005.10.042

Zeidan, A., Hunter, J. C., Javadov, S., & Karmazyn, M. (2011). mTOR mediates RhoA-

dependent leptin-induced cardiomyocyte hypertrophy. Mol Cell Biochem, 352(1-2),

99-108. doi: 10.1007/s11010-011-0744-2



I207

Appendix

Thamonwan Imerbtham a, Teonchit Nuamchit

b, Teerapat Yingchonchareon, Duangduan

Siriwittayawan a*

a Department of Cardio-Thoracic Technology, Faculty of Allied Health Sciences, Naresuan

University, Phitsanulok, Thailand, 65000

b Department of internal medicine, Faculty of Medicine, Ramathibodi-hospital, Bangkok,

Thailand,

* Corresponding author: Duangduan Siriwittayawan, Ph.D. (Cardiovascular Sciences),

Department of Cardio-Thoracic Technology, Faculty of Allied Health Sciences, Naresuan

University, Phitsanulok, Thailand, 65000

Tel: +66 64 009 6222.

E-mail address: [email protected]

Author Contributions: Conceived and designed the experiments: DS and TY.

Performed the experiments: TM. Statistical Analysis: DS and TN. Contributed

materials/analysis tools: DS and TY. Drafted the manuscript: DS and TN. All authors have

read and approved the final version of the manuscript, and agree with the order of

presentation of the authors.

Competing Interests: None of the authors declare competing financial interests.

Funding: This work was supported by Naresuan University Research Fund.



I208

Shallow Subsurface Structure Estimated from Geophysical Data in Mae On

District, Chiang Mai Province

Author: Srivipa Lerkratanawaree* and Siriporn Chaisri**

Program: Applied Geophysics Institute: Chiang Mai University

Abstract

Mae On district is located in eastern part of Chiang Mai province,

Thailand. There are volcanic rocks distribute in this area. The objective of this study

is to map quaternary layers, composing of a sedimentary layer, overlying volcanic

layer. This study integrates three geophysical investigations. Seismic reflection

method is a major investigation that focuses on the deeper part. Moreover, the

multichannel analysis of surface waves and electrical resistivity surveys were

conducted to provide more supporting information in the shallow part. There are two

survey lines, one in north-south and the other in east-west direction. The results show

that the top-soil layer has low resistivity and low seismic velocities (both P- and S-

waves) with 10 m estimated depth. The top-soil is underlaid by the high resistivity

and high seismic velocities layer, this could be interpreted as the basaltic layer with

more information from the basaltic outcrop contribution around the study area. The

study of sedimentary layer provides an information of the subsurface which is useful

for future land development.

Keywords: Geophysical Survey, Seismic Reflection, MASW, Resistivity

* Student, Master of Science Program in Applied Geophysics, Faculty of Science,

Chiang Mai University

** Department of Physics and Materials Science, Faculty of Science, Chiang Mai

University



I209

Introduction

Mae On is a political district (amphoe) of Chiang Mai province in the

north of Thailand. It is located about 40 km eastern of Chiang Mai center. It is

situated on the foothill terrain with a long shape in north-south trend flanked by

mountains on the west and east sides. The subsurface information of this area is

supported by Department of Mineral Resources (DMR), Thailand, including well log

data (Department of Mineral Resources, 2003) released in 2004 and the geological

map (Figure 1) released in 2007. Mae On area is mostly covered by Quaternary

sediments related to recent fluvial and alluvial processes (Department of Mineral

Resources, 2007). The previous ground gravity data were collected by Suntamano and

Guntiya, (2014) and aeromagnetic data were obtained from DMR. Both anomaly

maps show high values in the study area. Generally, the sediments should provide the

low anomalies of gravity and magnetic data because of the lower density and

magnetic susceptibility. Moreover, the thickness of the Quaternary sediments from

well data is about 80 m underlaid by the basaltic rock. However, the well location is

about 6.5 km in South-West direction away from the study area, therefore, some

geological information might be varied especially the sedimentary thickness.

Consequently, the study area is interested in estimating depth of sediment.

It is also well known that the potential filed data (gravity and magnetic

anomalies) will suffer from the non-uniqueness because several earth models could

produce the same gravity and/or magnetic response. Furthermore, many solutions may

not be geologically realistic. Because of this inherent ambiguity and the nonlinear

nature of the geophysical problem, the subsurface geology of this area will be

interpreted from several geophysical methods. There were many investigations by the

integration of geophysical data such as for fault and complicate geology zone (Pinet,

2013; Mahmut and Berge, 2017), geology contact interpretation (Ali, Saad, and

Nordiana, 2013), and cave structure (Leucci and Giorgi, 2005). Therefore, the aim of

this study is to map the quaternary layer using integrated geophysical methods. A

geological model has been obtained by seismic surveys. To provide more evidence

about the shallow quaternary sediment, this study acquired a multichannel analysis of

surface wave (MASW, 2017) and electrical resistivity surveys. The study of



I210

sedimentary layer such as its physical properties and thickness provides subsurface

information that useful for the area future development.

The geophysical methods are the subsurface investigation by using

specific instruments measure subsurface signals on the surface to determine the

subsurface geology. This study includes three geophysical methods, the reflection

seismic methods which focused on seismic body waves, the multichannel analysis of

surface wave method which concentrates on surface wave, and the electrical

resistivity method which measures how well the subsurface resist the flow of electric

current.

The basic technique of seismic exploration consists of generating seismic

waves into the ground and, then, the seismic energy disturbance several types of

waves propagating within the Earth and along its surface. The generated waves can be

divided into two main categories; body waves and surface waves. The propagating

waves are returned to the surface where encounter the layer of rock because of the

velocity and density contrasts. The body waves are transmitted through the interior of

the Earth while the surface wave is traveling near surface and characterized by

relatively higher amplitude with lower frequency in shot record. The instrument

collects the amplitude and time required for the waves to travel from the source to a

series of the receiver (Telford, Geldart, and Sheriff, 1990).

The electrical resistivity surveys are used in geophysics to measure the

subsurface variations in electrical resistivity. Resistivity measurements are carried out

with transmitting current from the surface into subsurface medium through one pair of

electrodes (source electrodes) and measuring the voltage different at another pair of

electrodes (potential electrodes). From the surface measurements, the apparent

resistivity of the medium will be obtained and processed to generate true electrical

resistivity model.

There are two selected geophysical survey lines (Figure 1) for this study.

The MO-1 survey line in the north-south direction with surface distance about 460 m

was investigated by seismic reflection and resistivity surveys. The application of

surface wave, MASW method, was also conducted in the middle part of MO-1. The



I211

second survey line is MO-2 in the east-west direction with surface distance about

1000 m. This survey line was investigated with reflection seismic method only.

Figure 1 Geological map of the study area, Mae On district, Chiang Mai province,

with MO-1 and MO-2 survey lines and previous well log location. Modify after

(Department of Mineral Resources, 2007)

Geological setting

The volcanic rocks in Thailand are widely distributed in Paleozoic and

Cenozoic Era (Barr and Charusiri, 2011). The volcanic rock in this area were assigned

to Dan Lan Hoi or Mae Tha group in Chiang Mai volcanic belt. Field survey and

petrography described types of volcanic rock that are basalt, basalt porphyry,

amygdaloidal basalt, pillow basalt (Barr and MacDoNald, 1978; Barr, et al. 1990).

The petrography of Chiang Mai volcanic belt represents a zone of back-arc

continental extension. The evidence of age was the close association with Permian

limestone (Barr and Charusiri, 2011). After the basaltic extrusion, Mae On area was

deposited of sedimentary in the quaternary.

Objectives of the study

There are two main objectives in this study. The first objective is to

acquire the geophysical data from seismic and electrical resistivity surveys. The

second is to map the quaternary sedimentary layer in the study area by geophysical

data integration.



I212

Methodology: Seismic reflection survey

The seismic waves were recorded as a function of the travel time (t) and

offset (x) in the seismic traces. The seismic velocities of the subsurface can be

calculated based on their arrival time. The reflected waves from the hyperbolic travel

time curves are used to estimate velocity in reflection processing and construct the

structure velocity model. Seismic cross-section is required to depict the image of

subsurface and it can be combined with another data for detailed investigation of

subsurface geometry structure.

The seismic surveys were conducted with three Geode Geometrics DZ

system (Geometrics, 2017), the total of 72 channels, and the Seismodule Controller

V9.1 as the acquisition software. Two types of energizing sources were used, a 20-lb

sledge hammer for line survey MO-1 and a 300kg elastic wave generator (EMG) for

line survey MO-2. The 72 of 28 Hz frequency respond geophones were used as the

signal receivers for each shot location. Every source location, three or five shots were

generated and vertically stacked to increase the signal-to-noise ratio (S/N). The source

and receiver locations georeferenced using differential global positioning system

(DGPS). The shot and geophone intervals are 4 m and 5 m for line MO-1 and line

MO-2, respectively. The data were acquired in a window of 1 s with a sampling

interval of 1 ms.

The first arrival in seismic shot gathers express the travel times of the

directed and refracted waves that examined for the velocity of top and underlaid

layers. The reciprocal slope of directed wave travel times, represent with red line on

Figure 2a, is the velocity of top-soil layer or weathering layer. It could be measured

directly as 600 m/s from the directed wave arrival. The second reciprocal slope of the

first arrival time is the refracted wave represented in yellow line which indicates the

velocity of second layer as 4000 m/s. The surface wave and air blast can also be

indicated with an apparent velocity about of 330 m/s and 200 m/s, respectively. After

examining, seismic data were processing with Vista5.5 software. The major

processing steps were applied to seismic data follow by

Firstly, the seismic data that collected on field survey were prepared for

processing, named pre-processing step. The locations of source and geophones were



I213

inputted for geometry setting. Some error were removed from the input data with

carefully quality checked. The seismic data have the effect from the different in

source and receiver elevations. Therefore, elevation static correction is calculated to

adjust the source and receiver to a common datum. This study used floating datum

that smoothing radial 200 m. The main attenuations of seismic signals are due to

spherical divergent, scattering, and absorption. Consequently, the data were amplitude

corrected. This study used exponential function technique. The parameter of

exponential function is 0.5 to recovery weak seismic signal that reduces by time on

shot gather.

Figure 2 shows (a) the example of field seismic shot record from line MO-2. The

directed wave, reflected wave, air wave, and ground roll are indicated with velocity

information in red, yellow, green, and blue line, respectively. (b) The shot record after

noise attenuation, three reflectors are emphasized.

To eliminate noise, there are three main steps, FK-filter, frequency filter,

and deconvolution. FK-filter are the most utilized step to eliminate coherent linear

noises such as ground roll and air waves. The seismic shot gathers were examined in

FK spectrum domain, then, the FK fan (Velocity) was designed between 100-450 m/s

to remove coherence noises. Frequency filtering applied to remove seismic noises in



I214

frequency domain. The reflected wave signals have the frequency range

approximately from 20 to 90 Hz. Therefore, the bandpass filter 10/20-90/120 was

applied. Follow by deconvolution, it was applied to eliminate wavelet. This study

used surface-consistent deconvolution technique that decomposition of log-amplitude

spectra to four components (source, receiver, offset and CDP) with the conventional

Guass-Saidal iteration inversion equation (Cary and Lorentz, 1993). Surface-

consistent deconvolution was applied with operator length 80 ms, and 12 ms of

predictive lag.

After that, seismic shot gathers were rearranged into common-mid-point

(CMP) gathers for velocity analysis, normal move-out (NMO) correction and

stacking. Velocity analysis determines a suitable velocity model, which used for

NMO correction (Yilmaz, 2001). Every CMP gather were simultaneously applied the

semblance analysis and constant velocity stack (CVS) techniques. After the velocity

analysis, the seismic CMP gather were NMO corrected to remove the difference

travel times that influence by difference offset and then stacked to obtain the seismic

stack section. Figure 3a and Figure 4 display the final seismic stack cross-section

from line MO-1 and MO-2 respectively.

Methodology: Multichannel Analysis of Surface Waves

The MASW (MASW, 2017) focus on surface waves that have velocity

dispersion property effected from subsurface layering contribution to velocity

variation with frequency. Because surface wave have lower frequency contents then

reflected wave, to capture more surface wave energy, the 4.5 Hz frequency respond

geophones were employed. The surface shot gathers were recorded with 24 channels

per shot, 2 m geophone spacing, 4 m shot spacing and the distance 8 m between shot

location and the first geophone. The MASW data were analyzed by software called

ParkSEIS (PS) (Park Seismic LLC, 2015). The field records were transformed into

phase velocity spectrum for dispersion analysis to estimate the fundamental mode

dispersion curves. The iteration of least-squares inverse routine was applied to

properly match between picked dispersion curve and calculated dispersion curve

which carry out from measurement and initial model respectively. The solution from

MASW method is the 2D S-wave velocity model displayed in Figure 3c.



I215

Methodology: Electrical Resistivity survey

The resistivity survey was acquired with ABEM Terrameter SAS4000

resistivity-meter (ABEM Instrument AB, 2012). The dipole-dipole configuration, that

has comparatively high sensitivity and very good noise rejection circuitry, were used

with electrode spacing 5 m. The RES2DINV inversion demo program (Loke, 1998)

read the field apparent resistivity values and inverted that to create the calculated

apparent resistivity carried out from 2D true resistivity model with least-squares

method. The iteration of least-squares inverse routine was applied to properly match

between a field apparent resistivity and calculated apparent resistivity. Figure 3b

presents the true electrical resistivity model resulted from the inversion process with

the 10 iteration calculations and final 5% RMS error.

Survey Results

Both reflection seismic MO-1 (Figure 3a) and MO-2 (Figure 4) profiles

show three main seismic reflectors in the lower part of geological geometry. There are

upper (USR), middle (MSR), and lower (LSR) reflectors that represented with blue,

green, and yellow lines, respectively. The USR reflector presents the high continuity,

high amplitude and nearly horizontal pattern with travel time about 35-50 ms. The

MSR reflector shows high amplitude, moderate continuity, and nearly irregular

pattern with travel time about 80-110 ms. The deepest reflector, LSR, shows high

amplitude and moderate continuity with slightly dip to southward with 120-180 ms

two-way travel time. The reflector USR, MSR, and LSR separate four major seismic

units. The Upper unit (UU) has interval velocity about 1500 m/s with 30 m average

thickness. It is underlaid by the mid unit (MU) that divided as two sub units, MU1 and

MU2. The top unit, MU1, has interval velocity about 1800 m/s with an average

thickness of 80 m and the lower unit, MU2, has interval velocity 1900 m/s with 30 m

average thickness. The Lower unit (LU) has interval velocity higher than 2100 m/s.

The results from electrical resistivity survey and MASW survey, the true

electrical resistivity model and S-wave velocity model (Figure 3c), show detail of the

upper part geological structure. The true electrical resistivity model (Figure 3b) from

line MO-1 displays three nearly horizontal layers with the maximum investigation



I216

depth of about 70 m. Whereas, the S-wave velocity model (Figure3c) explores more

detail of near surface layers with the maximum investigation depth of about 30 m.

The top soil layer with low resistivity less than 50 ohm.m and low S-wave velocity

less than 400 m/s has the thickness approximately 10 m corresponding to low P-wave

velocity of 600 m/s (directed wave, Figure 2a) which could not detect by seismic

reflected wave. However, from the first arrival time in shot record (Figure 2a), there is

the shallow high P-wave velocity (about 4000 m/s) layer that might be corresponding

to the unit UU indicated in Figure 3a and Figure 4. The corresponding to UU unit in

seismic section has the estimated thickness of 30 m with high resistivity range from

50 to 600 ohm.m. From MASW, the UU unit also has high S-wave velocity

approximately might higher than 2000 m/s in the southern part of line MO-1 which

could related to the hard rock layer. The deepest layer from electrical resistivity model

is corresponding to the MU1 of seismic section has resistivity range 35-200 ohm.m.



I217

Figure 3. (a) Interpreted seismic reflection section (b) true electrical resistivity model

and (c) S-wave velocity model from line survey MO-1.

Figure 4 Interpreted seismic reflection section from line survey MO-2.

Discussion

The refraction seismic data exposed P-wave velocity contrast between top-

soil (600m/s) and the UU unit (4000 m/s), Figure 2a. This velocity contrast is caused

the strong multiple reflections very near surface in seismic reflection record. It made

less seismic energy transmitted through and lots of the interfering patterns resulted in

ambiguous primary reflection as seen in Figure 2b. This lithological problem makes

the seismic acquisition limited in shallow part because the seismic energy cannot

penetrate into the deeper part. However, the reflection seismic waves have some

energy penetrate deeper zone but cannot going down to 400 m depth from surface. In

reflection seismic processing, the raw shot gathers expose that it difficult to

distinguish a shallow reflection event from refraction event. In addition, the top-soil

thickness is very thin that is not able to detect by seismic reflection method because of

the vertical resolution limit. The velocity of above reflector URS is merged into one

velocity, which the average velocity of lithology URS reflector. Therefore, the

velocity analysis of upper layer is considered from refraction and MASW methods.

Conclusion

The geophysical methods have been done including seismic reflection

survey, MASW survey, and electrical resistivity survey to map the quaternary

sedimentary layer in the study area. Based on electrical resistivity model and S-wave

velocity model from MASW, the top-soil layer has low resistivity and low S-wave



I218

velocity with 10 m estimated depth corresponding to the directed wave from seismic

reflection survey. From seismic reflection section, there are four major seismic units,

UU, MU1, MU2, and LU. Thickness of the UU unit is about 30 m located underlie

top-soil layer. The bottom of the UU unit presents at about 40 m from the surface. It

has very high resistivity and seismic velocities (P-wave and S-wave) which could be

interpreted as the basaltic layer with more information from the basaltic outcrop

contribution around the study area and well log data. The MU1, MU2, and LU units

can be interpretation to basaltic layer because of the limited support information.

Acknowledgement

We thank Chiang Mai University, and the Science Achievement

Scholarship of Thailand (SAST) for research funding supports. This work could not

be completed without help from the staffs of Geophysics Research Laboratory at

Department of Geological Sciences, Faculty of Science, Chiang Mai University, for

their supporting in field work and data discussion.

References

ABEM Instrument AB. (2012). Instruction Manual Terrameter LS. Sundbyberg,

Sweden.

Ali, N., Saad, R., and Nordiana, M. (2013). “Integration of Seismic Refraction and 2D

Electrical Resistivity in Locating Geological Contact”. Journal of

Geology, 7-12.

Barr, S. M., and Charusiri, P. (2011). “Volcanic rocks”. In The geology of Thailand,

415-440. London: The Geological Society.

Barr, S. M., and MacDoNald, A. S. (1978). “Geochemistry and petrogenesis of Late

Cenozoie alkaline basalt of Thailand.” Geology Society of Malaysia 10,

December, 25-52.

Barr, S. M., Tantisukrit, C., Yaowanoiyothin, W., and MacDonald, A. S. (1990).

“Petrology and tectonic implication of Upper PaleoZoic volcanic rocks of

tha Chiang Mai Belt, Northern Thailand.” Journal of Southeast Asian

Earth Sciences 4(1), 37-47.



I219

Cary, P. W., and Lorentz, G. A. (1993). “Four-Component surface-consistent

deconvolution.” Geophysics 58(3), 383-392.

Chaiyamongkon, K. (2014). “Advanced gravity data processing of Geophysical

survey, Amphoe Mae on, Changwat Chiang Mai”, Independent Study,

Bachelor Degree of Science, Faculty of Science, University of Chiang

Mai.

Department of Mineral Resources. (2003). “Groundwater well log data in Chiang Mai

Province.” October 14.

Department of Mineral Resources. (2007). Geological map of Thailand. 1:250,000.

Bangkok.

Geometrics. (2017). Geode Ultra-Light Exploration Seismograph. Accessed May

25. Available from http://www.geometrics.com/geometrics-

products/seismographs/geode/

Leucci, G., and Giorgi, L. D. (2005). “Integrated geophysical surveys to assess the

structural conditions of a karstic cave of archaeological importance.”

Natural Hazards and Earth System Sciences, 17–22.

Loke, M. H. (1998). RES2DINV version 3.3, Rapid 2D resistivity and IP inversion

using the least squares method. Computer disk and manual. Penang,

Malaysia.

Mahmut, G., and Berge, M. A. (2017). “Integrated geophysical investigations in a

fault zone located on southwestern part of İzmir city, Western Anatolia,

Turkey.” Applied Geophysics, 114–133.

MASW. (2017). Multichannel analysis of surface waves (MASW) Accesed May

25. Available from: http://www.masw.com

Park Seismic LLC. (2015). ParkSEIS© (PS) - User Guide. (C. B. Park, Editor)

Accessed May 25. Available from ParkSEIS (PS):

http://www.parkseismic.com/

Pinet, N. (2013). “Gaspé Belt subsurface geometry in the northern Québec

Appalachians as revealed by an integrated geophysical and geological

study: 2 - Seismic interpretation and potential field modelling results.”

Tectonophysics, 100-117.



I220

http://www.geometrics.com/geometrics-products/seismographs/geode/

http://www.geometrics.com/geometrics-products/seismographs/geode/

http://www.parkseismic.com/

Siri, T. (2014) “Structure of Mae On Basin, Mae On District, Chiang Mai Province,

based on gravity data interpretation”, Independent Study, Bachelor Degree

of Science, Faculty of Science, University of Chiang Mai.

Telford, W. M., Geldart, L., and Sheriff, R. (1990). Applied Geophysics. 2nd

ed.

Cambridge: Cambridge University press.

Yilmaz, Öz. (2001). Investigations in Geophysics Seismic Data Analysis:

Processing, Inversion, and Interpretation of Seismic Data. Tulsa,

Society of Exploration Geophysicists.



I221

Isolation and characterization of lytic bacteriophages for biocontrol of

Staphylococcus aureus in milk and dairy product

Author: Phiraphat Chaengphaniad and Rujikan Nasanit

Program: Biotechnology Institute: Silpakorn University

Abstract

Staphylococcus aureus is a gram positive bacterium in family Micrococcaceae

with highest pathogenicity in genus Staphylococci. This bacterium is frequency found,

especially in milk and dairy products and becomes a significant threat that can directly

affect human health. Although there are many methods both physical and chemical

methods to control this bacterium in milk and dairy products. However, these methods

have drawbacks such as it may result in residues or alters the sensory quality of food

products. A potential method to eliminate S. aureus in milk and dairy products is

bacteriophage therapy which is an interesting alternative method. Therefore, the

objectives of this study were to isolate specific lytic bacteriophages for S. aureus 01

and host range test of isolated phages. In total 105 samples collected from raw milk,

wastewater from cattle farms and expected sources of S. aureus in Nakhon Pathom and

Ratchaburi province, clear plaques were obtained from 23 samples by enrichment

method. 30 phage plaques were purified. The plaque sizes ranged from 1-2 mm. The

phage-host range test was performed by spot test in order to investigate the lysis activity

against other bacterial strains. It was found that 21 out of 30 phage lysates showed lytic

activity against all S. aureus strains (12 strains) in this study. However, all phage lysates

did not show lytic activity against other bacterial genera used in this study (Listeria

monocytogenes, Salmonella Enteritidis and Salmonella Typhimurium). The specificity

of phage is determined by receptors on the host cell and is an important reason why

phage is suitable for phage therapy.

Key Words: Staphylococcus aureus, Bacteriophage, Isolation, Host Range, Milk and

dairy product

Introduction

Food is a daily basic need for humans. It is considered as a main route of trans-

mission of diseases caused by pathogenic bacteria of more than 200 diseases that can

directly affect the consumer health if it is contaminated with excessive amounts of

pathogenic bacteria (Oliver et al., 2005). Milk and dairy products that are considered as

beverages and/or healthy food that are popular with high demand among different

consumer groups and also suitable for people of all ages. There are important sources

of calcium, proteins and other essential nutrients. It is found that 100 g of ready-to-

drink milk contains 3.3, 3.5 and 3.4 g of protein, fat and carbohydrate, respectively

(Department of health ministry of public health, 2011). These chemical compositions

make milk a highly nutritious food which acts as an excellent growth medium for

wide range of microorganisms (Ibrahim et al., 2015). Escherichia coli, Staphylococcus

aureus, Enterobacter spp., Klebsiella spp. and Pseudomonas pyocyaneus are



I222

commonly found in raw milk at the prevalence rate of 75%, 52%, 42%, 36%, and 25%,

respectively (Pourhassan et al., 2011). According to the annual report of Department of

Medical Science for the major public health problems caused by food poisoning,

S. aureus is a major pathogenic microorganism that contaminates food. It is also found

that the infections of this bacteria cause the ongoing outbreaks in Thailand. Consuming

food that contaminated with this bacteria causes nausea, vomiting, severe diarrhea. In

severe case, the patients may shock. In addition, this bacteria also causes disease in

animals, such as mastitis in cattle which directly affects dairy farmers in Thailand.

In general, S. aureus can grow at the temperature range of 7-48 °C, while the

optimal temperature for growth is 37 °C. It is resistant to freezing and survives well in

food stored below -20 °C (Stewart, 2003). However, the viability is reduced at -20-0

°C. S. aureus can be destroyed by pasteurization process which is a thermal process at

about 66 °C for 30 minutes or 72 °C for 15 seconds. The pasteurization process can

reduce S. aureus and other pathogenic bacteria up to 95-99%. However, S. aureus

contamination in milk and dairy products can still occur, especially ready-to-eat foods

made from raw milk such as cheese which often found contamination. Jamali et al.

(2015) reported that from 2650 milk and dairy product samples including cow milk,

goat milk and cheese sold in retail shops, 328 samples (12.4%) were contaminated with

S. aureus. The contamination of this bacteria in milk and dairy products may be because

heat or duration during the pasteurization process are insufficient to kill pathogens in

raw milk which results in direct contamination in final products or cross-contamination

after the pasteurization process (Arques et al., 2005). This bacteria may cross-

contaminate from raw milk to processed dairy products in the same production line or

use the same tools and equipment during the production process from processing,

packaging and storage. This results in direct and indirect cross-contamination (Carton

et al., 2005; Vazques-Boland et al., 2001). Moreover, various S. aureus strains can

produce staphylococcal enterotoxins (SEs) which is the cause of staphylococcal food

poisoning. In general, the amount of SEs that can cause disease is at least 105-108 cfu

/g or cfu/ml. SEs are also highly-resistant to environmental condition and the

pasteurization temperature cannot destroy or affect SEs (Montville and Matthews 2008;

FDA 2012). Therefore, controlling S. aureus in milk and dairy products is very

important.

Although there are several ways to control S. aureus both physical and chemical

methods, however it often produces residues or changes the sensory quality of foods

(Gao et al., 2006). Recently, the use of bacteriophage or phage to control foodborne

pathogen has received a lot of attention as an alternative method that does not affect

food quality and does not produce residues (Mahony et al., 2011). The use of

bacteriophage is safe and nontoxic to consumers (Monk et al., 2010). Bacteriophages

are commonly found in nature. Each type of phage is highly specific to pathogenic

bacteria. Therefore, phages do not destroy or affect gut microbial of consumers and also

do not cause bacterial mutation, unlike antibiotics. The multiplication of phage occurs

only when bacterial host still exist so phage is considered as obligate parasite.

According to these characteristics it is clear that bacteriophage is suitable for use as

biocontrol to reduce the amount of pathogenic bacteria that may be contaminated in



I223

foods or products. Therefore, this research aimed to isolate and characterize lytic

bacteriophages that are specific to S. aureus contaminated in milk, which could be used

as an alternative for controlling this pathogenic bacteria.

Materials & methods

Strains and growth conditions

In this study Staphylococcus aureus 01 isolated from raw milk obtained from

Nong Pho Veterinary Clinic, Ratchaburi was used as host cell for bacteriophage

isolation. The culture was streaked on selective Baird Parker Agar with Egg Yolk

Tellurite Emulsion (Titan biotech, India) and mannitol salt agar (Biokar diagnostics,

France), subsequently picked and grown in Tryptic soy broth (TSB) (Titan biotech,

India) at 37 °C. The cultures were grown to mid-log phase (3-h-old, OD600 nm = 1.3) by

incubation at 37 °C with shaking at 130 rpm.

For long-term storage, the mid-log phase S. aureus 01 in TSB containing 20%

(v/v) sterile glycerol was prepared and stored at -80 °C.

Sample collection and bacteriophage isolation

Total 105 samples were collected from raw milk, wastewater samples from

cattle farms and the sources that may contain S. aureus in Nakhon Pathom and

Ratchaburi provinces. All samples were screened for bacteriophage by enrichment

method according to Conveny et al. (2002) with slight modification. Debris and bacteria

were removed from 20 ml of sample by centrifugation at 10,000xg for 10 min at 4 °C.

The supernatant was pipetted and transferred to new tube. Then 1 ml of mid-log phase

S. aureus was added and incubated for 10 h at 37 °C with shaking at 130 rpm. The

culture media was centrifuged at 8,000xg for 10 min at 4 °C. The obtained supernatant

was filtered through 0.45 µm polyethersulfone (PES) (Whatman, UK). The filtrates

were stored at 4 °C until analysis. Plaque assay was performed using agar overlay assay

according to Adams et al. (1959) to examine the presence of S. aureus specific

bacteriophages. The mixture of 100 µl phage suspension and 200 µl of mid-log phase

S. aureus 01 was incubated for 10 min at 37 °C. Then the mixture was added into 3 ml

of molten soft agar (TSB with 0.45% agar) and overlaid on solid TSA medium surface.

The culture medium was incubated at 37 °C for 24 h and the plague formation was

observed.

Bacteriophage purification

Bacteriophage purification was adapted from Mohammed-Ali and Jumalludeen

(2015). Plaques obtained from agar overlay assay were collected using pipette tip to

penetrate agar piece containing single plaque and resuspended in 1 ml of sterile SM

buffer (0.05 M Tris-HCl, pH 7.5, 5 M NaCl, 1 M MgSO4 and 0.01% gelatin). The

suspension was stored at 4 °C overnight to allow phage diffuse from agar piece. The

obtained phage suspensions were purified by serial dilution and plating to soft agar

overlays as described above. The isolation of single plaques was repeated at least three

time to ensure phage purity. The appearance of homogeneous plaque morphology was

observed throughout the plate of purified phages. Phage lysate was prepared by adding



I224

6 ml of SM buffer into the plate containing the homogeneous plaques and stored at 4

°C overnight in order to elute phages from plate. Phage lysates were collected and

centrifuged at 10,000xg for 10 min at 4 °C. The obtained supernatant was filtered

through PES syringe filters (pore size 0.45 µm). The purified phage lysates were stored

at 4 °C.

Large-scale preparation of phage stocks

Five mililitres of purified phage lysate were mixed with 15 ml of mid-log phase

S. aureus 01 and 30 ml of TSB medium. This suspension was incubated for 18-24 h at

37 °C with shaking at 130 rpm and centrifuged at 10,000xg for 10 min at 4 °C. The

supernatant was filtered through PES syringe filters (pore size 0.45 µm). The phage

lysate stocks were stored at 4 °C. Titres of propagated phage lysates were determined

by agar overlay assay described above. The number of plaque on agar plate was counted

(counted on plates with 30-300 plaques) and used to calculate phage titer as plague-

forming unit/ml as followed: Phage titer (pfu/ml) = (number of plaque)/0.1 x dilution

Phage Host range determination

The phage host range tests were performed by spot test (Chopin et at., 1976).

Fifteen bacterial host strains used in this study are listed in Table 1. Two hundred

microliters of mid-log phase bacterial strains were mixed with 3 ml of molten TSA

(containing 0.45% agar) then overlaid on solid TSA surface and allowed the media

surface to be harden. 10 µl of phage lysates (108 pfu/ml) were spotted onto each

bacterial lawn. The same volume of SM buffer was used as control. The plates were

incubated at 37 °C for 24 h. The clear zone at the position of phage application were

observed. The phages showing clear zone at such position were indicated as positive

for lytic activity.

Table 1. Bacterial host strains used in this study

Bacterial host strains Source

Staphylococcus aureus 01 Nong Pho Veterinary Clinic

Staphylococcus aureus DN22 Nong Pho Veterinary Clinic

Staphylococcus aureus SM6 Nong Pho Veterinary Clinic

Staphylococcus aureus CM4 Nong Pho Veterinary Clinic

Staphylococcus aureus CH10 Nong Pho Veterinary Clinic

Staphylococcus aureus TMK3 Nong Pho Veterinary Clinic

Staphylococcus aureus MP128 Nong Pho Veterinary Clinic

Staphylococcus aureus MP34 Nong Pho Veterinary Clinic

Staphylococcus aureus NPT14 Nong Pho Veterinary Clinic

Staphylococcus aureus PNK38 Nong Pho Veterinary Clinic

Staphylococcus aureus KPS13 Nong Pho Veterinary Clinic

Staphylococcus aureus JB8 Nong Pho Veterinary Clinic

Salmonella Enteritidis DMST 8536 Department of medical science

Salmonella Typhimurium ATCC 13311 Department of medical science

Listeria monocytogenes DMST 17303 Department of medical science



I225

Results

Bacteriophage Isolation

In this study, S. aureus specific phages were isolated by enrichment method in

order to increase the amount of phage and detect the presence of phages in the samples.

Of total 105 samples, 34 samples (32.38%) contained S. aureus specific phages by

producing the noticeable plaques on the overlaid agar. Clear plaques obtained in 23

samples show the sizes ranging from 1-2 mm in diameter with and without halo

formation (Figure 1A). Turbid plaques were observed in other 11 samples

(Figure 1B). Clear plaques were selected for phage purification.

Figure 1. Plaque formation by agar overlay assay. (A) Clear plaques formed by phage

S24, (B) turbid plaques formed by phage S52

Thirty phage plaques were obtained after purification. The decisions were

performed on the basis of plaque morphology. These phages were multiplied in order

to prepare phage stocks with the average titer of about 108-109 pfu/ml.

Phage-Host specific

The purified phage lysates (phage titer of about 108 pfu/ml) were used to

determine the host range against 15 bacterial host strains (Table1). The results revealed

that 21 out of 30 phage samples (S1T1, S2T1, S5T1, S15T1, S24T3, S41T1, S41T2,

S41T3, S41T4, S41T5, S43T1, S44T1, S47T1, S55T1, S56T1, S62T1, S63T1, S65T1,

S66T1, S93T1 and S102T1) showed lytic activity against 12 strains of S. aureus

(Table 2). The characteristic clear zone of inhibition is shown in Figure 2. However,

these 21 phages cannot infect L. monocytogenes, S. Enteritidis and S. Typhimurium.

These indicate the specificity of isolated phage to S. aureus.

A B

A B



I226

Figure 2. The clear zone of inhibition by spot test method in phage host range test

Discussion and conclusions

The microbiological quality of milk and dairy products is influenced by initial

flora of raw milk, processing conditions, and post-heat-treatment contamination

(Rajagopal et al., 2005). Undesirable microbial contamination in milk and dairy

products, especially S. aureus may directly affect consumers because S. aureus can

cause toxin-mediated diseases and produces virulence factors (Que et al., 2010). These

bacteria enter the human body through the consumption of contaminated milk and dairy

products. Therefore, to control the dissemination of this bacteria is very challenging.

Most control methods, both physical and chemical methods can affect the product

qualification. It is therefore necessary to find an alternative method that is

environmentally friendly, safe and retain food quality. Recently, the use of phages to

control pathogens has received a lot of attention because it is an alternative way of

controlling infection and contamination of antibiotic resistant pathogens (Hanlon,

2007). There are many successful researches in the application of bacteriophage in milk

and dairy products. For example, the prevention of S. aureus growth in yogurt

production process (Garcia et al., 2007) , the phage control of S. Enteritidis during the

production process and storage of chedder cheese (Modi et al., 2001) and prevention of

L. monocytogenes growth in red smear cheese (Carlton et al., 2005).



I227

Table 2. Phage-Host specificity of 30 phage samples against 15 bacterial host strains

+ Clear zone, - No clear zone

The isolation of phages from environmental samples is possible, especially from

sources where the intended host is present (Higgins et al., 2007). In this study, S. aureus

specific bacteriophages were isolated from the samples that were expected to be the

host sources both in raw milk and livestock wastewater samples. Clear plaques and

Host

Strains

Phage

Sample

S. aure

us0

1

S. aure

us

DN

22

S. aure

us

SM

6

S. aure

us

CM

4

S. aure

us

CH

10

S. aure

us

TM

K3

S. aure

us

MP

128

S. aure

us

MP

34

S. aure

us

NP

T14

S. aure

us

PN

K38

S. aure

us

KP

S13

S. aure

us

JB8

L .m

onocy

togen

es

S. E

nte

riti

dis

S. T

yphim

uri

um

S1T1 + + + + + + + + + + + + - - -

S2T1 + + + + + + + + + + + + - - -

S5T1 + + + + + + + + + + + + - - -

S15T1 + + + + + + + + + + + + - - -

S24T1 + + + - + + + + + + + + - - -

S24T2 + + + - + + + + + + + + - - -

S24T3 + + + + + + + + + + + + - - -

S41T1 + + + + + + + + + + + + - - -

S41T2 + + + + + + + + + + + + - - -

S41T3 + + + + + + + + + + + + - - -

S41T4 + + + + + + + + + + + + - - -

S41T5 + + + + + + + + + + + + - - -

S42T1 + - + + - + - + + + + + - - -

S43T1 + + + + + + + + + + + + - - -

S44T1 + + + + + + + + + + + + - - -

S47T1 + + + + + + + + + + + + - - -

S55T1 + + + + + + + + + + + + - - -

S56T1 + + + + + + + + + + + + - - -

S62T1 + + + + + + + + + + + + - - -

S63T1 + + + + + + + + + + + + - - -

S65T1 + + + + + + + + + + + + - - -

S66T1 + + + + + + + + + + + + - - -

S76T1 + - + - - + - + + + + + - - -

S85T1 + - + - - + - + + + + + - - -

S85T2 + - + + - + - + + + + + - - -

S87T1 + - + + - + - + + + + + - - -

S88T1 + - + - - + - + + + + + - - -

S91T1 + - + - - + - + + + + + - - -

S93T1 + + + + + + + + + + + + - - -

S102T1 + + + + + + + + + + + + - - -



I228

turbid plaques were obtained in this study. Phage that from clear plaques are considered

as virulent phages. These phages have lytic life cycle, when phage enters bacterial host

cell it will multiply inside the bacterial cell by using host components for producing

protein and genome. After that, the assembly of phage progeny occurs and bacterial cell

is lyzed in order to release progeny which can be observed as clear plaque. This is

different from turbid plaque forming phages which are considered as temperate phages.

In the lysogenic life cycle, when phage enters bacterial host cell it will not produce

phage progeny. However, phage genome will integrate into bacterial chromosome

which is due to the genetic recombination. Phage in this stage is called prophage.

Prophage division occurs during bacterial chromosome division. As a result, new

recombinant bacterial cell carries latent prophage genome. In addition, there is also

prophage that the phage genome does not integrate into bacterial chromosome but is

independent in the cytoplasm. Co-existence between hosts and lysogenic phage can

cause coevolution by acting as mobile genetic element in gene transferring between

organisms via lateral or horizontal gene transfer. This phenomenon causes many

changes to host whether evolution of antibiotic resistance in bacteria or changes from

nonpathogenic bacterial strains to virulent strains (Abedon, 2008).

According to the phage life cycles, lysogenic phages are not suitable for phage

control application. Only lytic phages are suitable for biological control application and

this is probably one of the safest methods to destroy pathogenic bacteria (Sillankorva

et al., 2012). Therefore, lytic phages were selected in this study. 30 clear plaques were

obtained after the purification. There are a variety of plaque characteristics and sizes

ranging from 1 -2 mm. The different sizes of plaques depend on a number of factors.

These include virion diffusivity (rate of virion particle diffusion without the presence

of the host), various rate constants for phage-bacterium attachment, phage latent period

and burst size. Phage with higher diffusivity would has larger plaque size, especially

the size would be a quadratic function of diffusivity. Too high or too low adsorption

rate would generally results in smaller plaque size. Whilst an optimal adsorption rate

lead to a maximal plaque size. The plaque size is also predicted to be negatively

correlated with the latent period (or lysis time). This means the more time the phage

progeny spends inside the host, the less time it would be able to diffuse to a new host.

It is also intuitively apparent that a larger burst size would result in a larger plaque size

(Abedon and Yin, 2009) . However, plaque size can only increase to a certain extent

(You and Yin, 1999).

In this present study, the ratio of purified phage lysate: mid-log phage S. aureus

: TSB medium at 1 : 3 : 6 was used to proliferate the high titer phage of about 1 0 8-1 0 9

pfu/ml which was considered as satisfactory. As can be seen, the bacterial volume is

higher than phage lysate, this allows phage to infect bacterial host and multiply as well

as prevent “lysis from without” phenomenon which could happen if phage titer is higher

than host cell. This phenomenon results in bacterial lysis before phage production

(Abedon, 2011).

One of the main topic to consider in selecting effective phage for biocontrol is

its lysis efficiency against host cells. An in vitro screening of a potential lytic phage

provides a rigorous assessment of it lysis capabilities. In this study, 21 phages had lytic



I229

activity against all S. aureus strains. However, all phage samples could not infect

L. monocytogenes, S. Enteritidis and S. Typhimurium. The specificity of phage

infection is defined in attachment or adsorption step of the phage virion to the receptors

on bacterial cell wall during the initial stage of phage infection cycle (Parisien et al.,

2008). This is an important step in virus recognition of sensitive host cell. This makes

a specific bacteriophage able to infect a narrow host range or a concrete microbial

species or strains, which is in turn dependent on the nature and structural peculiarities

of receptors on bacterial cell surface (Braun and Hantke, 1997). The nature of receptor

contacting bacteriophages is different for representatives of diverse taxonomic groups

and is largely defined by composition of host cell wall and surface structures

(Rakhuba et al., 2010). There are reports described the importance of cell wall proteins

as receptors. Porins are one of the first outer membrane proteins of gram negative

microorganism to be characterized in detail, forming the channel in membrane (Nakae,

1976). Protein receptor of this type in E. coli cells are OmpC and OmpF. OmpC serves

as a receptor for phage T4 ( Scurray et al., 1 9 7 4 ) . Phage T4 utilized the protein as a

receptor in combination with cell wall lipopolysaccharide (LPS). It was shown in

experiments with LPS and OmpC mutants that absence of at least one receptor resulted

in reduced efficiency of infection, whereas loss of both receptors induced bacteriophage

resistance. Rakieten and Rakieten (1 9 3 7 ) was found that specific phage for S. aureus

might be also adsorbed onto Bacillus subtilis surface due to their structural similarity

(Jazwinski et al., 1975).

In conclusion, this study succeeded in isolating phages specific to S. aureus 01.

Most isolated phages had lytic activity against all S. aureus strains. These phages are

only specific to S. aureus without cross infection to other genera tested in this study.

Therefore, these phages are promising for further biocontrol of S. aureus. However,

phage genome characteristics, physical and biological properties of phage are needed

to be investigated.

References

Abedon, S.T. (2008). Bacteriophage ecology, population, evolution and impact of

bacterial viruses. UK: Cambridge University press.

Abedon, S.T. and Yin, J. (2009). Bacteriophage plaques: theory and analysis. Methods

in Molecular Biology. 501:161-174.

Abedon, S.T. (2011). Lysis from without. Bacteriophage. 1(1): 46-49.

Adams, M.H., (1959). Bacteriophages. Interscience Publishers, New York.

Arqués, J.L., Rodriguez, E., Gaya, P., Medina, M., Guamis, B. and Nunez, M. (2005).

Inactivation of Staphylococcus aureus in raw milk cheese by combinations of

high pressure treatments and bacteriocin producing lactic acid bacteria. Journal

of Applied Microbiology. 98(2): 254-260.

Braun, V. and Hantke, K. (1997). Bacterial receptors for phage and colicins as

constituents of specific transport systems. Microbial interaction. 3: 101-137.

Carlton, R.M., Noordman, W.H., Biswas, B., Meester, E.D. and Loessner, M.J. (2005).

Bacteriophage P100 for control of Listeria monocytogenes in foods: genome

sequence, bioinformatics analyses, oral toxicity study, and application.



I230

Regulatory Toxicology and Pharmacology. 43(3): 301-312.

Cerveny, K.E., Depaola, A., Duckworth, D.H. and Gulig, P.A. (2002). Phage therapy

of local and systemic disease caused by Vibrio vulnificus in iron-dextran-treated

mice. Infect Immun. 70(11): 6251-6262.

Chopin, M.C., Chopin, A. and Roux, C. (1976). Definition of bacteriophage groups

according to their lytic action on mesophilic lactic streptococci. Applied and

Environmental Microbiology. 32(6): 741-746.

Department of health ministry of public health. (2011). Nutritive values of Thai food.

Bangkok: Nutrition Division.

FDA (2012) Bad bug book: Foodborne pathogenic microorganisms and natural toxins

handbook, 2nd ed. US Food and Drug Administration, Silver Spring, p. 87-92.

García, P., Madera, C., Martínez, B. and Rodríguez, A. (2007). Biocontrol of Staphylo-

coccus aureus in curd manufacturing processes using bacteriophages.

International Dairy Journal. 17(10): 1232-1239.

Gao, Y.L., Ju, X.R. and Jiang, H.H. (2006). Statistical analysis of inactivation of

Listeria monocytogenes subjected to high hydrostatic pressure and heat in milk

buffer. Applied Microbiology and Biotechnology. 70(6): 670-678.

Hanlon, G.W. (2007). Bacteriophages: an appraisal of their role in the treatment of

bacterial infection. International Journal of Antimicrobial Agents. 30(2): 118-

128.

Higgins, S.E., Higgins, J.P., Bielke, L.R. and Hargis, B.M. (2007). Selection and

application of bacteriophages for treating Salmonella enteritidis infections in

poultry. International Journal of Poultry Science. 6(3): 163-168.

Ibrahim, G.A., Sharaf, O.M. and Abd El-Khalek, A.B. (2015). Microbiological quality

of commercial raw milk, domiati cheese and kareish cheese. Middle East

Journal of Applied Sciences. 5(1): 171-176.

Jamali, H., Paydar, M., Radmehr, B. and Ismail, S. (2015). Prevalence and

antimicrobial resistance of Staphylococcus aureus isolated from raw milk and

dairy products. Food Control. 4(3): 277-84.

Jazwinski, S.M., Lindberg, A.A. and Kornberg, A. (1975). The lipopolysaccharide

receptor for bacteriophage ϕx174 and S13. Virology. 66(1): 268-282.

Mahony, J., Mcaukiffe, O., Ross, R.P. and Van, S.D. (2011). Bacteriophage as

biocontrol agents of food pathogens. Current Opinion in Biotechnology. 22(2):

157-163.

Modi, R., Hirvi, Y., Hill, A. and Griffiths, M.W. (2001). Effect of phage on survival of

Salmonella enteritidis during manufacture and storage of cheddar cheese made

from raw and pasteurized milk. Journal of Food Protection. 64(7): 927-933.

Mohammed-Ali, M.N. and Jamalludeen, N.M. (2015). Isolation and characterization

of bacteriophage against methicillin resistant Staphylococcus aureus. Journal

of Medical Microbiology & Diagnosis. 5(1): 213-220.

Monk, A.B., Ress, C.D., Barrow, P., Hagens, S. and Harper, D.R. (2011). Bacterio-

phage application: where are we now? Letters in Applied Microbiology. 51(4):

363-369.

Montville, T.J. and Matthews, K.R. (2008). Food microbiology. In: An introduction.



I231

2nd ed. ASM Press, Washington D.C.

Nakae, T. (1976). Identification of the outer membrane protein of E. coli that produces

transmembrane channel in reconstituted vesicle membrane. Biochemical and

Biophysical Research Communications. 71(3): 877-84.

Oliver, S.P., Jayarao, B.M. and Almeida, R.A. (2005). Foodborne pathogens in milk

and the dairy farm environment: food safety and public health implications.

Foodborne Pathogens and Disease. 2(2): 115-29.

Parisien, A., Allain, B., Zhang, J., Mandeville, R. and Lan, C.Q. (2008). Novel alter-

natives to antibiotics: bacteriophages, bacterial cell wall hydrolases, and

antimicrobial peptides. Journal of Applied Microbiology. 104(1): 1-13.

Pourhassan, M. and Najafabadi T. (2011). The spatial distribution of bacteria

pathogens in raw milk consumption on malayer City, Iran. Shiraz E-Medical

Journal. 12(1): 2-10.

Que, Y. and Moreillon, P. (2010). Staphylococcus aureus (Including Staphylococcal

Toxic Shock). In Mandell, G.L., Bennette, J.E., Dolin, R., editors. Mandell,

Douglas and Bennett’s Principles and Practice of Infectious Diseases. 7th ed.

Elsevier Inc., Philadelphia, p. 2543-2578.

Rajagopal, M., Werner, B.G., and Hotchkiss, J.H. (2005). Low pressure CO2 storage

of raw milk: Microbiological effects. Journal of Dairy Science. 88(9): 3130-

3138.

Rakhuba, D.V., Kolomiets, E.I., Szwajcer Dey, E. and Novik, G.I. (2010).

Bacteriophage receptors, mechanisms of phage adsorption and penetration into

host cell. Polish journal of microbiology. 59(3): 145-155.

Rakieten, M.L. and Rakieten, T.L. (1937). Relationship between staphylococci and

bacilli belonging to the subtillis group as shown by bacteriophage adsorbtion.

Journal of Bacteriology. 34(3): 285-300.

Scurray, R.A., Hancock, E.W. and Reeves, P. (1974). Con- mutants: class of mutants in

E.coli K-12 lacking a major cell wall protein and defective inconjugation and

adsorption of a bacteriophage. Journal of Bacteriology. 119(3): 726-735.

Sillankorva, S.M., Oliveira, H. and Azeredo, J. (2012). Bacteriophages and Their Role

in Food Safety. International Journal of Microbiology.

Stewart, C.M. (2003). Staphylococcus aureus and Staphylococcal enterotoxins. In:

Hocking A.D., editor. Foodborne microorganisms of public health significance.

6th ed. Australian Institute of Food Science and Technology (NSW Branch),

Sydney, p. 359–380.

Vazquez-Boland, J.A., Kuhn, M., Berche, P., Chakraborty, T., Dominguez-Bernal, G.

and Goebel, W. (2001). Listeria pathogenesis and molecular virulence

determinants. Clinical Microbiology Reviews. 14(3): 584-640.

You, L. and Yin, J. (1999). Amplification and spread of viruses in a growing plaque.

Journal of Theoretical Biology. 200(4): 365-373.



I232

Effect of α-Amylase Treatment on Color Formation via a Simulated Reducing

Sugar-Glycine Model

Chudarat Watcharinrat1, Prakit Sukyai2

1,2 Department of Biotechnology, Faculty of Agro-Industry, Kasetsart University

Abstract Starch is a sugarcane impurity that is distributed throughout its mature stalks.

The soluble starch have been considered problematic for sugar processing and other

products. A sugar factory uses α-amylase to hydrolyze starch into simple sugars.

Enzymatic treatment also promotes reducing sugar in the processing, which causes a

browning reaction via the Maillard reaction. On that basis, this research was performed

to study the effects and kinetics of α-amylase treatment by using a simulated reducing

sugar-glycine model for investigation of the influence of α-amylase treatment. The

simulated model prepared by concentrated sucrose solution containing starch and

treated with α-amylase in a mixture with glycine for storage at 40, 50 and 60°C. Color

development was positively associated with high temperature and the decreasing of

reducing sugar. The kinetics of color change followed the zero-order kinetics and the

effect of temperature on the reaction was described by Arrhenius equations. Therefore,

this research showed the effects of enzymatic treatment with a browning reaction and

indicated the kinetics of color development in sugar processing.

Keywords: Starch, Raw Sugar, Color, Storage, Arrhenius equation

Introduction

Starch ( α-14-glucan) is a polymer of glucose linked through the glycosidic

bond and produced in sugarcane as a storage polysaccharide (Souza et al, 2010). It is a

natural component in the stalks of sugarcane and is the most abundant in the leaves. It

may be converted into sugar ( Vignes et al., 1974; Zhou et al., 2008) . Its concentration

varies depending on region, season, variety, diurnal cycle and sugarcane maturity

( Galliard et al., 1987; Eggleston et al., 2008) . Currently, many problems in sugar

processing exist because starch granules are extracted into sugarcane juice (Imrie et al.,

1972; Zhou et al., 2008). It is an undesirable impurity that contributes to lost efficiency

in production during sugar processing, such as increasing viscosity, slowing filtration,

and lowering evaporation rates ( Godshall et al., 1996; Cuddihy et al., 2001) . Starch

negatively affects the quality and quantity of raw and refined sugar when contamination

reaches over 250 ppm (Eggleston et al., 2006; Promraksa, 2008; Zhou et al., 2008).

Starch is generally removed in the clarification process through precipitation,

but this is not enough to alleviate starch process problems ( Amyangwa et al., 1993;

Eggleston et al., 2003). The use of α-amylase is widely established in the sugar industry

for starch removal (Chen et al., 1993; Kampen et al., 2006; Souza et al., 2010). The α-

amylase ( α -1, 4-glucan, 4-glucanohydrolase) is primarily hydrolysis α-1, 4-glycosidic

linkages of starch into smaller molecules as a mixture of monosaccharides, which

comprise the reactant of the Maillard reaction ( Chen et al., 2008; Souza et al., 2010) .

If starch content is not causing critical contamination, the factory may carefully monitor



I233

rather than add α-amylase because it saves money on unnecessary costs in the sugar

factory and causes color phenomena occurring in raw and refined sugar ( Chung et al.,

2012; Asikin et al., 2014) . Color is an important attribute in food product and can

change during sugar processing and storage by the Maillard reaction, which is an

important non-enzymatic browning reaction and involves a complex phenomenon

between reducing sugar and amino acids at a ratio of 1:1, ( Cocoa et al., 2004; Quintas

et al., 2010) . The Maillard reaction can be classified into three stages (initial,

intermediate and final stage) to change a dark brown color in food products (Martins et

al., 2001; Nursten, 2005; Chen et al., 2008) . The efficiency of Maillard color depends

on various factors such as reaction time and temperature, including chemical

compositions such as amino acids and reducing sugar (Saska et al., 2009; Chung et al.,

2012). Few studies have concentrated on the Maillard reaction during sugar storage and

its effect on sugar quality (Pacheco et al., 2012).

This work aimed to determine the effect of raw sugar storage after enzymatic

treatment and color formation. The experiments were carried out with a concentrated

sucrose solution containing starch and treated with α-amylase to build the simulated

reducing sugar-glycine model. The simulated reducing sugar-glycine model stored

goods with different storage conditions and proposed to express color development as

indicators of the Maillard reaction. The color kinetics of the simulated model via the

Maillard reaction followed the zero-order reaction kinetic model and was analyzed by

the Arrhenius equation. The Arrhenius equation is a formula for the temperature

dependence of reaction rates. It is common knowledge that reaction rates occur more

rapidly at higher temperatures. Therefore, the effect of temperature on the color of sugar

during storage showed different color developments in the simulated model systems.

This research can add to the knowledge of parameters affecting color formation and be

used to manage storage conditions in sugar factories to maintain suitable product

quality.

Objectives

1) The effect of enzymatic treatment on raw sugar processing

2) The development color of raw sugar during storage.

3) Analyzing the color development by Arrhenius equation. Research Methodology

1. Preparation of reaction mixtures

15% ( w/v) sucrose solution with soluble starch was prepared by dissolving 15

grams of commercial sucrose in distilled water and making up to a final solution volume

of 100 ml adding soluble starch at 500 ppm. The mixture was heated with stirring until

completely soluble.

2. Enzymatic treatment

The solutions were treated with 4 ppm α-amylase at 95°C for 20 minutes.

The reactions were stopped by keeping it in a boiling water bath for 15 minutes. The

reducing sugar and starch content after enzymatic treatment were determined.



I234

3. Measurement of reducing sugar

The reducing sugar was determined by Somogyi-Nelson method. First, 1 ml of

sample was placed into a test tube, followed by adding 1 ml of Alkaline copper reagent

to each tube and boiling all the tubes for 15 minutes in a boiling water bath, which were

then cooled in a cooling bath. Arsenomolybdate color reagent was added into the tubes

with a brief vortex and then incubated in the dark at room temperature for 30 minutes.

The mixtures were diluted with 5 ml distilled water before measuring absorbance at

520 nm. Reducing sugar was calculated using the equation:

4. Measurement of starch content

Starch content was measured following the SPRI starch test. It was precipitated

by 90% ethyl alcohol, caught on a mat of filter aid and solubilized by boiling in 40%

CaCl2 solution. Then, it was reacted with iodine and colormetrically analyzed as the

blue starch-iodine complex by Genesys 10-UV spectrophotometer ( Rochester, NY,

USA) at a wavelength of 600 nm. All analyses were performed in triplicate. Starch

content was calculated using the equation:

5. Preparation of reducing sugar-glycine model

The simulated reducing sugar-glycine model was prepared after α-amylase

treatment by heating 15% sucrose solutions with up to concentrated 70% sucrose

solutions and adding glycine. The initial molar ratio of reducing sugar to glycine was

1:1 for the development of color via Maillard reaction. Incubation for 30 days at 40, 50

and 60 °C occurred for color development. The simulated glucose-glycine and the

sucrose-glycine model were used as positive and negative control, respectively.

6. Measurement of color change

The color of raw sugar was determined in terms of ICUMSA (International

Commission for Uniform Methods of Sugar Analysis) GS1/3-7 protocol. The weight

of one gram of sample was dissolved in 100 ml of distilled water and then adjusted to

pH 7.0 by using an HCl or NaOH solution while stirring with a magnetic stirrer. The

mixture was filtered through filter paper and immersed in a flask in an ultrasonic bath

for 3 minutes. Afterward, absorbance was measured at 420 nm by using a UV

spectrophotometer. Color was calculated using the equation:

where b is the cell path length used (cm) and C is the concentration of sugar solution

(g/ml).

Starch (ppm) = 1000 x (C) x V1 x V3

50 weight of sample (g) V2

Reducing sugar (µg/ml) = Absorbance x dilution

Slope from the standard graph

ICUMSA color unit or IU = (Absorbance x 1000)

(b x c)



I235

7. Data analysis and statistical method

Analysis of reaction rates was performed and all samples were determined by

Arrhenius equation. Color has been found to follow the zero order reaction kinetics.

Following this evidence, it was reasoned that the thermal color increasing of Maillard

reaction prepared by the simulated reducing sugar-glycine model follows the zero order

kinetic model:

Cp = Cp0 + kt Eq.1

The dependence of the color development rate constant on temperature is represented

by the Arrhenius equation:

k = k0exp (-Ea/RT) Eq.2

Where k0 is the pre-exponential constant, Ea is the activation energy, R is the gas

constant (8.314 J mol-1 k-1), and T is the absolute temperature.

Results and Discussion

1) Effect of α-amylase treatment

Reducing sugar and starch content of 15% ( w/v) sucrose solution containing

500 ppm of soluble starch after α-amylase treatment is given in Table 1. Reducing sugar

after α-amylase treatment showed 2730.27 µg/ml because of 4 ppm α-amylases are

enzymes that catalyses the hydrolysis of the glycosidic linkage of starch into smaller

oligosaccharides and produced simple sugars such as glucose, maltose and maltotriose

units ( Souza et al., 2010) . However, the effect of its decomposition starch as reducing

sugar lead to non-enzymatic reaction to colored compounds ( Chuddihy et al., 2006;

Quintas et al., 2010) . Reducing sugars are sugars which have free aldehyde or

ketone group. These sugars can react with other compounds and provide electrons

to them ( Straathof et al.,2000) . This type of color is formed by the Maillard reaction

between reducing sugar and amino compounds in sugar cane juice ( Morrison et al.,

1983; Perez et al., 2009) . Therefore, when starch is critical contamination from

sugarcane in sugar production, the sugar factories should carefully use α-amylase

because the effect of reducing sugar after enzymatic treatment may occur the color in

raw and refined sugar products (Straathof et al., 2000; Schoones et al., 2006).

Table 1. The amount of starch and reducing sugar in 15% ( w/v) sucrose solution

containing 500 ppm of soluble starch after α-amylase treatment

Treatment time

(minutes) Starch content

(ppm)

Reducing sugar

(µg/ml) 20 0 2730.27



I236

2) Effect of the simulated reducing sugar-glycine model on color development

The concentrated sucrose solution in the simulated reducing sugar-glycine

model was stored at different temperatures and showed increasing color change with

the Maillard reaction ( Martins et al., 2001; Kitts et al., 2005) . Ajandouz (2001)

explained that the Maillard reaction is the non-enzymatic browning reaction between

reducing sugar and amino acid. The reducing sugar and amino acid content were

disappeared for color formation which monitored from the reduction of reducing sugar

and brown color development. After 30 days of storage, the color values changed from

138.06 IU to 958.08 IU, 1616.77 IU and 2137.73 IU at 40, 50 and 60°C, respectively

( Fig. 1A) whereas reducing sugar was found at 2730.27 µg/ml to 2220.53 µg/ml,

1654.55 µg/ml and 1266.36 µg/ml at 40, 50 and 60°C, respectively (Fig. 1B). However,

the control samples, the positive control in the simulated glucose-glycine model showed

the darkest color, while the color of negative control in the simulated sucrose-glycine

model did not change significantly during storage. It indicated that reducing sugar

which generated from starch hydrolysis is an impact on color development with

temperature. Mohr (1971) reported that degradation of reducing sugar and amino acid

promote the browning reaction at high temperature that might be an important factor to

impact color change with the Maillard reaction more than low temperature.

Color of sugar is recognized as the index of sugar quality that was create by The

International Commission for Uniform Methods of Sugar Analysis (ICUMSA). It is a

standard value of categorizing sugars. ICUMSA color levels ( IU) may be classified as

refined sugar, crystal sugar and raw sugar. The low number of IU indicating low levels

of color such as 45 IU is a high demand products and the safest form of sugar that

removes bacteria and contaminants present in raw sugar whereas 1000 IU or more when

analyzing raw sugars. The results of color formation on this study may have some useful

practical implications in the food technology which are interaction between the sugar

and amino group and may be exposed during their processing (Van et al., 1996; Martins

et al., 2001; Zhou et al., 2008).



I237

Fig 1. Color changes ( A) and reducing sugar ( B) content of the concentrated sucrose

solution prepared by the simulated reducing sugar-glycine model under various

conditions: 40°C, 50°C, 60°C

3) Effect of temperature on the rate constant

Martins ( 2005) have been studied in the kinetics of reducing sugar glycine in

the Maillard reaction pathways and was described a comprehensive kinetic of color

development by Arrhenius analysis. In this study, the kinetics model of the simulated

reducing sugar-glycine model was associated with temperature and period time, which

showed the zero-order reaction ( Villota et al., 1992; Kim et al., 2012) . The rate of

change in color development during storage can be characterized by the general rate

law ( Van et al., 1996; Peleg et al., 2002) . A linear regression analysis was performed

on the plot of indicator ( Cp, ln Cp or 1/Cp) with period time for the zero-, first-and

0

500

1000

1500

2000

2500

3000

0 3 6 9 12 15 18 21 24 27 30

Red

uci

ng s

ugar

(µ

g/m

l)

Time (days)

B

0

300

600

900

1200

1500

1800

2100

2400

0 3 6 9 12 15 18 21 24 27 30

Co

lor

(IU

)

Time (days)

A



I238

second-order reaction, respectively. It showed value the coefficient of determination

(R2) in Table2.

In Fig2, showed the time courses of the color development at a given

temperature and the line was evaluated by the coefficient of determination ( R2) that

rewritten as: Cp=Cp0 + kt as the R2 values at 0.9992, 0.9978 and 0.9920 for 40°C, 50°C

and 60°C, respectively. It described the color of this reaction using the zero-order

reaction equation because R2 values of Cp and period time all above 0.90 (Rodinova et

al., 2005). The growth rate fell under a zero-order reaction that can be drawn by taking

the concentration of the reactant at any given time. Reaction rate constants increased

with temperature. This indicates that the reaction rate is independent of the reactant

concentration and that increasing the reactant concentration has no effect on rate

reaction (Rodinova et al., 2005; Schaefer et al., 2015)

Table 2. The reaction rate constant ( k) of the concentrated sucrose solution prepared

by the simulated reducing sugar-glycine model after storage for 30 days at different

temperatures

Temperature

(°C) Zero order

(Cp vs. time)

R2

First order

(In Cp vs. time)

R2

Second order

(1/Cp vs time)

R2

Reaction rate

constant (h-1)

(Zero order)

40 0.9992 0.8737 0.8138 28.295

50 0.9978 0.8670 0.8651 47.617

60 0.9920 0.8364 0.8151 63.236

Fig 2. Time courses of the color development of the concentrated sucrose solution

prepared by the simulated reducing sugar-glycine model under varied conditions:

40°C, 50°C, 60°C

y = 28.295x + 169.56

R² = 0.9992

y = 47.617x + 172.63

R² = 0.9978

y = 63.236x + 237.23

R² = 0.9920

0

500

1000

1500

2000

2500

0 3 6 9 12 15 18 21 24 27 30

Cp

Time (days)



I239

The dependence of reaction rate constant (Table.2) on temperature followed the

Arrhenius relationship plot shown in Figure 3. The Arrhenius plots are often used to

analyze the effect of temperature on the rates of chemical reactions. It is obtained by

plotting the logarithm of the reaction rate constant (k) versus inverse temperature (1/T).

The result of the negative slope line is useful in finding the missing component of the

Arrhenius equation (Peleg et al., 2002; Schaefer et al., 2015).

After obtaining the activation energy and pre-exponential factor from the

Arrhenius plot, the rate constant at any temperature can be identified by using the

Arrhenius equation in Table 3, As a rule, higher Ea and k values indicate greater heat

sensitivity of color development during storage and the most biological and chemical

reaction. The Arrhenius parameters, Ea was estimated at 34.97 kJ/mol which is the

minimum energy needed for the reaction to occur ( Atkins et al., 2006) . The rate

constant ( k) of the color development from the simulated model as 29.27, 44.37 and

65.61 at 40, 50 and 60°C, respectively. This Arrhenius kinetic model is widely applied

nowadays to predict quality and color changes in food during storage. It is also a good

way to predict the rate constant of products for storage at any temperature ( Kim et al.,

2012; Rodinova et al., 2005).

Fig 3. The Arrhenius relationship between color development rate constant and

temperature of the concentrated sucrose solution prepared by the simulated reducing

sugar-glycine model: 40°C, 50°C, 60°C

Table 3. Arrhenius equation of color development and the rate reaction of color at

different temperatures

Temperature

(K)

Arrhenius equation Ea

(kJ/mol)

Rate reaction of color

development

(k) 313

ln (k) = -4207.2(1/T)+16.818

k = exp(-4207.2(1/T)+16.818)

34.97

29.27

323 44.37

333 65.61

ln k = -4207.2(1/T) + 16.818

0

0.5

1

1.5

2

2.5

3

3.5

4

4.5

0.00295 0.003 0.00305 0.0031 0.00315 0.0032 0.00325

ln k

1/T(K)



I240

Conclusion

Starch is a cause of the problem in sugar production. The sugar factories widely

used α-amylase treatment for starch removal. However, enzymatic treatment also

promotes reducing sugar in the processing and impact the color development. The color

was determined by reducing sugar reacts with amino acids via the Maillard reaction

that prepared by the simulated reducing sugar-glycine model for storage at 40, 50 and

60°C. Color changes in the model systems tended to increase during storage, especially

at 60°C. The color increased, whereas reducing sugar decreased over 1 month of

storage. Color development can be followed the zero-order kinetics and the effect of

temperature on the reaction was described by Arrhenius equations. The rate of these

reactions does not depend on increasing or decreasing reactant concentrations. This

means that the rate constant is equal to the reaction rate. Additionally, this information

will identify the factors affecting sugar quality and the effect of enzymatic treatment on

sugar processing, including the usefulness of rate prediction for the storage conditions

of sugar products.

Recommendations

-

References

Ajandouz, EH., Tchiakpe, LS, Benajiba Puigserver. ( 2001) . “Effects of pH on

caramelization and Maillard reaction kinetics in fructose–lysine model

systems.” Journal of Food Science 66, 7 (September): 926-931.

Asikin, Yonathan., Masami Mizu, Kensaku Takara, Hajime Tamaki, Koji Wada.

( 2014) . “Changes in the physicochemical characteristics and Maillard reaction

products, of non-centrifugal cane brown Sugar during storage.” Food

Chemistry 149, (April): 170-177.

Chen, JCP., Chou CC. (1993). A Manual for Cane Sugar Manufacturers and Their

Chemists. J. Wiley, New York.

Chen, XM., Kitts, DD. ( 2008) . “Antioxidant activity and chemical properties of

crude and Fractionated Maillard reaction products derived from four sugar-

amino acid Maillard reaction model systems.” Ann. N.Y.Acad. Science

1126, 1 (April) 220–224.

Chung, Soo Yeon., Seog Hee Han and Seog Won Lee ( 2012) . “Effect of Maillard

reaction products prepared from glucose–glycine model systems on starch

digestibility.” Starch/Stärke 64, 8 (April): 657–664.

Cocoa, Monica., Teresa Garcia and Gerardo Gonzalez ( 2004) . “Study of coloured

components formed in sugar beet processing.” Food Chemistry 86, 3 ( July) :

421-433.

Cuddihy, JA., Porro ME, and Rauh JS. ( 2001) . “The presence of total polysaccharides

in sugar production and methods for reducing their negative effects”. J. Amer.

Soc. Sugarcane Technology 31, 3 (July): 73-91.



I241

Din, Zia-ud., Ghulam Rasool. ( 2015) . “Physico-Chemical Analysis and Polarization

Value Estimation of Raw Sugar from Refining Point of View.” American

Journal of Plant Sciences 6, 1 (January): 1-5.

Eggleston Gillian. ( 2003) . “Recent developments in the use of oligosaccharides and

mannitol to understand and monitor sugarcane deterioration.” Proc Comm Int

Tech Sucr (CITS) 22, (March): 93-108.

Eggleston, Gillian; Benjamin Legender, Tom, Tew. ( 2004) . “Indicators of freeze-

damaged sugarcane varieties which can predict processing problems.” Food

Chemistry 87, 1 (August): 119-133.

Eggleston, Gillian., Morel du Boil, Walford SN. ( 2008) . “A review of sugarcane

deterioration in the United States and South Africa.” In: Proceedings of the

South African Sugar Technologists Association 81, (July): 72-85.

Figueira, Joelise de Alencar., Priscila Hoffmann Carvalho. ( 2012) . “Sugarcane

starch: quantitative determination and characterization.” Ciênc. Technology

Aliment 31, 3 (September): 806-815.

Godshall, MA. ( 1996) . “Starch, polysaccharide and proanthocyanidin in Louisiana

sugarcane varieties.” International Sugar Journal 98, 1168: 144-148.

Imrie, FK., Tilbury RH. ( 1972) . “Polysaccharides in sugar cane and its products.”

Sugar Technolgy Reviews, 1 (April): 291–361.

Javaid, Gulzar Shaikh., Muhammad Bilal Bhatti. ( 2011) . “To introduce the raw sugar

refinery, its operational concept and quality perspective in Pakistan.” Life

Science, 5 (January): 2053-2062.

Khaddour, Issam., Antonio Ferreira A, Luis Bento, Fernando Rocha. (2012) . “Sucrose

crystal growth in the presence of different molecular weights.” J. Cryst.

Growth. 355, 1 (June):17-25.

Kim, Yeon., Ah, Seung Won Jung, Hye Ri Park, Ku-Young Chung, Seung Ju Lee.

( 2012) . “Application of a prototype of microbial time temperature indicator

(TTI) to the prediction of ground beef qualities during storage.” Korean

Journal Food Science 32, 4: 448–457.

Kitts, David., Chun Hu. ( 2005) . “Biological and chemical assessment of antioxidant

activity of sugar-lysine model maillard reaction products.” Ann. N.Y. Acad.

Science 1043, 1 (January): 501–512.

Martins, Sara., Wim Jongen, Van Boekel, M. ( 2000) . “A review of Maillard reaction

in food and implications to kinetic modelling.” Trends in Food Science &

Technology 11, 9-10 (September): 364-373.

Martins, Sara., Van Boekel. (2005) . “A kinetic model for the glucose/glycine Maillard

reaction pathways.” Food Chemistry 90, 1 (March): 257–269.

Martins, RC., and CLM Silva. (2003). “Kinetics of frozen stored green bean (Phaseolus

vulgaris L.) quality changes: Texture, vitamin C, reducing sugars, and

starch.” Food Science 68, 7 (September): 2232–2237.

Mohr W, Roehrle D, Severin T. ( 1971) . “The formation of Cocoa flavor from the

precursors.” Fette Seifen An-strichsm 73, 1 (November): 515-521.

Morrison, William., and Bernard Laignelet, B. ( 1983) . “An Improved Colorimetric

Procedure for Determining Apparent and Total Amylose in Cereal and Other

Starches.” Journal of Cereal Science 1, 1 (January): 9-20.

Nelson, N. (1944). J. Biol. Chem. 153:375-380.



I242

Nursten, Harry., ( 2005) .“The Maillard reaction: Chemistry, biochemistry, and

implications.” Cambridge: Royal Society of Chemistry.

Peleg, Micha., Pobert Engel, Consuelo Gonzalez-Martinez, and Maria Corradini.

( 2002) . “Arrhenius and non-WLF kinetics in food systems.” J. Science Food

Agriculture 82, 12 (August): 1346–1355.

Perez, Serge., Paul Baldwin, and Daniel Gallant (2009). “Structural Features of Starch

Granules” Starch (3rd ed.) San Diego: Academic Press.

Quintas, M., Branda Otrs. (2007). “Modelling autocatalytic behaviour of a food model

system– sucrose thermal degradation at high concentrations.” Journal of Food

Engineering 78, 2 (January): 537–545.

Rodinava, OE., AL Pomerantesev. (2005). “Estimating the parameter of the Arrhenius

equation.” Kinetic Catalyse 46, 3: 305-308.

Saska, Michael., V. Kochergin. ( 2009) . “Quality changes during storage of raw and

VLC sugar: Effects of pH and moisture.” International Sugar Journal 111,

1324 (April):234-238.

Schaefer, Joachim., Geoffrey Lee. ( 2015) . “Arrhenius activation energy to catalase

during spay-drying.” Int. J. Pharm 489, 1-2 (July): 124-130.

Schoones, BM. (2006). “The use of α-amylase to control starch levels in South African

cane sugar Factories.” Proceedings of the International Society of Sugar

Cane Technologists Processing Workshop, Baton Rouge, U.S. Souza, Paula Monteiro., Pérola de Oliveira e Magalhães ( 2010) . “Application of

microbial amylase in industry–a review” Brazilian Journal of Microbiology

41, 4 (October): 850-861.

Straathof, AJJ., Adlercreutz, P. ( 2000) . “Applied Biocatalysis.” Harwood Academic

Publishers, Amsterdam.

SPRI. ( 2002) . “A rapid starch test for use in cane mills.” Technical Report No SPRI

2002, October, Sugar Processing Research Institute.

Van Boekel. ( 1996) . “Statistical aspects of kinetics modelling for food science

problems.” Journal of Food Science 61, 3 (May): 477-485.

Vignes, EC. (1974). “Notes on Cane Starch and its Determinations.” Proc. ISSCT 15:

1288-1295.

Villota, Ricardo., James Hawkes. ( 1992) . “Reaction kinetics in food systems.”

Handbook of food engineering 93-114.

Zhou, M., Kimbeng, CA, Gillian Eggleston, Veremis, JC, and Gravois K. (2008).

“Issues of starch in sugarcane processing and prospects of breeding for low

starch content in sugarcane.” Sugar Cane International 26, 3 (May): 3–12.



I243

Emissions of Major Air Pollutants from Charcoal Meat Grilling

Author: Nares Chuersuwan and Saranya Manatsakarn

Program in Environmental Pollution and Safety, School of Environmental Health,

Suranaree University of Technology

Abstract

This study estimates the emissions of criteria air pollutants (CO, NOx, SO2

and PM) and two greenhouse gases, CO2 and CH4, from charcoal meat grilling

activities. The emissions were quantified real-time in the experiment chamber using

eucalyptus charcoal as the fuel, with the exception of point measurements of PM and

CH4. All fifteen types of meat released high concentrations of CO, NOx and CO2 during

the flaming stage while CH4 concentrations were varied depending on the types of meat.

The average of emission rate of meat grilling ranged from 115.58±5.95 to 180.39±29.43

ppm/s for CO, 0.020±0.014 to 0.345±0.193 ppm/s for NOx, 841.31±12.66 to

1,569.63±324.86 ppm/s for CO2, 0.23±0.005 to 0.47±0.17 ppm/s for CH4. The

dominant size of PM emitted during meat grilling was between 0.4 and 0.7 μm, while

the emission rate of particulate matter ranged from 2.19±0.81 to 9.35±1.88 µg/s except

shrimp, squid, and meatball grilling provided the dominant size of 9.0-10 μm, with the

emission rate of particulate matter ranged from 2.53±0.78 to 4.13±0.90 µg/s. SO2 was

not detected in all samples. Measuring and monitoring real-time emissions yielded the

emission factors from charcoal meat grilling. The average emission factors of CO, NOx,

CO2, and CH4 were in the ranges of 13.53±4.12 to 121.11±11.05, 0.004±0.005 to

0.084±0.062, 153.16±47.27 to 1,541.42±214.58, and 0.75±0.06 to 6.07±2.15 g/MJ,

respectively. The average emission factor of PM10 ranged from 0.15±0.04 to 1.98±0.57

mg/MJ.

Keywords: charcoal meat grilling, major air pollutants, real-time measurement,

emission rate, emission factors.

Introduction

Under rapid expansion of industry and commerce included social change,

lifestyle and dietary habits of people change accordingly. The street food stalls can be

counted as an integral component of urban economy in Thailand. They are convenient

for consumers with accessible retail options. The street food stalls are very common

along the urban streets. Charcoal is the primary fuel for grilling foods. Meat grilling is

very popular among the food stalls but charcoal meat grilling emitted air pollutants into

the atmosphere. Charcoal meat grilling was found to be a significant source of

particulate matters (PM), carbon dioxide (CO2), carbon monoxide (CO), nitrogen

oxides (NOx), volatile organic compounds (VOCs), aldehyde, polycyclic aromatic

hydrocarbons (PAHs), and total hydrocarbons (THC) (Sung et al., 1997; U.S. EPA,

1999; Nordica, 2008; Ehsanul et al., 2011). Charcoal combustion have impact on

human, particularly in large cities where number of street food stalls is high and

increasing hazard of the nearby people exposed to pollutants with potential health risks

(Pandey, 2009). The most important environmental problem connected with charcoal

burning is the high probability of incomplete combustion. CO is one of the primary

products of incomplete combustion while NOx is produced when combustion



I244

temperatures reach high enough level to burn nitrogen in the air (Harshika, et al., 2014).

Moreover, charcoal meat grilling has the potential to produce net global warming

especially CO2, the main driving force for the past global climate change (Zhang et al.,

2000; Andreae et al., 2001; IPCC, 2001). CO is considered an indirect greenhouse gas

due to its close coupling to atmospheric methane (Khalil and Rasmussen, 1985; Metz

et al., 2007)

Real-time measurement, emission rate, and emission factors are normally

used to estimate the emission from charcoal meat grilling. These studies were focused

on real-time measurements, emission rate, and emission factors for the criteria gas pollutants including particulate matters from different size ranges emitted from grilling

activities commonly found on of streets.

Objectives

1) To quantify criteria air pollutants emitted from grilling activities similarly

to the street food stalls.

2) To develop local emission factors for the criteria air pollutants in Thai’s

context.


Source of experimental material

Fifteen types of meats were used in this study. All meat were used in the

experiment were purchased locally from markets in the area, i.e., pork, chicken, fish,

Thai sausage, Thai sour pork, seafood, and meatball. Charcoal derived from eucalyptus

woods was used exclusively as the solely fuel. Charcoal was also purchased from local

production. Table 1 shows details on variety of meat, range of wet weight for meat,

amount of fuel and grill time for charcoal meat grilling.

Table 1 Types and amount material for charcoal meat grilling

Meat Initial wet weight

(Range) (g/stick) Grill time (min)

Pork 35-55 20

Chicken 44-63 20

Chicken wing 34-63 20

Chicken liver 65-120 20

Catfish 340-450 20

Ruby fish 430-540 20

Tilapia 450-720 20

Shrimp 55-62 15

Squid 23-37 15

Thai sausage 31-52 20

Thai sour pork 75-97 20

Meatball 43-59 15

Pork ball 32-61 15

Fish ball 32-70 15

Chicken ball 38-53 15



I245

Experimental design

The experiment were achieved by using combustion testing equipment,

schematically explained in Figure 1. The combustion testing equipment has been

designed and installed in a laboratory at Suranaree University of Technology. The

equipment is an inverted funnel with a cylinder bottom, 1.20 m in diameter and 0.80 m

in high. From the top of the cylinder, the tower decreases to 0.28 m in a length of 0.50

m, and is topped with a stack 1.70 m in height. Surface area of the stack is 0.03 m2. The

lowest position of the testing equipment is the aluminum rectangular box, used to

collect the ash obtained from combustion. The size of aluminum rectangular box is 0.50

m x 0.50 m. Meats were grilled on an aluminum mesh screen, 0.40 m. x 0.47 m. A gas

sampling point was at 0.50 m. below the top funnel. Temperatures and velocity of

airflow was measured at the same location.

Gas and particulate matter sampling

All measurements of CO, CO2, SO2, and NOx, were performed by a Testo

350 (Testo AG, Germany). The instrument was a brand new and factory calibrated prior

to the experiment. The probe was inserted inside the stack to measure gas

concentrations. Probe direction was laminar flow. The instrument was set to record

every 5 second of CO, CO2, SO2, and NOx concentrations. The Testo easyEmission®

software was used as the interface.

Grab sample was used for collecting methane gas in-stack. The samples were

sampling every 3 minutes using a polypropylene syringe and were transferred into

separated gas sampling bags (Tedlar® bag), about 200 ml in each bag. Methane was

quantified by a GC-FID (Agilent 7890A, USA). The GC was calibrated daily with a

standard CH4 gas (certified at 19.5 ppm, Air Liquid, Thailand). All gas sample bags

were analyzed within 24 h in the laboratory. All gas sampling bag used in each

experiment were flushed adequately with compressed clean air for at least three times

and evacuated prior use.

The particle mass concentrations were collected in-stack using the ANDERSEN

eight-stage impactor (Gresby-Anderson, USA). The impactor separated particles into

different aerodynamic diameters (Da) (<0.4, 0.4-0.7, 0.7-1.1, 1.1-2.1, 2.1-3.3, 3.3-4.7, 4.7-

5.8, 5.8-9.0, and 9.0-10.0 μm) at a flow rate of 28.3 L/min.

Experimental process

The background concentrations of test gases were also measured routinely

for 5 minutes at the beginning of each test. Prior to each grilling test, meats, charcoal,

and aluminum foil were pre-weighted with an analytical balance and recorded all the

weights. Aluminum pan was placed underneath to collect remaining ash. Charcoal

weighted about 700 g for each test and placed in the bottom of an aluminum mesh

screen. Another electronic balance, Mettler Toledo (MS32001L), was placed under the

combustion equipment and connected to a computer to record real-time mass changes.

The LabX™ software was used as the interface to continuously monitor the mass.

Emissions were recorded until the combustion was finished. Gas velocity in stack (m/s),

temperature (°C), sampling time (min), and weight loss (g) were also continuously

measured and recorded. All the grilling activities were ventilated naturally. Ash was

left at room temperature to cool down before weighted and recorded the remaining

mass. The total sampling time was 20 minutes each, except seafood and meatball



I246

grilling was 15 minutes. The combustion was separated into 3 stages, ignition of

charcoal around 3 min, smoldering at the following 7-10 min and 10 min flaming.

Emission rates and emission factors of these combustion pollutants were calculated

based on the results.

Data analysis

The emission rate (ER, ppm/s) and emission factor (EF, g/MJ) of the air

pollutants from charcoal meat grilling were calculated by Eqs. (1), (2), and (3),

respectively.

t

C

ER

n

1i

i (1)

where: Ci is air pollutant concentration (ppm), i is the initial sampling time (s), n is the

final sampling time, t is sampling time (s).

fuel

iPM

M

MEF (2)

where: EFPM is the emission factor of particulate matter (mg/kg or g/kg), Mi is the mass

of emitted particles on the filter (mg or g), Mfuel is the mass of fuel consumed (g or kg).

dt22.4

wuCA

m

10E i

i

t

t

s

fd

3

i

f

o

(3)

where: Ei is the emission factor of gas i (g/kg), mfd is the mass of burned material (g),

t0 is the starting time accounted from fuel ignition (s), tf is the finishing time of burn

(s), As is the surface area of the stack (m2), u is the velocity of gas in the stack (m/s), Ci

is the concentrations of measured gas i (ppm), wi is the molecular weight of measured

gas i (g/g-mol).

Emission factors of gases and particulate matter were expressed in terms

of mass of pollutant per energy input, which can be derived from dividing the emission

factors of gases and particulate matter (in mass basis) by the fuel heating value, to obtain

emission factors in the unit of mg/MJ or g/MJ.



I247

Figure 1 Schematic illustration of the combustion testing equipment

Results/Conclusions

Real-time measurements. Charcoal meat grilling showed three general combustion

stages included (1) after 1 min of ignition (ignition stage), (2) after about 3 minutes, the

charcoal glowing red and flames starting to flicker the over top of charcoal (smoldering

stage), (3) and then a relatively steady condition (flaming stage). In this study, the

ignition stage had the shortest duration and flaming stage had the longest duration.

Figure 2 illustrates these three stages with real-time data from Thai sour pork grilling.

Gas emissions increased rapidly during ignition stage. A large quantity of CO, and CO2

were generated during smoldering stage and further increased during the flaming stage

while NOx emissions gradually increased in ignition stage. During smoldering stage,

NOx generated rapidly and further increased during the flaming stage. In contrast, CH4

concentrations emitted from meat grilling activities showed inconsistent patterns.

Emission rate. CO emissions during ignition stage increased rapidly at the rate of about

29.54±14.46 to 125.33±29.96 ppm/s. A large quantity of CO were generated during

smoldering stage at the rate of about 98.53±29.07 to 174.41±21.56 ppm/s and further

increased during the flaming stage at the rate of about 153.32±30.74 to 212.63±14.67

ppm/s. At the ignition stage, NOx emissions gradually increased at the rate of

0.002±0.002 to 0.064±0.065 ppm/s for eight types of meat grilling while seven types

of meat grilling was unable to detected NOx, possibly due to lower temperature during

combustion. During smoldering stage, NOx was generated more rapidly at the rate of

0.012±0.010 to 0.111±0.029 ppm/s for twelve types of meat grilling and further

0000.00 g

Charcoal

Meat

PM

CH4

CO, NOx, SO2, CO2



I248

increased during the flaming stage at the rate of 0.040±0.027 ppm/s to 0.533±0.295

ppm/s. Three types of meat grilling were unable to detected NOx. In all samples, CO2

increased quickly for 3 min after ignition and increased gradually until the end. The

rate of CO2 concentrations at the ignition stage, smoldering stage and flaming stage

were 251.39±145.28 to 846.89±177.43 ppm/s, 746.81±124.51 to 1,303.48±216.50

ppm/s, and 1,237.53±441.50 to 1,972.77±78.81 ppm/s, respectively. The rate of CH4

concentrations at the ignition stage, smoldering stage and flaming stage were 0.32±0.15

to 1.00±0.28 ppm/s, 0.25±0.04 to 0.43±0.11 ppm/s, and 0.17±0.05 to 0.40±0.09 ppm/s,

respectively. Figure 3 shows comparison emission rate of CO, NOx, CO2, and CH4 from

different type of meat grilling. The rate of emissions for difference type of meat grilling

is shown in Table 2. Table 3 shows the emission rate of particulate matter, the most

dominant size of particle emitted during meat grilling was size between 0.4-0.7 μm in

the range of 2.19±0.81 to 9.35±1.88 µg/s except grilling shrimp, squid, and meatball

the most dominant size of particle was 9.0-10 μm in the range of 2.53±0.78 to 4.13±0.90

µg/s.

Calorific value. The results of calorific value from charcoal derived from eucalyptus

woods was determined by calculating the heat provided by the combustion of a

specified quantity of the sample product in a bomb calorimeter. The average calorific

value of the charcoal was 28.55 MJ/kg.



I249

0.00

0.50

1.00

1.50

2.00

2.50

3.00

3.50

4.00

4.50

5.00

NO

xco

nce

ntr

ati

on

(p

pm

)

NOx

0

1000

2000

3000

4000

5000

6000

7000

8000

9000

10000

11000

12000

13000

14000

CO

2co

ncen

tra

tion

(p

pm

)

0

10

20

30

40

50

60

70

80

90

100

110

120

130

140

0

60

120

180

240

300

360

420

480

540

600

660

720

780

840

900

960

1020

1080

1140

1200

CH

4co

ncen

tra

tion

(p

pm

)

Figure 2 Example of real-time behavior for CO, NOx, CO2, and CH4 emissions during

Thai sour pork grilling activities

0

100

200

300

400

500

600

700

800

900

1000

1100

1200

1300

1400C

O c

on

cen

tra

tion

(p

pm

)

CO

Smoldering stage Flaming stageIgnition

stage

Time (Sec)

0

0

0



I250

Table 2 Emission rate of air pollutants for different types of meat grilling with charcoal.

Meat Stage

Average Emission rate (ppm/s) ±SD

CO NOx CO2 CH4

Pork

Whole stage (0-20 min)

Ignition stage (0-3 min)

Smoldering stage (3-10 min)

Flaming stage (10-20 min)

153.03±12.86

74.34±40.27

146.45±18.93

181.25±6.82

0.261±0.192

0.025±0.024

0.233±0.207

0.351±0.232

1,519.06±324.86

594.13±232.51

1,303.44±364.62

1,947.48±357.78

0.31±0.07

0.87±0.40

0.25±0.04

0.19±0.07

Chicken





167.45±8.59

93.49±10.64

154.18±13.05

198.93±9.78

0.345±0.193

0.060±0.050

0.199±0.126

0.533±0.295

1,569.63±101.34

846.89±177.43

1,303.48±216.50

1,972.77±78.81

0.25±0.03

0.40±0.24

0.27±0.04

0.20±0.02

Chicken

wing





159.26±19.60

85.78±17.61

145.69±26.58

190.80±28.58

0.248±0.091

0.064±0.065

0.150±0.082

0.372±0.137

1,370.44±141.85

731.67±106.15

1,150.71±202.26

1,715.88±199.98

0.26±0.07

0.58±0.37

0.27±0.06

0.17±0.05

Chicken

liver





166.13±5.95

94.47±40.41

172.84±17.98

182.93±12.53

0.190±0.188

0.019±0.018

0.147±0.212

0.272±0.239

1,392.46±12.66

576.02±210.20

1,240.20±117.32

1,743.97±69.68

0.42±0.03

0.85±0.23

0.43±0.11

0.28±0.05

Catfish





126.40±10.32

39.89±20.86

103.43±21.66

168.43±6.19

0.038±0.026

ND

ND

0.075±0.051

1,120.22±165.37

251.39±145.28

755.98±157.92

1,635.83±222.89

0.23±0.17

0.41±0.23

0.36±0.06

0.33±0.06

Ruby

fish





130.96±9.83

43.14±12.77

115.95±14.76

167.81±17.74

0.020±0.014

ND

ND

0.040±0.027

1,095.76±137.86

399.68±42.17

832.45±143.05

1,488.90±201.87

0.30±0.03

0.38±0.12

0.30±0.04

0.29±0.06

Tilapia





135.44±25.64

33.03±11.60

112.62±40.18

182.15±31.21

0.051±0.025

0.002±0.002

0.036±0.020

0.077±0.036

1,217.95±169.76

341.22±191.16

991.86±227.10

1,639.23±202.57

0.30±0.06

0.32±0.15

0.33±0.06

0.28±0.06

Shrimp





170.02±15.36

102.65±26.10

172.10±19.34

207.54±10.98

0.065±0.053

ND

0.024±0.023

0.161±0.143

1,350.51±119.44

744.51±122.96

1,289.15±117.31

1,800.00±191.79

0.47±0.12

0.93±0.28

0.38±0.13

0.32±0.10

Squid





152.64±12.24

86.50±39.39

155.73±16.59

188.01±24.78

0.071±0.031

0.005±0.006

0.055±0.021

0.134±0.068

1,316.44±135.16

672.50±309.25

1,245.57±204.45

1,802.04±121.08

0.45±0.14

0.85±0.22

0.39±0.17

0.29±0.12

Thai

sausage





115.58±20.35

29.54±14.46

98.53±29.07

153.32±30.74

0.029±0.010

ND

ND

0.058±0.021

1,065.08±190.91

310.00±146.66

797.26±210.94

1,479.08±235.89

0.34±0.005

0.42±0.12

0.37±0.07

0.29±0.05

Thai

sour

pork





180.39±29.43

112.22±16.37

174.41±21.56

205.03±47.02

0.119±0.063

0.023±0.016

0.111±0.029

0.155±0.106

1,359.52±124.30

680.14±49.20

1,170.77±136.10

1,695.46±186.53

0.45±0.10

0.97±0.48

0.39±0.11

0.33±0.15

Meatball





173.93±19.99

125.33±29.96

173.69±22.42

203.43±32.09

0.053±0.023

ND

0.036±0.024

0.109±0.050

1,395.91±197.63

785.99±172.65

1,341.88±218.84

1,837.52±233.13

0.47±0.11

1.00±0.28

0.37±0.10

0.29±0.13

Pork ball





157.97±23.88

91.20±29.96

156.09±33.46

200.68±13.18

0.057±0.030

0.006±0.003

0.044±0.028

0.105±0.060

1,090.56±213.30

593.68±185.17

1,020.21±239.87

1,487.17±215.04

0.46±0.07

0.76±0.17

0.38±0.08

0.40±0.09



I251

Table 2 Emission rate of air pollutants for different type of meat grilling with charcoal

(Continued).

Meat Stage

Average Emission rate (ppm/s) ±SD

CO NOx CO2 CH4

Fish ball Whole stage (0-15 min)




170.27±6.63

103.37±12.67

168.68±5.06

212.63±14.67

0.035±0.015

ND

0.014±0.012

0.084±0.032

1,316.62±212.76

683.89±61.78

1,217.83±223.40

1,834.56±307.14

0.46±0.05

0.92±0.14

0.36±0.05

0.33±0.08

Chicken

ball





134.59±21.16

64.94±30.90

128.03±16.24

185.57±27.67

0.033±0.029

ND

0.012±0.010

0.084±0.074

841.31±195.94

401.44±71.23

746.81±124.51

1,237.53±441.50

0.40±0.08

0.64±0.41

0.34±0.06

0.35±0.16

(a) (b)

(c) (d)

Figure 3 Emission rates of CO, NOx, CO2, and CH4 from different types of meat grilling



I252

Table 3 Emission rate of particulate matter for different type of meat grilling with charcoal.

Meat Average emission rate of particulate matter (µg/s) ±SD

9.0-10 µm 5.8-9.0 µm 4.7-5.8 µm 3.3-4.7 µm 2.1-3.3 µm 1.1-2.1 µm 0.7-1.1 µm 0.4-0.7 µm <0.4 µm

Pork 2.93±0.28 2.17±0.22 1.79±0.58 2.16±0.16 1.95±0.27 2.10±0.11 3.32±1.05 6.76±2.91 2.56±1.02

Chicken 2.87±0.44 2.39±0.28 2.17±0.33 2.02±0.32 2.05±0.23 2.58±0.68 3.86±1.27 9.11±2.45 3.10±1.64

Chicken wing 3.50±0.52 2.55±0.52 2.21±0.38 2.14±0.53 1.88±0.54 2.49±0.58 3.50±0.72 9.35±1.88 2.65±1.73

Chicken liver 2.09±0.16 1.80±0.27 1.76±0.16 1.64±0.29 1.42±0.36 1.39±0.31 1.78±0.62 3.08±0.72 1.07±0.46

Catfish 2.29±0.30 2.24±0.29 1.76±0.11 1.76±0.05 1.69±0.33 1.36±0.18 2.08±0.63 3.89±1.06 1.01±0.15

Ruby fish 1.62±0.27 1.37±0.20 1.06±0.19 1.05±0.22 0.90±0.23 1.05±0.29 1.90±1.05 2.90±1.30 0.54±0.32

Tilapia 2.08±0.30 1.71±0.51 1.71±0.24 0.14±0.29 1.21±0.30 1.54±0.79 1.99±0.68 4.08±1.37 0.55±0.09

Shrimp 4.13±0.90 2.99±1.08 3.35±1.00 2.95±0.83 2.77±1.06 1.76±0.96 2.17±0.55 3.38±1.56 1.42±0.65

Squid 3.45±1.51 3.39±1.43 2.88±1.58 3.32±1.85 2.35±1.46 2.13±1.31 2.05±1.17 3.00±1.00 1.52±0.76

Thai sausage 2.94±0.83 2.61±0.84 2.18±0.60 1.98±0.93 1.71±0.67 1.98±0.38 3.65±2.90 5.12±2.68 1.25±0.86

Thai sour pork 3.09±0.67 2.69±0.59 1.79±0.24 1.96±0.58 1.95±0.44 2.58±0.65 3.42±1.06 5.86±1.55 1.04±0.16

Meatball 2.53±0.78 2.27±0.89 2.12±0.72 2.08±0.79 1.78±0.69 1.90±0.99 1.28±0.43 1.94±0.34 0.87±0.45

Pork ball 2.18±0.51 2.08±0.48 1.81±0.35 1.63±0.45 1.60±0.38 1.35±0.29 1.84±0.46 2.48±0.81 0.68±0.26

Fish ball 2.29±0.27 1.71±0.55 1.53±0.42 1.43±0.31 1.25±0.63 1.20±0.40 1.60±0.50 2.72±0.99 0.52±0.21

Chicken ball 1.92±0.45 1.74±0.41 1.27±0.29 1.31±0.49 0.99±0.39 0.99±0.32 1.50±0.28 2.19±0.81 0.35±0.26



I253

Emission factor. Table 4 shows the emission factors of particulate matter and gases

from charcoal meat grilling, expressed as mass of emitted pollutant divided by the units

of energy (g/MJ). It was found that among fifteen meats, grilling shrimp had the highest

emission factors of CO, PM10, CO2, and CH4 while grilling the chicken had the highest

emission factor of NOx. The average emission factors ranged from 13.53±4.12 to

121.11±11.05 for CO, 0.004±0.005 to 0.084±0.062 for NOx, 153.16±47.27 to

1,541.42±214.58 for CO2, and 0.75±0.06 to 6.07±2.15 g/MJ for CH4. The average

emission factor of PM10 ranged from 0.15±0.04 to 1.98±0.57 mg/MJ.

Table 4 Emission factors of particulate matter and gaseous from charcoal meat grilling.

Meat

Emission factors ±SD

CO

(g/MJ)

NOx

(g/MJ)

PM10

(mg/MJ)

CO2

(g/MJ)

CH4

(g/MJ)

Pork 32.02±5.74 0.052±0.033 0.50±0.11 508.02±93.63 1.44±0.47

Chicken 36.51±5.54 0.084±0.062 0.46±0.07 501.86±112.62 1.10±0.35

Chicken wing 31.70±11.23 0.075±0.032 0.55±0.12 425.51±145.43 0.75±0.06

Chicken liver 37.30±12.29 0.051±0.048 0.32±0.08 452.98±107.86 1.49±0.62

Catfish 24.28±6.75 0.016±0.010 0.32±0.04 332.94±95.90 1.27±0.43

Ruby fish 19.89±5.11 0.010±0.000 0.15±0.04 250.40±64.32 0.86±0.20

Tilapia 26.32±11.36 0.020±0.018 0.22±0.04 337.85±145.61 1.05±0.38

Shrimp 121.11±11.05 0.060±0.063 1.98±0.57 1,541.42±214.58 6.07±2.15

Squid 25.35±7.40 0.027±0.022 0.38±0.15 337.85±97.09 1.39±0.16

Thai sausage 57.85±16.70 0.033±0.025 0.84±0.34 797.14±215.33 2.85±0.45

Thai sour pork 40.79±10.44 0.031±0.017 0.41±0.09 453.91±97.46 1.74±0.32

Meatball 23.11±1.33 0.013±0.006 0.21±0.07 292.06±41.01 1.14±0.14

Pork ball 15.79±2.88 0.007±0.007 0.18±0.02 171.32±31.16 0.92±0.25

Fish ball 34.75±3.77 0.016±0.008 0.28±0.07 383.87±138.23 1.50±0.23

Chicken ball 13.53±4.12 0.004±0.005 0.17±0.06 153.16±47.27 0.91±0.19

Discussion

Real-time measurement data were capable of identifying emission of criteria

air pollutants from charcoal meat grilling and shows that the emission varied from

stages of combustion. Grilling activity of Thai sour pork had higher emissions of CO

than other kinds of meats while grilling chicken had the highest emissions of NOx and

CO2. Grilling shrimp showed the highest emissions of CH4 and PM10. Incomplete

combustion from charcoal meat grilling led to high concentration of CO and led to low

concentrations of NOx and PM. Observation showed that the liquid content, probably

fat content of meats, dripping on the fuel during combustion caused high CO and NOx

concentrations. The results showed that all of meat grilling activities with the

eucalyptus charcoal was not associated with SO2 emission due to fuel and meats used

in the experiments have negligible sulfur content.

Recommendations

Future measurements may exclude SO2 from the similar experiments and

further study should be used charcoal derived from other wood for meat grilling

activity.



I254

References

Andreae, MO., and Merlet, P. (2001). “Emission of trace gases and aerosol from

biomass burning.” Global Biogeochemical Cycles, 15 (December): 955-

956.

Ehsanul, K., Ki-Hyum, K., and Yoon., HO. (2011). “Trace metal contents in barbeque

(BBQ) charcoal products.” Journal of Hazardous Materials, 185

(January): 1418-1424.

Harshika, K., Avinash, Chandra., and Kaushik, S.C. (2014). “Comparative study on

emissions from traditional and improved biomass cookstoves used in

India.” International Journal for Research in Applied Science and

Engineering Technolog, 2 (August): 249-257.

IPCC (2001). Third assessment report climate change 2001. The scientific basis.

Cambridge University Press.

Khalil, M.A.K., and Rasmussen, R. A. (1985). “The behavior of trace gases in the

troposphere.” Science of The Total Environment, 48 (February): 169-

186.

Metz, B., Davidson, O.R., Bosch, P.R., Ave, R., and Meyer, L.A. (2007).

“Contribution of Working Group III to the Fourth Assessment Report of the

Intergovernmental Panel on Climate Change.” 499-540.

Nordica, M., Damon, M., Dean, S., Tami, B., and Christoph, R. (2008). “A laboratory

comparison of the global warming impact of five major types of biomass

cooking stoves.” Energy for Sustainable Development, 12 (June): 56-65.

Pandey, SK., Kim, KH., Kang, CH., Jung, MC., and Yoon, H. (2009). “BBQ charcoal

as an important source of mercury emission.” Journal of Hazardous

Materials, 162 (February): 536–538.

Sung, B., Kim, YS., and Perry, R. (1997). “Indoor air quality in homes, offices and

restaurants in Korean urban areas-indoor/ outdoor relationship.”

Atmospheric Environment, 31 (February): 529-544.

U.S. EPA. (1999). “U.S. Environmental Protection Agency, Emissions from Street

Vendor Cooking Devices (Charcoal Grilling).” Washington, DC: U.S.

Environmental Protection Agency. June.

Zhang, J., Smith, K.R., Ma, Y., YE, S., Jiang, F., Qi, W., Liu, P., Khalil, M.A.K..,

Rasmussen, R.A., and Thorneloe, S.A. (2000). “Greenhouse gases and

other pollutants from household stoves in China: a database for emission

factors.” Atmospheric Environment. 34 (August): 4537-4549.



I255

Study of spray processing parameters and coating thickness of silica

hard coating film on polymethyl ethacrylate (PMMA) sheets

Author: Taksorn Jirathampradhab, Toemsak Srikhirin

Materials Science and Engineering Program, Multidisciplinary Unit,

Faculty of Science, Mahidol University

Abstract

To improve scratch-resistant property of transparent plastics such as

polymethyl methacrylate (PMMA), the hard coating film will be used as a protective

layer on the top of plastic surface. The hard coating is fabricated from a mixture of

silica nanoparticles and methyltrimethoxysilane (MTMS) via sol-gel process. The

effect of airbrush spray coating parameters of the nanocomposites hard coating film on

PMMA substrate will be investigated. The spray coating parameters including air

pressure and nozzle to substrate were effect on film formation. The effect of the

spraying coating on the film thickness, coating morphology and coating quality will be

investigated. The pencil hardness and adhesion strength between coating layer and

PMMA substrate with different coating thickness were reported.

Key Word (s): Spray deposition, Nanocomposite, Silica nanofiller

Introduction

Transparent plastic material is the materials that can transmit the visible

spectrum greater than 80%. It has been used to replace glass in many applications such

as window, building wall, display panels and optical devices. They are many

advantages over the glass in term of cost efficiency, machinability, thermoform ability

and safety. Transparent plastics are used primarily when the clarity of vision through

the material is concerned. They rarely stay perfectly transparent due damage from

abrasion and scratch during uses (M.S. Lee et al. 2002, L. Y.L. Wu et al. 2008). This is

a major drawback that limits the use of transparent plastic materials. Many researchers

create the hard coating film applied as the preventive layer on the substrates that

required optical clarity, durability and weathering resistant. The silica nanocomposites,

prepared by sol-gel processing, is the one of the widely used hard coating formulation

because they can be formulated at relatively low temperature (R. S.R. Kalidindi et al.

2014). The fabrication can be carried out by applying the coating solution on substrates

and cure. The pencil-hardness and cross-hatch adhesion tape test are used to evaluate

the hardness and cross-hatch adhesion tape test are used to evaluate the hardness and

adhesion of the hard coating film.

Previously our silica-MTMS nanocomposites hard coating formulation was optimized

for a dip coating process (R. Chantarachindawong et al. 2014, S. Yodmongkol et al.

2014, P. Kamonwanon et al. 2015) to improve the scratch resistant of PMMA



I256

substrates. There is an interest in applying the hard coating onto an object with complex

shape where complex shape where the dip coating is not suitable. Therefore, the spray

coating is being considered in this work.

Spray coating technique is the simple process that can be used on flat surface and

complex shape articles (H.S. Hwang et al. 2004). It is the process that widely used for

applying the coating for industrial applications. Spray coating technique allow the ease

of thickness control and single side deposition. The coating thickness is an important

factor that affected the coating film properties. Residual tensile stress and film

shrinkage were as the major problems for the thick coating film (M.A. Aegerter et al.

2004, R. M. Almeida et al. 2005).

In this report, we use spray coating equipped with a double action bottom

feed airbrush gun and with the nozzle outlet diameter of 0.35 mm for apply the

nanocomposite hard coating on PMMA sheets to study the effect of spray coating

process parameters and coating thickness on film formation, coating film hardness and

adhesion strength between hard coating film and PMMA substrates.

Objectives

1) To fabricate nanocomposite hard coated PMMA using spray deposition

process.

2) To study the effect of spray coating process parameters on film formation.

3) To study the effect of coating thickness on film hardness and adhesion

strength.


The nanocomposites hard coating formulation was prepared according to

our previous report (R. Chantarachindawong et al. 2014, S. Yodmongkol et al. 2014, P.

Kamonwanon et al. 2015). Firstly, methyltrimethoxysilane (MTMS) was hydrolyzed

with glacial acetic acid. Colloidal silica nanoparticles with average diameter range of

20 nm was added as a nanofiller and stirred for 4 hrs. Acetone and dowanol PM were

used as mix solvent to adjust the viscosity of coating solution and to control the

evaporation rate of the coating.

PMMA sheets (Thai MMA CO., LTD. Thailand) were use as substrates.

Before coating deposition, PMMA sheets were cut into 5x5 cm2 wiped by iso-propyl

alcohol soaked on cleanroom paper. The hard coating solution was applied on the

PMMA substrate by spray coating using airbrush spray nozzle outlet diameter 0.35 mm

(Type BD800AK, Siam Global Group CO., LTD. Thailand). The airbrush gun was set

in vertical plane from the PMMA substrate and spray coating process parameters was

optimized by varied the air pressure and nozzle to substrate distance as shown in figure

1. The air pressure was varied between 1 to 3 bar and the nozzle to substrate distance

were varied from 5 to 15 cm. The different coating thickness can be controlled by varied



I257

the spray deposition time on constant substrates dimension. After spray coating

deposition, the coating layers were cured in hot air oven at 80 ºC for 3 hrs.

The coating film morphology and thickness were observed by scanning

electron microscope (Model TM1000, Hitashi, Japan) on the surface and along the

cross-sectional plane. The adhesion tape test was measured follow the standard ASTM

D3359. The 10x10 grids were patterned with eleventh cross-cut on coating layer to

substrate. The pressure-sensitive tape is applied over the grid and then removed rapidly.

The adhesion level is evaluated by counted the adhered area. The pencil-hardness

results were evaluated according to standard ASTM D3363. The coated surface was

placed on a firm horizontal surface. The pencil lead was held against the coating film

at a 45º angle and put away from the operator with 1 kg loading and consider the

cracking damage by pencil lead on the coating films.

Figure 1. Schematic diagram of the spray coating apparatus.

Results / Conclusion

The hybrid silica nanocomposites hard coating was applied on PMMA

substrates by spray coating deposition. The effect of spray coating parameters was

studied in order to find the optimum condition. Figure 2 show the SEM micrographs of

hard coating surface morphology and uniformity with different spray coating process

parameters include air pressure from 1-3 bar and nozzle to substrate distance from 5-

15 cm. In this part, we fix spray duration time at 20 seconds applied on fixed constant

substrate dimension. The adhesion was reported along with the film appearance for the

ease of visualization.



I258

Figure 2. SEM micrograph of hard coating layer on PMMA substrates with different

spray coating process parameters.

At air pressure of 1 bar, we obtained good film formation with every nozzle

to substrate distance (5-15 cm) but adhesion strength is unacceptable. At 3 bar, the

contamination from surrounding was induced by high velocity of air pressure (see the

arrows). Between 2 and 3 bar air pressure, the nozzle to substrate distance should be at

10 cm. It showed 100% adhesion strength of coating film and substrate. After we

consider the results of two main key parameters. The spray condition of air pressure at



I259

2 bar and nozzle to substrate distance at 10 cm was chosen as an optimal spray condition

for this work.

The coating film thickness was controlled by vary the spray duration time

on a constant substrate dimension. The plot of adhesion and pencil-hardness as a

function of coating thickness was shown in figure 3.

Figure 3. Pencil-hardness and adhesion results of hard coated PMMA with different

coating thickness.

The results can be divided into two parts. First part is a coating thickness

less than 12 µm, pencil-hardness of hard coating film was increased from 4H to 6H

hardness as the coating thickness increased with 100% adhesion. At the coating

thickness higher than 12 µm, the adhesion was decreased dramatically when the coating

thickness more than 12 µm. Pencil-hardness results are also decreased from 7H to 6H

hardness. The figure 4 show the coating defect from cross-hatch adhesion test and

pencil hardness test of hard coating layer. Uncoated area is the area that shielded by

transparent tape and remove after curing.

In figure 5, shows the SEM micrograph of cross-section hard coated layer

on PMMA substrate with around 10 um thickness. It can be seen clearly that the hard

coating film shows a good adhesion on the PMMA substrate.



I260

Figure 4. Cross-hatch adhesion and scratch failure of pencil hardness test of 7H with

1 kg loaded on coated PMMA with 8 µm (left) and 16 µm thick layer (right)

Figure 5. SEM micrograph of cross-sectional plane of hard coating layer on PMMA

substrate

It can be concluded that air pressure, nozzle to substrate distance and spray

duration time are the key parameters for spray coating process that affected on

nanocomposites film formation. Air pressure of 2 bar and 10 cm of nozzle distance

were chosen for this work. The coating thickness can be controlled by vary spray

duration time. The critical cracking thickness of silica-MTMS nanocomposite film on



I261

PMMA substrate by spray deposition process is around 12 µm. It was found that the

result shows the highest pencil-hardness at 7H with 1 kg loading and adhesion strength

at 100% adhesion.

Discussion

The two main key parameters that have an influence on the film formation

are operating air pressure and nozzle to substrate distance. There is no exactly spray

condition for every paint situation. The user needs vary and find the best spray condition

for each painting process. For the effect of air pressure, at 1 bar, the coating solution

was sprayed on to substrate with low velocity yielding a dry powder film with poor

adhesion. At moderate air pressure, 2 bar will decrease the size of the droplet size and

show more irregular film. If the coating process use too high air pressure (3 bar), the

droplets will be blown away and hit the substrate leading to non-homogeneous film

formation. Moreover, the nozzle to substrate distance is the important factor that

affected the adhesion strength of film and substrate because when we use the short

distance (5 cm), the coating film become wet and irregular film that affect the

decreasing of adhesion strength. This is believed to be an effect of wetting and droplet

to film formation. For long distance (15 cm), the volatile components in coating

solution will be evaporated on the way to the substrate and has a higher waste of coating

material.

The important factor that affects the film mechanical properties is the

coating thickness. The hard coating film with thickness higher than 12 µm can be

explained in term of different of thermal expansion properties between coating film and

substrates. During the densification, the residual solvent of coating solution was

evaporated and removed from the coating film to from the network film. For thick film,

there are very large stresses that can be generated during curing and cooling process

and also lead to film shrinkage and crack formation (R. M. Almeida et al. 2005).

Recommendations

The associated coating formulation should be compatible with various

coating process. The coating concentration, coating viscosity and evaporation rate can

be adjusted by control the amount or ratio of mix solvent in coating formulation to

applicable for wide range coating processes.

References

H.S. Hwang, N.H. Kim, S.K. Lee, D.Y. Lee, K. Cho and I. Park. (2011). Facile

fabrication of transparent superhydrophobic surfaces by spray

deposition. ACS Applied Materials and Interfaces 3 (July): 2179-2183.

L. Y.L. Wu, E. Chwa, Z. Chen and X.T. Zeng. (2008). A study towards improving

mechanical properties of sol-gel coatings for polycarbonate. Thin Solid

Films 516 (January): 1056-1062.



I262

M.A. Aegerter and M. Mennig. (2004). Sol-Gel Technologies for Glass Producers

and Users. Kluwer Academic Publishers.

M.S. Lee and N.J. Jo. (2002). Coating of methyltriethoxysilane-modified colloidal

silica on polymer substrates for abrasion resistance. Journal of Sol-Gel

Science and Technology 24 (June): 175-180.

P. Kamonwanon, S. Yodmongkol, R. Chantarachindawong, S. Thaweeboon, B.

Thaweeboon, T. Srikhirin. (2015). Wear resistance of a modified

polymethyl methacrylate artificial tooth compared to five commercially

available artificial tooth materials. The Journal of Prosthetic Dentistry

114 (August): 286-292.

R. Chantarachindawong, W. Luangtip, P. Chindaudom, T Osotchan and T. Srikhirin.

(2012). Development of the scratch resistance on acrylic sheet with basic

colloidal silica (SiO2)-methyltrimethoxysilane (MTMS) nanocomposite

films by sol-gel technique. The Canadian Journal of Chemical Engineering

90 (August): 888-896.

R. S.R. Kalidindi and R. Subasri. (2014). Anti-abrasive nanocoatings: Current and

future applications. Woodhead Publishers.

R. M. Almeida and S. Sakka. (2005) “Handbook of Sol-Gel Science and

Technology Vol II: Characterization and Properties of Sol-Gel

Materials and Products. Kluwer Academic Publishers.

S. Yodmongkol, R. Chantarachindawong, S. Thaweboon, B. Thaweboon, T.

Amornsakchai and T. Srikhirin. (2014). The effects of silane-SiO2 nanocomposite films on Candida albicans adhesion and the surface and

physical properties of acrylic resin denture base material. The Journal

of Prosthetic Dentistry 112 (December): 1530-1538.



I263

Title Effects of Glass Fiber Content on Engineering Properties of Glass Fiber Reinforced

Concrete

Authors: Ratthanan Ianleng and Thatchavee Leelawat

Program Mater’s Degree of Civil Engineering

Institute Department of Civil and Environmental Engineering Mahidol University

Abstract

The purposes of this study were to determine the compressive strength, flexural strength,

and modulus of elasticity of Glass Fiber-Reinforced Concrete (GFRC) varying the percentage

of fiber content. The mortar used for making GFRC were prepared by mixing white Portland

cement, silica sand, water, and Styrene Butadiene Rubber (SBR) latex. Attempt has been made

to control the percentage of sprayed glass fiber by volume of GFRC mix. The mechanical

properties of GFRC including compressive strength, flexural strength, and modulus of

elasticity were performed at 1 and 28 days after specimens were cast. The flexural strength

results of GFRC with high fiber content were found to be higher than those with low fiber

content. On contrasts, the compressive strength and modulus of elasticity of GFRC with high

fiber content were found to be lower than those with low fiber.

Keyword: Styrene Butadiene Rubber Latex, Glass Fiber Reinforced Concrete, Flexural

strength, Compressive strength, Modulus of elasticity, Glass Fiber Content

Introduction

Glass Fiber-Reinforced Concrete (GFRC) is a cementitious composite material made up

of mortar matrix and chopped glass fiber. GFRC is mainly used for exterior building façade

panels and architectural precast concrete because the properties of GFRC are tough, ductile,

and water-resistant. The GFRC is generally fabricated by sprayed technique where the mortar

matrix is pumped and mixed with the chopped fibers at the nozzle gun of the spraying machine.

The mortar matrix is usually blended by mixing cement, sand, water, and additive whereas the

chopped glass fibers, made up from alkali resistant glass ( AR- Glass) , are selected commonly

for making GFRC due to minimizing the degradation of glass fibers from alkaline of cement

[1-4]. The type of additive used in the GFRC is a polymer latex because the latex could improve

the flexural strength, workability, and toughness of GFRC [5].

However, very limited researches were found to study the effect of SBR content and

chopped fiber fractions on the engineering properties of GFRC for use in real exterior building

façade panels. Therefore, the main aim of the study was to determine the effect of glass fiber

content on compressive strength, flexural strength, and modulus of elasticity of GFRC

specimens which were fabricated by the spraying machine being used practically for making

exterior building façade panels.

Objective

The main aim of this paper was to determine the compressive strength, flexural strength,

and modulus of elasticity of Glass Fiber-Reinforced Concrete (GFRC) varying the percentage

of fiber content and SBR content.



I264


Materials

White Portland cement used was Tiger brand obtaining from Siam Cement Group (SCG)

Industry. Its specific gravity was 3.15. Silica sand with the maximum nominal size of 0.84 mm

(No.20) was used.

Glass fiber, conforming to ASTM D578, was AR- Glass type obtaining from Nippon

Electric Glass. The compositions of glass fiber contained 61% of silicon oxides, 15% of

sodium oxides, and 20.8% of zirconia oxides. The specific gravity of AR-glass was 2.74 g/cm3.

Polymer latex used was a Styrene Butadiene Rubber (SBR). The specific gravity of SBR

was 1.02 kg/l. The water content of SBR latex was 54.5%.

Mixing Proportion and Specimen Preparation

The summary of mix proportions for GFRC is given in Table 1. In the case of 1.5% latex

used to prepare needed to reduce the water content to achieve the pumpability and cohesion of

the mixes being fabricated with the spraying machine. The results are in line with those

obtained from Wang et al [5].

The mortar matrix was prepared by mixing water and SBR latex for 1 minute in the mixer.

Thereafter, silica sand and white portland cement were added into the mixer and mixed further

for 5 minutes.

The prepared mortar matrix was transferred to the container of the spraying machine and

then pumped continuously through the nozzle of the spray machine. The fiber roll was chopped

to obtain nominal lengths of fiber within the range of 38 and 50 mm. The chopped fibers and

the mortar matrix were then mixed at the spray nozzle. Attempt has been made to control the

fiber content in the GFRC mixture by manually adjusting the air pressure valve and pumping

speed of the spraying machine. The GFRC mixture was then sprayed in six cylindrical

specimens with the dimension of ø100×200 mm, six cylindrical specimens with the dimension

of ø150×300 mm, six prismatic specimens with the dimension of 350×150×25 mm, and one

0.1ft3 container to collect the fiber content. Thereafter, the specimens and the container were

consolidated using a tamping rod and vibrating table. The container was then wet-sieved

through the No20 sieve and all of the fibers retained on the sieve were collected and oven-

dried. Thereafter, the fiber content for each mix was then weighed and calculated as the

percentage of fiber content in the mix as shown in Table 2.

All of the specimens prepared were covered with plastic sheets. After demolded at the age

of 244 hours, the specimens were transferred to a moist-cured room, which was controlled at

the temperature of 23ºC and the relative humidity of 95%.



I265

Table 1 Mix proportions of GFRC

Mix No Latex

(%)

White

Portland

Cement

(kg/m3)

Water

(kg/m3)

Silica

Sand

(kg/m3)

SBR

(kg/m3)

Fiber

content

(%)

L0F1.60 0 930 465 930 0 1.60

L0F3.45 0 930 465 930 0 3.45

L0F3.79 0 930 465 930 0 3.79

L1.5F0 1.5 930 446 930 13.5 0

L1.5F2.55 1.5 930 335 930 13.5 2.55

L1.5F3.23 1.5 930 372 930 13.5 3.23

L1.5F3.50 1.5 930 484 930 13.5 3.50

L1.5F3.57 1.5 930 391 930 13.5 3.57

L1.5F3.77 1.5 930 372 930 13.5 3.77 * L1.5F2.55 mean SBR latex 1.5% with glass fiber content 2.55%

Procedure and Testing

Compressive strength test, according to ASTM C39 [6], was performed at 1 and 28 days

after casting for the ø100×200 mm cylindrical specimens. The maximum load pressing on the

specimen was used to calculate the compressive strength of GFRC.

Flexural strength test, modified from ASTM C1018 [7], was performed at 1 and 28 days

after casting for the 350×150×25 mm prismatic specimens. The specimens were laid on the

support of the universal testing machine and loaded at their mid-point span. The relationship

between the flexural stress and deflection of GFRC specimen was established using a “Merlin”

software. The maximum flexural stress was then used to determine the flexural strength of

GFRC.

Modulus of Elasticity test, conforming to ASTM C469 [8] was determined at 1 and 28

days after casting for the ø150×300 mm cylindrical specimens. Up to 40% of maximum load

for the specimen was applied. The relationship between the stress and strain of GFRC was

plotted. The slope of the graph was calculated to determine the modulus of elasticity for GFRC.

Results and Discussion

Fig 1 shows the relationship between the compressive strength results of GFRC and

percentage of fiber content. It can be seen that increasing the fiber content exhibited the lower

for both 1-day and 28-day compressive strength because the chopped fibers possibly increased

the amount of air voids inside the GFRC. It was confirmed by decreasing the harden density

of GFRC specimens with increasing the fiber content in mix.



I266

Fig 1: Relationship between compressive strength and fiber content of GFRC

Fig 2 shows the relationship between flexural stress and deflection of GFRC without glass

fiber content. Fig 3 shows the typical relationship between flexural stress and deflection of

GFRC with glass fiber content. It was found that the GFRC without glass fiber exhibited the

flexural strength about 2.0 and 4.9 MPa at 1 day and 28 days of specimen’s ages respectively.

The specimens were immediately broken after their flexural stress reached the first crack.

These results are in line with those stress-strain relationship given by Tassew and Lubell [9].

This is due to no or very little restrain of tension stress from mortar matrix. It was confirmed

by the tensile strength of cement mortar obtained by Singh et al. [10]. On the other hand, GFRC

specimens with 3.57% of fiber content exhibited the 28-day flexural strength at about 11 MPa

and the specimens continued to sustain load without broken after their flexural stress reached

the maximum value. The toughness, which was calculated from the area under the relationship

between flexural stress and deflection, of GFRC with fiber content was also found to be

significantly higher than that of GFRC without fiber content. This is due to transfer of tensile

strength from the glass fibers in the GFRC.

L0F3.79

L0F1.60 L0F3.45

L1.5F0

L1.5F2.55 L1.5F3.23

L1.5F3.50



I267

Fig 2: Relationship between flexural stress and deflection of GFRC without glass fiber.

Fig 3: Typical relationship between flexural stress and deflection of GFRC

with 3.57% fiber content

Fig 4 shows the relationship between flexural strength and fiber content of GFRC. The

results showed that increasing fiber content exhibited the higher the flexural strength for both

1 and 28 days of specimen’s age. It was also found that, for a given glass fiber content, the 28-

day flexural strength results of GFRC with 1.5% latex polymer were higher than those

corresponding GFRC without latex polymer. This is possibly due to latex improving flexible

behavior of adhesive bond between aggregate particles. Moreover, the latex were improved

tensile crack capacity of GFRC.

Fig 5 shows the relationship between modulus of elasticity and fiber content of GFRC.

The results showed that increasing fiber content exhibited the lower modulus of elasticity of

GFRC because of higher air voids obtained from glass fiber composite.

0

50

100

150

200

250

300

350

400

0

2

4

6

8

10

12

14

16

0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0

Equ

ival

en

t Fl

exu

ral S

tre

ss (

ksc)

Equ

ival

en

t Fl

exu

ral S

tre

ss (

MP

a)

Deflection (mm)

11: FM-MF-L1.5-P455060-1d-1 11: FM-MF-L1.5-P455060-28d-1

11: FM-MF-L1.5-P455060-1d-2 11: FM-MF-L1.5-P455060-28d-2

11: FM-MF-L1.5-P455060-1d-3 11: FM-MF-L1.5-P455060-28d-3

0

50

100

150

200

250

300

350

400

0

5

10

15

20

25

30

35

40

0.0 0.5 1.0 1.5 2.0 2.5 3.0 3.5 4.0 4.5 5.0 5.5 6.0Eq

uiv

ale

nt

Fle

xura

l Str

ess

(ks

c)

Equ

ival

en

t Fl

exu

ral S

tre

ss (

MP

a)

Deflection (mm)

1-11-21-32-32-12-2

L1.5F0 (1) _1day

L1.5F0 (2) _1day

L1.5F0 (3) _1day

L1.5F0 (1) _28days L1.5F0 (2) _28days L1.5F0 (3) _28days

L1.5F3.57 (1) _1day

L1.5F3.57 (2) _1day

L1.5F3.57 (3) _1day

L1.5F3.57 (1) _28day

L1.5F3.57 (2) _28day

L1.5F3.57 (3) _28day



I268

Fig 4: Relationship between flexural strength and fiber content of GFRC

Fig 5: Relationship between modulus of elasticity and fiber content of GFRC

L0F3.79

L0F1.60

L0F3.45

L1.5F0

L1.5F2.55 L1.5F3.23

L1.5F3.50 L0

L1.5

L0F3.79

L0F1.60

L0F3.45

L1.5F0

L1.5F2.55

L1.5F3.23



I269

Conclusion

1) The compressive strength and modulus of elasticity of GFRC were found to decrease

with increasing glass fiber content.

2) GFRC specimens with glass fiber continued to sustain load without broken after their

flexural stress reached the maximum value.

3) The flexural strength results of GFRC were found to increase with increasing the glass

fiber content.

4) GFRC with 1.5% latex polymer exhibited the flexural strength higher than GFRC

without latex polymer.

Reference

1. Majumdar, A. J., Nurse, R. W. (1974). “Glass fibre reinforced cement” Materials Science

and Engineering 15: 107-127.

2. Hull, D. (1981). “An Introduction to Composite Materials”, Cambridge Solid State Science

Series 2: 14-15.

3. Proctor, B. A., Yale, B., Ubbelohde, A. R., Manfre, G. (1980). “Glass fibres for cement

reinforcement” Philos, Trans, London: The Royal Society.

4. Larner, L. J., Speakman, K., Majumdar, A. J. (1976). “Chemical Interactions between Glass

Fibers and Cement” Journal of NonCrystalline Solids 20: 43-74.

5. Wang, R., Wang, P.-M., Li, X.-G. (2005), “Physical and mechanical properties of styrene–

butadiene rubber emulsion modified cement mortars” Cement and Concrete Research 5:

900-906.

6. ASTM "American Society for Testing and Materials," in ASTM C39 Standard Test Method

for Compressive Strength of Cylindrical Concrete Specimens., ed. 100 Barr Harbor

Drive, PO Box C700, West Conshohocken, PA 19428-2959, United States: ASTM

International, 2007.

7. ASTM “American Siciety for Testing and Materials,” in ASTM C1018 Standard Test Method

for Flexural Toughness and First-Crack Strength of Fiber-Reinforced Concrete (Using

Beam With Third-Point Loading). 100 Barr Harbor Drive, PO Box C700, West

Conshohocken, PA, United States: ASTM International.

8. ASTM “American Siciety for Testing and Materials,” in ASTM C469 Standard Test Method

for Static Modulus of Elasticity and Poisson’s Ratio of Concrete in Compression. 100

Barr Harbor Drive, PO Box C700, West Conshohocken, PA, United States: ASTM

International.

9. S.T. Tassew, A. S. L. (2014). "Mechanical properties of glass fiber reinforced ceramic

concrete." Construction and Building Materials 51: 215-224.

10. S.B. Singh, P. M., Nikesh Thammishetti (2015). "Role of water/cement ratio on strength

development of cement mortar." Journal of Building Engineering 4: 94-100.



I270

The 7th

National and International Graduate Study Conference 2017 I271

“Thailand 4.0 Creative Innovation for Sustainable Development”

Prototype Development of Authentication System on Cloud Computing Systems

Author: Ajchariya Saeung, Assoc. Prof. Panjai Tantatsanawong, Ph.D.

Master of Science Program in Information Technology, Faculty of Science

Silpakorn University

Abstract

This research has developed a prototype of the authentication system on

cloud computing. The proposes of this study are to development of cloud access

authentication mechanisms and to development Single sign-on (SSO) intermediary

system for different authentication systems to access resources from the Linux platform

and Windows platform. This paper use authentication namely Shibboleth technology,

which allows log in once. The results of the study were as follows enhances are the

security of system access, reduce user workloads and speed up to access.

Keywords: operating system security, single sign-on, Shibboleth, cloud authentication

Introduction

The Cloud Computing is the various service systems. The distinctive point is the

high effects of the processing even though using low cost. The trends of using are

increasing continuously. A user is able to have many accounts and each account

contains a username and password for system that was used. Because of much operating

systems (OS) in this time, such as Linux, Windows and UNIX. All users need to

register for creating an account in its own system. Therefore, there are too many

accounts in the system. As a user could have only an account, for logging in the Cloud

Computing, we must always register the new username and password by the existed

security devices e.g. the Security Assertion Markup Language, the Active Directory in

Windows, and the Lightweight Directory Access Protocol.

There are a lot of research works established by SingAREN [6] (Singapore

Advanced Research and Education Network) that is Singapore Access Federation, the

intermediary of information services providing the authentication system for education

and research by Shibboleth for authenticate per time. [9] People who want to sign into

any OS have to register and select which OS they'll use in order to enter to the resources

of singAREN's system. However, the users have to install the Identity Provider from

OS. To install, it needs to set by the prescribed form. If they change the computer after

installed main Metadata, they have to verify your identity in the new computer for

connecting to singAREN's Main system resource.

This research provides the alternative identification method by directory to be an

important complement of the Cloud Computing's [1] Network Management System

gathering clouds. It works by distribution of Cloud Computing system and by

communication the information from any resources. The Security devices used

Shibboleth, Active Directory and LDAP, which are the security standards. Users don’t

necessary to install the authentication system in computer, but they can enter via the

verified the Exchange system in each OS that they use.

The 7th



Objectives

1. To study and develop the authentication system in accessing the cloud

computing’s resources.

2. To develop the Exchange system for the authentication systems in the different

ways to access the resource of Linux and Windows platforms.

Literature Reviewed

1. Shibboleth [2]

Shibboleth is one of the Internet2’s works. It’s used for an Identification

Management (Federated System) [4] that OASIS SAML (Organization for the

Advancement of Structured Information System, Security Assertion Markup language)

is the defined standard forms in request, creation, communication and identity

verification. It’s the structure of authentication and permission on SAML’s standard.

The Federated Identity’s concepts consist of Identity Provider (IdP) and Service

Provider (SP).

WAYS (“Where Are You Form”) or Discovery Service is one of the Shibboleth

that will find out the key on SAML2 Metadata file to choosing the data provider.

Shibboleth’s work process shows on Fig.1

Figure 1 the Shibboleth’s process. [7]

According to Fig.1, Shibboleth’s work process presents operating when users

have already registered on the information providers.

1. Users try to access Shibboleth’s resources on the Network Service

Provider.

2. Shibboleth will send the request to WAYF.

3. Users choose the providers they want.

4. WAYF forwards the information to check by Handle Service.

5. The system will resend to users in order to authenticate username and

password, and then it will be sent back to Management Services to search

The 7th



for the accessible resource via Attribute Authority and Authentication

Authority.

6. The process of authentication from the Information Service Provider will

be sent to the Network Service Provider for Assertion Consumer Service

by making session.

7. Users’ attributes will be sent to the Information Service Provider after

verifying the data.

8. The Information Service Provider will send the users’ attributes to the

Network Service Provider.

9. The Network Service Provider will send the attributes and the required

resources back to users.

2. OpenLDAP [6]

Developed from the structure of LDAP (Lightweight Directory Access Protocol),

It was designed for small database that is able to search, read and access the information

efficiently more than general information. Furthermore, it’s high security because

working on Transport Layer Security (TLS).

Fig.2 shows the structure of Directory LDAP, [8] which presents the LDAP

organized by DNS structure that its name is udid=jsmith , unique DN name is

udid=jsmith, ou=People, dc=example, dc=com. The information forms are set in

RFC2253.

Figure 2 the structure of Directory LDAP. [3]

3. Active Directory (AD) [5]

Active Directory is the service for Network Management Resource including the

security system. It is comprised of the information, for example users, groups of users,

computers, domains, organizational units and security policies. Directories will be saved

in Domain Controller (DC) by the system Administrators, users or applications that are

able to enter to the saved information.

The Structure of Active Directory (DC)

The server installing AD is called ‘Domain Controller’. A domain might contain

lots of DCs that could change the database. If it changes, DC will transfer to other DCs

in automatic domain.

The 7th



AD Schema Object: Keep the important information in network

- Attributes: Object’s Attributes

- Schema: Determinant of each types of objects.

- Containers: Similar to folders in file system. Containers in AD are made up

of

Domains: Scope of Security

Sites: Network connecting by high bandwidth like LAN.

Organizational Units: Containers adding computers and

printer, but not for objects from other domains.

In the Active Directory, there are more parts of the previous Windows 2008,

Active Directory Domain Services (ADDS). They are the roles of working on

Authentication and Authorization by being the center of the Management Resource

System.

Comparisons of Authorization technology

Shibboleth, OpenLDAP and Active Directory’s processes are alike. Theses 3

technologies are just differences in unique to management system, effects, and

supportability in OS according to the table 1.

Table 1 compares the differences in identity verification technology.

Shibboleth LDAP Active Directory

Role

Among the world's

most widely deployed

federated identity

solutions, connecting

users to applications

both within and

between

organizations.

Protocol to access

directory service and

mostly used by

medium to large

organizations.

Database based system

that provides

authentication, directory,

policy, and other services

in a Windows

environment.

Purpose

Extend SSO to

services outside the

University, such as

journal access.

Authentication and

establishment of a

security layer on

which to carry out

subsequent

communication

Allow users to organize

their file systems into a

cohesive and high

performance directory

structure.

operating

system Linux / Windows Linux Windows

Support

for SSO Web SSO only Yes Yes

The 7th



Shibboleth LDAP Active Directory

levels Enterprise Organization individual


1. Principle of Computer System Design

The research presents the security devices by simulating the Cloud Computing

that can provide the services on computers. To enter to the system, it was made to one

time access. The intermediary server with Shibboleth’s technology is the manager for

approaching the system that contains the exchange system forwarding user’s

information to the Cloud Computing by using AD security for Windows OS and

OpenLDAP for Linux OS.

2. Specifying the Authentication Mechanism

According to the Research Objectives and the development of Authentication

Mechanism, researchers suggest using Shibboleth’s technology. There are 2 mechanism

sides; those are the Information Service Provider and Network Service Provider by

using LDAP to save the data as Fig.3 System access mechanism.

The Information Service Provider consists of Authentication Engine and Relying

Party Configuration Manager to manage the attributes, screen by Attribute Filter and

verify by Attribute Resolver.

Figure 3 shows system access mechanism.

1. The Exchange System Access Once

According to the Objectives of intermediary development for the different

Authentication in Linux and Windows platforms, the required the exchange system by

accessing once from Shibboleth’s technology in this process, Researchers suggest using

The 7th



the exchange system that can send the data to Linux and Windows platforms as shown

in Fig.4. The exchange system mechanism is as below:

1. Connect to Windows OS

Connect to Windows OS crossing the platform in this research by

Winbind and Kerberos’s services. Request the information accesses for

checking by AD via Application Proxy,

Figure 4 the exchange system mechanism.

DNS (Domain Name System) is the determination for contacting

with AD.

NTP (Network Time Protocol) is the protocol for Time and OS

comparison.

PAM (Pluggable Authentication Modules) and NSS (Name

Service Switch) are the licenses for accessing the applications by

Kerberos, and using offline.

Winbind is a service for logging into Microsoft Remote

Procedure Call cooperating with PAM and NSS in order to access

domain windows.

Kerberos is AD Authentication Request Service by KDC (Key

Distribution Center) containing AD and setting Kerberos’s scope

for managing by Winbind.

According to the devices and services, users are able to access the

resources after checking that DNS is in the same NTP system. After that, they

can search for username and password from directory. Finally, users can access

the resources in Windows OS without logging into AD system again.

The 7th



2. Connect to Linux OS

Linux is the same OS with the exchange system hence it can transfer this

session via SAML to authentication by connecting and searching for user’s

information on OpenLDAP. When data found, users are allowed to access

resource.

Authentication on the Cloud Computing

According to the study and development of the Authentication on Cloud

Computing objectives and the exchange system access once objectives, Researchers

designed the Authentication architecture by 3 main servers; those are main systems that

work on Linux by using Shibboleth’s authentication technology set up by the

Information Service Provider and the Network Service Provider. Users are able to

access via application. There is the security system, guaranteed by SSL certificate and

X.509 Certificate. It transfers the information by the exchange system to the other 2 OS,

Linux platform installs the OpenLDAP and Windows platform installs the Active

Directory.

Figure 5 the proposed authentication architecture.

System Testing

This research used technology access once for system development referred to

the SingAREN’s Singapore Access Federation research. Researchers suggest the

concepts and methods to reduce the process of users but users are still able to access the

resource safely. The concepts of research systems are as the Fig.6

The 7th



Figure 6 the proposed system structure.

1. Logging into system by using Username and Password.

2. Logging into Shibboleth’s Authentication Request for sending Username

and Password to check.

3. After the verification, the information service provider will send the

Response Session back to the network service provider.

4. The network service provider will transfer the Response Session to the

exchange system for choosing OS that users want.

5. After selection, the exchange system will authenticate the Request for

OS.

Windows OS will transfer to verify in Active Directory.

Linux OS will transfer to verify in LDAP.

6. If the information is correct, the Security System will allow to Return

Resource.

7. Users are able to use either Linux or Windows OS.

According to Fig.6, the Structure of System is accessing once by username and

password (in case of not registering, registration is required). This process is to

authenticate by Shibboleth. The process 2 is to search in Directory System and transfer

the session values to the Network Service Providers to save in the process 3 as Fig.6 the

example of session.

Figure 7 example of sessions.

In the process 4 of the exchange system, Users can choose the OS. If the user’s

data isn’t found, the system will register and send the User ID from session back to

users in order to confirm permissions. In case of using Windows OS, it will be checked

in Active Directory, and the Linux OS will verify in LDAP. In the process 5 of Resource

The 7th



Request, system will send the required resource back to the network service provider in

the process 6 for using by users in the process 7.

Conclusion

This research proposes the role of authentication working on the Cloud

Computing by developing Authentication Mechanism that can access the resources in

Linux and Windows platforms from the exchange system with the access once structure.

In addition, it is able to use across the platforms between Linux and Windows that can

reduce the resource and the users’ process, but it doesn’t reduce the process of safety.

All processes have data encryption for information security and for monitoring each

step. Users have the ability to work on the exchange system only when there are the

different platforms.

References

[1] B. Grobauer, T. Walloschek, and E. Stocker, “Understanding Cloud Computing

Vulnerabilities,” IEEE Security Privacy, vol. 9, No. 2, 2011, pp. 50-57.

[2] C. Powell, T. Aizawa and M. Munetomo. (2014). “Design of an SSO

authentication infrastructure for heterogeneous inter-cloud environments.” 2014

IEEE 3rd International Conference on Cloud Networking (CloudNet), 1 (December).

[3] Craig Ellrod, “LDAP Authentication.” Accessed July 29 January 2015. Available

from https://www.citrix.com/blogs/2010/11/05/load-balancing-ldap-authentication

[4] Internet2®. (n.d.) . “What's Shibboleth?” Accessed July 6, 2016.

Available from https://shibboleth.net/about/ [5] Microsoft. (2017). “Active Directory Domain Services” Microsoft Developer

Network.” Accessed November 15, 2016. Available from http://msdn.microsoft.com/th-

th/library/aa362244(v=vs.85).aspx.

[6] SingAREN. (2016). “Singapore Access Federation.” Singapore Advanced

Research & Education Network. Accessed August 3, 2016. Available from

http://www.singaren.net.sg/SGAF.php

[7] SWITCHaai. (2017). “WAYF Service.” Accessed July 29, 2016. Available from

https://www.switch.ch/aai/support/tools/wayf/

[8] V. Koutsonikola, A. Vakali. “LDAP: framework, practices, and trends.” IEEE

Internet Computing., vol. 8, issue 5, Sept.-Oct. 2004, pp. 66 – 72.

[9] V. Radha, D. Hitha Reddy. “A Survey on Single Sign-On Techniques.” 2nd

International Conference on Computer, Communication, Volume 4, 2012, pp. 134-139.

https://shibboleth.net/about/

http://www.singaren.net.sg/SGAF.php

https://www.switch.ch/aai/support/tools/wayf/

Title: The investigation of shoppers’ intention in purchasing online global brand.

Author: Miss WarissaraVitoonphun and Keatkhamjorn Meekanon, Ph. D.

Program: M.B.A in International Business Institute: Silpakorn University International

College

Abstract:

The purpose of this research aims to investigate shoppers’ intention in purchasing

online global brand. Qualitative Research Method is designed to examine the 4 major factors

influencing shoppers' intention in purchasing online global brand. In order to reach the

customers' intention in purchasing online global brand, using Qualitative Research Method is

easier than others technique. This method can help webs online shopping understanding how

customers' intention is associated with the 4 major factors: convenience, experience, attitude

and safety.

26 Interview questions are used to question 20 respondents who prefer going online

purchasing global brand and those customers who are interested in global brands online

shopping. This method will help researcher to measure and evaluate the investigation of

shoppers’ intention in purchasing online global brand at the present time and in the future.

Nowadays online global brand is evolving and appearing in human’s life more day by

day. In the past, people used to go to department stores to buy their things, but now Internet

technology designs people's way of lives to be easier. It’s really convenient and mainly useful

for customers. People can communicate to the others by social networking services (SNSs).

It’s basically being as a major part of human's life. Online shopping trends to be an

interactive channel; it presently influences people to spend their time online. One of the most

favorite social networking websites is web shopping. Online shopping and webs shopping

turn to be more popular.

Web shopping seems to be an alternative to the shopping channel for customers to be

online. It is a strategy that online sellers try to make competitive advantages of cost savings

and improve their profit margins. Online sellers are able to supply difference of products for

customer’s decision when they have no inventory pressure like brick-and-mortar stores.That

is the best answer to the question why most of the sellers prefer to sell goods on the internet.

So the internet shopping is a remarkable appliance which is growing forward rapidly. The

exponential growth appears to be the major performer in the industry refers to a large stock of

market potential for e-commerce.

Keywords: Customers' Intention, Online shopping, Global brand, Convenience, Experience,

Attitude. Safety, Trust



I280

Introduction:

People's way of life has been changed recently internet plays an important role

influencing their daily lives style. Communication among people in all the regions of the

world is getting more systemically convenient. People can send text message, search

information, go online either shopping or playing games by the usage of the internet.

Web shopping has been participated and accepted extensively as an alternative

channel for consumers to shop online conveniently. Online websites also provide consumers

beneficial information, various choices of product items and price comparison. Additionally,

consumers who have experienced shopping online satisfyingly or unfavorably, influence their

families, friends and the others to shop or avoid shopping on those webs shopping.

Consequently, good or bad shopping online experiences are liable to bring about to

consumers' good or bad attitude. Positive or negative attitude influences on consumers'

intention in purchasing online global brand is significant for web shopping administers' major

consideration.

On the other hand, shopping at the malls or stores is really lost the time. First of all,

driving to the place burns down gasoline. Being caught in traffic is stressful and takes time.

Looking for the space for car parked, walking around searching for a single right item,

standing in a line waiting for scanning bar-quote at the cashier counter is annoying.

Furthermore, in case of the item a shopper bought being under the term of guarantee

or returns, appears to be claimed, he or she has to take that item to the store for returning. The

investigation of shoppers' intention in purchasing online global brand was focused by the

main factors of: convenience, experience, attitude and safety; to explore the influencing on

shoppers' intention. The results indicate that the factors as the above mentioned is mightily

significant influencing shoppers' intention in purchasing online global brand as the model

illustration.

In Thailand, people can go online shopping conveniently. Thai consumers rather

attend to listen to the recommendation from families, relatives, friends or even social media

before making decision. The main drivers of buying decision in developed countries are

concerning of prices, quality and other product-related aspects. But the consideration could

be different from developing countries. Consumers mostly expect to receive useful

information and to browse through online shopping web sites favorably for their purchasing.

The theory of Purchase Intention and Consumer Behavior stimulate people to perform

to what their concentration and how they attempt to achieve their certain behavior. Applying

the theory of planned behavior (TPB) by Orapin (2009), on Thai consumers can be indicated

that the intention to shop online is mostly likely to be effected by perceiving behavioral

control and subjective norm, together with the aggregate of the attitudes from the people



I281

surrounding them. Meanwhile, the shopping intention being as a substitute role playing for

purchasing behavior is needed to be explored.

Behavior of shoppers' intention online in Bangkok, Thailand is identified as the following:

1. Shopper characteristics: shopper demographics, convenient, experience, attitude and safety

2. Product characteristics: brands, prices, promotion, free delivery, guarantee and returns

3. Web-shopping characteristics: information quality, services, privacy and security control

4. Web-shopping environment: exposure, market tools, market competition

The research shows that young women regularly go online shopping global brand

products, as it was a dream of purchasing global brand accessory. While, there are various

webs shopping for shoppers to shop. Although the important younger age group may not

purchase many items but they have richer knowledge of luxury brands.

Convenience:

Convenience motivated shoppers' intention in purchasing online global brand as the

advantage that the shoppers are able to spend their time preferably shopping online 24 hours

whenever they would like to shop. Shopping online is exactly, an alternative channel

interactive which influences shoppers who have specific time but in-need to shop certain

things they really want.

Moreover, shopping online global brand is beneficial to who admire brand items such

as hard working people, busy students, housewives and others who have to spend their

daytime hours doing their routine work. Online websites can help them manage their time to

go online shopping after their busy day pleasantly.

Time saving is one of the most productive influencing factors. Being convenience

searching online global brand catalogues and comparing prices are available for shoppers to

save their time shopping, during purchasing. It is also short time taken for delivery the

products or services over webs shopping after making intention purchasing online global

brand.

Experience:

It was identified that most shoppers who have experienced satisfying the webs

shopping and having positive attitude towards the websites, preferably recommended family

and friends to shop on those webs.

Online shopping habit is being as a link between customer satisfaction and

expectation adjustment. As the matter of fact, online shopping experience is being as a

guideline to customer satisfaction. It is confirmed that customer satisfaction is an important

guideline for expectation adjustment and online repurchase intention.



I282

Web experience, brand market share and product category are corroborative to affect

the significance of brands online. There is an evidence that brand familiarity and knowledge

dominates directly and positively effects on shoppers' intention, brand familiarity and

knowledge about the brand turning later to the online web shopping which the brand

familiarity influences purchasing. It is liable to imply that those brand familiarity and

knowledge of brand are connected with online channel.

One of the other important research found that familiarity with brand offered online

influenced perception of online shopping, associated with shopping online as well as

intentions to purchase online global brand. It is believed that people who plan to shop brand

items on the web, are more likely to search for product information on the specific web. The

relationship between web-searching and web-shopping intentions are connected to be

dominant shoppers on exploring through the list of products category.

Attitude:

Website design is showed to be one of the important attitude factor motivate shoppers'

intention in purchasing online global brand. The website design features of the brand webs

shopping are likely important to influence shoppers' intention. Website design leads shoppers

to feel satisfaction or dissatisfaction with a specific brand web shopping.

Some web shopping provides an option that invites customers to recommend a

product to a friend. Encouraging recommendation is brought into social networks and

emulating the social nature of fashion choices, later there may be a recommend from a friend

option by sending a friend's contact details to the other friend, when the friend makes a

purchase the recommender would receive a bonus plus credit.

The answer to the interview questions identified that shoppers are interesting in the

images of the online products. However, they are also pleased with the chances to view figure

of perspective separately, and display with cooperative items included. Various stage models

for the establishment of an Internet emerging for global brand webs shopping page design

have been offered to controlled shoppers' intention with a view to online connection and

global brand type.

Promotion offering has been affected to boost sales volume, customers' intention

become higher with those promotional offers. As the matter of fact, intention on purchasing

has been influenced customers' attitude during the period of making decision.

Loyalty project are operated influencing customers' attitude. Benefits of membership

of bonus include discount mailing, bonus day events, monthly price draws, website

promotion, exclusive offer, encourage shoppers' attitude to be satisfaction. Online

information is provided on those cards for customers, the card can be used for purchasing

where appropriate. However, these services are promoted to convince customers to be a part

of the brand community.

With the reference to the psychological and behavioral drivers of shoppers' intention

in purchasing online global brand, there is an explanation that being an adventurous online



I283

shoppers and heavy catalogue shoppers, obtained the most productive on online global brand

intention.

Safety:

Fulfillment privacy, personal information security, responsiveness and contact are

significant determinants for safety in online webs shopping. This finding supports that one of

the most important aspect of the service quality of the global brand webs shopping

experience, is the product safety delivery by the webs.

The web site-related determinants of safety including privacy, security, trade route,

presentation, order fulfillment is indicated as an acceptance to perceive website quality,

significantly influences customer trust online webs shopping.

The customer determinants of trust include familiarity with the trustable website

online, online shopping experience, and entertainment or chat experience are described as a

value of webs shopping. Service quality is commonly defined as how good a delivered

service level matches customer expectation.

A lack of safety prevents shoppers from engaging in online shopping, they are

unlikely to choose the web-shopping that fail to bring a trustworthiness. Mainly, they feel to

lose the safety they trust initially. Online shopping is beneficial to effectiveness shopping

performance shoppers will eventually visit the webs and believe in those useful online

shopping.

Privacy is positively related to safety. Privacy refers to the degree of which the online

shopping web sites, is safe and protects the customers' information. The primary reason why

most shoppers, hesitates to shop online or to provide their personal information to unsafe

online web shopping.

Trend of online shopping involved the online payment, online transactions enhance

the use of credit card or debit card. The opportunity of online payment provide a facility to

recognize the legal of user and keeps the fraudulent machines away from the system by

saving during the payment OTP (One Time Password) will be generated and sent to user's

mobile number to be confirmed that user has provided the correct OTP. This is to prevent the

phishing attacks using user machine identification. It is convenience and safety for shoppers

to shop online global brand.

Objectives:

1. To study customer intention in purchasing online global brand.

2. To study what factor affects customer intention in purchasing online global brand.



I284

Research Methodology:

To gain higher reliability understanding of shoppers' intention in purchasing online

global brand, qualitative method is used to collect data analysis. The 26 interview questions

were provided to inquire 20 participants were totally consistent with sample identified in the

research design. The population targeted in this research was people living in Bangkok who

have experienced in purchasing online global brand. Besides, these respondents were

classified from variety group such as high school students, university students, students in

higher education and working people.

In depth interview by 26 interview questions were rationally practiced to interview 20

respondents separated into 2 groups. First group of respondents was a group of students who

were studying in high schools, colleges, universities and the students in higher education. The

second group was a group of shoppers who were shopping during interviewing at the top

shopping malls and universities.

26 Preparation questions were designed and applied directly to be as the interview

issues, 2 sections were divided: Section 1composed of demographic information about gender

and age: Section 2 composed of 4 significant factors: convenient, experience, attitude and

safety linking to the objective of this research with the aim to approach the intention of

respondents toward shoppers' intention in purchasing online global brand.

In order to gain higher reliability understanding of shoppers' intention in purchasing

online global brand, 20 Participants in Bangkok are assorted to conduct focus group interview

answering the questions about their experiences and their attitudes of purchasing online

global brand, questioning about their feeling of convenience and the safety they have when

they intent to purchase online global brand. During the interview, the interviewer kept

investigating the responses by questioning for further cooperation.

The investigation was organized in Bangkok because focusing group of respondents

mainly lived in Bangkok. Moreover, there are many attractive shopping malls located in the

central of Bangkok. A lot of most popular shopping malls at Siam Square where top global

brand items are presented there motivate the shoppers' interest to shop. Those shopping malls

are included; Central World, Siam Discovery, Siam Paragon and Siam Square One. Doing the

investigation with the target sample above mentioned would provide higher reliability

understandings and the better effectiveness results for the research.

While interviewing all the answers, were wrote in paper note and then they were built

in Microsoft Word Program. It took about half an hour to one hour to interview each

respondent. Respondents were separated into 2 groups. First group of respondents were in the

university areas. The second group of respondents was shopping in the shopping mall such as

Siam Paragon or Central Department Store.



I285

Demographics questions were questioned in order to understand the participants'

profile. The characteristics of students and shoppers' demographics were classified through

the interview questions included gender, age, education and occupation.

The first question was designed to find out the total amount of gender between males and

females.

Figure 1: Percentage of respondents by gender

Mainly, there were 14 females and 6 males of total. The result showed that, in

Bangkok women intent to purchase online global brand than men did. While the group of

people who were working go online shopping more frequently than the group of students.

Male25%

Female75%

Gender

Male Female

Less than 25

15%

25-3450%

35-4925%

More than 50

10%

Age

Less than 25 25-34 35-49 More than 50



I286

Figure 2: Percentage of respondents by age

4 Categories of age: A. less than 25 years old, B. from 25 - 34 years old, C. from 35 -

49 years old, D. 50 years old and above. The sample was mainly from 25-34 years old and

35-49 years old

The result displays that the group of shoppers who are 25 to 34 years old and 35 to 49

years old are apparently, tend to purchase online global brand than the older and the younger

groups. It is probably that most people who are aged 25 -34 and 35 - 49 probably obtain job

stability with higher income. Certainly, they access their own mobile phones, laptops or

personal computers. They would have better knowledge to be able to associate with the social

connection and know how to shop online.

Figure 3: Percentage of respondents by education

With the reference to Figure 3 is assumed that the higher education levelis the higher

tendency in purchasing online global brand. The reason probably is those people are

educated. They are able to associate with social networking websites. Shopping online is

convenience and time saving for them. Besides, their higher education is likely to make them

earn more money to spend for purchasing online global brand.

College/University

55%

Postgraduate

45%

Education Level

College/University Postgraduate



I287

Figure 4: Percentage of respondents by occupation

Figure 4.shows that working people group share the largest of occupation 65% while

students group account for 35% in purchasing online global brand. It is found that those

people who obtain job stability and earn more income would have enough financial condition

to purchase online global brand.

Result and Conclusion:

It is concluded that shoppers who have had previous online purchasing global brand

experiences may feel more confident to purchase the items on those webs shopping which

they experienced. It is also possible that information quality, such as how description the

information is or how easy the detail can be read, could be more important for webs shopping

to be considered.

The different several of information on the shopping websites may not be perceived,

as shoppers may not consider carefully the product information. That is because the

experiment is not an actual purchase situation.

The findings of this study can be defined that the amount of information available on

a web site may not be exactly important determinant for shoppers' intention in purchasing

online global brand. Brand familiarity could be used as internal information for shoppers'

intention in purchasing online global brand.

Thai people, especially in Bangkok, Thailand can always go online shopping in

anytime and anywhere whenever they prefer to do. Visiting webs shopping as frequently as

every day or even several times a day is possible for them.

As the matter of fact, most shops and shopping malls in Bangkok, are closed 2 or 3

hours before midnight while some consumers are busy working during the time mentioned.

Students35%

Working people

65%

Occupation

Students Working people



I288

They can shop online after their working hours since the webs shopping offer consumers the

opportunity of direct interaction to the online shopping.Therefore, consumers is possible

interested how convenience shopping online is.

Apart from the reason mentioned about factors influencing shoppers' intention in

purchasing online global brands, the result also identifies that convenience, experiences,

attitude and safety, the main factors investigated by this research, was important. The

researcher also considered the important and obvious possibility influencing shoppers'

intention among the target group and the general public in Bangkok, Thailand.

The results of the investigation of shoppers' intention in purchasing online global

brand in Bangkok, Thailand, tends to be highly influenced by the factors of convenience,

experiences, attitude and safety.

The connection between purchasing intention and online shopping behavior showed

the strongest relationship. The result implied that university students' intention in purchasing

online global brand was influenced by perception of the families, friends and media.

The researcher believes that the majority of potential shopping websites in Bangkok,

Thailand, are suitable at the stage of investigating the actions of the others' intention in

purchasing online global brand in other cities in Thailand.

As the result shows that consumers who have not experienced with the unknown webs

shopping, are more likely to reject those websites, for the reason that consumers intend to

avoid of the security risk involved the unfamiliar web-shopping transactions.

Discussion:

This study is limited by several factors that need to be addressed in any further

research. First, probability sampling methods could be used in consideration. The sample

manipulated was composed of technically higher educated and graduated students which

although appropriate for this study, but it may not be the population-wide representative,

consequently limited summarizing would be defined.

Further studies should identify additional variables and include those variables in to

the model in order to produce a better description of the processes, leading to shoppers'

intention in purchasing online global brand. The agreement between online shoppers and the

relationship towards the intention to shop online global brand in this study was not indicated.

To evaluate shoppers' intention in purchasing online global band, a larger sample size

is desirable. Future research needs to focus on a larger cross section of shoppers' intention

and more diversified random samples to verify the findings of the current study to further

studies clarity of the factors influence on intention toward online shopping, other behavioral

model could be used and larger sample sizes, sample areas for the purpose should be

reconsidered for more accurate findings.



I289

Analyzing the factors: convenience, experience, attitude, safety, influenced shoppers'

intention in purchasing online global brand is important to clarify the scientific approach to

shopping online. To understand online shopping as individual's actions are limited relatively

to intention in purchasing online. Focusing on aspects influenced consumers behavior is

identified the relationship between intention in purchasing online and the factors affecting the

intention.

Initially, customers' decision to go online shopping, starts with their need awareness,

information searching, alternative assessment, considering purchasing the items, and

following by post-purchasing behavior. When customers have enough information about the

products, they will need to compare those choices of products or services. They might search

for the product reviews or customer comments. Attractive design is important images to

persuade customers to be interested in buying product and services.

Well-organized web site structure and the attractive design are important to persuade

consumers to be interested in order to influence their attentions. A consumer would be more

likely to engage in web-shopping activities when he or she is satisfied with the web-shopping

experience. In consideration the effect of past web-shopping experience, however, the overall

consumer satisfaction with past web-shopping experiences was not considered in this study.

According to the model actively educates consumers obviously to improve frequency

of use and the knowledge gained, it will then in turn affect attitude formation. To

Investigation the way to realize consumer acceptance of web-shopping as showed in the

results that web-search behavior significantly mediate the relationship between web-shopping

attitude and web-shopping intentions is consistent with previous finding. The methods linking

web-shopping attitude to shopping intentions being actually interconnected, are not

considered in this study.

In term of worrying about safety and privacy and the perceived importance of safety

issues, the respondents are similar to the respondents in other studies. But right now

customers quite believe in safety more than in the past because now in online global brand

they have stronger security so respondents quite feel more secure with online global brand

more than in the past.

Truly, safely and privacy problems have long been similarly explored in the contexts

by many authors also suggest that perceived risk is an influencing factor which opposes

consumers in proceeding to adoption decisions. It is found that privacy refers to the degree to

which the online global brand websites is safe and protects consumers' information.

Recommendation:

Since transition into a global interconnection networking share and deliver

information, webs shopping have emerged as a useful marketing tool to serve consumers to

shop online conveniently.

To perceive a convenient way to explore and shop online at anytime and anywhere,

consumers are able to search products they want to buy and compare prices while they are



I290

going online easily. Attractive webs shopping for brand styles should be designed to

influence the brand shoppers. Competitive prices and promotion offering are as the most

important for brand name clothing and accessories purchasing.

Shoppers' intention in purchasing online global brand changed the world of selling

and buying brand products. Trend of online shopping involved the online payment, online

transactions enhance the use of credit cards or debit cards, should likely be more convenience

and safety for shoppers.

To investigate the access through the customer's bank account for online payment

transfer was found that shoppers are secure with the procedure. Communicated through SMS

needed to be confidential using OTP (One Time Password), is provided the highest level of

safety for customers.

Suggestion to further studies as related to the investigation of shoppers' intention in

purchasing online global brand, researcher believes that there are some more significant

interview questions that suitable for further exploration, and a bigger size of respondents

sample should be considered and developed methodically to understand clearly the intention

in purchasing online global brand in the future.

Finally, researcher expects that these findings may benefit to other additional research

related "shoppers' intention on purchasing online global brand."

References:

Aghdaoe, S.F., Piraman, A., Fathi, S., (2011). “An Analysis of Factors Affecting the

Consumer’s Attitude of Trust and their Impact on Internet Purchasing Behavior”

International Journal of Business and Social Science, 147-158.

Ajzen, I. (1985),” Form intentions to actions: a theory of planned behavior”, in Kuhl, J. and

Beckmann, J, (Eds), Action-control: From Cognition to Behavior, Springer, Heidelberg, pp.

22-39.

Ajzen, I. (1988), Attitudes, Personality and Behavior, Dorsey Press,Chicago, II.

Ajzen, I. and Fishbein, M (1980), Understanding Attitudes and PredictingSocial Behavior,

Prentice-Hall, Englewood Cliffs, NJ

Ajzen, I. and Madden, T.J. (1986), “Prediction of goal-directed behavior: attitudes,

intentions, and perceived behavioral control”, Journal of Experimental Social Psychology,

Vol.22, pp. 453-74.



I291

Cao, M., Zhabg, Q. and Seydel, J (2005), ” B2C e-commerce web site quality: and empirical

examination”, Industrial Management & Data Systems Vol. 105 No. 5, pp. 645-61

Dabholkar, P. (1994), “Incorporating choice into an attitudinal framework: analyzing models

of mental comparison processes”, Journal of Consumer Research, Vol. 21 No. 1, pp. 100-18

Degeratu, A., Rangaswamy. A. and Wu, J. (2000), “Consumer choice behavior in online and

traditional supermarkets: the effects of brandname, price, and other search attributes”,

International Journal of Research in Marketing Vol. 17, pp. 55-78”

Diallo, M.F., Chandon, J.-L., Cliquet, G., Philippe, J.,( 2013).” Factors influencing Consumer

Behavior towards Store Brands: Evidence from the French Market”. International Journal of

Retail & Distribution Management, 41(6), 422-441.

East, R. (1997), “Attitude, beliefs, intentions and behavior”, Consumer Behavior: Advances

and Applications in Marketing, Prentice-Hall, London, pp. 109-32.

Eroglu, S.A., Machleit, K.A and Davis, L.M. (2001), “Atmospheric qualities of online

retailing – a conceptual model and implications”, Journal of Business Research, Vol.54, pp.

177-84.

Fishbein, M. and Ajzen, I. (1975), “Belief, Attitude, Intention, and Behavior”: An

Introduction to Theory and Research, Addison-Wesley, Reading, MA.

Gong, W., Stump, R.L., Maddox, L.M., (2013), “Factors influencing consumers’ online

shopping in China.” Journal of Asia Business Studies, 7(3), 214-230

Hu, Y., Sun, X., Jing, Z., Zhang, X., Luo, F., Huang, L., (2009). “A University Student

Behavioral Intention Model of Online Shopping Based on TAM”. International Conference

on Information Management, Innovation Management and Industrial Engineering pp. 625-

628. IEEE Computer Society.

Huang, M.H. (2000), “Information load: its relationship to online exploratory and shopping

behavior”, International Journal of Information Management, Vol. 20, pp. 337-47.

Jamil, N. A., Mat, N. K., (2011), “To Investigate The Drivers of Online Purchasing

Behavioral In Malaysia Based on the Theory of Planned Behavior (TPB): A Structural



I292

Equation Modeling (SEM) Approach”, International Conference On Management, pp. 453-

460

Jiang, J.C., Chen, C. A., Wang, C. C.,(2008),” Knowledge and Trust in E-Consumers’ Online

Shopping Behavior”. International Symposium on electronic Commerce and Security pp.

652-656, IEEE Computer Society.

Kim, S., Jones, C., (2009), “ Online Shopping and Moderating Role of Offline Brand Trust ”

Journal of Direct Marketing., pp. 282-300

Kindel, T.L (1983). “A partial theory of Chinese consumer behavior: marketing strategy

implications”, Hong Kong Journal of Business Management, Vol.1 p.105.

Lai, E., Wang, Z., (2012), “An Empirical Research on Factors Affecting Customer

Purchasing Behavior Tendency During Online Shopping” Institute of Electrical and

Electronics Engineers, pp. 583-586

Leeraphong, A., Mardko, A, (2013, November), “Trust and Risk in Purchase Intention

through Online Social Network: A Focus Group Study of Facebook in Thailand”. Journal of

Economics, Business and Management, 1(4), 314-316

Liao, Z. and Cheung, M.T. (2000), “Internet-based e-shopping and consumer attitudes: an

empirical study”, Information & Management, Vol. 38, pp. 299-306

Limayem, M., Khalifa, M. and Frini, A. (2000), “What makes consumers buy from the

internet? A longitudinal study of online shopping”, IEEE Transactions on Systems, Man and

Cybernetics, Vol. 30 No. 4, pp. 421-32.

Mathwick, C., Malhotra, N.K. and Rigdon, E. (2002), “The effect of dynamic retail

experiences on experiential perceptions of value: an internet and catalogue comparison”,

Journal of Retailing, Vol. 78, pp. 51-60

Menon, S. and Kahn, B. (2000), “Cross-category effects of induced arousal and pleasure on

the internet shopping experience”, Journal of Retailing, Vol. 78, pp. 31-40.



I293

O’Cass, A and Fenech, T. (2002), “Web retailing adoption: exploring the nature of internet

users web retailing behavior”, Journal of Retailing and Consumer Services, uncorrected proof

available online 22 January 2002.

Oliver, R.L. (1997), Satisfaction: A behavioral Perspective on the Consumer, McGraw-Hill,

Boston, MA.

Peter, J. and Olson, J.C. (2002), Consumer Behavior and Marketing Strategy, Irwin McGraw-

Hill, Boston, MA.

Ranganathan, C. and Ganapathy, S.(2002), “Key dimensions of business-to- consumer web

sites”, Information & Management, Vol. 39 pp. 457-65

Salisburym, W.D., Pearson, R.A., Pearson, A.W. and Miller, D.W. (2000),”Perceived

security and world wide web purchase intention”, Industrial Management & Data

Systems, Vol. 101 No. 4, pp. 165-76

Shih, D., Chiang, H., Chan, C. and Lin, B. (2004), “Internet security: malicious e-mails

detection and protection”, Industrial Management and Data Systems, Vol. 104 No. 7, pp.

613-23

Shim, S., Eastlick, M.A. Lotz, S.L. and Warrington, P. (2001), “An online pre-purchase

intentions models: the role of intention to search”, Journal of Retailing. Vol. 77, pp. 397-416.

So, W.C. and Sculli, D. (2002), “The role of trust, quality, value and risk in conduction e-

business”, Industrial Management & Data Systems, Vol. 102 No. 9, pp. 503-12.

Zanna, M. and Rempel, J.K. (1988), “Attitudes: a new look at an old concept”, in Bar-Tal, D.

and Kruglanski, A.W (Eds), The Social Psychology of Knowledge, Cambridge University,

Cambridge, pp. 315-34



I294

THE IMPACTS OF TRADITIONS AND CUSTOMS ON VIOLIN

TEACHING AND LEARNING

Abstract

The purpose of the study is to understand the Myanmar Traditions and

Customs how impacts on violin teaching and learning and to know positive and

negative impacts of Myanmar traditions and customs on violin teaching and learning.

This study used qualitative method, research interview and observation participated by

10 violin teachers and 15 violin students

Keywords: Myanmar Traditions and Customs/ Impacts/ Violin teaching and learning/

Positive and Negative impacts/ Violin teachers and students / Interview and

observation.

Introduction

Traditions and customs derived from the past to present and it is important

to every nation and human society. The families of structure and foundation of habits,

behaviors, manners and daily practices are affected by the traditions and customs and

they keep practicing and belief those of the elders and the ancestor of doctrine.

Traditions and customs passed from one generation to generation orally (“Common

usage, Customs, Tradition and Convention,”.n.d.). Between the traditions and customs

difference is - traditions which is long established practice from the past time to until

now and the people still keep doing as the same manners, behaviors, habits. It mostly

refers to wider arrange of scale, culture norms and the practice passed through the over

a history and derived from the ancestor or the old generation to new generation.



I295

Customs is a kind of social norms which is the manners or behaviors are accepted by

groups or society (Trammell, 2015). Tradition is a kind of long study and customs that

can happen according to the circumstance but those customs happen many times and

again and again as long practice, it will become a tradition too.

Traditions are behaviors and actions that man engage again and again

(Mckay, Brett and Kate, 2013). Likewise, Customs and culture are also similar

tradition. Tradition, customs, culture and human’ living lifestyles, connected to life

and interrelation and depend on each other. There are affected and influence things for

human society too. Then those things will form people of morality, religion,

knowledge, habits, talk, dressing and living ways. According to the tradition and

customs, each of the different human societies will reflexed the different way of living

life style, greeting, eating and communication, teaching and learning also.

Most Burmese beliefs in Buddhist and their life style is the reflection of

Buddhism teaching way. Therefore they live their life very simple and honestly.

Moreover Burmese are very friendly and outgoing people and mostly they treat each

other nicely and more concern about their manner and behavior to act as good figure

in public. At the first meeting with other people, they used to act by good greeting

instead of judging, critic, bad talking, or showing bad emotion or aggression. Because

of they care about themselves, and other people feeling. They don’t want to make

them feel bad and their looks bad toward other people. Burmese of natural mind are a

heritage in eastern tradition and culture or according to the Myanmar tradition and

culture. Burmese characteristics are collectivists and individualists also. Burmese

society relationship accepts the power relations which constructed in all organizations

and levels in all Myanmar society. Power relationships mean giving respect the

seniority, rank, age, birth, position or achievement. Moreover, Burmese have the

feminine qualities which are politeness, caring other feeling, quietness, shyness.

According to these kinds of attitudes and manners can make the positive and negative

effects on musicianship and teaching and learning process.

Music education in Myanmar, since earliest, we did not have music

schools, universities or conservatories. Students want to learn music must go to their



I296

teacher’s residence for private lessons. According to the past Myanmar traditional

custom, the children are supposed to give a lot of respect to teachers and could not

have chance to ask questions. Therefore the student’s critical thinking is shallow.

Those kinds of situations are an obstacle for student thinking and the quality of

learning. Nowadays, people become more educated and revolt form the old custom.

That is why education system is getting better. Prominently in 1900’s, the State School

of Dance, Drama and Music and University of Culture were opened in Yangon and

Mandalay which offer music lesson. For admission, the school and the university only

accepted the students who are 14 to 18 years old. For applicants, after they passed the

middle school level, then they can apply for the school. Even now, Generally Primary

School, Secondary School and High School do not have yet a music program and the

only music activity in the school is singing of the national anthem song every day.

In Myanmar, ideas about music are changing. Many music schools are

establishing, music and art activities are developing. After ending of military

dictatorship, it is more obvious in Myanmar and here people of the show interests in

music. They are willing to learn the music and perform, and love to watch concert.

Such as the situation, we can see the people who know the music taste and is

becoming an obsession for that According to this situation it is a good time and

opportunity to develop of music. Although Burmese’ tradition, customs of manner and

behaviors could be the obstacle when they study in music. The student will not be able

to perform emotionally when they feel shy. In the classroom, the students and teacher

relation will get affected by giving respect. It will limit the student mind of creativity

and critical thinking. If the students do not have the self – helping mind, in self –

learning is the weak part of the student.

Culture, tradition and customs refine the national identity and the country.

In Myanmar, according to the traditions and customs, the people have the character

like polite, simplicity, honesty, shy, frank, respecting to elders, hospitality, and

friendly and brave, self-esteem, low self-esteem, and self-confidence or fear. Those

characteristics, behavior, manner and thinking are coming from their initial

experiences. Communication and interrelationship between the children, their parents,

teachers and environment’ reflect to their children’ characters, habits, behaviors and



I297

manners. For instance, if parents care for their children and serve everything instead of

children do for their own, those children will be less with self-sufficient and in

education, the children effort less for self-study. In Myanmar most of the parents care

for their children intensively and the foundation, Myanmar family base on love,

respects, responsibilities and this is not consideration from religious creed ( “My

family and perception,” .n.d.). Actually, Parents should teach their children how to

serve themselves instead of they do for their children.

Some of the Myanmar people think of showing their emotions in public

and used to behave with temperance. They hide their thought, emotion and feeling

(Hays, 2008). These characters, manner and thought could make good and bad effects

in music learning. Sometimes it will turn to have habits like shy, afraid or fear in

person and for the shy student, the symptom will show as ignorance and avoid ask the

question, against other people of idea and they are express less by them and will

follow easily by other. It seems to be less confidence to other as well. Moreover,

student may think teacher is always right. This situation can make the students’ critical

thinking to lose. Then, most of the young people, they still rely on their parents until

their adult age or more. Relying on other too much which manner can be the lack of

self-reliance. In communication with each other, the manner of temperance will make

the difficulties of showing body languages.

Objective of the Study

1) To examine the actual impacts of Myanmar traditions and customs on

the success and failure of violin teaching and learning

2) To outline general music studies requirements


The topic of this study is “The impacts of Myanmar traditions and customs

on the violin teaching and learning”. In this investigation, 10 selected violin teachers

and 15 selected violin students would be interviewed and observed. The methodology



I298

consists of Qualitative research because focuses on individuals’ experiences in

teaching and learning. Qualitative research method can explore the each participant of

violin teaching and learning experiences, their background story and moreover by

addition with the researcher of consideration and perspective for analysis. The purpose

of the research is to inquire how certain aspects of Myanmar traditions and customs

influence violin instruction, while taking place in their native environment. The

aspects considered are: beliefs, practice of traditional rules and disciplines, habits,

norms, behaviors, social attitudes, characteristics, generation to generation verbal

instruction (in the absence of written instruction), obedience and other possible

features of culture. This research is done in terms of Descriptive Analysis. The steps of

this method are:

1) Selecting of participants

2) Data collection technique and Research tools

3) Data analysis

Results and Conclusion

This research analyzing results came from questions and answers

interviewing and classroom observations with violin teachers and students under the

main objectives study 1) to examine the actual impacts of Myanmar traditions and

customs on the success and failure of violin teaching and learning and 2) to outline the

general music studies requirements. Under the question of 1) “the actual impacts of

Myanmar traditions and customs on success and failure of violin teaching and

learning” will explain by following eight topics which are:

1) The Actual Impacts of Myanmar Traditions and Customs on Success and Failure of

Violin Teaching and Learning

1.1) General Characteristics of Teachers and Students



I299

1.2) Myanmar Traditions and Customs that become an Issue of Teaching and Learning

of violin, Evolution and Resolving the Problems

1.3) Students’ Likes and Appreciation of Violin Class and Teachers

1.4) In Teaching, Learning, and Playing Styles, about Young Students how they

diverge from long- established Myanmar Tradition and Customs and the Value of

Western Music

1.5) Value of Western Music Learning Impacts and Expectation

1.6) Expectation and Recognizing Achievement in Teaching and Learning

1.7) Music Resources and Teaching and Learning styles

1.8) Personal or Social Constrains to Violin Teaching and Learning Process

For the question of 2) “to outline the general music studies requirements” will explain

by following topics:

2) The Outline of General Music Studies Requirements

Now I will focus to present about three topics;

1) General Characteristics of Teachers and Students

2) Myanmar Traditions and Customs that become an Issue of Teaching and Learning

of violin, Evolution and Resolving the Problems

3) The outline of general music studies requirements

1. General Characteristic of Teachers and Students

Interview with teachers

Students in Myanmar are observed to have some general characteristics.

The traits tend to be those of innocence, respect, honesty, purity of thought and

sensitivity. They commonly enjoy helping their peers and treat each other well, and

are often seen to be sensitive to any negative feedback from others. This can



I300

sometimes lead to sadness and suffering. Their innocent conscientiousness is also seen

in their respect for elders and teachers. Generally, their communication with them is

polite and they adopt their teachers’ doctrines and practices and think in the ways that

are suggested to them.

“At 18 and over ages, it does not seem as child but they are still innocent

that I think. According to our country of old and young people of relationship culture,

most of the students treat their every elder one very politely. For teacher, they give

respect as a special one for them and used to obey what their teacher said and doctrine.

Sometimes, I afraid it would make their thinking process to be narrow and contract

because they follow their teacher and less of their own decision and thinking to do

anything. That’s why, I am trying to make the teacher and student relationship in open

type and let the students to talk out their idea in any case. Give the permission to do as

the way of their thinking and I said if you think it is good, do it by your own decision.”

(Violin teacher, Male, Aged 39, 10 years of teaching violin)

Moreover, students tend toward honesty, and exhibit a positive social

character which contributes to a good relationship between teacher and students, and

their emotional sensitivity makes some of them predisposed toward shyness and low

self-esteem. When they making music with violin, at first, they need to know the

feeling how they feel and understand on music piece and should show their feeling

according their felt by produce the violin sound and body and face features. That is

really needs to be a good violinist, soloist and musician. So, every teacher and student

needs that ability in making music and normal living life style as well. People of

passion will make the life more alive and exciting. Life is going to be more interested.

“When the people shy to express themselves, I think it will be disturbing

in music. In music making, It will be better if the players can do by heartily and show

their feeling according to music how its make them,. Music will alive differently by

each person of own feeling and style because everyone has different traits and identity.

So I want my students to show their feeling and body movement as well in playing

music with violin. I do not want they have the behaviors and feeling like, shy, afraid,



I301

contract minded when they playing violin and making music.” (Violin teacher,

Female, Aged 37, 8 years of teaching violin)

Myanmar students like encouragement from others. Encouragement can

inspire them to try even harder to please and to do things correctly. They do not like

strong judgments, critics and harsh conversation and it is easy to make them

depressed. According to their traditional doctrines, children were thought their

knowledge and ability by their own experience is less and they have to learn from their

elders, parents and teachers. To believe and know the children ability well by

themselves, a few parents do only. Most of the children were not taught to know their

instinct by themselves and the parents used to give the way what they want children to

do. That is the reason the children should not have the chance to know what are they

good at to do excellent which kind of emphasize by their talent. So, some of the

students came to school without their desire and they were less interest. Anyway,

teachers try to teach those students to enjoy the music and hope that they will be good

violinist.

“Some of the students don’t show interest and play violin well because

they came to school to fill the desire of parents. For those students, I try to make them

to enjoy the violin class and lesson. I am not strict and demand the students in teaching

and learning. I talk with them about funny things and famous musicians. I teach the

good easy melody and after all many students become interested in music and violin

playing. I believe everyone can be a good violinist and musician. Therefore, I cherish

them not to give up on violin playing” (Violin teacher, Male, Aged 45, 12 years of

teaching violin)

Interview with students

Students said most of our classmate has lots of characteristic if they say

details but generally, they are funny, friendly, helpful, respect, polite but sometimes a

bit rude, shy, contract mind and chill out and calm, then lazy as well. Anyway,

students said that they love their friends and that is one of the reasons to come to



I302

school every day. Respect and polite characters build up the friendship and helping

each other then can solve the problems easily. For instance, when some students don’t

understand the lessons, other student explains as helping and sharing. They do not take

a pride like a teacher.

“We are helping each other and so friendly. Sometimes we have mocking

each other but rarely to have big problem. We do lesson together, playing violin,

music theory and music history and after all at taking rest time, we are talking or

discussing about our future plan, ambitious, knowledge and other funny things like

movie and television series. I love the violin class, my friends and teachers” (Violin

student, Female, aged 19, 3 years of studying violin)

Some students are shy to express by themselves to show their feeling. It is

good in some case but not for every cases. To know each other well, we have to

understand the other mind what kind of person they are and how they feel it in any

cases. So, our friend should build up the relationship in open type. If we feel friendly

to each other, those shiny men will not control too much to show their feeling.

Moreover, if this kind of good behavior will active in man, that will support and affect

in violin playing and music making. They will feel more comfort and confidence to do

the performance in public. Then some students have the feeling of fear and contract

mind. Those kinds of characters are disturbing in violin playing to express the feeling

and communication with people as well. They cannot mix easily with other people and

it takes longer time to build friendship with their classmates. Good friendship can rise

up self-confidence and encourage them.

“I feel so shy at first when I started study in violin playing in the class

room and to play in front of my teachers my homework revision and friends to show

my playing skills. After all along, I am so closed to my friends and being friendly with

them. Then some of changes became in my mind and the mind state situation engaged

me more free, less caring, calm and confidence. After those experiences when and

wherever I perform alone in public, I am trying to think like all of the people who

listen to me are my friends and my performance is not taking the exam and just

entertain to my friends. After all, I know well those kind of thinking process is make



I303

me feel good and my performance going through well very much” (Violin student,

Male, Aged 21, 5 years of studying violin)

“If I say about my friends, they like them. I would like to play with them

not only music but also other kinds of many playing games as well. I am okay with all

of my friends. But sometimes it rarely happened, I need to patience and clam to

communicate when my friend gets angry about some mistakes or did something

wrong. I have a kind of patience characteristic and do not like to anger. I think those

traits will help me in violin practicing. I can practice long time. Some of the songs are

difficult and I cannot get during one week and I keep my patience for one month or

one year. After all I can have accomplishment to play completely the songs that I

practice. That is why I think some of my character helps me a lot in studying violin.”

(Violin student, Male, Aged 24 years old and 7 years of studying violin)

2. Myanmar Traditions and Customs that become an Issue of

Teaching and Learning of Violin, Evolution and Resolving the

Problems

Interview with teachers

Teachers said traditions and customs are very important for our country

and in any other country too and it should be a good issue to be concern. Myanmar

traditions and customs traits and about their positive and negative facts are shown in

tables.

The Impacts of Myanmar Tradition and Customs of Positive and

Negative Facts on Violin Teaching and Learning

Topic Positive Negative

Respect, Polite, humble It can make the Trust easily without



I304

– Admiration,

Deference, Valuing

other-(Mostly, one of

Myanmar peoples’

customs is showing

respect to their elders.)

communication advantage in

human society because

treating each other nicely

instead of judging.

Moreover, do not insult,

mock and talk about people

behind their backs. Caring

other people feeling and do

not pressure them what they

do not want to do.

awareness and critical

mind then believe and

follow the way whatever

right or wrong is kind of

dangerous situation

because It can be

misleading to the wrong

way. Sometimes too much

politeness turn to humble

and it seem like out of

confidence as well.

Shyness, Fear and

Anxiety – Kind of Self-

conscious, bashful,

showing nervousness,

insecure and

unconfident-(Myanmar

people have ordinarily

shyness in character.)

Modest, calm, less

conversion and good listener,

deeper friendship, shrink

from compliments, thinking

carefully before act, prepared

well themselves to achieve

goals.

Express themselves less,

Reserve, Introvert, hidden

thought and opinion,

awkwardness and

uncomfortable, antisocial,

perform with less emotion,

body movements and eyes

contact.

Honesty – Purity of

Innocent, showing

maturity and self-

acceptance (Most of

Myanmar people

honestly and simple life

style.)

It is kind of doing the right

things like no lying and

talking frankly, no cheating

and be faithful, no deceiving

and candid. Live the life as

simple and telling the truth,

and self-respect. Honesty can

make the best connection

with the people because of

the people trust and come

closer to the honest person.

Honesty of traits such as

frank talker cannot hide

secret and simple thinking

can get cheating from

other. Sometimes frank

talking can make

embarrasses to other

according to the

circumstances.

Encouragement – good Encouragement can support Encouraging for the wrong



I305

motivation and support

other – (Myanmar

people like encouraging

and usually the elders

encourage to their

younger.)

to evolve the students’ effort

for their study and deduct the

depression. Can build the

positive relationship and

supportive to other.

practice way, manners,

behaviors and attitude will

be bad.

Frank and Outgoing –

Myanmar people

usually warm and

friendly and talking

way is directly and

sincere.)

The habit of friendly to other

is good to make friendship in

a classroom and

environment. Good reason to

avoid the conflict and fight

with each other.

Criticism – A form of

communication,

Judgments ( Myanmar

people cannot accept the

bad critical talking and

so sensitive)

Accepting the critic about

themselves seem it’s has the

self-acceptance and some of

the critic should accept

because it can make to

improve the study or to

prevent the mind process, or

to stop ding mistakes

Individualism – Self-

reliance and independent

( some of Myanmar

people culture is

individualism)

Being individualist can

achieve in self-study with

their self-determination and

will depend less on other.

Collectivism – Tightness

and interdependence

( some of Myanmar

people of culture has

collectivism and they are

usually follow the

Being collectivism is good

for group activity and they

are dutiful and obligation

person.



I306

society harmoniously)

Self- confidence and

self-esteem – believe in

him/herself, happy and

satisfy ( Usually

Myanmar people of

habits and viewing mind

process themselves has

self-esteem and self-

confidence is not stable

and according to

situation has the

tendency)

Being self-confidence that

habit set up in human can

make the people to achieve

their goal straightly, dare to

take the risk and adventure

as well. Being self-esteem, it

will brought you to happy

life and respecting others and

him/herself. They can accept

their mistakes and learn from

that.

Table2. The Traits of Myanmar Traditions and Customs and Development of

Violin Study

Topic Facts and Brief Explanation

Traditions

and Customs

between

Teachers and

Students and

their

relationship

Characteristics, Behaviors and feeling of nature mind

Teachers– according to old ages, teachers’ nature, they are basically

patience, encouragement, Creative, Strict, Flexible, Funny, most of

them good at public relation but not all teachers, sometimes

disappointing and a bit aggressive, Shy, Afraid to do bad things,

Students – polite, obedience, shy, afraid to do mistakes, innocence,

respect, honesty, purity of thought and sensitivity, friendly.

Collectivism

and

Individualism

To differentiate the Collectivism and Individualism – their

tendency is on the side of collectivism and it usually good at group

working. The weakness on the side Individualism is less express

them and hide their feeling. In that case good and bad effect is

together to be a good violin player and musician.



I307

Violin Study Teaching and Learning – Violin studying is developed day by day

and according to digital age, the learners can study not only by

violin teachers and books but also from internet website, TV

channel as well.

Success and

Failure of

Violin

Teaching and

Learning in

Myanmar

Success for development and Still weak requirement for violin

study – Myanmar people of interest and studying about violin has

development and improved more and more even though music

education and violin techniques are still weak. Anyway it is better

than a lot if we compared the past.

4) Requirements of general music studies in Myanmar

Table Detailed in Topic and Explanation Facts

General

Music

Education

Music Education – There is no Primary, Secondary and High

School of Regular Music Education Curriculums and just do for

music activities and events occasionally.

Music University and Schools – There are a few numbers of Music

Universities and Schools.

Violin

Teaching and

Learning

Violin Study – There are lots of requirements and needs about

technically and literally to build up the good violin players. Several

of Violin Methods books and studies are need and qualified violin

teachers as well. Not only watching and virtuoso violinists on TV

channel and Internet website but also should have watch lots of

violin performance concert in outside for violin learner. Nowadays

of violin learner are getting those good chances and the situation I

better than past time.

Musicianship Myanmar people and Musicianship – to be a good musician,

Myanmar people still needs to train too many things and violin

practice. Anyway violin learners are improve in musicianship as



I308

well if we compared in the past time.

The

Requirements

of Violin

Study

Good ahead to violin study in Myanmar- Nowadays of violin study

is a lot better than before and impressively improve day by day even

though still weak if we compared to other countries.

Discussion

Based on the data analysis on information of teachers and students

interviews and observation, by understanding the research questions of objective

study; The discussion of findings involve to discuss the facts about Myanmar

traditions and customs, general characteristic, divergent of teaching and learning

playing styles of violin, between teacher and students relationship, Musical studies

used in Myanmar, personal and social constrain to teaching and learning process and

to know the music and violin general studies requirements. All of these main finding

facts will discuss by following facts by combining;

1. Myanmar Traditions and Customs and Violin Study of success and failure

and teachers and students relationship from the past and present

2. The outline of General studies and requirements

1.) Teacher and Students relationship is important for classroom and studying. Brophy

suggest that if the teachers’ think of themselves primarily as instructors, their respond

will be negative to the students. They act like aggressively, interpersonally

disconnected to the students and classroom (Brophy, 1985). In case, according to data

analysis, teacher and student relation is quite good even though traditionally teacher

role play in Myanmar as an instructor or authority because most of teachers are kind to

their students, motivated and encourage according to their habit. Students are also

polite and give respect to their elders who is included parent, teachers, brothers and

sisters. That is why usually the classroom study of interrelation is harmoniously

between teachers and students. Politeness and nice treating each other is one of the



I309

reason to avoid the fight and conflict. In Myanmar school, there may have some fight

or conflict and it rarely happen. Then that kind aggressive thing and anger event are

strongly restricted at school, home or other places too. Teacher want the students to

solve the problems by discussing, negotiating by improving their thinking process.

The other ways is if the students have the problems, teacher wants them to come and

let him know to solve the problems together. Teacher expects the classroom society

with valuing and trusts each other such as nice treating, no insult and caring the feeling

and emotion good or bad, supportive and helping.

2.) Music studying in Myanmar, the entire teacher used western violin lesson books

and they do not have the own Myanmar originated lesson or book about violin

studying. Researcher thought Western violin tutor is very systematically and good to

build up from the beginning until to advance. Moreover we should have the Myanmar

tradition violin tutor and etudes that based on violin Myanmar traditional music.

Violin teaching and learning process of personal constrain is related to teachers,

school and University, musical environment, parents supports, worldwide Internet and

musical concert. At first, violin teacher should be a good role model of violin playing

or famous at good teaching. University and School are very important to show their

ability what they can do for every learner like they have good teachers for students and

facilitates such as good sound safe studio rooms, instruments supporting. In students

and teaching and learning, parents are also very important and if the students can get

the parents supporting absolutely that will be more helpful in studying. About musical

environment, it is very important.

Recommendation

Some of Myanmar traditions and customs are good and some might be bad.

That is why the people should think which is more useful for them and good impacts

for daily life style, relationship, communication, health and any cases. Likewise in

violin teaching and learning as well, what kind of things should keep from the old

traditions and which one are should discard, they have to carefully think and act



I310

wisely. For example, polite is good but do not need to so humble and sway on other

opinion, trust their own and act bravely what they want to, do not need to follow other

but they need to rise up as leader by themselves as well.

References

BIBLIOGRAPHY

Bloom, A. (1991). The republic of Plato, U.S.A: BasicBooks A Division of Harper

Collins Publishers

Hofstede, G. (1997).Culture and organizations: software of the mind. London:

MaGraw Hill.

Menuhin, R. (2009). The Violin an Illustrated History. Flammarion, Paris: Rizzoli

Intonations, Inc.

Young, W. (1990). An Integrated Music Program for Elementary School. New Jersey:

Prentice – Hall, Inc. U.S.A.

F, Heger, (1902). Alte Metalltromeln aus Sudest-Asie; Leipzig

Marshall, H.I, (1922). The Karen People of Burma: Columbus. A Study

in Anthropology and Ethnology

Marshall,H.I. (1929). Karen Bronze Drums, Journal of the Burma

Research Society, pp. 1-14.

Cooler, R. M. (1986). The Use of Karen Bronze Drums in the Royal

Courts and Buddhist Temples of Burma and Thailand: A

Continuing Mon Tradition?, Papers from a Conference on

Thai Studies in Honor of William J.Gedney Michigan

Papers on South and Southeast Asia, No 25, Ann Arbor, pp.

107-20.

Cooler, R.M. (1994).The Karen Bronze Drums of Burma, Leiden:

Types, Iconography, Manufacture, and Use



I311

Talbot, J. (September, 1997). Mission Unstoppable, The Strad, Vol. 108:1289, pp.979,

981 – 982.

Galamian, I. (1985). Principles of Violin Playing and teaching third edition.

Englewood cliffs, New Jersey: Prentice-Hall, Inc.

Rush, M. (2006). Playing the Violin. New York: Routledge (Taylor and Francis

Group).

Howard, C (2008). How the Violin plays the violinist. USA: Ink Well Publishing

Arlington, MA.

Starr, W. (2000). The Suzuki violinist; A guide for teacher and parents (Rev. ed.).

U.S.A; Summy – Bichard Music.

Galamian, I. (1962). Principles of violin playing and teaching. Englewood cliffs, NJ:

Prentice – Hall.



I312

Author Name – Miss Myat Thiri Nyein

ID Number – 5538131

Master’s Program/ Field of the Study – Music Education Program

Institute – College of Music, Mahidol University



I313

A Comparative Study of Heavy Metal Contamination in Conventional and Organic Rice Kudkanut Cheunwongaroon Environmental Management and Technology Mahidol University Abstract

The present research study aimed to investigate and evaluate the amount of heavy metal contents in Mali Nil Surin Rice growing from two different rice cultivation techniques, conventional and organic farming systems. At different growth stages; vegetative, reproductive and ripening stages, rice plants were collected to measure and evaluate their physical development before oven dried and digested with wet-acid digestion technique. The amounts of Cadmium (Cd), Chromium (Cr), Copper (Cu), Lead (Pb) and Zinc (Zn) in the plant tissues were determined by using the Flame Atomic Absorption Spectrometry (F-AAS).

Due to the excessive rainfalls in July and early winter in the year of 2016, the rain-fed conventional farming system produced rice with short heights, less tillers, less numbers of panicles and grains compared to the organic rice which had its own water controlling system. As a result, the absolute growth rates of conventional rice plants displayed their exponential growth, the acceleration to produce grains in 80 days time while organic rice took nearly 100 days to grow.

In heavy metals analysis, metals found in rice plants at different growth stages were in the suitable range for plant to grow; Cr (1-3 mg kg-1 ), Cu (20-60 mg kg-1) and Zn (< 100 mg kg-1). Pb was undetected in both paddy fields. However, Cd found in the conventional rice grain (0.14 mg kg-1), was considered to be too high according to the FAO standard (Cd < 0.1 mg kg-1) but it was under the maximum level allowed in European and Asian countries (Cd < 0.2 mg kg-1). From the analysis of variance, the major factors which statistically affected the contaminations of heavy metals in rice were the stages of growth and the differences in parts of accumulations.

In conclusion, plants were capable to restrict toxic metals in root to minimize the threats from toxicity. However, under numerous variables in the environment and the agricultural activities, heavy metals could be brought to the soil alongside other essential nutrients for plants, which provided accessibility for plants to absorb and mobilize into reproductive organs of plants such as panicles and grains, and posed the threats to all consumers. Keywords: Heavy metals, Rice, Organic paddy field, Conventional paddy field Introduction

Rice is one of the major staple foods in the world, feeding half of world’s population (Redfern, Azzu and Binamira, 2012). Over centuries, rice is irreplaceable as the main basis of dietary especially in Asia (Sohn, 2014). For Asia’s people, rice is not only a major source of food and income, it was part of country’s history, culture and belief in Asian society (Gomez, 2001).

However, there are serious threats lies hidden inside the rice grains which are normally overlooked by most of the people. Rice consumers or even the farmers themselves are not aware of the serious threat from heavy metals poisoning (Sarah,



I314

2013). Especially, in Asia’s developing countries where these toxic pollutants are undetected leaking into the environment, causing unusual and deadly illness to people (Arunakumara et al., 2013).

Even though, heavy metals are elements that can be naturally found in the earth crust, the industrialization, urbanization and the intensive agricultural practices are tremendously increasing the rates of extraction and accumulation of these heavy metals in the environment (Xu et al., 2014). Heavy metals are extremely pernicious because of their toxic, persistent and non-biodegradable characteristics in nature (APIS, 2014). Moreover, their toxicity can be magnified through various types of interactions with other elements presented in the nature (Wuana and Okieimen, 2011).

These metals are contaminated and accumulated in soil, air and water which later, transported into plants and living organisms, ready to be mobilized further into higher trophic of the food chains (Dalcorso, 2012). Heavy metal poisoning can cause serious health effects or death in humans and living organisms.

In the world of agriculture, rice farming is relying on the quality of soil and water. They are the most essential elements which can directly determine the quality and quantity of the crop productions.

Heavy metals can come from different sources, both direct and indirect pathways (Tangahu et al., 2011). Some can originate from far away sources carrying through wind and water. Some are already presented in the daily farm’s applications such as fertilizers and pesticides (Wuana and Okieimen, 2011). In spite of the increasing green agricultural practices, promoting the principle of the organic farming systems by avoiding the uses of all synthetic materials, the toxic metals are still presented in the agricultural soil. Even though environmental pollution and degradation can be recovered by nature, the understanding and effective managements are still relying in human hands (Boshoff et al., 2014).

In order to promote sustainable agriculture and notify the local farmers to beware of their utilizations of chemicals in their farmlands, concrete evidences and simple explanations are needed to be found and presented (Hu et al., 2014). It is the first major step that brings cooperation among the stakeholders, leading the conceptual ideas and plans into actions.

The present study can be further used as concrete evidence in raising local farmer’s awareness, promoting the organic farming system in the future for better living and environment. Objectives

1) To study the major practices of conventional and organic rice farming systems

2) To investigate the amount of heavy metals contents in Mali Nil Surin rice at different growth stages

3) To evaluate the amount of heavy metals contents in rice growing from both cultivation techniques


Study sites were the local paddy fields located in Sakae Phrong, Mueang District, Buriram Province. The rice plant samples were collected from the organic and conventional paddy fields which belonged to the local farmers in the Ban Sawai



I315

So community. Conventional paddy field was rainfed-rice farming system which totally depended on rainfall to grow rice while organic paddy field had its own pond and pumping system which could collect rainfalls and controlling water level in the field.

The conventional paddy field was located not far from the organic paddy field by having earth dyke and tall trees act as buffer between them. The selected areas were 80 m. x 45 m. (3,600 m2), which 6 plots based on the grid soil sampling techniques were selected as the sampling plots. The location of the conventional paddy field was on A spot while the organic paddy field was on B spot (Figure 1a). Rice plant samples were collected based on the growth and development stages of rice which in this case three phases were selected as follow; Phase 1: Vegetative stage, Phase 2: Reproductive stage and Phase 3: Ripening stage.

In each phase, plant samples were carefully collected and kept in plastic bags for future analysis. In this study, approximately 6 tillers of rice samples were collected per paddy field per phase. 6 plots in conventional paddy field were labeled as 1A, 2A, 3A, 4A, 5A and 6A while the plots in organic paddy field were labeled as 1B, 2B, 3B, 4B, 5B and 6B Rice plant sample in one meter radius of selected plot were collected in correspondent with soil sample (Figure 1b).

Figure 1 Study sites (a) and sampling plots (b)

In the first stage, rice plants collected from both paddy fields were mainly

divided into 3 parts which were root, stem and leaf. In the second stage, panicles were added in the parts needed to be analyzed and last in the third stage, husk and grain were added. Plant samples were separated into parts before their physical characteristics such as weight, height and length were measured. Including, numbers of panicles and grains were counted at the last two stages. (Table 1)

Absolute growth rates (AGR) which calculated from the height (AGRH) and weight (AGRW) of rice plants in each growth stage were used to determine the growth and development of rice plants. For conventional paddy field, numbers of days between intervals were 48, 21, and 10 days respectively. For organic paddy field, numbers of days between intervals were 62, 48, and 19 days respectively. Table 1 Rice samples and the parameters used in physical measurements No. Growth stage Parts of rice plants Parameters 1 Vegetative Root, stem, leaf - Wet/dry weight

- Length & width - Numbers of

panicle/grain 2 Reproductive Root, stem, leaf and panicle

3 Ripening Root, stem, leaf, husk and grain



I316

Hence, plant samples which separated into different parts from both paddy

fields were weighed, oven-dried and digested into solutions to be ready for heavy metal analysis using flame atomic absorption spectrometry. All samples were measured and done in triplicates to minimize errors in the data outputs. The procedures and methods used were described in the following table (Table 2).

Table 2 Methods used and references

No. Procedures Methods References

1 Sample preparations Oven-dried at 60°C for 48 hrs Particle size reduction (Campbell and

Plank, 1998) 2 Organic matter

destruction Wet acid digestion : mixtures of HNO3, HCl and H2O2

3 Heavy metals analysis

Cd, Cr, Cu, Pb and Zn were determined by F-AAS (Soon, 1998)

The basic information on the practices of organic and conventional

faming, including all information about the inputs, prices of rice and etc., were obtained from informal interviews with the local farmers and the owner of the paddy fields. All the data was analyzed using descriptive, inferential statistics and ANOVA by IBM SPSS Statistics (version 21.0). Results

The major practices of the conventional and organic farming systems were studied through the informal interviews with the owners and the fields observations in each time the rice samples were collected. The seasonal calendar was displayed the practices of the famers throughout the year of growing rice (Table 3).

Table 3 Seasonal calendar of conventional and organic farming systems Jan Feb Mar Apr May Jun Jul Aug Sep Oct Nov Dec

GS Seedling Vegetative Reproductive Ripening

A - Soil preparations Prepared seeds

Chem. fertilizer

Sowing

Chem.

fertilizer

Chem. fertilizer

Harvesting period

B - Soil preparations Prepared seeds

Transplanting + manure

Weed elimination +

Pruning

Non-Disturbing

period

Harvesting period

Note: GS = Growth stage A = Conventional farming, B = Organic farming

The conventional rice farming was begun with the process of soil preparations which generally started in March. Usually, the old rice stalks would be burned to ashes before the beginning of soil plough process.



I317

However, in this 2016 season, the burning process was decided not to be done in order to preserve and adjust the soil for future transition of growing organic rice farming. Instead of slash and burn, the famer used old rice straws to cover soil surface in its resting period to preserve moisture and avoid the organic matter destruction under the weather.

Conventional paddy field was using rice sowing technique to grow rice. Seeds were simply prepared and sowed in the field. Rain water was the only water source for the conventional paddy field. Chemical fertilizers, “Brand Top1”, with approximately 16-17 kg rai-1 were applied 3 times in one crop season. First time in the vegetative stage, 16:20:0 chemical fertilizer was applied, second in the early October before the panicle initiation, 15:15:15 was applied and finally in November, 7:14:21 was applied to the soil. However, some cow dunks could be found in the field from grazing of the local cows in the area because of the open access of the conventional paddy field. Rice in the conventional paddy field were allowed to be grown naturally, less agricultural activities were done during the growing period. Insects, crabs and mouse could be found in the paddy field. No measurements were conducted to eliminate these insects and pests. Weeds were plucked out. Rice would be ready to be harvested in late November to early December.

Organic rice farming was started similarly with soil preparation early in March. The processes were begun with plough the old rice stalks and plowing to replenish the soil. The sword bean was selected among legumes to be cultivated as green manure plants. In April, manure was applied to the soil before water was pumping up into the paddy field to eliminate weeds and made the soil ready for rice transplantation. In June, the process of seedling preparation was started. The farmers were growing rice seedling in the seedling trays which took around 20 to 30 days for rice seedling to be ready for transplanted in the paddy field. Organic rice transplantation was begun in late July. Rice seedlings would take around 90 days to develop and grow its tiller to maximum before start their panicle initiation in early October. During the rice vegetative stage, the processes of took care the rice were mostly done by the nature or the rice field ecosystem itself. The farmers allowed the nature took it cause. There was no insecticide or herbicide used. For weed elimination, machinery was used, as well as labors were used to take out the weed and pruning the plants. In reproductive stage, rice plants were allowed to grow in the non-disturbed environment. The farmers would make less interfere in this process. After growing more than 130 days, rice was in the ripening phase and ready to be harvested. In the harvesting period, no machines were used, including the harvesting process as well. Rice was harvested by the hands of the owners and friends, local farmers.

A total yield of the organic paddy field was around 490 kg rai-1. The Mali Nil rice in the organic paddy field was milled by local rice mill and packed in local package for sell. The price of organic Mali Nil rice was 80-100 baht kg-1.

Rice samples which had been collected from each phase were separated into various parts for physical measurements before heavy metals analysis. The results were represented rice growth and its development in each growth stage. (Table 4)

Rice plants were growing and increasing its biomass in each stage. The length of stem of conventional (a) and organic rice (b) were distinctly increasing from vegetative (Ma = 40.95, SDa = 0.64), (Mb = 33.33, SDb = 8.64) to reproductive (Ma =



I318

70.56, SDa = 3.24), (Mb = 103.02, SDb = 20.70) and lastly in ripening stage (Ma = 71.75, SDa = 6.14) (Mb = 110.71, SDb = 12.76), respectively.

Including, leaves of conventional and organic rice which were slightly increasing in its length from vegetative (Ma = 37.37, SDa = 6.79), (Mb = 47.85, SDb = 11. 46) to reproductive (Ma = 37.74, SDa = 4.16), (Mb = 48.54, SDb = 7.70) and shortly declined in the ripening stage (Ma = 36.45, SDa = 3.28) (Mb = 47.79, SDb = 3.47), respectively.

In reproductive stage, organic rice produced higher number of panicles (Mb = 120, SDb = 23) than conventional rice (Ma = 88, SDa = 14). Therefore, the number of organic grains (Mb = 103, SDb = 15) were also slightly higher than conventional grains (Ma = 96, SDa = 18). Table 4 Physical Measurement of Rice Plants (Mean ± SD)

Stage Rice field

Plant Parts

Weight (g) Size (cm) Numbers

Wet Dry Length Width

Veg

etat

ive

stag

e A Root 2.12 ± 0.38 0.34 ± 0.06 9.00 ± 0.64 0.10 ± 0.00 - Stem 2.95 ± 0.84 0.76 ± 0.23 40.95 ± 0.64 0.69 ± 0.05 - Leaf 0.19 ± 0.04 0.11 ± 0.02 37.37 ± 6.79 0.78 ± 0.09 -

B Root 2.60 ± 0.66 0.34 ± 0.13 10.59 ± 4.55 0.11 ± 0.01 - Stem 4.28 ± 1.92 1.08 ± 0.63 33.33 ± 8.64 1.08 ± 0.16 - Leaf 0.33 ± 0.10 0.17 ± 0.06 47.85 ± 11.46 1.01 ± 0.23 -

Rep

rodu

ctiv

e st

age

A Root 1.10 ± 0.36 0.33 ± 0.08 9.21 ± 1.50 0.10 ± 0.00 - Stem 4.18 ± 0.58 1.50 ± 0.26 70.56 ± 3.24 0.90 ± 0.04 - Leaf 0.15 ± 0.03 0.10 ± 0.01 37.74 ± 4.16 1.10 ± 0.06 - Panicle 0.92 ± 0.27 0.55 ± 0.12 - - 88 ± 14

B Root 3.48 ± 2.12 0.88 ± 0.48 11.71 ± 1.52 0.11 ± 0.02 - Stem 7.08 ± 2.65 2.66 ± 0.92 103.02 ± 20.70 1.06 ± 0.16 - Leaf 0.26 ± 0.08 0.22 ± 0.06 48.54 ± 7.70 1.00 ± 0.10 - Panicle 1.16 ± 0.48 0.84 ± 0.28 - - 120 ± 23

Rip

enin

g st

age

A Root 1.58 ± 0.64 0.42 ± 0.14 10.85 ± 3.17 0.10 ± 0.00 - Stem 3.57 ± 0.76 1.06 ± 0.21 71.75 ± 6.14 0.91 ± 0.07 - Leaf 0.11 ± 0.02 0.10 ± 0.02 36.45 ± 3.28 1.21 ± 0.03 - Husk 0.07 ± 0.01 0.06 ± 0.01 - - - Grain 0.21 ± 0.05 0.13 ± 0.02 - - 96 ± 18

B Root 2.53 ± 0.77 0.49 ± 0.12 9.00 ± 1.34 0.10 ± 0.00 - Stem 7.32 ± 1.73 2.35 ± 0.61 110.71 ± 12.76 1.09 ± 0.15 - Leaf 0.20 ± 0.03 0.17 ± 0.02 47.79 ± 3.47 1.10 ± 0.08 - Husk 0.05 ± 0.01 0.04 ± 0.01 - - - Grain 0.14 ± 0.04 0.08 ± 0.02 - - 103 ± 15

Note: A = Conventional paddy field, B = Organic paddy field



I319

The coefficient of variation was conducted to analyze the variability of the data set (Table 5). The highest dispersion of data was presented in the dataset of root which was high up to 42.97 % in the root’s length and up to 60.92 % in wet weight. The minimum dispersion was occurred in the width data sets of rice plants which the coefficients of variations were under 23 % for all rice in conventional and organic paddy fields.

Table 5 Coefficient of variations in the physical measurements of rice plant (%)

Stage Rice field

Plant Parts

Weight Size Wet Dry Length Width

Veg

etat

ive

stag

e A Root 17.92 17.65 7.11 0.00

Stem 28.47 30.26 1.56 7.25

Leaf 21.05 18.18 18.17 11.54

B Root 25.38 38.24 42.97 9.09

Stem 44.86 58.33 25.92 14.81

Leaf 30.30 35.29 23.95 22.77

Rep

rodu

ctiv

e st

age

A Root 32.73 24.24 16.29 0.00

Stem 13.88 17.33 4.59 4.44

Leaf 20.00 10.00 11.02 5.45

Panicle 29.35 21.82 - -

B Root 60.92 54.05 12.98 18.18

Stem 37.43 34.59 20.09 15.09

Leaf 30.77 27.27 15.86 10.00

Panicle 41.38 33.33 - -

Rip

enin

g st

age

A Root 40.51 33.33 29.22 0.00

Stem 21.29 19.81 8.56 -

Leaf 18.18 20.00 9.00 2.48

Husk 14.29 16.67 - -

Grain 23.81 15.38 - -

B Root 30.43 24.49 14.89 0.00

Stem 23.63 25.96 11.53 13.76

Leaf 15.00 11.76 7.26 7.27

Husk 20.00 25.00 - -

Grain 28.57 25.00 - - Note: A = Conventional paddy field, B = Organic paddy field

From the physical measurements, the absolute growth rate of rice plants from both conventional and organic paddy fields were evaluated to represented its growth since the beginning of the rice farming through each stage.

For phase 1 or vegetative stage, AGRH and AGRW of conventional rice were 1.82 cm day-1 and 0.03 g day-1, respectively while AGRH and AGRW of organic rice was 1.48 cm day-1 and 0.03 g day-1, respectively. AGR of conventional rice was a little bit higher but no significant differences (Figure 2).



I320

For phase 2 or reproductive stage, AGRH and AGRW of conventional rice were higher at 5.60 cm day-1 and 0.12 g day-1, respectively while AGRH and AGRW of organic rice were 3.19 cm day-1 and 0.10 g day-1, respectively (Figure 2).

For phase 3 or ripening stage, AGRH and AGRW of conventional rice were still higher at 11.91 cm day-1 and 0.30 g day-1, respectively while AGRH and AGRW of organic rice was 8.82 cm day-1 and 0.23 g day-1, respectively (Figure 2).

Figure 2 Absolute growth rates of rice plants on height (a) and weight (b) basis

Therefore, conventional rice was growing late due to the excessive rainfall in July which caused the duration time of its growth to be shortened compared to the organic rice. Therefore, AGR of conventional rice displayed higher exponential rate. Rice plants were adapting themselves and accelerated their growth, ensuring to reproduce and produce grains before the crop season ended.

Heavy metal contents in different growth stages and different parts of rice

plants were presented in the following table (Table 6). The analysis of variances was conducted. The influences of the major factors (growth stage, sites and parts of plant) on the accumulation of heavy metals in rice plants were presented in the following tables (Table 7-9).

In vegetative stage, Cd content was highest in the root of both conventional and organic rice, 0.90 and 1.12 mg kg-1, respectively. Cd was declined in the upper parts of rice plant. The highest Cr content was in the root part of both conventional and organic rice as well, which were 13.72 and 7.92 mg kg-1, respectively.

The lowest amount in the stem was around 4.50 mg kg-1. Cr was considered high in the leaf of both rice plants which were around 7.63 and 6.85 mg kg-1, respectively. The highest mean concentration of Cu content was in the root of both conventional and organic rice, 28.84 and 22.62 mg kg-1, respectively. The highest mean concentration of Zn content was in the stem for conventional rice, 50.67 mg kg-1 and in the leaf part of organic rice, 46.15 mg kg-1 (Table 6).

In reproductive stage, Cd was still the highest accumulated in the root especially for conventional rice which was 0.32 mg kg-1 while in organic rice was only 0.19 mg kg-1. However, in the panicle, Cd content was higher than the accumulations in stem and leaf parts especially for conventional rice, Cd in panicle was 0.23 mg kg-1. Cr was highest in the rice panicle especially for organic rice which was high up 10.47 mg kg-1. Cu was still the highest in the root for conventional rice



I321

which was 15.31 mg kg-1 while in organic rice was only 8.83 mg kg-1. However, the amount of Cu was a relatively high in the panicle for both rice plants. In conventional rice, Cu content was 8.95 mg kg-1 while in organic rice; Cu content was high up to 12.72 mg kg-1. The highest mean concentration of Zn was in the stem and panicles for conventional rice, 34.48 and 23.82 mg kg-1, respectively. However, in the panicle of organic rice was shown the highest accumulations at 35.04 mg kg-1 (Table 6).

In ripening stage, Cd in the root was still the highest for both conventional and organic rice, 0.45 and 0.23 mg kg-1, respectively. However, Cd contaminated in the rice grain from conventional paddy field, 0.14 mg kg-1, while in the upper parts of organic rice plants were undetected. Cr in the husk was the highest for both conventional and organic rice, 9.78 and 8.76 mg kg-1, respectively.

In stem, leaf and grain were lower than 0.05 mg kg-1 for both conventional and organic rice. Cu was still the highest in the root for both conventional and organic rice, 17.97 and 32.57 mg kg-1, respectively. In husk and grain were relatively high compare to the amount of contamination in stem and leaf. The amounts of Cu in rice grain for conventional and organic rice were 8.63 and 9.41 mg kg -1, respectively. Zn was relatively high in the rice grain at 40.10 mg kg-1 while organic rice grain contained only 25.22 mg kg-1. In the husks for conventional and organic rice plants, the mean concentrations of Zn were 11.46 and 13.67 mg kg-1, respectively (Table 6). Table 6 Heavy metals in different growth stages of rice (Mean ± SD) (mg kg-1)

Rice Field

Plant Parts Cd Cr Cu Pb Zn

Veg

etat

ive

stag

e

A Root 0.90 ± 0.12 13.72 ± 4.36 28.87 ± 15.91 ND 19.24 ± 4.43 Stem 0.59 ± 0.11 4.53 ± 0.59 6.75 ± 0.42 ND 50.67 ± 15.67 Leaf ND 7.63 ± 1.44 7.04 ± 0.74 ND 18.69 ± 3.69

B Root 1.12 ± 0.20 7.92 ± 1.46 22.62 ± 10.88 ND 29.37 ± 8.83 Stem 0.54 ± 5.47 4.81 ± 0.68 8.52 ± 2.27 ND 31.47 ± 5.47 Leaf ND 6.85 ± 0.55 8.11 ± 1.37 ND 46.15 ± 15.41

Rep

rodu

ctiv

e st

age

A Root 0.32 ± 0.29 ND 15.31 ± 7.63 ND 10.87 ± 2.13 Stem ND 4.60 ± 0.55 14.77 ± 10.68 ND 34.48 ± 7.31 Leaf ND 6.28 ± 0.39 7.42 ± 0.65 ND 28.93 ± 3.85 Panicle 0.23 ± 0.16 ND 8.95 ± 1.34 ND 23.82 ± 2.93

B Root 0.19 ± 0.11 7.62 ± 1.22 8.83 ± 0.91 ND 18.62 ± 5.54 Stem ND 5.40 ± 0.52 5.60 ± 0.41 ND 24.20 ± 3.56 Leaf ND 3.89 ± 0.61 6.37 ± 0.62 ND 25.00 ± 3.77 Panicle ND 10.47 ± 2.53 12.72 ± 11.16 ND 35.04 ± 4.78

Rip

enin

g st

age A Root 0.45 ± 0.23 ND 17.97 ± 7.16 ND 11.75 ± 5.78

Stem ND ND 5.03 ± 1.08 ND 26.65 ± 13.32 Leaf ND ND 11.90 ± 3.07 ND 9.69 ± 2.77 Husk ND 9.79 ± 4.88 6.00 ± 2.90 ND 11.46 ± 1.48 Grain 0.14 ± 0.09 ND 8.63 ± 0.67 ND 40.10 ± 4.00



I322

B Root 0.23 ± 0.22 9.78 ± 8.63 32.57 ± 8.63 ND 22.07 ± 3.93 Stem ND ND 4.70 ± 0.97 ND 51.99 ± 8.78 Leaf ND ND 2.69 ± 0.38 ND 10.84 ± 1.44 Husk ND 8.76 ± 5.38 8.24 ± 3.35 ND 13.67 ± 2.17 Grain ND ND 9.41 ± 3.46 ND 25.22 ± 1.97

Note: A = Conventional paddy field, B = Organic paddy field ND = not detected

The analysis of variances showed the effects of growth stages on heavy metals contaminations in rice plants (Table 7). There were significantly differences of three growth stages on Cd, Cr, Cu and Zn contaminations in rice at p < .05, [F(2, 59) = 48.632, p < .001, F(2, 86) = 3.097, p = .050, F(2, 141) = 4.532, p = .012, F(2, 141) = 8.599, p < .001], respectively.

The Tukey HSD tests were conducted to analyze the differences among means. The test indicated that the mean score for Cd content in vegetative stage (M = 0.79, SD = 0.25) was significantly different from reproductive (M = 0.23, SD = 0.12) and ripening stages (M = 0.35, SD = 0.16). There was no statistically significant difference in mean scores between reproductive and ripening stages. In addition, a Tukey HSD test revealed there was no statistically significant difference between the amounts of Cr in each growth stage (p > .05). Cu content in vegetative stage (M = 13.76, SD = 11.54) was significantly different in ripening stage (M = 9.02, SD = 5.87). There was no statistically significant difference in mean scores between reproductive stages (M = 10.05, SD = 5.56) and the others. Zn content in vegetative stage (M = 32.60, SD = 14.60) was significantly different in reproductive (M = 25.10, SD = 8.16) and ripening stages (M = 21.25, SD = 14.98). There was no statistically significant difference in mean scores between reproductive and ripening stages.

Table 7 One-way analysis of variance of heavy metals by growth stages

ANOVA Growth stages SS df MS F Sig.

Cd Between Groups 3.944 2 1.972 48.632 .000 Within Groups 2.392 59 .041

Total 6.336 61

Cr Between Groups 66.001 2 33.001 3.097 .050 Within Groups 916.295 86 10.655

Total 982.296 88

Cu Between Groups 523.989 2 261.995 4.532 .012 Within Groups 8150.522 141 57.805

Total 8674.511 143

Zn Between Groups 2906.646 2 1453.323 8.599 .000 Within Groups 23830.349 141 169.010

Total 26736.995 143 Note: p < .05



I323

The analysis of variances showed the influences of rice plants parts on heavy metals contaminations (Table 8). There were significantly differences on Cd, Cr, Cu and Zn contaminations in different part of rice plant at p < .05, [F(4, 57) = 4.261, p = .004. F(4, 84) = 10.649, p < .001. F(5, 138) = 15.537, p < .001. F(5, 138) = 16.768, p < .001], respectively. Post- hoc Turkey HSD test revealed there was no statistically significant difference between heavy metal contents in each part of rice plant (p > .05), except in the root which showed the significant difference (p < .05). Table 8 One-way analysis of variance of heavy metals by parts of rice plant

ANOVA Parts of rice plant SS df MS F Sig.

Cd Between Groups 1.459 4 .365 4.261 .004 Within Groups 4.878 57 .086

Total 6.336 61

Cr Between Groups 330.522 4 82.631 10.649 .000 Within Groups 651.774 84 7.759

Total 982.296 88

Cu Between Groups 3124.351 5 624.870 15.537 .000 Within Groups 5550.160 138 40.219

Total 8674.511 143

Zn Between Groups 10104.589 5 2020.918 16.768 .000 Within Groups 16632.406 138 120.525

Total 26736.995 143 Note: p < .05

An independent sample t-test was conducted to compare the means of

heavy metals contamination between two study sites, conventional and organic paddy fields with 95% confidence interval of the difference (Table 9).

The results indicated that there was no significant differences in Cd contaminations in rice plants from conventional (M = 0.47, SD = 0.26) and organic paddy fields (M = 0.54, SD = 0.39); t(45) = -0.90, p = .929.

Similarly, there were no significant differences in Cr contaminations in rice plants from conventional (M = 7.64, SD = 3.93) and organic paddy fields (M = 6.88, SD = 2.80); t(66) = 1.024, p = .310.

There was no statistically difference in Cu content in rice from conventional (M = 11.64, SD = 8.46) and organic paddy fields (M = 9.46, SD = 6.94); t(142) = 1.692 , p = .093.

There was no significant differences in Zn contents in rice from conventional (M= 23.86, SD = 14.00) and organic paddy field (M = 26.88, SD = 13.27); t(142) = -1.331, p = .185.



I324

Table 9 Compare means of heavy metals contents in conventional and organic rice

Independent t-test Levene's Test for

Equality of Variances t-test for Equality of Means

F Sig. t df Sig. (2-tailed)

Mean Difference

Std. Error Difference

95% Confidence Interval of the Difference

Lower Upper

Cd

Equal variances assumed 4.528 .037 -.093 60 .926 -.007742 .082926 -.173619 .158136

Equal variances not assumed

-.090 44.962 .929 -.007742 .086233 -.181427 .165944

Cr

Equal variances assumed 4.051 .047 1.067 87 .289 .761023 .713208 -.656555 2.178600


1.024 65.953 .310 .761023 .743086 -.722615 2.244660

Cu

Equal variances assumed 1.619 .205 1.692 142 .093 2.182639 1.289707 -.366867 4.732145


1.692 136.757 .093 2.182639 1.289707 -.367708 4.732985

Zn

Equal variances assumed .041 .840 -1.331 142 .185 -3.024417 2.272845 -7.517402 1.468569


-1.331 141.611 .185 -3.024417 2.272845 -7.517508 1.468675

Note: p < .05, p < .02 (two-tailed)



I325

Discussion According to the informal interview with the owner, conventional rice

paddy field was started sowing late due to the excessive rainfalls in July and early upcoming winter in 2016. The rice plants grew from conventional paddy fields showed some visible signs indicated the delayed in growing during crop season. From field observation and physical measurements, conventional rice plants were shorter in height, produced less tillers and less panicles compared to the organic rice.

According to the Figure 2, the graph similarly indicated the higher growth rate of conventional rice, because rice plants were accelerated their growth, trying to grow and produce grains before the crop season was over. The amount of time or days after sowing for conventional rice was also shorter, around 80 days while organic rice took almost 100 days after transplanting.

For heavy metal contamination in rice plant, Cd found in the conventional rice grain was 0.14 mg kg-1. According to EU (2006) and standards in Asian countries (Thai MOPH, 1986; China MOH, 2012), Cd in conventional rice was under permitted level (Cd < 0.20 mg kg-1) but it was higher than the FAO Codex (1995) standard for food (Cd < 0.10 mg kg-1).

According to the results, majority of Cd content was restrained in the root parts, only small amount of Cd had been transported up to upper parts of rice plant. However, according to Dalcorso (2012), Cd could mobilize to the vegetative and reproductive organs, as similar as the results, which Cd was concentrated in the panicles (0.23 mg kg-1) and grains (0.14 mg kg-1) of the conventional rice.

Heavy metals could be easily uptake and transport by plants to accumulate in different parts, even though some metals such as Cd and Cr which were known as toxic metal with no biological function for plants (Dalcorso, 2012). Cd and Cr could be restrained in the root parts, but some were capable to be interrupted others metals or chemical compounds to be transport up in upper parts of rice plants.

For Cr, it was more complicated because of its complex chemistry. The concentration of Cr mostly accumulated in the root parts, but it could mobilize and accumulate in the upper parts of rice plants. Cr found in rice husks for both paddy fields but undetected in the rice grain.

The amount of Cr found in rice samples were under the suitable range, 1-3 mg kg-1 that plants were normally grew. There was no Cr found in the rice grain from both paddy fields. According to Arunakumara et al. (2013), rice plants could act as hyper-accumulators of Cr, Ni and Co, these metals could be transfer up from root to grain but the concentrations in the edible grain were significantly below the food standards. These two toxic metals could derived from chemical fertilizers especially Cd which mainly originated from anthropogenic sources. Similarly, no trace of Pb found in rice plants and its grains from both paddy fields.

For Cu and Zn, they were micronutrients for plants which the amounts found in plants were considered to be relatively high compared to other metals. Both Cu and Zn were found in the range that plants normally grew (20-60 mg kg-1 and < 100 mg kg-1), respectively (Chaney, 1982). Cu and Zn were micronutrients for plants. These metals could originate from parent materials and both livestock manure and phosphate-based fertilizers (Arunakumara et al., 2013).

From the analysis of variance and independent t-test, it showed that plant functional ability to absorb nutrients and metals available in the environment was the



I326

major factor influencing the heavy metals found in each particular part of plant. Toxic metals such as Cd and Cr, plants had their own ability to restrict these metals in root to protect itself from harms.

However, under various factors and circumstances these toxic metals were mobilized to upper parts of rice plants alongside the other essential nutrients, which could accumulated in the reproductive organs such as panicles and grains, and posed the threats for all consumers. The activities of the farmers in different stages of rice growth were directly increased the metals input to the environment which allowed the accessibility for rice plants to uptake metals and accumulated into its grains.

Recommendations

1.) Plants samples should be measured their physical characteristics in few days after collected from the field because plant materials could easily loss their moisture and its physiques could easily change

2.) Plants samples should be dried in the oven at 60 – 70 ºC more than 48 hours in order to make sure it was properly dried and would not cause moles or other contaminants to generate in the samples

3.) All the laboratory glassware need to be cleaned and soaked in nitric acid for 24 hours before uses to eliminate residue and contaminants which could interfere the heavy metal contents in the analysis

References APIS (Air Pollution Information System). (2014). “Heavy metals: Introduction.”

Available from http://www.apis.ac.uk/overview/pollutants/overview_ HM.htm

Arunakumara, K.K.I.U., Walpola, B.C., and Yoon, M.H. (2013). “Current status of heavy metal contamination in Asia’s rice lands.” Reviews in Environmental Science and Bio/Technology, 12: 355-377.

Boshoff, M., DeJonge, M., Dardenne, F., Blust, R., and Bervoets, L. (2014). “The impact of metal pollution on soil faunal and microbial activity in two grassland ecosystems.” Environmental Research, 134:169–180.

Campbell, C.R., and Plank, C.O. (1992). “Preparation of plant tissue for laboratory analysis.” In Yash P. Kalra (Eds.), Handbook of reference methods for plant analysis, 37-49. United States: CRC Press.

Chaney, R.L. (1982). “Fate of toxic substance in sludge applied to cropland.” In: Proc International Symposium on Land Application of Sewage Sludge, Association for the Utilization of Sewage Sludge. Tokyo, Japan.

China MOH. (2012). “Maximum allowable level of metals in Rice.” May 22. Dalcorso, G. (2012). “Heavy Metal Toxicity in Plants.” Plants and Heavy Metals: 1-

25. EU. (2006). “Commission Regulations no. 1881/2006.” May 22. FAO. (1995). “Codex-stan 193-1995.” May 22. Gomez, K. A. (2001). “Rice, the grain of culture.” Paper presented at the Siam

Society Lecture Series, The Siam Society, Bangkok, Thailand. Hu, X.F., Jiang, Y., Shua, Y., Hu, X., Liu, L., and Luoa, F. (2014). “Effects of mining

wastewater discharges on heavy metal pollution and soil enzyme activity



I327

of the paddy fields.” Journal of Geochemical Exploration, 147: 139–150.

Jones, J.B. Jr. (1998). “Handbook of Reference Methods for Plant Analysis.” In Y. P. Kalra (Eds.), Field sampling procedures for conducting plant analysis , 25-36. Florida, United States: CRC Press.

Thailand, MOPH (1986). “General Standard for Contaminants and Toxins in Food, B.E. 2529 (1986).” May 22.

Redfern, S.K., Azzu, N., and Binamira, J.S. (2012). “Rice in Southeast Asia: facing risks and vulnerabilities to respond to climate change.” Paper presented at the Building resilience for adaptation to climate change in the agriculture sector for Joint Workshop of FAO/OECD, Rome, Italy.

Sohn, E. (2014). “The toxic side of rice: Around the world, researchers are looking for ways to rid rice of a troublesome companion.” Nature: 514, 62-63.

Soon, Y.K. (1998). “Determination of As, Hg, Cd, Cr and Pb in plant tissue. In Yash P, Karla (Eds.)”, Handbook of reference methods for plant analysis, 183-198. Florida, USA: CRC Press.

Tangahu, B.V., Sheikh-Abudallah, S.R., Basri, H., Idris, M, Anuar, N., and Mukhlisin, M. (2011). “A review on heavy metals (As, Pb and Hg) uptake by plants through phytoremediation.” International Journal of Chemical Engineering: 1-32.

Wuana, R.A., and Okieimen, F.E. (2011). “Heavy Metals in Contaminated Soils: A review of sources, chemistry, risks and best available strategies for remediation.” ISRN of Ecology: 1-20.

Xu, X., Zhao, Y., Zhao, X., Wang, Y., and Deng, Y. (2014). “Sources of heavy metal pollution in agricultural soils of a rapidly industrializing area in the Yangtze Delta of China.” Ecotoxicology and Environmental Safety 108: 161–167.



I328

Effect of indole acetic acid produced by Klebsiella variicola C1DO on simulated drought condition for evaluating grain filling and seed weight

of rice (Oryza sativa L.)

R.A.P.S. Wimalasenae1

, P. Na Chiangmaia1

, S. Khianngama1

, M. Kanjanamaneesathiana1

e1

Student in the Program for a Degree in Master of Science in Bioscience for Sustainable Agriculture

a1Faculty of Animal Science and Agricultural Technology, Silpakorn University,

Phetchaburi IT campus, Cha-Am, Phetchaburi, 76120, Thailand

[email protected],

[email protected],

[email protected],

[email protected]

Abstract

Rice is a food staple for people worldwide. However, rice production has been subjected to various limiting factors such as pests and drought. The objective of this study was to investigate effect of simulated drought condition by alternately wetting and drying (AWD) soil and application of exogenous indole acetic acid (IAA) on grain filling and grain weight of rice (Oryza sativa L.) of both upland rice (variety Nah San) and lowland rice (variety RD 31). The result showed that exogenous IAA (both syntactic and bacteria), watering schedule, and the interaction between them did not significantly affect percentage of filled grains and grain weight of both varieties. However, applied IAA showed a positive affect for increasing percentage value of grain filling in dry condition of variety Nah San.

Key Word (s): beneficial microorganisms, rice production

1. Introduction

Rice (Oryza sativa L.) is a food for people in Asia, part of Latin America and Africa. However, rice production has been subjected to various limiting factors such as pests and drought. In Asia, rice yield lost due to the adverse weather such as drought in 2014 has been reported to be very high, at approximately 5.3 million tons (FAO, 2015).

Drought stress at different growth stages incurs high percentage of unfilled grains (Davatgar et al., 2009) and low grain weight (Yang et al., 2001). The reduction is mainly due to the lowered number of endosperm cells, and decreased sink size (Yang et al., 2001). Application of plant growth regulators and water saving management methods has been investigated to deal with drought condition (Yang et al., 2001; Dawe, 2005 and Javid et al., 2011). Exogenous IAA application at the reproductive stage has been reported to increase the grain weight, fill grain percentage and rice yield (Javid et al., 2011).

IAA producing microorganisms is a source of exogenous IAA for plant growth promotion (Park et al., 2006; Mohite, 2013). Klebsiella sp. is the bacterium known to possess several beneficial characteristics such as production of IAA (Sachdev et al., 2009). Klebsiella variicola C1DO is capable of producing IAA (Wimalasena et al., 2017). IAA filtrated (at 25 µM) from the Klebsiella variicola C1DO culture was found



I329



to have a positive effect in increasing the shoot height of rice seedlings (variety Nah San) (Wimalasena et al., 2017).

Objective

1. To evaluate the effect of IAA produced by Klebsiella variicola C1DO on grain filling and grain weight of rice under simulated drought conditions.

Research Methodology 1. Source of Klebsiella variicola C1DO

K. variicola C1DO, isolated from the organic compost, was obtained from Dr. Saowapar Khianngam, Faculty of Animal Science and Agricultural Technology, Silpakorn University, Phetchaburi IT campus, Cha-Am, Thailand. 2. Preparation of IAA solution from Klebsiella variicola C1DO

Klebsiella variicola C1DO was cultured in nutrient broth and IAA was extracted for spray to rice plants in the grain filling experiment. This was carried out by dissolving 0.15g of nutrient medium (Wimalasena et al., 2017) in 150 mL distilled sterile water (in 250 mL conical flasks) with L- tryptophan (at 100 µg mL

-1) as a substrate (Phetcharat and

Duangpaeng, 2011). Each flask was inoculated with 0.15 mL of bacterial suspension which had been adjusted to the optical density at 0.5 and incubated in a rotary shaker with 150 rpm at 30-32

o C. After 66 hours (Wimalasena et al., 2017), the medium was

sterilized using filtration method (Nissen et al., 1990). IAA was determined using Salkowski method (Gordon and Weber, 1951; Phetchara and Duangpaeng, 2011).

3. Determination of changes in soil water content (SWC) with time

This experiment was conducted to determine soil water content (SWC) over time by collecting soil samples with 4 replications in the greenhouse. Eight kilograms of commercially available planting substrate (the mixture of compost and manure) were put into the plastic pot (dimension: 26 cm in height and 35 cm in diameter). Saturation water volume was identified as 1.2 L, a volume of water that would be added to the planting substrate in the pots. The planting substrate samples (10 - 15 g) were taken from the center of the four pots at the 10 cm depth daily for eight days. The fresh weight of these samples was determined immediately and the dry weight was obtained after they had been dried in the hot- aired oven at 105

oC for 24 hours (Zhang et al., 2012). The water

holding capacity was calculated using following equation:

Soil water content (SWC) = 100 X (Fresh soil weight – Dry soil weight) / Fresh soil weight (Zhang et al., 2012) 4. Effect of exogenous IAA on grain filling under simulated drought

An experiment was conducted to study the effect of types of IAA, rice varieties and drought on grain filling of rice. The experiment was arranged in the 3 X 2 X 2 factorial completely randomized design (CRD) with 4 replications in the greenhouse. To prepare the rice plants, eight kilograms of commercially available planting substrate (pH 5.71, OM 14.2%, EC 6.3dS/m, N 67.5 mg/ kg, P 111.34 mg / kg, K 3465 mg / kg) were put into the plastic pots (dimension: 26 cm in height and 35 cm in diameter) after which either Nah San or RD 31 rice seeds (10 – 15 seeds per pot) were sown. After 10 days, excessive seedlings were removed and four seedlings per pot were retained for use in the experiment (one pot as a replicate, containing four plants). These rice plants were



I330

watered until its reached flowering stage. After flowering, the drought condition (DC) was initiated by an alternate watering (up to saturation) - drying four cycles (7

days/

cycle, 7th

day leaf rolling was started)) soil in the pots. For the nil control treatment, the soil water content (at day 0 = 59.1 and at day 1 = 52.1) was regularly maintained (normal condition - NC). At the anthesis stage, these rice plants were transferred to the greenhouse which had overhead cover to avoid the effect of the rain.

To spray the rice plants, fifty milliliters of either filtered IAA produced by Klebsiella variicola C1DO, the synthetic IAA (at 2.5 X 10

-5 M concentration) or the

distilled sterile water [all with Tween 20 polysorbate (at 0.05% v/v) as surfactant (Park et al., 2006)] were sprayed three times to rice panicles at the beginning of anthesis in the evening at 6.00 p.m. (Javid et al., 2011) every seven days. At the 80 % of ripening stage, three panicles were harvested from each hill. Each panicle was divided into two equal parts at the middle between the tip and the end of rice panicle. The filled grain percentage and grain weight were assessed separately in the upper and the lower part of the panicle to identify the effect of the spray to each parts (Javid et al., 2011). Dry weight of the grains was determined after drying in the oven at 70

◦C for 48 hours (Zhang

et al., 2012).

5. Statistical analysis The results of the experiments were expressed as mean and standard deviation. The

data were analyzed using analysis of variance followed by Turkey test using R version 3.3.1(P ≤ 0.05) (R Core Team, 2016). Results 1. Determination of changes in soil water content (SWC) with time

Soil water content (SWC) of the commercially available planting substrate was 59.11 and 38.55 at the day 0 and day 7 respectively. SWC was found to decline at the rate of -2.59 (Figure 1).

Figure 1 Soil water content changes with time

2. Effect of exogenous IAA on grain filling under simulated drought The effect of drought (alternate wetting – drying, four cycles with seven days

interval) and IAA spray on the percentage of filled grains in both varieties are shown (Table 1 and Table 2). The varieties of rice, drought and the spray of IAA (regardless of the sources of IAA) and all the interactions between them did not significantly affect the percentage of filled grains in both the upper and the lower parts of the panicle.



I331

The effect of drought (alternate wetting - drying cycle) and IAA spray on the weight of the grains of both varieties are shown (Table 3 and Table 4). Only the rice variety had the significant effect to grain weight, basing on the assessment of the grains in the upper and the lower parts of the panicle. Table 1 Effect of type of indole acetic acid and drought on grain filling percentage of the upper part of the panicle Treatment Nah

San, NC

Nah San, DC

A-B RD 31, NC

RD 31, DC

A-B Mean (IAA)

IAA Bacteria

53.81

±19.49

59.71

± 20.35 (A)

+ 2.38 65.74

± 7.92

62.00

±11.25 (A)

-2.73 60.31

±14.72

IAA Synthetic

57.31

±23.05

65.53

± 7.11

(A)

+ 8.20 64.84

± 7.39

59.72

±19.13 (A)

-5.01 61.85

±14.60

Control

52.76

± 9.07

57.33

± 5.89

(B)

74.59

± 6.19

64.73

± 4.47 (B)

62.35

±10.38

Mean (Nah San) = 57.74 ±14.59 Mean (RD 31) = 65.27 ±10.47

Mean (Dry Condition) = 61.50 ±11.87, Mean (Normal Condition) = 61.5

±14.54

CV (%) = 21.81 F test (P value) Varity = ns (0.0597), Watering = ns (0.9984), IAA = ns (0.9050),

Varity: IAA = ns (0.3590), Varity: Watering = ns (0.1162) Watering: IAA = ns (0.8896), Varity: Watering: IAA = ns (0.9655)

Table 2 Effect of type of indole acetic acid and drought on grain filling percentage of the lower part of the panicle Treatment Nah

San, NC

Nah San, DC

A-B RD 31, NC

RD 31, DC

A-B Mean (IAA)

IAA Bacteria 38.98

±13.21

40.71

± 31.56

(A)

+0.47 51.90

± 8.44

41.36

± 12.76 (A)

-11.9 43.24

± 17.56

IAA Synthetic

45.34

±14.49

42.04

± 17.34 (A)

+1.8 49.07

± 7.41

53.81a

± 12.55 (A)

+0.55 47.56

± 12.85

Control

50.58

± 5.38

40.24

± 20.91 (B)

55.62

± 7.19

53.26a

± 9.52 (B)

49.93

± 12.59

Mean (Nah San) = 42.98 ±17.21 Mean (RD 31) = 50.84

±9.99

Mean (Dry Condition) = 45.24 ±17.78, Mean (Normal Condition) = 48.58

±10.31

CV (%) = 32.18 F test (P value) Varity = ns (0.0798), Watering = ns (0.4480), IAA = ns (0.4538),

Varity: IAA = ns (0.9779), Varity: Watering = ns (0.8869) Watering: IAA = ns (0.7925), Varity: Watering: IAA = ns (0.5532)



I332

Table 3 Effect of type of indole acetic acid and drought on grain weight (g) of the upper part of the panicle Treatment Nah

San, NC Nah San, DC

A-B RD 31, NC

RD 31, DC

A-B Mean (IAA)

IAA Bacteria 0.019

± 0.002

0.019

± 0.000

(A)

-0.001 0.024

± 0.000

0.023 ± 0.002 (A)

0.000 0.021

± 0.002

IAA Synthetic

0.021

± 0.001

0.020

± 0.002

(A)

0.000 0.023

± 0.001

0.024

± 0.001 (A)

+0.001 0.022

± 0.002

Control

0.019

± 0.001

0.020

± 0.002

(B)

0.024

± 0.001

0.023

± 0.001 (B)

0.022

± 0.002

Mean (Nah San) = 0.020b ± 0.001g Mean (RD 31) = 0.024

a ± 0.001g

Mean (Dry Condition) = 0.022 ± 0.002g, Mean (Normal Condition) = 0.022

±0.002g

CV (%) = 7.64 F test (P value) Varity = <0.001***, Watering = ns (0.980),

IAA = ns (0.631), Varity: IAA = ns (0.840), Varity: Watering = ns (0.507), Watering: IAA =ns (0.842), Varity: watering: IAA = ns (0.193)

Four replicates were analyzed for each treatment a, and b is indicate significance of mean at p ≤ 0.05 Table 4 Effect of type of indole acetic acid and drought on grain weight (g) of the lower part of the panicle Treatment Nah

San, NC Nah San, DC

A-B RD 31, NC

RD 31, DC

A-B Mean (IAA)

IAA Bacteria 0.019

± 0.002

0.018

± 0.000

(A)

-0.001 0.023

± 0.000

0.023

± 0.000 (A)

-0.001 0.021

± 0.002

IAA Synthetic 0.017

± 0.003

0.019

± 0.001 (A)

0.000 0.023

± 0.001

0.023

± 0.001 (A)

-0.001 0.020

± 0.003

Control

0.019

± 0.001

0.019 ±

0.002 (B)

0.023

± 0.001

0.024

± 0.002 (B)

0.021

± 0.002

Mean (Nah San) = 0.018 b

± 0.001g Mean (RD 31) = 0.023a ± 0.001g

Mean (Dry Condition) = 0.021 ± 0.002g, Mean (Normal Condition) = 0.021

±0.003g

CV (%) = 8.22 F test (P value) Varity = <0.001***, Watering = ns (0.591),

IAA = ns (0.661), Varity: IAA = ns (0.718), Varity: Watering = ns (0.824) Watering: IAA = ns (0.686), Varity: Watering: IAA = ns (0.696)

Four replicates were analyzed for each treatment a and b is indicate significance of mean at p ≤ 0.05



I333

Discussion The spray of IAA (at 2.5 X 10

-5 M concentration, 3 applications both Klebsiella

variicola C1DO and synthetic IAA) did not significantly affected grain filling percentage and grain weight in both upper and lower part of the panicle under simulated drought. Percentage of filled grain in the upper part is higher than that of the lower part in both verities. Upland rice (var. Nah San) treated with IAA had grain filling percentage higher than that of nil control for both upper and lower part (A-B). However, lowland rice (var. RD 31) treated with IAA had grain filling percentage lower than that nil control (A-B). Both rice variety treated with synthetic IAA had grain filling percentage and grain weight higher than that treated with IAA from Klebsiella variicola C1DO. It has been reported that the effect of IAA on grain filling is depending on other factors such as rice variety and concentration of exogenous IAA (Yang et al., 2001; Javid et al., 2011). There was a report that the IAA concentration in rice grain was varied based on rice varieties (Yang et al., 2001). Two applications of the exogenous IAA (at 5 X 10

-5 M

concentration at anthesis) significantly increased the grain yield and 1000-grain weight of rice under salinity and normal conditions (Javid et al., 2011). Application of naphthalene acetic acid, an artificial auxin at 90 ml/ha, at the grain development stage has been reported to promote grain filling and yield of rice (Bakhsh et al., 2011).

Simulated drought condition also did not significantly affect grain filling and grain weight in both rice varieties. In AWD treatment, soil water content fluctuated from 59.11 to 38.55 every seven days. Rice (var. Nah San), an upland rice which is comparatively tolerant to drought (Fukai and Cooper, 1995) had high grain filling percentage (in upper part) in the dry conditions than the normal condition. On the other hand, RD 31, a lowland rice variety, had high grain filling percentage (in upper part) in the wet conditions than dry condition. Drought at the flowering stage significantly affected the percentage of unfilled grains and grain yield of rice (Davatgar et al., 2009). In this experiment, water stress (by AWD) was created soon after flowering necessitating the need to identify the effect of drought condition on grain filling in each stage of rice growth. Conclusion

The spray of indole acetic acid (2.5 X 10 -5

M concentration, both synthetic and produced by Klebsiella variicola C1DO) and AWD (7-day cycles) did not significantly affect the percentage of grain filling and grain weight of rice. However, application of IAA increased the percentage of grain filling in the upper part of the panicle of rice (var. Nah San) in the simulated drought condition.

Recommendation

The effect of IAA under drought conditions should be investigated further to identify the optimal IAA concentrations with respect to grain filling of both rice varieties. Acknowledgment The first author would like to thank the Thailand International Cooperation Agency (TICA) for providing scholarship to study for Master of Science in Bioscience for Sustainable Agriculture at the Faculty of Animal Science and Agricultural Technology, Silpakorn University, Phetchaburi IT campus, Cha-Am, Thailand. The authors also like to thank TICA for providing grant to conduct this research work. The Faculty of Animal Science and Agricultural Technology, Silpakorn University, Phetchaburi IT campus, Cha-Am, Thailand is gratefully acknowledged for laboratory facilities.



I334

References Bakhsh, I., I. Awan, M. Sadiq, M. Niamatullah, K. U. Zaman and M. Aftab. (2011).

“Effect of plant growth regulator application at different growth stages on the economical yield potential of coarse rice (Oryza Sativa L.)”. The Journal of Animal & Plant Sciences 21, 3 : 612-616.

Dawe, D. (2005). “Increasing water productivity in rice-based systems in Asia—past trends, current problems, and future prospects”. Plant Production Science 8 (December): 221–230.

Davatgar, N., M. R. Neishabouri, A. R. Sepaskhah, and A. Soltani. (2009). “Physiological and morphological responses of rice (Oryza sativa L.) to varying water stress management strategies”. International Journal of Plant Production 3, 4 (September): 19-32.

Food and Agriculture Organization of the United Nation. (2015). Rice market monitor. Food and Agriculture Organization of the United Nation 18, 1.

Fukai, S, and M. Cooper. (1995). “Development of drought-resistant cultivars using physiomorphological traits in rice”. Filed crop research 40 (February): 67- 86.

Gordon, S. A. and R. P. Weber. (1951). “Colorimetric estimation of indole acetic acid”. Plant Physiology 26, 4 (October): 192-195.

Javid, M. G., A. Sorooshzadeh, S. A. M. M. Sanavy, I. Allahdadi, and F. Moradi. (2011). “Effects of the exogenous application of auxin and cytokininon carbohydrate accumulation in grains of rice under salt stress”. Plant Growth Regulation 65 (June): 305-313.

Mohite, B. (2013). “Isolation and characterization of indole acetic acid (IAA) producing bacteria from rhizospheric soil and its effect on plant growth”. Journal of Soil Science and Plant Nutrition 13, 3: 638-649.

Nissen, S. J. and E. G. Sutter. (1990). “Stability of IAA and IBA in nutrient medium to several tissue culture procedures”. Hort Science 25, 7 (July): 800-802.

Park, K., D. Paul, and W. Yen. (2006). “Bacillus Vallismortis EXTEN -1 mediated growth promotion and disease suppression in rice”. The Plant Pathology Journal 22, 3 (September): 278-282.

Phetcharat, P., and A. Duangpaeng. (2011). “Screening of endophytic bacteria from organic rice tissue for indole acetic acid production”. Procedia Engineering 32 (November): 177-183.

R Core Team. (2016). R: A language and environment for statistical computing. Accessed 2016 December 05. Available from http://www. R-project.org/

Sachdev, D. P., H. G. Chaudhari, V. M. Kasture, D. D. Dhavale, and B. A. Chopade. (2009). “Isolation and characterization of indole acetic acid (IAA) producing Klebsiella pneumoniae strains from rhizosphere of wheat (Triticum aestivum) and their effect on plant growth”. Indian Journal of Experimental Biology 47, 12 (December): 993-1000.

Tabatabaei, S., P. Ehsanzadeh, H. Etesami, H. A. Alikhani, and B. R. Glick. (2016). “Indole-3-acetic acid (IAA) producing Pseudomonas isolates inhibit seed germination and α-amylase activity in durum wheat (Triticum turgidum L.)”. Spanish Journal of Agricultural Research 14,1 (March): 1-10.

Wimalasena, R. A. P. S., P. Na Chiangmai, S. Khianngam, and M. Kanjanamaneesathian. (2017). “Common household flavor enhancer as a nutrient for culturing Klebsiella variicola C1DO, a potential rice growth promoting bacterium”. In 8

th

International science, social science, engineering and energy conference, March 15-17,2017, Abstract book, 4. Pattaya, Thailand : Phranakhon Rajabhat University.



I335

http://www/

Yang, J., J. Zhang, Z. Wang, Q. Zhu and W. Wang. (2001). “Hormonal changes in the grains of rice subjected to water stress during grain filling”. Plant Physiology 127 (September): 315-323.

Zhang, Y., Q. Tang, S. Peng, D. Xing, J. Qin, R. C. Laza, and B. R. Punzalan. (2012). “Water use efficiency and physiological response of rice cultivars under alternate wetting and drying conditions”. The Scientific World Journal 2012 (November): 1-10.



I336

Title Wound area measurement using image processing analysis

Author : Maemmoth Chuongsakun and Surapong Chatpun Program Institute of Biomedical Engineering, Faculty of Medicine, Institute Prince of Songkla University, Songkhla 90110, Thailand

Abstract

Wounds are physical damages or injuries which cause an opening or break of

the skin tissues. The healing potential is usually evaluated from the change of wound

area or wound diameter during the inspection period. This study aimed to create the

computer algorithm to assist the wound area measurement. The algorithm was based

on the image processing technique. Digital image of wound was converted to

grayscale image and black and white (B&W) image, respectively. Morphological

operations were then applied to B&W image such as dilating filling, cutting and

eroding. Image segmentation was performed for wound boundary detection and

wound area was then measured. Our algorithm was tested with two groups of images;

simple geometries and wounds. The accuracy of wound area measurement was

determined by comparing our algorithm with ImageJ software. The results showed

that it had high accuracy when testing with simple geometries (>96%). The accuracy

of wound measurement was quite high (>91%) but there was an image that could not

be determined wound area. Our results showed that the accuracy of area measurement

depended on the quality of digital image. It can be concluded that this algorithm will

reduce the hum an work for wound area measurement and it might reduce the inter-

observer variability.

Keywords: wound, area measurement, image analysis, ImageJ, morphological

operation

Introduction

Wounds are physical damages or injuries which cause an opening or break of

the skin tissues. In the repairing process of wound healing, there are four stages which

involve homeostasis, inflammation, proliferation and maturation or remodeling (Rhett

et al.,2008; Velnar et al., 2009). There are many techniques that have been

implemented to accelerate wound healing process. Vacuum-assisted closure

technique removed chronic edema and enhanced formation of granulation tissue

leading to efficacious wound closure (Argenta et al.,1997). Electrical stimulation has

been applied for wound healing and several studies showed that the electrical



I337

stimulation could increase rate of healing (Rouabhia et al.,2013; Houghton et al.,2010

; Sebastian et al.,2011 ; Kloth .,2014). Light therapy using light-emitting diode (LED)

is a new technique to enhance wound healing (Adamskaya et al.,2011; De Sousa et

al.,2010; Minatel et al.,2009).

The healing potential is usually evaluated from the change of wound area or

wound diameter during the inspection period (Cardinal et al.,2008; Wood et al.,2014).

There are both manual and automatic methods to measure wound area. Nayak et al.

used transparency paper and a permanent marker to record wound size and then they

used graph paper to measure wound area (Nayak et al.,2009). In other study, wounds

were photographed, transferred to computer and measured with special size analysis

software (Atiba et al.,2011). Furthermore, an open source software such as ImageJ

was used to trace the outline of wound and to calculate the wound area (Chang et

al.,2011). Zordan and colleague wrote MATLAB algorithm to perform texture

segmentation to measure the wound area (Zordan et al.,2011). Therefore, the

computer-assisted analysis for wound size is still a challenge for biomedical research.

Objectives

1) This study aimed to create the computer algorithm to assist the wound area

measurement and compared the results with the open source image processing

program.


The process of our algorithm to measure the wound area is generally described

as a diagram in Figure 1. The image was firstly converted from RGB to grayscale and

then it was converted to black and white image. After that, morphological operations

i.e. dilation, filling, cutting and erosion were applied to image as a step of image

processing. Image segmentation was then performed to trace the edge of area or

wound. Finally, area was determined with the area calculation code. We tested the

efficiency of the algorithm by determine the accuracy of area measurement.

Therefore, the measured area using our algorithm was compared with the result

determined by ImageJ (version 1.46r). The accuracy of area measurement has been

calculated as presented in equation 1.

% 𝑎𝑐𝑐𝑢𝑟𝑎𝑐𝑦 = 100 − (|𝐴𝑟𝑒𝑎𝑎𝑙𝑔𝑜𝑟𝑖𝑡ℎ𝑚−𝐴𝑟𝑒𝑎𝐼𝑚𝑎𝑔𝑒𝐽|

𝐴𝑟𝑒𝑎𝐼𝑚𝑎𝑔𝑒𝐽×100) …….………. (1)

There were two groups of images used to determine the efficiency of the algorithm.

First group contained images of known geometry whereas the second group contained

images of animal wounds. All images in our study were obtained from online sources.



I338

Results/Conclusion

In the first group of images, using simple geometries, the differences in the

area measurement using ImageJ and our computer-assisted algorithm are showed in

Table 1. Furthermore, the accuracy of measurement had been determined and

presented in Table 1.The accuracy for the images in the first group is in a range of

96.1%-99.9 %. In the second group of images, wound image was processed

according to our algorithm. The images resulted from the image processing are

presented in Figure 2. Then, the wound areas and measurement accuracy were

calculated as showed in Table 2. The accuracy for the images in the second group is

in a range of 91.0%-97.7 %. However, we found that our algorithm could not

determine area for the image which has many voids after black and white conversion

as shown in last row in Table 2.

Figure 1 Diagram of image analysis processes to determine wound area



I339

Figure 2 Example of images after processes to determine the wound area: (a) original

image, (b) grayscale image, (c) black and white image, (d) image after dilation, (e)

image after filling, (f) image after cutting, (g) image after erosion and (h) image after

tracing



I340

Table 1 Area of given geometries and the accuracy of area measurement using the

computer-assisted algorithm and ImageJ

Image

Measured Area

(pixel) Difference of

area

(pixel)

Accuracy

(%) ImageJ Computer-

assisted

algorithm

10,525 10,940 415 96.1

14,199 14,676 477 96.7

19,106 19,104 2 99.9

7,473 7,674 201 97.3

1,2801 1,2761 40 99.7



I341

Table 2 Area of animal wounds and the accuracy of wound area measurement using

the computer-assisted algorithm and ImageJ

Image

Measured Area

(pixel) Difference of

area

(pixel)

Accuracy

(%) ImageJ Computer-

assisted

algorithm

7,315 7,980 665 91.0

13,323 13,686 363 97.3

924 903 21 97.7

10,987 11,274 287 97.4

- 28,010 - -

41,999 - - -



I342

Discussion

We have created an algorithm that determines the area of digital wound image.

It was found that our algorithm provided high accuracy of test images contained

different sizes of wound. We notice that images with light reflection have lower

accuracy than images without light reflection. Furthermore, the contrast between the

object and background can influence the image processing (Lopez-Molina et

al.,2013). There was a study showed that it is difficult to recognize the images of

human chronic wounds because of the variability of the wound bed and the

inhomogeneity of the patient skin (Papazoglou et al.,2010). In this study, it was

noticed in this study that ImageJ also could not give the value of wound area if the

wound (object) and the skin (background) was not clearly distinguishable. That means

the quality of image plays a role for wound detection. In addition, image noise also

causes the error in an image processing. Therefore, it is necessary to have an image

pre-processing to enhance a quality of image such as noise filtering, contrast

adjustment and histogram modification (You et al.,2008; Adel et al., 2008; Geetha et

al.,2014). Currently, our algorithm is not completely developed for wound

measurement. It is still a challenge to improve this algorithm to have an automatic

image quality enhancement and a boundary of wound detection. Moreover, it should

have a function to determine the percent of wound change from two images of wound

at the certain points in time. This algorithm will reduce the human work for wound

measurement and it might reduce the inter-observer variability.

Recommendations

Using the computer-assisted program can facilitate the wound measurement

and reduce the variation of inter-observer. Our results showed that the accuracy of

area measurement depends on the quality of image. Therefore, it should be concerned

before taking a digital photograph of wound. It is also necessary to verify the

repeatability of area measurement for different conditions of wounds such as dirty

wound bed, a large color contrast with surrounding tissues and wound with

inflammation.



I343

References

Adamskaya, N., Dungel, P., Mittermayr, R., Hartinger, J., Feichtinger, G., Wassermann, K., Redl H. & van Griensven, M. (2011). “Light therapy by blue LED improves wound healing in an excision model in rats.” Injury 42, (September): 917- 921. .

Adel, M., Zuwala, D., Rasigni, M., & Bourennane, S. (2008). “Filtering noise on

mammographic phantom images using local contrast modification functions.” Image Vision Comput 26, 1 (September): 1219-1229. .

Argenta, L. C., & Morykwas, M. J. (1997). “Vacuum-Assisted Closure: A New Method for Wound Control and Treatment: Clinical Experience.” Annals of Plastic Surgery 38, (June): 563-577. . .

Atiba, A., Nishimura, M., Kakinuma, S., Hiraoka, T., Goryo, M., Shimada, Y., Ueno H. & Uzuka, Y. (2011). “Aloe vera oral administration accelerates acute radiation-delayed wound healing by stimulating transforming growth factor-beta and fibroblast growth factor production.” Am J Surg 201, (June):809-818.

.Cardinal, M., Eisenbud, D. E., Phillips, T., & Harding, K. (2008). “Early healing rates and wound area measurements are reliable predictors of later complete wound closure.” Wound Repair Regen 16, 18 (January): 19-22. .

Chang, A. C., Dearman, B., & Greenwood, J. E. (2011). “A comparison of wound area measurement techniques: visitrak versus photography.” Eplasty 11, 18 (April): e18. .

De Sousa, A. P. C., Santos, J. N., dos Reis Jr, J. A., Ramos, T. A., de Souza, J.,

Cangussú, M. C. T., & Pinheiro, A. L. (2010).” Effect of LED phototherapy of three distinct wavelengths on fibroblasts on wound healing: a histological study in a rodent model.” Photomed Laser Surg 8, 12 (August): 547-552. .

Geetha, P., & Chitradevi, B (2014). “An Overview on Image Processing Techniques.”

International Journal of Innovative Research in Computer and Communication Engineering 2, (March): 6466-6472. .

Houghton, P. E., Campbell, K. E., Fraser, C. H., Harris, C., Keast, D. H., Potter, P. J.,

& Woodbury, M. G. (2010). “Electrical stimulation therapy increases rate of healing of pressure ulcers in community-dwelling people with spinal cord injury.” Arch Phys Med Rehabil 91, (May): 669-678. .

Kloth LC. (2014).” Electrical Stimulation Technologies for Wound Healing.” Adv

Wound Care (New Rochelle) 3,: 81-90. .

Lopez-Molina, C., De Baets, B., & Bustince, H. (2013). “Quantitative error measures

for edge detection.” Pattern Recogn 46, (April): 1125-1139. .

.Minatel, D. G., Frade, M. A. C., França, S. C., & Enwemeka, C. S. (2009). “Phototherapy promotes healing of chronic diabetic leg ulcers that failed to respond to other therapies.” Lasers Surg Med 41, 8 (July): 433-441.



I344

. . Nayak, B. S., Sandiford, S., & Maxwell, A. (2009). “Evaluation of the Wound-healing

Activity of Ethanolic Extract of Morinda citrifolia L. Leaf.” Evid Based

Complement Alternat Med 6, 10 (July):351-356. .

Papazoglou, E. S., Zubkov, L., Mao, X., Neidrauer, M., Rannou, N., & Weingarten, M. S. (2010).“Image analysis of chronic wounds for determining the surface area.” Wound Repair Regen 18, 11 (May): 349-358.

Rhett, J. M., Ghatnekar, G. S., Palatinus, J. A., O’Quinn, M., Yost, M. J., & Gourdie, R.G. (2008). “Novel therapies for scar reduction and regenerative healing of skin

wounds.” Trends in Biotechnology 26, (April): 173-180.

Rouabhia, M., Park, H., Meng, S., Derbali, H., & Zhang, Z. (2013). “Electrical

stimulation promotes wound healing by enhancing dermal fibroblast activity and

promoting myofibroblast transdifferentiation.” PLoS One 8, 19 (August): e71660.

Sebastian, A., Syed, F., Perry, D., Balamurugan, V., Colthurst, J., Chaudhry, I. H., &

Bayat, A. (2011). “Acceleration of cutaneous healing by electrical stimulation:

degenerate electrical waveform down-regulates inflammation, up-regulates

angiogenesis and advances remodeling in temporal punch biopsies in a human

volunteer study.” Wound Repair Regen 19, 19 (October): 693-708.

Velnar, T., Bailey, T., & Smrkolj, V. (2009). “The wound healing process: an overview of the cellular and molecular mechanisms.” J Int Med Res 37, 1 (October): 1528-1542.

Wood, S., Jayaraman, V., Huelsmann, E. J., Bonish, B., Burgad, D., Sivaramakrishnan, G., & Shafikhani, S. H. (2014). “Pro-inflammatory chemokine CCL2 (MCP-1) promotes healing in diabetic wounds by restoring the macrophage response.” PLoS One 9, 1 (March): e91574.

You, X., Bao, Z., Xing, C. F., Cheung, Y., Tang, Y. Y., & Li, M. (2008). “Image

denoising by using nonseparable wavelet filters and two-dimensional principal

component analysis.” Optical Engineering 47, 29 (October): 47.

Zordan, M. D., Mill, C. P., Riese, D. J., & Leary, J. F. (2011). “A high throughput,

interactive imaging, bright-field wound healing assay.” Cytometry A 79, 9

(February): 227-232. .



I345

http://opticalengineering.spiedigitallibrary.org/issue.aspx?journalid=92&issueid=22116

Analysis of Constraint Functions for Cost Optimization of Glass Fiber Reinforced

Concrete Cladding System with Steel Frame

Author: Phanupong Amornsirichokechai, Asst. Prof. Dr. Praveen Chompreda

Program Master of Engineering (Civil Engineering) Institute Mahidol University

Abstract

This study attempted to verify the accuracy of constraint functions between

theoretical equations and finite element method (FEM) for the purpose of cost

minimization of glass fiber reinforced concrete (GFRC) stud-frame system. Thickness

of GFRC panel, thickness and spacing of steel supports, and spacing and length of flex

anchor are the variables that were considered in optimization. Constraints equations

were developed to consider the strengths and deformations of the panels, steel

supporting frame, and the flex anchor. Finite element method was used as a tool to

verify the results from theoretical equations and formulate certain constraints. Based on

the results of this study, theoretical equations provide satisfactory accuracy for the

moment capacity of steel stud, deflection of steel stud, flexural strength of panel,

deflection of panel, mid-plate deflection, moment capacity of flex anchor, and direct

shear strength of flex anchor. The theoretical equations did not provide satisfactory

accuracy for the punching shear strength of panel and deflection of steel stud because

of the distortions of flex anchor and deflections of steel studs, respectively.

Keywords: Minimization, Nonlinear Programming, Finite Element, Façade, GFRC

Introduction

Nowadays, cladding is widely used worldwide to decorate the exteriors of

buildings. It’s mostly preferred by architects for aesthetic reasons. Conventionally,

cladding is manufactured as precast concrete panel, which provided good quality

control due to the factory production. However, precast concrete panel is very heavy

which leads to increasing in cost of the supporting structure, and construction cost to

transport and handle the heavy panel. To reduce the thickness of panel, glass fiber

reinforced concrete, also known as GFRC, is used.



I346

GFRC is a composite material consisted of cement, glass fiber, fine

aggregates and polymers admixture. It provides high tensile strength and crack

resistance. Therefore, it can be formed into thin panels, which leads to savings in the

construction costs. Typically, GFRC cladding is often fabricated with stud-frame

system, as shown in Figure 1. The system consists of three primary components: 1)

GFRC panel, which is the surface of system. 2) Steel stud which is the supporting of

frame. 3) Flex anchor, which is a small steel bar that connects the panel to the

supporting system.

GFRC Panel

Flex Anchor

Steel Stud

Figure 1 GFRC Stud-frame system

From a previous study (Amornsirichokechai & Chompreda, 2016), cost

optimization of GFRC stud frame system was studied. In the optimization process, each

constrain function should capture the actual behavior of the system. However, there

was no verification of accuracy in the constraint functions provided. Thus, to increase

an efficiency and economic design in a cost optimization of GFRC stud-frame system,

the constraint functions should be investigated in more details. This study attempts to

verify the accuracy of constraint functions by comparing results between theoretical

equations and finite element method (FEM) for various constraint functions.

Objectives

The objectives are:

1) Verify the accuracy of constraint functions between theoretical

equations and FEM for the purpose of cost optimization of GFRC

stud-frame system.

2) Identify any complex behavior that might occur for each constraint

that cannot be captured by theoretical equation.



I347


This study considered constraint functions for cost optimization of GFRC

stud-frame system. The stud-frame system has a maximum panel size of 4000 mm, a

125×50 mm steel stud as a supporting frame, and 6 mm diameter flex anchor with 75

mm hook length connecting the panel to the frame, as shown in Figure 2.

Steel Stud

125×50 mm

GFRC Panel

Bonding PadFlex Anchor

diameter 6 mm

Hook Length 75 mm

Figure 2 Details of steel stud and flex anchor

The optimization problem consisted of variables, objective function, and

constraint functions.

Design Variables

Five variables were optimized in this study: namely the thickness of steel

stud (ts), thickness of panel (tp), spacing of stud (ss), spacing of flex anchor (sf), and

cantilever length of flex anchor (xf).

Objective Functions

The objective function is to minimize the cost of GFRC system per 1 square

meter ( TC ). This function is represented by materials and fabrication costs ( mC ),

transportation cost ( tC ), and erection cost ( eC ) as:

T m t eC C C C (1)

However, Amornsirichokechai (2016) found that the transportation cost

and erection cost can be removed when the panel thickness is at the lower limit of

practicality. The function of material and fabrication costs consist of the costs of face

mix ( FMC ), backing layers ( GFRCC ), steel frame ( SFC ), and flex anchors ( FC ), as:

m FM GFRC SF FC C C C C (2)



I348

Constraints functions

The constraint functions were classified into three categories, namely: 1)

out-of-plane behavior constraints, 2) in-plane behavior constraints, and 3) practicality

constraints. Only out-of-plane and in-plane behaviors were compared to the results

from FEM. The wind load, dead load, construction live load, and shrinkage/thermal

contraction were considered in the constraint functions. These constraints are

summarized in Table 1. For all of the constraints, the design criteria were either that the

corresponding maximum stress or maximum deflection must not be over the strength

or deflection limits. The material properties for developing the constraint function are

summarized in Table 2. The related variables are substituted in each constraint function,

and then the results from hand calculation would be compared to that from the

corresponding finite element model.

Table 1 Summary of constraints

Category Constraint

Out-of-plane

behavior

Moment capacity of steel stud

Deflection of steel stud

Flexural strength of panel

Deflection of panel between studs

Mid-plate deflection

Punching shear of panel

Strength of panel while lifting

In-plane

behavior

Moment capacity of flex anchor

Direct shear of flex anchor

Deflection of flex anchor

Practicality Thickness of GFRC panel, spacing of steel stud, spacing of flex

anchor

Table 2 Material properties

Materials Properties Values

GFRC panel

Elastic Modulus 13,200 MPa**

Density 2,200 kg/m3

Compressive strength 10*, 20** MPa

Tensile strength (Modulus of Rupture) 4*, 8** MPa

Steel stud

Elastic Modulus 200,000 MPa

Density 7,850 kg/m3

Yield strength 240 MPa

Flex anchor

Elastic Modulus 200,000 MPa

Density 7,850 kg/m3

Yield strength 480 MPa

* 1 day, ** 28 day



I349

Finite element method

The GFRC stud-frame system was modeled as three-dimensional model.

GFRC section was analyzed as linear elastic behavior before cracking, and steel was

modeled as bilinear elastic-plastic behaviors to allow local yielding, if any.

Pin supports at four corners were used as boundary conditions for the case

where the system was installed vertically on the structure. Surface frictionless contact

was used as boundary condition for the case of lifting of the panel from the ground.

For the load in model, wind load of 200 kg/m2 and construction live load of

50 kg/m2 were applied as pressure. Dead load was applied as gravity according to the

material’s density. Shrinkage was applied as thermal contraction on GFRC panel.

Lifting of the panel was applied as displacement.

Results and Discussions

1. Out-of-plane behavior constraints

• Moment capacity of steel stud

Moment capacity of steel stud must be sufficient to resist wind load of 200

kg/m2 imposed on the panel. The calculating assumption, as shown in Figure 3, was

that the loads on the panels were transferred directly to the stud, which was simply

supported.

Loads

Steel stud

Tributary area for

out-of-plane load

on steel stud

ss

ls= 4000 mm

Figure 3 Calculating assumption for strength of steel stud.

The constraint equation for the moment capacity of steel stud is:

3 2 6432 64800 3.04 10 6280 s s s st t t s (3)

Figure 4 shows the comparison between the stress of steel stud from hand

calculation and FEM for various stud size and spacings. Overall, the stresses from hand

calculation follow similar trend as those from FEM, but were higher by 20-35%. This

was because the panel was not assumed to carry any load in the hand calculation, while

there may be some contribution of the panel in the FEM model. Therefore, the equation



I350

from hand calculation can be safely used as a constraint function for moment capacity

of steel stud.

(a) Varying steel stud size

(b) Varying spacing

Figure 4 Comparison of stresses of steel stud between hand calculation and FEM

• Deflection of steel stud

The deflection of the steel stud should not be over the allowable deflection.

The calculating assumption, as shown in Figure 5, was that the GFRC panel and steel

stud frame were not working as a composite system under the wind load of 200 kg/m2.

The supports were assumed to be simple at the both ends of the steel stud.

s

Steel studLoad

ls= 4000 mm

Figure 5 Calculating assumption for deflection of steel stud

The constraint equation for steel stud deflection can be written as follows:

5 2 3 4

22.2(7.16 10 2

2450

1900 283 1.33 )

0 s

s ss s

s

t tt t

(4)

Figure 6 shows the comparison between the deflection of steel stud from

hand calculation and FEM. The deflections from hand calculation were 30-43% higher

than the values from FEM. The percentage difference may seems large but the actual

difference was only 1 to 4 mm over 4000 mm stud span, which were insignificantly

small considering the variabilities in materials and construction. Primary cause of the

difference was because the panel was not considered composite with the steel stud in

resisting the load. Since the deflections of steel stud from hand calculation follow

similar trend as those from FEM and always provide slightly higher value. It is

conservative and safe to use the equation from hand calculation as the constraint

function for the deflection of steel stud.



I351


(b) Varying spacing

Figure 6 Comparison of deflections of steel stud between hand calculation and FEM

• Flexural strength of panel

The flexural strength of panel must be sufficient to resist the wind load of

200 kg/m2 imposed on the panel. Yield line theory (MacGregor and Wight, 2012) was

used to calculate the flexural strength of the GFRC panel. Four collapse mechanism, as

shown in Figure 7, were compared for the critical mechanism.

Collapse mechanism 2

PLAN

SECTION

ss

sf

Conti

nuous

Conti

nuous

2

ss

ss

sf

sf > ss

PLAN

SECTION

Conti

nuous

Conti

nuous


2

ss

ss

sf

ss > sf

PLAN

SECTIONβss

Conti

nuous

Conti

nuous


2

ss

Collapse mechanism 1ss ss

PLAN

SECTION

2

ss

Figure 7 Yield line collapse mechanisms

The critical one was found to be the collapse mechanism 2

(Amornsirichokechai & Chompreda, 2016). The constraint equation for flexural

strength of panel at 28 days can be written as follows:

2

2

15.50.00314

p

s

t

s (5)



I352

Figure 8 shows the pattern of normal stress along x-axis of panel under the

wind load of 200 kg/m2. Dark red color represents the area of high tensile stresses.

Green color represents the area of zero stress and blue color represents the area of high

compressive stress. It can be observed that the locations of high stress from FEM appear

to be in the parallel direction to the steel stud, similar to the yield line collapse

mechanism 2. Therefore, the yield line equation of collapse mechanism 2 can be

conservatively used as the constraint function for the flexural strength of panel.

(a) ss 500 mm, sf 500 mm

(b) ss 800 mm, sf 500 mm (c) ss 1000 mm, sf 500 mm

Figure 8 Normal stress (X-axis) of panel

• Deflection of panel between studs

The deflection of panel should not be over the allowable deflection. The

calculating assumption, as shown in Figure 9, was that the wind load of 200 kg/m2 acted

uniformly on the panel. The critical panel was the one at the edge where the interior

side was continuous (fixed) and the exterior side was simply supported.

p

LoadContinuous side

ss

Figure 9 Calculating assumption for deflection of panel

The constraint equation for the deflection of panel can be written as follows:

39

30.005

7.25 05

16

p

s

t

s

(6)

Figure 10 shows comparison between the deflection of panel from hand

calculation and FEM. The deflections from hand calculation were 1-85% higher than

those from the FEM. The deflections from hand calculation tend to diverge from those

of FEM when the panel is thin and the stud is far apart. This was because the thin panel

and far stud spacing lead to a flexible system, where panel membrane action becomes

important factor in resisting the wind load. Nonetheless, in terms of practicality, the

difference of 1 mm is insignificant for 800 mm of stud spacing. Since the deflections



I353

obtained from hand calculation are always higher than those from FEM, its equation

can be conservatively used as the constraint function for the deflection of panel.

(a) Varying thickness of panel

(b) Varying stud spacing

Figure 10 Comparison of deflection of panel between hand calculation and FEM

• Mid-plate deflection

The mid-plate deflection should not over the allowable deflection. It was

considered as the sum of the cross beam and the steel stud deflections. The assumption,

as show in Figure 11, was that the wind load of 200 kg/m2 acted on the panel surface

and the load was transferred directly to supporting steel frame, which consisted of cross

beam and steel stud. The cross beam was considered with either simple or fixed

supports. The steel stud was considered as simply supported.

cb

lcb = 4000 mm

l s /2

l s = 4

000

mm

/ 2w sw l

/ 2w sw l

(a) Cross beam

s

l s = 4

000

mm

ss

w sw s

(b) Steel stud

Figure 11 Calculating assumption for mid-plate deflection

The constraint equation for mid-plate deflection can be written as follows:

If the cross beam is simply supported:

7

4 3 2 5

4.91 10 2450022.2

1.33 283 21900 7.16 10

s

s s s s

s

t t t t

(7)

If the cross beam is fixed:

4 3

6

2 5

2450022.2

1.33 283 21900 7.16 10

9.81 10

s

s s s s

s

t t t t (8)



I354

Figure 12 shows the comparison of the mid-plate deflections between hand

calculation and FEM. When cross beam is simply supported, the deflections from hand

calculation were 88-116% higher than the values from the FEM. On the other hand,

when cross beam is fixed, the deflections from hand calculation were 7-22% lower than

the values from the FEM. This was because the behavior of supporting cross beam

while resisting the wind load are not truly simple support or fixed support, but rather in

between. Figure 13 shows behavior of cross beam under the wind load. Moreover,

slightly higher deflection from hand calculation compared with FEM may be expected

because the panel was not considered in resisting the load.


(b) Varying stud spacing

Figure 12 Comparison of mid-plate deflection between hand calculation and FEM

Figure 13 Behavior of cross beam under the wind load

Since the supporting cross beam is neither simple support nor fixed support,

for simplicity, a weighted average of mid-plate deflection between those from simple-

support and fixed support conditions was applied for this constraint. Three-fourth of

mid-plate deflection with fixed-support cross beam and one-fourth of mid-plate

deflection from simple-supported cross beam was found to be a reasonable and

conservative approximation of the deflection from the FEM, as shown in Figure 12.

The adjusted constraint equation can be written as:

7

4 3 2 5

1.96 10 2450022.2

1.33 283 21900 7.16 10

s

s s s s

s

t t t t (9)



I355

• Punching shear of panel

The punching shear capacity of panel must be sufficient to resist the wind

load of 200 kg/m2. The calculating assumption, as shown in Figure 14, was that the

perimeter area around flex anchor was the critical section for punching shear failure.

Steel stud

Critical perimeter

for punching shear

Plan

Punching shear area

Flex anchor

Steel stud

Section

tp + 75 mm

tp + 6 mm

Figure 14 Calculating assumption for punching shear

The constraint equation for punching shear can be written as follows:

2107 2.65 0.00157 0p p f st t s s (10)

Figure 15 shows the comparison between the punching shear of panel from

hand calculation and the FEM. The punching shear from the hand calculation were

found to be 44-51% lower than the values from FEM for the steel stud spacings of 500

and 800 mm. This was because the critical punching shear perimeters were located on

the steel studs which were distorted, as shown in Figure 16. For steel stud spacing of

1000 mm, the punching shear from hand calculation was 19% lower than the those from

the corresponding FEM. This was because the steel stud supporting the critical

punching shear perimeter was located at the center of panel, which had little distortion

so the result from both method agree with each other. Due to a large difference, the

hand calculation must be adjusted to allow for the steel stud distortion before it can be

used as a constraint. Since it is not easy to account for the distortion, the adjustment

factor of 2.0 was adopted to be the additional safety factor for this constraint. The

adjusted constraint equation can be written as:

210 07 2.65 0.00322p p f st t s s (11)



I356

Figure 15 Comparison of punching shear

between hand calculation and FEM

Figure 16 Distortion of steel stud while

carrying the load

• Strength of panel while lifting

Generally, the panel was lifted by cables at two lifting points for stability.

However, there may be an instant where one cable is sagged while lifting, which causes

the panel to carry an usually high load at one corner. This leads to the critical stress in

the panel due to the longer span length between the lifting corner and the supporting

corner.

Lift

SupportRod

Figure 17 Lifting one point of the panel

In this case, due to complex geometry and load, it is complicated to

formulate a closed-form equation for hand calculation. Therefore, only FEM was used

to investigate the behavior of panel while lifting out of the mold. The displacement of

1 m was applied to the steel frame through a flexible rod, as shown in Figure 17.

The analysis of results indicate that the panel had very little stresses while

lifting out of the mold, as it has to carry only its self-weight which was significantly

smaller than the wind load experienced at later stages. At this stage, the maximum stress

of panel is about 10 times lower than its ultimate strength. Thus, this constraint is

unlikely to control the result of the optimization.

2. In-plane behavior constraints

• Moment capacity of flex anchor

Moment capacity of the flex anchor must be sufficient to resist the resultant

load caused by a combination of dead load, shrinkage, and thermal contraction of the



I357

panel. The calculating assumption was that the 6 mm diameter flex anchor was fixed at

the both ends with one support settles relative to the other, as shown in Figure 18.

Steel stud

GFRC panel

xf

Dea

d L

oad

M

MFlex anchor

Welded

point

Assumed

fixed support

Figure 18 Calculating assumption for the moment capacity of flex anchor

The constraint equation for the moment capacity of flex anchor is:

21 21 2 6 3 16

4

5.71 3230 9.14157 0

10 100

f s p f f s p f

f

s s t x s s t x

x

(12)

Figure 19 shows the comparison between the stresses in flex anchor from

hand calculation and FEM. The combination of shrinkage and thermal contraction tends

to be more critical than the dead weight. Therefore, reducing the flex anchor length lead

to higher restraint and greater moment. At the critical flex anchors near the corner of

panel, the stress from hand calculation were 11-14% higher than that from FEM. Since

the stresses of flex anchor from the hand calculation are slightly higher than that from

the FEM, the equation from hand calculation can be conservatively used as the

constraint function for this constraint.


(b) Varying length of flex anchor

Figure 19 Comparison of stresses of flex anchor between hand calculation and FEM

• Direct shear of flex anchor

Shear capacity of flex anchor must be sufficient to resist the resultant of the

combination of dead load, shrinkage, and thermal contraction of the panel. The

assumption for this constraint is similar to that in the moment capacity of flex anchor

constraint. The constraint equation for direct shear of flex anchor can be written as:



I358

2 2 2 6 3 17

6

10 129002.28 1 3.67 0

0 174 0

0f s p f f s p f

f

s s t x s s t x

x

(13)

Figure 20 shows the comparison between the shear forces of flex anchor

from hand calculation and FEM. The shear forces from hand calculation follow similar

trend as FEM, and were 6-8% higher than the values from FEM. Since the shear from

hand calculation always provide slightly higher values than those from FEM. Thus, the

equation from hand calculation can be conservatively used as the constraint function

for this constraint.



Figure 20 Comparison of shear in flex anchor between hand calculation and FEM

• Deflection of flex anchor

The defection of flex anchor should not be over the allowable deflection. In

this study, the allowable deflection for this constraint was chosen to be 5 mm due to

aesthetic concern. The calculating assumption for this constraint is similar to moment

capacity of flex anchor constraint. The constraint equation can be written as:

14 37.0 0 57 1 f s p fs s t x (14)

Figure 21 shows the comparison between the deflections of flex anchor from

hand calculation and FEM. The deflections from hand calculation were 8-17% lower

than the values from FEM. This was because the flex anchors at the edge and the corner

of panel carry the dead weight more than the tributary weight due to the deformation of

the steel frame. Thus, they deflects more than the average deflection used in the hand

calculation. To be able to use constraint equation from the hand calculation, an

adjustment factor of 1.2 must be adopted to be the additional safety factor for this

constraint. The adjusted constraint equation can be written as follows:

14 38.4 0 58 1 f s p fs s t x (15)



I359



Figure 21 Comparison of the deflection of flex anchor between hand and FEM

Conclusions

The accuracy of constraint functions and complex behaviors for each

constraint can be summarized in Table 3

Table 3 Summary of accuracy of constraint functions

Constraint Accuracy of

theoretical equation

Complex behavior

Moment capacity of steel stud Satisfactory

Deflection of steel stud Satisfactory

Flexural strength of panel Satisfactory

Deflection of panel between studs Satisfactory

Mid-plate deflection Unsatisfactory Cross beam support is

not truly simple or fixed

Punching shear of panel Unsatisfactory Distortion of steel stud

and flex anchor

Strength of panel while lifting - -

Moment capacity of flex anchor Satisfactory

Direct shear of flex anchor Satisfactory

Deflection of flex anchor Satisfactory

The conclusions can be drawn as follows:

1) Hand calculation provides satisfactory accuracy for the moment

capacity of steel stud, deflection of steel stud, flexural strength of panel, deflection of

panel, and moment and shear capacity of flex anchor.

2) Hand calculation is not accurate for punching shear of panel because

hand calculation did not include the effect of distortion of steel stud and flex anchor,

which cause non-uniform load distributions among flex anchors. It is also not accurate

for mid-plate deflection because the behavior of supporting cross beam while resisting

the wind load cannot be idealized as either simple support or fixed support.



I360

Recommendations

The effect of distortion of steel stud and flex anchor should be developed

for hand calculation for the punching shear of panel constraint. The behaviors of steel

supporting frame while resisting the gravity load should be studied in more details

because it affects the load distribution of flex anchor.

References

Amornsirichokechai and Chompreda. (2016). “Cost Optimization for Glass Fiber

Reinforced Concrete Cladding System with Steel Frame.” The 21st

National Convention on Civil Engineering, Songkhla, Thailand.

Amornsirichokechai. (2016). “Analysis and Cost Optimization for Glass Fiber

Reinforced Concrete Cladding System with Steel Frame.” Master Degree

Thesis, Mahidol University.

TIS. (1990). Standard for Hollow Structural Sections, TIS 107-2533. Bangkok,

Thailand.

ACI. (1996). State-of-the-Art Report on Fiber Reinforced Concrete, ACI 544.1R-

96. Farmington Hills, Michigan.

ASCE. (2010). Minimum Design Loads for Buildings and Other Structures. ASCE

7-10. Reston, Virginia.

AISC (2003). Manual of Steel Construction Load and Resistance Factor Design.

3rd ed. Chicago, Illinois.



I361

Multidiscipline Techniques in Spatial Audio

Author: Thomas Hanson

Program: Masters of Sonic Art and Acoustic Design

Institute: Silpakorn University

Abstract

Spatial audio is a term commonly used to describe both the acoustic phenomenon in

physical space and modern multi-source sound reproduction, in particular, those related to the

modern concept of ‘surround sound’. It is becoming an increasingly important area of study due

mostly to commercial industries furthering their exploration of virtual spaces (VR) and

interactive media. The commercialization of sound has been a particularly influential force on

the sonic arts in terms of not only how sound is created and consumed, but the intention and

meaning it carries. As this increasing interest in spatial audio furthers the commercial potential

of sound, it also ushers new tools for the artist to explore sonic possibilities previously obscured

by the popular misconception of sound as a commodity. These tools can provide new avenues for

the modern musician and sound artist but must be applied in new ways. Finding new ways to

apply this tools requires the artist to use a multidisciplinary approach. By looking at related fields

of study I believe the potential of spatial audio can expand beyond the confines of the industry

and commercial audio consumption.

Keywords: Multidisciplinary, Spatial Audio, Sonic Art, Buddhism, Asian Occult, Visual Sound,

Linguistics, Architecture, Philosophy, Linguistics, Mathematics, Art.

Introduction

I was first “turned-on” to spatial audio after visiting the Audium theatre in San Francisco.

Since 1967, Audium hosts weekly presentations of spatial audio compositions by Stan Shaf on

176 speakers. While I had been familiar with spatial audio at the time, the majority of my

experiences where those in traditional types of movie theatres and always in connection with a

film. The experience at the Audium was significant because it focused on the sound experience

rather than a particular story. What I experienced was much more inner reflection than

transportation. I became aware that spatial audio had the potential of not only recreating spaces,

but also invoking deeper listening: a process that could also lead within. As a musician this

sparked my curiosity and pushed me beyond the bounds of chords, notes, and musical language.

As I continued my research into areas of knowledge: about spaces, about acoustics, about

manipulation of sound, and the psychology of the listener, I quickly discovered that music had

the potential to be so much more.

Although inherent to the nature of sound itself, Spatial Music, as a distinct concept, was

first recognized just before the turn of the 21st century. It is true that all music is spatial, but

acoustic locality became a distinct element of music with the introduction of the loudspeaker and

the artificial reproduction of sound. Today the majority of music and composed sound is

delivered to listeners through the means of speakers and audio amplification. As technology

continues to develop we must find new ways of connecting modern capability with elemental

human needs.



I371

Music and sonic performance served many roles for the early human and was commonly

used as a spiritual and communal tool for society. Today we find that the role of music and

sound has evolved. This evolution can be traced to the technologies and social practices of the

modern age. In particular, the industrial commercialization of music has changed sonic practices

in several major ways, including increased focus on sound as a commodity, increased consumer

access to the tools of sound production, and hyper-distribution via the internet. Furthermore, this

type of technological evolution has had a profound impact on all aspects of life; everything from

psychology and politics to the visual arts.

In this paper, I suggest ways in which we can continue this evolution more responsibly,

particularly with those elemental human needs in mind. I believe we can find new perspectives

for critiquing and improving modern sound practices by looking at other disciplines and how

they have reacted to the rapidly changing technology of today.

Objectives

1) Identify trending issues in the world of sonic arts.

2) Illustrate the benefits and importance of multidisciplinary perspectives in research.

3) Explore the relationship between the sonic art and other disciplines.

3) Create spatial audio works that incorporate the methodologies and perspectives of other

disciplines.


From within each discipline there is an inherent understanding of other related

disciplines. In 1265 English philosopher Roger Bacon wrote “… mathematics is not beyond the

intellectual grasp of anyone. For the people, at large and those wholly illiterate know how to

draw figures and compute and sing, all of which are mathematical operations.” That is,

regardless of our skillset or level of ability, looking deeper into fields other than our own and

working alongside those who do gives us a greater understanding of our own methods.

A multidisciplinary approach to spatial audio requires an in-depth look at both the

conceptual and physical dimensions of working with sound. The primary method of research

here involves finding overlaps between the perspectives of other disciplines and their potential

application in the world of sonic arts. For example, the religious scholars and devotees of Hindu

and Buddhism have often spoken philosophically of the significance of sound in universal

understanding. As the world becomes increasingly secular has some of this insight been lost?

Can these perspectives help to inform some of the new spatial audio practices which are

predominately driven by personal and commercial interest? Likewise, we can look to the theories

and practices of architecture to learn more about the social and psychological effects of space

and how this insight can be further applied to the creation of sound and music in a spatial

environment.

Methodologies for identifying conceptual connections involve a deep look into the

literary works of scholars and artist working within the related disciplines. By reading the



I372

theories of these disciplines we find both scientific and esoteric proof of sonic understanding,

long forgotten by the commercially driven practices of today’s sonic art.

Methodologies for further understanding the physical possibilities of sound require a

reassessment of space and sound as a physical element. By removing oneself from the

perspectives of a musician, sound designer, or sonic artist, the elements of sound and space take

on new roles. From the study of sound pollution and mental health to architectural experiments

on social interaction, there exists many models of efficiency and ulterior intentions for which the

sound artist may not have been previously concerned.

‘Philosophy’

“In ancient times words and music were used to attain an altered state of mind. Music

was an aid to develop the mind, spirit, emotions and sensitivity. In this modern age, different

forms of music have developed, like rock, heavy metal, jazz, etc., but until recent times music

was used not to please the mind but to tranquillize the agitations of the mind.” - Swami

Niranjanananda Saraswati

Starting with namely ancient Indian metaphysics, humans have had longstanding

philosophies of sound and vibration. Many of these theories and thoughts have since been lost in

today’s mathematical and scientific approach to sound design. When comparing the function of

ancient music with the popular music of today, it may seem obvious that music no longer serves

many of the roles it once played. Music was believed by the masses to connect us with a

universal energy, it was seen as capable of psychological healing, and a guiding measure for self-

reflection. While this perspective is arguably still present in the mindset of today’s musician’s,

the commercialism of music threatens it. As Swami Saraswati suggest in the quote above, there

is, in recent times, hope for greater functionality in the world of sound. I consider much of this

due to the recent technological developments that give sound artist greater control over sound

and increased interest in the environmental spaces where acoustic phenomenon occurs.

From the spiritually enlightened work of La Monte Young, which forces the listener to

explore space and note relation, to the sound therapy practices of Dr. Jeffrey Thompson, the

modern musician seeks to go beyond the thematic song and entertainment oriented perspective

and considers the tonal implication, physiological impact, and intention of their pieces.

‘Graphic Design’

“The comparison of various means with which each single art expresses itself, by

learning from each other, can only be successful and conclusive if the lesson is not only

superficial but truly fundamental. Thus, one art must learn from another how to use its common

principle and how to apply it to the fundamentals of its own medium. Borrowing these methods,

the artist must not forget that all mediums contain within themselves unique characteristics, and

it is up to him to discover the proper application.” - Wassily Kandinsky (On the Spiritual in Art,

1911)



I373

Perhaps one of the most influential abstract painters and art theorists, Wassily Kandinsky

was a design teacher at the Bauhaus school of art in the 1920’s. Kandinsky, a color theorist, was

no stranger to multi-disciplinary study. Some of his most famous works of art were experiments

in synesthesia, or the attempt to visualize sound. While not a musician himself, he saw a

common language between the two very different mediums. On the topic of this commonality, he

stressed the importance of learning the limitations and advantages of each medium.

“In this application of form, music achieves results which are beyond the realm of

painting. On the other hand, painting outdistances music in many ways. For instance, music has,

at its disposal, the duration of time, while painting does not possess this advantage but presents

to the spectator Its entire message in one single Instance, something music is incapable of doing.

Music, by its very nature, is ultimately and fully emancipated” This suggest that while we may

find limitations in our medium, we can overcome these limitations by exploring its relationship

to another medium. In the case of music and art he concludes by saying, “…music can avoid the

extension of time while painting can utilize it.” By visualizing our sonic works, we can further

expand out palate; stretching time beyond its limitations, freezing it, and opening up new

connections between our composition and how others are capable of perceiving it.

‘Architecture’

“Architecture is frozen music.” - Johann Wolfgang Von Goethe. In perhaps one of

referenced quote in all of architecture, Goeth pronounces the relationship between architecture

and music to be that of a mere shift in state. Whether or not they are of the same origin, they

certainly have a deep relationship. For as long as people have been building structures they have

been making sound inside them. Throughout history, various cultures have taking to building

with acoustics in mind; from temples to theaters, and halls. Still very evident in today’s concert

venues and recording studios, musicians and engineers must work with architects to some extent

in search for creating quiet and ideal acoustic spaces.

Much has been said both for and against the infamous Goethe quote. David Foxe, an MIT

student who graduated with degrees in both architecture and music, responded in the quote in the

MURJ student journal by saying, “Goethe’s idea relating architecture to “frozen music” seems to

do a disservice to both disciplines; taken literally, architecture can often be quite flowing and

dynamic, while music doesn’t always feel thawed through. Searching for such “parallels”

between architecture and music shows that it is the descriptive, semantic language that is shared

rather than any actual content.” (Foxe, 2002) While it is up to the individual to see architecture

as fluid or music as structural, this statement reminds us that: no matter how similar two

disciplines or mediums might be they are not one and the same. The true significance of multi-

disciplinary study is to explore the full dynamics of each discipline and form a common

language for which the two can communicate.

‘Mathematics ‘

“Mathematics and music, the most sharply contrasted fields of intellectual activity which

can be found and yet related, supporting each other, as if to show forth the secret connection

which ties together all the activities of our mind…” - H. Von Helmholtz, 1884



I374

Mathematics has long been an integral part of Music and without it, the developments of

all sonic understanding would be nearly nonexistent. Conversely there is a great divide between

the mathematical understanding of music and the physical or emotional relationship to sound.

For the greater part of music’s history, the musician has come to understand, in a very direct

way, the physicality of sound; everything from the relationships of frequencies to the sonic

effects of materials and the environment. When asked to explain these phenomena arithmetically

most musicians could barely scrape together a basic equation. As a result, the interaction

between mathematics and music has been fairly reciprocal in nature. A musician discovers

something he believes is of sonic significance and the mathematician seeks to explain it.

Consequently, the mathematician discovers both fundamental concepts of the sonic phenomenon

and equations for which they can be reproduced or expanded.

This relationship is evident in the creation of the western music system. What was

originally a mathematical analysis of ancient music language becoming a mathematically refined

set of rules which would later become a standard. (see the just intonation and equal temperament

systems). Because of mathematics musicians have gained the powerful function of transposition,

or the ability to change the fundamental of scales and musical motifs while retaining all the

relative ratios.

In spatial audio, mathematics is an integral tool to explaining the acoustic properties of

space. Spatial audio must be concerned, far more than conventional audio, the way in which the

audience perceives the sound. Sonic Arts researcher Gary S. Kendall explains that: “the listener’s

experience depends on many factors, among which are acoustic factors that directly affect the

listener’s spatial hearing and ultimately influence the spatial meanings understood by the

listener” Mathematics is essential to understand the acoustic phenomenon and to recognize the

acoustic principles that both prohibit and enhance the spatial listening experience. Spatial audio

concepts such as depth, envelopment, and precedence are best understood when analyzed in

controlled and calculated environments. Without this cross curricular focus, it is extremely

difficult to reproduce sound spatially with consistency.

‘Linguistics’

Linguistics is a field of study highly concerned with sound as Linguistics is the

study of language and refined communication, which, when concerned with oral expression, is a

type of sonic phenomenon. The connection between sound and meaning however is rocky one,

and the linguists of our times have searched far and wide to disprove the current rule of the

structural linguistics: the relationship between sound and meaning is arbitrary.

Current research on the topic of sound symbolism looks beyond the traditional umbrella

of language to disprove this long debated tenant of structural linguists. Considerable evidence

shows non-arbitrary connections in concepts such as: vocal intonation, ending rising tones

convey a question; intonation in relationship to size, e i y vowels convey small sizes and a o u

vowels convey large sizes; non-human vocalization, connections between animal ‘languages’;

and acoustic origins of body language, the smile and suggestive movements. (Ohala, 1997)

Through this type of research musicians and sound designers might find insight to the universal



I375

meaning of sounds, the types of emotions they convey, and new methods of sonifying ideas and

themes.

Whether or not linguistics can provide proof to the inherent meaning of sound, It is a

significant field in relation to music and particularly spatial audio. The semantics of our language

is not unlike the structure of ours songs, the ups and down of our emotional expressions are not

unlike a melodic passage, and the evolution of language in response to each new means of

communication is not unlike the various musical genres and styles born from each new

technological offering.

In the modern age, technology allows the sound artist to move far beyond the poetic

constraints normally associated with music and focus instead on audibility, sonic manipulation of

language, and the synthesis of spoken languages. There is already significant progress in this

sector and one can look to Google’s progress in translation technologies, TTS technology for the

disabled, Vocaloid and other melodic voice synthesis software, and Adobe’s recent efforts in

voice modeling and the field of augmented reality.

‘Personal Methodologies’

My personal method of approaching multi-disciplinary studies is all about making

connections. The connections which I seek to identify vary in type and intensity. Quite often I

will find a simple word combination, such as you will see with my piece Ching I Ching, which I

will explain later on. Linguistics often times shares underlying concepts hidden beneath the

popular connotation of a word. For example, in music we may have concepts such as a flat or a

sharp note. By considering the other meanings of flat and sharp, you may be able to relate a

punctured tire with a flat note and knife with a sharp note. Results may often be arbitrary, but I

argue that there are underlying connections to be explored beneath the language that these

connections hide behind. A majority of my work focuses on establishing a connection between

sounds and our perception of them as humans. It is nearly impossible to listen to a sound and not

engage the thought process: connecting it with a theme, an emotion, a memory, or idea. This

sound consciousness can be brought to new levels by intentionally exploring the underlying

properties of what is at play. If I incorporate the sound of the ocean in a sound piece, the next

step is to explore every related concept. What can we learn about the ocean? Can we connect the

scientific knowledge of oceanic waves with those of sound waves? Can we communicate some

of the social issues regarding the ocean through sound alone? Can we take advantage of spatial

audio techniques to invoke the ocean’s vast movements? I find my inspiration in these types of

questions and believe this is an important step to furthering the sonic art practices.

Results

The results of my connection making and multi-disciplinary research are the basis of

several spatial audio projects which I shall explain piece by piece. Utilizing my personal method

of research, each piece starts with central object. Whether an it is unique perspective, an ancient

philosophy, or a collection of symbols, the object is explored through as many disciplines as

possible. By asking questions about their philosophical principles, mathematical explanation, or

aesthetic qualities I find many parameters which can be directly applied to spatial audio domain.



I376

The intention for most of this work is to empower sound with new functionality. From

transporting the audience to a new perspective to inducing self-reflection, each piece seeks to

take the potential of sound beyond that of pure entertainment.

‘Foreign Ears’

Foreign Ears is an installation, previously installed as a part of the 2015-2016 As(ear)n

Exhibition at Museum Siam. Foreign Ears was the natural result of the multi-disciplinary aspects

of my life, particularly being a foreigner studying in a Thai University. It started first with an

obsession to record everything. With an effort to focus less on the quality of my sounds and more

on the content. I began to secretly record every day-to-day situation I found myself in. Upon

review of these sounds I discovered some great stories told to me by Thai taxi drivers whom I

would regularly have casual conversations with. At some point, I chose to share these recordings

with my peers and quickly discovered that the conversations between me, a foreigner, and the

driver, a native Thai, were linguistically unique. Particularly in terms of content. This usually

came in form of a Thai person explaining their perspective on Thailand in their own native

language with no intention to be translated. I realized that conversations of this type are quite

rare. While they may feel completely natural from my perspective, it is a very strange

perspective for native speakers to follow. Sonically and linguistically it also reveals

subconscious details about the way we communicate, in particular: the phrasing, semantics, and

tone a native speaker may use when trying to speak to a foreigner in their native language.

In the process of composition and mixing, many concepts of linguistics were also

borrowed. The poetic aspects of lyrical content and figurative themes in music have always taken

into consideration the linguistic property of each word. Each word has a connotation or hidden

meaning which opens the composer up to opportunities of word play. This allows the songs

meaning to twist and turn with each changing perspective. In Foreign Ears, the stories of each

taxi driver were analyzed and joined together at points of commonality. When two stories used

the same word or the same theme appeared the recordings were cropped and juxtaposed into a

new conversation. The result is a dream-like soundscape which flows between conversations

which are seemingly aimed at a person of the most peculiar perspective.

The spatial audio techniques used in this piece were focused on building a parallel story

structure. Because Foreign Ears is concern more with perspective than narrative, the

conversations were mixed on multiple channels and frequently over lapping each other. This

allows the audience to explore the piece, moving around to hear the different perspectives; not

only different perspectives of the sound in space but also the stories which varied from one area

to another. At times, it becomes difficult to focus on one particular conversation and the listener

begins to jump from one source to another based on their own personal interest. This was

intentional decision to force the listener to make connections, to create their own story, and to

establish their perception of the stories rather than be force to experience the stories in a linear

fashion. This type of spatial presentation gives the audience an opportunity to better understand

spatial audio as a concept. By physically exploring the space and listening closely to the various

stories or elements mixed within, the audience can begin to creating their own connections.

Conversely the audience is also presented with the opportunity to listen from the center of the

sound stage for which they can take in the totality of the sounds; reflect on the strangely foreign



I377

perspective that surrounds them.

‘Ching I Ching’

‘Ching I Ching’ is a cross disciplinary exercise between sound art, philosophy, and

cultural anthropology. The scope of the project involves a series of generative compositions to be

actualized through both performance and interactive installation. At its core ‘Ching I Ching’

focuses on two sources of inspiration: first, ‘the ching’ or ‘ฉง’, a traditional Thai instrument of

Chinese ancestry and second, the ‘I-ching’ an ancient Chinese book of clairvoyant wisdom. Both

the I-ching and its musical counterpart, the ching, are seminal forces in their domains.

Because this project was a sound-based art piece the I-ching took on majority of my

research as the ching, being a musical instrument had a self-explanatory role. In researching the

ching I did discover the ching’s ability to lead, much like a heartbeat, the Thai musical structure.

For philosophical ideas, It was more important however to dig deep into the I-ching. While there

are no in-depth music studies on the I-ching, several musicians have been influenced by its

fascinating ability to explain the element of chance. I began to look at the ways in which these

artists were influenced by the book and had incorporated it into their compositions.

To begin creating a piece which brought together the ching and I-ching, the parameters

and languages of both tools were laid out. I began making connections between these parameters.

These results were graphed out (see the figure below) and a process for the work began to take

form.

I

C

H

I

N

G

PARAMETER NOTES PARAMETER

C

H

I

N

G

closed and broken ching/chap – yin/yang closed and open

above / below symbol up/ down – send/revieve top / bottom cymbal

changing lines primary /secondary divisions of tempo

universal cycles constant change tempo

king weng sequence progression rhythmic patterns

four seasons cycle 4 stages 4 steps 4 bar measures

six lines identity 6 bar measures

8 trigrams 2measure2trigrams 2 measures

64 symbols divisions of 64 2 cymbals

The divination process is one of chance but I always sensed it was not entirely random.

Whether the toss of a coin or draw of a card, the process of casting always involved a

performative action, a physical connection, and a transfer of energy. To preserve this I decided to

continue this piece as a performative one. By using digital tools, one could consult the wisdom of

the I’ching through traditional means but with sound as the medium of transferring results and a

digital instrument as the means of access and navigation. The results were sonified using both

associated patterns of ching symbols and synthetic voices of both Chinese and English origin. A

database of the hexagrams and their meanings was created in addition to a visual menu which

gave a deeper look into the chosen hexagrams meaning.



I378

While not deviating from the tradition method of I-ching divination, the Ching I Ching

sought to create a new aesthetic for fortune telling and oracle consulting. By using sound as the

medium, I believe the fortune for which you receive can be more than just analyzed visually, but

felt by the body and allowing a sonic connection to both the mathematics of the I-ching and the

elemental nature of the ching symbol.

The spatial audio techniques used in this piece focus on the elemental nature of the

I’ching hexagrams. Each symbol in the I’ching is an expansion of smaller concepts. The entire

Chinese system of philosophy stems from one singular energy, from which is divided by two

(yin-yang) and so forth until we reach the 64 hexagrams of the I’ching. Because the intention

was to bring these mathematical patterns to the sonic domain it seemed logical to illustrate each

element of the hexagram separately. If one speaker could represent one element of each

hexagram, then six speakers could give each hexagram their own unique presence in space,

something not possible with two speakers in which many configurations of sounds will be

identical when sonified.

‘Speak Spell’

Speak and spell is an ongoing series of generative sonic pieces that I have created based

on the visual compositions of various yant symbols. Yant symbols are a type of religious and

mystic diagram derived from the yantra symbology of ancient India some 2000 years ago. Today

yant symbols are a popular feature of Thai Buddhism and traditional Thai culture, particularly in

the art of tattoo. Yant symbols originated sound: transcribed mantras, or words and sounds to be

chanted in prayer or meditation. The mantras or ‘kata’ are then written, usually in ancient Khmer

script, and incorporated into geometric or figurative like visual forms to become yant.

The sonic installations of Speak Spell combine the two elements defined above using

spatial audio techniques and text to speech software. Composition considers many aspects and

parameters of each yant; primarily its numerical and geometric values but also its intended

meaning and even associated folklore. In terms of reproducing the symbols sonically these

parameters are translated into various spatial audio concepts: the number of speakers, speaker

placement, rhythmic patterns, frequency ratios, and the type of sonic content. See the figure

below for a visual comparison of a yant diagram and a spatial audio speaker diagram.



I379

As Speak Spell is an ongoing project, the initial symbols to be realized are three of the

most significant and consequently most popular yant symbols: Hah Teaw, Gao Yort, and

Trinisinghae. To begin I analyzed the yant’s features and created a list of possible values. The

Trinisinghae, for example, features the following elements: 4 diamonds containing the number 5,

8 triangles containing 3 7 4 6 1 9 2 and 8 (in that order), 4 corners on two planes (a 2d

representation of a three-dimensional compass), and 8 loops or ‘knots’ that connect each corner

with ‘sealing’ spells written inside. In the order of traditional incantation, these combined

elements create a number stream of 3.7.5.4.6.5.1.9.5.2.8.5. Not only can the numerical content,

order, and location be considered in the sonification process but also the meaning of each

number. Ranging from the four emanations of Vishnu to the six guardian angels of heaven, each

numerical value represents the divine ruler of one domain.

The spatial audio techniques used in this piece are rather direct in their manner, the

elements of the yant are spatialized using speakers to represent the 8 knots of the symbol. The

speakers themselves are placed in the appropriate directions using a compass. Those four

speakers that represent the ‘knots’ will be given the short mantra associated with each seal of the

yant. Each sound inside the yant will be performed in its intended location and recording using a

microphone array. This type of recording involves a multi-channel recording of live acoustical

performance in a space identical to playback. Because the microphone will capture directionality,

no artificial localization of sounds is necessary. The performers inside the space during

recordings will be given instructions based on the divine being they will honor. The

compositional order of these elements will be based on the order of incantation. The frequency

and sound types they use with also relate to the number they represent. For example the square

which represent the number one is dedicated to the demon Mara. This square may be represented

by a single cymbal crescendo while the ‘three square’ that represents the Triple Gem may be the

strike of three harmonious bells.

The finalized installation layers these various sounds with the synthetic soundings of each

related mantra in addition to some harmonizing drones. The results is something between both

sound sculpture and digital enchantment. The intention is not only to explore the possibilities of

sonifying two dimensional graphics spatially, but also to explore the functionality. I believe that

by consorting ancient diagrams of the past, such as these yant symbols, we can better understand

the karmic nature of our sounds. Through specialization we can envelop listeners with sound;

enshrouding them with ancient wisdom.

Discussion

Locality and accessibility were once an extremely important element of music. No two

musicians think exactly alike and their personal interests take form as informants to their musical

expression. As the commercial markets of the world are unified by the internet, we find that

microeconomics become a new trend for consumption and that more and more humans are

reversing the effects of globalization and the virtual world by seeking a more physical and

localized relationship to their hyper-realities. This has a great effect on music as the musician

becomes far more common place and not that of international stardom. The gap between the



I380

listener and the musician, a once idolized super figure, is once again narrowing. As the line

between the performer and listener narrows, how do you see the relationship between yourself

and music changing? Do you feel a deeper connection to a singer who, perhaps sitting directly

across from you, delivers a beautiful song than that of your favorite album on headphones? Can

technology bridge the gap between human’s natural relationship with sound and our complex

interaction with those of artefactual nature?

As we witness the incredible discoveries of engineers in the dawn of bioengineering, or

the integration of software and computer sciences in the social and political systems of the world,

the importance of cross-curricular and multidisciplinary study is becoming increasingly obvious.

Similarly, I believe that the field of sonic arts, and spatial audio in particular, is one that could

benefit greatly from the insight of other disciplines also concerned with perception, physicality,

and human expression. This sharing of perspectives will lead to not only an expanded pallet for

artists but a deeper understanding of the effect that sound has on us as a society.

Recommendations

By exploring concepts like the geometry of ancient Thai symbology, the philosophy of

change in Chinese divination, and the linguistic peculiarities of my life as a foreigner, I

discovered new perspectives to approach my practice as a sonic artist. These concepts not only

brought new wisdom, meaning, and intention to my pieces but informed me in the process of

exploring spatial audio. In a field (spatial audio) mostly concerned with entertainment and

reproducing reality, these fields of research helped to form deeper connection between the

origins of my inspiration and their future potential.

I recommend that now, more than ever, musicians and artists work ‘outside of the box’.

With today’s nearly endless number of styles and the rapid evolution of artistic tools available to

us the idea of ‘a box’ seems sometimes non-existent, but it still exists. One such box for the

modern musician is the speaker box (especially stereo) paradigm in which almost all of these

genres and styles squeeze into. By using technology (both forgotten and new) to escape these

confines, artist today will find new forms expression with a greater variety of influence, using

the multidisciplinary approach to justify and navigate these deviations.

References

Fauvel, John, Raymond Flood, and Robin Wilson. Music and Mathematics: from Pythagoras to

Fractals. Oxford: Oxford U Press, 2010. Print.

Kandinsky, Wassily, and Hilla Rebay. On the Spiritual in Art. New York: Pub. by the Solomon

R. Guggenheim Foundation, for the Museum of Non-objective Painting, 1946. Print.

Ohala, John J. 1997. Sound Symbolism. Proc. 4th Seoul International Conference on Linguistics

[SICOL] 11-15 Aug 1997. 98-103.

Goethe, Johann Wolfgang von, Margaret Fuller, and Johann Peter Eckermann. Conversations

with Goethe in the last years of his life. Boston: Hilliard, Gray, and Company, 1839. Print.



I381

Foxe, David. Production and Reproduction; Architecture and Music

MIT Undergraduate Research Journal (MURJ) 7, 29, 2002.

"AUDIUM." AUDIUM. N.p., n.d. Web. 26 May 2017.



I382

Comparison of dimensional accuracy of various impression techniques in PW

plus implant system.

Authors: Nattaya Poovarodom, Chaivut Prunkngarmpun and Wilawan Weraarchakul

Program: Master degree in Prosthodontics Institute: Khon Kaen University

Abstract

The aim of this research is to compare the dimensional accuracy of the two

impression techniques and the three impression materials for PW plus implants.

Material and methods: The acrylic resin model with two implant fixture (4.2 x 10.0

millimeters, PW Plus, Thailand) were placed paralleling to each other. The

impressions were made by closed-tray and open-tray techniques. The three impression

materials (polyether, vinylpolysiloxane -monophase, and vinylpolysiloxane- putty and

light body) were fabricated ninety working casts. The groups were subdivided into:

Gr. 1 Closed-tray with polyether, Gr. 2 Closed-tray with vinylpolysiloxane

(monophase), Gr. 3 Closed-tray with vinylpolysiloxane (putty and light body), Gr. 4

Open-tray with polyether, Gr. 5 Open-tray with vinylpolysiloxane (monophase), and

Gr. 6 Open-tray with vinylpolysiloxane (putty and light body). The linear distances

were examined between the implant abutments and measured with the measurement

microscope. The data was collected into the 4 linear distances ([AC], [AD], [BC], and

[BD]) and the distortion value that provided the illustration for the dimensional

accuracy of the working cast measurement difference from the reference model

measurement. After the data was transformed by logarithmic transformation, the

result was analyzed with Two-way ANOVA. Results: there is no significant

difference in means of dimensional accuracy for the impression materials, the

impression techniques and the interaction between the impression materials and the

impression techniques in term of the distortion value. However, the linear distance

[BD] value shows that the closed-tray technique has more distortion than the open-

tray technique with a statistical significance (p = 0.039). There is significant

difference in mean linear distance values for the interaction between the impression

materials and the impression techniques in term of the linear distance [AD] and linear

distance [BD] values (p = 0.002 and p = 0.020). Conclusions: The working casts were

fabricated from 6 method demonstrated differences from acrylic resin reference

model. The closed-tray technique is likely to be less accurate than the open-tray

technique.

Keywords: dental implant, impression techniques, impression materials

Introduction

The successful outcomes of implant-supported prosthesis are dependent

upon the passive fit between the connection of the fabricated prostheses and the

implant frameworks [1]. Passive fit is critical for the long-term successful of

osseointegrated implants [2]. Misfit between implant frameworks and prostheses may

result in problems such as mechanical failures of the prostheses (e.g. loosening of

prosthetic and abutment screws), failures of implant systems (e.g. fracture of

abutment screws or implant components), or biological complications of the



I383

surrounding tissues (e.g. pain, tenderness, tissue responses, the loss of bone tissues,

and the loss of osseointegration) [3].

An acceptable prosthesis requires accuracy in all steps of procedure.

Distortion during master cast fabrication could lead to a misfit between implant

framework and prosthesis. The master cast must duplicate the surrounding tissues and

correct intraoral relation of the implant abutments position [4]. The first step of the

fabrication demands accurate position of the impression implant components and

records it with the impression procedure. Several impression techniques can be used

for implant prosthesis. There are two impression methods - at the abutment level and

at the implant level. The abutment level can be made either by a direct technique,

which makes impression on the abutment or by an indirect technique, which uses a

transfer impression coping, and then picking up coping on abutment. Two methods

can be applied for the implant level: direct technique (pick-up technique for open-

tray) using impression coping screwed onto implant body and unscrewed before

removing from the mouth, and an indirect technique (transfer technique for closed-

tray) using a narrow impression coping screwed onto implant body. Then, removed

the impression coping from the mouth and connected to the implant analog, and

reinserted into the impression [5].

Several impression materials had been studied, polyether and vinyl

polysiloxane (VPS) have been used at most and have been recommended for the

implant impression materials [6]. The polyether and the vinyl polysiloxane (VPS)

contributed to more accurate results comparing to other materials i.e. polysulfide,

condensation silicone, plaster impression, irreversible hydrocolloid and reversible

hydrocolloid [6-8].

From the present study, the passive fit demonstrates a significant impact

on success in implant-supported prosthesis. The crucial process is to copy the implant

positions through impression procedures. To accurately record the implant positions,

it is vital and sensitive to apply the proper impression materials and the impression

techniques. PW plus dental implant is a new generation of the Thai implant system.

There are only a few research topics on the PW plus dental implant. Therefore, it is

interesting to study that efficacy impression technique on PW plus dental implant that

could transfer accurately the location of the implant from the oral to the dental

laboratory. The objective of this research is to study the dimensional accuracy of two

impression techniques and three different impression materials for PW plus implant.

Objectives

The aim of this research is to compare the dimensional accuracy of the two

impression techniques and the three impression materials for PW plus implants.


The in vitro study to compare two impression techniques (closed-tray and

open-tray techniques) and three impression materials : 1) polyether - medium body

(ImpregumPenta, 3M ESPE, Germany), 2) vinylpolysiloxane - monophase

(Monopren transfer, Kettenbach GmbH & Co. KG, Germany), 3) vinylpolysiloxane -

putty and light body-regular set (Express XT, 3M ESPE, Germany)

Six groups will subdivide into

Group 1 Closed-tray with polyether



I384

Group 2 Closed-tray with vinylpolysiloxane (monophase)

Group 3 Closed-tray with vinylpolysiloxane (putty and light body)

Group 4 Open-tray with polyether

Group 5 Open-tray with vinylpolysiloxane (monophase)

Group 6 Open-tray with vinylpolysiloxane (putty and light body)

The reference acrylic resin model was fabricated and the two implant

fixture (4.2 x 10.0 millimeters, PW Plus, Thailand) drilled into the wax model which

center-to-center distance approximately 8 millimeters apart and paralleling to each

other, 10 millimeters in deep. After that the wax model was flasking and processing

into heat clear acrylic resin (Figure 1).

Figure 1 The reference acrylic resin model

For closed-tray technique, two closed-tray impression copings (PW Plus,

Thailand) were screwed onto the implants (Figure 2A). For open-tray technique, two

open-tray impression copings (PW Plus, Thailand) were tightened onto the implant

(Figure 2B). The model was used throughout the experiment. The impressions must

be made in an environmental stability test chamber, where construction is conducted

under a controlled temperature environment (36 ± 1°C) with relative humidity of 70%

± 5%. The impression trays were maintained in position with standard 5 kilograms

weight throughout the setting time.

Figure 2 Impression copings: closed-tray technique (A) and open-tray technique (B)

Two types of custom tray were made of stainless steel which carries 3

millimeters of internal space for consistent thickness of the impression materials. The

stainless steel trays were to be 2 millimeters in thickness and must be perforated

around for the use of retaining the impression material. For the open-tray, a window

was made on upper section of tray to expose the impression copings (Figure 3).

Applied the adhesive (Polyether tray adhesive or VPS tray adhesive,

Panasil tray adhesive) in each type of the impression material within the internal

surface of the tray for entirety and the application must be beyond on the external tray

border for 5 millimeters. It is expected that the adhesive must be allowed to dry and

A B



I385

set for 15 minutes before the final impression process. The open and closed-trays

were used throughout the experiment.

Figure 3 The stainless steel trays: the open-tray (A) and the closed-tray (B). The

impression trays were maintained in position with standard 5 kilograms weight

throughout the setting time (C).

Impression method: there was only one operator throughout the study. For

closed-tray technique, the impression material must be used according to the

manufacturer’s directions. The impression material is then injected around the

impression copings up to the level of completely covering the copings. Next, the filled

closed-tray will be placed over the acrylic resin model. The pressure must be

maintained with a standard of 5 kilograms weight and remains in a position until

impression set. After that the impression tray will be separated from the acrylic resin

model, two closed-tray impression copings will be unscrewed from the implant

fixtures, connected to the implant analogues, and then reinserted into the impression

(Figure 4).

For open-tray technique, after the two open tray impression copings were

screwed, the impression material was mixed according to the manufacturer’s

suggestions. The material is then injected around the impression copings. Next, the

filled open-tray will be placed over the acrylic resin model. The pressure must be

maintained with a standard of 5 kilograms weight and remains in a position until

impression set. The impression tray will be separated from the acrylic resin model

after the impression allowed to setting according to manufacturer’s recommendations.

Before separating, impression copings were unscrewed from the impression-tray unit.

Implant analogues were replaced and screwed into impression coping, while the

impression coping remained position in the impression-tray unit (Figure 5).

The impression tray was boxed in by the wax. (Boxing wax strips, Kerr,

USA) After the impression tray has been removed from the model for 30 minutes, the

type IV dental gypsum (Vel-mix, Kerr, USA) will be poured into the impression tray

to fabricate the working cast. The stone was mixed according to the manufacture’s

recommendations (100 grams powder/ 23 milliliters of distilled water). The powder

should be added to the water in the bowl and mixed by hand for 30 seconds and

mechanically mixed under the vacuum mixer (Whip mix, USA) for 30 seconds. Under

the constant vibration of vibrator, the mixed stone will be poured into the impression.

After stone setting for 60 minutes, the impression was separated. After that, the base

extension method will be implemented to adjust the height of the working cast. Before

measurement, implant abutments (PW Plus, Thailand) was fixed to the implant

fixtures (torque wrench 35 N.cm according to the manufacturer’s directions) and all

working casts must be stored for 24 hours at the room temperature.

A B C



I386

Figure 4 The closed-tray technique: the impression material is then injected around

the impression copings (A) up to the level of completely covering the copings (B).

Next, the filled custom tray will be placed over the acrylic resin model (C). The

impression tray was separated from the acrylic resin model (D).

Figure 5 The open-tray technique: the impression material is then injected around the

impression copings (A and B). Next, the filled custom tray will be placed over the

acrylic resin model (C). The impression tray will be separated from the acrylic resin

model. Before separating, impression copings were unscrewed from the impression-

tray unit (D).

C

A

D

B

A

D C

B



I387

The same operator was performed all measuring randomly to examine the

linear distances between the implant abutment and measured with the measurement

microscope (Nikon Measurescope 20 Trinocular Microscope, Nikon, Japan) with the

ability of concurrently recording -x, -y, and -z dimensions. The accuracy of the

measurement of the microscope is 0.001 mm for the x-, y-, and z-axes. The horizontal

measurement of the microscope would provide the x and y coordinate axes, which

would appear in a digital format. Whereas, the vertical measurement by adjusting the

focus of the microscope would provide the result of the z coordinate axis.

Before the measurement, the heights of implant abutments were reduced

until the second horizontal groove was reached in order to clearly examine the flat

surface and vertical grooves along the body surface of implant (Figure 6). Then,

dictate the reference points on the top surface of abutments. The reference points

located at two ends of the flat surface of implant abutment. The calculation of each of

the working cast must be done for 3 times and bring the results of the three time to

average, which is so called the value of the distance. The distance values derive from

the measurement between the 4 reference points (A, B, C, and D) at the two ends of

the flat surface of the two implant abutments (Figure 7).

Each reference point was recoded as three-dimensional coordinate axes.

Use the Pythagorean Theorem as explained by Carr et al., 1991 and Wee AG et al.,

2000 [8, 9]. The distances between each implant abutment were measured. The linear

distances were made of four inter-implant distances for all working casts and

reference acrylic resin model.

Distance ACworking cast – Distance ACmodel = Linear distances [AC] value

Distance ADworking cast – Distance ADmodel = Linear distances [AD] value

Distance BCworking cast – Distance BCmodel = Linear distances [BC] value

Distance BDworking cast – Distance BDmodel = Linear distances [BD] value

The formula above provides the illustration for the dimensional accuracy

of the working cast measurement difference from the reference model measurement.

To evaluate the dimensional accuracy of the working casts, the 4 linear distances

([AC], [AD], [BC], and [BD]) is then averaged, thus resulting in a distortion value.

The distortion value will be analyzed the overall accuracy by a statistical method.

A B

Figure 6 (A) Implant abutment

and (B) the heights of implant

abutments were reduced

Figure 7 An illustration of the 4 linear distances



I388

The SPSS software 19 (SPSS Inc., Illinois, Chicago, USA) was being used

in the analytical statistics. Normal distribution was done by using the Shapiro-Wilk

test. Two-way ANOVA was a major tool used to verify significant difference in the

dimensional accuracy of different combinations of three impression materials and two

impression techniques. On all analysis, α = 0.05 was the level of significance used for

the statistical analysis.

Results

Analysis of the distortion value

The distortion value was nonparametric and therefore must be transformed

by logarithmic transformation, and then the data was calculated with Shapiro-Wilk

test. The result was a normally distributed data.

The descriptive analysis of the means and standard deviations of the

distortion value are shown in Table 1. Group 4 (open-tray with polyether) showed the

lowest distortion value which means lowest distortion from the reference model and

had the lowest SD values (48.06 ± 30.66 µm). The distortion value for group 6 (open-

tray with putty and light body) had the greatest distortion from to the reference model

(90.33± 69.91 µm). Group 3 (closed-tray with putty and light body) showed the

greatest SD values (84.68± 86.29 µm) (Figure 8).

Table 1 Mean distortion value (µm)

Technique Material Group Mean (SD) Median

Closed-tray Polyether 1 78.88 (49.80) 63.67

Monophase 2 72.67 (46.30) 55.46

Putty and light body 3 84.68 (86.29) 49.87

Open-tray Polyether 4 48.06 (30.66) 45.24

Monophase 5 78.51 (63.54) 60.18


The test of Two-way ANOVA has shown that there is no significant

difference in means of distortion value for impression materials, the impression

techniques, and the interaction between impression materials and impression

techniques (p = 0.566, p = 0.378, and p = 0.275).

Figure 8 The distortion value (µm) of 6 groups

78.88 72.67

84.68

48.06

78.51

90.33

0102030405060708090

100

Closed-tray

(polyether)

Closed-tray

(monophase)

Closed-tray

(putty and

light body)

Open-tray

(polyether)

Open-tray

(monophase)

Open-tray

(putty and

light body)

Dis

tort

ion

val

ue

(µm

)



I389

Distortion values derived from the average of the 4 linear distances ([AC],

[AD], [BC], [BD]). The statistical analysis of the 4 linear distances has found that the

data was not normally distributed. Logarithmic transformation was then performed to

transform the data and examined the data with Shapiro-Wilk test. The result was a

normally distributed data, which was statistically tested by means of the Two-way

ANOVA and can be categorized the analysis into 4 distances.

Analysis of the linear distances [AC]

The descriptive analysis of the mean and standard deviation of the linear

distance [AC] values are shown in Table 2.The analysis was done using the Two Way

ANOVA. The result tells that there is no significant difference in mean linear distance

[AC] value of the impression techniques, the impression materials, and the interaction

between the impression materials and the impression techniques in the direction of the

AC distance (p = 0.950, p = 0.236, and p = 0.981).

Analysis of the linear distances [AD]

The descriptive analysis of the means and standard deviations of the linear

distance [AD] values are shown in Table 3. Two-way ANOVA analysis demonstrates

that there are significant differences in the mean linear distance [AD] values in the

interaction between the impression materials and the impression techniques (p =

0.002). But, there is no statistically significant difference in the mean linear distance

[AD] values in the impression techniques and the impression materials (p = 0.887 and

p = 0.763).

Analysis of the linear distances [BC]


distance [BC] values are shown in Table 4. The Two way ANOVA was used to

analyze. The result shows that there is no significant difference in mean linear

distance [BC] value of the impression techniques, the impression materials and the

interaction between impression materials and impression techniques in the direction

of the BC distance (p = 0.989, p = 0.578, and p = 0.285).

Analysis of the linear distances [BD]


distance BD value is shown in Table 5. The Two-way ANOVA demonstrates that

there are significant differences in mean linear distance [BD] value in impression

techniques and the interaction between the impression materials and the impression

techniques (p = 0.039 and p = 0.020). But there was no statistically significant

difference in mean linear distance [BD] value in the impression materials (p = 0.518)

The Pairwise Comparisons between the open tray and the closed tray

techniques of the linear distance [BD]. The result demonstrates that the closed-tray

technique has more distortion than the open-tray technique (mean difference = 27.886

µm) with a statistical significance (p = 0.039).



I390

Table 2 Mean linear distances [AC] value (µm)



Monophase 2 43.76 (29.39) 40.10



Monophase 5 60.28 (76.11) 28.22


Table 3 Mean linear distances [AD] value (µm)



Monophase 2 84.08 (68.56) 62.49



Monophase 5 105.89 (78.23) 89.78


Table 4 Mean linear distances [BC] value (µm)



Monophase 2 96.45 (83.65) 74.19



Monophase 5 123.27 (117.18) 94.31


Table 5 Mean linear distances [BD] value (µm)



Monophase 2 66.39 (53.33) 53.79



Monophase 5 24.59 (28.71) 15.30


Figure 9 The graph of the mean linear distances [AD] value

Open-tray

technique

Closed-tray

technique



I391

Figure 10 The graph of the mean linear distances [BD] value

Discussion

The results of this research show that when compared the distortion value

of the working cast to the reference model, given the three of the null hypothesis were

accepted, there is no significant difference in means of dimensional accuracy for the

impression materials, the impression techniques and different combinations of the

impression materials and the impression techniques.

Meanwhile, however, the linear discrepancies that express in terms of the

linear distances values of the 4 distances measurement ([AC], [AD], [BC] and [BD]),

the second null hypothesis was rejected due to the fact that the distance [BD] shows

that the open-tray technique is significantly more accurate than the closed-tray

technique in terms of the linear discrepancies when comparing with the reference

model. The third null hypothesis was rejected since the distance AD and the distance

BD shows that there is a significant difference in mean linear distance values in the

interaction between the impression materials and the impression techniques.

As a result, it can be found that the closed-tray impression technique has

demonstrated no difference between polyether, polyvinyl siloxane (monophase) and

polyvinyl siloxane (putty and light body). The result is similar with other studies e.g.

Chang et al., 2012 [10]. The study of the mechanical properties of the elastomeric

impression materials in 1998 by Chai et al. [11] reveals that VPS putty had high yield

strength, moderate strain tolerance, and moderately low tear resistance. Meanwhile,

the polyvinyl siloxane tray and syringeable materials showed moderate yield strength,

high strain tolerance, and relatively low rigidity. In the meantime, the polyether

displayed moderate yield strength, relatively low strain tolerance, and moderately

high tear resistance. To avoid a permanent dimensional distortion, it is mandatory that

the impression material must possess a large tolerable strain in the elastic range that

would allow the impression to flex over the undercutting tissues. On removal of the

impression from the mouth, high elastic recovery and acceptable flexibility can be

gained from the Elastomeric impression materials.

Thus, for the open-tray impression techniques, it can be concluded that the

polyether possesses the tendency to be less distorted than the polyvinyl siloxane

(monophase) and the polyvinyl siloxane (putty and light body) but no statistically

significant. The result was similar with other study e.g. Wee, 2000, Barrett et al.,

1993, Wenz et al., 2008, Del’Acqua et al., 2010, Mostafa et al., 2010 [8, 12-15]

Closed-tray

technique

Open-tray

technique



I392

On the technique with the impression material for the open-tray technique,

adequate rigidity on the impression material is needed to hold the impression coping

in their position during the removal the impression from oral cavity. The polyether

possesses the great torque values and its rigidity provides resistance to the accidental

displacement of the direct impression coping when the analog was tightened, which

means the polyether may be favorable for open tray impression procedure. However,

the use of the polyether for an impression of a partially edentulous arch also presents

increased difficulty for the impression removal [8].

As Vigolo et al. [16] explains in 2004, when an impression with the

copings is removed from the internal connection implants, the vinyl polysiloxane

material may hypothetically reduce the permanent deformation of the impression

material determined by the stress created between the impression material and

impression copings. Vigolo et al. [16] suggested that the fabrication of the definitive

cast, the important factor is preventing the movement of the impression copings inside

the impression material throughout the procedures. The accuracy of the cast will be

compromised cause minor movement when unscrewing the guide pins from the

impression copings upon the impression tray is removed or screwing the implant

analog in the impression.

The result of the Two Way ANOVA analysis of the linear distance BD

value shows that the closed-tray technique has more distortion than the open-tray

technique with a statistical significance (p = 0.039). Other studies have also rendered

similar results e.g. Carr, 1991, Barrett et al, 1993., 2010 and Assif et al., 1992 [9, 12,

17]. More variation occurred in the position of an abutment and implant analogue

assembly in the resulting casts from the repositioning impression technique at the

implant level, according to the study by Daoudi et al. [18] in 2001. The repositioning

impression technique at the implant level is less predictable than the pickup

impression technique.

This study has found distortion value of the range between 11.25 to 324.57

µm. There were controversies over the clinically acceptable value of the passive fit,

revealed the literature. The values of the measurement of the fit implant support

prostheses differ significantly depending on whether the prostheses are trying directly

to the mouth or the master cast [19].

Branemark et al. was the first to measure the passive fit of the implant

framework. He maintained that the acceptable misfit shall not exceed 10 microns [20].

Jemt maintained that the misfit is acceptable when it is not exceed 150 microns. He

introduced the screw resistance test and revealed that screwing an extra one half turn

can help achieve the passive fit [21]. In the vivo study of primates, the result showed

no statistically significant differences in bone responding that can evaluated around

the misfit of the implants supporting frameworks range 38 to 345 μm [22].

Kallus and Bessing, in their retrospective study, have found that the 236

patients with actually misfit of the implant supported prosthesis for at least 5 years

had no signs of the osseointegration loss. In addition, the misfit of the superstructure

did not affect the maintenance of the marginal bone level [23]. Corresponding

measurements of the prosthesis misfit and marginal bone level in implants placed in

the edentulous maxilla, in a vivo study, have found that a mean of misfit of 111 μm

and 91 μm for the groups of following up between 1 year and 5 years. There is no

correlation between the change in the marginal bone level and misfits, the authors



I393

reasoned. They, thus, concluded that the misfits reported in the study were clinically

acceptable [24].

Lee et al. [25] in 2008 presented a systematic review of the accuracy of the

implant impressions from 9 studies, which measured a linear discrepancy at the

connection level between the working cast and the experimental model. The

researchers have found that the discrepancies can be ranged between 0.6 µm and 136

µm.

The limitation of present study is that the examination of accuracy of

implant working casts was being studied using a reference model with the implant is

placed in parallel. In fact, the result might have been different if the implants were

angulated placed, as demonstrated in the earlier studies that study the effect on

accuracy of the impression if the implants were placed angulated [25, 26].

This study has found that the data was nonparametric. Thus, the mean and

median were presented as a result. The median value could better represent the center

of the data distribution. The SD value of some groups was found to be close to or

more magnitude than the mean distortion value. The errors may occur in any of the

required steps such as the machining tolerance of the implant units, the dimensional

change of the impression material, incorrect repositioning of the implant impression

coping, inaccurate connection of the implant component, the dental stone expansion,

and operator error [27]. The disadvantage of the measurement by the microscope was

a wrong placement of the optical positioning, which could result in an incorrect

measurement [28]. Many factors could contribute to this deviation. This variability

was not only limit the clinical procedure of the measurement technique, but it also

reduced the predictability of the test technique as well.

Conclusion

The limitations of present study in vitro study, the following conclusions

were drawn:

The result of the impression materials were similar which found no

significant differences (p > 0.05) in term of cast inaccuracy between three impression

materials (polyether, vinylpolysiloxane –monophase, and vinylpolysiloxane- putty

and light body). The working casts were fabricated from the two impression

techniques and the three impression materials for PW plus implants and it

demonstrated a differentiation from the acrylic resin reference model. The closed-tray

technique is likely to be less accurate than the open-tray technique.

References

1. Cabral LM, Guedes CG. (2007). “Comparative analysis of 4 impression techniques

for implants.” Implant dentistry. 16, 2 (June): 187-194.

2. Branemark PI. (1983). “Osseointegration and its experimental background.” The

journal of prosthetic dentistry. 50, 3 (September): 399-410.

3. Kan JY, Rungcharassaeng K, Bohsali K, Goodacre CJ, Lang BR. (1999). “Clinical

methods for evaluating implant framework fit.” The journal of prosthetic

dentistry. 81, 1 (January): 7-13.

4. Wee AG, Schneider RL, Aquilino SA, Huff TL, Lindquist TJ, Williamson DL.



I394

(1998). “Evaluation of the accuracy of solid implant casts.” Journal of

prosthodontics : official journal of the american college of

prosthodontists. 7, 3 (September): 161-169.

5. Chee W, Jivraj S. (2006). “Impression techniques for implant dentistry.” British

dental journal. 7, 201, 7 (October): 429-32.

6. Prithviraj DR PM, Garg P, Shruthi DP. (2011). “Accuracy of the implant

impression obtained from different impression materials and techniques:

review.” Journal of clinical and experimental dentistry. 3, 2: 106-111.

7. Assuncao WG, Filho HG, Zaniquelli O. (2004). “Evaluation of transfer impressions

for osseointegrated implants at various angulations.” Implant dentistry.

13, 4 (December): 358-366.

8. Wee AG. (2000). “Comparison of impression materials for direct multi-implant

impressions.: The journal of prosthetic dentistry. 83, 3 (March): 323-

331.

9. Carr AB. (1991). “Comparison of impression techniques for a five-implant

mandibular model.” The international journal of oral & maxillofacial

implants. 6, 4 (Winter): 448-455.

10. Chang WG, Vahidi F, Bae KH, Lim BS. (2012). “Accuracy of three implant

impression techniques with different impression materials and stones.”

The international journal of prosthodontics. 25, 1 (January- February):

44-47.

11. Chai J, Takahashi Y, Lautenschlager EP. (1998). “Clinically relevant mechanical

properties of elastomeric impression materials.” The international

journal of prosthodontics. 11, 3 (May-June): 219-223.

12. Barrett MG, de Rijk WG, Burgess JO. (1993). “The accuracy of six impression

techniques for osseointegrated implants.” Journal of prosthodontics :

official journal of the american college of prosthodontists. 2, 2 (June):

75-82.

13. Wenz HJ, Hertrampf K. (2008). “Accuracy of impressions and casts using

different implant impression techniques in a multi-implant system with an

internal hex connection.” The international journal of oral &

maxillofacial implants. 23, 1 (January- February): 39-47.

14. Del’Acqua MA, Chavez AM, Amaral AL, Compagnoni MA, Mollo Fde A, Jr.

(2010). “Comparison of impression techniques and materials for an

implant-supported prosthesis.” The international journal of oral &

maxillofacial implants. 25, 4 (July-August): 771-776.

15. Mostafa TM, Elgendy MN, Kashef NA, Halim MM. (2010). “Evaluation of the

precision of three implant transfer impression techniques using two

elastomeric impression materials.” The international journal of

prosthodontics. 23, 6 (November-December): 525-528.

16. Vigolo P, Fonzi F, Majzoub Z, Cordioli G. (2004). “An evaluation of impression

techniques for multiple internal connection implant prostheses.” The

journal of prosthetic dentistry. 92, 5 (November): 470-476.

17. Assif D, Fenton A, Zarb G, Schmitt A. (1992). “Comparative accuracy of implant

impression procedures.” The international journal of periodontics &

restorative dentistry. 12, 2: 112-121.

18. Daoudi MF, Setchell DJ, Searson LJ. (2001). “A laboratory investigation of the



I395

accuracy of two impression techniques for single-tooth implants.” The

international journal of prosthodontics. 14, 2 (March-April): 152-158.

19. Jemt T. (1996). “In vivo measurements of precision of fit involving implant-

supported prostheses in the edentulous jaw.” The international journal of

oral & maxillofacial implants. 11, 2 (March-April): 151-158.

20. Branemark PI ZG, Albrektsson T. (1985). Tissue –integrated prostheses.

Chicago: Quintessence. P 253.

21. Jemt T. (1991). “Failures and complications in 391 consecutively inserted fixed

prostheses supported by Branemark implants in edentulous jaws: a study

of treatment from the time of prosthesis placement to the first annual

checkup.” The international journal of oral & maxillofacial implants.

6, 3 (Fall): 270-276.

22. Carr AB, Gerard DA, Larsen PE. (1996). “The response of bone in primates

around unloaded dental implants supporting prostheses with different

levels of fit.” The journal of prosthetic dentistry. 76, 5 (November):

500-509.

23. Kallus T, Bessing C. (1994). “Loose gold screws frequently occur in full-arch

fixed prostheses supported by osseointegrated implants after 5 years.” The

international journal of oral & maxillofacial implants. 9, 2 (March-

April): 169-178.

24. Jemt T, Book K. (1996). “Prosthesis misfit and marginal bone loss in edentulous

implant patients.” The international journal of oral & maxillofacial

implants. 11, 5 (September-October): 620-625.

25. Lee H, So JS, Hochstedler JL, Ercoli C. (2008). “The accuracy of implant

impressions: a systematic review.” The journal of prosthetic dentistry.

100, 4 (October): 285-291.

26. Sorrentino R, Gherlone EF, Calesini G, Zarone F. (2010). “Effect of implant

angulation, connection length, and impression material on the dimensional

accuracy of implant impressions: an in vitro comparative study.” Clinical

implant dentistry and related research. 12 Suppl, 1(May): e63-76.

27. Rashidan N, Alikhasi M, Samadizadeh S, Beyabanaki E, Kharazifard MJ. (2012).

“Accuracy of implant impressions with different impression coping types

and shapes.” Clinical implant dentistry and related research. 14, 2

(April): 218-225.

28. Nicholls JL. (1980) “The measurement of distortion: concluding remarks.” The

journal of prosthetic dentistry. 43, 2 (February): 218-223.



I396

Wound healing activity of recombinant TCTP protein from Elaeis guineensis

Jacq

Author: Ajchara Kaewjurat, Assoc. Prof. Dr. Jasadee Kaewsrichan,

Prof. Dr. Amornrat Phongdara

Program Molecular Biotechnology and Bioinformatics, Institute Department of

Molecular Biotechnology and Bioinformatics, Faculty of Science, Prince of Songkla

University

Abstract

A translationally controlled tumor protein of Elaeis guineensis Jacq (called

Eg-TCTP) had been identified. This protein acts as a constitutive promoter for

enhancing growth rate in calli of oil palm. In this study, wound healing activity of a

recombinant Eg-TCTP protein was investigated using L929 fibroblast cell line by the

scratch method. The mRNA expression levels of tumor associated genes, such as

sydecan-2, β-catenin, lrp6 and bmi1 were assessed by quantitative real-time PCR

(qPCR) technique. Results indicated that 50 ng/ml of Eg-TCTP significantly promoted

wound closure within 48 h after wounding. In addition, the transcription levels of those

genes were not significantly changed, suggesting that Eg-TCTP might be non-

oncogenic. The protein is premised in application for repairing wounded skin.

Keywords: Eg-TCTP protein, oil palm, wound healing, tumor associated genes

Introduction

Biomedical and clinical researches are important in development of

therapeutic proteins for wound healing application (Li et al., 2015). Wound healing is

a complex biological process involving several physiological events, such as

hemostasis, inflammation, proliferation, and remodeling (Matin, 1997; Singer and

Clark,1999; Gurtner et al., 2008) in order to trigger and regulate the healing of wounds.

(Li et al., 2007; Sosne et al., 2007)

The translationally controlled tumor protein (TCTP) is ubiquitously found in

both the animal and plant kingdoms. Its expression is associated with many cellular

processes, such as cell proliferation, cell growth, and programmed cell death (Brioudesa

et al., 2010; Hoepflinger et al., 2013). In plant, the TCTP is related to functions

regarding cell growth and differentiation of plant organs. Differential expression of

TCTP was evident under abiotic stresses, such as aluminum and mercuric ion exposure,

wounding, salinity, and water limitation, resulting in increased plant tolerance (Kim,

2012; Wang, et al., 2012 ; Li et al., 2013; Santa Brı´gida et al., 2014; Zhang et al., 2014). Moreover, the protein was shown to be a positive regulator of mitotic growth by

controlling the plant cell cycle. (Berkowitz et al., 2008; Brioudesa, et al., 2010 ; Qin et

al., 2010)

The TCTP from E. guineensis Jacq or Eg-TCTP was previously identified in

our laboratory (Nakkaew et al., 2010), which revealed 84- 91% sequence homology to

those TCTP proteins deposited in bioinformatics data bases. It contained 168 amino

acids with a calculated molecular mass of 19.2 kDa. This was in contrast to a result

analyzed by SDS-PAGE, which showed a protein band at 22.9 kDa. However, by

concerning its actual functions, the recombinant Eg-TCTP protein was evaluated for

wound healing activity in this study.



I397

Objectives

To investigate wound healing activity of recombinant TCTP protein from

Elaeis guineensis Jacq (Eg-TCTP)


Purification of recombinant Eg-TCTP from E. coli

Escherichia coli M15 (pRep4) cells were transformed with a recombinant

plasmid containing Eg-tctp encoding gene as previously described (Nakkaew et al.,

2010). After inducing protein expression, the cells were harvested by centrifugation

(1500xg, 15 min). The cell pellet was resuspended in lysis buffer (50 mM NaH2PO4,

pH 8.0, 300 mM NaCl and 10 mM imidazole) containing 1 mM phenylmethanesulfonyl

fluoride (PMSF). Then, the recombinant protein was purified using a Ni–NTA column

(QIAGEN, Germany) in conjunction with elution buffer (50 mM NaH2PO4, pH 8.0,

300 mM NaCl and 250 mM imidazole) containing 1 mM PMSF. The eluted protein was

verified via 12.5% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-

PAGE) and analyzed using Western blotting.

Cells and culture conditions

L929 cells were routinely grown in Dulbecco's modified Eagle's medium

(DMEM, Gibco, USA) supplemented with 10% fetal bovine serum (FBS) and 100

units/ml of penicillin and 100 μg/ml streptomycin (Gibco, USA) and incubated at 37ºC

in a 5% CO2 atmosphere. The cells were subcultured every 3-4 days using standard cell

culture technique.

Wound-healing assay

The L929 cells (5 × 104 cells/ml) in DMEM supplemented with 10% FBS were

seeded in a 24-wells plate and incubated overnight. A wound was made in the center of

each confluent monolayer using a sterile pipette tip, and any cellular debris was

removed by washing with phosphate buffer saline (PBS). The wounded monolayers

were then cultured in serum-free DMEM in the presence or absence of 50 and 150 ng/ml

of purified Eg-TCTP protein for 48 h. The cell migration surrounding the wounded area

was captured by a 4x-magnification microphotograph (Olympus CK2, Japan). The %

migration was calculated using the equation below.

% Migration

=Average distance of the scratch on day 0 Average distance of the scratch on day 1, 2 or 3

Average distance of the scratch on day 0



I398

Transcription levels of tumor associated genes following incubation with

Eg-TCTP

Total RNA was extracted from L929 normal cell line after incubated with 50

or 150 ng/ml Eg-TCTP for a desired time period using Trizol reagent (Invitrogen,USA).

The complementary DNA (cDNA) was synthesized from 1 µg of total RNA according

to the manufacturer’s instructions (Invitrogen, USA). The synthesized cDNAs were

used to analyse the transcription levels of tumor associated genes by qRT-PCR (BIO-

RAD, USA). The Ct (threshold cycle) value for each gene was calculated and

normalized by that of gapdh gene before reported.


Data were reported as mean S.D. Differences between test groups and

control groups were analyzed from data of one independent experiment performed in

triplicate (n = 3) using one-way analysis of variance (ANOVA) at p = 0.05.

Results/ Conclusion

Effect of Eg-TCTP on wound healing of cells

The L929 cells exposed to 50 ng/ml of Eg-TCTP showed a significant wound

closure at 48 h after treatment. (Figure 1a). In contrast, the protein of 150 ng/ml revealed

inhibitory effect on the cell migration. The highest percentage of cell migration was

found in cell incubated with Eg-TCTP at dose of 50 ng/ml for 48 h when compared

with other two groups (Figure. 1b). This result showed that Eg-TCTP elicited wound

healing property.

Transcription of tumor associated genes after treated with Eg-TCTP

In focusing on tumorigenic effect of Eg-TCTP on the cells after treatment,

transcription levels of β-catenin, lrp6, bmi1, and syndecan-2 genes were determined by

qPCR technique after the cells were incubated with 50 or 150 ng/ml Eg-TCTP for 1, 3,

5 and 7 days. Results indicate that Eg-TCTP protein only induced bmi1 expression at 3

and 7 day, in contrast to the other genes were not significantly increased throughout the

experiment (Figure 2), suggesting that the test protein was not tumorigenic.



I399

Figure 1 Effect of Eg-TCTP on cell migration: (a), the monolayer cells of L929 were

scratched and incubated with 50 or 150 ng/ml Eg-TCTP for 48 h. Their migration was

monitored at 24 and 48 h after incubation using a 4x-magnification light microscope;

(b) The % cell migration (n = 3) ; * indicates significantly different ( p < 0.05).

(a)

(b)



I400

Figure 2 Relative transcription levels of genes, including β-catenin, lrp6, bmi-1,and

syndecan-2 ,as measured by qPCR technique. The cells of L929 were incubated with

50 or 150 ng/ml Eg-TCTP for 1, 3, 5, and 7 days, followed by total RNA extraction.

The first cDNA strands were reversely transcribed and qPCR was performed The Ct

for each gene was recorded (n =3) and reported as folds increase in compared to that of

gapdh gene. * indicates significantly different (p < 0.05).

Discussion

We firstly report wound healing activity of Eg-TCTP on normal fibroblasts

(L929), based on the scratch assay. The protein at the dose of 50 ng/ml could accelerate

the migration of the cells, in contrast to the dose of 150 ng/ml that was revealed

inhibitory effect on the cell migration. Taken together, the results suggested

proliferative effect of the protein. To confirm that Eg-TCTP would not be tumorigenic,

stimulated transcription of tumor associated genes was verified by qPCR technique. In

this study was interested the transcription of genes associating the Wnt/β-catenin

signalling pathway for determine effect of protein in oncogenic properties such as, β-

catenin, lrp6, bmi1 and syndecan-2. From previous study reported that syndecan-2 is

representatives of anti-oncogenes (Villena et al., 2003; Modrowski et al., 2005; Orosco

et al., 2007;Dieudonné et al., 2010), whereas β-catenin (Chung et al.,2002; Gaujoux et

al.,2013), lrp6 (Li et al., 2004; Wang et al.,2004; Liu et al.,2010), and bmi1(Dimri et

al., 2002; Proctor et al., 2013) are the genes with oncogenic property. The expression

levels of β-catenin, lrp6, and syndecan-2 mRNAs in L929 were not significantly

increased after 1, 3, 5 and 7 days of incubation with the protein. Our result indicated

that Eg-TCTP induced bmi1 expression at 3 and 7 day, resulting in induced cell



I401

proliferation. However, as bmi1 was over-expressed, safety in using Eg-TCTP by

incorporation in pharmaceutical products should be considered. Whereas, Eg-TCTP

was not affected on the expressions of β-catenin and lrp6 genes in dose dependent at 1,

3, 5 and 7 days. From our data, Eg-TCTP might play a proliferative role in wound

healing by activating the Wnt/β-catenin signaling pathway and not be implicated in

tumorgenicity. This finding suggests the possibility in that Eg-TCTP might be

beneficial in wound healing process.

Recommendations

Eg-TCTP promoted cell migration and proliferation that are advantageous in

wound healing process. Eg-TCTP is promising to be applied for healing the skin.

References

Adam J, Singer, and Richard, A.F. Clark. (1999). Cutaneous wound healing. USA:

The New England Journal of Medicine.

Armelle, Orosco, Olivia, Fromigué, Céline, Bazille, Natacha, Entz-Werle, Pierre,

Levillain, Pierre J, Marie, and Dominique, Modrowski. (2007). Syndecan-2

affects the basal and chemotherapy-induced apoptosis in osteosarcoma.

France: Cancer Research.

Ailton Borges, Santa Brígida, Sávio Pinho, dos Reis, Carinne de, Nazaré Monteiro

Costa, Cristina Michiko, Yokoyama Cardoso, Aline, Medeiros Lima, and

Cláudia Regina, Batista de Souza. (2014). Molecular cloning and

characterization of a cassava translationally controlled tumor protein

gene potentially related to salt stress response. Brazil: Molecular Biology

Reports.

Alisa, Nakkaew, Wilaiwan, Chotigeat, and Amornrat, Phongdara. (2010). Molecular

cloning and expression of Eg-TCTP, encoding a calcium binding protein,

enhances the growth of callus in oil palm (Elaeis Guineensis, Jacq).

Thailand: Songklanakarin Journal of Science and Technology.

Chia-Chen, Liu, Julie, Prior, David, Piwnica-Worms, and Guojun, Bua. (2010). Lrp6

overexpression defines a class of breast cancer subtype and is a target

for therapy. USA: Proceedings of the National Academy of Sciences.

Dejun, Li, Zhi, Deng, Xianghong, Liu, and Bi, Qin. (2013). Molecular cloning,

expression Profiles and characterization of a novel translationally

controlled tumor protein in rubber Tree (Hevea Brasiliensis). China:

Journal of Plant Physiology.

Dominique, Modrowski, Armelle, Orosco, Judicael, Thevenard, Olivia, Fromigue, and

Pierre J, Marie. (2005). Syndecan-2 overexpression induces osteosarcoma

cell apoptosis: implication of syndecan-2 cytoplasmic domain and Jnk

signaling. France: Bone.

Erica, Proctor, Meghna, Waghray, Cheong Jun, Lee, David, G. Heidt, Malica,

Yalamanchili, Chenwei, Li, Filip, Bednar, and Diane, M. Simeone. (2013).

Bmi1 enhances tumorigenicity and cancer stem cell function in

pancreatic adenocarcinoma. USA: PLoS One.

Eun Joo, Chung, Sang-Gu, Hwang, PhuongMai, Nguyen, Sunmin, Lee, Jung-Sik, Kim,

Jin Woo, Kim, Pierre, A. Henkart, Donald, P. Bottaro, Lilian, Soon, Paolo,

Bonvini, Su-Jae, Lee, Judith, E. Karp, Ho Jung, Oh, Jeffrey, S. Rubin, and



I402

Jane, B. Trepel. (2002). Regulation of leukemic cell adhesion,

proliferation, and survival by beta-catenin. Baltimore: Blood.

Feijuan, Wang, Yongshen, Shang, Ling, Yang, and Cheng, Zhu. (2012). Comparative

proteomic study and functional analysis of translationally controlled

tumor protein in rice roots under Hg2+ stress. China: Journal of

Environmental Sciences (China).

François-Xavier, Dieudonne, Allison, Marion, Eric, Hay, Pierre, Jacques Marie, and

Dominique, Modrowski. (2010). High wnt signaling represses the

proapoptotic proteoglycan syndecan-2 in osteosarcoma cells. France:

Cancer Research.

Florian, Brioudes, Anne-Marie, Thierry, Pierre, Chambrier, Bertrand, Mollereau, and

Mohammed, Bendahmanea. (2010). Translationally controlled tumor

protein is a conserved mitotic growth integrator in animals and plants.

France: Proceedings of the National Academy of Sciences of the United

States of America.

Gabriel Sosne, Ping Qiu, and Michelle, Kurpakus-Wheater. (2007). Thymosin beta 4:

A novel corneal wound healing and anti-inflammatory agent. USA:

Clinical Ophthalmology.

Geoffrey C, Gurtner, Sabine, Werner, Yann, Barrandon, and Michael T, Longaker.

(2008). Wound repair and regeneration. USA: Nature.

Goberdhan P, Dimri, Jose-Luis, Martinez, Jacqueline J.L, Jacobs, Petra, Keblusek,

Koji, Itahana, Maarten van, Lohuizen, Judith, Campisi, David E, Wazer, and

Vimla, Band. (2002). The bmi-1 oncogene induces telomerase activity and

immortalizes human mammary epithelial cells. USA: Cancer Research.

Haichang, Li, Pu, Duann, Pei-Hui, Lin, Li, Zhao, Zhaobo, Fan, Tao, Tan, Xinyu, Zhou,

Mingzhai Sun, Minghuan, Fu, Matthew, Orange, Matthew, Sermersheim,

Hanley, Ma, Duofen, He, Steven M, Steinberg, Robert, Higgins, Hua, Zhu,

Elizabeth, John, Chunyu, Zeng, Jianjun, Guan, and Jianjie, Ma. (2015).

Modulation of Wound Healing and Scar Formation by MG53 Protein-

mediated Cell Membrane Repair. China: The Journal of Biological

Chemistry.

Jian-Min, Zhang, Liu-Feng, Ma, Wen, Li, Jie, Zhang, Deng-Di, Li, and Xue-Bao, Li.

(2014). Cotton tctp1 gene encoding a translationally controlled tumor

protein participates in plant response and tolerance to aphids. China:

Plant Cell, Tissue and Organ Culture.

Jie, Li, Juan, Chen, and Robert, Kirsner. (2007). Pathophysiology of acute wound

healing. USA: Clinics in Dermatology.

Joan, Villena, Christine, Berndt, Francesc, Grane´s, Manuel, Reina, and Sene´n, Vilaro.

(2003). Syndecan-2 expression enhances adhesion and proliferation of

stably transfected swiss 3t3 cells. Spain: Cell Biology International.

Marion Christine, Hoepflinger, Johannes, Reitsamer, Anja Maria, Geretschlaeger,

Norbert, Mehlmer, and Raimund, Tenhaken. (2013). The effect of

translationally controlled tumour protein (tctp) on programmed cell

death in plants. Austria: BMC Plant Biology.

Oliver, Berkowitz, Ricarda, Jost, Stephan, Pollmann, and Josette, Maslea. (2008).

Characterization of TCTP, the translationally controlled tumor protein,

from Arabidopsis Thaliana. Australia: Plant Cell.

Paul, Martin. (1997). Wound healing: aiming for perfect skin regeneration. London: Science.



I403

Sebastien, Gaujoux, Constanze, Hantel, Pierre, Launay, Stephane, Bonnet, Karine,

Perlemoine, Lucile, Lefevre, Marine Guillaud-Bataille, Felix Beuschlein,

Frederique Tissier, Jerome Bertherat, Marthe Rizk-Rabin, and Bruno

Ragazzon. (2013). Silencing mutated beta-catenin inhibits cell

proliferation and stimulates apoptosis in the adrenocortical cancer cell

line H295r. France: PLoS One.

Xiaobo, Qin, Fan, Gao, Jinping, Zhang, Jihai, Gao, Sha, Lin, Yong, Wang, Luding,

Jiang, Yi, Liao, Lina, Wang, Yongjiong, Jia, Lin, Tang, Ying, Xu, and Fang,

Chen. (2011). Molecular cloning, characterization and expression of

cdna encoding translationally controlled tumor protein (Tctp) from

Jatropha Curcas L. China: Molecular Biology Reports.

Xiaohong, Wang, Neeta, Adhikari, Qinglu, Li, and Jennifer L, Hall. (2004). LDL

receptor-related protein LRP6 regulates proliferation and survival

through the Wnt cascade in vascular smooth muscle cells. China: The

American Journal of Physiology-Heart and Circulatory Physiology.

Yong-Min, Kim, Yun-Jeong, Han, Ok-Jin, Hwang, Si-Seok, Lee, Ah-Young, Shin, Soo

Young, Kim, and Jeong-II, Kim. (2012). Overexpression of arabidopsis

translationally controlled tumor protein gene Attctp enhances drought

tolerance with rapid Aba-induced stomatal closure. Korea: Molecules and

Cells.

Yonghe, Li, Wenyan, Lu, Xi, He, Alan L, Schwartz, and Guojun, Bu. (2004). Lrp6

expression promotes cancer cell proliferation and tumorigenesis by

altering beta-catenin subcellular distribution. USA: Oncogene.



I404

Appendix

Author: Ajchara Kaewjurat

Program: Molecular Biotechnology and Bioinformatics

Institute: Department of Molecular Biotechnology and Bioinformatics, Faculty of

Science, Prince of Songkla University, Hat-Yai, Songkhla,90112 ,Thailand.


Author: Associate Professor Dr. Jasadee Kaewsrichan

Program: Pharmaceutical Chemistry

Institute: Department of Pharmaceutical Chemistry, Faculty of Pharmaceutical

Sciences, Prince of Songkla University, Hat-Yai, Songkhla 90112, Thailand.

Tel. - e-mail. [email protected] .com

Author: Professor Dr. Amornrat Phongdara

Program: Molecular Biotechnology and Bioinformatics

Institute: Center for Genomics and Bioinformatics Research, Faculty of Science,

Prince of Songkla University, Hat-Yai, Songkhla, 90112, Thailand.

Tel. - e-mail. [email protected]



I405

Enhancing seismic resolution by Empirical Mode Decomposition

Author: Apiwat Hiran* Siriporn Chaisri**

Program Applied Geophysics Institute Chiang Mai University

Abstract

Seismic resolution is an important factor for interpretation. The increase in

resolution related to separate more detail of two features from seismic data. A new

method for analyzing seismic data, the Empirical Mode Decomposition (EMD) is

applied to reduce noise in seismic signal for improving the signal-to-noise ratio in

time domains (Battista et al.,2007). The EMD method is used to decompose non-

stationary and non-linear data into sub-signal referred as "intrinsic mode functions

(IMFs) . The first sub signal, IMF1, contains the highest frequency components of the

original signal, and the final sub signal contains the lowest frequency components. In

this study, we apply the EMD method for increasing seismic resolutions. The

response of EMD will be observed via thickness variation of a thin bed using the

synthetic data of a wedge model. The IMF1 section resulted from the EMD can

distinguish the two reflectors from top and bottom of wedge model with thinner

thickness than that from the original seismic section. Applying the EMD with the

original seismic data, the IMF1 section enhances the quantification resolution and

shows a better continuity reflection of the seismic data.

Keywords: seismic resolution, Empirical Mode Decomposition (EMD), wedge model, thin bed

* Student, Master of Science Program in Applied Geophysics, Faculty of Science, Chiang Mai University

** Department of Physics and Materials Science, Faculty of Science, Chiang Mai University



I406

Introduction

The oil and gas industries are high investment with high risk and high benefits,

therefore it is highly required to explore for the new prospect which the most widely

geophysical technique used for this is seismic method. Seismic methods are the most

commonly conducted geophysical surveys for mapping subsurface geological

structures which used for interpreting structures related to oil and gas reservoirs. The

thin bed reservoir is one of the important exploration targets. Seismic resolution is the

ability to distinguish stratigraphic detail from seismic data, which includes vertical

and horizontal resolutions. This study focuses on vertical resolution which refers as

the abilities to detect the thickness between layers from seismic section.

The vertical resolution limit in seismic data is the ability to distinguish the

smallest layer thickness when that is about one-eighth of the wavelength, (λ/8), with λ

representing the predominant wavelength in the seismic data, Widess (1973). This

conclusion was based on an experiment in which a simplified wedge model was

embedded in a homogeneous rock, resulting in a pair of equal and opposite seismic

reflection coefficients corresponding to the top and bottom of the model. In the

presence of noise and the subsequent broadening of the seismic wavelet during its

subsurface path, the vertical resolution limit is usually reduced to one-quarter of the

signal dominant wavelength (λ/4) (Chopra et al., 2006, Luping et al., 2009). This

condition has been universally accepted as the vertical resolution limit for the

consideration in seismic data. At a spacing of less than one-quarter of the wavelength

(λ/4), the bed thickness becomes indistinguishable in seismic section, known as

the tuning thickness. Due to the tuning thickness and resolution limit, detecting thin

bed thickness has been a problem in seismic data processing.

The Empirical Mode Decomposition (EMD) is an analysis method which is

automatic, fully adaptive (data-driven), and time-variant (Flandrin and Goncalves,

2004). It is providing an adaptive decomposition of a sub-signal either within the time

or frequency axis, capturing the movement of the input signal. The main advantage of

EMD is that it gives an automatic decomposition which is fully adapted to the data,

and does not rely upon an assumed set of functions like the wavelet transformation



I407

The application of EMD has the ability to eliminate random noise and improve

the signal-to-noise ratio in time domains for seismic signal (Liu, Y et al., 2012). It

was used for filtering nonlinear cable strum and obtained meaningful geologic

information from seismic reflection data, Battista et al. (2007).

Objective of the study

This study has two main purposes. The first objective is to modify the

Empirical Mode Decomposition code for seismic application. The second objective is

to test the response of EMD in improving seismic resolution with wedge model and

real seismic section.


Empirical Mode Decomposition and Intrinsic Mode Functions

EMD proposed by Huang et al. (1998) for analyzing nonlinear and non-

stationary data which can be decomposed any multi-component signal into sub-

signals referred as ‘intrinsic mode functions (IMFs)’. Each IMF has different

frequency components, shows different geologic and stratigraphic information. The

work flow of the method is shown in Figure 1.

Figure 1 The EMD decomposes the signal into sub-signal (IMFs)

IMFs are functions that must follow two conditions. The first condition is that,

in the entire set, the number of extrema as well as zero crossings must be equal or

differ by one. The second condition is that, throughout the entire data, the average

value of the boundaries defined by the local maxima and minima is zero. Generally,

most of the original signals are not IMFs, but can be decomposed into sub-signals

through sifting process. To find the first IMF (IMF1) of a given signal �(�), the sifting



I408

process is described briefly by Huang et al. 1998, Flandrin and Goncalves, 2004, as

follow;

(1) Identify all extrema of �(�); ℎ��(�) = ℎ(�) = �(�), �ℎ � � = 1, � = 0

(2) Find local maxima and local minima to generate lower envelope ��(�) and

upper envelope ��(�) of function ℎ��(�)

(3) Calculate the average and let � = � + 1gives the function

��(�) = �(�) = ( ��(�) + ��(�))/2 (2. 1)

(4) Subtract the average from the input signal

ℎ(�) = ℎ(�) − �(�) (2. 2)

or ℎ��(�) = ℎ�(��)(�) − ��(�)

If ℎ(�) does not meet the IMF conditions, repeat steps from (2) to (4) � times until

the function ℎ�(�) becomes an IMF. Therefore

�(�) = ℎ�(�) (2. 3)

where �(�) is IMF1. The stopping criteria for IMF1 can be done by restricting the

breadth of the standard deviation (SD) which can be determined from two consecutive

sifting results as

SD = " #$(ℎ(��)(�) − ℎ�(�))$%ℎ(��)% (�) &

'

() (2. 4)

Subtract IMF1, �(�), from the signal input function, the residue function is

*(�) = �(�) − �(�) (2. 5)

Then, the process steps from (2) to (4)are repeated with *(�) as the new input and the

new residual functions for �(+ iteration are

*�(�) = *(��)(�) − ��(�) (2. 6)

when *(�) = �(�)

where ��(�) is the �(+ IMF (IMFj). The sifting process can be stopped by *�(�) is

become monotonic function. The input signal �(�) can be constructed by

�(�) = " ��(�)��

�)+ *�(�) (2. 7)



I409

which expressed as the sum of the IMFs and the last residue *�(�). Where ��(�)

denotes the resulting IMFj, � − 1 is the total number of IMFs, and *�(�) shows the

last residue of �(�) (Figure 2). It presents that �(�) has the highest frequency content,

�,(�) has the lowest frequency content and *(�), the residual, is the monotonic

function (Figure 3). For applying the EMD with seismic data, the Wu's EMD

MATLAB (2010) code, (Wu and Huang, 2009) was modified.

Result from Empirical Mode Decomposition of a wedge model

We observe the response of EMD to increase the seismic resolution via

thickness variation of a thin bed using the synthetic data of a wedge model that

consists with three layers of velocities 2000,1800 and 2400 m/s, shown in Figure 4a.

The synthetic seismogram is obtained from the convolution between wedge model

and a zero-phase 30 Hz Ricker wavelet presented on Figure 4b called IMF0, the zero-

intrinsic mode function. The thickness of the wedge is displayed on the top of the

synthetic seismogram in Figure 4b. The tuning thickness of the wedge model with

average velocity of 1900 m/s (consider the velocity from the top and the wedge layers

only) and 30 Hz Ricker wavelet is approximately 15.8 m (λ/4). However, it is hardly

recognized two reflectors from top and bottom of wedge model at the wedge

thickness less than 28 m and this number is larger than the seismic resolution limit.

The EMD then applies to the seismogram in Figure 4b and generates the first IMF

(IMF1) and the second IMF (IMF2) shown in Figure 4c and Figure 4d. The IMF1,

Figure 4c, has the dominant frequency about 35 Hz which higher frequency content

than that of the original seismogram. It can distinguish the two reflectors until the

wedge thickness at about 21 m, so the result show high resolution more than Figure

4b. The positive peak in the middle of the two reflectors can also be observed and this

might help to confirm the separation of those reflectors. The IMF2, Figure 4d, has

lower frequency content, dominant frequency about 25 Hz, the two reflectors are

interfering with longer or wider wavelet that make them hard to recognize as two

reflectors. As the results of the wedge model, the IMF1 obtained from the EMD could

increase seismic resolution.



I410

Figure 2 EMD process work flow



I411

Figure 3 Results of EMD process, �(�) is the original data (IMF0), �(�) − �,(�) are

sub-signal (IMF1−IMF5) and r(�) is the monotonic function

a)

b)

c)

d)

Figure 4 (a) The wedge model, (b) synthetic seismogram (IMF0) using zero-phase 30-

Hz Ricker wavelet with the vertical resolution limit about 15.8 m with λ/4, (c) IMF1

and (d) IMF2 from EMD



I412

Result from Empirical Mode Decomposition of the real seismic data

The real seismic section is decomposed by the EMD and demonstrated the

results in Figure 5 corresponding each IMFs. The original seismic section, IMF0 in

Figure 5a, has the dominant frequency about 30 Hz. The corresponding IMF1 in

Figure 5b shows the higher frequency component of IMF0 with the 45 Hz dominant

frequency. It shows better detail of reflectors with more resolution as expected (Figure

6b). The lower frequency content of IMF0 presented by IMF2 (Figure 5c). The 25 Hz

dominant frequency shows the strong amplitude with rough and low frequency

reflectors (Figure 6c).

Figure 5 Results from EMD process (a) IMF0, the real seismic section, (b) IMF1, the

higher frequency content and (c) IMF2, the lower frequency content. Red and blue are

positive and negative amplitudes.



I413

Figure 6 Illustrates of the highlighted zones from Figure 5 corresponding to (a) IMF0,

the real seismic section, (b) IMF1, the continuous and more reflection detail and (c)

IMF2, the lower frequency content. Red and blue are positive and negative

amplitudes.

Discussion

The EMD is applies with synthetic seismic from wedge model. It shows that

The IMF1 of EMD can improve the seismic resolution because it contains the higher

frequency contents from the original data then more wedge thickness could be

observed. When apply the EMD with real seismic data, it can also enhance the

quantify features and resolution of the seismic data. Especially, this method is

applicable to nonlinear and non-stationary data decomposed into IMFs. The

comparison between original seismic with seismic section from IMF1 shows a greater

continuity of reflection when the reflection cannot see in original seismic.



I414

The EMD is the tool for decomposing the signal with automatic

decomposition that is fully adapted to the data liked doing the frequency filter in time

domain. It does not manipulate the signal unlike doing frequency filter with FFT (Fast

Fourier Transform) with the risk of the ringing effect when apply it with steep taper

function.

Conclusion

The EMD code was modified and tested for seismic application. The testing

results from wedge model and real seismic section indicate that we can apply the

EMD to increase the seismic resolution. The quality of the IMF1seismic section has a

strong reflectivity and display clearly reflection detail. Seismic data retrieved using

the EMD in the form of reflectivity data is very useful for making accurate

interpretations, of the thin bed seismic resolution.

Recommendations

The solution from the EMD, the IMF1 section, could be used as the seismic

input for the application such as the instantaneous attributes to obtain more reasonable

and reliable interpretation.

References

Battista, B.M., Knapp, C., McGee, T. and Goebel, V., 2007. Application of the

empirical mode decomposition and Hilbert–Huang transform to seismic

reflection data. Geophysics 72 (2), H29–H37.

Chopra, S., Castagna, J. and Portniaguine, O., 2006. Seismic resolution and thin-bed

reflectivity inversion. CSEG recorder, 31(1), 19-25.

Flandrin, P. and Goncalves, P., 2004. Empirical mode decomposition as data-driven

wavelet-like expansions. International Journal of Wavelet, Multiresolution

and Information Processing 2 (4), 477–496.

Huang, N.E., Shen, Z., Long, R.S., Wu, M.C., Shih, H.H., Zheng, Q., Yen, N.C.,

Tung, C.C. and Liu, H.H., 1998. The empirical mode decomposition and

the Hilbert spectrum for nonlinear and non-stationary time series analysis.

Proceedings of the Royal Society of London Series A 454, 903–995.



I415

Liu, Y. P., Li, Y., and Ma, H. T. 2012, July. Seismic random noise reduction by

empirical mode decomposition combined with translation invariant scale-

adaptive threshold. In Wavelet Analysis and Pattern Recognition

(ICWAPR), 2012 International Conference (pp. 53-57). IEEE.

Robertson, J.D., and Nogami, H.H., 1984. Complex seismic trace analysis of thin

beds. Geophysics 49 (4), 344–352.

Sun, L., Zheng, X., Li, J., and Shou, H. 2009. Thin-bed thickness calculation formula

and its approximation using peak frequency. Applied Geophysics, 6(3),

234-240.

Widess, M.B., 1973. How thin is a thin bed. Geophysics 38 (6), 1176-1180.

Wu, Z., and Huang, N. E. 2009. Ensemble empirical mode decomposition: a noise-

assisted data analysis method. Advances in adaptive data analysis, 1(01), 1-

41.

Wu, Z., 2010. Empirical mode decomposition MATLAB codes. Retrieved on August

10, 2014. Available from http://rcada.ncu.edu.tw.



I416

Title: Gold nanoparticle-graphene-chitosan modified disposable electrode

for detection of prohormone Dehydroepiandrosterone sulfate

Author: Karnpimon Krorakai

Program: Biochemistry Institute: Khon Kaen University

Abstract

Dehydroepiandrosterone sulfate (DHEAs) is the most abundant circulating

prohormone in human. DHEAs has been known as a biomarker of aging because DHEAs

levels in human decline markedly with age. There are many techniques for determination

of DHEAs including HPLC, GC-MS, LC-MS and ELISA. However, these techniques are

not available for application in point of care testing. The objective of this study is to

prepare electrochemical immunosensor based on gold nanoparticle-graphene-chitosan

(AuNPs-GP-CS) for DHEAs detection because this technique has high sensitivity and

specificity, simple to use, cost effective, using small samples volume and portable device.

AuNPs-GP-CS nanocomposite was synthesized and characterized by UV-vis

spectroscopy and transmission electron microscope. Amperometric detection was

performed at a potential of -0.2 V using 3,3′,5,5′-tetramethylbenzidine (TMB)/H2O2 as

substrate solution. The experimental conditions were optimized, including the

concentration of anti-DHEAs antibody, dilution ratio of DHEAs-HRP conjugate and

incubation time. Under optimal conditions, this immunosensor showed a linear range

from 0.001-10 g mL-1

with a detection limit of 0.089 g mL-1

.

Keywords : Dehydroepiandrosterone sul fate (DHEAs) , Aging b iomarker,

Electrochemical immunosensor

Introduction

Dehydroepiandrosterone sulfate (DHEAs) is the major prohormone produced by zona

recticularis of adrenal cortex. Its concentration in serum is more than 10 M. It functions

as a precursor to male and female sex hormone (androgens and estrogens). DHEAs has

been called fountain of youth or hormone of youth because DHEAs levels in serum peak

around the age of 20 to 30 and then decline dramatically with age, decreasing 1-2% per

year. (Ferrari et al., 2001) The benefit effects of DHEAs from in vivo and in vitro

experiment are anti-diabetes mellitus, anti-atherosclerosis, anti-dementia, anti-obesity,

anti-osteoporosis and modulation of immune system. Furthermore, low DHEAs levels are

found in diabetes, artherosclerosis, high pressure, gout, and metabolic syndrome patients.

(Arlt., 2004) Moreover, DHEAs has been widespread used as a food supplement in USA.

As many researches study the relationship between DHEAs and health or diseases,

DHEAs is considered to be a marker of individual function of adrenal cortex and a

biomarker of aging. Thus, the measurement of DHEAs is useful in the medical diagnosis

and applied to predict biological age.

There are many techniques for the determinat ion of DHEAs including

radioimmunoassay (RIA), High-performance liquid chromatography (HPLC), Liquid

chromatography-mass spectrometry (LC-MS) and chromatography–mass spectrometry



I417

(GC-MS). Although these techniques offer high sensitivity and selectivity, the drawbacks

are expensive instruments, complicate detection and need specialist for analyze data.

Recently, the most common technique for DHEAs measurement in laboratory is enzyme-

linked immunosorbent assay (ELISA). The disadvantages of ELISA are expensive, high

volume of sample, time-consuming for the assays and the frequent negative or positive

false results so it is not suitable for point of care testing. (Zhang et al., 2016)

Electrochemical immunosensor is one of the alternative analytical methods for point of

care testing because of high sensitivity and specificity, low cost and portable device. To

best of our knowledge, we found that there are few reports using electrochemical

immunosensor for DHEAs detection. However, there are many reports using this

technique for determination of steroid hormone such as testosterone, estradiol and

cortisol.

Electrochemical immunosensor is based on the specific binding between antigen and

antibody. In the design electrochemical immunosensor, immobilization and signal

amplification are the important steps. Chitosan (CS) is considered as a suitable

immobilizing matrix for biological elements because it possesses excellent film forming,

good adhesion, nontoxicity, and high density of amino group. However, its usage is

limited for development and applications of electrochemical immunosensor due to its low

electrical conductivity. Many studies have been reported that graphene (GP) is an

excellent material for improved conductivity of immunosensor. Moreover, it has large

active surface area and inexpensive synthesis. Graphene combined with noble

nanoparticles are also considered as immobilization matrices with synergistic effects.

(Afkhami et al., 2017) Among noble nanoparticles, gold nanoparticles (AuNPs) are one

of the most widely used nanomaterials for immunosensor, due to their unique properties

such as good conductivity, electrocatalytic ability, and biocompatibility. More

importantly, antibodies were immobilized directly on AuNPs surface via the NH2- group.

(Samanman et al., 2015)

Objectives

1. To synthesize gold nanoparticle-graphene-chitosan (AuNPs-GP-CS)

2. To determine DHEAs by electrochemical immunosensor

Research methodology

Reagents Graphene material was provided by Dr.Adisorn Tuantranint (NECTEC). Chitosan,

Gold (III) chloride (HAuCl4), Bovine serum albumin and Acetic acid (CH3COOH) were

purchased from Sigma. Potassium ferricyanide was obtained from Ajex finechem. Anti-

DHEAs antibody, DHEAs standard and TMB substrate solution were purchased from

Abcam. DHEAs-HRP conjugate was purchased from Fitzgerald. Other reagents were

analytical grade. Phosphate buffered saline (PBS) as washing buffer.

Apparatus

Cyclic votammetry (CV) and amperometry measurement were carried out using

portable electrochemical analyzer 910 PSTAT software connected to a laptop computer.



I418

Screen-printed carbon electrode (SPCE) was purchased from Dropsens that compose of

an Ag as reference electrode, carbon as auxiliary and working electrode. UV-vis

spectrometry was performed using EZ Read 2000 Microplate Reader (Biochrom). TEM

images were obtained from TEM FEI/TECNEI G2 20.

Preparation of AuNPs-GP-CS

0.25 wt% of Chitosan (CS) was dissolved in 1% (v /v) acetic acid with stirring for

1 h at room temperature. Then 5 mg of graphene (GP) was added and sonicated into 5 mL

of chitosan solution for 4 h. After that, the mixture solution was centrifuged at 10,000

rpm for 10 min. 2.5 mL of 1.0 mM HAuCl4 was mixed with the supernatant of GP-CS

with vigorous stirring for 30 min at room temperature and then incubated at 80oC for 1 h

with stirring until a pink solution was observed. In this step, Au3+

could be reduced to Au0

(gold nanoparticles) by chitosan. (Samanman et al., 2015)

Preparation of electrochemical immunosensor

Fig. 1 Schematic representation of the immobilization process of the DHEAs competitive

immunosensor based on AuNPs-GP-CS nanocomposite.

The immobilization process of DHEAs competitive immunosensor is shown in Fig.

1. First, 5 μL of AuNPs-GP-CS nanocomposite was dropped on the surface of SPCE and

dried in air for 1 h. Following, 5 μL of anti-DHEAs antibody was coated on the electrode

surface and then incubated at 4°C overnight. Subsequently, the fabricated electrode was

washed with PBS. To reduce non-specific binding, 1% BSA blocking solution was

applied on the surface and incubated at room temperature for 1 h. The electrode was

washed by PBS. The electrochemical immunosensor based on AuNPs-GP-CS was

successfully obtained and stored at 4oC prior to use. To perform the electrochemical

measurement, 5 L of DHEAs standard was mixed with 5 L DHEAs-HRP conjugate

and dropped on the immunosensor. After incubation for 1 h, the electrode was washed

with PBS. For electrochemical measurement, 50 μL of the TMB/H2O2 substrate solution

was dropped on the immunosensor. The enzymatic reaction between horseradish

peroxidase (HRP) and TMB/H2O2 is shown in Fig. 2. (Esteban-Fernández De Ávila et al.,

2013) The amperometric detection was performed with constant potential of -0.2 V,

interval time of 0.5 s and duration time of 100 s at room temperature.

HRP Anti-DHEAs antibody DHEAs DHEAs-HRP conjugate 1% BAS

HRP HRP TMB/H2O2

HRP HRP

AuNPs-GP-CS



I419

Fig. 2 The enzymatic reaction between horseradish peroxidase (HRP) and TMB/H2O2

involved in the amperometric detection

Results and discussions

Characterization of AuNPs-GP-CS

Fig. 3 (A) UV–vis absorption spectra of GP–CS and AuNPs–GP–CS (B) TEM image of

AuNPs–CP-CS

UV-vis spectroscopy was used to confirm gold nanoparticles formation. The UV-vis

absorption spectra were recorded in the range of 350 to 750 nm. As shown in Fig. 3A, the

absorption spectra of GP-CS solutions exhibited no absorption peak while the AuNPs-

GP-CS solution had a maximum absorption band around 520 nm, which is a

characteristic plasmon resonance band for gold nanoparticles. The results indicated the

formation of gold nanoparticles prepared with chitosan as a reducing/stabilizing agent.

The morphology and size of the gold nanoparticles was investigated using TEM. Figure

3B shows the TEM image of gold nanoparticle prepared with chitosan. The TEM images

display the nanoparticles shape of spherical and polygonal. Other study was also

observed the polygonal particles when the nanoparticles were synthesized using medium

molecular weight chitosan. The study reported that the formation of polygonal particles

was caused by decomposition and recombination of preformed spherical nanoparticles.

(Huang & Yang., 2004) The particles were not uniform in size. The analysis of particle

400 500 600 700

0.0

0.2

0.4

0.6

Ab

sorb

an

ce

Wavelength/ nm

GP-CS

AuNPs-GP-CS

TMBox

TMBred

HRPox

HRPred

H2O2

H2O 2e

-

A B



I420

size distribution was performed using image J. The diameters were in the range of from

2.3 to 39.4 nm with an average of 13.3 nm (n = 100).

Characterization of immunosensor

Fig. 4 (A) Cyclic voltammograms and (B) CV peak current of (a) bare SPCE (b) AuNPs-

GP-CS /SPCE (c) Anti-DHEAs antibody/AuNPs-GP-CS /SPCE (d) BSA/Anti-DHEAs

antibody/AuNPs-GP-CS /SPCE (e) DHEAs-HRP conjugate /BSA/Anti-DHEAs

antibody/AuNPs-GP-CS/SPCE in 5 mM [Fe(CN)6]3-/4-

containing 0.1 M KCl.

In order to characterize the fabrication process of the electrochemical

immunosensor, cyclic voltammetry was performed after each step. Fig. 4 showed (A)

cyclic voltammograms and (B) CV peak current of difference fabricated electrode in 5

mM [Fe(CN)6]3-/4-

containing 0.1 M KCl. The peak current increased greatly after

AuNPs-GP-CS was dropped onto the bare SPCE. The result illustrated that AuNP-GP-CS

had accelerated electron transfer between [Fe(CN)6]3-/4-

and electrode. The electro-active

surface areas were estimated based on the Randles–Sevcik equation:

Ip = (2.69 × 105) n

2/3A D

1/2 1/2

Co (1)

where Ip is the redox peak current, n is the number of electrons per molecule

reduced or oxidized, A is the active surface area of the electrode surface (cm2), D is the

diffusion coefficient of potassium ferricyanide in 0.1 M KCl (0.76 × 10−6

cm2 s

−1), Co is

the concentration of potassium ferricyanide, and is the scan rate (Vs−1

). (Prasad et al.,

2012) The active surface areas of unmodified electrode (bare SPCE) and modified

electrode (AuNPs-GP-CS/SPCE) were 0.17 and 0.62 cm2, respectively. It is indicating

the electro-active surface of modified electrode increased almost 4-fold of bare SPCE

which provided signal amplification. The peak current significantly decreased when

coated with anti-DHEAs antibody (curve c), indicating that anti-DHEAs antibody acted

as barrier to electron transfer. The results showed that anti-DHEAs antibody was

successfully immobilized on the immunosensor. After immobilization of BSA and

DHEAs-HRP conjugate, the peak current decreased gradually because of an increasing

-0.3 -0.2 -0.1 0.0 0.1 0.2 0.3 0.4 0.5

-150

-100

-50

0

50

100

150

Cu

rren

t (

A)

Potential (V)

a b c d e

0

20

40

60

80

100

Cu

rren

t (

A)

a

b

c d e

A B



I421

electron transfer blockage, indicating that the immobilization of BSA and DHEAs-HRP

was successful obtained.

Electrochemical responses of immunosensor based on AuNPs-GP-CS electrode

Fig. 5 current-time curves corresponding to Anti-DHEAs antibody/SPCE (a) Anti-

DHEAs antibody/AuNPs-GP-CS/SPCE (b) DHEAs-HRP conjugate/BSA/Anti-DHEAs

antibody/SPCE (c) DHEAs-HRP conjugate/BSA/Anti-DHEAs antibody/AuNPs-GP-CS

/SPCE (d) in TMB solution.

As shown in Fig. 5, curve c was the current-time curve for unmodified electrode

after immobilized with Anti-DHEAs antibody, BSA and DHEAs-HRP conjugate

(DHEAs-HRP conjugate/BSA/Anti-DHEAs antibody /SPCE). The current signal of curve

c gradually increased when compared with curve a that was the current-time curve for

Anti-DHEAs antibody immobilized on unmodified electrode ( Anti-DHEAs

antibody/SPCE). The difference in current signal between curve a and c was 0.13 A.

The result showed that the DHEAs-HRP conjugate was bound onto the anti-DHEAs

antibody to produce the current signal. The similar phenomenon was observed for the

modified electrode with AuNPs-GS-CS (curves b and d), but the current signals increased

significantly and the difference in current value between curve b and d was 0.39 μA.

Compared with the unmodified electrode, the current difference of the modified electrode

was more than 3 times, demonstrating that the AuNPs-GP-CS could significantly enhance

the amperometric current response.

0 20 40 60 80 100

-2.0

-1.5

-1.0

-0.5

0.0

Cu

rren

t (

A)

Time (s)

a

b

c

d



I422

Optimization of experimental conditions

Fig. 6 Effect of experimental conditions on ampermetric response: (A) anti-DHEAs

antibody concentration (B) dilution ratio of DHEAs-HRP conjugate and (C) incubation

time of BSA/Anti-DHEAs antibody/AuNPs-GP-CS/SPCE and DHEAs antigen

In order to achieve excellent amperometric response, some experimental conditions

were optimized. The anti-DHEAs antibody was an important parameter in the

competitive format. To obtain the optimal anti-DHEAs antibody concentration, the

fabricated electrode was incubated with different concentration of anti-DHEAs antibody.

As shown in Fig. 6A, the current signal increased when the concentration of Anti-DHEAs

antibody increased and trended to level off at 40 g mL-1

. Thus, 40 g mL-1

was chosen

as the optimal anti-DHEAs antibody concentration. Dilution ratio of DHEAs-HRP

conjugate was optimized. In Fig. 6B, the maximum signal was obtained using a 1:2500

dilution ratio of DHEAs-HRP conjugate so 1:2500 was selected as the optimal dilution

ratio of DHEAs-HRP conjugate. Fig. 6C shows the effect of the incubation time of

BSA /Anti-DHEAs antibody /AuNPs-GP-CS /SPCE and DHEAs antigen. The current

0 10 20 30 40 50 60 70 80

0.18

0.19

0.20

0.21

0.22

-i (

A)

Concentration of anti-DHEAs antibody (g/mL)

10 20 30 40 50 60

0.10

0.15

0.20

0.25

0.30

0.35

-i (

A)

Incubation time (min)

A

1:10000 1:5000 1:2500 1:1000

0.22

0.24

0.26

0.28

0.30

-i (

A)

Dilution ratio of DHEAs-HRP conjugated

B C



I423

signal of immunosensor was increased sharply with the incubation time for 30 min. After

that, the current signal increased slowly and trended to level off. The result indicated that

the time to equilibrium of antigen and antibody interaction was 30 min. Therefore, 30

min for incubation time was selected.

Analytical performance of immunosensor

Fig. 7 (A) Current–time curves corresponding to the immunosensor after incubating with

difference concentration of DHEAs standard (a) 0, (b) 0.001 g mL-1

, (c) 0.01 g mL-1

,

(d) 0.1 g mL-1

, (e) 1 g mL-1

, (f) 10 g mL-1

. (B) The linear relationship between

currents and logarithmic DHEAs standard concentration (from 0.001g mL-1

to

10 g mL-1

).

Under the optimal experimental parameters, the modified electrode was incubated

with the DHEAs standard at different concentrations mixed with DHEAs-HRP conjugate.

The DHEAs standard completed with DHEAs-HRP conjugate in solution to bind the

immobilized antibody. The amperometric response was measured based on the enzymatic

reaction between horseradish peroxidase (HRP) and TMB/H2O2. As shown in Fig.7A, the

current decreased with the increase of the concentration of DHEAs standard in the range

from 0.001g mL-1

to 10 g mL-1

. A good linear relationship between the current signal

and the logarithmic value of DHEAs standard concentrations was observed in Fig. 7B.

The linear regression equation was y = -0.0636X + 0.1561, R2

= 0.9677. A detection limit

of DHEAs standard could be estimated using 3s (where s is the standard deviation of the

blank solution, n=3) and was calculated to be 0.089 g mL-1

.

Conclusion

This study described an electrochemical immunosensor for determination of

DHEAs using AuNPs-GP-CS nanocomposite modified on a screen printed carbon

electrode. AuNPs-GP-CS successfully synthesized with the ease method. AuNPs-GP-CS

could enhance amperometric response. The optimal anti-DHEAs antibody concentration,

0 20 40 60 80 100

-1.5

-1.0

-0.5

0.0

cu

rren

t (

A)

Time (s)

-3 -2 -1 0 1

0.05

0.10

0.15

0.20

0.25

0.30

0.35

0.40

-i (

A)

Log concentration of DHEAs (ug/mL)

A B

a

e



I424

dilution ratio of DHEAs-HRP conjugate and incubation time of BSA /Anti-DHEAs

antibody /AuNPs-GP-CS /SPCE and DHEAs antigen was 40 g mL-1

, 1:2500 and 30 min,

respectively. Under optimized conditions, this electrochemical immunosensor showed

a linear range from 0.001g mL-1

to 10 g mL-1

with a detection limit of 0.089 g mL-1

.

Acknowledgement We would like to thank department of biochemistry, faculty of science Khon Kaen

University for providing research facilities, Dr.Adisorn Tuantranont from National

Electronics and Computer Technology Center (NECTEC) for graphene, Assoc.Prof.Dr.

Wittaya Ngeontea from deparment of Chemistry, faculty of science Khon Kaen

University for Metrohm 9101 PSTAT mini. This work was supported by the Science

Achievement Scholarship of Thailand (SAST).

Referenes

Afkhami, A., Hashemi, P., Bagheri, H., Salimian, J., & Ahmadi, A. (2017). Biosensors

and Bioelectronics Impedimetric immunosensor for the label -free and direct

detection of botulinum neurotoxin serotype A using Au nanoparticles / graphene -

chitosan composite. Biosensors and Bioelectronic, 93, 124–131.

Arlt, W. (2004). Dehydroepiandrosterone and ageing. Best Practice and Research:

Clinical Endocrinology and Metabolism, 18(3), 363–380.

Esteban-Fernández De Ávila, B., Escamilla-Gómez, V., Campuzano, S., Pedrero, M.,

Salvador, J . P., Marco, M. P., & Pingarrón, J . M. (2013). Ultrasensitive

amperometric magnetoimmunosensor for human C-reactive protein quantification in

serum. Sensors and Actuators, B: Chemical, 188, 212–220.

Ferrari, E., Casarotti, D., Muzzoni, B., Albertelli, N., Cravello, L., Fioravanti, M., Magri,

F. (2001). Age-related changes of the adrenal secretory pattern: Possible role in

pathological brain aging. Brain Research Reviews, 37(1–3), 294–300.

Huang, H., & Yang, X. (2004). Synthesis of Chitosan-Stabilized Gold Nanoparticles in

the Absence / Presence of Tripolyphosphate, 2340–2346.

Prasad, K. S., Chuang, M. C., & Ho, J. A. A. (2012). Synthesis, characterization, and

electrochemical applications of carbon nanoparticles derived from castor oil soot.

Talanta, 88, 445–449.

Samanman, S., Numnuam, A., Limbut, W., Kanatharana, P., & Thavarungkul, P. (2015).

Highly-sensi t ive label -free electrochemical carcinoembryonic ant igen

immunosensor based on a novel Au nanoparticles-graphene-chitosan nanocomposite

cryogel electrode. Analytica Chimica Acta, 853(1), 521–532.

Zhang, X., Li, C., Wang, W., Xue, J., Huang, Y., Yang, X., Qiu, J. (2016). A novel

electrochemical immunosensor for highly sensitive detection of aflatoxin B 1 in corn

using single-walled carbon nanotubes / chitosan. Food Chemistry, 192, 197–202.



I425

Isolation and Characterization of Bacteriophage Specific for Staphylococcus

aureus .

Author: Wongsatorn Sirisurapong and Rujikan Nasanit

Program: Biotechnology Institute: Silpakorn University

Abstract

Staphylococcus aureus is a common photogenic bacteria and important

bacteria that causes foodborne illness. S. aureus causes symptoms of food poisoning

including diarrhea, abdominal pain, nausea, and vomiting. In some cases, this

pathogen can cause serious problems leading to death. Generally, chemicals or

antibiotics have been used to control the number of pathogenic bacteria in agricultural

and food industries. These could have negative effect on consumer health according

to the residues of chemicals remained in food and environment. Moreover, antibiotic-

resistant bacteria can occur by treating with antibiotics in long term treatment.

Therefore, this study aimed to isolate bacteriophages that are specific to S. aureus as

an interesting alternative for biological controlling of S. aureus instead of using

chemicals and antibiotics. A total of 247 samples were collected from various sources

such as waste water from sewage and fresh pork markets for bacteriophage isolation.

Of these total, S. aureus specific bacteriophages were isolated from only 14 samples

by enrichment method. A Total of 40 bacteriophages were obtained and purified.

These consisted of 37 lytic phages and 3 lysogenic phages. The lytic bacteriophages

were selected for host-range test among different bacterial strains; S. aureus (11

strains), Listeria monocytogenes (1 strain), Salmonella enterica Typhimurium and

Salmonella enterica Enteritidis. The results showed that 9 phages can infect all

S. aureus. Moreover, we found 3 phages that can infect L. monocytogenes and 2

phages can infect S. Enteritidis. These results revealed that the isolated bacteriophages

have a potential for further application in biological controlling of S. aureus. These

bacteriophages will be selected for further genome analysis and characterized their

ability for further applications as biocontrol agent.

KeyWords: Staphylococcus aureus, Bacteriophages, Foodborne pathogens, Isolation,

Host-range

Introduction

Staphylococcus aureus is a small gram positive, non-motile, non-spore

forming and high heat resistant bacteria. The optimal growth temperature for

S. aureus is 35-37 °C (Bhumibhamon and Bilhmad., 2011), however it can grow in

temperature ranging from 7-48 °C. In general, this bacteria can be found on human

skin, snot, saliva, acne, abscess and pus. Moreover food and/or beverages may be

contaminated with S. aureus such as drinking water, meats, milk and dairy products.

(FDA., 2012). S. aureus is considered as primary pathogen that can cause infection in

humans and animals and produce enterotoxin. Angkitatrakul et al. (2014) reported

that contamination of S. aureus was found in 31.87% of 91 ground pork samples from



I426

4 fresh-food markets and 4 department stores in Khon Kaen Municipality during

July - August 2012. The contamination of these bacteria have also been reported in

ready-to-eat food. For example Homthong et al. (2011) found the contamination of S.

aureus in 14 of 40 sushi samples from department stores in Sriracha district and the

area around Burapha University, Chonburi province during November 2008-January

2009. Consuming food contaminated with S. aureus can cause nausea, diarrhea,

vomiting and may be life-threatening in some cases (Chang et al., 2017). Al-Bahry et

al. (2014) reported that contamination of S. aureus was most commonly found in food

prepared by hand such as chicken bread, sandwich and spring roll.

The Centers for Disease Control and Prevention (CDC) in the United States

has reported up to 241,188 cases of foodborne illness from eating food contaminated

with S. aureus and there are 6 deaths every year (FDA, 2012). Generally, the control

of S. aureus has been performed by using antibiotics or chemicals such as Peracetic

acid, Chlorine and Cetylpyridinium chloride. However, these methods have major

disadvantages, such as misuse or overuse of antibiotics leads to the appearance of

antibiotic-resistant bacteria. The antibiotic resistance is a widespread problem that

makes treatment difficult and requires stronger antibiotics which may have side

effects and expensive (Siriwong and Chukeatirote., 2009). The use of chemicals has a

significant limitation which is the negative effect on sensory properties of food. Some

European countries do not allow the use of chemicals to remove contaminated

bacteria because the potential of chemical residues can adversely affect consumers

(Hungaro et al., 2013). It can be seen that such methods both the use of antibiotics and

chemicals have direct and indirect effects on products and/or human health.

Therefore, it is necessary to find new ways to control foodborne pathogens.

Recently, bacteriophages or phages have gained more interest for applications

in foodborne pathogen control as an alternative method. This is because phage has

high host specificity, thus it does not cause pathogen mutation, so it does not affect

human health which makes phage treatment safe. From the characteristics mentioned

above, it can be seen that phage is suitable for controlling foodborne pathogens.

Therefore, the objectives of this study were to isolate and characterize the properties

of specific bacteriophages for S. aureus for controlling pathogenic bacteria in food.


Isolation of S. aureus

Raw pork samples were collected from local markets in Nakorn Pathom

province for isolation of S. aureus. Twenty five grams of raw pork sample was sliced

into small pieces and mixed with 225 mL of peptone water 10 g/L peptone; sodium

chloride 5 g/L, pH 7.2) in stomacher bag. The samples were homogenized using Bag

Mixer (Interscience, France) for 3 minutes at 8 strokes/sec. One millilitre of liquid

mixture was spreaded on the surface of Baird-Parker agar (Titan Biotech, India)

supplemented with 5% egg yolk tellurite and incubated at 37 °C for 24-48 h. The

colonies of S. aureus which are glossy black convex with opaque inner zone and clear

outer zone on the selective medium were selected and streaked on Baird-Parker agar

to obtain single colony. S. aureus isolates were cultured in Tryptic soy broth (TSB)



I427

(Titan Biotech, India) overnight. The cultures were transferred into fresh medium and

incubated at 37 °C with shaking at 180 rpm for 3-4 h to obtain mid-log phase S.

aureus. For long-term storage, the mid-log phase S. aureus in TSB containing 20%

(v/v) sterile glycerol was prepared and stored at -80 °C.

Phage lysate preparation and Bacteriophage isolation

Total 247 samples were collected from various environments such as waste

water from sewage and fresh pork markets for bacteriophage isolation and the sources

that may contain S. aureus then the phage solution was prepared by enrichment

method (Modify from Nukdee (2007)). The samples were centrifuged at 1000×g for

15 minutes to get rid of debris. The supernatant (4.5 mL) was pipetted into new tube

mixed with 0.5 mL of mid-log phase S. aureus BPA3 and 10xTSB (0.5 mL). The

mixtures were incubated at 37 °C for 48 h with shaking at 180 rpm. The supernatants

were collected by centrifugation at 1000×g for 10 minutes and filtered through a

syringe filter with 0.45 µm pore size. The filtrate as phage solution was stored at

4 °C until used.

Double layer agar method

Double layer agar method of Adams et al. (1959) was adopted for the isolation

of S. aureus-specific phages with some modifications. Briefly, Two hundred

microliters of mid-log phage S. aureus were mixed with 100 µL phage solution and

incubated for 10 minutes to allow the phage to infect bacteria. The mixtures were then

added into 4 mL molten soft agar (TSB with 0.45% agar) and poured on TSA. The

plates were incubated at 37 °C for 24 h. The observed plaque sizes and the morpho-

logy of plaques (turbid or clear) were recorded.

Bacteriophage purification

Plaques formed in double layer agar were collected using pipette tip to

penetrate agar piece containing single plaque. The plug was resuspended in 500 µL of

sterile SM buffer (0.05 M Tris-HCI, pH 7.5, 5 M NaCI, 1 M MgSO4 and 0.01%

gelatin). The content was mixed well and leaved for 30 minutes to allow phage

diffusion from the agar piece. The obtained phage solutions were purified by the

double layer agar method for at least triplicates to ensure purified phage. 5 mL of SM

buffer were added on the plates with homogeneous plaque population and leaved

overnight at 4 °C to allow phage diffusion from the agar. The phage lysates were

centrifuged at 10,000×g for 10 minutes at 4 °C and filtered through 0.45 µm syringe

filter.

Bacteriophage prolifiration and phage stock preparation

Fifteen millilitres of mid-log phase S. aureus mixed with 30 mL of medium

and 5 mL of phage lysate then incubated at 37 °C for 16-24 h. The culture was

centrifuged at 10,000×g for 10 min at 4 °C. The supernatant was filtered through

0.45 µm filter. The obtained filtrate which is phage lysate stock was kept at 4 °C.

Determination of bacteriophage titer

Phage titer was determined by using double layer agar method as described

above. The number of plaque appeared on plate was counted (counted on plates that

had 30-300 colonies). The number of plaque was used to calculate bacteriophage titer

as plaque-forming unit/mL (pfu/mL) as followed:



I428

Bacteriophage titer (pfu/mL) = number of plaque × dilution factor

0.1 mL

Determination of phage host range

The determination of phage host range was performed by spot test adapted

from Phumkhachorn (2010). Two hundred microliters of bacterial hosts used in this

study which were S. aureus (11 isolates), Listeria monocytogenes DMST 17303

(1 strain), Salmonella enterica Typhimurium ATCC 13311 and Salmonella enterica

Enteritidis DMST 8536 were mixed with 4 mL of molten soft agar and overlaid on

TSA agar. It was allowed to harden before dropping 10 µL of phage lysate

(108 pfu/mL). After incubating at 37 °C for 24 h, the lysis zone on the bacterial strains

was observed.

Results

Isolation of S. aureus in pork samples

In this study, nine isolates of S. aureus (BPA1-BPA9) were isolated from pork

samples collected from 5 shops in Nakhon Pathom city market. All isolates were

black shiny colonies with clear halo around the colonies of about 1-2 mm diameter on

baird-parker agar with 5% egg yolk tellurite (Figure 1).

Figure 1 S. aureus colonies on baird-parker agar with 5% egg yolk tellurite

Isolation and purification of bacteriophage

Of total 247 samples, only 14 samples (Table 1) contained S. aureus specific

phages. 40 plaques obtained after the purification consisted of 37 clear plaques

(Figure 2A) and 3 turbid plaques (Figure 2B). The plaques sizes were approximately

1-2 mm.



I429

Table 1 Show source of samples and isolate bacterial strain

Bacterial strain Code Sample

S. aureus BPA 3 I11 Water from pork wash

S. aureus BPA 3 K11 Raw milk

S. aureus BPA 3 L1 Raw milk

S. aureus BPA 3 M1 Raw pork

S. aureus BPA 3 N1 Water from sewage

S. aureus BPA 3 O1 Water from sewage

S. aureus BPA 3 O2 Water from sewage

S. aureus BPA 3 O3 Water from pork stall



S. aureus BPA 3 O6 Water from pork wash

S. aureus BPA 3 O7 Water from pork wash

S. aureus BPA 3 O8 Raw pork

S. aureus BPA 3 O9 Raw pork

Figure 2 Plaques obtained on agar overlay assay (A) clear plaques, (B) turbid plaques

Determination of phage host range Thirty-seven lytic bacteriophages were selected for host-range test. The results

showed that 9 phages were able to infect all of S. aureus isolates. Interestingly, 5

phages showed infection across genus by 3 phages could infect Listeria

monocytogenes and 2 phages infect Salmonella enterica Enteritidis (Table 2).

2A 2B



I430

Table 2 Host range test of S. aureus phages. The characteristics of phages

were indicated by: ++ Clear zone, + Relatively clear, - No clear zone. p

hag

es

S.

aure

us

BP

A1

S.

aure

us

BP

A2

S.

aure

us

BP

A3

S.

aure

us

BP

A4

S.

aure

us

BP

A5

S.

aure

us

BP

A6

S.

aure

us

BP

A7

S.

aure

us

BP

A8

S.

aure

us

BP

A9

S.

aure

us

01

S.

aure

us

DN

22

L.

monocy

togen

es

S. T

yphim

uri

um

S. E

nte

riti

dis

PO102.1 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO102.2 - ++ ++ - - ++ ++ ++ ++ ++ + - - -

PO101 ++ ++ ++ + + ++ ++ ++ ++ ++ ++ + - -

PI1102 + ++ ++ + + ++ ++ ++ ++ ++ ++ - - -

PI1101 ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ ++ + - -

PN201.2 + ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PN201.1 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PK1103 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PK1102 + ++ ++ + + ++ ++ ++ ++ ++ ++ - - -

PK1101 + ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO201 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - +

PO202 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - +

PO203 + ++ ++ + + ++ ++ ++ ++ ++ ++ - - -

PN202.2 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PN202.1 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PN203.1 - ++ ++ - - ++ ++ ++ ++ ++ + - - -

PO301 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO302 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO303 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO401 + ++ ++ + + ++ ++ ++ ++ ++ ++ - - -

PO402 + ++ ++ + + ++ ++ ++ ++ ++ ++ - - -

PO403 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO501 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO502 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO503 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO601 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO602 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO603 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO701 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO702 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO703 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO801 + ++ ++ + + ++ ++ ++ ++ ++ ++ - - -

PO802 + ++ ++ + + ++ ++ ++ ++ ++ ++ + - -

PO803 - ++ ++ - - ++ ++ ++ ++ ++ + - - -

PO901 - ++ ++ - - ++ ++ ++ ++ ++ ++ - - -

PO902 - ++ ++ - - ++ ++ ++ ++ ++ + - - -

Bacterial

strains



I431

PO903 - ++ ++ - - ++ ++ ++ ++ ++ + - - -

Discussion

Over time, antimicrobial resistance has been reported and becomes a threat to

human and animal health. This makes it harder for physicians to treat diseases or

bacterial infections, which are usually treated by antibiotics. The problem arises

because pathogenic bacteria are increasingly resistant to antibiotics. One of the most

important pathogenic bacteria is S. aureus which often causes foodborne illness

(Wang et al., 2014; Zhang et al., 2012). Bhumibhamon and Bilhmad (2011) isolated

drug resistant S. aureus from pork collected from slaughterhouses in southern

Thailand during 2006-2008. They found that the percentage of 375 samples of

S. aureus that showed resistant to penicillin, amoxicillin, tetracycline and

streptomycin were 82.67, 76.53, 73.60 and 58.40%, respectively. Increasing of drug-

resistant bacteria is because these drugs are widely used in both humans and animals

for a long period of time. Misuse or overdose of antibiotics is a major cause of

antibiotic resistant bacteria. Therefore, it is necessary to find alternative methods of

treatments such as phage treatment which is a potential bactericidal agent (Basdew

and Laing., 2015; Fischetti., 2010). The bactericidal effect of phage is due to the

production of endolysin of phage. Endolysin breaks down cell wall of bacteria which

makes phage able to kill antibiotic resistant bacteria (Fan et al., 2016). The major

advantages of phage treatment are high specificity to bacteria, do not destroy useful

bacteria and no harm to humans and animals (Nukdee., 2007). During the last decade,

studies on phages biocontrol of S. aureus in food product have been reported. Garcia

et al. (2007) studied on phage cocktail used for control S. aureus in curd and whey.

Two phages, Ф 35 and Ф 88, were isolated from raw milk. The phage cocktail

treatment resulted in the reduction of S. aureus after 1 h of phage infection. Han et al.

(2013) isolated phage SAH-1 from sewage effluent near a dairy cow farm in

Gwacheon, South Korea and used for control S.aureus. The Multiplicity of infection

(MOI) was 100 for growth inhibition of S. aureus. Tabla et al. (2012) reported that the

combination of phages phiIPLA35 and phiIPLA88 with high hydrostatic pressure

treatments at 400 MPa was able to reduce the initial S. aureus contamination below

the detection limit (≤10 cfu/mL). Chang et al. (2017) combined LysSA97, an

endolysin extracted from bacteriophage SA97, with carvacrol a natural antimicrobial

compound, in order to improve potential in biocontrol treatment against S. aureus.

The results showed that this combination is more effective than treatments with either

LysSA97 or carvacrol.

In this study we obtained 9 isolates of S. aureus from 2 pork samples collected

from 5 fresh markets in Nakhon Pathom. It was found that S. aureus produced shiny

black and convex colony due to the reduction of tellurite to telluride with opaque

inner zone and clear outer zone which was due to lecithinase of S. aureus. Lecithinase

breaks down lecithin in egg yolk and forms halo (Baird-parker., 1962).

Phages have been isolated from various sources such as sea water, wastewater,

garbage etc. In effective phage isolation, samples should be collected from specific

sources for that phage because phage needs host for multiplication and survive (Li

and Zhang., 2014). In this study, we have succeeded in isolating phages specific to

S. aureus from various sources such as wastewater from drainpipe, pork, milk, etc. 40

plaques were isolated which composed of 37 clear plaque and 3 turbid plaque. In this



I432

study, we interested in lytic phages because these phages can infect bacteria, multiply

and release phage progeny which make bacteria dies and clear plaque is formed. This

is different from lysogenic phages because after infection, phage genome will be

inserted into bacterial chromosome. The obtained plaque is opaque. Lysogenic phages

may cause bacterial mutation which is unsuitable for controlling of pathogenic

bacteria. Therefore, 37 lytic phages were collected for bacterial host range test. It was

found that 9 phages could infect 11 strains of S. aureus, 3 phages could infect

L. monocytogenes and 2 phages could infect S. Enteritidis. This indicates that isolated

phages have broad host range. The specificity of phage depends on adhesion or

adsorption between phage and receptor on bacterial cell during infection (Wong et al.,

2014). Phage has receptor-binding protein (RBPs) which play an important role in

determining the specificity of receptor and bacterial cell recognition. In conclusion,

the results of this study demonstrate the feasibility of using the isolated phages to

control wide range of S. aureus strains. However, the research on phage applications

is relatively new in Thailand. Therefore we interested in studying phage properties as

a guideline for controlling pathogens without using chemical or antibiotics and

expected that this information will be useful to those interested in the future.

References Adams, M. H., (1959) Bacteriophages. Interscience Publishers, New York.

Al-Bahry S. N., Mahmoud I. Y., Al-Musharafi S. K. and Sivakumar N. (2014)

Staphylococcus aureus Contamination during Food Preparation, Processing

and Handling. International Journal of Chemical Engineering and

Applications. 5(5): 388-392.

Angkititrakul, S., Sringam, P. and Polpakdee, A. (2014) Quality of Minced Pork Sold

in Khon Kaen Municipality. Khon Kaen University Research Journal. 19(6):

900-904.

Baird-parker, A. C. (1962) An Improved Diagnostic and Selective Medium for

isolating Coagulase Positive Staphylococci. Journal of Applied Bacteriology

25(1): 12-19.

Basdew, I. H. and Laing, M. D. (2015) Investigation of the lytic ability of South

African bacteriophages specific for Staphylococcus aureus, associated with

bovine mastitis. Biocontrol Science and Technology. 25: 429-443.

Bhumibhamon, T., Bilhmad, U. (2011) Antimicrobial resistance of S. aureus in pork

from slaughterhouses in the southern part of Thailand during 2006-2008.

Nation Institute of Animal Health. 6(1): 1-8.

Chang, Y., Yoon, H., Kang, D. H., Chang, P. S. and Ryu, S. (2017) Endolysin

LysSA97 is synergistic with carvacrol in controlling Staphylococcus aureus in

foods. International Journal of Food Microbiology. 244: 19-26.

Fan, J., Zeng, Z., Mai, K., Yang, Y., Feng, J., Bai, Y., Sun, B., Xie, Q., Tong, Y. and

Ma, Jingyun. (2016) Preliminary treatment of bovine mastitis caused by

Staphylococcus aureus, with trx-SA1, recombinant endolysin of S. aureus

bacteriophage IME-SA1. Veterinary Microbiology 191: 65-71.

FDA (2012) Bad bug book: Foodborne pathogenic microorganisms and natural toxins

handbook, 2nd ed. US Food and Drug Administration, Silver Spring, p. 87-92.

Fischetti, V. A. (2010) Bacteriophage endolysins: a novel anti-infective to control



I433

gram-positive pathogens. International Journal of Medical Microbiology.

300: 357-362.

García, P., Madera, C., Martínez, B. and Rodríguez, A. (2007) Biocontrol of

Staphylococcus aureus in curd manufacturing processes using bacteriophages.

International Dairy Journal. 17(10): 1232-1239.

Han, J. E., Kim, J. H., Hwang, S. Y., Choresca, C. H., Shin, S. P., Jun, J. W., Chai, J.

Y., Park, Y. H. and Park, S. C. (2013) Isolation and characterization of a

Myoviridae bacteriophage against Staphylococcus aureus isolated from dairy

cows with mastitis. Research in veterinary science. 95: 758-763.

Homthong, S., Tanwutthibandit, J., Dungkong, N., Boodngam, A. and Nilnoree, B .

(2011) Prevalence of Staphylococcus aureus and Bacillus cereus in Sushi. Burapha Science Journal. 16(1): 69-76.

Hungaro, H. M., Mendonça, R. C. S., Gouvêa, D. M., Vanetti, M. C. D. and Pinto, C.

L. D. O. (2013) Use of bacteriophages to reduce Salmonella in chicken skin in

comparison with a chemical agents. Food Research International. 52: 75-81.

Li, L. and Zhang, Z. (2013) Isolation and characterization of a virulent bacteriophage

SPW specific for Staphylococcus aureus isolated from bovine mastitis of

lactating dairy cattle. Molecular Biology Reports. 41(9): 5838-5829.

Nukdee, K. (2007) Isolation of Bacteriophages Specific to Enteric Bacteria. Ubon

Ratchathani Research Journal. 9(3): 29-37.

Phumkhachorn, P. and Rattanachaikunsopon, P. (2010) Isolation of bacteriophage

specific to a giant tiger prawn pathogen, Vibrio harveyi, as a candidate for

disease control. African Journal of Microbiology Research. 4(16): 1794-1800.

Siriwong, N. and Chukeatirote, E. (2009) Antibiotic resistance in Staphylococcus

aureus and controlling. Songklanagarind Medical Journal. 27(4): 347-358.

Tabla, R., Martínez, B. Rebollo, E. J., González, J., Ramírez, R. M., Roa, I.,

Rodríguez, A. and García, P. (2012) Bacteriophage performance against

Staphylococcus aureus in milk is improved by high hydrostatic pressure

treatments. Journal of Food Microbiology. 156: 209-213.

Wang, X., Wang, X., Wang, Y., Guo, G., Usman, T., Hao, D., Tang, X., Zhang, Y.

and Yu, Y. (2014) Antimicrobial resistance and toxin gene profiles of

Staphylococcus aureus strains from holstein milk. Letters in Applied

Microbiology. 58: 527-534.

Wong, C. L., Sieo, C. C., Tan, W. S., Abdullah, N., Hair-Bejo, M., Abu, J. and Ho, Y.

W. (2014) Evaluation of a lytic bacteriophage, Φ st1, for biocontrol of

Salmonella enterica serovar Typhimurium in chickens. International Journal

of Food Microbiology. 172: 92-101.

Zhang, C. P., Song, L., Chen, H.J., Liu, Y., Qin, Y. L. and Ning, Y. B. (2012)

Antimicrobial susceptibility and molecular subtypes of Staphylococcus aureus

isolated from pig tonsils and cow's milk in China. Canadian Journal of

Veterinary Research. 76: 268-274.



I434

The Investigation of Mixed Metal Nanoparticles for Potential Applications in the

Hydrogen Production

Author: Thitiwat Tanyalax

Program Chemistry Institute Mahidol University

Abstract

Hydrogen gas, a renewable and clean energy, generated from water splitting

with photocatalyst has drawn attention around the world. In this research, three types of

NiFe2O4 (NiFe2O4, mesoporous-NiFe2O4, and ferrocenated-NiFe2O4) were investigated as

photocatalysts which may be used for the production of hydrogen gas in the future. NiFe2O4

was prepared in a simple method by mixing NiCl2 and FeCl3 with molar ratio of 1:2 and

the mixture turned to orange precipitate after NaOH was added. Then, precipitate was

calcined at 500oC. Mesoporous-NiFe2O4 and ferrocenated-NiFe2O4 were prepared by the

same method but pluronic P-123 and ferrocenium were added during preparation,

respectively. Diffused reflectance UV-Vis spectroscopy, XRD, and SEM were performed

to characterize the prepared catalysts. For catalytic activity, the photocatalysts were tested

in a photoreactor filled with sacrificial reagent and water. The visible light was used as the

light source to proceed the reaction for 1 hour. The results showed that no hydrogen gas

was generated from all photocatalysts catalytic at 25oC for 1 hour. The further

investigation of the synthesis and photocatalysis of this materials for the production of

hydrogen gas will be proceeded in the future.

Keywords: Hydrogen production; NiFe2O4; photocatalyst



I435

Introduction

Currently, fossil fuel has an important role for human activity

especially in the transportation. However, to use fossil fuel, the problem

involves exhaustion fossil fuel sources and global warming are facing. So

chemical fuels made by artificial photosynthesis like H2, NH3, and CH3OH have

drawn many attentions to solve these problems. There are many reactions that

can make chemical fuels such as methanol can provide from CO2 reduction, N2

reduction can provide NH3 from N2 and H2 can provide from electrolysis or

water splitting.

Hydrogen is one of the most abundant elements on the Earth’s surface, mostly

chemically bonded in hydrocarbons and water. Hydrogen can also be used as fuel energy.

Hydrogen energy is the green technology which has drawn attention from many researchers

around the world. Because the product of hydrogen combustion is water without any

pollutants as shown in the reaction (1)

H2 + 1/2O2 H2O (1)

Photocatalysts are the important materials that can convert the light energy for

redox reaction. Photocatalysts show many advantages to use in many fields such as

degradation of organic pollutants molecules, and water splitting in order to generate

hydrogen gas. However, the band gap energy is the necessary factor for photocatalyst. Due

to photocatalysts utilize the light energy to carry out the oxidation and reduction process

when light energy (hν) incident its surface, the electrons in conduction band (CB) are

excited to valence band (VB) and generate hole (h+) in CB. After that the oxidation and

reduction process are occurred from this phenomenon.

Recently, many reports have been revealed the hydrogen production by various

catalysts in the presence of irradiations such as TiO2, ZnO, CdS, WO3, NiO, and NiFe2O4.

The catalysts for the reaction require sufficient light energy (ultraviolet or visible light) to

promote electrons in valence band (VB) to conduction band (CB) and generate hole in



I436

valence band. The water molecule receives electrons in conduction band and generate

hydrogen gas as shown in Scheme 1.

Scheme 1. Photocatalytic process of water with semiconductor

H.S. Kim et al. reported that NiFe2O4@TiO2, the semiconductor material with

magnetic and photocatalytic properties, generated hydrogen gas from the photo-spiltting

methanol/water solution around 18.5 mL after 8 h when the 0.5 gL-1 of NiFe2O4@TiO2

was used as shown in Scheme 2.

Scheme 2. Mechanism of charge separation and the photocatalytic process of

NiFe2O4@TiO2

Erik Casbeer, and et al. reported about the synthesis and photocatalytic activity of ferrites

under visible light. They reported the use of ferrites in photocatalytic conversion of

VB

CB e-

h+

Photon

H2O

H2

O2

H2O

Semiconductor + 2hv 2e- + 2h

+

Oxidation: H2O + 2h

+ 2H

+ + 1/2O

2

Reduction: 2H+ + 2e

- H

2

Overall: H2O + 2hv H

2 + 1/2 O

2



I437

visible solar energy to generate e-/h+ for the degradation of the contaminants. They found

that the different band gap energy effected the ability of photocatalysts in order to absorb

light for degradation of contaminants in water.

Table 1. The band gap energies of some of these commonly used ferrites

Ferrite Band gap (eV)

CaFe2O4 1.9

MgFe2O4 2.18

ZnFe2O4 1.92

NiFe2O4 2.19

CuFe2O4 1.32

In this study, the objective of this work are to generate hydrogen gas from

photocatalysts. The band gap energy of the photocatalyst will modify for the optimize

condition in order to generate hydrogen gas.

Objectives

1) To synthesize photocatalysts for hydrogen production.

2) To characterize of the synthesized photocatalysts by diffuse reflectance UV-

Visible spectroscopy, Scanning electron microscope (SEM) and X-ray powder

diffractometer (XRD).

3) To evaluate the catalytic activity of the synthesized photocatalysts.



I438


1) Preparation of catalysts

1.1) Preparation of NiFe2O4

Prepare NiFe2O4 by mixing 1.28 g (0.01 mol) of NiCl2.6H2O and 3.22 g (0.02

mol) of FeCl3.6H2O in 20 mL of deionized water, the reaction was proceeded under room

temperature for 2 hours and the mixture turned to orange precipitate after NaOH was added.

Then, precipitate was calcined at 500oC to obtain NiFe2O4.

1.2) Preparation of mesoporous-NiFe2O4

Mesoporous-NiFe2O4 was prepared as in 2.1. Add the solution of pluronic P-

123 in ethanol into the mixture and then stir the mixture for 15 minutes. After that the

mixture turned to orange precipitate by adding NaOH. Then, precipitate was calcined at

500oC to obtain mesoporous-NiFe2O4.

1.3) Preparation of Ferrocenated-NiFe2O4

Ferrocenated-NiFe2O4 was prepared by dissolve 3.00 g (0.016 mol) of ferrocene

in 2.5 mL of conc.H2SO4. In the separate flask, mixing between 1.28 g (0.01 mol) of

NiCl2.6H2O and 3.22 g (0.02 mol) of FeCl3.6H2O and then stir the mixture for 15 minutes.

Slowly add the mixture into ferrocenium solution and calcined at 500oC to obtain

ferrocenated-NiFe2O4.

2) Material Characterizations

NiFe2O4, mesoporous-NiFe2O4, and ferrocenated-NiFe2O4 were analyzed by

using, X- Ray diffraction (XRD), Scanning Electron Microscope (SEM), diffused



I439

reflectance UV-Visible spectroscopy, Cyclic voltammogram (CV), and Gas

Chromatography with Thermal Conductivity Detector (GC-TCD).

3) Hydrogen production

3 mg of NiFe2O4 was added into photoreactor with contain 50 mM of sacrificial

reagents in 4 mL of deionized water. Then light up (light source: Xe lamp (300W), CM-1

mirror, <400 nm filter cutoff) to photoreactor for 1 hr. The produced gas was taken and

analyzed by GC-TCD. The same method was applied to mesoporous-NiFe2O4 and

ferrocenated-NiFe2O4.

Results/Discussion

1) The morphologies of catalyst

The typical scanning electron micrograph of the catalysts are shown in Fig. 1

Fig. 1 SEM of a) NiFe2O4 and b) mesoporous-NiFe2O4 at 5.00x

Fig. 2 SEM of c) NiFe2O4 and d) mesoporous-NiFe2O4 at 15.00x

The SEM images show the spherical shaped particles can be seen

having grain size of ~ 160 nm for NiFe2O4 and ~ 220 nm for mesoporous-

a b

c d



I440

NiFe2O4. The SEM results confirm that the template from pluronic-P123 can

increase the particles size of mesoporous-NiFe2O4.

2) X-ray diffraction

The XRD pattern of 3 types of NiFe2O4 are shown in Fig. 3

Fig. 3 X-ray diffraction patterns of NiFe2O4

The particles of NiFe2O4 and mesoporous-NiFe2O4 show same XRD

patterns, which the characteristic NiFe2O4 diffraction peaks at 2θ = 10.31, 30.37,

31.86(220), 33.26, 43.62(400), and 57.44(511). For ferrocenated-NiFe2O4 also

show peak pattern of carbon and NiFe2O4, 2θ = 23.94(002,graphite), 30.45(220),

32.07, 34.42, 35.88(311), 43.70(101,graphite), 45.83, 48.14,

56.77(004,graphite), and 75.59. The peaks obtained are identified and they are

similar to the pattern of NiFe2O4.

3) Study of UV-visible spectrum

Fig. 4 and Fig. 5, the results from diffused reflectance UV-visible spectrum,

suggest that all kind of NiFe2O4 exhibits light-harvesting property in visible light and the

band gap energy of each catalyst are shown in table 1.

10 20 30 40 50 60 70 80

2θ (degree)

NiFe2O4 mesoporous-NiFe2O4 ferrocenated-NiFe2O4



I441

Fig. 4 Diffused reflectance UV-visible spectrum of NiFe2O4

Fig. 5 Graphical representation of F(R) spectra versus energy (eV)

Table 2 Experimental absorption wavelength and band gap energy values for catalysts

Entry Catalysts Diffuse-reflectance

(λ, nm)

Band gap energy

(eV)

1 NiFe2O4 719 2.03

2 Mesoporous-NiFe2O4 711 2.19

3 Ferrocenated-NiFe2O4 724 2.62

200 400 600 800

Kub

elka-

Munk

wavelength (nm)


1.5 2 2.5 3 3.5 4 4.5 5 5.5 6

Kub

elka-

Munk

Energy (eV)




I442

4) Electrochemistry study

The cyclic voltammogram of all kind NiFe2O4 are shown in Fig. 6 and Fig.7.

The cyclic voltammogram results show that all kind of NiFe2O4 can serve as a

heterogeneous electrocatlyst for H2 production as shown in Fig. 6.

Fig. 6 Cyclic voltammogram of a) NiFe2O4, b) mesoporous-NiFe2O4, and c) ferrocenated-

NiFe2O4 in MeCN

Fig. 7 Cyclic voltammogram of NiFe2O4 deposited on GC electrode in MeCN and 10%H2O

at room temperature under Ar

-3 -2 -1 0 1 2

Potential(V vs. Ag/AgCl)

A1 A1+10%H2O

-3 -2 -1 0 1 2


B1 B1+10%H2O

-3 -2 -1 0 1 2


C1 C1+10%H2O

-2.5 -2 -1.5 -1 -0.5 0


A1 B1 C1 Blank MeCN

a b

c



I443

Conclusion

The three kinds of NiFe2O4 (NiFe2O4, mesoporous-NiFe2O4, and ferrocenated-

NiFe2O4) were successfully synthesized and investigated as photocatalysts. The

characterization results confirm that 3 kinds of NiFe2O4 have different band gap energy

values by different synthesis method. For catalytic activity, the photocatalysts were tested

under visible light source to proceed the reaction. However, the results showed that no

hydrogen gas was generated from all photocatalysts catalytic at 25oC for 1 hour. The

further investigation of the synthesis and photocatalysis of this materials for the production

of hydrogen gas will be proceeded in the future.

References

Techalertmanee, T., Chancharoenrith, S., Namkajorn, M., Kiatisevi, S.,

Chaicharoenwimolkul, L., and Somsook, E. (2015). "Facile synthesis of zinc–

iron mixed oxide/carbon nanocomposites as nanocatalysts for the degradation

of methylene blue." Materials Letters 145, 224-228.

Jinasan, A., Poonsawat, T., Chaicharoenwimolkul, L., Pornsuwan, S., and Somsook, E.

(2015). "Highly active sustainable ferrocenated iron oxide nanocatalysts for the

decolorization of methylene blue." RSC Adv. 5 (40), 31324-31328.

Bai, Y. Y., Lu, Y., and Liu, J. K. (2015). "An efficient photocatalyst for degradation of

various organic dyes: Ag@AgMoO-AgBr composite." Journal of hazardous

materials 307, 26-35.

Wang, H., Chen, W., Zhang, J., Huang, C., and Mao, L. (2015). "Nickel nanoparticles

modified CdS – A potential photocatalyst for hydrogen production through

water splitting under visible light irradiation." International Journal of

Hydrogen Energy 40 (1), 340-345.

Wang, X., Liu, M., Chen, Q., Zhang, K., Chen, J., Wang, M.; Guo, P., and Guo, L. (2013).

"Synthesis of CdS/CNTs photocatalysts and study of hydrogen production by



I444

photocatalytic water splitting." International Journal of Hydrogen Energy

38 (29), 13091-13096.

Barakat, N. A. M., Taha, A., Motlak, M., Nassar, M. M., Mahmoud, M. S., Al-Deyab, S.

S., El-Newehy, M., and Kim, H. Y. (2014). "ZnO&Fe2O3-incoportaed TiO2

nanofibers as super effective photocatalyst for water splitting under visible light

radiation." Applied Catalysis A: General 481, 19-26.

Koca, A., and Şahin, M. (2002). "Photocatalytic hydrogen production by direct sun light

from sulfide/sulfite solution." International Journal of Hydrogen Energy 27

(4), 363-367.

Kim, H.-i., Kim, J., Kim, W., and Choi, W. (2011). "Enhanced Photocatalytic and

Photoelectrochemical Activity in the Ternary Hybrid of CdS/TiO2/WO3

through the Cascadal Electron Transfer." The Journal of Physical Chemistry

C 115 (19), 9797-9805.

Peng, T., Zhang, X., Lv, H., and Zan, L. (2012). "Preparation of NiFe2O4 nanoparticles

and its visible-light-driven photoactivity for hydrogen production." Catalysis

Communications 28, 116-119.

Kim, H. S., Kim, D., Kwak, B. S., Han, G. B.; Um, M.-H., and Kang, M. (2014). "Synthesis

of magnetically separable core@shell structured NiFe2O4@TiO2 nanomaterial

and its use for photocatalytic hydrogen production by methanol/water

splitting." Chemical Engineering Journal 243, 272-279.

Preethi, V., and Kanmani, S. (2013). "Photocatalytic hydrogen production." Materials

Science in Semiconductor Processing 16 (3), 561-575.

Ahmad, H., Kamarudin, S. K., Minggu, L. J., and Kassim, M. (2015). "Hydrogen from

photo-catalytic water splitting process: A review." Renewable and

Sustainable Energy Reviews 43, 599-610.

Das, S., and Wan Daud, W. M. A. (2014). "Photocatalytic CO2 transformation

into fuel: A review on advances in photocatalyst and photoreactor." Renewable

and Sustainable Energy Reviews 39, 765-805.



I445

Casbeer, E., Sharma, V. K., and Li, X.-Z. (2012). "Synthesis and photocatalytic activity

of ferrites under visible light: A review." Separation and Purification

Technology 87, 1-14.



I446

Title Molecular cloning and characterization of Ig- like fibronectin III of

Gnathostoma spinigerum , GsIGF, for development of immunod iagnos is

Author : Preeyarut Malaithong , Poom Adisakwattana , Paron Dekumyoy ,

Dorn Wattanakulpanich , Jiraporn Ruangsittichai

Program Helminthology Institute Mahidol University

Abstract

Human gnathostomiasis is one of severe helminthic infection that is

difficult to diagnose. Recently, detection of specific antibody against 24 kDa

protein in crude somatic antigen of G. spinigerum L3 is a gold standard but

antigen preparation and time- consuming are claimed as a barrier. In this study,

we selected Ig- like fibronectin III protein (GsIGF) that has been identified from

our previous study. The nucleotide and amino acid sequences analyzed by

bioinformatics were demonstrated specific antigenic region of GsIGF at amino

acid residues 1,098 to 1,258 (GsIGF aa1,098 -1,258). cDNA encoding GsIGF

aa1,098 -1,258 was cloned into prokaryotic expression vector and then induced

recombinant protein expression (rGsIGF). rGsIGF was expressed at the

molecular weight of 18 kDa and reacted with anti-His tag antibody. The

immunodiagnostic potential of rGsIGF was evaluated with indirect ELISA and the

result suggested that this rGsIGF could differentiate G. spinigerum- infected sera

from negative healthy control . Our further study need to perform validation

of rGsIGF with heterologous sera and then calculated sensitivity and specificity.

The successive outcome may lead to establish a reliable immunodiagnosis of

gnathostomiasis that will be advantage for diagnostic laboratory and development

of diagnostic test kit in the future.



I447

Keywords : Immunodiagnosis, recombinant protein, Ig-like fibronectin III,

Gnathostoma spinigerum

Introduction

Gnathostomiasis is the parasitic disease caused by nematode in the Genus

Gnathostoma. The outbreaks of the disease have been occurred frequently in Asia

and Central America (Daengsvang 1980, Almeyda-Artigas et al. 2000) and sporadic

cases in several countries when travelers returning home after visiting endemic

areas, especially Southeast Asia (Moore et al. 2003 , Katchanov et al. 2011).

G. spinigerum is the major species that causes human gnathostomiasis in Southeast

Asia particularly Thailand.

Subcutaneous or cutaneous intermittent migratory swelling with peripheral

eosinophilia are the most common clinical manifestations. However, the severe

case potentially observed when the parasite migrates to visceral organs such as

brain, spinal cord and eyes (Visudhiphan et al. 1980 , Chitanondh et al. 1967 ,

Boongird et al. 1977). For diagnosis, clinical signs and symptoms combination

with a history of ingestion of improperly second intermediate hosts or paratenic

hosts of Gnathostoma from endemic areas have been used in general.

Alternatively, immunodiagnosis have been developed and used as a supportive

diagnosis of gnathostomiasis. Immunoblotting to detect the 24 kDa crude somatic

antigen of G. spinigerum L3 is gold standard (Intapan et al. 2010) but the

whole process of antigen preparation is time consuming, seasoning dependence

and laborious. To improve immunodiagnosis, recombinant protein technology has

been applied to improve reliability of the essay (Laummaunwai et al. 2010).

However, there are few antigens show power of diagnosis but they are still in the

pipeline of validation. Therefore, several recombinant antigens may require for

increasing a successful outcome of immunodiagnostic. In this regard, our group is

identifying the diagnosis targets from excretory-secretory products of

G. spinigerum L3 using proteomics- immunomics approach. The recent result



I448

shows several protein candidates including Ig- like fibronectin III protein (GsIGF)

interacted with G. spinigerum infected sera but less with other helminths. In

this study, we selected GsIGF for bioinformatics and biochemical analyses using

computational prediction, recombinant protein technology and ELISA,

respectively. This study may provide information regarding potential of GsIGF in

further development of immunod iagnos is.

Objectives

1. To produce recombinant proteins in prokaryotic expression system

2. To evaluate a potential diagnosis of recombinant proteins using ELISA


Third-stage larvae G. spinigerum

The third stage larvae (L3) G. spinigerum were obtained from the

livers of naturally infected eels. In summary, the livers were removed and

then homogenized in 0.7% acid-pepsin using a blender. After that, the homogenate

were incubated at 37°C for 3 hr. in water bath with frequent stirring. After

digestion, the supernatant were removed and then the sediment were washed

several times with tap water. To obtain the larvae, the sediment were transferred

into several Petridishes and then looked for the parasite under stereomicroscope.

Larvae were washed several times with 0.85% normal saline solution (NSS) and

finally with distill water.

Bioinformatics analysis

Nucleotide sequence of GsIGF derived from in-house transcriptomes

database of G. spinigerum L3 (unpublished data) was used for prediction

amino acid sequence prior to bioinformatic analysis. The specific amino acid

regions of GsIGF compared with orthologs were analyzed with a multiple protein



I449

alignment constructed with Clustal Omega (Goujon et al. 2010). All orthologs

recruited in this experiment are composed of Ascaris suum (accession no.

ERG85480), Haemonchus contortus ( accession no. CDJ98493), and Brugia malayi

(accession no. XP_001898707). Antigenic epitopes were predicted in the GsIGF

specific protein region to determine potential of antigen-antibody interaction using

web-based prediction program (http://imed.med.ucm.es/Tools/ antigenic.pl).

Amplification of GsIGF

Total RNA were isolated from G. spinigerum L3 using TRIZOL reagent

(Invitrogen, Carlsbad, CA) according to manufacturer’s instructions. After treating

total RNA with DNase I, f irst-strand cDNA was constructed by RevertAid First

Strand cDNA Synthesis Kit (Thermo Fisher Scientific, Watham, MA). The specific

amino acid region of GsIGF analyzed with Clustal Omega was used for design

specific primers, Forward : AATATGCATGCCGAGCCTTTCCACAACCTCATATC

and Reverse :ATACTGCAGTTAATAAGCATCACAGTGAGGTTGGTTC. Restriction

sites of Pae I and Pst I were incorporated into Forward and Reverse

primers, respectively (underlined). Amplification of GsIGF was performed by PCR

in a total volume of 50 l containing 1 x Taq DNA polymerase buffer, 2 mM

MgCl2, 0.2 mM each dNTP, 200 nM each degenerate primer, and 1 U of

Taq DNA polymerase (Thermo Fisher Scientific). The cycling conditions were

95 °C for 5 min, 40 cycles of 95 °C for 30 s, 45 °C for 30 s, and 72 °C for 30 s,

and a final extension step at 72 °C for 5 min. The partial cDNA sequence was

subcloned into the pGEM - T plasmid (Thermo Fisher Scientific) and the DNA

sequence was analyzed with DNA sequencing (AITbiotech Pte Ltd, Singapore).

Expression and purification of rGsIGF

The pGEM-T containing GsIGF cDNA and pQE30 vector (Qiagen GmbH,

Hilden, Germany) were digested with Pae I (Thermo Fisher Scientific) and Pst I

(Thermo Fisher Scientific) at 37 °C for 16–18 h. After gel purification, GsIGF



I450

cDNA was ligated with pQE30 using T4 DNA ligase (Thermo Fisher Scientific),

and then transformed into E. coli strain JM109 and subsequently -strain M15,

respectively with the heat-shock technique (Froger and Hall 2007). M15 carrying

pQE30–GsIGF was cultured in LB broth containing 100 µg/ml ampicillin and 25

µg/ml kanamycin until growth reaches OD 600 0.4-0.6. After that, expression

of recombinant GsIGF (rGsIGF) was induced by adding 1 mM isopropyl--d-

thiogalactopyranoside (IPTG; Thermo Fisher Scientific) for 4 h. The bacteria

were harvested by centrifugation at 6,000 x g at 4 °C for 30 min, and the protein

was purified from the pellet under denaturing conditions, as described

previously (Pakchotanon et al. 2016).

Immunological assay

The crude worm antigen (CWA) were prepared as described previously

(Adisakwattana et al. 2007). A 100 l sample of rGsIGF (2.5 g/ml) or CWA

(5 g/ml) in 0.05 M carbonate buffer (pH 9.6) was coated onto each well of a

96-well microtiter plate (Nunc; Thermo Scientific, Denmark) and incubated at

37 °C until complete drying. An ELISA was performed as previously described, with

some modifications. In brief, nonspecific binding was blocked with blocking solution

(0.5% skim milk in 1x PBS) at 37 °C for 1 h, and the sections were then washed

with PBS–Tween. Human sera (1:400) were added to the wells and incubated at

37 °C for 1 h. After the wells were washed, HRP-conjugated goat anti-human IgG

antibody (1:2,000) was added. The samples were incubated at 37 °C for 1 h and

then visualized with the addition of ABTS substrate (Sigma-Aldrich). The

reaction was developed in the dark at room temperature for 30 min and then

stopped with 1% SDS. The optical density at a wavelength at 405 nm was

measured with the Sunrise™ absorbance reader (Tecan Group Ltd, Männedorf,

Switzerland).



I451

Results / Conclusion

Sequence analysis

In our in-house transcriptomes, we found partial nucleotide

sequence encoding GsIGFP composed of 4,425 bp that is translated to 1,475

amino acid residues (Fig. 1). To identify specific protein region of GsIGF,

a multiple sequence alignment of GsIGF comparing with its orthologues was

performed and the result suggests that GsIGF contains specific region at amino acid

residue (aa) 1,098 to 1,258 (Fig. 2). Antigenic epitopes predicted in the GsIGF

aa1,098-1,258 demonstrate that this region contains 7 potential antigenic determinants

(Fig. 3 and Table 1)

Fig. 1 Deduced amino acid sequence of partial GsIGF is composed of 1,475

amino acid residues.



I452

Fig. 2 Multiple alignment of deduced amino acid sequences identified the

specific protein region of GsIGF. Identical and similar residues are indicated with

black and gray shading, respectively. Specific protein region of GsIGF (aa1 ,0 9 8-1,258).

Fig. 3 Seven potential antigenic determinants predicted in specific protein region

of GsIGF (aa1,098 -1,258) (bold with underlined).



I453

Table 1 Antigenic determinants of GsIGF aa1,0 9 8 -1,258

No. Position Sequence

1 4-10 PQPHISW

2 33-45 IAPNLYESVLVIK

3 52-58 GVYMCNA

4 68-92 RNVDLAVSSVVLPITP RFVLKCCSD

5 95-107 ISDSCQRACSVAP

6 109-124 YNQNCSEYSRELLKCA

7 129-157 DHRQCCVHAGVPLDCLPICKGVTTLNQPH

Cloning, expression and purification of rGsIGF

cDNA encoding GsIGF aa1,098-1,258 was amplified by RT-PCR followed by

detecting the amplicon on agarose gel electrophoresis. The result showed

that the amplicon was amplified at a molecular size of 483 nucleotides

(Fig. 4A). After subcloning of the cDNA into prokaryotic expression system,

expression of rGsIGF was induced using IPTG and subsequently examined with

SDS-PAGE. The result demonstrated that rGsIGF was expressed with an

approximately molecular mass of 18 kDa (Fig. 4B). The water solubility was

determined and demonstrated that rGsIGF was expressed in an insoluble form,

which was reacted with an anti-His-tag antibody (Fig. 4C). rGsIGF was

purified under denaturing condition, and a major band of 18 kDa was eluted (Fig.

4D). The purified rGsIGF reacted with the anti-His-tag antibody (data not

shown).



I454

Fig. 4 GsIGF cDNA was amplified by PCR and showed the amplicon at 483 bp (A).

M : 1 kb DNA marker (Thermo Fisher Scientific); 1 : GsIGF cDNA; arrowhead

indicates GsIGF cDNA. rGsIGF was heterologously expressed in E. coli (B) and then

western blot analysis with anti-His-tag antibody (C). M : broad-range prestained protein

marker; 1 : noninducing; 2 : inducing; 3 : inducing-soluble fraction; 4 : inducing-

insoluble fraction. rGsIGF was purified with a Co2+ affinity column under

denaturing condition (D). M : broad-range prestained protein marker; 1 : purified

rGsIGF, arrowhead indicates rGsIGF.

ELISA

To determine a potential of rGsIGF in diagnosis of G. spinigerum

infection, G. spinigerum-infected human sera and negative healthy sera were recruited in

this study. Initially, the optimal condition of ELISA was optimized using checker board

analysis and the result presented that at dilution 1:800 of human serum incorporating with

1:4,000 of conjugated antibody (data not shown). After performing ELISA, the result

suggested that G. spinigerum-infected sera reacted with rGsIGF at a higher OD405

than healthy control (Fig. 5).



I455

Fig. 5 Evaluation the potential of rGsIGF for immunodiagnosis using ELISA.

positive: G. spinigerum infected human sera; negative: negative healthy control sera.

Discussion

The severe pathology and treatment management are still concerning

problems in gnathostomiasis. In this regard, reliable diagnosis is necessary issue

for clinical management and treatment follow-up. Immunodiagnosis is the gold

standard that has been used with high power of detection and differentiation.

Recently, Western blot analysis to detect antigen at the molecular weight of 24 kDa in

crude G. spinigerum L3 extract is accepted to be reference test for diagnosis of

gnathostomiasis (Maleewong et al.1988). However, obtaining the parasite from natural

source, complex life cycle, time-consuming in antigen preparation and non-quality

batch-to-batch are main barriers. In this study, we selected one protein candidate

identified from our ongoing research (unpublished data), namely GsIGF, to analyzed

by bioinformatics, recombinant protein expression, and ELISA.



I456

A multiple alignment of GsIGF with other orthologs identified the

specific protein region aa1,098-1,258 that contains seven antigenic determinants. These

predicted epitopes may be a guidance to indicate the capacity of GsIGF

aa1,098 -1,258 region for immunodiagnosis. Moreover, this result may be suggested the

possibility to use the peptide epitopes to develop peptide-based immunodiagnosis.

In previous study, Fasciola gigantica cathepsin L-based synthetic peptide could be

used for diagnosis of parasite infected sheep and seem to discriminate between

early and late infection (Jezek et al. 2008).

rGsIGF was expressed in E. coli as an insoluble product with an approximate

molecular weight of 18 kDa. The expression of rGsIGF in insoluble form may be due to

incorrect conformation or lack of post-translation modification of the prokaryotic

expression system (Jana 2005). To express a soluble protein, novel expression condition

need to be optimized including different concentrations of IPTG, induction period,

growth temperature, shaking speed, as well as different types of culture media (Hossein

2014). Otherwise, changing to eukaryotic expression system is another option that

may increase protein solubility (Geisse et al. 1996).

To evaluate the immunodiagnostic potential of rGsIGF, ELISA was

initially tested with G. spinigerum-infected sera and healthy control sera. The result

demonstrated that rGsIGF could discriminate infections from healthy control. This

result may indicate that denature-linear epitopes of rGsIGF aa1,098-1,258 are sufficient in

diagnosis of gnathostomiasis. However, validation of rGsIGF with related- and unrelated

heterologous sera need to be performed for analysis of sensitivity and specificity.

In conclusion, rGsIGF was successfully expressed in E. coli and shows the

evidence to discriminate G. spinigerum- infected sera from healthy control. These may

lead to development of reliable immmunodiagnosis for gnathostomiasis that can be

applied to use in immunodiagnostic laboratory and developed to diagnostic kit in the

future.



I457

References

Adisakwattana, Poom et al. (2007). Comparative molecular analysis of two asparaginyl

endopeptidases and encoding genes from Fasciola gigantica. Molecular and

Biochemical Parasitology 156(2): 102–116.

Almeyda-Artigas J, Roberto et al. (2000). “ITS-2 rDNA sequencing of Gnathostoma

species (Nematoda) and elucidation of the species causing gnathostomiasis in the

Americas.” Journal of Parasitology 86(3): 537-544.

Boongird, Prasert et al. (1977) . Neurological manifestations of gnathostomiasis. Journal

of the Neurological Sciences 31(2): 279–291.

Chitanondh, Hatai et al. (1967). Fatal eosinophilic encephalomyelitis caused by

the nematode Gnathostoma spinigerum. American Journal of Tropical

Medicine and Hygiene 16(5): 638-645.

Daengsvang, Svasti. (1 9 80 ) . A Monograph on the Genus Gnathostoma and

Gnathostomiasis in Thailand. Southeast Asian Medical Information Center.

Froger, Alexandrine and Hall E, James . (2007). Transformation of Plasmid DNA into

E. coli Using the Heat Shock Method. Journal of Visualized Experiments

6: 253.

Geisse, S. (1996). Eukaryotic expression systems: a comparison. Protein Expr Purif

8(3): 271-282.

Goujon, Mickael et al. (2010). A new bioinformatics analysis tools framework at

EMBL–EBI. Nucleic Acids Research 38(2): 695-699.

Hossein, Zarei Jaliani. (2 01 4 ) . Optimized Condition for Enhanced Soluble-

Expression of Recombinant Mutant Anabaena Variabilis Phenylalanine

Ammonia Lyase. Adv Pharm Bull 4(3): 261-266.



I458

Intapan M., Pewpan et al. (2010). Immunoblot diagnostic test for neurognathostomiasis.

American Journal of Tropical Medicine and Hygiene 83(4): 927-929.

Jana S, Deb JK. (2005). Strategies for efficient production of heterologous proteins in

Escherichia coli. ApplMicrobiolBiotechnol 67(3): 289-298.

Jesek, J et al. (2008). Fasciola gigantica cathepsin L proteinase-based synthetic peptide

for immunodiagnosis and prevention of sheep fasciolosis. Biopolymers

90(3):349-357.

Katchanov , Juri et al. (2011). Neurognathostomiasis, A neglected parasitosis of the

central nervous system. Emerging Infectious Diseases Journal 17(7): 1174–

1180.

Laummaunwai, Porntip et al. (2010). Gnathostoma spinigerum : Molecular cloning,

expression and characterization of the cyclophilin protein. Experimental

Parasitology 126(4): 611-616.

Maleewong, Wanchai et al. (1988). Serodiagnosis of human gnathostomiasis. The

Southeast Asian journal of tropical medicine and public health 19(2):

201-205.

Moore A.J, David et al. (2003). Gnathostomiasis : an emerging imported disease.

Emerging Infectious Diseases Journal 9(6): 647–650.

Pakchotanon, Pattarakul et al. (2016). Molecular characterization of serine protease

inhibitor isoform 3, SmSPI, from Schistosoma mansoni. Parasitology Research

115(8): 2981-2994.

Visudhiphan, Pongsakdi et al. (1980). Causes of spontaneous subarachnoid hemorrhage

in Thai infants and children. A study of 56 patients. Journal of Neurosurgery

53(2): 185-187.



I459

Title Effect of season and temperature shock on insecticide susceptibility of

Aedes aegypti in Thailand

Author: Promsup Supcharoen, Narumon Komalamisra, Raweewan Srisawat,

Siriluck Attrapadung, Nuananong Jirakanjanakit

Program Medical Entomology Institute Mahidol University

Abstract

In this study, eight strain of Aedes aegypti mosquitoes from four provinces

(Nakhon sawan, Kanchanaburi, Rayong, and Ranong) in two seasons (winter and

summer) in Thailand were used for testing on susceptibility test to commonly used

insecticides for mosquito control in Thailand. The insecticides include malathion,

deltamethrin, and propoxure. All of the Ae. aegypti strains were strongly resistant to

propoxure and showed incipient resistance to deltamethrin. In contrast, most Ae.

aegypti strains were susceptible to malathion. The insecticide susceptibility test showed

that seasonal temperature has some effect on insecticide susceptibility. The propoxure

susceptibility of Kanchanaburi and Rayong summer strains were higher than winter

strains. Malathion and deltamethrin susceptibility can be observed that the seasonal

temperature effect only in Rayong and Ranong strains, respectively. The effect of

temperature on insecticide susceptibility was also investigated in laboratory, all Ae.

aegypti strains were exposed at three temperatures (20±1C, 25±1C, and 30±1C) for 4

hours prior to insecticide susceptibility test with same insecticides. Mortality was

examined after 24 hour exposure. The results of deltamethrin susceptibility was showed

negative relationship with temperature in all strains. In the other hand, the results of

malathion and propoxure susceptibility were showed positive relationship with

temperature. We conclude that deltamethrin insecticide has higher toxicity to mosquito

when used in low temperature than high temperature while malathion and propoxure

are used in high temperature better than low temperature environment.

Keywords: Aedes aegypti, Season, Temperature, Insecticide susceptibility, Thailand



I460

Introduction

Dengue fever is one of the serious mosquito-borne viral diseases in urban areas

of tropical countries and this disease is the most rapidly spreading around the world

(World Health Organization, 2012). The bite of an infected mosquito is a transmission

process for disseminating the problem of disease. The important mosquito vector is

Aedes aegypti, it is a primary vector in tropical and sub-tropical regions (World Health

Organization, 2009). In Thailand, the disease with the highest of cases and speedily

distributed disease are dengue (Chareonviriyaphap et al, 2013). Therefore, the

management of vector control is needed. Chemical control is the most effective method

for controlling mosquito-borne diseases transmission, several synthetic insecticides that

are commonly used included organochlorines, organophosphates, carbamates, and

synthetic pyrethroids. Synthetic pyrethroids are known for rapid knockdown effect, low

toxicity, and have a high insecticidal effect (Chareonviriyaphap et al, 2013).

Deltamethrin is the one of the most commonly used for the emergency control of Ae.

aegypti in Thailand. Malathion and fenitrothion are used for during the high period of

vectors, especially during the rainy season. The wrong used of chemical insecticides

can alter insecticide resistance, several researchers found Ae. aegypti in Thailand resist

to many insecticides including DDT, malathion, fenitrothion, temephos, cyfluthrin,

cypermethrin, deltamethrin, lambda-cyhalothrin, permethrin, etofenprox, and propoxur

(Thanispong et al, 2008; Chareonviriyaphap et al, 2013).

Changing climatic and environmental temperature influence density physiology

of mosquito, dengue virus susceptibility, and transmission (Patz et al, 2003; Vargas et

al, 2010; Alto et al, 2013). Temperature has a beneficial effect on mosquito population

dynamics and the rate they come to contact with humans (Patz et al, 2003). Mohammed

et al. (2011) found temperature changing affected on time of development, egg

hatching, larval and pupation. Moreover, the temperature influences the morphological

structure including size and shape of their wings, longevity, and survivorship (Swain et

al, 2008; Vargas et al, 2010).

In addition, the temperature to decrease extrinsic incubation period of the

vector-borne pathogen, at a higher temperature and decrease the viral replication (Patz

et al, 2003). More importantly, the changes of environmental temperature due to global

warming can alter the insecticide toxicity (Polson et al, 2012). An insecticide with a



I461

negative temperature coefficient that has more toxic when a decrease in temperature or

vice versa for an insecticide with positive temperature coefficient become more toxic

when an increase in temperature (Glunt et al, 2013).

Khan et al. (2014) studied the effect of temperature on the insecticide toxicity in Musca

domestica, they found positive temperature coefficient in organophosphate insecticides

including profenofos and chlorpyrifos, in contrast to pyrethroid insecticides showed a

negative temperature coefficient. Little researchers are known about the impact of

temperature on insecticide toxicity in Ae. aegypti. Whiten et al. (2015) experimented

with adult female Ae. aegypti to permethrin and the results of toxicity were found

negative temperature coefficient. Therefore, the toxicity of pyrethroids insecticides is

negative temperature coefficient, whereas, organophosphate group exhibits a positive

temperature coefficient in the laboratory. It is expected that the result could be helpful

in selecting appropriate insecticides in the reasonable conditions.

Objective

The aim of the present study was to investigate the season and climatic effect

on the insecticides susceptibility against field Ae. aegypti in Thailand.


Study site selection: The data of annual temperature was used for select study

sites and time to collecting samples. Four provinces were selected and divided to two

provinces represent for high different annual temperature and two provinces represent

for low different annual temperature. The average of annual temperature for five years

and the average 2 weeks of temperature before collect samples of each study sites in

winter and summer are given in Table 1 and 2, respectively.

Study sites: Four provinces of Thailand selected for collecting mosquito

populations were Nakhon sawan, Kanchanaburi for high different annual temperature

and Rayong, and Ranong provinces for low different annual temperature. Larvae and

pupae were collected from containers located indoor and outdoor in winter (January

2016) and summer (April to May 2016) shown in Fig. 1. GPS coordinated and

description of the location are provided in Table 1.



I462

Mosquito strain: Field mosquito larvae and pupae were brought and colonized

into the insectary at Department of Medical Entomology, Faculty of Tropical Medicine,

Mahidol University, Thailand. Adults identified as Aedes aegypti. Three to seven days

old female mosquitoes were fed on uninfected human blood by the artificial feeder.

Mosquito strains were colonized under laboratory condition at 25 C and relative

humidity of 60-80%. Only first and second generations of Ae. aegypti were used in the

experiment.

Fig. 1. Aedes aegypti collection sites in Nakhon sawan (Right top), Kanchanaburi (Left

top), Rayong (Right bottom), and Ranong (Left bottom) of Thailand.



I463

Table 1. Description and GPS coordinates of field collecting sites.

Provinces Average of

temperature for

5 years (°C)

Sites GPS coordinates

Nakhon sawan

Kanchanaburi

Rayong

Ranong

34.46± 2.25

34.33± 2.18

31.28± 0.87

31.86± 1.38

Phromnimit-1

Phromnimit-7

Soytong-2

Soytong-5

Nongbua

Muang-NK

Muang-KC

Wangka

Sungkla

Muang-RY

Cherngnern

Chumsang

Wangchan

Wangwha

Huaiyang

Ruksawharin

Muang-RN

Bangnon

Pronrung

Phulumphi

15.1391 N 100.4269 E

15.1658 N 100.4102 E

15.1172 N 100.4066 E

15.1388 N 100.3591 E

15.8730 N 100.4338 E

15.7102 N 100.1011 E

14.0186 N 99.5350 E

15.1566 N 98.4508 E

15.1347 N 98.4502 E

12.6722 N 101.2988 E

12.7027 N 101.2925 E

12.9328 N 101.5272 E

12.8511 N 101.5525 E

12.7813 N 101.5650 E

12.7533 N 101.5761 E

9.9586 N 98.6519 E

9.9616 N 98.6150 E

9.9641 N 98.6188 E

9.8946 N 98.6424 E

9.9057 N 98.6320 E

Insecticide impregnated paper: Three insecticides and two control chemicals

were used in susceptibility testing including, 0.05% Deltamethrin (Pyrethroid), 5%

Malathion (Organophosphate), 0.1% Propoxure (Carbamate), PY-control, and OP/C

control. Insecticide impregnated paper (12x15 cm2) were bought from Universiti Sains

Malaysia, Malaysia.



I464

Table 2. The average 2 weeks temperature before collected samples of each study sites

in winter and summer season

Seasons Province Minimum-Maximum

temperature (°C)

Mean difference of

temperature (°C)

Winter

Summer

Nakhon sawan

Kanchanaburi

Rayong

Ranong

Nakhon sawan

Kanchanaburi

Rayong

Ranong

21.30-33.32

22.07-34.74

23.27-31.80

24.22-33.34

27.70-42.22

27.30-41.02

27.27-31.85

27.02-33.81

12.02±2.21

12.67±2.85

8.53±2.40

9.12±0.88

14.52±0.34

13.72±1.64

4.58±1.83

6.79±2.31

Temperature pre-exposed: Effect of temperature on insecticide susceptibility

was estimated by WHO insecticide susceptibility tube test. Three to five days old

females of Ae. aegypti were used in experiments. Twenty-five adults were anesthetized

by ice and introduced in WHO holding tube, 5 replicates (4 replicates for treatment and

another one for control) in each temperature there were 20±1C, 25±1C, and 30±1C.

After that the mosquitoes were exposed to these temperatures for 4 hours and then held

at 25±1C for 1 hour prior to insecticide susceptibility test. All of experiments were done

3 replicates.

Insecticide susceptibility test: Temperature for testing is 25±2C and relative

humidity 60-80%. The principle of the WHO insecticide susceptibility tube test is to

expose insects to a given dose of insecticide for a given time to assess susceptibility or

resistance. In this experiment, three groups of insecticides using diagnostic dose were

tested: Pyrethroid (0.05% Deltamethrin), Organophosphate (5% Malathion), and

Carbamate (0.1% Propoxure). They were gently blown into the exposure tubes

containing the insecticide-impregnated papers. After one hour of exposure, mosquitoes

were transferred back into holding tubes and provided with cotton wool moistened with

a 5% sugar solution. The number of dead mosquitoes at 24 hours were recorded.



I465

Data analysis: Interpretation of results of insecticide susceptibility test were

determined according to WHO criteria. The WHO divided the results of susceptibility

test using diagnostic dose into three categories, 98-100% mortality indicates

susceptibility, 80-97% mortality suggest the possibility of resistance that needs to be

confirmed, less than 80% mortality suggests resistance. The correlation between the

mortality and experimental temperature exposure was calculated by Pearson correlation

using the statistical software package Statistical Package for Social Sciences (SPSS;

SPSS 18.0 for Windows.)

Results/ Conclusion

The results showed that all of the Ae. aegypti strains were strongly resistant to

propoxure. In contrast, most Ae. aegypti strains were susceptible to malathion, except

Nakhon sawan summer strain was resistant. With deltamethrin, all of the Ae. aegypti

strains showed incipient resistance to deltamethrin.

The results of susceptibility test of malathion, propoxure, and deltamethrin for

different Ae. aegypti strains are shown in Fig. 2.

Investigation of mosquito status and seasonal effect on insecticide susceptibility

to malathion, propoxure, and deltamethrin are given in Fig. 2. With malathion, all of

the mosquito populations in summer season were susceptible or close to susceptible

(95.33-99.33% mortality) except Nakhon sawan strain was resistant (66.33%

mortality). In the winter season, Rayong strain (72% mortality) showed less susceptible

to malathion. In the case of deltamethrin susceptibility, all of the Ae. aegypti strains of

winter and summer seasons were resistant, Nakhon sawan (37%, 41.67% mortality),

Kanchanaburi (34.67%, 40.67% mortality), Ranong (63%, 47% mortality), Rayong

(36%, 59.33% mortality). However, increasing of percent mortality to malathion of

Rayong strain was observed in the summer strain than winter strain while decreasing

of percent mortality to deltamethrin of Ranong winter strain than summer strain.

Similarly to propoxure, strong resistance was observed in all of the mosquito strains,

Nakhon sawan (19%, 8.33% mortality), Kanchanaburi (2.33%, 14.67% mortality),

Ranong (19%, 11.67% mortality), Rayong (5.67%, 18% mortality), summer strains of

Kanchanaburi and Rayong gave more percent mortality than the winter stains.



I466

In this study was found seasonal temperature have some influence on insecticide

susceptibility (Fig. 2).

Fig.2. Percent mortalities of Aedes aegypti strains to different insecticides between

winter and summer seasons

Fig. 3. Effect of temperature on insecticide susceptibility to adult female Aedes aegypti

in winter season (A, B, C) and summer season (D, E, F) (NK = Nakhon sawan, KC =

Kanchanaburi, RN = Ranong, RY = Rayong, DT = Deltamethrin, PP = Propoxure, and

ML = Malathion).

The experimentation of temperature effect on insecticide susceptibility in field

Ae. aegypti strains were estimated at 20 C, 25 C, and 30 C (Fig. 3). The mortality of all

mosquito strains to deltamethrin were found negative correlated with the temperature



I467

range tested. While, malathion and propoxure susceptibility were found positive

correlated. As a result, there were a positive correlated with temperature in both seasons

of Kanchanaburi whereas other provinces found positive correlation in some season

(see in Table 3).

Table 3. The correlation values between the mortality of mosquitoes to each insecticide

and temperature exposed.

Insecticides Seasons Sites P value Correlation value

(P < 0.05)

Deltamethrin Winter Nakhon sawan 0.004 -0.850

Kanchanaburi 0.001 -0.892

Rayong 0.000 -0.963

Ranong 0.005 -0.834

Summer Nakhon sawan 0.014 -0.776

Kanchanaburi 0.000 -0.989

Rayong 0.001 -0.904

Ranong 0.001 -0.912

Propoxure Winter Nakhon sawan 0.637 No correlation

Kanchanaburi 0.001 +0.914

Rayong 0.015 +0.772

Ranong 0.192 No correlation

Summer Nakhon sawan 0.956 No correlation


Rayong 0.129 No correlation

Ranong 0.009 +0.803

Malathion Winter Nakhon sawan 0.309 No correlation


Rayong 0.941 No correlation


Summer Nakhon sawan 0.498 No correlation


Rayong 0.019 +0.753




I468

Discussion

The management of Aedes aegypti mosquito is very important for reducing

deadly disease transmission including dengue fever, chikungunya, yellow fever, and

zika syndrome. Chemical control is a major controlling measure for vector populations

(World Health Organization, 2006). In the present study, the influence of seasonal and

the effect of three temperature levels was determined on the mortality of different

insecticides in field Aedes aegypti. In nature, mosquitoes are stimulated by varying

different types of physical environmental stresses including heat. Consequently, the

extremes of temperature caused them to develop mechanisms in order to survive in

environmental conditions. Heat stress in Ae. aegypti have been found to affect the

population dynamics and the life cycle (Mohammed et al, 2011; Simoy et al, 2015).

In this study, we examined the effect of season and temperature shock on the

insecticide susceptibility of the primary dengue vector, Ae. aegypti. Our study was

investigated to assess the effects of seasons and temperature variations to mosquito

susceptibility to current insecticides. We detected a trend of negative correlation

between the susceptibility rate and temperature on deltamethrin insecticide, vice versa

to malathion and propoxure were showed a positive trend.

The effect of temperature on physiology and other information of Ae. aegypti

mosquito was found in several studies. Carrington et al, (2013) investigated of

fluctuating versus constant temperatures effects on selected life-history traits of larval

and adult Ae. aegypti and they found the survival of immature life stage and egg

production of large diurnal temperature fluctuation range (DTR) mosquito populations

were decreased as compared with a constant temperature at 26 °C.

In the present study was used field Ae. aegypti mosquito populations of Thailand

for estimate the effect of temperature on the insecticide susceptibility. The commercial

products for household pest control in Thailand are organophosphate, pyrethroid, and

carbamate (Chareonviriyaphap et al, 2013). In this study was also found some

relationship between season and the mortality in some strain that collected from

different locations and seasons. The results of the insecticide susceptibility test during

the different seasons in the different provinces were uncertain. Nevertheless, the season

is a determinant of transmission of dengue diseases and other mosquito-borne diseases,

especially rainy season. Rainfall may increase transmission by promoting other



I469

breeding sites leads to Ae. aegypti larval increased during the rainy season as compared

with winter and summer seasons (Paul Reiter, 2001; Patz et al, 2003; Wongkoon et al,

2013). Moreover, Malar et al, (2015) studied about seasons and a population density of

mosquitoes in agro-rural areas, they found in the summer season density of Culex spp.

was higher than other seasons. Whereas for the density Armigeres and Mansonia in

winter were higher than others. The abundance of mosquito in the winter season

(December-February) more than summer season (March-May) to 3.97 fold (Malar et

al, 2015).

The mosquito-borne diseases including dengue are massive occurrence within

urban areas which in turn respond to changes in environmental stimulation especially

temperature. A combination of rainy season, high relative humidity, and appropriate

temperature leads to increase the density of insect vectors. The mortality of field Ae.

aegypti in Thailand to currently insecticides revealed a direct relationship with

temperature. The result would be helpful in planning effective pyrethroid insecticides

application for Ae. aegypti mosquito. In this result also increase understanding of how

Ae. aegypti mosquito adapts to temperature changes. Consequently, it can support the

development of the best practice management approach to control vector and help

predict dengue disease transmission.

Acknowledgement

This research was financial support by the Biodiversity-based Economy

Development Office (BEDO-NRCT 45/2558)

References

Alto, B. W., & Bettinardi, D. (2013). Temperature and dengue virus infection in

mosquitoes: independent effects on the immature and adult stages. The

American journal of tropical medicine and hygiene, 88(3), 497-505.

Carrington, L. B., Seifert, S. N., Willits, N. H., Lambrechts, L., & Scott, T. W. (2013).

Large diurnal temperature fluctuations negatively influence Aedes aegypti

(Diptera: Culicidae) life-history traits. Journal of medical entomology, 50(1),

43-51.



I470

Chareonviriyaphap, T., Bangs, M. J., Suwonkerd, W., Kongmee, M., Corbel, V., &

Ngoen-Klan, R. (2013). Review of insecticide resistance and behavioral

avoidance of vectors of human diseases in Thailand. Parasites & vectors, 6(1),

280.

Glunt, K. D., Blanford, J. I., & Paaijmans, K. P. (2013). Chemicals, climate, and

control: increasing the effectiveness of malaria vector control tools by

considering relevant temperatures. PLoS Pathog, 9(10), e1003602.

Khan, H. A. A., & Akram, W. (2014). The effect of temperature on the toxicity of

insecticides against Musca domestica L.: implications for the effective

management of diarrhea. PloS one, 9(4), e95636.

Malar, K. S., & Pandian, R. G. R. S. (2015). Influential inflicts of monsoon and

agricultural practices among the population density of mosquitoes in the agro-

rural villages of Madurai.

McMichael, A. J. (2003). Climate change and human health: risks and responses.

World Health Organization.

Mohammed, A., & Chadee, D. D. (2011). Effects of different temperature regimens on

the development of Aedes aegypti (L.)(Diptera: Culicidae) mosquitoes. Acta

tropica, 119(1), 38-43.

Patz, J. A., Githeko, A. K., McCarty, J. P., Hussein, S., Confalonieri, U., & De Wet, N.

(2003). Climate change and infectious diseases. Climate change and human

health: risks and responses, 103-132.

Polson, K. A., Brogdon, W. G., Rawlins, S. C., & Chadee, D. D. (2012). Impact of

environmental temperatures on resistance to organophosphate insecticides in

Aedes aegypti from Trinidad. Revista Panamericana de Salud Pública, 32(1),

1-8.

Reiter, P. (2001). Climate change and mosquito-borne disease. Environmental health

perspectives, 109(Suppl 1), 141.

Simoy, M. I., Simoy, M. V., & Canziani, G. A. (2015). The effect of temperature on

the population dynamics of Aedes aegypti. Ecological Modelling, 314, 100-110.

Swain, V., Seth, R. K., Mohanty, S. S., & Raghavendra, K. (2008). Effect of

temperature on development, eclosion, longevity and survivorship of



I471

malathion-resistant and malathion-susceptible strain of Culex

quinquefasciatus. Parasitology research, 103(2), 299-303.

Thanispong, K., Sathantriphop, S., & Chareonviriyaphap, T. (2008). Insecticide

resistance of Aedes aegypti and Culex quinquefasciatus in Thailand. Journal of

Pesticide Science, 33(4), 351-356.

Vargas, R. E. M., Ya-umphan, P., Phumala-Morales, N., Komalamisra, N., & Dujardin,

J. P. (2010). Climate associated size and shape changes in Aedes aegypti

(Diptera: Culicidae) populations from Thailand. Infection, Genetics and

Evolution, 10(4), 580-585.

Whiten, S. R., & Peterson, R. K. (2016). The influence of ambient temperature on the

susceptibility of Aedes aegypti (Diptera: Culicidae) to the pyrethroid insecticide

permethrin. Journal of medical entomology, 53(1), 139-143.

World Health Organization. (2009). Dengue guidelines for diagnosis, treatment,

prevention and control: new edition.

World Health Organization. (2012). Global strategy for dengue prevention and control

2012-2020.

Wongkoon, S., Jaroensutasinee, M., & Jaroensutasinee, K. (2013). Distribution,

seasonal variation & dengue transmission prediction in Sisaket,

Thailand. Indian Journal of Medical Research, 138(3), 347.



I472

Development of luciferase enhancement assay for dengue virus enhancing antibody detection Kedsara Panyasu1, Suwipa Kaewsod1, Krongkan Saipin1, Chunya Puttikhunt2, 3, Sutha Sangiambut3, Chakrit Hirunpetcharat1, Nopporn Sittisombut4, Jiraphan Junjhon1* 1Department of Microbiology, Faculty of Public Health, Mahidol University, Bangkok 10400, Thailand. 2Division of Dengue Hemorrhagic Fever Research, Department of Research and Development, Faculty of Medicine, Siriraj Hospital, Mahidol University, Bangkok 10700, Thailand. 3Medical Biotechnology Research Unit, National Center for Genetic Engineering and Biotechnology, National Science and Technology Development Agency, Bangkok 12120, Thailand. 4Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai 50200, Thailand. *Corresponding author: Jiraphan Junjhon, Department of Microbiology, Faculty of Public Health, Mahidol University, Bangkok 10400, Thailand E-mail address: [email protected] Abstract Dengue virus (DENV) burdens the public health problem globally. DENV infection causes a range of symptom from dengue fever (DF) to the severe form of the disease, dengue hemorrhagic fever (DHF) and dengue shock syndrome (DSS). DSS has been documented to associate with antibody dependent enhancement (ADE) phenomenon. Currently, enhancing antibody facilitating ADE can be detected by plaque assay or flow cytometric assay. However, these are the technical complex processes, which sometimes cause an operator-error prone manual readout. This study aimed to develop the Luc-based enhancement assay in more feasible way in K562 cells. Surface staining of FcγRII showed mean 97.97 ± 0.29 %, (n=3) in among the population of K562 cell used in this study, allowing the permissive infection condition for the developed ADE assay. The Luc-based enhancement assay was first tested for enhancing activity of antibody against DENV in comparison to the flow cytometry assay by using DENV-2, stain 16681 and single-round infectious particle reporter (Luc-SIP) at 37°C. As expected, Luc-SIP infection was peak enhanced by 4G2 at 1:40 dilution, similar to the peak enhancement observed for DENV-2 stain 16681. This result was likely implied that Luc-SIP show similar antigenicity to the naturally occurring DENV particles. Moreover, the number of virus-infected cell by flow cytometry was well correlated to the luciferase activity employed in Luc-base enhancement assay using Luc-SIP. This finding strongly ensured that our Luc-SIP could be used in replacement of conventional ADE assay. We further investigated the influence of virus breathing on the infection enhancement phenomenon by exposing virus to antibody at 4°C and 25°C. Interestingly, Luc-SIP displayed 10% lower level of peak enhancement than DENV at 4°C and 25°C by the appearance of a strong correlation of intracellular virus infection and luciferase activity in these conditions. Hence, this result brought us to the hallmark of structural conformations due to virus



I473

breathing on ADE assay. Taken together, the Luc-based enhancement assay developed in this study should be a robust method for detecting DENV enhancing antibody for diagnosis of dengue diseases. Key Words: dengue virus, enhancing antibody, ADE assay, luciferase assay Introduction DENV is enveloped, single-stranded positive-sense RNA virus, classified in the family Flaviviridae. Four different serotypes (DENV-1 to 4) have been circulated in the endemic region worldwide (Chamber et al., 1990). DENV is transmitted between people by mosquitoes called Aedes aegypti and Ae. albopictus. Diseases caused by DENV are a public health problem in many countries around the world. Almost 40% of the world population is at risk of DENV infection (Bhatt et al., 2013). The 50-100 million individuals are infected with DENV and approximately 390 million people are at risk of dengue infections per year (Bhatt et al., 2013, WHO, 2016). All four serotypes of DENV cause various disease severity in human. The majority of DENV infected patients has asymptomatic infection, while the others have the development of symptoms to DF, DHF and DSS. Primary DENV infection in human naturally occurs in person with naive DENV experience. The host immunity induced by this infection is usually life-long serotype specific but short-term cross-protection against heterotypic serotypes. An individual with secondary infection with another DENV serotype has a high risk to the severe form of the disease. Secondary heterotypic DENV infection sometimes causes the ADE phenomenon (Halstead et al., 1970). ADE occurs when the virus binds to heterotypic cross-protective antibody and then forms the complexes entering into cells via Fcγ receptor (FcγR)-mediated endocytosis. There are three main human FcγRs; FcγRI, FcγRIIa and FcγRIIb, found on myeloid cells (such as monocytes and macrophages) (Littaua et al., 1990, Rodrigo et al., 2008, Watanabe et al., 2015). These receptors relatively facilitate the uptake of IgG-bound virus immune complexes into host cells. FcγRI mediates ADE of DENV infections as shown in U937 cells (Kontny et al., 1988). In a related study, FcγRII was reported to mediate ADE of DENV infection in a human erythroleukemic cell line (K562) which has only FcγRII, more efficient at the uptake of IgG-bound DENV immune complexes (Littaua et al., 1990). Plaque assay using live viruses is currently the “gold standard” for measuring neutralizing or enhancing antibodies (Russell and Nisalak, 1967, Akihigo and Junko, 2013). This assay lacks standardize format, generating a low sample throughput to detect antibodies. ADE assay is conducted by firstly mixing the virus to an antibody of interest in different concentrations. When the incubation period is appropriate, the virus-antibody complex is formed, allowing the virus to enter the cells, where a progeny virus is generated. The number of infected cells will be then compared with no antibody condition (Olsen et al., 1992). The virus yield is determined by plaque assay (Russell and Nisalak, 1967) or flow cytometry (Boonnak et al., 2008 and 2011, Guy et al., 2004). The weakness in carrying the ADE assay for enhancing antibody detection is the requirement of labor-intensive, time-consuming and technical complex processes, which sometimes cause an operator-error prone manual readout. This study aimed to develop an ADE assay in more feasible way by using a Luc-SIP (Junjhon et al., unpublished result), so called Luc-based enhancement assay.



I474

By using the Luc-SIP model, this should also benefit the development of ADE detection assay by eliminating the possibility of losing the reporter from the viral genome while it is being replicated inside the cells. This Luc-based enhancement assay is validated using monoclonal antibodies, demonstrating well correlation to the flow cytometry assay. Objectives To develop the robust Lucia-based enhancement assay for the detection of enhancing antibody against DENV. Research Methodology

Cell lines. The mosquito cell line, C6/36 (Igarashi, 1978) and capsid (C)-expressing mosquito cell line (Sangiambut et al., 2013) were maintained in Leibovitz L-15 medium (Gibco BRL) supplemented with 10% fetal bovine serum (FBS), 2 mM L-glutamine (Gibco BRL), 0.26% tryptose phosphate broth (Sigma-Aldrich), and 100 units/ml penicillin and 100 microgram (µg)/ml streptomycin (Gibco BRL) at 29°C. African green monkey kidney epithelial cell (Vero cells) (Yasumura and Kawakita, 1963) was cultured in Minimum Essential Media (MEM) (Gibco BRL) supplemented with 10% FBS, 2 mM L-glutamine (Gibco BRL), 100 units/ml Non-Essential Amino Acids (NEAA) and 100 units/ml penicillin and 100 µg/ml streptomycin (Gibco BRL) in the presence of 5% CO2 at 37°C. The Human erythroleukemic K562 cell line (Anderson et al., 1979) was kindly provided by Dr. Bunpote Siridechadilok, Medical Biotechnology Research Unit (BIOTEC), NSTDA. The K562 cell line was grown in RPMI 1640 supplemented with 10% FBS, 2 mM L-glutamine (Gibco BRL), 100 units/ml penicillin and 100 µg/ml streptomycin (Gibco BRL) in the presence of 5% CO2 at 37°C. Antibodies. The monoclonal antibody specific to flavivirus E protein, 4G2 (Henchal et al., 1982) and the clone Cap 2 S.1 (clone 2E11), DENV NS1 antibody were kindly provided by Dr. Chunya Puttikhunt, Medical Biotechnology Research Unit (BIOTEC), NSTDA. The anti-CD32 antibody conjugated with phycoerythrin (PE), goat anti-mouse IgG antibody conjugated with Cy3, goat anti-mouse IgM antibody conjugated with Alexa Fluor 488 and goat anti-mouse IgG (H+L) antibody conjugated with alkaline phosphatase (AP), were purchased from the company (Abcam, cambridge, UK).

Virus. DENV-2 strains 16681 (Russell and Nisalak, 1967) was kindly provided by Dr. Nopporn Sittisombut, Faculty of Medicine, Chiang Mai University. The virus was propagated in C6/36 cell line in L15 medium (Gibco BRL, Grand Island, NY, USA) supplemented with 1.5% FBS, 2 mM L-glutamine (Gibco BRL), 0.26% tryptose phosphate broth (Sigma-Aldrich), and 100 units/ml penicillin and 100 µg/ml streptomycin (Gibco BRL) at 29°C for virus stock preparation used in this study.

Luc-SIP. The Luc-SIP of DENV-2 was generated previously using reverse genetic technology (Junjhon et al, unpublished result). Briefly, the plasmid pBluescript II KS (pBK) containing cDNA full-length DENV-2 (Sriburi et al., 2001) was subjected to replacement of C coding region in DENV genome with a cassette of gene encoding 38 amino acids of C protein at 5’end, followed by Lucia luciferase and 2A peptide of foot-and-mouth disease virus (FMDV2A) genes at the 3’end,



I475

generating the pBK(S1SP6-10,723)∆C_Lucia (Figure 1) (Junjhon et al, unpublished result). The resulting plasmid was used as the template for in vitro RNA synthesis and the transcribed RNA was transfected into C-expressing cells via Lipofectamine 3000 (Invitrogen, Carlsbad, CA, USA) to produce the Luc-SIP. This Luc-SIP can replicate within the cells for a single cycle due to depletion of C gene from its genome. However, amplification of Luc-SIP stock for used in all experiments was done in the C-expressing cell, where it can generate multiple rounds of infection.

Figure 1. Diagram of Luc-SIP generated from plasmid pBK(SISP6-10,723) ΔC_Lucia by transfection into the C-expressing C6/36 cells.

Focus immunoassay titration. The focus immunoassay titration was employed to determine the infectious titer of DENV-2, strain 16681 and Luc-SIP. Virus samples were serially diluted in a 10-fold steps with 2% FBS-MEM medium and 50 µl of each virus dilutions were added onto Vero cells seeded in a 96-well plate. After 2 hr of incubation at 37°C with the presence of 5% CO2, 125 µl of 1.5% carboxymethyl cellulose (CMC) in 4% FBS-MEM medium was added onto the cells to restrict the area of infected cells and the plate was further incubated at 37°C, 5% CO2 for 48 hr. Then, monolayers of infected cells were fixed with 3.7% formaldehyde in phosphate buffered saline (PBS) and permeabilized with 2% Triton X-100 in PBS.

In vitro transcription

FMV

D2A

C38 SP6

Lucia prME

pBK(S1SP6-10723)∆C_Lucia

NS1 2A 2B NS3 4A 4B NS5

Amp.

FMV

D2A

C38

Lucia prME NS1 2A 2B NS3 4A 4B NS5 3’UTP 5’UTP

CAP

RNA

Luc-SIP

Lucia luciferase

C-expressing C6/36 cells

Transfect



I476

After permeabilization, the infected cells were reacted with 4G2 antibody at 37°C for 1 hr followed by the AP-conjugated goat anti-mouse IgG (H+L) antibody (Abcam, Cambridge, UK). The signal of infected cells was observed by the catalytic reaction of AP to its chromogenic substrate [5-bromo-4-chloro-3'-indolyphosphate p-toluidine salt (BCIP) and nitroblue tetrazolium chloride (NBT)], generating the dark purple spots. The virus titer was calculated from the spots number and expressed as focus-forming unit (FFU) per ml.

Luciferase activity assay. To investigate whether the luciferase enzyme was derived by Luc-SIP replication, the luciferase activity assay was employed. The 50 µl of Luc-SIP infected culture supernatant was mixed with equal amount of QUANTI-Luc substrate in a 96-well OptiplateTM and the luciferase signal was read promptly by the VICTORTM X series multilabel plate reader. The luciferase activity derived from the ADE experiments was also carried out as the procedure described above. ADE assay. The Luc-based enhancement assay was developed in comparison to the conventional ADE assay using flow cytometry. Initially, the amount of input virus for ADE experiment was investigated to obtain the ADE background level. DENV-2, strain 16681 or Luc-SIP was used to infect C6/36 cells and K562 cells at MOI of 0.001, 0.05 and 0.1 in a 24-well plate. After 48 hr of incubation at 29°C for C6/36 cells and 37°C with 5% CO2 for K562 cells, the infected cells were washed and determined the infection by intracellular staining and flow cytometric assay. To test whether Luc-SIP particles display similar antigenicity to DENV particles in Luc-based enhancement assay, a 4G2 MAb was used for comparison the enhancing activity. DENV-2, strain 16681 and Luc-SIP were reacted with the 4-fold serial dilutions of 4G2 MAb from 1:10 to 1:10,240 at 37°C for 1 hr. The particle-antibody complex was then allowed to infect K562 cells in 24-well plate for another 2 hr at 37°C. To remove excess complex, the cells were washed with 2% FBS-RPMI medium by centrifugation at 900 g for 3 min and the cells were transferred into 24-well plates, incubated for an additional 48 hr. The culture supernatant was collected for luciferase activity assay and the infected cells were analyzed by flow cytometry. The enhancing activity was evaluated by subtracting the percentage of infected cells or RLU value from cells harboring antibody-virus complex with the cells harboring virus alone. In addition, the Luc-based enhancement assay was set up at 4°C and 25°C to examine the effect of virus breathing on antibody binding. The enhancing activity was compared to the luciferase activity and intracellular infection obtained at 37°C.

Flow cytometry assay. To ensure the expression of FcγRII on K562 cells for ADE test, the cells were subjected to surface staining by flow cytometry assay. The 1×106 of K562 cells were fixed with 4% formaldehyde in PBS at 4°C for 20 min. After washing the cells with PBS for 2 times, cells were stained with anti-CD32 antibody conjugated with PE (Abcam, Cambridge, UK) at 5 µg/ml in PBS at 4°C for 45 min in the dark. After final wash with 2% FBS-PBS for 2 times, the fluorescence-activated cell were analyzed by performing data acquisition on a Flow Sight® Imaging Flow Cytometer. The data of FcγRII expression was acquired from 3 independent experiments.

For the ADE experiment, percentage of virus infected K562 cells was determined by intracellular staining and flow cytometry assay. Cells were fixed with 4% formaldehyde at 4°C for 15 min followed by permeabilization with 0.5% Triton



I477

X-100 in PBS at 4°C for 10 min. After the washing steps to remove Triton X-100, cells were stained intracellularly with 2E11 or 4G2 MAbs at 4°C for 45 min in the dark. To develop the fluorescent signal, the cells were washed 2 times with 0.2% Tween 20 in PBS before reacting with goat anti-mouse IgM conjugated with Alexa Fluor 488 or goat anti-mouse IgG conjugated with Cy3 at 4°C for 45 min in the dark. The signal of infected cells was analyzed by performing data acquisition on a Flow Sight® Imaging Flow Cytometer. Result Dominant expression of FcγRII on K562 cells

Surface staining of FcγRII on K562 cells was performed to ensure the presence of cell receptors facilitating irregular DENV infection pathway by ADE mechanism. A total of 1×106 K562 cells were stained with anti-CD32 antibody conjugated with PE and the signal of FcγRII expression on the cell surface was detected by Flow Sight® Imaging Flow Cytometer. The yellow fluorescent signal from PE was observed on the CD32 positive cells (Figure 2A) with the fluorescent intensity greater than 1×103 (Figure 2B), whereas CD32 negative cells expressed lower PE signal than that of the positive cells (Figure 2B). A total of 1×104 gated single cells examined for FcγRII expression displayed mean 97.97 ± 0.29 %, (n=3) of CD32 positive cell, suggesting major population of K562 cell in this study can be served as the permissive target for DENV infection by ADE mechanism.

Figure 2. Flow cytometry analysis of FcγRII expression on K562 cells. A) Appearance of K562 cells stained with PE-conjugated anti-CD32 antibody. B) Scatter plot of gated single cell displayed CD32 positive (yellow dot) and negative (blue dot). The data was acquired from 3 independent experiments. Optimal virus input for Luc-based enhancement assay

K562 cell is the permissive target for DENV infection via antibody-dependent pathway. Thus, DENV infection in the absence of antibody was investigated to set the base line level for ADE assay in this cell line. The amount of DENV-2 strain 16681 ranges from MOI of 0.001, 0.05 and 0.1 was used to infect K562 cells and the level of virus infection was examined by intracellular staining with anti-DENV antibodies and analyzed by flow cytometer. DENV infection was not observed in K562 cells at the

97.97% 2.03%

Asp

ect R

atio

Brig

htfie

ld

Intensity CD32

B

Positive

Brightfield CD32

Negative

A



I478

MOI of 0.001, similar to the mock control. When increased the MOI to 0.05 and 0.1, virus infection was slightly increased to 1.13% and 3.11%, respectively (Figure 3). However, this result was contradictory to the level of DENV infection in C6/36 cells, where the peak of virus infection was greater to 43.15% at MOI of 0.1 (Figure 3). This result strongly confirmed that K562 cell is not a natural permissive host for DENV infection. The MOI of 0.05 and 0.1 provided a significant different of virus infection in between K562 cells and C6/36 cells, suggesting the appropriate virus input for the Luc-based enhancement assay developed in this study.

Figure 3. Flow cytometry analysis of DENV infection in K562 cells and C6/36 cells. MOI of 0.001, 0.05 and 0.1 was used to determine the optimal virus input for K562 infection for further development of Luc-based enhancement assay. C6/36 cell infection was used as the positive control. Percentage of virus infection was obtained by intracellular straining of infected cells with DENV specific antibodies and counted by flow cytometer. Error bars indicate the standard deviations from two independent experiments.

Luc-SIP showed similar antigenic property to naturally occurring DENV particles Luc-SIP was genetic engineered to enclose the partial DENV genome linked with Lucia luciferase gene, which is differed from the natural DENV genome. To test whether this difference lead to structural organization changes of the viral antigens, prM and E proteins on the surface of Luc-SIP, DENV antibody enhancement assay was performed in comparison to DENV particles derived from the parental strain virus.

The MOI of 0.1 of DENV-2, stain 16681 and Luc-SIP were exposed to the four-fold serial dilutions of 4G2 antibody and measured the infection enhancement activity by flow cytometry and luciferase activity assay. At the baseline control (Ab absence), intracellular infection in K562 cells was 5.83% for Luc-SIP and 1.02% for DENV-2, 16681. In the presence of anti-E antibody, the peak enhancement was 36.42% for Luc-SIP which closely similar to DENV-2, 16681 (41.13%) (Figure 4A). This result implied that Luc-SIP had relatively similar antigenic epitope to live DENV particles. A well correlation of luciferase activity to the level of virus infection in all concentrations of the antibody tested was also observed (Figure 5A). A peak enhancement of luciferase activity was found at a concentration antibody of 1:40



I479

(823,951 RLU) as compared to K562 cells infected with Luc-SIP in the absence of 4G2 antibody (104,907 RLU) (Figure 5A). A strong linear correlation (R2>0.99) was observed when the luciferase activity form Luc-SIP was plotted against the percentage of virus infection (Figure 5B).

Figure 4. ADE assay by flow cytometry and Luc-based enhancement assay. A) DENV-2, strain 16681 and Luc-SIP were exposed to 4G2 antibody at 37°C. B) 4°C, C) 25°C. D) Intracellular infection from DENV-2, 16681 plotted for 4°C, 25°C, and 37°C. E) Intracellular infection from Luc-SIP, strain 16681 plotted for 4°C, 25°C, and 37°C. Error bars indicate the standard deviations from two independent experiment, dashed line; base line of Luc-SIP (upper panel) and base line of DENV-2, 16681 (lower panel). Temperature-dependent enhancement of Luc-SIP by DENV antibody DENV particle is dynamic and the structural organization of surface protein is altered dependent upon temperature conditions so called “breathing” (Ansarah-Sobrinho et al., 2008). We therefore tested this effect on Luc-SIP indirectly by exposing the particles to 4G2 antibody at 4°C and 25°C in parallel to DENV-2, strain 16681 particles. Interestingly, there was 22.19% and 23.33% of intracellular infection enhancement by Luc-SIP at 4°C and 25°C, respectively (Figure 4B-C). This was 14.23% and 13.09% lower than that of the enhancement of infection detected for Luc-SIP at 37°C (Figure 5E). The similar result was found when tested with the DENV-2, 16681 in which the enhancement of infection was 16.88% and 16.96% for 4°C and 25°C, respectively (Figure 4B-C). Thus, there was 24.25% and 24.17% less than what observed at 37°C (Figure 5D). By using Luc-based enhancement assay, we confirmed that the peak virus enhancement expressed as the intracellular virus infection was well correlated with the peak luciferase activity (603,782 RLU for 4°C and 395,366 RLU for 25°C) (Figure 5A, 5C, 5E) and both values displayed a well linear relationship at all temperature tested (R2 = 0.97 for both 4 °C and 25 °C) (Figure 5B, 5D, 5F).

05

101520253035404550

Infe

ctio

n (%

)

Antibody dilution

37°C

DENV-2 16681Luc-SIP

Base line of Luc-SIP Base line of DENV-2 16681

0

5

10

15

20

25

30

35

40

45

50

Infe

ctio

n (%

)

Antibody dilution

4°C DENV-2 16681Luc-SIP


05

101520253035404550

Infe

ctio

n (%

)

Antibody dilution

25°C DENV-2 16681Luc-SIP


05

101520253035404550

Infe

ctio

n (%

)

Antibody dilution

DENV-2 16681 infection 4°C25°C37°C

05

101520253035404550

Infe

ctio

n (%

)

Antibody dilution

Luc-SIP infection 4°C25°C37°C

B C

D E

A



I480

Figure 5. Enhancement of Luc-SIP infection at different temperatures. A, C, E) Intracelluar infection enhancement and luciferase activity enhancement of Luc-SIP when tested at 37°C, 4°C , 25°C, respectively B, D, F) Linear regression analysis of infection enhancement and luciferase activity enhancement of Luc-SIP at 37°C, 4°C, 25°C, respectively. Discussion

Secondary infection with another DENV serotype may lead to infection by enhancing antibody, which is believed to be a factor in promoting the DENV replication in monocyte (Halstead. 1970). ADE assay is the functional antibody testing method for enhancing antibody detection in flavivirus. A test is conducted by first exposing the virus of interest to antibody at different levels of concentration or to an appropriate antibody-serum. After an appropriate period of incubation, progeny virus yield or number of infected cells are determined and compared. Basically, yield of viral progeny increases when cells exposed to virus-antibody mixture (Halstead and O’Rourke, 1977). The viral yield can be detected by plaque assay (Russell and Nisalak, 1967), the IgG/IgG ELISA (Burk and Nisalak, 1982, Kuno et al., 1991,

0

5

10

15

20

25

30

35

40

45

50

0

100,000

200,000

300,000

400,000

500,000

600,000

700,000

800,000

900,000

1,000,000

Infection (%)

Luci

fera

se a

ctiv

ity (R

LU)

Antibody dilution

37°C Luciferase activity

Luc-SIP infection

Base line control

y = 18637x + 18949 R² = 0.9943

0

100,000

200,000

300,000

400,000

500,000

600,000

700,000

800,000

900,000

1,000,000

0 5 10 15 20 25 30 35 40 45 50

Luci

fera

se a

ctiv

ity (R

LU)

Luc-SIP infection (%)

37°C

y = 15755x + 54562 R² = 0.9731

0

100,000

200,000

300,000

400,000

500,000

600,000

700,000

800,000

900,000

1,000,000

0 5 10 15 20 25 30 35 40 45 50

Luci

fera

se a

ctiv

ity (R

LU)


4°C

0

5

10

15

20

25

30

35

40

45

50

0

100,000

200,000

300,000

400,000

500,000

600,000

700,000

800,000

900,000

1,000,000

Infection (%)

Luci

fera

se a

ctiv

ity (R

LU)

Antibody dilution


Luc-SIP infection

Base line control

y = 21278x - 27634 R² = 0.976

0

100,000

200,000

300,000

400,000

500,000

600,000

700,000

800,000

900,000

1,000,000

0 5 10 15 20 25 30 35 40 45 50

Luci

fera

se a

ctiv

ity (R

LU)


25°C

0

5

10

15

20

25

30

35

40

45

50

0

100,000

200,000

300,000

400,000

500,000

600,000

700,000

800,000

900,000

1,000,000

Infection (%)

Luci

fera

se a

ctiv

ity (R

LU)

Antibody dilution


Luc-SIP infection

Base line control

A B

C D

E F



I481

Cardosa et al., 1992) or fluorescence in situ hybridization (Olsen, 1992). The plaque assay used for measurement of enhancing antibody by observing the presence of antibody that causes the virus to multiply within the cell (Kliks et al., 1989) using live viruses is currently the “gold standard” for measuring neutralizing or enhancing antibodies (Goncalvez et al., 2007). Later development of virus infection was done by flow cytometry (Guy et al., 2004, Boonnak et al., 2008 and 2011, Alwis et al., 2014, Mukkherjee et al., 2014, Dejnirattisai et al., 2010). The dengue virus reporter is developed as a robust tool for measuring dengue infection by labeling the virus with the luciferase enzyme or green fluorescent protein (GFP) (Zou et al., 2011, Song et al., 2014). It is capable of measuring fluorescence or enzyme activity to indicate the ability of virus replication within the cells. This method can detect enhancing antibodies more quickly. Recently, Song et al., 2014 developed a stable Renilla luciferase reporter DENV (Luc-DENV) and tested with various known monoclonal antibodies (MAbs) and clinical sample from infected patient for measuring neutralization and ADE assay against DENV. Infection rate and progeny viral yield was measured on FcγR expressing K562 cells, which have increased the degree of ADE of DENV infection by human anti-DENV antibody. However, this method is technically complex, as the lysis of infected cells is required for Luc-based enhancement assay.

Development of Luc-based enhancement assay in our study is more feasible by using a Luc-SIP (Junjhon et al., unpublished results), which provides the flash light signal in a long period of detection time by the activity of Lucia luciferase enzyme. The benefit of using Luc-SIP is that it generates a single cycle of replication within the cells due to depletion of C gene from its genome; therefore it has no safety concern. The K562 cells used to develop the Luc-based enhancement assay was previously described to demonstrate that virus entry during ADE infection of FcγRII-expressing cell by virus-Ab complexes (Littaua et al., 1990, Rodrigo et al., 2009, Chawla et al., 2013, Chotiwan et al., 2014). We showed here in our study that K562 cell is the unusual permissive cell for DENV infection unless the presence of enhancing antibody (Figure 2).

Luc-based enhancement assay demonstrated enhanced infection of DENV-2, strain 16681 and Luc-SIP in the presence of similar amount of 4G2 MAb in K562 cell (Figure 4A-C). This firmly ensured the similar antigenic property of Luc-SIP and DENV-2, 16681 and therefore it can be replace each other for DENV antibody detection. Production of infectious DENV-2, stain 16681 and Luc-SIP via enhancing antibody was also the temperature-dependent; the yield of infectious Luc-SIP and DENV at 37°C was significantly reduced when compared to experiment conducted at lower temperatures (Figure 4A-C). This result agreed well with the previous finding (Ansarah-Sobrinho et al., 2008). The flow cytometry assay determined the infection of Luc-SIP within the cells in various temperature conditions, whereas the Luc-based enhancement assay described in this study determined the luciferase activity. Linear correlation was established between the Luc-SIP infection and luciferase activity from Lucia luciferase enzyme released into the K562 cell culture supernatant (Figure 5). Thus, the development of Luc-based enhancement assay is comparable to the conventional flow cytometry assay. Moreover, our developed assay has more advantages. It allows easy reading, reliable, more consistency and time saving. The Luc-based enhancement assay developed in this study should be robust and useful



I482

tool to detect the enhancing antibody in all DENV research areas, particularly the DENV vaccine trial where numerous samples are required to test.

Conclusion Development of Lucia-based enhancement assay for the detection of enhancing antibody against DENV by using Luc-SIP model demonstrated that Luc-SIP had similar antigenic property to the parental strain of DENV-2, strain 16681, when tested the enhancing property of the well-characterized anti-E 4G2 MAb. In addition, we demonstrated that temperature-dependent binding of Luc-SIP by DENV antibody and found that the highest expression of E protein inside the cell in 37°C, normal human body temperature. Further assay is to validate the test with DENV-infected serum to make sure it is applicable for dengue diagnosis. Therefore, this developed method will be helpful for laboratory detection and epidemiological investigation for DENV antibodies.

References Akihigo M and Junko M. (2013). “Review of diagnostic plaque reduction

neutralization tests for flavivirus infection.” Vet J, 195(1): 33-40. Alwis RD, Williams KL, Schmid MA, Lai CY, Patel, Smith SA, et al. (2014).

“Dengue viruses are enhanced by distinct populations of serotype cross-reactive antibodies in human immune sera.” PLoS Pathogens, 10(10).

Anderson LC, Nilsson K and Gahmberg CG. (1979). “K562 A Human erythroleukemic cell line.” Int J Cancer, 23(2): 143-7.

Ansarah-Sobrinho C, Nelson S, Jost CA, Whitehead SS and Pierson TC. (2008). “Temperature-dependent production of pseudoinfectious dengue reporter virus particles by complementation.” Virology, 381(1): 67-74.

Bhatt S, Gething PW, Brady OJ, Messina JP, Farlow AW, Moyes CL, et al. (2013). “The global distribution and burden of dengue.” Nature, 496(7446): 504-7 .

Bokisch VA, Top FH Jr, Russell PK, Dixon FJ and Muller-Eberhard HJ. (1973). “The potential pathogenic role of complement in dengue hemorrhagic shock syndrome.” N Eng J Eng J Med, 289(19): 996-1000.

Boonnak K, Slike BM, Burgess TH, Mason RM, Wu SJ, Sun P, et al. (2008). “Role of dendritic cells in antibody-dependent enhancement of dengue virus infection.” J Virol, 82(8): 3939-51.

Boonnak K, Dambach KM, Donofrio GC, Tassaneetrithep B and Marovich MA. (2011). “Cell Type Specificity and Host Genetic Polymorphisms Influence Antibody-Dependent Enhancement of Dengue Virus Infection.” J Virol, 85(4): 1671-83.

Burk DS, Nisalak A and Gentry MK. (1982). “Antibody capture immunoassay detection of Japanese encephalitis virus immunoglobulin M and G antibodies in cerebrospinal fluid.” J Clin Microbiol, 16(6): 1034-42.

Cardosa MJ, Tio PH, Nimmannitya S, Nisalak A and Innis B. (1992). “IgM capture ELISA for detection of IgM antibodies to dengue virus: comparison of 2 formats using hemagglutinins and cell culture derived antigens.” Southeast Asian J Trop Med Public Health, 23(4): 726-9.



I483

Chamber TJ, Hahn CS, Galler R and Rice CM. (1990). “Flavivirus genome organization, expression and replication.” Annu Rev Microbiol, 44(1): 649-88.

Dejnirattisai W, Jumnainsong A, Onsirisakul N, Fitton P, Vasanawathana S, Limpitikul W, et al. (2010). “Cross-reactive antibodies enhance dengue virus infection in humans.” Science, 328(1): 745-8.

Goncalvez AP, Engle RE, St Claire M, Purcell RH and Lai CJ. (2007). “Monoclonal antibody-mediated enhancement of dengue virus infection in vitro and in vivo and strategies for prevention.” Proc Natl Acad Sci, 104(22): 9422-7.

Guy B, Chanthavanich P, Gimeneza S, Sirivichayakul C, Sabchareon A, Begue S, et al. (2004). “Evaluation by flow cytometry of antibody-dependent enhancement (ADE) of dengue infection by sera from Thai children immunized with a live-attenuated tetravalent dengue vaccine.” Vaccine, 22(27-28): 3563-74.

Halstead SB, Nimmannitya S and Cohen SN. (1970). “Observations related to pathogenesis of dengue hemorrhagic fever, IV. Relation of disease severity to antibody response and virus recovered.” Yale J Biol Med, 42(1): 311-28.

Halstead SB and O’Rourke EJ. (1977). “Dengue viruses and mononuclear phagocytes, I. Infection enhancement by non-neutralizing antibody.” J Exp Med, 146(1): 201-17.

Henchal EA, Gentry MK, McCown JM and Brandt WE. (1982). “Dengue virus-specific and flavivirus group determinants identified with monoclonal antibodies by indirect immunofluorescence.” Am J Trop Med Hyg, 31(4): 830-6.

Igarashi A. (1978). “Isolation of a Singh's Aedes albopictus cell clone sensitive to dengue and chikungunya viruses.” J Gen Virol, 40(3): 531-44.

Kliks SC, Nisalak A, Brandt WE, Wahl L and Burke D. (1989). “Antibody-dependent enhancement of dengue virus growth in human monocytes as a risk factor for dengue hemorrhagic fever.” Am J Trop Med Hyg, 40(4): 444–51.

Kontny U, Kurane I and Ennis FA. (1988). “Gamma interferon augments Fcγ receptor mediated dengue virus infection of human monocytic cells.” J Virol, 62(11): 3928-33.

Kou Z, Quinn M, Chen H, Rodrigo WW, Rose RC, Schlesinger JJ, et al. (2008). “Monocytes, but not T or B cells, are the principal target cells for dengue virus (DV) infection among human peripheral blood mononuclear cells.” J Med Viral, 80(1): 134-46.

Kuno G, Gomez I and Gubler DJ. (1991). “An ELISA procedure for the diagnosis of dengue infection.” J Virol Methods, 33(1-2): 101-13.

Littaua R, Kurane I and Ennis FA. (1990). “Human IgG Fc receptor II mediates antibody-dependent enhancement of dengue virus infection.” J Immunol, 144(8): 3183-6.

Mukherjee S, Pierson TC and Dowd KA. (2014). “Pseudo-infectious reporter virus particles for measuring antibody-mediated neutralization and enhancement of dengue virus infection.” In Dengue: Methods and Protocols, Methods in Molecular Biology, 75-97. Edited by



I484

Radhakrishnan Padmanabhan and Subhash G. Vasudevan. Spring New York Heidelberg Dordrecht London.

Olsen CW, Corapi WV, Ngichabe CK, Baines JD and Scott FW. (1992). “Monoclonal antibodies to the spike protein of feline infectious peritonitis virus mediate antibody-dependent enhancement of infection of feline macrophages.” J Virol, 66(2): 956-65.

Rodrigo WW, Jin X, Blackley SD, Rose RC and Schlesinger JJ. (2006). “Differential enhancement of dengue virus immune complex infectivity mediated by signaling-competent and signaling-incompetent human FcγRIA (CD64) or FcγRIIA (CD32).” J Virol, 80(20): 10128-38.

Russell PK and Nisalak A. (1967). “Dengue virus identification by the plaque reduction neutralization test.” J Immunol, 99(2): 291-6.

Sangiambut S, Suphatrakul A, Sriburi R, Keelapang P, Puttikhunt C, Kasinrerk W, et al. (2013). “Sustained replication of dengue pseudo-infectious virus lacking the capsid gene by trans-complementation in capsid-producing mosquito cells.” Virus Research, 174(1-2): 37-46.

Sriburi R, Keelapang P, Duangchinda T, Pruksakorn S, Maneekarn N, Malasit P and Sittisombut N. (2001). “Construction of infectious dengue 2 virus cDNA clones using high copy number plasmid.” J Virol Methods, 92(1): 71-82.

Song KY, Zhao H, Jiang ZY, Li XF, Deng YQ, Jiang T, et al. (2014). “A novel reporter system for neutralizing and enhancing antibody assay against dengue virus.” BMC Microbiology, 14(1).

Watanabe S, Chan KW, Wang J, Rivino L, Lok SM and Vasudevan SG. (2015). “Dengue virus infection with highly neutralizing levels of cross-reactive antibodies causes acute lethal small intestinal pathology without a high level of viremia in mice.” J Virol, 89(11): 5847-61.

WHO. (1997). “Dengue hemorrhagic fever: diagnosis, treatment prevention and control.” Accessed February 20, 2017. Available from http://apps.who. int/iris/ bitstream/ 10665/41988/1/9241545003_eng.pdf.

WHO. (2016). “Dengue and severe dengue.” Accessed January 10, 2017. Available from http://www.who.int/mediacentre /factsheets/fs117/en/.

Yasumura Y and Kawakita M. (1963). “The research for the SV40 by means of tissue culture technique.” Nippon Rinsho, 21(6): 1201–19.

Zou G, Xu HY, Qing M, Wang QY and Shi PY. (2011). “Development and characterization of a stable luciferase dengue virus for high-throughput screening.”Antiviral Res, 91(1): 11-19.



I485

Title: Preliminary Evaluation of the Anti-inflammatory Effect of Wannachawee

Recipe in Rats

Author: Sirawipak Thankanjanatorn1, 2

, Parirat Khonsung1, Ampai Panthong

3,

Seewaboon Sireeratawong1, Natthakarn Chiranthanut

1, Puongtip Kunanusorn

1,

Ariyaphong Wongnoppavich4

1Department of Pharmacology, Faculty of Medicine, Chiang Mai University, Chiang

Mai. 2Student in Graduate School Chiang Mai University, Department of

Pharmacology, Faculty of Medicine, Chiang Mai University, Chiang Mai. 3Department of Pharmacology and Center for Innovation in Chemistry, Faculty of

Medicine, Chiang Mai University, Chiang Mai. 4Department of Biochemistry,

Faculty of Medicine, Chiang Mai University, Chiang Mai.

Abstract

Wannachawee recipe is a Thai herbal medicine recipe which is often used

to treat psoriasis. It consists of eight Thai herb including kha, khao yen tai, khao yen

nuea thai, ngueak plaa mo, thong pan chang, non tai tak, hua ta pead, and khao yen

neua jeen. The primary pharmacological effects of these herbs include anti-

inflammation, anticancer and antimicrobial activity. This study evaluated the anti-

inflammatory effect of Wannachawee recipe in animal models. Application of the

water extract of Wannachawee recipe (WRE) to the ears of rats (2 mg/ear)

significantly reduced ear edema thickness induced by ethyl phenylpropiolate (EPP).

The reduction was similar to that with ibuprofen (1 mg/ear) at all evaluation times. In

addition, the paw edema volume tended to decrease in rats which received WRE at a

dose of 500 mg/kg, P.O. in a carrageenan-induced paw edema model. This study

showed that Wannachawee recipe exhibits anti-inflammatory effect in animals.

Keywords: Anti-inflammatory effect, Carrageenan, EPP, Wannachawee recipe

Introduction

Inflammation is a first-line body defense response to cell injury. The

response is the same irrespective of the nature of the agent of cell injury, whether

physical, chemical, ischemic or infectious [1]. In the inflamed vascularized areas, a

group of easily observable characteristics appear: redness, heat, swelling and pain

[2]. There are two major types of inflammation: acute and chronic. Acute

inflammation is a combination of vascular and cellular responses characterized by an

easily recognizable set of localized clinical manifestations such as redness, swelling,

and pain. The response of acute inflammation is short duration and continues only

until the immediate threat to the host is eliminated. This response begins immediately

after cellular injury or infection occur which that involves a vascular response,

activation of plasma protein systems, and activation of a variety of cells. This usually



I486

takes 8 to 10 days from onset to healing. The exemplary vascular response is

vasodilation which involves with the releasing of prostaglandins and histamine on the

injury area. Chronic inflammation can continue for two weeks or more. The

physiological and histological characteristics of chronic inflammation are

indistinguishable from the acute response. Inflammation is related to and a cause of

diseases such as colitis, arthritis, and psoriasis [1].

Currently, nonsteroidal anti-inflammatory drugs (NSAIDs) such as

diclofenac, indomethacin, and ibuprofen are often used to treat inflammatory

disorders but side effects from those drugs often occur in the gastrointestinal (GI)

tract and in the kidneys [3]. Thai herbs or Thai herbal medicine recipes which have

been used to treat inflammation include kha, curcumin, phlai, and Sahatara recipe.

These herbs do not produce side effects in GI tract [4].

Wannachawee recipe is Thai herbal medicine recipe which is often used to

treat psoriasis at Prapokklao Hospital, Chanthaburi Province, Thailand. The recipe

consists of eight Thai herbs including kha, khao yen tai, khao yen nuea thai, ngueak

plaa mo, thong pan chang, non tai yak, hua ta pead, and khao yen neua jeen. They

have been reported to have primary pharmacological effects such as anti-

inflammation, anticancer and antimicrobial activity [5-16]. However, there have been

no reports of laboratory research on the anti-inflammatory effects of Wannachawee

recipe. The current study aimed to conduct a preliminary evaluation of the anti-

inflammatory effects of Wannachawee recipe in animal models.

Objectives

The main objective of this study was to evaluate the anti-inflammatory

effects of Wannachawee recipe in animal models.


Extract preparation Wannachawee recipe extract was prepared at Prapokklao Hospital,

Chanthaburi Province, Thailand. Raw materials were identified by Assoc. Prof.

Noppamas Soonthornchareonnon. All samples of the herbs were stored in the

Department of Pharmacognosy at the Faculty of Pharmacy, Mahidol University. The

recipe was extracted with water and yielded about 12% by weight. The extract was

designated WRE.

Experimental Animals

Male Sprague Dawley rats were obtained from the National Laboratory

Animal Center, Mahidol University (Salaya), Nakorn Pathom, Thailand. All animals

were kept in a room at controlled conditions of 24±1°C and 12 h light/12 h dark cycle.



I487

All experiments were approved by the Animal Ethics Committee of the Faculty of

Medicine, Chiang Mai University, Thailand.

Anti-Inflammatory Study

Ethyl phenylpropiolate (EPP)-induced ear edema in rats [17, 18]

Six male rats (40-60 g) were divided into 3 groups of 2 animals each (n=4

ears per group). Each group received acetone (control group), ibuprofen 1 mg/ear or

WRE 2 mg/ear. Ear edema was induced by EPP (50 mg in 1 mL of acetone)

application on the inner and outer surfaces of both ears. The substances were smeared

on the same area just before applying EPP. Ear edema was measured using a digital

Vernier caliper before application and at 15, 30, 60, and 120 min after EPP

application. The results are expressed as percentage ear edema inhibition.

Carrageenan-induced hind paw edema in rats [19]

Nine male rats (100-120 g.) were divided into 3 groups of 3 animals each

(control group, ibuprofen 100 mg/kg, and WRE 500 mg/kg). They were orally

administered either distilled water, ibuprofen, or WRE 1 h prior to intradermal

injection of carrageenan at the right hind paw (1% w/v in NSS, 0.05 mL/paw). Paw

edema was measured using a Plethysmometer before injecting and at 1, 3, and 5 h

after carrageenan injection.

Statistical Analysis

The results were expressed as mean ± standard error of mean (S.E.M).

Statistical comparison between groups was analyzed using one way analysis of

variance (ANOVA) and the post hoc least-significant difference (LSD) tests (SPSS

statistical software version 22.0). P values < 0.05 were determined statistically

significant.

Results/ Conclusions

Ethyl phenylpropiolate (EPP)-induced ear edema in rats

Ear edema was elevated maximally at 120 min after application of EPP in

the control group. The Ibuprofen (1 mg/ear) and the WRE (2 mg/ear) groups had

significantly reduced ear edema thickness compared to the control group at all

evaluation times (Figure 1). At 60 min, the percentage ear edema inhibition in WRE

group was higher than that of the Ibuprofen group (92.86% and 76.19%) (Figure 2).



I488

Figure 1. Effect of ibuprofen and WRE on EPP-induced ear edema

0.00

0.05

0.10

0.15

0.20

0.25

15 30 60 120

Ed

ema

th

ick

nes

s (µ

m)

Time (min)

Control

Ibuprofen 1 mg/ear

WRE 2 mg/ear

*Significantly different from the control group, p < 0.05 (n = 4).

Figure 2. Percentage of ear edema inhibition of ibuprofen and WRE on EPP-

induced ear edema

36.36

56.52

76.1978.65

0.00

39.13

92.86

73.03

0.00

10.00

20.00

30.00

40.00

50.00

60.00

70.00

80.00

90.00

100.00

15 30 60 120

Per

cen

tag

e o

f E

ar

Ed

ema

in

hib

itio

n

Time (min)

Ibuprofen 1 mg/ear

WRE 2 mg/ear

*

* *

*

*

* *

*



I489

Carrageenan-induced hind paw edema in rats

Hind paw edema reach a maximum at 5 h after carrageenan injection in the

control group. Rats which received ibuprofen (100 mg/kg) or WRE (500 mg/kg) had

decreased paw edema volumes at all evaluation times, but the differences were not

statistically significantly different from the control group (Figure 3). The percentage

of paw edema inhibition in rats which received ibuprofen or WRE was increased in

time dependent manner (Figure 4).

Figure 3. Effect of ibuprofen and WRE on carrageenan-induced hind paw edema

0.00

0.20

0.40

0.60

0.80

1.00

1 3 5

Ed

ema

vo

lum

e (m

l)

Time (h)

Control

Ibuprofen 100 mg/kg

WRE 500 mg/kg

Figure 4. Percentage of paw edema inhibition of ibuprofen and WRE on

carrageenan-induced hind paw edema

22.11

53.82

74.29

11.58

34.38

60.82

0.00

10.00

20.00

30.00

40.00

50.00

60.00

70.00

80.00

90.00

100.00

1 3 5

Per

cen

tage

og P

aw

Ed

ema i

nh

ibit

ion

Time (hr)

Ibuprofen 100 mg/kg

WRE 500 mg/kg



I490

Discussion

The results of this study found that Wannachawee recipe (WRE) had an

efficient anti-inflammatory effect on the acute phase of inflammation. EPP-induced

ear edema in rats is a common model for screening and evaluating the anti-

inflammatory activity of test substances on the acute phase of inflammation and

related instantaneous irritation which brings about an increase in fluid and edema. The

mediators of inflammation in this model were histamine, serotonin, bradykinin and

prostaglandins (PGs). These mediators are capable of promoting vasodilatation and

increasing vascular permeability which increase edema [17, 18]. In the present study,

the WRE group (2 mg/ear) showed a significant reduction of ear edema thickness at

all evaluation times which were similar to the ibuprofen group (1 mg/ear). At 60 min,

WRE showed a percentage ear edema inhibition higher than the ibuprofen group. This

suggests that WRE possesses efficient anti-inflammatory activity and may involve the

release or synthesis of several inflammatory mediators.

Carrageenan-induced paw edema is commonly used in models of the

acute phase of inflammation and is widely used for testing potential anti-

inflammatory drug [19]. This model is known to be sensitive to COX inhibitors, but

not LOX inhibitors. Inflammation induced by carrageenan injection to the hind paws

of rats goes through 3 phases over a period of time as mediators are released [20].

During the primary phase, from the onset to 1.5 h, histamine and serotonin are

released. During the second phase, between 1.5 and 2.5 h, bradykinin is released.

Finally, during the third phase, between 2.5 to 6 h, PGs are released in response to

carrageenan [21]. The release of PGs in late phase relies on the mobilization of

neutrophils [22]. In the present study, WRE at a dose of 500 mg/kg reduced paw

edema volume at all evaluation times. The reduction was not significantly different

from that in the ibuprofen group which received a dose of 100 mg/kg. That lack of

statistical significance may have been due to the small number of rats in the study.

The prominent inhibitory effect of WRE on carrageenan-induced hind paw edema at 5

h might be related to inhibition of biosynthesis of PGs.

Recommendations

This study should be repeated with a larger number of animals to identify

important statistically significant relationships.

References

1. Bullock, Shane. (2013). “ Principles of pathophysiology.” in chapter 2

Inflammation and healing, 40-54. Australia.

2. Sue E. Huether Kathryn L. McCance. (2015). “ PATHOPHYSIOLOGY,

the Biologic Basis for Disease in Adults and Children, 7E” in chapter 7

Innate immunity: inflammation, 228-261. USA: College of Nursing,

University of Utah.



I491

3. Rang H. P et al. (2016) “RANG AND DALE’S Pharmacology, 8E” in

chapter 26 Anti-inflammatory and immunosuppressant drugs, 324-341.

London.

4. มลนธฟนฟสงเสรมการแพทยแผนไทยเดมฯ โรงเรยนอายรเวท(ชวกโกมารภจจ). ต ำรำเภสช

กรรมไทย. พมพครงแรก. กรงเทพฯ: พฆเณศ พรนทตง เซนเตอร, 2548. 5. Ali Esmail Al-snafi. (2014). “The Pharmacological Activities of Alpinia

Galangal - A Review.” International Journal for Pharmaceutical Research

Scholars (IJPRS), V-3, I-1.2277 - 7873, 607–14.

6. Subramanian P. and Nishan M. (2015). “Biological Activities of Greater

Galangal, Alpinia Galanga - A Review.” A Review. Journal of Botanical

Sciences, 2015, 15–19.

7. Tiantian She and others. (2015). “Sarsaparilla (Smilax Glabra Rhizome)

Extract Inhibits Migration and Invasion of Cancer Cells by

Suppressing TGF-β1 Pathway.” PLoS ONE.

8. Chuan Li Lu and others. (2015). “Inhibitory Effects of Chemical

Compounds Isolated from the Rhizome of Smilax Glabra on Nitric

Oxide and Tumor Necrosis Factor-α Production in

Lipopolysaccharide-Induced RAW264.7 Cell.” Evidence-Based

Complementary and Alternative Medicine.

9. Ruangnoo, S. , Jaiaree, N.and others. (2012). “An in Vitro Inhibitory

Effect on RAW 264.7 Cells by Anti-inflammatory.” Asian Pac J Allergy

Immunol ;30:268-74.

10. Reanmongkol, W. , Itharat, A, and Bouking, P. (2007). “Evaluation of the

Anti-Inflammatory, Antinociceptive and Antipyretic Activities of the

Extracts from Smilax Corbularia Kunth Rhizomes in Mice and Rats

(in Vivo).” Songklanakarin Journal of Science and Technology, 59–67.

11. Jirakiattikul, Y. , Rithichai, P. , and Itharat, I. (2013). “Effects of Medium

Salt Strength and Plant Growth Regulators on Shoot Multiplication

and Root Induction of Smilax Corbularia.” Pharmacologyonline, 1–7.

12. Somchaichana, J. , Bunaprasert, T. , and Patumraj, S. (2012) “Acanthus

Ebracteatus Vahl. Ethanol Extract Enhancement of the Efficacy of the

Collagen Scaffold in Wound Closure: A Study in a Full-Thickness-

Wound Mouse Model.” Journal of Biomedicine and Biotechnology.

13. Bukke, S. , and others. (2011). “The Study on Morphological,

Phytochemical and Pharmacological Aspects of Rhinacanthus Nasutus.

(L) Kurz (A Review).” Journal of Applied Pharmaceutical Science, 26–32.

14. Victoria L. Challinor and others. (2012). “Steroidal Saponins from the

Roots of Smilax Sp.: Structure and Bioactivity.” Steroids, 77.5, 504–11.

15. Sittiwet, c., Niamsa, N. , and Puangpronpitag, D. (2009). “Antimicrobial



I492

Activity of Acanthus Ebracteatus Vahl. Aqueous Extract: The

Potential for Skin Infection Treatment.”, International Journal of

Biological Chemistry, 95–98.

16. Bukke, S. , and others. (2011). “The Study on Morphological,

Phytochemical and Pharmacological Aspects of Rhinacanthus Nasutus.

(L) Kurz (A Review)”, Journal of Applied Pharmaceutical Science, 26–32.

17. Brattsand, R., Thalen, A., Roempke, K., Kallstrom, L. and Gruvstad, E. (1982). “Influence of 16 alpha, 17 alphaacetal substitution and

steriod nucleus fluorination on the topical to systemic activity ratio of glucocorticoids.” J. Steroid. Biochem. 16(6): 779 - 786.

18. Carlson, R.P., O’Neill-Davis, L., Chang, J. and Lewis, A.J. (1985).

“Modulation of mouse ear edema by cyclooxygenase and lipoxygenase

inhibitors and other pharmacological agents.” Agents Actions. 17: 197 -

204.

19. C. A. Winter, E. A. Risley, and G. W. Nuss, (1962). “Carrageenininduced

edema in hind paw of the rat as an assay for antiiflammatory drugs,”

Proceedings of the Society for Experimental Biology and Medicine. Society

for Experimental Biology and Medicine, vol. 11, pp. 544–547.

20. Di Rosa M. (1972). “Biological properties of carrageenan.” J Pharm

Pharmacol; 24: 89–102.

21. Vinegar R, Schreiber W, Hugo R. (1969). “Biphasic development of

carrageenin edema in rats.” J Pharmacol Exp Ther ;166:96-103.

22. Di Rosa, M., Giroud, J.P. and Willoughby, D.A. (1971). “Studies on the

mediators of the acute inflammatory response induced in rats in

different sites by carrageenan and turpentine.” J. Pathol. 104(1): 15 -

29.



I493

Appendix

Author: Sirawipak Thankanjanatorn, Asst. Prof. Parirat Khonsung, Ph.D. (Adviser)

Major: Pharmacology Faculty: Medicine, Chiang Mai University.

Phone: 053-935352 Email: [email protected],

[email protected]



I494



Effect of encapsulated cytotoxic T-cells on cancer cell destruction

Author: Porntida Wattanakull1 and Dakrong Pissuwan

1

1Materials Science and Engineering Program, Multidisciplinary Unit, Faculty of

Science, Mahidol University, Thailand. E-mail: [email protected], [email protected]

Abstract

Cytotoxic T-cells can destroy cancer cells by releasing cytotoxic molecules

to attack cancer cells. Therefore, the cell therapy by implanting cytotoxic T–cells for

cancer treatment has been of interest. However, to avoid the reaction of the immune

system on the implanted cells, the encapsulation technique has been applied. In this

study, the encapsulated cytotoxic T-cells were used for destroying breast cancer cells

(MCF-7 cells). Cytotoxic T-cells were encapsulated in poly(allyamine hydrochloride)

(PAH) as a first encapsulating layer and poly(styrene sulfonate) (PSS) as a second

layer. Thereafter, encapsulated cytotoxic T-cells were co-cultured with MCF-7 cells.

When compared with the control cells (MCF-7 cells cultured alone), the results

showed that the significant percentage of dead MCF-7 cells (13.11%) was detected in

MCF-7 cells co-cultured with encapsulated cytotoxic T-cells. As well, the significant

percentage of dead MCF-7 cells (14.67%) found in MCF-7 cells co-cultured with

non-encapsulated cytotoxic T cells. This implies that the encapsulation of cytotoxic

cells could remain some cell functions that could involve in cancer cell destruction. Key Word (s): Cytotoxic T-cells, Cell encapsulation, Cancer cells

Introduction

It is well-known that T lymphocyte cells (T-cells) are a main player in an

adaptive immune system. In the environment containing pathogens or malignancies,

effector T-cells called cytotoxic T-cells could work on specific target cell (TC)

destruction based on their antigen-specific receptor and their ability to release toxic

molecules. Therefore, the use of cytotoxic T-cells for TC destruction has been applied

in the field of immunotherapy. It was reported that T-cells could be induced to

cytotoxic T cells by activating with anti-CD3 antibodies (Tsoukas et al. 1985,

Tsoukas et al. 1985). After activation, these cytotoxic T-cells could destroy infected

cells and tumor cells (Alborán et al. 2003, Lindsten et al. 1989, Smith-Garvin et al.

2009, Wajant et al. 2005). However, these cytotoxic T-cells could also affect healthy

cells. Furthermore, in the case of implanted cytotoxic T-cells into the body for cancer

therapy, these cells may also face with the host immune reaction of the immune

system.

Recently, cell encapsulation has been proposed to avoid implanted cells

from the host immune reaction (Vos et al. 2002, Hernández et al. 2010, Lim & Sun,

1980, Visted & Lund-Johansen, 2003). Cell encapsulation can be done by

immobilizing living cells within the polymer matrix. The polymer used for

encapsulation should act as a semi-permeable membrane that can allow the diffusion

of small molecules such as oxygen and nutrients between inside and outside cells.

This diffusion helps maintain the cell viability and also helps implanted cells escaping



I495

from immune cells and some antibodies (Lim et al. 2010, Orive et al. 2004, Uludag et

al. 2000). Some reports have shown that encapsulated living cells could release

important molecules used for some therapeutics (Goren et al. 2010, Uludag et al.

2000). Due to this reason, we were interested to encapsulate cytotoxic T-cells with

polyelectrolyte polymers and investigated the possibility of using encapsulated

cytotoxic T-cells for cancer treatment. In this study, the MCF-7 cells were used as a

model cancer cell. .

Therefore, in this study we activated T-cells with anti-CD3 anibodies and

encapsulated activated T-cell (cytotoxic T-cells) with poly(allyamine hydrochloride)

(PAH) and poly(styrene sulfonate) (PSS). After encapsulation, the ability of

encapsulated cytotoxic T-cells for killing cancer cells was observed by co-culturing

with breast cancer cell (MCF-7 cells).

Objectives

1) To activate T-cells to cytotoxic T-cell with anti-CD3 antibodies

2) To encapsulate cytotoxic T-cell

3) To investigate the cancer destruction of encapsulated and non-

encapsulated cytotoxic T-cells

Research Methodology Cell preparation. MCF-7 cells (breast cancer cells) were cultured in

Dulbecco’s Modified Eagle’s Medium (DMEM) plus Minimum Essential Medium

(MEM) (DMEM: MEM = 1:1) supplemented with 10% of fetal bovine serum (FBS).

The media were added with 1% penicillin and streptomycin and cells were incubated

at 37oC in a 5% CO2 incubator. T-cells used in this study were separated from

peripheral blood mononuclear cells (PBMCs). PBMCs were cultured in DMEM

without FBS for 3 h. Then, non-adherent cells (T-cells) were collected from the

culture dish. The separated T-cells were cultured in Roswell Park Memorial Institute

(RPMI) 1640 medium supplemented with 10% FBS plus 1% penicillin and

streptomycin. The cells were also incubated in an incubator at the same condition

used for MCF-7 cells.

Cytotoxic T-cell preparation. A 96 well plate were coated with a 50 µl of

anti-CD3 antibodies (clone: HIT3a; antibodies 0.05 µg/ml). The plate was incubated

at 4oC overnight. After incubation, the antibody solution was removed and the plate

was washed 3 times with sterile PBS. The suspension of T-cells (1x106

cells/ml)

dispersed in culture media was prepared. A 200 µl of T-cells was added into a 96-well

plate previously coated with anti-CD3 antibodies. Next, the coated plate was

incubated at 37oC in a 5% a CO2 incubator for 3 days. Finally, T-cells were activated

and changed to cytotoxic T-cells. These cytotoxic T-cells were stored in liquid

nitrogen for using in further experiments.

Cell encapsulation. Two polyelectrolytes were used to encapsulate cells.

The first layer of cytotoxic T-cells was coated with poly(allyamine hydrochloride)

(PAH), which is a cationic polymer. Cytotoxic T-cells (at the number of 1x106

cells in

1 ml) were centrifuged at 6500 rpm for 5 min. The pellet after centrifugation was

dispersed in RPMI without FBS. A 500 µl of 0.05 mg/ml PAH was added into cell

suspension and the cell suspension was mixed on a shaker for 5 min. After that, the

free PAH was removed by washing with RPMI without FBS. Thereafter, cytotoxic T-



I496

cells were mixed with 0.1 mg/ml poly(styrene sulfonate) (PSS; anionic polymer) on a

shaker for 10 min. The PSS formed a second encapsulating layer on the surface of

cytotoxic T-cells. Similar to PAH, the PSS was removed by washing as described

previously. Finally, cytotoxic T-cells encapsulated with PAH/PSS were suspended in

RPMI-1640 medium. These cells were called as “PSS/PAH@CT” cells. The normal

T-cells encapsulated with PAH/PSS were also prepared using the same procedure. T-

cells encapsulated with PAH/PSS were called as “PSS/PAH@lym” cells.

Cancer destruction by encapsulated cytotoxic T-cell. The MCF-7 cells at a

number of 1x104 cells (with a volume of 100 µl) were added into a 24-well plate. The

cells were cultured for 24 h at 37oC in a 5% CO2 incubator. After incubation,

PSS/PAH@CT, PSS/PAH@lym non-encapsulated T-cells, and non-encapsulated

cytotoxic T-cells at a number of 4x105 cells (with a volume of 100 µl) were added

into a 24-well plate containing MCF-7 cells. This was a co-culture of each form of T-

cells with MCF-7 cells. The co-culture of cells was incubated for 24 h. After

incubation, PSS/PAH@lym, PSS/PAH@CT, non-encapsulated T-cells, and non-

encapsulated cytotoxic T-cells were removed from the plate by washing 3 times with

PBS containing Ca2+

and Mg2+

. Then, a 150 µl of RPMI without FBS was added into

a 24-well plate containing MCF-7 cells. Next, a 150 µl of trypan blue was added into

a 24-well plate and incubated for 5 min. After that, the trypan blue was removed and

the MCF-cells in a well plate were washed 2 times with PBS containing Ca2+

and

Mg2+

. The dead MCF-7 cells stained with blue colour were observed under inverted

microscope.

Results T-cells and cytotoxic T-cells could be encapsulated with PAH/PSS. After

encapsulation, their relative cell viability compared to non-encapsulated cells was

dropped from 100% to 73.19% for PSS/PAH@lym cells and 71.50% for

PSS/PAH@CT cells (Figure 1).

Figure 1. Cell viability of T-cells and cytotoxic T-cell encapsulated with PAH and

PSS.



I497

As mentioned previously, cytotoxic T-cells can destroy cancer cells. Thus,

to investigate whether encapsulated cytotoxic T-cells could destroy cancer cells,

PSS/PAH@CT cells were co-cultured with MCF-7 cells for 24 h. After culturing, the

dead MCF-7 cells were observed by staining with trypan blue. The results showed

that the dead MCF-7 cells (shown in blue) were detected in MCF-7 cells co-cultured

with non-encapsulated cytotoxic T-cells (Figure 2D) and PSS/PAH@CT cells (Figure

2E). As expected, there were no dead MCF-cells after co-culturing with normal T-

cells with and without encapsulation (Figure 2B&C). These results confirm that

encapsulated cytotoxic T-cells still had an ability to destroy MCF-cells. In the case of

MCF-7 cells cultured alone, it also found that cells were healthy (Figure 2A).

Figure 2. The bright field image of MCF-7 cells cultured alone (A) and MCF-7 cells

after co-cultured with: normal T-cells (B), encapsulated normal T-cells cells (C), non-

encapsulated cytotoxic T-cells (D), and encapsulated cytotoxic T-cells (E) for 24 h

and stained with trypan blue.

The percentage of dead MCF-7 cells after co-culturing with different forms of

T-cells was shown in Figure 3.



I498

Figure 3. The percentage of dead MCF-7 cells co-cultured with T-cells (lym cells),

cytotoxic T-cells (CT cells), PSS/PAH@lym cells (encapsulated T-cells), and

PSS/PAH@CT cells (encapsulated cytotoxic T-cells).

The small number of dead cells at ~ 0.16% was detected in MCF-7 cells. The

numbers of dead MCF-7 cells co-cultured with normal T-cells and PSS/PAH@lym

cells were similar to MCF-7 cells cultured alone. However, when MCF-7 cells were

co-cultured with cytotoxic T-cells and PSS/PAH@CT cells, the percentage of dead

MCF-7 cells was significantly increased to ~14.67% (for MCF-7 cells co-cultured

with cytotoxic T-cells) and 13.11% (for MCF-7 cells co-cultured with PSS/PAH@CT

cells) after comparing to MCF-7 cells cultured alone.

Discussion T-cells could be stimulated to cytotoxic T-cells by using anti-CD3

antibodies. When cytotoxic T-cells were cultured with cancer cells (MCF-7 cells), the

dead MCF-7 cells were detected. It was reported that cytotoxic T-cells could destroy

cancer cells through three possible pathways (Andersen et al. 2006). First, cytotoxic

T-cells may kill cancer cells by releasing cytokines such as tumour necrosis factor-α

and IFN-γ (interferon-gamma) resulting in induction of target cell death. Second, the

interaction between cytotoxic T-cells and target cells may lead to apoptotic cell death

through receptor triggering. And third, the release of cytotoxic molecules (perforin

and granzymes) can destroy their target cells. The results here could confirm that

cytotoxic T-cells could destroy MCF-7 cancer cells. As well, encapsulated cytotoxic

T-cells (PSS/PAH@CT cells) could effectively destroy MCF-7 cancer cells.

However, the pathway of cancer destruction between encapsulated and non-

encapsulated cytotoxic T-cells might be different. As shown in Figure 3, the

percentage of cell death of MCF-7 cells co-cultured with PSS/PAH@CT cells was

lower than that of MCF-7 cells co-cultured with non-encapsulated cytotoxic T-cells.

This implies that PSS/PAH@CT cells might destroy MCF-7 cells through indirect

pathway by releasing toxic cytokines to destroy MCF-7 cells. The direct killing of

MCF-7 cells by PSS/PAH@CT cells through receptor could be hardly occur because

the surface of cytotoxic T-cells was encapsulated with PAH and PSS. In the case of



I499

non-encapsulated cytotoxic T-cells, the destruction of MCF-7 cells might occur

through all possible mechanisms mentioned above resulting in more efficiency in

killing MCF-7 cells. This outcome provides useful data to further develop the use of

encapsulated cytotoxic T-cells for cancer therapy.

Recommendations

The outcome of this work has shown that encapsulated cytotoxic T-cells

were capable to destroy cancer cells (MCF-7 cells) used as a model cell in this study.

The further work on detections of cytokines and toxic molecules involving in cancer

destruction should be further performed to clearly understand the mechanism of

cancer destruction by encapsulated cytotoxic T-cells. This information can be used to

further development encapsulated cytotoxic T-cells for cancer therapy.

References

Alborán, Ignacio Moreno, Marı Robles, x, S. a, Alexandra Bras, Esther Baena, Martı,

x, and Carlos nez-A. (2003). "Cell death during lymphocyte development

and activation." Seminars in Immunology 15, 3: 125-133.

Andersen, Mads Hald, David Schrama, Per thor Straten, and Jürgen C. Becker.

(2006). "Cytotoxic T Cells." Journal of Investigative Dermatology 126,

1: 32-41.

Goren, Amit, Nitsan Dahan, Efrat Goren, Limor Baruch, and Marcelle Machluf.

(2010). "Encapsulated human mesenchymal stem cells: a unique

hypoimmunogenic platform for long-term cellular therapy." The FASEB

Journal 24, 1: 22-31.

Hernández, Rosa M., Gorka Orive, Ainhoa Murua, and José Luis Pedraz. (2010).

"Microcapsules and microcarriers for in situ cell delivery." Advanced

Drug Delivery Reviews 62, 7–8: 711-730.

Lim, F, and AM Sun. (1980). "Microencapsulated islets as bioartificial endocrine

pancreas." Science 210, 4472: 908-910.

Lim, G. J., S. Zare, M. Van Dyke, and A. Atala. (2010). "Cell microencapsulation."

Adv Exp Med Biol 670: 126-136.

Lindsten, Tullia, Carl H. June, Jeffrey A. Ledbetter, Gregory Stella, and Craig B.

Thompson. (1989). "Regulation of lymphokine messenger RNA stability by

a surface-mediated T cell activation pathway." Science 244, 4902: 339-

343.

Orive, Gorka, Rose Maria Hernández, Alicia Rodrıguez Gascón, Riccardo Calafiore,

Thomas Ming Swi Chang, Paul de Vos, Gonzalo Hortelano, David

Hunkeler, Igor Lacık, and José Luis Pedraz. (2004). "History, challenges

and perspectives of cell microencapsulation." Trends in Biotechnology

22, 2: 87-92.

Smith-Garvin, Jennifer E., Gary A. Koretzky, and Martha S. Jordan. (2009). "T Cell

Activation." Annual review of immunology 27: 591-619.

Tsoukas, C D, B Landgraf, J Bentin, M Valentine, M Lotz, J H Vaughan, and D A

Carson. (1985). "Activation of resting T lymphocytes by anti-CD3 (T3)



I500

antibodies in the absence of monocytes." The Journal of Immunology

135, 3: 1719-1723.

Tsoukas, Constantine D., Mary Valentine, Martin Lotz, John H. Vaughan, and Dennis

A. Carson. (1985). "The Role of the T3 Molecular Complex on Human T

Lymphocyte-Mediated Cytotoxicity." Mechanisms of Cell-Mediated

Cytotoxicity II 187, 1:365-385

Uludag, Hasan, Paul De Vos, and Patrick A. Tresco. (2000). "Technology of

mammalian cell encapsulation." Advanced Drug Delivery Reviews 42, 1–

2: 29-64.

Visted, and Morten Lund-Johansen. (2003). "Progress and challenges for cell

encapsulation in brain tumour therapy." (2003). Expert Opinion on

Biological Therapy 3, 4: 551-561.

Vos, P., A. F. Hamel, and K. Tatarkiewicz. (2002). "Considerations for successful

transplantation of encapsulated pancreatic islets." Diabetologia 45, 2: 159-

173.

Wajant, Harald, Jeannette Gerspach, and Klaus Pfizenmaier. (2005). "Tumor

therapeutics by design: targeting and activation of death receptors."

Cytokine & Growth Factor Reviews 16, 1: 55-76.



I501



I502

Thermal properties of poly (butylene carbonate) and its modification

Author: Tharathep Chunsakul, Supakij Suttiruengwong

Department of Materials Science and Engineering, Silpakorn University

Abstract

The aim of this work was to study the thermal properties of poly (butylene

carbonate) and modification. PBC was poor thermal stability to processing.

Copolymerization with PBA using MDI act as chain extender to improve the thermal

properties of PBC. In the FTIR spectra of PBC/PBA/MDI blends, the terminal

hydroxyl group of PBC and PBA reacted with the NCO group of MDI to produce an

amide bond at 1600 cm−1 (C = O) and (N − H) are shown at 1530 cm−1. In the thermal

properties, then adding PBA and MDI to PBC showed that the Tonset was increase

from 209.7 to 256.07oC as a result of PBA and MDI were reacted the hydroxyl end

group of PBC. The 1H NMR spectrum of PBC/PBA/MDI. The peaks at 6.92 ppm

(NH) and 7.68–7.71 ppm (aromatic ring), which could be ascribed to the urethane and

aromatic ring of MDI, confirm the existence of the terminal hydroxyl group of PBC

and PBA reacted with the NCO group of MDI to produce an amide bond.

Key Word (s): Poly (butylene carbonate), Poly (butylene adipate), MDI

Introduction

Poly (alkylene carbonate) is a thermoplastic polymer, which can be

synthesized from CO2 and epoxide group such as ethylene oxide, propylene oxide,

isobutylene oxide, cycloheptene oxide, cyclopentene oxide, cyclohexene oxide and

cyclic oxide etc. [1 , 2]. CO2 is particularly attractive due to its availability, low cost,

abundance, and non-toxicity. The conversion of carbon dioxide to useful chemicals is

a challenging task because CO2 has a low free energy therefor fixation through

reaction with the highly reactive reactant. Poly (alkylene carbonate) represent the

other interesting synthetic target of the coupling reaction between CO2 and epoxides

[1, 2]. The structure of poly (alkylene carbonate) is presented in Figure 1.

Figure 1. The general structure of poly (alkylene carbonate) [1].

Poly (butylene carbonate) is a bio-based amorphous to synthesized by 1, 2-

butylene oxide with CO2 using Zinc glutarate (ZnGA) as a catalyst [3-5].

Poly (butylene carbonate ) (PBC) is a bio-based amorphous and more than 50% of

CO2 by weight can be converted into PBC, showing the cost competitiveness and

environmental friendly advantages of PBC because carbon dioxide (CO2) is



I503

a currently a major greenhouse gas causing global warming. These factors

demonstrate its potential to be a substitute for petroleum-based plastics [4].

The structure of PBC provide chain flexibility and favorable property of PBC

which gives opportunities to blending with PBC to enhance its poor stiffness and

improve toughness of the other polymer. However, the poor thermal stability of PBC

because the weak carbonate linkage in the backbone and reactive end groups of PBC

lead to its relatively low thermal decomposition temperature, which is unfavorable for

processing [6, 7]. To improve the thermal stability of PBC. Generally, the blending of

most polymers is performed at high temperatures, this the condition, PBC would be

degraded and poor blending is inevitable. Therefore, it is of great necessity to improve

the thermal stability of PBC [6].

Aliphatic polyesters are semi-crystalline polymers with a wide variety of

physical properties, mechanical properties, and biodegradability. It was polymerized

through a polycondensation reaction between a diol, and diacid, such as poly

(butylene succinate) (PBS) and poly (butylene adipate) (PBA), etc. PBA is

synthesized through polycondensation of adipic acid and 1, 4-butanediol using

Titanium (IV) butoxide (Ti (BuO)4) as a catalyst [8, 9].

This research will present and discuss the synthesis and characterization of

poly (butylene carbonate-co-butylene adipate) between poly (butylene carbonate)

(PBC) and poly (butylene adipate) (PBA) with methylene diphenyl diisocyanate

(MDI) act as chain extender.

Objectives

1 . To synthesis and characterization of poly (butylene carbonate)-co-poly

(butylene adipate) from poly (butylene carbonate) and poly (butylene adipate) using

MDI as a chain extender to improve the thermal property of PBC.


Material

1, 2-butylene oxide (99%, density of 0.83g/ml) was purchased from TCI

Chemicals, Carbon dioxide (99.8%) was purchased from MSG. Zinc oxide (ZnO)

(99%) was purchased from UNIVAR. Glutaric acid (>99%), and toluene (density

0.87g/ml) was purchased from MERCK. Dichloromethane (99%) was purchased from

SCHARLAU. 1, 4-Butanediol, adipic acid were purchased from TCI Chemicals.

Titanium (IV) butoxide reagent grade, 97% and 4, 4′-Methylenebis (phenyl

isocyanate) (MDI) were purchased from Sigma-Aldrich.

Synthesis of PBC

The ZnGA was dried at 60ºC for 30 min. The dried ZnGA catalyst (1.00 g)

and 1, 2-butylene oxide were added into the reactor. The reactor was pressurized to 70

bar with CO2 after were cleaned out by dry argon gas. Then the reactor was heated up

to 95 °C. After the reaction time 52 h, the reactor was cooled to 50°C. The product

was dissolved in dichloromethane and extracted catalyst from the product solution by

adding a diluted hydrochloric acid. The extraction, washing and removed

dichloromethane from polymer solution. Then the product solution was precipitated in

excess methanol and dried at for 48 h at 60ºC.



I504

Synthesis of PBA

Poly (butylene adipate) were synthesized from adipic acid and excess of

the 1, 4-butanediol (diol/diacid molar ratio of 2.2/1) by thermal polycondensation.

Titanium butoxyde (0.3 mol %) was used as a catalyst. Initially, the temperature was

kept at 190 °C under a slow stream of N2 to help eliminate the H2O and excess of diol.

After 2 h, the three neck was connected to a vacuum pump (0.8 bar), whereas the

temperature of the bath was raised to 250 °C for 9 hr. under vacuum. Precipitation in

excess methanol and dried at for 48 h at 60 ºC.

PBC/PBA Blend

Preparation the PBC/PBA/MDI form PLA and PPC, which blended in

50/50 ratio with the addition of 7 phr of MDI using internal mixer, the temperature,

time and rotor speed were set at 60∘C, 15 min, and 40 rpm, respectively. PBC and

PBA was dried in a vacuum oven for 12 h at 60∘C.

Characterization

Fourier Transform Infrared spectrophotometry (FTIR) using Bruker

Vertex 70 spectrometer at a resolution of 2 cm-1 and 32 scans were signal averaged.

The testing range was from 400 to 4000 cm-1 to analyze the functional groups of PBC,

PBA, and PBC/PBA/MDI. Thermal stability was measured in a nitrogen atmosphere

by Thermogravimetric analyzer (TGA), METTLER TGA. The samples, under a

nitrogen atmosphere, were heated from 50 to 600oC at a rate of 10oC/min-1. Nuclear

magnetic resonance (NMR) using NMR spectrometer from Varian (400 MHz) with 1H probes. In the NMR spectroscopic measurements, chemical shifts were calibrated

with the chemical shifts of the solvents used: chloroform-d.

Results/Conclusion

The chemical structure of PBC/PBA/MDI

Figure 2 presents the FTIR spectra of PBC, PBA, and the PBC/PBA/MDI

blends for comparison, and Table 1, 2 lists the vibration modes and wavenumbers of

the IR absorption peaks.

Figure 2. Comparison of FTIR of PBC, PBA, and PBC/PBA/MDI.



I505

Table 1. Vibration modes and wavenumbers of IR absorption peaks in FTIR spectra

of PBC and PBA

Peak value (cm-1) Group

3000-2800 Stretching vibration of saturated C-H bond

1750-1700 Stretching vibration of C=O

1280-1200 Stretching vibration of C-O (ester bond)

Table 2. Vibration modes and wavenumbers of IR absorption peaks in FTIR spectra

of PBC/PBA/MDI

Peak value (cm-1) Group

3000-2800 Stretching vibration of saturated C-H bond

2382, 2341 Free isocyanate groups (NCO)

1735 Stretching vibration of C=O

1600 Stretching vibration of amide I (C=O)

1530 Stretching vibration of amide II (N-H)

1262 Stretching vibration of C-O (ester bond)

The results in Figure 2 and Table 1 show, two strong peaks for PBC and

PBA can be found. Peak at 1750-1700 cm−1 represents the strong absorption of the C

= O bond and peak at 1280-1200 cm−1 is the stretching vibration of C − O (ester

linkage). In the PBC/PBA/MDI blend, the terminal hydroxyl group of PBC and PBA

reacted with the NCO group of MDI to produce an amide bond in Figure 3.

In the spectra of PBC/PBA/MDI blends, that will be present a new

characteristic peaks corresponding to the amide bond can be found. Characteristic

peak of amide I (C = O) is indicated at 1600 cm−1 and peaks representing the

absorption of amide II (N − H) are shown at 1530 cm−1. Peak at 2382, 2341 cm-1 are

found in PBC/PBA/MDI blend, indicating that it has free NCO group (unreacted

isocyanate) [6, 7, 9-12].

Figure 3. Chain extension reaction of PBC, PBA, and PBC/PBA/MDI.



I506

The 1H NMR spectra of PBC was in accordance with proposed structure.

1HNMR spectra of PBC is shown in Figure 4. The signal of polycarbonate (carbonate

linkage) confirmed its expected structure. The 1H-NMR spectrum of PBC reveals no

signal of –CH2- of ether linkage (3.5-3.6ppm).

Figure 5 shows 1H NMR spectra of these polyesters and corresponding

proton resonance signals, respectively. The signals occurring at 4.08, 2.3, 1.68, and

1.64 ppm can be assigned to the methylene protons d, e, b, and f, corresponding to

those of butylene adipate unit. The signals at 3.66 ppm assignable to proton of the

terminated hydroxyl group. These data indicate that synthesized linear PBA chains are

terminated by hydroxyl functional end groups [7, 13, 14].

Figure 4 1H NMR spectra of synthesized PBC.

Figure 5 1H NMR spectra of synthesized PBA.



I507

From the figure 6 shows the 1H NMR spectrum of PBC/PBA/MDI. The

peaks at 6.92 ppm (NH) and 7.68–7.71 ppm (aromatic ring), which could be ascribed

to the urethane and aromatic ring of MDI, confirm the existence of the terminal

hydroxyl group of PBC and PBA reacted with the NCO group of MDI to produce an

amide bond [11].

Figure 6 1H NMR spectra of synthesized PBC/PBA/MDI.

The thermal properties of polymer blends

Figure 7 and Table 3 shows the TGA curves of PBC, PBA, and

PBC/PBA/MDI blend, and Table 3 lists the decomposition thermal of PBC, PBA, and

PBC/PBA/MDI.

As shown in Figure 7 and Table 3, PBC has two stages of weight loss. In

the initial temperature of weight loss was 209.70oC. The temperature at the first stage

of weight loss ranged from 180 to 250oC, and the final temperature at the second stage

[6] of weight loss was 250–320oC. According to the reported Inoue et al [15-17] have

indicated that the thermal decomposition of PBC exhibits two decomposition

mechanisms: main chain random scission (Figure 8) at high temperature and

unzipping degradation (Figure 9) at low temperature.



I508

Figure 7. TGA curves of PBC, PBA, and PBC/PBA/MDI.

The reactive hydroxyl end group in PBC can lead to a chain unzipping

degradation mechanism from a “backbiting”, the terminal hydroxyl groups attack on

the carbonyl group. Therefore, PBC with uncapped end groups of lower molecular

weight more easily induces a chain unzipping reaction due to the existence of an

abundance of hydroxyl groups.

Table 3. Thermal degradation data of the PBC, PBA, and PBC/PBA/MDI

Formular Tonset (oC) Td (oC) T endset (oC)

Tonset,1 Tonset,2 Td,1 Td,2 T endset,1 T endset,2

PBC 209.70 - 220.52 - 238.52 -

PBC/PBA/MDI 256.07 329.74 267.4 345.74 276.29 367.57

PBA - 349.49 - 364.56 - 381.27

In contrast, PBC with a high molecular weight induces the main chain random

scission reaction due to a small amount of the active terminal group, and has higher

thermal stability than PBC with a low molecular weight, in which the decomposition

mechanism is controlled by chain unzipping degradation because the PBC has low

molecular weight [6]. Then adding PBA and MDI to PBC showed that the Ton set was

increase from 209.7 to 256.07OC as a result of PBA and MDI were reacted the

hydroxyl end group of PBC.



I509

Figure 8. The degradation of PBC : random chain scission [6].

Figure 9. The degradation of PBC: unzipping degradation [6].

Conclusions

PBC was poor thermal stability to processing. Copolymerization with PBA

using MDI act as chain extender to improve the thermal properties of PBC. In the

FTIR spectra of PBC/PBA/MDI blends, produce an amide bond at 1600 cm−1 (C = O)

and (N − H) are shown at 1530 cm−1. In the thermal properties, then adding PBA and

MDI to PBC showed that the Ton set was increase from 209.7 to 256.07oC The 1H

NMR spectrum of PBC/PBA/MDI, which could be ascribed to the urethane and

aromatic ring of MDI to confirm the existence of the terminal hydroxyl group of PBC

and PBA reacted with the NCO group of MDI to produce an amide bond.



I510

Discussion

Poly (butylene carbonate) was improved the thermal properties using MDI act

as chain extender with poly (butylene adipate). The thermal degradation temperature

of PBC increase from 209.7 to 256.07oC. It was explain that hydroxyl group of PBC

react with isocyanate group of MDI. The thermal degradation properties of PBC have

been improved.

Recommendations

The improvement of PBC thermal degradation properties with PBA and MDI

will result in the mechanical properties and impact properties of the polymer blends.

So MDI content should be added appropriately.

References

1. Ree, M., et al., New findings in the catalytic activity of zinc glutarate and its

application in the chemical fixation of CO2 into polycarbonates and their

derivatives. Catalysis Today, 2006. 115(1–4): p. 134-145.

2. Ree, M., et al., A new copolymerization process leading to poly(propylene

carbonate) with a highly enhanced yield from carbon dioxide and propylene

oxide. Journal of Polymer Science Part A: Polymer Chemistry, 1999. 37(12):

p. 1863-1876.

3. Gao, L.J., et al., Copolymerization of carbon dioxide and propylene oxide with

zinc glutarate as catalyst in the presence of compounds containing active

hydrogen. Journal of Applied Polymer Science, 2007. 104(1): p. 15-20.

4. Wang, J.T., et al., Copolymerization of carbon dioxide and propylene oxide

using zinc adipate as catalyst. Journal of Applied Polymer Science, 2006.

99(1): p. 200-206. 5. Meng, Y.Z., et al., Effects of the structure and morphology of zinc glutarate on

the fixation of carbon dioxide into polymer. Journal of Polymer Science Part

A: Polymer Chemistry, 2002. 40(21): p. 3579-3591.

6. An, J., et al., A novel method to improve the thermal stability of

poly(propylene carbonate). Polymer Chemistry, 2014. 5(14): p. 4245-4250.

7. Wang, X.-y., et al., Chain extension and modification of polypropylene

carbonate using diphenylmethane diisocyanate. Polymer International, 2015.

64(10): p. 1491-1496.

8. Herrera, R., et al., Characterization and degradation behavior of

poly(butylene adipate-co-terephthalate)s. Journal of Polymer Science Part A:

Polymer Chemistry, 2002. 40(23): p. 4141-4157.

9. Yang, J., et al., Temperature-dependent polymorphic crystalline structure and

melting behavior of poly(butylene adipate) investigated by time-resolved FTIR

spectroscopy. Journal of Polymer Science Part B: Polymer Physics, 2009.

47(20): p. 1997-2007.

10. Gan, Z., H. Abe, and Y. Doi, Temperature-Induced Polymorphic Crystals of

Poly(butylene adipate). Macromolecular Chemistry and Physics, 2002.

203(16): p. 2369-2374.



I511

https://dict.longdo.com/search/appropriately

11. Rogulska, M., A. Kultys, and S. Pikus, The effect of chain extender structure

on the properties of new thermoplastic poly(carbonate–urethane)s derived

from MDI. Journal of Thermal Analysis and Calorimetry, 2017. 127(3): p.

2325-2339.

12. Zhong, W., et al., Study on biodegradable polymer materials based on

poly(lactic acid). I. Chain extending of low molecular weight poly(lactic acid)

with methylenediphenyl diisocyanate. Journal of Applied Polymer Science,

1999. 74(10): p. 2546-2551.

13. Saito, T., et al., Organophosphate-catalyzed bulk ring-opening polymerization

as an environmentally benign route leading to block copolyesters, end-

functionalized polyesters, and polyester-based polyurethane. Polymer

Chemistry, 2015. 6(24): p. 4374-4384.

14. Zulkifli, N.N.b., et al., Palm kernel oil-based polyurethane film:

Biocompatibility and antibacterial activity studies. AIP Conference

Proceedings, 2017. 1817(1): p. 020005.

15. Phillips, O., J.M. Schwartz, and P.A. Kohl, Thermal decomposition of

poly(propylene carbonate): End-capping, additives, and solvent effects.

Polymer Degradation and Stability, 2016. 125: p. 129-139.

16. Kuran, W. and P. Górecki, Degradation and depolymerization of

poly(propylene carbonate) by diethylzinc. Die Makromolekulare Chemie,

1983. 184(5): p. 907-912.

17. Sheng, X., et al., Efficient synthesis and stabilization of poly(propylene

carbonate) from delicately designed bifunctional aluminum porphyrin

complexes. Polymer Chemistry, 2015. 6(26): p. 4719-4724.



I512

1

Title: Optimized Radiation Dose and Image Quality for Abdominal CT Protocol:

Phantom Study

Author(s): Saimai Siangyai1, Supawan Jivapong2, Pacharin Prapaisilp3, Dittapong

Songsaeng3, Malulee Tuntawiroon3

Institution(s): 1Navamindradhiraj University, 2Golden Jubilee Medical Center, Mahidol

University, 3Department of Radiology, Faculty of Medicine Siriraj Hospital.

Abstract

The purpose of this study was to determine an acceptable dose of radiation required to

achieve a diagnostically acceptable image quality of the computed tomography (CT) scan of

standard, large and very large size body phantom by using routine adult abdominal protocol at

different levels of noise index. The study was performed by 2 CT systems, 64-section MDCT

scanners (LightSpeed; GE Healthcare) and high definition CT (HDCT) 64-MDCT scanners

Model HD750 (GE Healthcare) at Siriraj Diagnostic Imaging Centers. The volume CT dose

index (CTDI)vol of CT images was measured in all sizes of phantom. By fix mode (500 mA)

and auto modulation (noise index 0 – 20), radiation doses were recorded and the image quality

was evaluated by measuring image noise of 5 regions of interest (ROI); right and left lobes of

liver, spleen, aorta and left kidney.

At different settings of noise index ranging from 0 to 20 and the slice thicknesses of

1.25 and 7.0 mm, the CTDIvol increased in all sizes of phantom but higher in thin slice (1.25

mm) than thicker slice (7 mm). An image quality was enhanced by noise index reduction in the

process of image reconstruction using adaptive statistical iterative reconstruction (ASIR) and

Model-Based iterative reconstruction (MBIR) software. Radiation doses increases with

phantom sizes; 4.57, 5.36 and 6.44 mGy, for standard, large and very large body size

respectively.

Factors affecting radiation dose and image quality were levels of noise index, slice

thickness and reconstruction method. Decreasing the noise index resulted in increased

radiation dose and increasing the patient size will increase the radiation dose. Thin slice

thickness gave poorer image quality than thicker slice but gave better details. Small change in

protocol could be used in the process for CT scan of upper abdomen to reduce the radiation

dose to patient while image quality remains high enough to preserve diagnostic use.

Keyword(s): CT PROTOCOL, BODY PHANTOM, NOISE INDEX



I513

2

Introduction

Current imaging technology in medical diagnosis is developed very quickly. The

advancement of multidetector CT (MDCT) technology has markedly improve image quality as

well as significantly increase radiation doses to patients. Over the past decade, reducing

radiation dose delivered by CT scans has become a major concern, particularly with regards to

MDCT. Varieties of CT vendors introducing new generation of CT scanners and each CT

system has different algorithm tests (Protocol) according to different characteristics of the

machine. Different versions also have differences in detail sharpness of images. When

concerning about CT dose, it is important to understand factors and parameters affecting

radiation dose and image quality. The purpose of this study was to assess an acceptable dose of

radiation required to achieve a diagnostically acceptable image quality by measuring image

noise of the abdominal CT scan at 4 separate noise index levels using routine upper abdomen

protocol for adult. This study will pay particular attention on abdominal imaging because it is

the most frequently performed CT scan at the center. In some patients, abdominal CT

examination has been performed up to 4 times per year each and with more than one

acquisition phase.

Objectives

1. To assess an acceptable dose of radiation required to achieve a diagnostically

acceptable image quality of upper abdomen CT scan using routine abdominal protocol.

2. To compare image quality in association with radiation doses when routine upper

abdomen protocol was performed in BODY PHANTOM model at different setting of

noise index of the 2 different CT systems.

3. To compare quality when enhanced by noise index reduction in the process of image

reconstruction using adaptive statistical iterative reconstruction (ASIR) and Model-

Based iterative reconstruction (MBIR) software.


This research is an experimental study in body phantom to measure the characteristics

of CT scan images using routine abdominal CT protocol at Imaging Center, Department of

Radiology, Faculty of Medicine Siriraj Hospital.



I514

3

Materials

CT Scanners

The CT scanners at the Department of Diagnostic Radiology, Siriraj Hospital, used in

this study are 64-MDCT (VCT LightSpeed, General Electric Medical System (GE) (Fig. 1) and

64-HDCT (Discovery CT750 HD) (Fig. 2).

Figure 1 The 64 slices MDCT, GE Medical System Model VCT LightSpeed

Figure 2 The 64 slices MDCT, High definition CT (HDCT), GE Medical System Model

Discovery CT750 HD



I515

http://www.google.co.th/url?sa=i&rct=j&q=&esrc=s&source=images&cd=&cad=rja&uact=8&ved=0ahUKEwiiy-KYm5fSAhWHPY8KHR-EBg8QjRwIBw&url=http://www3.gehealthcare.com/en/products/categories/goldseal_-_refurbished_systems/goldseal_computed_tomography/goldseal_ct750_hd&bvm=bv.147448319,d.c2I&psig=AFQjCNHik1bUBEuPUaWwqPR6Kz-3pzYm2w&ust=1487423679120183

4

Body Phantom

Anthropomorphic phantom (Fig. 3) was used to test the performance of the

scanner incorporating upper abdomen protocol. The body phantom has different test

modules used for assessing different image quality parameters. The material is specially

designed to be scanned or photographed in the field of medical imaging to evaluate,

analyze and tune the performance of variety of imaging devices.

Figure 3. Body Phantom

Bolus

Bolus (Fig. 4) is a material applied to the surface of a patient to negate the skin

sparing effect of megavoltage photons and some megavoltage electron fields or to

compensate for an irregular patient contour to achieve flat isodose lines at depth or to

smooth out sharp edges on the patient surface to prevent hot spot formation (particularly

for electron beams).

Figure 4 Bolus



I516

5

Method

Three different size anthropomorphic phantoms were scanned using same vertical

centering and radiation dose was assessed with radiation dose–monitoring software. The

effect of vertical positioning on the radiation dose was studied using the volume CT dose

index, dose-length product, and size-specific dose estimates for different-sized phantoms.

Image noise was determined from CT number histograms. The body phantom was

vertically positioning for abdomen. The scanning range was set for abdomen and the

AEC was used to modulate tube current according to patient size and x-ray attenuation in

tissues.

AEC is an automatic exposure control in GE CT scanners. It is used to help reduce the

radiation dose to the patients. In GE CT scanners, the AECs are called Auto mA and Smart

mA. A noise index parameter allows to select the amount of x-ray noise that will be present in

the reconstructed images.

Veo: CT scanning reconstruction technology called Veo™ enable physicians to diagnose

patients with high-clarity images at previously unattainable low radiation dose levels.

Reconstruction method: The CT scan creates 3D X-ray images which can look into the

volume. The computer generated image. The images have a cross section of the storage

requirements carefully. The locations selected to store information includes right liver lobe, left

liver lobe, spleen, aorta, and left kidney.


Descriptive statistics was used to determine mean of image noise each value was

from triplicate measurements.

Results/ Conclusion

Size and Thickness

Large organs have higher image noise than small organs. Thin slice thickness (1.25

mm) gave higher image noise than thick slice thickness (7 mm) both in MDCT and HDCT.

MDCT image noises both in thick and thin slice are lower than HDCT by average (Table. 1).

Fig.5 (A) (B) (C) and (D) compare image noise of the right lobe of liver between 2 slice

thicknesses at 4 levels of noise index.



I517

6

Table 1. Image noise of the CT images of body phantom (standard, large and very large size)

scanned by 2 CT systems (MDCT and HDCT) at 4 levels of noise index; 0, 10, 15, 20

and 2 slice thicknesses 1.25 and 7 mm.

Thin slice produced similar image noise in all size of phantom at different levels of

noise index in MDCT and HDCT. In contrast, thick slice produced much different image noise

between MDCT and HDCT.

Right Lobe of Liver (RL)

(A) Noise index = 0

Slide thickness 1.25 mm Slice thickness 7 mm



I518

7

(B) Noise Index = 10

(C) Noise Index = 15

(D) Noise Index = 20

Fig.5 (A) (B) (C) and (D) compare image noise of the right lobe of liver between 2

slice thicknesses at 4 levels of noise index.



I519

8

Reconstruction

Iterative reconstruction techniques have demonstrated the potential of image quality and

reducing radiation dose in CT. The reduction of image noises of the right and left lobes of liver,

spleen, aorta and left kidney scans were shown in Fig 6 to 10. An image noise was reduced in

both lobes of the liver but increases with the size of the patient. The measured SD value will

decrease at higher index of adaptive statistical iterative reconstruction (ASIR) noise and even

more reduced in Model-Based iterative reconstruction (MBIR).

Both CT machines use Different software, image quality obtained when using different

noise make different worlds. Using MBIR will produce images with less noise than ASIR and

NONE in standard thickness 1.25 mm.

Figure 6 Reduction of noises in the CT image of the right lobe of liver by methods of

reconstructions at 4 separate levels of noise index in standard, large and very large

phantom sizes.



I520

9

Figure 7. Reduction of noises in the CT image of the left lobe of liver by methods of


phantom sizes.

Figure 8. Reduction of noises in the CT image of the spleen by methods of reconstructions at 4

separate levels of noise index in standard, large and very large phantom sizes.

0

5

10

15

20

25

0 10 15 20 0 10 15 20 0 10 15 20

Standard Large Very large

SP (Thickness 1.25 mm)

NONE

ASIR30 SD

ASIR40 SD

ASIR50 SD

MBIR MBIR



I521

10

Figure 9. Reduction of noises in the CT image of the aorta by methods of reconstructions at 4

separate levels of noise index in standard, large and very large phantom sizes.

Figure 10. Reduction of noises in the CT image of the left lobe of liver by methods of


phantom sizes.

0

5

10

15

20

25

0 10 15 20 0 10 15 20 0 10 15 20

Standard Large Very large

LK (Thickness 1.25 mm)

NONE SD

ASIR30 SD

ASIR40 SD

ASIR50 SD

MBIR SD



I522

11

Radiation dose (mGy)

Factors affecting radiation dose and image quality were noise index, slice thickness and

reconstruction filers. The scanning parameter of abdomen technique were used with various

filters, the circular ROI area was placed at the center of the phantom to determine the noises in

CT images of the Right lobe of liver, Left lobe of liver, Spleen, Aorta and Left kidney

The standard deviation of CT number is an indicator of the noise level in the image.

The radiation dose in volume CT dose index (CTDI)vol was recorded from monitor displayed

with scanning the 2 thickness of Abdomen phantom using scanning parameters 120 KVp, 0.5

sec rotation time by varying the noise index from 0, 10, 15 and 20 in 3 body sizes of abdomen

phantom. The radiation dose was shown in Table 10 and Figure 11.

Table 10. The radiation dose in volume CT dose index (CTDI)vol of the 2 thickness of abdomen

phantom scans at different levels of noise index and phantom sizes.

Phantom Size Noise Index Radiation Dose (mGy)

MDCT HDCT

Standard

0 6.86 6.88

10 6.87 6.87

15 6.6 5.87

20 4.57 3.68

Large

0 6.87 6.88

10 6.86 6.87

15 6.82 6.61

20 5.36 4.42

Very Large

0 6.87 6.88

10 6.87 6.88

15 6.87 6.88

20 6.44 5.21



I523

12

Figure 11. Compare radiation dose (mGy) of 2 CT systems, MDCT and HDCT of abdomen

phantom scans at different levels of noise index and phantom sizes.

Radiation dose from CT procedures varies by size of the body part examined, the type

of procedure, and the type of CT equipment and its operation. Typical values cited for radiation

dose should be considered as estimates that cannot be precisely associated with any individual

patient, examination, or type of CT system. Both machines provide minor different values.

HDCT gave slightly lower Radiation dose than MDCT. New software technology can

significantly reduce the radiation dose required to achieve clinically acceptable image quality.

Discussion

Protocols: These protocols are intended as guidelines only. All CT scans must be

closely monitored by a radiologist, who may modify these procedures as needed. In this study

decreasing the Noise Index (NI) on result in an increase in dose for a patient of a given size

where the scan is being performed with AEC.

Radiation dose: An important issue in radiology today is how to reduce the radiation

dose during CT examinations without compromising the image quality. New software

technology can significantly reduce the required radiation dose. Individualize the examination

and adjust the radiation dose to the body type and body organ examined. Different body types

and organs require different amounts of radiation. Prior to every CT examination,

appropriateness of the exam should be evaluated whether it is motivated or if another type of

examination is more suitable. Higher resolution is not always suitable for any given scenario,

such as detection of small pulmonary masses.



I524

13

Recommendations

Radiologists, medical physicists, registered radiologist assistants, radiologic

technologists, and all supervising physicians have a responsibility for safety in the workplace

by keeping radiation exposure to staff, and to society as a whole, “as low as reasonably

achievable” (ALARA) and to assure that radiation doses to individual patients are appropriate,

taking into account the possible risk from radiation exposure and the diagnostic image quality

necessary to achieve the clinical objective. All personnel that work with ionizing radiation must

understand the key principles of occupational and public radiation protection (justification,

optimization of protection and application of dose limits) and the principles of proper

management of radiation dose to patients (justification, optimization and the use of diagnostic

reference levels or DRL).

Bibliography

Modified according to: http://media.wiley.com/product_data/excerpt/

63/04712376/0471237663.pdf (Last visited: July 13, 2016)

Courtesy of University Medical Centre Mannheim, Germany (SOMATOM Force) last updated:

Oct 5, 2016

Fundamentals of Body CT 2nd Edition. Webb Brant Helms

Whole Body Computed Tomography Second Edition Otto Hardcover Wegener – 1 Dec 1992

AAPM Report # 39 Specification and Acceptance Testing of Computed Tomography Scanners

Polacin A; Kalender WA; Marchal G. Evaluation of section sensitivity profiles and image noise

in spiral CT. Radiology, 1992 Oct, 185(1):29-35.

Polacin A; Kalender WA; Brink J; Vannier MA. Measurement of slice sensitivity profiles in

spiral CT. Medical Physics, 1994 Jan, 21(1):133-40.

McCollough CH, Zink FE. Performance evaluation of a multi-slice CT system. Med Phys

1999; 26:2223–2230.

Droege RT, Morin RL A practical method to measure the MTF of CT scanners. Med Phys 1982

Sep-Oct; 9(5):758-760.

McNitt-Gray, “Radiation dose in CT,” Radiographics 22:1541-1553 (2002)



I525

http://media.wiley.com/product_data/excerpt/%2063/04712376/

http://media.wiley.com/product_data/excerpt/%2063/04712376/

14

FDA Notice dated 11-2-01 http://www.fda.gov/cdrh/safety/110201-ct.html

American Association of Physicists in Medicine (AAPM). Phantoms for performance

evaluation and quality assurance of CT scanners diagnostic radiology committee task force

on CT scanner phantoms.1977; 1.

American Association of Physicists in Medicine (AAPM). Specification and acceptance testing

of computed tomography scanners report of task group 2 diagnostic x-ray imaging

committee.1993; 39.

American Association of Physicists in Medicine (AAPM). The measurements reporting and

management of radiation dose in ct.2008.

Angjelina PR. Optimization of image quality in pediatric computed tomography

Education in Developing Asia Author: Saimai Siangyai, Department of Radiology Faculty of

medicine Siriraj Hospital, Bangkok 10700, Thailand

Email: [email protected]



I526

http://www.fda.gov/cdrh/safety/110201-ct.html

Development of luciferase reduction neutralization test for DENV neutralizing

antibody detection

Suwipa Kaewsod1, Kedsara Panyasu

1, Krongkan Saipin

1, Chunya Puttikhunt

2,3, Sutha

Sangiambut3, Chakrit Hirunpetcharat

1, Nopporn Sittisombut

4, Jiraphan Junjhon

1*

1Department of Microbiology, Faculty of Public Health, Mahidol University, Bangkok

10400, Thailand. 2Division of Dengue Hemorrhagic Fever Research, Department of Research and

Development, Faculty of Medicine, Siriraj Hospital, Mahidol University, Bangkok

10700, Thailand. 3Medical Biotechnology Research Unit, National Center for Genetic Engineering and

Biotechnology, National Science and Technology Development Agency, Bangkok

12120, Thailand. 4Department of Microbiology, Faculty of Medicine, Chiang Mai University, Chiang Mai

50200, Thailand.

*Corresponding author: Jiraphan Junjhon, Department of Microbiology, Faculty

of Public Health, Mahidol University, Bangkok 10400, Thailand

E-mail address: [email protected]

Abstract

Dengue virus (DENV) is an important mosquito-borne viral disease in tropical

and subtropical areas, where the vaccine and specific antiviral drugs for the treatment and

prevention is absence. Although plaque reduction neutralization test (PRNT) or focus

reduction neutralization test (FRNT) has been accepted to use as the “gold standard”

method for the measurement of neutralizing antibody to DENV. These techniques require

the property of virus to generate plaque and are restricted to the virus strains used for

neutralization test. To overcome this bottleneck, we developed luciferase reduction

neutralization test (LRNT) for detecting DENV-2 neutralizing antibody by measuring the

luciferase enzyme released from Luc-SIP infected cells. The LRNT and FRNT resulted in

a close relative amount of anti-E antibody (4G2) driving 50% of Luc-SIP and live DENV

neutralization, implying similar antigenic property between both types of DENV

particles. In addition, a linear correlation of Luc-SIP neutralization by anti-DENV

antibody using FRNT and LRNT was observed (R2

= 0.9150). Therefore, the finding

strongly emphasized that our developed LRNT is well generated based upon the live

virus replication behavior. The Luc-SIP(H346Y) was also generated using the Luc-SIP

genome background. This purpose was to apply the developed LRNT in studying the role

of amino acid mutation on the change of antigenic property of DENV-2. We observed

that Luc-SIP(H346Y) displayed a similar LRNT50 and FRNT50 to the Luc-SIP parental

strain. However, since this result represented the total binding of antigen on the particles

by 4G2 antibody, it was noted that this mutation might not be a relevant epitope for the

antibody used. Further study using different types of anti-E antibody is required to draw



I527


the complete conclusion. Collectively, our results generated the robust method for

detecting the neutralizing antibody, which can be widely applied in DENV vaccine trial,

high-throughput drug screening and other flavivirus research areas.

Keywords: DENV, neutralizing antibody, infectious particle reporter, neutralization test,

luciferase assay

Introduction

DENV infection is an important mosquito-borne viral disease. It is

approximately 100-200 million cases of dengue infection each year (WHO., 2009).

DENV is a single positive-strand RNA virus. It belongs to the genus Flavivirus in the

family Flaviviridae (Lindenbach BD et al., 2007). Four distinct serotypes are being

circulated in the endemic region. However, some have developed to various degrees of

diseases, including dengue fever (DF), dengue hemorrhagic fever (DHF), and a more

severe fatal form of disease dengue shock syndrome (DSS) (Gubler DJ.,1998; Halstead

SB., 2007; Guzman M et al., 2010). Currently, no vaccine or specific antiviral drugs for

the treatment and prevention present.

Primary infection with any of the four DENV serotypes provides life-long

immunity against the homologous type by the action of neutralizing antibodies (NAbs)

against viral proteins. The ectodomains III (EDIII) of envelope (E) protein is a major

target for neutralization (Rothman AL., 2011). Interestingly, the study of genetic

variation of DENV-2 E protein in Thailand, since 1974 to 2010 demonstrated that

majority of E protein sequence was mutated at amino acid position 346. The replacement

of Histidine (H) with Tyrosine (Y) is observed concomitantly to time. This conserve

change may be important for both antibody recognition or neutralization epitope

(Sukupolvi-Petty S et al., 2010; Puiprom O et al., 2011).

Currently, plaque reduction neutralization test (PRNT) is the “gold standard”

method for measuring the neutralizing antibody to DENV. This method is labor intensive,

time-consuming and technical complex processes, which sometimes cause an operator-

error prone manual readout. Recently, attempting to generate the single-round infectious

particle reporter (Luc-SIP) with the tag of Lucia luciferase in the DENV-2 genome

deleting partial capsid encoding sequence has been made (Junjhon J., unpublished

results). This Luc-SIP is able to replicate within the cells for a single cycle and the Lucia

luciferase is released into the culture supernatant upon Luc-SIP replication. Therefore,

the amount of Lucia luciferase detected outside the cells is based up on the Luc-SIP

infection.

This study developed more feasible and reliable method to detect DENV

neutralizing antibody by using Luc-SIP, so called LRNT. We demonstrated that Luc-SIP

displayed antigenic similarity to live DENV-2, strain 16681 when tested for the

neutralizing property of the well-characterized anti-E monoclonal antibody (MAb) 4G2.

This result suggested that Luc-SIP should be used to replace the live virus for detecting

DENV neutralizing antibody.



I528

Objectives

To develop the LRNT for neutralizing DENV antibody detection by using

Luc-SIP of DENV-2 strain 16681.


Cells and antibody. The african green monkey kidney (Vero) cells (Igarashi

A., 1978) was cultured in Minimum Essential Media (MEM) (Gibco BRL) supplemented

with 10% FBS, 2 mM L-glutamine (Gibco BRL), 100 units/ml Non- Essential Amino

Acids (NEAA) and 100 units/ml penicillin and 100 µg/ml streptomycin (Gibco BRL) in

the presence of 5% CO2 at 37°C. The mosquito (C6/36) cell lines (Igarashi A., 1978)

derived from Aedes albopictus and capsid-expressing mosquito cell lines (Sangiambut S.,

2013) were cultured in Leibovitz L-15 medium (Gibco BRL) supplemented with 10%

fetal bovine serum (FBS), 2 mM L-glutamine (Gibco BRL), 0.26% tryptose phosphate

broth (Sigma-Aldrich), and 100 units/ml penicillin and 100 microgram (µg)/ml

streptomycin (Gibco BRL) at 29°C. DENV-2 strains 16681(Russell and Nisalak, 1967)

was kindly provided by Dr. Nopporn Sittisombut, Faculty of Medicine, Chiang Mai

University. The virus was propagated in C6/36 cell line in L15 medium (Gibco BRL,

Grand Island, NY, USA) supplemented with 1.5% FBS, 2 mM L-glutamine (Gibco

BRL), 0.26% tryptose phosphate broth (Sigma-Aldrich), and 100 units/ml penicillin and

100 microgram (µg)/ml streptomycin (Gibco BRL) at 29°C for virus stock preparation

used in this study.

Dengue specific anti-E protein murine monoclonal antibody (MAb) 4G2 was

kindly provided by Dr. Chunya Puttikhunt, Medical Biotechnology Research Unit

(BIOTEC), NSTDA. 4G2 was used in the focus immunoassay titration, focus reduction

neutralization test (FRNT), and LRNT.

The Luc-SIP. The Luc-SIP of DENV-2 strain 16681 was generated

previously (Junjhon et al., unpublished result). Briefly, the cDNA full-length of dengue

virus serotype 2 containing plasmid, pBluescript II KS (pBK) (Sriburi et al., 2001) was

subjected to replacement of C coding region with a cassette of gene encoding 38 amino

acids of C protein at 5’ end, followed by Lucia luciferase and foot-and-mouth disease

virus (FMDV) 2A genes at the 3’ end, resulting in the pBK(SISP6-10,723)ΔCLucia

(Junjhon J, Unpublished result). The Luc-SIP was amplified in C-expressing C6/36 cells

and the supernatant was collected for further use through all experiments .

Generation of Luc-SIP(H346Y). The Luc-SIP(H346Y) was generated in

order to study the effect of H346Y mutation on antibody recognition to DENV epitope.

The PCR mutagenesis were performed to introduce point mutation at the amino acid

position 346 of E protein from histidine to tyrosine into the DENV 2 reporter genome

containing plasmid, pBK(SISP6-10,723)ΔCLucia. Briefly, JJ-8F and JJ-8R

oligonucleotides were designed for PCR-based site-directed mutagenesis (Table 1).



I529

Table 1. Oligonucleotide primers for PCR-based site-directed mutagenesis, reverse

transcription PCR and nucleotide sequencing.

aNumber represents base position in the genome of strain 16681.

F, forward; R, reverse

A pBK(SISP6-10,723)ΔCLucia plasmid was used as a template in PCR

reaction with the following PCR parameters: denaturation 98°C, 20 s; annealing 60°C,

30 s; extension 72°C, 7 min for 30 cycles using Phusion DNA polymerase (Thermo

scientific, USA). The amplified products were transformed into E. coli strain DH5α.

After 4 days of incubation, the small transformed colonies were selected for further

growth at 22°C for 2 days. A plasmid DNA was extracted with QIAGEN plasmid Mini

kit (QIAGEN, Hilden, Germany) and a desired mutation containing plasmid was

screened by particular restriction enzyme digestion. A plasmid DNA were analyzed for

the nucleotide sequence using JJ-9F and JJ-1R oligonucleotides (Table 1) by Macrogen

sequencing services (GIBTHAI), before used as a XbaI-linearized cDNA for

RiboMax™ Large Scale RNA Production System–SP6 (Promega,USA). To generate

the Luc-SIP (H346Y), the transcribed RNA was subjected to trans-

complementation into C-expressing C6/36 cells (Sangiambut et al., 2013) via

Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA). The supernatant was collected

when appropriate cytopathic effect is observed. The Luc-SIP (H346Y) supernatant was

used to infect C-expressing C6/36 cells for making the stock, which was further used

through all experiments (Fig 1).

Designation Sequence (5'3') Rangea Introduced sequence

/restriction site

JJ-8F GAT CTC GAG AAA AGA

TAT GTC TTA GGT CGC

CTG ATT ACA GTC AAC CC

1957-1993 H346Y mutation (bold),

XhoI (underlined)

JJ-8R GGC GAC CTA AGA CAT

ATC TTT TCT CGA GAT

CCA TTA TCT CAA AAG GG

1987-1941 H346Y mutation (bold),

XhoI (underlined)

JJ-9F GTC ATA CTC TAT GTG

CAC AGG

1827-1847

JJ-1R ACC TCT AGA ACC TGT

TGA TTC AAC AGC ACC

10729-10700 XbaI (underlined)



I530

Figure 1. Diagram of Luc-SIP (H346Y) generated from plasmid pBK (SISP6-

10,723)ΔC_Lucia by transfection into C-expressing C6/36 cells.

Focus immunoassay titration. The focus immunoassay titration was employed

to determine the infectious virus titer of DENV-2, strain 16681, Luc-SIP, and Luc-SIP

(H346Y). The virus samples were diluted in a 10-fold serial dilution with 2% FBS-MEM

and 50 µl of each virus dilutions were added onto Vero cells in a 96-well plate. After 2 h

of incubation at 37°C with the presence of 5% CO2, the 125 µl overlayered (1.5%

carboxymethyl cellulose (CMC) in 4% FBS- MEM) was added and the plate was

incubated at 37°C, 5% CO2 for 48 h. Foci of infected cells were visualized by staining

with DENV antibody. The infected cells were fixed with 3.7% in formaldehyde in

phosphate buffered saline (PBS) and permeabilized with 2% triton X-100 in PBS. After

permeabilization, 4G2 antibody was added 50 µl/well and reacted for 1 h at 37°C. The

signal of infected cells was developed by reacting infected cells with the alkaline

phosphatase (AP) conjugated goat anti-mouse IgG (H+L) (Abcam, cambridge, UK),

which provided the catalytic reaction to its chromogenic substrate [5-bromo-4-chloro-3'-

indolyphosphate p-toluidine salt (BCIP) and nitroblue tetrazolium chloride (NBT)],

generating the dark purple spots. The virus titer was calculated from the spots number

and expressed as focus-forming unit (FFU) per ml.



I531

Focus reduction neutralization test (FRNT). The FRNT was used as the

standard method to measure the neutralizing activity of antibody against DENV in

comparison to the developed Luc-based neutralizing activity assay. The 100 μl of 4-fold

serial dilutions of 4G2 antibody in 1X-MEM from 1:8 to 1:2,048 were reacted with an

equal volume of 100 FFU DENV-2 strain 16681 virus or Luc-SIPs in 2% FBS-MEM.

After 1 h of incubation at 37°C with the presence of 5% CO2, 200 μl of antibody-particle

reporter mixture were added onto Vero cell monolayer seeded in a 24-well plate for

additional 2 h. The infected cells were washed twice with 500 μl of sterile PBS to

eliminate luciferase residue and overlayered with 250 µl of 1.5% CMC in 4% FBS-

MEM. After further incubation at 37°C for 48 h, the infected cells were fixed and stained

with 4G2 antibody to determine the infectious titer by focus immunoassay titration. The

number of focus was counted under the light microscope and the FRNT50 is defined as the

antibody dilution resulting in 50% focus reduction referred to no antibody presence.

Luciferase activity assay. The luciferase activity assay was carried out to

determine luciferase activity derived from Luc-SIP. Briefly, 50 µl aliquots of Luc-SIP

infected culture supernatants was transferred onto a white opaque 96-well microplate and

reacted with 50 µl of QUANTI-Luc™ reagent (Invivogen, San Diego, USA). The

luciferase light signal was immediately detected by the VICTOR ™ X series multi-label

plate readers. For LRNT experiment, culture supernatant harvested at 48 h post infection

was subjected to determine the luciferase activity using a similar protocol mentioned

above.

LRNT. The LRNT was developed to examine the neutralizing activity of DENV

antibody. The 100 μl of 4-fold serial dilutions of 4G2 antibody in 1X-MEM from 1:8 to

1:2,048 were mixed with an equal volume of 100 FFU of DENV-2 16681 live virus or

single-round infectious particle reporters in 2% FBS-MEM. After 1 h of incubation at

37°C with the presence of 5% CO2, the 200 μl of antibody-particle reporter mixtures

were added onto Vero cell monolayer in 24-well plate and the virus adsorption was

allowed for 2 h at 37°C with 5% CO2. The complex of antibody-particle reporter was

then removed and the infected cells were washed twice with 500 μl of sterile PBS to

eliminate an excess luciferase residue. After 48 h additional incubation at 37°C with the

presence of 5% CO2, the culture supernatants were harvested for luciferase activity assay.

The 1X-MEM was served as the negative control for the absence of 4G2 antibody.. The

antibody dilution resulting in 50% reduction of RLU value referred to negative control

was defined as LRNT50.



I532

Results

Optimization of luciferase activity assay To obtain the optimal amount of luciferase substrate for luciferase activity assay,

a set of different volume of QUANTI-Luc™ reagent (Invivogen,San Diego,USA) was

tested for luciferase activity with 50 μl of Lucia luciferase containing culture supernatant.

The luciferase activity was first detected at 130,545 RLU when the 5 μl of the

coelenterazine substrate was used (Figure 2). It was enhanced gradually upon increasing

the amount of the substrate and plateau at 940,866 RLU with 15 μl of substrate (Figure

2). This result suggested that 5 μl of the substrate was the optimal amount for further

luciferase assay.

Figure 2. Optimization of coelenterazine substrate amount for luciferase activity assay.

The equal amount of Lucia luciferase containing supernatant was reacted with the

coelenterazine substrate from 5, 10, 15, 20, 25, 30, 35, 40, 45, and 50 μl then the

luciferase activity was measured by VICTOR ™ X Series multi-label plate readers.

Correlation of Luc-SIP input and luciferase activity

Luc-SIP replicates inside the cells and secretes the Lucia luciferase enzyme into

the culture supernatant. To ensure the amount of luciferase activity detected from the

culture supernatant is derived by Luc-SIP replication, the correlation of Luc-SIP input

and luciferase activity was tested. The Luc-SIP input of 10, 100 and 1000 FFU was used

to infect Vero cells and the supernatant was collected at 24 and 48 hr for luciferase

activity assay. The detectable luciferase activity was less than 1,000 RLU when tested in

all virus input at 24 hr after infection (Figure 3A). Interestingly, the luciferase activity

increased in a virus input dependent manner from Luc-SIP input of 10 to 1000 FFU when

measured at 48 hr (Figure 3B). This result suggested that the luciferase activity

determined from the Luc-SIP infected cells reflected the number of Luc-SIP infection

into cells.



I533

Figure 3. Correlation of Luc-SIP input and luciferase activity. A) Luciferase activity

obtained from Vero cells infected with Luc-SIP input of 10, 100, and 1000 FFU at 24 hr

and B) 48 hr. Mean represents three independent experiments.

Luc-SIP are antigenically equivalent to live DENV

Luc-SIP is generated to replace the use of live DENV in PRNT or FRNT

assay. However, Luc-SIP is the engineered DENV particle reporters, which lack of the

partial C encoding gene, causing the different genome size between Luc-SIP and DENV.

To test whether this difference alters the overall structure of Luc-SIP from live DENV

particles, the neutralization assay with well-characterized anti-E antibody was performed.

The four-fold serial dilutions of 4G2 was used to neutralize Luc-SIP and DENV-2, 16681

at 37 °C for 1 hr. The FRNT50 of Luc-SIP and DENV-2, 16681 were calculated at 1:108

and 1:120 of 4G2 dilution, respectively (Figure 4A). The Luc-SIP and DENV-2 16681

were neutralized by 4G2 similarly, indicating no total antigenic difference between both

particle types. As expectedly, the LRNT50 of Luc-SIP was at 1:165 of 4G2 dilution

(Figure 4B), which was closed to the FRNT50 of Luc-SIP. A strong linear correlation of

Luc-SIP was calculated between infectious particle reporter and luciferase activity given

the R2

= 0.9797 (Figure 4C). Collectively, this result implied that the luciferase activity

detected from LRNT was derived from the Luc-SIP infection.



I534

Figure 4. FRNT and LRNT detecting of Luc-SIP neutralization by anti-E antibody. A)

FRNT of Luc-SIP and DENV-2, 16681. B) FRNT and LRNT of Luc-SIP. C) Linear

regression analysis of infectious titers and luciferase activity obtained from Luc-SIP

FRNT and LRNT.

H346Y mutation in E protein displayed similar antigenicity to parental DENV-2

strain

To apply the LRNT for studying the role of amino acid mutation at 346

position of DENV E protein, the Luc-SIP(H346Y) was generated. The mutant Luc-SIP

was then used to test for the neutralization by 4G2 antibody in comparison to Luc-SIP.

The FRNT50 of Luc-SIP and Luc-SIP (H346Y) were calculated to 1:141 and 1:156 of 4G

dilutions, respectively (Figure 5A). The LRNT50 of Luc-SIP and Luc-SIP(H346Y)

calculated from a fitting curve were 1:122 and 1:125 of 4G2 dilutions, respectively

(Figure 5B). A linear correlation calculated between infectious titers and luciferase

activity were R2

= 0.9867 and 0.9814, for Luc-SIP and Luc-SIP(H346Y), respectively

(Figure 5C-D). Taken together from the results, it was relatively implied that the

antigenicity of Luc-SIP(H346) was not altered from parental DENV strain when

recognized by 4G2 antibody. However, further testing with several types of antibody

against DENV is required to emphasize the concrete finding.



I535

Figure 5. FRNT and LRNT detecting the neutralization of Luc-SIP(H346Y) compared to

Luc-SIP. A) FRNT of Luc-SIP(H346Y) and Luc-SIP. B) LRNT of Luc-SIP(H346Y) and

Luc-SIP. C-D) Linear regression analysis between infectious titers and luciferase activity

from Luc-SIP(H346Y) and Luc-SIP. Mean represents 3 independent experiments.

Discussion

PRNT has been used as the “gold standard” method for the measurement of

neutralizing antibody to DENV. This method is the technical complex processes, which

sometimes causes an operator-error prone manual readout. Therefore, by improving the

detection system, the green fluorescent protein (GFP) or luciferase enzyme is introduced

into the viral genome, generating various types of flavivirus particle reporters. The

DENV particles carrying GFP or luciferase have been used to replace the naturally

DENV particles when tested for the neutralizing activity. Instead of reading the number

of plaque or foci generating by live DENV, GFP expressing cells or luciferase activity

can be detected by flow cytometer and luminometer, respectively with rapidity, stability,

reproducibility for high-throughput screening of antiviral drugs (Zou G et al.,2011;

Schoggins J et ai.,2012). Recently, Song and coworkers (Song K et al., 2014) have

developed the stable Renilla luciferase reporter DENV (Luc-DENV) as a novel reporter



I536

system for measuring neutralization activity of DENV antibody. Luc-DENV produces

robust luciferase signal in the BHK-21 cell. This developed assay is validated using

clinical samples from infected animal and patients, demonstrating a good correlation with

the traditional PRNT (Song K et al., 2014). However, there are limitations to technically

complex, as the lysis of infected cells is required for Luc-based neutralization assay and

the signal of luciferase reporter to be detected can be stable in a short period of time.

To develop a more feasible way to detect the luciferase activity from the

DENV particle reporters, we used the Luc-SIP expressing similar antigenicity to live

DENV as a tool for neutralizing antibody detection. This type of reporters secretes the

Lucia luciferase into the culture supernatant, avoiding the technical complex of cell lysis

steps. The Luc-SIP is also restricted for a single round of replication allowing a straight

forward for the result interpretation. It is noted that this replication characteristic of Luc-

SIP still permit the large scale production of the reporter stocks as we could derived large

amount of the particle by amplifying in C-expressing C6/36 cell line (Sangiambut et al.,

2013).

Commonly, neutralizing antibody is induced against three ectodomains (EDs)

of E protein (Gubler D.,1998). Most mouse monoclonal antibodies (MAbs) that strongly

neutralize DENV bind to epitope on the lateral ridge (LR) and A strand of EDIII (Pierson

TC et al., 2008; Shrestha B et al., 2010; Sukupolvi-Petty S et al., 2010). Interestingly, the

study of genetic variation of DENV-2 E protein in Thailand (data from the NCBI dengue

virus database), since 1974 to 2010 demonstrated that majority of E protein sequence was

mutated at amino acid position 346. The replacement of histidine with tyrosine is

observed concomitantly to time. Additionally, substitution at H346Y was previously

found in DENV-2 from mosquito and human plasma samples (Puiprom et al., 2010;

Pitaksajjakul et al., 2016). This occurrence suggests that the variation found at this

position is not due to the natural escape of DENV-2 from immune selection pressures

occurring in the hosts. E protein amino acid 346 is a surface-exposed residue on EDIII-

lateral ridge. This position is buried in the mature virus but may become surface

accessible as part of the ensemble of transitional states (Lok S et al., 2008), which likely

reflect “breathing” of the virion. This may explain why substitutions at position H346

reduced binding of several type-specific neutralizing antibodies (Sukupolvi-Petty S et al.,

2010). However, the neutralization behavior of anti-E antibody used in our study did not

show difference LNRT50 for Luc-SIP(H346Y) and Luc-SIP. This is suggested that a

single amino acid change in this position does not alter the total antigenicity to antibody

used in our study. It should be better to test the neutralization effect on this H346Y

mutation with other panel of anti-E specific antibody to obtain the strong results.

Conclusions In this study, we aimed to develop luciferase the LRNT for detecting DENV-2

neutralizing antibody using Luc-SIP. We demonstrated that Luc-SIP had antigenic

similarity to live DENV-2, strain 16681 when tested for the neutralizing property of the

well-characterized anti-E MAb 4G2. This result suggested that Luc-SIP should be used in

replacement of the live virus for detecting DENV neutralizing antibody. Further assay is



I537

to validate the test with DENV-infected serum to make sure it is applicable. In addition,

we also applied the LRNT to study the role of H346Y mutation regarding to the

antigenicity change among DENV strains observed for times. Therefore, we should be

able to use this developed method in many directions to overcome the bottleneck in the

area of disease diagnosis, epidemiology study and vaccine development of DENV.

Reference Chompoosri J, Thavara U, Tawatsin A, Anantapreecha S, Siriyasatien P. (2011).

“Seasonal Monitoring of Dengue Infection in Aedes aegypti and Serological

Feature of Patients with Suspected Dengue in 4 Central Provinces of Thailand.”

Thai J Vet Med; 42(2): 185-193.

Fibriansah G, Thiam N, Kostyuchenko V, Lee J, Lee S, Wang J, Lok S. (2013).

“Strutural changes in dengue virus when exposed to a temperature of 37 C.” J

Virol. Jul; 87(13); 7585-9

Gubler DJ. “Dengue and dengue hemorrhagic fever.” (1998). Clin Microbiol Rev; 11:

480- 496.

Guzman M, Halstead S, Artsob H, Buchy P, Farrar J, Gubler D, Hunsperger E, Kroeger

A, Margolis H, Martínez E, Nathan M, Pelegrino J, Simmons C, Yoksan S,

Peeling R. (2010). “Dengue: a continuing global threat.” Nat. Rev. Microbiol; 8:

7–16.

Igarashi A. (1978). “Isolation of a Singh's Aedes albopictus cell clone sensitive to

Dengue and Chikungunya viruses.” J Gen Virol Sep; 40: 531-544.

Halstead SB. (2007). “Dengue.” Lancet; 370: 1644–1652.

Lindenbach BD, Jurgen TH, Rice CM. (2007). “Flaviviridae: the viruses and their

replication.” Fields virology,5th ed, vol 1; 1101-1152.

Lok SM, Kostyuchenko V, Nybakken GE, Holdaway HA, Battisti AJ, Sukupolvi-Petty S,

Sedlak D, Fremont DH, Chipman PR, Roehrig JT, Diamond MS, Kuhn RJ,

Rossmann MG.(2008). “Binding of a neutralizing antibody to dengue virus alters

the arrangement of surface glycoproteins.” Nat. Struct. Mol. Biol. 15:312– 317.

Okuno Y, Igarashi A, Fukai K. (1978). “Neutralization tests for dengue and Japanese

encephalitis viruses by the focus reduction method using peroxidase-anti-

peroxidase staining.” Biken J; 21:137–147.

Pierson TC, Fremont DH, Kuhn RJ, Diamond MS. (2008). “Structural insights into the

mechanisms of antibody-mediated neutralization of flavivirus infection:

implications for vaccine development.” Cell Host Microbe 4:229 –238.

Pitaksajjakul P, Benjathummarak S, Son H, Thongrungkiat S, Pongrama Ramasoota.

(2016). “Genomic studies of envelope gene sequences from mosquito and human

samples from bangkok, Thailand.” Springer plus; 5:1960.

Puiprom O, Yamashita A, Sasayama M, Limkittikul K, Boonha K, Jittmitraphap

A, Leaungwutiwong P, Kurosu T, Ramasoota P, Ikuta K. (2011). “Co-existence

of major and minor viral populations from two different origins in patients



I538

https://www.ncbi.nlm.nih.gov/pubmed/?term=Fibriansah%20G%5BAuthor%5D&cauthor=true&cauthor_uid=23637405

https://www.ncbi.nlm.nih.gov/pubmed/?term=Ng%20TS%5BAuthor%5D&cauthor=true&cauthor_uid=23637405

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kostyuchenko%20VA%5BAuthor%5D&cauthor=true&cauthor_uid=23637405

https://www.ncbi.nlm.nih.gov/pubmed/?term=Lee%20J%5BAuthor%5D&cauthor=true&cauthor_uid=23637405

https://www.ncbi.nlm.nih.gov/pubmed/?term=Lee%20S%5BAuthor%5D&cauthor=true&cauthor_uid=23637405

https://www.ncbi.nlm.nih.gov/pubmed/?term=Wang%20J%5BAuthor%5D&cauthor=true&cauthor_uid=23637405

https://www.ncbi.nlm.nih.gov/pubmed/?term=Lok%20SM%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kostyuchenko%20V%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Nybakken%20GE%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Holdaway%20HA%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Battisti%20AJ%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Sukupolvi-Petty%20S%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Sukupolvi-Petty%20S%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Sedlak%20D%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Fremont%20DH%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Chipman%20PR%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Roehrig%20JT%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Diamond%20MS%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kuhn%20RJ%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kuhn%20RJ%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Rossmann%20MG%5BAuthor%5D&cauthor=true&cauthor_uid=18264114

https://www.ncbi.nlm.nih.gov/pubmed/?term=Puiprom%20O%5BAuthor%5D&cauthor=true&cauthor_uid=21872571

https://www.ncbi.nlm.nih.gov/pubmed/?term=Yamashita%20A%5BAuthor%5D&cauthor=true&cauthor_uid=21872571

https://www.ncbi.nlm.nih.gov/pubmed/?term=Sasayama%20M%5BAuthor%5D&cauthor=true&cauthor_uid=21872571

https://www.ncbi.nlm.nih.gov/pubmed/?term=Limkittikul%20K%5BAuthor%5D&cauthor=true&cauthor_uid=21872571

https://www.ncbi.nlm.nih.gov/pubmed/?term=Boonha%20K%5BAuthor%5D&cauthor=true&cauthor_uid=21872571

https://www.ncbi.nlm.nih.gov/pubmed/?term=Jittmitraphap%20A%5BAuthor%5D&cauthor=true&cauthor_uid=21872571

https://www.ncbi.nlm.nih.gov/pubmed/?term=Jittmitraphap%20A%5BAuthor%5D&cauthor=true&cauthor_uid=21872571

https://www.ncbi.nlm.nih.gov/pubmed/?term=Leaungwutiwong%20P%5BAuthor%5D&cauthor=true&cauthor_uid=21872571

https://www.ncbi.nlm.nih.gov/pubmed/?term=Kurosu%20T%5BAuthor%5D&cauthor=true&cauthor_uid=21872571

https://www.ncbi.nlm.nih.gov/pubmed/?term=Ramasoota%20P%5BAuthor%5D&cauthor=true&cauthor_uid=21872571

https://www.ncbi.nlm.nih.gov/pubmed/?term=Ikuta%20K%5BAuthor%5D&cauthor=true&cauthor_uid=21872571

secondarily infected with dengue virus serotype 2 in Bangkok.” Biochemical and

Biophysical Research Communications; 413: 136–142.

Rothman AL. (2011). “Immunity to dengue virus: a tale of original antigenic sin and

tropical cytokine storms”. Nature immunology; 532-543.

Russell PK and Nisalak A. (1967). “Dengue virus identification by the plaque reduction

neutralization test.” J Immunol, 99(2): 291-6.

Sangiambut S, Suphatrakul A, Sriburi R, Keelapang P, Puttikhunt C, Kasinrerk

W, Malasit P, Sittisombut N. (2013). “Sustained replication of dengue

pseudoinfectious virus lacking the capsid gene by trans-complementation in

capsid-producing mosquito cells.” Virus Res; 174: 37-46.

Schoggins JW, Dorner M, Feulner M, Imanaka N, Murphy MY, Ploss A. (2012).

“Dengue reporter viruses reveal viral dynamics in interferon receptor-deficient

mice and sensitivity to interferon effectors in vitro.” Proc Natl Acad Sci USA;

109: 14610-14615.

Shrestha B, Brien J, Sukupolvi-Petty S, Austin S, Edeling M. (2010). “The development

of therapeutic antibodies that neutralize homologous and heterologous genotypes

of dengue virus type 1”. PLoS Pathog. 6:e1000823.

Song KY, Zhao H, Jiang ZY, Li XF, Deng YQ, Jiang T, Zhu SY, Shi PY, Zhang FC, Qin

ED, Qin CF. (2014). “A novel reporter system for neutralizing and enhancing

antibody assay against dengue virus.”BMC Microbiology; 14: 44-52.

Sriburi R, Keelapang P, Duangchinda T, Pruksakorn S, Maneekarn N, Malasit P,

Sittisombut N. (2001). “Construction of infectious dengue 2 viruscDNA clones

using high copy number plasmid.” J Virol Methods;92(1):71-82.

Sukupolvi-Petty S, Austin KS, Engle M, Brien JD, Dowd KA, Williams KL, Johnson S,

Rico-Hesse R, Harris E, Pierson TC, Fremont DH, Diamond MS. (2010).

“Structure and Function Analysis of Therapeutic Monoclonal Antibodies against

Dengue Virus Type 2.” Journal of virology; 9227–9239.

Thavara U, Siriyasatien P, Tawatsin A, Asavadachanukorn P, Anantapreecha S,

Wongwanich R, Mulla MS. (2006). “Double infection of heteroserotypes of

dengue viruses in field populations of Aedes aegypti and Aedes albopictus

(Diptera: Culicidae) and serological features of dengue viruses found in patients

in southern Thailand”. Southeast Asian J Trop Med Public Health; 37(3): 468-

476.

WHO. (2009). “Dengue guidelines for diagnosis, treatment, prevention and control: new

edition.”

Zou G, Xu HY, Qing M, Wang QY, Shi PY. (2011). “Development and characterization

of a stable luciferase dengue virus for high-throughput screening”. Antiviral Res;

91: 11-19.



I539

http://www.ncbi.nlm.nih.gov/pubmed/?term=Suphatrakul%20A%5BAuthor%5D&cauthor=true&cauthor_uid=23466247

http://www.ncbi.nlm.nih.gov/pubmed/?term=Sriburi%20R%5BAuthor%5D&cauthor=true&cauthor_uid=23466247

http://www.ncbi.nlm.nih.gov/pubmed/?term=Keelapang%20P%5BAuthor%5D&cauthor=true&cauthor_uid=23466247

http://www.ncbi.nlm.nih.gov/pubmed/?term=Puttikhunt%20C%5BAuthor%5D&cauthor=true&cauthor_uid=23466247

http://www.ncbi.nlm.nih.gov/pubmed/?term=Malasit%20P%5BAuthor%5D&cauthor=true&cauthor_uid=23466247

http://www.ncbi.nlm.nih.gov/pubmed/?term=Sittisombut%20N%5BAuthor%5D&cauthor=true&cauthor_uid=23466247

http://www.ncbi.nlm.nih.gov/pubmed/23466247

The 7th National and International Graduate Study ...

Documents

Transcript of The 7th National and International Graduate Study ...