Target Cells of 3-Melanocyte-Stimulating Hormone Detected ...

Target Cells of g3-Melanocyte-Stimulating HormoneDetected through Intracellular Ca21 Responses inImmature Rat Pituitary Constitute a Fraction of AllMain Pituitary Cell Types, but Mostly Express MultipleHormone Phenotypes at the Messenger Ribonucleic AcidLevel. Refractoriness to Melanocortin-3 ReceptorBlockade in the Lacto-Somatotroph Lineage*

M. ROUDBARAKI, A. LORSIGNOL, L. LANGOUCHE†, G. CALLEWAERT,H. VANKELECOM, AND C. DENEF

Laboratories of Cell Pharmacology and Physiology (G.C.), University of Leuven Medical School,Campus Gasthuisberg (O & N), B-3000 Leuven, Belgium

ABSTRACTg3-MSH has recently been shown to be a biologically active peptide

in the rat anterior pituitary. It induces a sustained rise in intracel-lular free calcium levels ([Ca21]i) in a relatively small population ofimmature pituitary cells. The present study was intended to identifythe target cells of this peptide and to discern the signal-transducingmelanocortin (MC) receptor. In dispersed pituitary cells from 14-day-old rats, increasing doses of g3-MSH (0.1, 1, and 10 nM) evoked asustained oscillating [Ca21]i rise in an increasing number of cells (upto 14.5%). Within the responsive cells, 53% showed GH immunore-activity (-ir), 12% showed PRL-ir, 2% showed TSHb-ir, 5% showedLHb-ir, and 10% showed ACTH-ir, whereas 18% did not express anyhormone-ir to a detectable level. As assessed by single cell RT-PCR forthe presence of pituitary hormone messenger RNA (mRNA), 26% ofthe g3-MSH-responsive cells contained only GH mRNA, 5% containedonly PRL mRNA, and 4% contained only TSHb mRNA. Twenty-twopercent contained mRNA of GH, PRL, and TSHb in various dual ortriple combinations. About 24% of the g3-MSH-responsive cells ex-pressed POMC mRNA, mostly together with other mRNAs, i.e. withGH mRNA and/or PRL mRNA or with mRNA of GH, PRL, and TSHb.Eighteen percent of the responsive cells expressed LHb, all of themtogether with mRNA of GH, PRL, and TSHb in various combinations.The absence of hormone mRNA was found in less than 1% of theresponsive cells. In cells chosen at random (representative of the totalpituitary cell population), the proportion of cells expressing two or

multiple hormone mRNAs was twice as low as that in the g3-MSH-responsive population, whereas the proportion of cells expressing asingle hormone mRNA was twice as high (about two thirds of all cells).Moreover, unlike in the g3-MSH-responsive cell population, randomlychosen cells were found that coexpressed POMC mRNA with LHbmRNA.

The effect of g3-MSH on [Ca21]i was blocked by the MC-3 receptorantagonist SHU9119 (used up to a 1000-fold excess) in 46% or less ofthe responsive cells. SHU9119 failed to block the [Ca21]i response tog3-MSH in PRL-, GH-, and TSHb-ir cells, but it did block the responsein most ACTH-ir cells and in cells expressing no hormone to a de-tectable level. Single cell RT-PCR revealed that expression of MC-3receptor mRNA was detected in only 16% of g3-MSH-responsive cells.

The present data suggest that the target cells of g3-MSH in termsof [Ca21]i responses in the immature rat pituitary constitute sub-populations of all main pituitary cell types, including nonhormonal (orlow expression hormonal) cells. However, in contrast to the totalpituitary cell population, most of these cells display multilineage geneactivation at the mRNA level, i.e. express mRNA of GH, PRL, TSHb,POMC, and LHb in dual, triple, or quadruple combinations. Althoughg3-MSH may act through the MC-3 receptor in a portion of these cells,most of these cells (mainly in the lacto-somatotroph lineage) maytransduce the signal through another receptor or through an MC-3receptor with unconventional binding characteristics. (Endocrinology140: 4874–4885, 1999)

g3-MSH AND THE C-terminally truncated derivativesg1- and g2-MSH, are peptides that can be generated

from the N-terminal fragment of POMC (POMC1–74) (1).These peptides exert similar as well as divergent effects in the

brain, adrenal gland, kidney, and cardiovascular system (re-viewed in Refs. 2 and 3). We recently showed that g3-MSHis biologically active in the anterior pituitary of immaturerats. It has a mitogenic action on lactotrophs, somatotrophs,and thyrotrophs (4). Moreover, it induces a sustained oscil-lating rise in the intracellular free Ca21 concentration([Ca21]i) in an unidentified small proportion (;14%) of thecells (5). The peculiarity of this response is that the magni-tude and the frequency of [Ca21]i oscillations does notchange with the concentrations of g3-MSH applied, indicat-ing that the cells respond in an all or none manner. However,increasing the concentration results in a significant rise in thepercentage of cells showing [Ca21]i responses to the peptide,suggesting that the dose determines the number of cells

Received February 22, 1999.Address all correspondence and requests for reprints to: Prof. Carl

Denef, Laboratory of Cell Pharmacology, University of Leuven MedicalSchool, Campus Gasthuisberg (O & N), B-3000 Leuven, Belgium. E-mail:[email protected].

* This work was supported by grants from the Geconcerteerde Onder-zoeksacties (GOA 1997–2001) and the “Fonds voor WetenschappelijkOnderzoek Vlaanderen.”

† Supported by a fellowship from the Flemish “Instituut voor bev-ordering van het wetenschappelijk onderzoek in de industrie” (I.W.T.).

0013-7227/99/$03.00/0 Vol. 140, No. 10Endocrinology Printed in U.S.A.Copyright © 1999 by The Endocrine Society

4874

Dow

nloaded from https://academ

ic.oup.com/endo/article/140/10/4874/2991015 by guest on 19 July 2022

recruited to respond or that the threshold of response differsaccording to cell type. The latter characteristic is interestingin view of recent findings that signaling molecules duringvertebrate development, such as members of the transform-ing growth factor-b family, act by establishing a concentra-tion gradient from the site of production and that distinctthreshold concentrations are sufficient to pattern distinct celltypes and activate different genes (6–9).

The candidate receptor mediating the actions of g3-MSHis the melanocortin-3 (MC-3) receptor, as this receptor is theonly one among the five MC receptors known today thatmediates the actions of g3-MSH in low nm doses (10–12).However, several observations on the action of g-MSH pep-tides in the cardiovascular system suggest the existence ofother receptors for which these peptides have high affinity(3). Although MC-3 receptor messenger RNA (mRNA) ispresent in the anterior pituitary of immature rats (5), wefound that the MC-3 receptor antagonist SHU9119 (13)blocked the effect of g3-MSH on [Ca21]i in less than 50% ofthe responsive cells (5), suggesting that more than one g3-MSH receptor may exist in the pituitary: a typical MC-3receptor and either a variant of the latter or a hitherto un-identified g3-MSH receptor.

In view of the above data, the present investigation wasintended to identify the cell type(s) displaying [Ca21]i re-sponses to g3-MSH and to determine which of the responsivecell types are sensitive and which are refractory to blockadeby SHU9119. The cells showing [Ca21]i responses to g3-MSHwere visualized by fluo-3 imaging, and the hormone phe-notypes expressed were identified at the protein level bymeans of immunostaining and at the mRNA level by singlecell RT-PCR. The latter technique has been used for thesimultaneous detection of different mRNA species within asingle cell (14, 15) in complex tissues, such as brain (16),hemopoietic system (17), and pituitary gland (18).

Materials and MethodsPeptides

g3-MSH was obtained from Peninsula Laboratories, Inc., Europe (Mer-seyside, UK). Ac-Nle4-cyclo[Asp5,(d-Nal (2)7,Lys10]a-MSH-(4–10)-NH2(SHU9119) (13) was purchased from Neosystem Laboratoire (Strasbourg,France). Peptides were prepared as stock solution (0.1 mm) in 0.1% crys-talline BSA and kept at 225 C. All reagents were analytical grade.

Animals

Female Wistar rats, 12–15 days old, were obtained from the Univer-sity Animal Breeding Facility (Heverlee, Belgium). They were killed bydecapitation.

Pituitary cell dissociation and short term culture

Whole pituitaries were cut into small tissue blocks and enzymaticallydispersed into single cells as previously described (19–21). For Ca21

imaging, dispersed cells were seeded on a Lab-Tek chamber slide (1.8cm2/chamber; 500,000 cells/chamber; Nunc, Roskilde, Denmark). Forphotometric Ca21 recording followed by single cell RT-PCR, dispersedcells were seeded on glass coverslips (Prochilab, Bordeaux, France). Thecoverslips (Bellco, Vineland, NJ) used for identification by immuno-staining after Ca21 imaging were photoengraved with a numbered/lettered grid to enable accurate location of the Ca21-recorded cells. In allcases, Lab-Tek and glass coverslips were coated with poly-l-ornithine(0.001%; Sigma Chemical Co., St. Louis, MO). Cells were maintained inserum-free defined medium (19–21) containing 0.5% BSA at 37 C in a

humidified atmosphere (1.5% CO2-98.5% air), and [Ca21]i changes inresponse to g3-MSH were tested within 24 or 48 h of culture.

Detection of [Ca21]i changes in response to g3-MSH

[Ca21]i was recorded in individual cells either by fluo-3 video im-aging, allowing the simultaneous study of 20–40 cells/field (immuno-staining studies), or by conventional photometric microspectrofluorom-etry (patch-clamp single cell RT-PCR studies). The culture medium wasreplaced with HBSS containing 1.3 mm Ca21, pH 7.3. Cells were thenincubated for 20 min at 37 C with 10 mm fluo-3 acetoxymethyl ester(fluo-3/AM) and 0.02% pluronic F127 in HBSS. After loading, cells werewashed with and kept in HBSS during recordings. Recording of thefluorescence was performed at room temperature. The dye was excitedat 488 nm, and the emitted light was recorded at 530 nm.

Details of fluo-3 video imaging, including the criteria used to determinewhether a given cell type was responding, were previously described (5,21). As the lack of emission or excitation spectral shift of fluo-3 upon Ca21

binding makes it difficult to calibrate fluorescence signals in terms of preciseabsolute values of [Ca21]i, all fluorescence measurements (expressed inarbitrary units) are values normalized to the function of the basal fluores-cence intensities after background correction. It is then possible to extrap-olate [Ca21]i from fluo-3 fluorescence changes and to consider that anincrease in fluo-3 fluorescence corresponds to an increase in [Ca21]i and adecrease of fluorescence, to a decrease of [Ca21]i.

For the photometric microspectrofluorometry in the patch-clamp sin-gle cell RT-PCR studies, the glass coverslips holding the cultured cellswere sealed in a hollowed plastic petri dish, which was placed on themicroscope stage equipped for epifluorescence (340 oil immersion ob-jective, NA 1.3, Nikon, Melville, NY). Emitted fluorescence was mea-sured from a field slightly larger than the cell under study and detectedby a photomultiplier tube (Hamamatsu type R928, Hamamatsu Pho-tonics, Hamamatsu City, Japan) at 535 6 35 nm. Fluorescence signalswere digitized on a PC and analyzed off-line with Axotape Software(Version 2.0.2, Axon Instruments, Inc., Foster City, CA). Fluorescencesignals are expressed as ratios (F/F0) of the fluorescence during a re-sponse (F) relative to the resting fluorescence before stimulation (F0).

Test substances (g3-MSH, SHU9119), diluted in recording medium(HBSS), were applied to the recorded cells by perfusion in the case ofvideo imaging and by low pressure ejection from micropipettes (3- to5-mm tip diameter) positioned approximately 40 mm from the cell in thecase of the photometric technique.

As previously described (21), 53% of the pituitary cells displayedspontaneous [Ca21]i oscillations with variable frequency and amplitudeand therefore were called spontaneously oscillating cells. Cells notshowing these oscillations were called nonoscillating cells. Both oscil-lating and nonoscillating cells were included in the present study. Onlya small number of cells that were spontaneously nonoscillating during1 min of examination started to show some spontaneously oscillating[Ca21]i transients during a further 2-min examination; this number was8 cells of 347 cells registered (2.3%). There was no additional effect ofapplication of the vehicle only; 10 of 483 registered cells (2.07%) becamespontaneously oscillating. As among the g3-MSH-responsive cells therewere about twice as much spontaneously oscillating as spontaneouslynonoscillating cells (5), and as data for responding cells included bothof these cell populations, the proportional number of potentially falsepositive responders to g3-MSH would be about 0.7%, which was withinexperimental variation.

Identification of cells responsive to g3-MSH, in the absenceand presence of SHU9119, by triple immunofluorescence ofpituitary hormones

The accurate location of all pituitary cells for which [Ca21]i had beenrecorded (g3-MSH-responsive and nonresponsive cells) was ascertainedby the numbered and lettered grid pattern on the coverslip. In this way,all [Ca21]i-recorded cells could be caught again after the immunostain-ing step to determine their hormone immunoreactivity (-ir) content.

The hormone content of the cells was identified as previously de-scribed (21, 22). Briefly, cells were fixed in Zamboni fluid (4% parafor-maldehyde and 15% saturated picric acid in phosphate buffer, pH 7.6).In a first series, triple immunostaining was performed using rabbitantiserum against rat PRL (rabbit anti-rPRL-IC5, diluted 1:6,000), mon-

g3-MSH AND MULTILINEAGE GENE EXPRESSION IN PITUITARY 4875

Dow



key antiserum against rat GH (monkey anti-rGH-IC1, diluted 1:6,000),and guinea pig antiserum against rat TSHb (guinea pig anti-rTSHb-IC,diluted 1:4,000), all provided by the NIDDK through the National Hor-mone and Pituitary Program. Cells were incubated with all antiseraovernight at 4 C. The secondary antibodies, Cy3-labeled goat antirabbitIgG(H1L) (diluted 1:200; from Jackson ImmunoResearch Laboratories,Inc., West Grove, PA; orange-red fluorescence), fluorescein isothiocya-nate (FITC)-labeled goat antimonkey IgG (diluted 1:150; from Nordic,Tilburg, The Netherlands; green fluorescence), and 7-amino-4-methyl-coumarin-3-acetic acid (AMCA)-labeled antiguinea pig IgG(H1L) (di-luted 1:100; from Jackson ImmunoResearch Laboratories, Inc.; blue flu-orescence), were applied for 2 h at room temperature. In a second series,monkey anti-rGH antiserum, rabbit antiserum against human ACTH(diluted 1:10,000), and guinea pig antiserum against rLH-b (diluted1:4,000), all provided by the NIDDK through the National Hormone andPituitary Program, were simultaneously applied, followed by incuba-tion with the above-mentioned second antibodies. The immunoreactivecells were visualized under a Leica Corp. microscope equipped fortransmitted light fluorescence (Leica Corp., Wetzlar, Germany) using I3,UVA, and N2.1 filters for FITC, AMCA, and Cy3 fluorescence, respec-tively. Omission of the first antibody abolished staining. Replacing thefirst antibody with nonimmune rabbit or guinea pig serum did not resultin any fluorescent staining with the FITC-, AMCA-, or Cy3-labeledantibodies, all three applied with each of the primary nonimmune sera.For each hormone staining, positive fluorescent cells were only seen withthe homologous fluorescent-labeled second antibody and not with theheterologous second antibodies. For example, positive staining withrabbit antirat PRL antiserum was obtained with Cy3-labeled goat an-tirabbit IgG, but not with FITC-labeled goat anti-monkey IgG or AMCA-labeled anti-guinea pig IgG.

Single cell [Ca21]i measurements and single cell RT-PCR ofhormone, MC-3 receptor, and L19 mRNAs

Single cell RT-PCR was performed using protocols similar to thosepreviously described (23, 24). Details in the present study are as follows.

Detection and harvest of cytoplasm of cells showing [Ca21]i changes in responseto 10 nm g3-MSH. The cells responsive to g3-MSH were detected on thebasis of an increase in fluo-3 fluorescence reflecting an increase in [Ca21]iincrease as described above. The average time between the applicationof g3-MSH and response of the cells was 28.4 6 1.87 sec (mean 6 sem;

calculated for 92 cells). In case a change in fluo-3 fluorescence was noted,the cytoplasm of the responsive cell was collected using the patch-clamptechnique. Patch pipettes were pulled from heated (200 C, overnight)borosilicate glass tubing. When filled with the internal pipette solution(10 ml 140 mm KCl, 2 mm MgCl2, 1.1 mm EGTA, and 10 mm HEPES, pH7.25), the patch pipettes showed an electrical resistance of 2–5 MV. Ahigh resistance seal was formed between the patch pipette and the cellmembrane (25). After establishing a whole cell patch-clamp configura-tion, the cell contents were aspirated under visual control. The pipettecontent (;8 ml) was ejected into an Eppendorf microtube without touch-ing the tube wall, immediately frozen, and kept at 280 C until processed.For each cell patch-clamped and harvested, a new pipette was used.

RT reaction. The RT reaction for each cell was performed on the harvestedcytoplasm using random hexamer primers without prior RNA purifi-cation. Each individual cell cytoplasm was adjusted to 8.8 ml with in-ternal pipette solution, then heated to 65 C for 10 min to break upsecondary mRNA structures and placed on ice for 5 min or more. TheRT reaction was performed in a final volume of 20 ml for each cellcytoplasm using the following final reaction conditions: 10 mm Tris-HCl(pH 8.3); 56 mm KCl; 3.8 mm MgCl2; 0.5 mm each of deoxy (d)-ATP,dCTP, dGTP, and dTTP (Perkin-Elmer Corp., Foster City, CA); 3 mmrandom hexamer oligonucleotides (Perkin-Elmer Corp.); 50 U murineleukemia virus (MuLV) reverse transcriptase (Perkin-Elmer Corp.); and20 U ribonuclease inhibitor (Perkin-Elmer Corp.). The reaction mixturewas incubated for 10 min at 20 C to allow hybridization of the primersto the RNA. The RT was performed at 42 C for 20 min, followed by a5-min incubation at 95 C, then chilled on ice and stored at 220 C untilPCR amplification. In the case of RT of MC-3 receptor mRNA, cellcytoplasm was divided into a portion on which the RT reaction wasperformed and a control portion on genomic DNA without RT (MuLVreverse transcriptase and ribonuclease inhibitor omitted), as MC recep-tor genes are intronless.

PCR amplification. The PCR primers used to amplify the RT-generatedpituitary hormone, MC-3 receptor, and ribosomal protein L19 comple-mentary DNAs (cDNAs) were designed on the basis of establishedGenBank sequences with commercially available software (GenejockeyII, Biosoft, Cambridge, UK). Primers were synthesized by PharmaciaBiotech (Uppsala, Sweden). The primer sequences, GenBank accessionnumbers of the template sequence with positions of the primers, andexpected sizes of the amplified fragments are summarized in Table 1.

TABLE 1. PCR amplification of pituitary hormones, MC-3 receptor, and ribosomal protein L19 mRNAs (cDNAs) and restriction analysisof the amplified fragments: oligonucleotide primers and expected fragment sizes

mRNA to bedetected

PCR primers Expected fragment size (bp)

Sequence Position in GenBank sequence(accession no.)

cDNA GenomicDNAPCRPCR Restriction

GH S: 59-GCTGCAGACTCTCAGACTCCCTGG-39 464–470, 655–672 (J00739, V01239) 242 185, 57 (HaeIII) 1087AS: 59-GTCTCTGAGAAGCAGAACGCA-39 1608–1587 (J00739, V01239)

PRL S: 59-ACCATGAACAGCCAGGTGTCAG-39 474–494 (J00760) 291 244, 47 (HaeIII) 1536AS: 59-CTTGTCTTCAGGAGTAGCTAG-39 453–434 (J00762)

TSHb S: 59-CCGTGCTTTTCGCTCTTGCTTGTG-39 4265–4288 (M13897, K01935) 278 143, 135 (EcoRV) 650AS: 59-GGCAACGGGGTAGGAGAAATAAGG-39 4889–4866 (M13897, K01935)

LHb S: 59-TTCACCACCAGCATCTGTGC-39 1192–1210 (J00749, M54957) 288 191, 97 (ApaI) 513AS: 59-TGGGCATCAGAAGAGGAGAAGG-39 1693–1682 (J00749, M54957)

POMC S: 59-ATAGACGTGTGGAGCTGGTG-39 131–150 (K01878) 254 166, 88 (PstI) 403AS: 59-TCTTCCTCCGCACGCCTCTGCGCTGA-39 273–248 (J00759)

a-GSU S: 59 CTTCATTCTCTTCCTGATGG 39 126–144 (D00575) 284 176, 108 (SspI) 1984AS: 59 TAACAAGTGCTACAGTGGCA 39 408–389 (D00575)

MC3-R S: 59-ACATGCTGGTGAGCCTGTCCAA-39 549–570 (X70667) 226 149, 77 (AvaII) 226AS: 59-CTAACCGTCATGATGCTGTGGTAAC-39 774–750 (X70667)

Nested S: 59-CGTGGTTATCAACAGCGACTC-39 592–612 (X70667) 183 ND 183AS: 59-CTAACCGTCATGATGCTGTGGTAAC-39 774–750 (X70667)

L19 S: 59-TCGATGCCGGAAGAACACCTT-39 1994–2014 (X82202) 186 116, 70 (BamHI) 1227AS: 59-AGGCTGTGATACATATGACGG-39 2903–2895, 3220–3209 (X82202)

S, Sense primer; AS, antisense primer; MC3-R, MC3 receptor; ND, not determined.

4876 g3-MSH AND MULTILINEAGE GENE EXPRESSION IN PITUITARY Endo • 1999Vol 140 • No 10

Dow



PCR of the RT-generated cDNA was performed using a GeneAmpPCR System 2400 thermal cycler (Perkin Elmer Corp., Branchburg, NJ).For detection of cDNA of GH and PRL (in duplex PCR), TSHb, POMC,LHb, glycoprotein hormone a-subunit (aGSU), and ribosomal proteinL19 (all in independent amplification reactions), PCR was performed byadding 3 ml RT template to a mixture of (final concentrations): 50 mmKCl, 10 mm Tris-HCl (pH 8.3), 4.5 mm MgCl2, 200 mm of each dNTP,sense and antisense primer (1 mm of each), and 1 U AmpliTaq Gold(Perkin Elmer Corp.) in a final volume of 25 ml. For PCR of MC-3 receptorcDNA, 5 ml reverse transcribed (1RT) and nonreverse transcribed (2RT)template was used in a final volume of 25 ml. The conditions of DNAamplification were the same for all pairs of primers and included aninitial denaturation step of 10 min at 95 C (which also activates the Goldvariant of the Taq polymerase); 45 cycles of 20 sec at 95 C, 20 sec at 60C, and 30 sec at 72 C; and finally 7 min at 72 C. The nested PCR for MC-3receptor cDNA was performed using 2 ml of the first PCR product astemplate under the same reaction conditions, except for the final con-centration of MgCl2 (1.5 mm), and the number of cycles (5 40). Half ofthe PCR samples were electrophoresed in a 2% agarose gel 5 stainedwith ethidium bromide (EtBr; 0.5 mg/ml).

Sensitivity of the RT-PCR. To assess the sensitivity of our RT-PCR method,standards of POMC and MC-3 receptor cDNA and of POMC mRNAwere prepared. MC-3 receptor cDNA was cloned by RT-PCR from totalrat pituitary RNA using as 59-primer 59-CGCAAGCTTCGCCGATAAC-CATGAACTCT-39 containing a HindIII restriction site, and as 39-primer59-CGCGGATCCCTCGGGGTTCCTAGCCCAC-39 containing a BamHIsite (5). The 1012-bp amplified fragment was inserted into the HindIIIand BamHI cloning sites of pcDNA3 (Invitrogen, Groningen, The Neth-erlands). Plasmid DNA was propagated, purified, and digested withHindIII and BamHI, and the MC-3 receptor cDNA fragment was elutedfrom agarose gel with the Geneclean II Kit (Vista, CA). POMC cDNA wasobtained by EcoRI digestion of pBSrPOMC (prPAE, provided by Dr. R.Mains, Johns Hopkins University, Baltimore, MD), followed by gel pu-rification of the 907-bp fragment (QIAquick Gel Extraction Kit, QIAGEN,Valencia, CA). POMC mRNA was prepared by in vitro transcription oflinearized pBSrPOMC with T7 RNA polymerase. RNA-free pBSrPOMCwas prepared with the QIAGEN Plasmid Kit, linearized with BamHI,ethanol precipitated, and used for in vitro transcription during 3 h at 37C in the following reaction conditions: 4 mg linearized DNA template,1 3 transcription buffer, 40 U T7 RNA polymerase, 1 mm of each rNTP(all from Roche Molecular Biochemicals, Brussels, Belgium), and 20 Uribonuclease inhibitor (Perkin Elmer Corp.). Full-length transcripts (985bp) were purified from a nondenaturing 1% agarose gel by means of theQIAquick Gel Extraction Kit (QIAGEN) under ribonuclease-free condi-tions. Residual DNA template was removed by treatment with ribonu-clease-free deoxyribonuclease I (Life Technologies, Inc., Gaithersburg,MD). The concentrations of the cDNA and mRNA standards were mea-sured by spectrophotometry (absorbance at 260 nm) and/or by spec-trofluorometry using the PicoGreen double stranded DNA andRiboGreen RNA quantitation dyes from Molecular Probes, Inc. (Eugene,OR). PCR, as performed in the present study, detected 2–3 copies ofPOMC cDNA and 2–8 molecules of MC-3 receptor cDNA. With theRT-PCR method as described, we were able to detect 5–8 copies ofPOMC mRNA, meaning a 50% efficiency of the RT reaction. Taking intoaccount that only part of the RT mixture of the cell lysate is used foramplification, the detection limit of our RT-PCR method is judged to bein the range of 50 copies of mRNA/cell for both POMC and MC-3receptor (supposing that RT efficiency is ;50%). However, cellularenvironment and secondary and tertiary structures of RNA as presentin the cell cytoplasm may impose additional constraints.

Controls. As a positive control for the RT-PCR, total pituitary RNA wasused. Total RNA from pituitary cells of 14-day-old rats was isolated bythe guanidium thiocyanate-phenol-chloroform extraction procedure(26). After a deoxyribonuclease I (Life Technologies, Inc.) treatment toeliminate genomic DNA, 5 mg total RNA were reverse transcribed intocDNA at 42 C using random hexamer primers (Perkin Elmer Corp.) andMuLV reverse transcriptase (Perkin Elmer Corp.) in a 20-ml final volume,followed by PCR, both as described above.

RT and PCR were performed following procedures minimizing thechances of cross-contamination (27). To rule out contamination betweenreagents or individual PCR amplifications, the following controls were

performed in each experiment. First, for every two to four cells har-vested, a pipette control was included, i.e. the patch-clamp pipette washeld for a while in the close vicinity of a cell, and after withdrawal, thepipette content was ejected in the test tube and subjected to RT-PCR asdescribed for cell cytoplasm. Second, contamination from extraneoussources was checked by replacing the cellular template with water forevery set of cells analyzed by RT-PCR. Experiments were accepted onlyif all control lanes were negative. On only one occasion, in a set of sevencells, was there a positive RT-PCR signal in a pipette control, and thesecells were excluded from the study. Another control consisted of aspi-rating HBSS medium in which the cells had been incubated. GH and PRLmRNA signals were not detected in any of these control samples. Fur-thermore, amplification of genomic DNA was checked using primersthat flanked a sequence containing at least one intron or was ruled outusing primers that spanned the intron (see Table 1). As mentioned above,for detection of MC-3 receptor mRNA (intronless gene) the PCR wasperformed on 2RT and 1RT cytoplasm.

Reproducibility of the amplification reactions was verified on 25cell cytoplasm samples. The same PCR products were found in bothreactions.

Restriction analysis of RT-PCR products. To confirm the identity of theamplified products, restriction analysis was carried out. After electro-phoresis, PCR products were gel purified using the Geneclean II kit [BIO101, Inc. (Westburg, The Netherlands), or Polylab N.V. (Antwerpen,Belgium)] and used as a template for a second PCR with the same setof primers. The final reaction volume of 100 ml contained 1–3 ml gel-purified DNA, 50 mm KCl, 10 mm Tris-HCl (pH 8.3), 1.5 mm MgCl2, 100mm of each dNTP, 1 mm upstream primer, 1 mm downstream primer, and1 U AmpliTaq Gold. After 10 min at 95 C; 35 cycles of 20 sec at 95 C, 20sec at 60 C, and 30 sec at 72 C; and a final step of 7 min at 72 C forelongation, the PCR product was ethanol precipitated and resuspendedin 50 ml H2O. Eight-microliter aliquots were digested by appropriaterestriction enzymes (all from Roche Molecular Biochemicals, Brussels,Belgium) as summarized in Table 1. Digested products were analyzedby electrophoresis in EtBr-stained 2% agarose gel.

Data analysis

All experiments were repeated several times on different pituitariesand different cultures obtained from different animals. Where necessary,values were expressed as the mean 6 sem of several independent ex-periments and compared by ANOVA with post-hoc Scheffe’s multiplecomparison tests. To analyze the differences in the number of cellsresponsive to g3-MSH in the absence and presence of SHU9119, the x2

test or Fisher’s exact test was used. These tests were also used to comparethe number of single hormone mRNA and multiple hormone mRNAcontaining cells in the g3-MSH-responsive population with those in thetotal pituitary cell population.

ResultsEffect of g3-MSH alone and in combination with the MC-3receptor antagonist SHU9119 on [Ca21]i

In confirmation of previous results (5), g3-MSH at doses of0.1, 1 and 10 nm caused a sustained oscillating increase in[Ca21]i in, respectively, 4.8 6 2.9%, 10.1 6 1.1%, and 14.5 60.6% of the analyzed cells (Fig. 1A). A 50- or 100-nm dose didnot further increase the number of responsive cells. In fact,at 100 nm this number was lower again (8.1 6 0.6%; data notshown). The 10-nm dose was therefore used in experimentsaimed to identify the target cells of g3-MSH. A representativerecording of the fluo-3 fluorescence changes induced by ap-plying 10 nm g3-MSH is shown in Fig. 1B.

Figure 1A also shows the effect of MC-3 receptor blockadeby SHU9119 on the [Ca21]i responses. As previously shown(5), SHU9119 had to be given 30 min before g3-MSH, becauseon its own it showed a temporary stimulatory effect on[Ca21]i [most likely through its agonist action at the MC-5


Dow



receptor (13)], and this effect had disappeared after 30 min.It was also shown that pretreatment with SHU9119 did notdesensitize the cells for later response to g3-MSH (5). Whenpituitary cells were pretreated for 30 min with the MC-3receptor antagonist SHU9119 (0.1 and 1 mm) and then testedfor [Ca21]i responses to 1 and 10 nm g3-MSH, still in thepresence of the same concentration of the antagonist, thepercentage of cells showing [Ca21]i responses significantlydecreased. However, even at 1 mm (a 100- or 1000-fold excesscompared with the dose of g3-MSH), SHU9119 was effectivein only 45% (1 nm g3-MSH) and 46% (10 nm g3-MSH) of thecells (Fig. 1A). Interestingly, SHU9119 was ineffective inblocking the effect of 0.1 nm g3-MSH. Consistent with theobservations of others (13), we have found that a 100-foldexcess of SHU9119 over g3-MSH completely blocks thebiological action of g3-MSH at the MC-3 receptor, as assessedin a HEK293 cell line stably transfected with the MC-3 re-ceptor (unpublished data).

Identification of cells responsive to g3-MSH in the absenceand presence of SHU9119

Cells were cultured on coverslips marked with numbereddemarcation lines, allowing accurate localization of the cellsto be identified after the [Ca21]i recordings were performedin several microscopic fields. In a first run, cells responsiveto 10 nm g3-MSH were analyzed simultaneously for theircontents of PRL, GH, and TSHb by immunofluorescent stain-ing. In a second run, cells responsive to 10 nm g3-MSH wereanalyzed simultaneously for their contents of GH, ACTH,and LHb by immunostaining. This was done for three in-dependent cell preparations. Then, the number of ACTH-irand LHb-ir cells within the immunonegative cells of the firstimmunostaining runs were calculated from the data ob-tained in the respective second immunostaining runs, and

the number of PRL-ir and TSHb-ir cells within the immu-nonegative cells of the second immunostaining runs werecalculated from the data obtained in the respective first im-munostaining runs. The numbers of identified cells withineach cell type category obtained in the different runs as wellas the calculated numbers were then combined and ex-pressed as percentage of total g3-MSH-responsive cells. Anexample of the triple immunofluorescent staining is shownin Fig. 2.

In total, 868 cells were recorded in the absence and 1108 inthe presence of 1 mm SHU9119. Within these populations, 121(14%) and 100 (9%), respectively, were responsive to g3-MSH. Figure 3 shows that about half of the cells responsiveto g3-MSH in the absence of SHU9119 were GH-ir, but PRL-,TSHb-, LHb-, and ACTH-ir cells were also found. About 18%of the g3-MSH-responsive cells were not immunoreactive toeither of the antisera applied. From Fig. 3 it is clear thatSHU9119 markedly decreased the proportions of ACTH-ir,LHb-ir, and immunonegative cells that remained responsiveto g3-MSH, but did not lower the percentages of GH-, PRL-,and TSHb-ir cells that remained responsive. Statistical anal-ysis (performed on absolute numbers) showed that the dis-tribution of g3-MSH-responsive cells among the different celltype categories was significantly changed by SHU9119 (byoverall x2 test, P , 0.001), but that for individual cell typesstatistical significance was reached only for ACTH-ir cells (byFisher’s exact test, P 5 0.0237) and immunonegative cells (byFisher’s exact test, P 5 0.0013). For LHb-ir cells, Fisher’s exacttest was not significant (P 5 0.07).

Similar conclusions were obtained when the number ofcells responsive to g3-MSH within each cell type categorywas expressed as a percentage of the total number of pitu-itary cells recorded (Fig. 4).

FIG. 1. A, Effects of 0.1 and 1 mMSHU9119 on the percentage of g3-MSH-responsive cells. Three differentdoses of g3-MSH were tested. Data arethe mean 6 SEM. In each independentexperiment, each combination wastested on four microscopic fields. Thenumber of experiments was as follows:g3-MSH (10 nM)/SHU9119 (0.1 mM), n 53; g3-MSH (10 nM)/SHU9119 (1 mM),n 5 9; g3-MSH (1 nM)/SHU9119 (0.1mM), n 5 4; g3-MSH (1 nM)/SHU (1 mM),n 5 3; g3-MSH (0.1 nM)/SHU9119 (0.1mM), n 5 4; and g3-MSH (0.1 nM)/SHU9119 (1 mM), n 5 3. Statistics wereperformed on the total number of fieldstested in each group (by ANOVA withpost-hoc Scheffe’s multiple comparisontests). *, P , 0.05 vs. control; **, P ,0.001 vs. control; §, P , 0.05 vs. 1 nMg3-MSH; #, P , 0.001 vs. 0.1 nM g3-MSH; ns, not significant vs. control (P .0.05). B, Representative recording ofthe fluo-3 fluorescence changes inducedby applying 10 nM g3-MSH in a non-oscillating cell. The bar indicates thetime of g3-MSH application.


Dow



Cells immunoreactive for more than one hormone werenot found.

In all the immunostaining runs the number of immuno-reactive and immunonegative cells not responsive to g3-MSH in the microscopic fields studied was also counted. Thisallowed calculation of the proportion of cells in each cell typecategory that responded to g3-MSH as well as the propor-tional distribution of the various pituitary cell types in thetotal pituitary cell population. It was found that 23% of theGH-ir cells, 10% of the PRL-ir cells, 10% of the TSHb-ir cells,8% of the ACTH-ir cells, 7% of the LHb-ir cells, and 11% ofthe immunonegative cells responded to g3-MSH (in the ab-sence of SHU9119). Figure 3 also shows the proportionaldistribution of the various pituitary cell types in the total

pituitary cell population. The proportion of GH-ir cells in theg3-MSH-responsive population was significantly higherthan that in the total pituitary cell population (by Fisher’sexact test, using absolute numbers, P 5 0.0001), indicatingpreference of g3-MSH for target GH-ir cells.

Detection of hormone mRNAs and MC-3 receptor mRNA incells responsive to g3-MSH by single cell RT-PCR

To identify cells responsive to g3-MSH at the mRNA level,the technique of [Ca21]i measurements was combined withsingle cell RT-PCR. In initial experiments, mRNA of pituitaryhormones, of the MC-3 receptor, and of the ribosomal proteinL19 were amplified from a RNA extract of the entire pituitary

FIG. 3. Upper panel, Distribution ofthe number of pituitary cells containinga particular hormone (detected by im-munostaining) and showing a [Ca21]iresponse to 10 nM g3-MSH in the ab-sence and presence of 1 mM SHU9119,expressed as percentage of the totalnumber of g3-MSH-responsive cells.Lower panel, Distribution of the num-ber of pituitary cells containing a par-ticular hormone (detected by immuno-staining) in the total pituitary cellpopulation.

FIG. 2. Photomicrographs of triple im-munofluorescent staining of dispersedpituitary cells for GH, ACTH, and LHb.After Ca21 imaging, all recorded cellswere fixed, subjected to triple immuno-staining, and examined under 340magnification. GH-ir cells are identifiedby using a secondary FITC antibody(green cells), ACTH-ir cells with asecondary Cy3 antibody (orange-redfluorescence), and LHb-ir cells with asecondary AMCA antibody (blue fluo-rescence).


Dow



of 14-day-old rats using RT-PCR. Amplification conditionswere optimized, yielding single bands of the predicted sizefor each primer set (see also Table 1). Next, a similar analysiswas performed on cytoplasm harvested from single pituitarycells responsive to 10 nm g3-MSH. Examples of results ob-tained after single cell RT-PCR and agarose gel electrophore-sis are shown in Figs. 5 and 6. Digestion with appropriaterestriction enzymes yielded DNA fragments of the expectedsizes (Fig. 7 and Table 1), confirming the identities of theproducts amplified from single cell cDNA.

From RT-PCR analysis of a dilution series of a standardPOMC mRNA, the detection limit was judged to be about 5mRNA molecules, or 30–40 mRNA copies/cell, taking intoaccount the volume of the RT mixture used (see Materials andMethods; data not shown).

A total of 152 cells showing an increase in [Ca21]i uponapplication of 10 nm g3-MSH were analyzed. All cells weretested for the presence of mRNA of GH, PRL, TSHb, andPOMC. In 17 cells none of the above mRNAs could be de-tected. However, all of these cells except 1 were also negativefor the mRNA of the ribosomal protein L19. These 16 L19-negative cells were considered false negative cells, possiblydue to failure of cytoplasm aspiration by the patch pipette,inadequacy of the RT reaction, or degradation of RNA. Therewas not sufficient cytoplasmic material to test all envisagedmRNAs on all cells. Therefore, 69 cells were tested for thepresence of MC-3 receptor mRNA, and another 53 weretested for the presence of mRNA of LHb. All LHb-positivecells were also tested for aGSU mRNA. Figure 8 shows thedistribution of the different hormone mRNAs as a percentageof the total g3-MSH-responsive cells, not including the L19-negative cells. In 26% of the responsive cells only GH mRNAwas found. Only a small number of cells contained only PRLmRNA, only TSHb mRNA, or only POMC mRNA. In con-trast, a considerable number of cells contained the mRNAsof GH, PRL, TSHb, and POMC in dual, triple, and evenquadruple combinations. Of all of the cells tested (136 cells),there was only 1 that did not contain 1 or more of these

mRNAs. LHb mRNA was always found together withmRNA of GH and/or PRL or TSHb, amounting to 18% of theg3-MSH-responsive cells. These cells also contained aGSUmRNA (see also Fig. 6).

Figure 8 also shows the distribution of the different hor-mone mRNAs in cells patched at random (representing thetotal pituitary cell population). It is clear that the proportionof cells containing one mRNA in the total pituitary cell pop-

FIG. 4. Percentage of cells within the total pituitary cell populationcontaining a particular hormone (detected by immunostaining) andshowing a [Ca21]i response to 10 nM g3-MSH in the absence andpresence of 1 mM SHU9119.

FIG. 5. Detection of pituitary hormone and MC-3 receptor mRNA bysingle cell RT-PCR in pituitary cells responsive to g3-MSH. Cyto-plasm harvested from single cells (C1-C9) was subjected to RT, fol-lowed by PCR for PRL and GH (amplified fragments of 291 and 242,respectively; A), TSHb (278 bp; B), MC-3 receptor (226 bp; C), andPOMC (254 bp; D). Amplified fragments were resolved by agarose gelelectrophoresis and visualized by EtBr staining. M, Mol wt marker;H2O and PC (pipette control), negative controls; HP, whole pituitarytotal RNA as positive control.


Dow



ulation is twice as high as that in the g3-MSH-responsivepopulation, whereas in the latter, the proportion of cellscontaining transcripts of two or more hormone mRNAs wastwice as high as that in the total population (by x2 test, P 50.0008). Moreover, in the randomly chosen cells there werecells that coexpressed POMC mRNA with LHb mRNA,whereas these cells were not found in the g3-MSH-respon-sive cell population.

These results were not affected by the time in culture, aspostexamination of the mRNA distributions in the cellsgrouped according to time in culture (24 or 48 h) gave es-sentially the same results (data not shown).

Figure 9 shows the distribution of MC-3 receptor mRNAamong g3-MSH-responsive cells. Because the MC-3 receptorgene has no introns, PCR was run with prior RT reaction(1RT) and without prior RT reaction (2RT). A PCR productwas never obtained in the 2RT samples, indicating thatchromosomal DNA is not amplified in our test conditions.That chromosomal DNA is not readily amplified under sin-gle cell RT-PCR conditions is consistent with observations byothers (15). In the 1RT samples, MC-3 receptor mRNA wasfound in only a small part of the g3-MSH-responsive cells (12of 69 cells; examples are shown in Fig. 5). It was foundcoexpressed with GH mRNA alone or in combination with

mRNA of PRL, TSHb, and POMC and in 1 cell not expressingeither of these hormone mRNAs (but positive for L19mRNA). When the MC-3 receptor mRNA-containing cellswere examined as a proportion of all responsive cells ex-pressing GH, PRL, or POMC mRNA, it was found that MC-3receptor mRNA was detectable in 11 of 57 cells expressingGH mRNA (19%), in 5 of 23 cells expressing PRL mRNA(22%), and in 2 of 22 cells expressing POMC mRNA (9%). AsMC-3 receptor mRNA expression was observed in only 16%of the g3-MSH-responsive cells, we wanted to exclude thepossibility that a single amplification run would have misseddetection of MC-3 receptor mRNA due to very low expres-sion levels in some cells. A seminested PCR on the first PCRproduct of all 69 cells was performed. The first PCR productof cells positive for MC-3 receptor mRNA was diluted 100-fold, whereas material in negative lanes was used as such (asdescribed in Materials and Methods). An amplified and clearlydetectable fragment of the expected size (183 bp) was only

FIG. 6. Detection of LHb and aGSU mRNA by single cell RT-PCR inpituitary cells responsive to g3-MSH. Cytoplasm harvested from sin-gle cells (C10-C18) was subjected to RT, followed by PCR for LHb(amplified fragment of 288 bp; A) and aGSU (283 bp; B). Amplifiedfragments were resolved by agarose gel electrophoresis and visualizedby EtBr staining. LHb mRNA-positive cells (C10, C11, C14, and C15)also expressed aGSU mRNA. M, Mol wt marker; H2O, negative con-trol.

FIG. 7. Restriction analysis of DNA fragments obtained by single cellRT-PCR for different pituitary hormone mRNAs and MC-3 receptormRNA. Aliquots of the amplified DNA products were digested with A)HaeIII (PRL and GH) and ApaI (LHb); and B) EcoRV (TSHb), AvaII(MC-3 receptor), and PstI (POMC). The sizes of the digested frag-ments were as expected (see Table 1). UC, Uncut; C, cut.


Dow



observed in the cells already positive for MC-3 receptormRNA in the first PCR and not in cells previously negative(data not shown). The detection limit of the whole methodwas estimated to be in the range of 50 copies of MC-3 receptormRNA/cell (see Materials and Methods; data not shown).

Discussion

The present investigation identified target cells of g3-MSHin the rat pituitary by determining cellular hormone pheno-types expressed at both the protein and mRNA levels in cellsshowing [Ca21]i transients upon exposure to this peptide.Immunocytochemistry revealed that a relatively small pro-portion (7–23%) of all main pituitary cell types showed a[Ca21]i response to g3-MSH, including cells that did notexpress hormone to a level detectable by light microscopy.However, some preference of g3-MSH to target GH-ir cellswas found. A clearly unexpected picture emerged when phe-

notypes were detected at the hormone mRNA level by singlecell RT-PCR. About 39% of the g3-MSH-responsive cells con-tained one of the specific hormone mRNAs defining each ofthe main pituitary cell types, whereas 61% expressed mRNAsof GH, PRL, TSHb, POMC, and LHb in dual, triple, and evenquadruple combinations within the same cell. In contrast, inthe overall pituitary cell population the proportion of cellscoexpressing two or more hormone mRNAs was almosttwice as low as that in the g3-MSH-responsive population.Moreover, cells coexpressing POMC and LHb were notfound in the g3-MSH-responsive population, although thesecells were present in the overall pituitary cell population.Thus, when examining hormone phenotypes at either theprotein or the mRNA level, the target cells of g3-MSH are notrandomly distributed among the various pituitary cell typesand subtypes.

The differential distribution of hormone mRNAs in theg3-MSH-responsive population compared with that in thetotal cell population furthermore excludes that the presenceof multiple hormone mRNAs in the same cell is due to verylow “illegitimate” gene transcription, reported to occur inprobably every cell type in the organism (28–30). Moreover,these extreme low copy number “illegitimate” mRNAs havebeen detected in extremely sensitive PCR conditions, farexceeding those used in the present study (30). Clearly, thepresence of multiple hormone mRNAs preferentially in mostof the g3-MSH responsive cells appears to be of biologicalrelevance.

To our knowledge, coexpression of mRNA for GH, PRL,and TSHb and of POMC mRNA or LHb mRNA with mRNAof GH, PRL, and/or TSHb in multiple combinations in nor-mal pituitary cells has not been reported previously. How-ever, dual combinations within the same cell of PRL, GH, andTSHb has been reported previously in both normal and ad-enomatous pituitary cells (31–38). Some extremely rare hu-man pituitary adenomas produce GH and ACTH or GH,PRL, and ACTH and store these hormones in the same se-cretory granules (39, 40). In some GH-secreting adenomas,mRNA of POMC and LHb have been observed (41). Childset al. (42) have shown ACTH-ir in a considerable number of

FIG. 8. Percentage of pituitary cells showing expression of one ormore pituitary hormone mRNAs among single pituitary cells respon-sive to 10 nM g3-MSH compared with the percentage of such cells inthe total pituitary cell population. mRNA detection was performedusing single cell RT-PCR.

FIG. 9. Percentage of pituitary cells showing coexpression of MC-3receptor mRNA and one or more pituitary hormone mRNAs amongpituitary cells responsive to 10 nM g3-MSH. mRNA detection wasperformed using single cell RT-PCR.


Dow



gonadotrophs during early postnatal life in the rat and in alow percentage of gonadotrophs in adult rat pituitary (43) aswell as in a small subpopulation of cells containing TSHb(44).

The present findings uncover novel aspects in pituitarycell lineage specification. The main pituitary cell types aredefined on the basis of the expression of a specific hormoneand its corresponding mRNA, and it has become clear thatthis is determined by various lineage-specific transcriptionfactors (reviewed in Ref. 45). The majority of the g3-MSH-responsive cells express various pituitary hormone mRNAsin dual, triple, or quadruple combinations. These cells ap-parently express multilineage phenotypes, raising intriguingquestions for future research. Do these cells coexpress thetranscription factors typical for the different lineages or (inaddition) other factors allowing multilineage gene expres-sion? How do these cells relate to single lineage cells ex-pressing only one pituitary hormone gene? Do multilineagegene-expressing cells already exist during embryonic life ordo they appear later on in life? The discovery in the presentstudy of an agonist, g3-MSH, preferentially targeting thesecells may open new perspectives for defining the functionalsignificance of pituitary cells displaying multilineage geneexpression.

Another intriguing finding was that the number of cellsexpressing a particular pituitary hormone mRNA (alone orin combination with other hormone mRNAs) is alwayshigher than the number of cells expressing the hormoneprotein as determined by immunodetection, whereas coex-pression of different hormones could not be detected. Forexample, some 47% of the g3-MSH-responsive cells con-tained PRL mRNA, but only 12% contained PRL protein. Onthe other hand, in a considerable number of cells responsiveto g3-MSH, no hormone could be detected, whereas only 1of 136 g3-MSH-responsive cells did not contain 1 or more ofthe pituitary hormone mRNAs. Taken together, these datasuggest that a significant part of the nonhormone- as well asthe hormone-containing cells represent cells containing mul-tiple hormone mRNAs but none or only one of the corre-sponding hormone proteins in a detectable amount. It ispossible that light microscopic detection of immunostainedhormone underestimates coexpression, but if so, one hor-mone seems to be stored in a much higher amount than theother in a given cell type. These multiple mRNA-containingcells may be progenitor cells or “reserve” cells waiting for astimulus to terminally differentiate (express single or mul-tiple hormone proteins at a higher level) depending on de-velopmental or other physiological needs. Some data in theliterature are consistent with this view. Cosecretion of LH,FSH, and GH from gonadotrophs at proestrus or of TSH andACTH during cold stress has been reported by Childs et al.(44, 46). There have been reports of Pit-1-expressing cells thatdo not yet express PRL, GH, or TSH (37, 47, 48). TSHb-iradenomas have been reported that express GH and PRLmRNA in the same cells, but a part of these cells is immu-nonegative for GH and PRL (38). GH-secreting adenomasexist that show PRL-ir but no GH-ir, whereas mRNAs forboth GH and PRL in the same cells are found (49).

We previously (and more extensively in the present study)showed that treatment with SHU9119, a potent competitive

MC-3 receptor antagonist (13), blocked [Ca21]i responses inonly 46% or less of the cells responsive to g3-MSH even at a1000-fold molar excess, suggesting that in most of the re-sponsive cells, g3-MSH transmits its signal through a recep-tor different from the MC-3 receptor (the only known re-ceptor with high affinity for this peptide). We previously (5)excluded that the latter receptor is the MC-4 or MC-5 recep-tor. To further test the above hypothesis we exploredwhether the receptor blocked by SHU9119 and the one notblocked by this compound were differentially distributedamong the different target cells. It was found that the g3-MSH receptor not blocked by SHU9119 is located in PRL-ir,GH-ir, and TSHb-ir cells, whereas the receptor blocked bySHU9119 is present in ACTH-ir cells and in cells that do notdetectably express hormone. Thus, this differential distribu-tion of a SHU9119-blockable and a SHU9119-nonblockablereceptor strengthens our proposal (5) that a g3-MSH receptormay exist in the pituitary that is at least functionally differentfrom the cloned MC-3 receptor tested to date in transfectedcell lines. Current investigations in our laboratory supportthe latter hypothesis. We found that g3-MSH potently (ef-fective from 0.001 nm) increases [Ca21]i in the PRL- andGH-secreting GH3 cell line, that this effect is not affected bySHU9119, and that RT-PCR performed on a RNA extractfrom this cell line could not reveal a signal for the presenceof MC-3 receptor mRNA (Langouche, L., M. Roudbaraki, andC. Denef, unpublished observations in three independentexperiments). In further support of limited involvement ofthe MC-3 receptor in most of the g3-MSH-induced [Ca21]iresponses in the normal pituitary cells was the finding thatMC-3 receptor mRNA was detectable in only 16% of the cellsresponsive to g3-MSH. However, MC-3 receptor mRNA wasdetectable in only 9% of the cells expressing POMC mRNA.This is not consistent with the above interpretation that inmost ACTH-ir cells the response to g3-MSH was blocked bySHU9119. There are several possible explanations for thisdiscrepancy. The absence of a PCR signal may arise from astatistical sampling error in the case of low abundance mes-sages (50). We cannot exclude that the expression of MC-3receptor mRNA in part of the ACTH-ir cells is too low to bedetectable; the detection limit of our method is in the rangeof 50 MC-3 receptor mRNA molecules/cell. Another possibleexplanation is that ACTH-ir cells that express the MC-3 re-ceptor on their surface might no longer contain detectablelevels of MC-3 receptor mRNA, as is, for example, the casein many CD34-expressing bone marrow stem cells (51). How-ever, within the scope of the present investigation and re-gardless of the above tentative explanations, the potentialbiological relevance of the findings is that there seem to existg3-MSH receptors that are blockable and others that are notblockable by SHU9119 and that they are differentially dis-tributed according to cell type. An additional peculiar char-acteristic of the [Ca21]i response to g3-MSH is that there is agraded recruitment of responding cells with increasing dosesof g3-MSH. Very tempting issues for future research arewhether different subtypes of cells are recruited at differentpeptide doses.

In conclusion, the present findings show that the targetcells of g3-MSH as detected on the basis of [Ca21]i changesin the immature rat pituitary constitute specific subpopula-


Dow



tions within each main pituitary cell type category, includingnonhormone-containing cells (or low expression hormonalcells), the majority of which contain transcripts of the GH,PRL, and TSHb genes together with the POMC or LHb genein various combinations. The data reveal the existence of cellsdisplaying multilineage gene activation. Because [Ca21]i re-sponses are not blocked by SHU9119 in GH-, PRL-, andTSHb-ir cells and most of these cells do not seem to expressthe MC-3 receptor at a substantial level, it is suggested thatmost of the g3-MSH effects in these cells are mediated by ahitherto unknown receptor type or at least by a MC-3 re-ceptor with ligand-binding characteristics different fromthose of the cloned MC-3 receptor examined to date in trans-fected cell lines.

Acknowledgments

Y. Van Goethem, N. Hersmus, and L. Straetemans are acknowledgedfor excellent technical assistance. The authors express their gratitude toDr. A. F. Parlow and the National Hormone and Pituitary Program forgifts of anti-PRL, -GH, -TSHb, and -LHb antisera. We thank Dr. M.Garret for helpful discussions and comments on the single cell RT-PCRtechnique before the beginning of this study. We thank Eve Seuntjens forhelp in editing the color picture.

References

1. Seger MA, Bennett HPJ 1986 Structure and bioactivity of the amino-terminalfragment of pro-opiomelanocortin. J Steroid Biochem 25:703–710

2. Denef C, Van Bael A 1998 A new family of growth and differentiation factorsderived from the N-terminal domain of pro-opiomelanocortin (N-POMC)Comp Biochem Physiol C 119:317–324

3. Versteeg DH, Van Bergen P, Adan RA, De Wildt DJ 1998 Melanocortins andcardiovascular regulation. Eur J Pharmacol 360:1–14

4. Tilemans D, Ramaekers D, Andries M, Denef C 1997 Effect of POMC1–76,its C-terminal fragment g3-MSH and anti-POMC1–76 antibodies on DNAreplication in lactotrophs in aggregate cell cultures of immature rat pituitary.J Neuroendocrinol 9:627–637

5. Lorsignol A, Vande Vijver V, Ramaekers D, Vankelecom H, Denef C 1999Detection of melanocortin-3 receptor mRNA in immature rat pituitary. Func-tional relation to g3-MSH-induced changes in intracellular Ca21 concentra-tion? J Neuroendocrinol 11:171–179

6. Gurdon JB, Harger P, Mitchell A, Lemaire P 1994 Activin signalling andresponse to a morphogen gradient. Nature 371:487–492

7. Dosch R, Gawantka V, Delius H, Blumenstock C, Niehrs C 1997 BMP-4 actsas a morphogen in dorsoventral mesoderm patterning in Xenopus. Develop-ment 124:2325–2334

8. Wilson PA, Lagna G, Suzuki A, Hemmati-Brivanlou A 1997 Concentration-dependent patterning of the Xenopus ectoderm by BMP4 and its signal trans-ducer Smad1. Development 124:3177–3184

9. Jones CM, Smith JC 1998 Establishment of a BMP-4 morphogen gradient bylong-range inhibition. Dev Biol 194:12–17

10. Roselli-Rehfuss L, Mountjoy KG, Robbins LS, Mortrud MT, Low MJ, TatroJB, Entwistle ML, Simerly RB, Cone RD 1993 Identification of a receptor forgamma melanotropin and other proopiomelanocortin peptides in the hypo-thalamus and limbic system. Proc Natl Acad Sci USA 90:8856–8860

11. Gantz I, Konda Y, Tachiro T, Shimoto Y, Miwa H, Munzert G, Watson SJ,DelValle J, Yamada T 1993 Molecular cloning of a novel melanocortin recep-tor. J Biol Chem 268:8246–8250

12. Desarnaud F, Labbe O, Eggerinckx D, Vassart G, Parmentier M 1994 Mo-lecular cloning, functional expression and pharmacological characterization ofa mouse melanocortin receptor gene. Biochem J 299:367–373

13. Hruby VJ, Lu D, Sharma SD, Castrucci AL, Kesterson RA, al Obeidi FA,Hadley ME, Cone RD 1995 Cyclic lactam a-melanotropin analogues of Ac-Nle4-cyclo[Asp5,d-Phe7,Lys10]a-melanocyte-stimulating hormone-(4–10)-NH2 with bulky aromatic amino acids at position 7 show high antagonistpotency and selectivity at specific melanocortin receptors. J Med Chem38:3454–3461

14. Kumazaki T, Hamada K, Mitsui Y 1994 Detection of mRNA expression in asingle cell by direct RT-PCR. BioTechniques 16:1017–1019

15. Johansen FF, Lambolez B, Audinat E, Bochet P, Rossier J 1995 Single cellRT-PCR proceeds without the risk of genomic DNA amplification. NeurochemInt 26:239–243

16. Mermelstein PG, Song WJ, Tkatch T, Yan Z, Surmeier DJ 1998 Inwardlyrectifying potassium (IRK) currents are correlated with IRK subunit expressionin rat nucleus accumbens medium spiny neurons. J Neurosci 18:6650–6661

17. Hu M, Krause D, Greaves M, Sharkis S, Dexter M, Heyworth C, Enver T 1997Multilineage gene expression precedes commitment in the hemopoietic sys-tem. Genes Dev 11:774–785

18. Bresson-Bepoldin L, Jacquot MC, Schlegel W, Rawlings SR 1998 Multiplesplice variants of the pituitary adenylate cyclase-activating polypeptide type1 receptor detected by RT-PCR in single rat pituitary cells. J Mol Endocrinol21:109–120

19. Tilemans D, Andries M, Proost P, Devreese B, Van Beeumen J, Denef C 1994In vitro evidence that an 11 kilodalton N-terminal fragment of proopiomela-nocortin is a growth factor specifically stimulating the development of lac-totrophs in rat pituitary during postnatal life. Endocrinology 135:168–174

20. Van Bael A, Vande Vijver V, Devreese B, Van Beeumen J, Denef C 1996N-Terminal 10 and 12 kDa POMC fragments stimulate differentiation of lac-totrophs. Peptides 17:1219–1228

21. Lorsignol A, Himpens B, Denef C 1998 Stimulation of Ca21 entry in lac-totrophs and somatotrophs from immature rat pituitary by N-terminal frag-ments of proopiomelanocortin. J Neuroendocrinol 10:217–229

22. Lorsignol A, Taupignon A, Horvath G, Dufy B 1997 Intracellular calciumconcentration and hormone secretion are controlled differently by TRH in ratneonatal lactotrophs and somatotrophs. J Endocrinol 154:483–494

23. Surmeier DJ, Song W-J, Yan Z 1996 Coordinated expression of dopaminereceptors in neostriatal spiny neurons. J Neurosci 16:6579–6591

24. Mermelstein PG, Surmeier, DJ 1997 A calcium channel reversibly blocked byv-conotoxin GVIA lacking the class Da1 subunit. Neuroreport 8:485–489

25. Hamill OP, Marty A, Neher E, Sakmann B, Sigworth FJ 1981 Improved patchclamp techniques for high-resolution current recording from cells and cell-freemembranes patches. Pflugers Arch 391:85–100

26. Chomczynski P, Sacchi N 1987 Single-step methode of RNA isolation byacid guanidium thiocyanate-phenol-chloroform extraction. Anal Biochem162:156–159

27. Cimino GD, Metchette K, Isaacs ST, Zhu YS 1990 More false-positive prob-lems. Nature 345:773–774

28. Chelly J, Concordet JP, Kaplan JC, Kahn A 1989 Illegitimate transcription:transcription of any gene in any cell type. Proc Natl Acad Sci USA 86:2617–2621

29. Kaplan JC, Kahn A, Chelly J 1992 Illegitimate transcription: its use in the studyof inherited disease. Hum Mutat 1:357–360

30. Kimoto Y 1998 A single human cell expresses all messenger ribonucleic acids:the arrow of time in a cell. Mol Gen Genet 258:233–239

31. Losinski NE, Horvath E, Kovacs K 1989 Double-labeling immunogold elec-tron-microscopic study of hormonal colocalization in nontumorous and ad-enomatous rat pituitaries. Am J Anat 185:236–243

32. Osamura RY, Oda K, Utsunomiya H, Inada K, Umemura S, Shibuya M,Katakami H, Voss JW, Mayo KE, Rosenfeld MG 1993 Immunohistochemicalexpression of PIT-1 protein in pituitary glands of human GRF transgenic mice:its relationship with hormonal expressions. Endocr J 40:133–139

33. Asa SL, Kovacs K, Stefaneanu L, Horvath E, Billestrup N, Gonzalez-Manchon C, Vale W 1992 Pituitary adenomas in mice transgenic for growthhormone-releasing hormone. Endocrinology 131:2083–2089

34. Horvath E, Lloyd RV, Kovacs K 1990 Propylthiouracyl-induced hypothy-roidism results in reversible transdifferentiation of somatotrophs into thy-roidectomy cells A morphologic study of the rat pituitary including immu-noelectron microscopy. Lab Invest 63:511–520

35. Lloyd RV, Jin L, Chandler WF, Horvath E, Stefaneanu L, Kovacs K 1993Pituitary specific transcription factor messenger ribonucleic expression in ad-enomatous and nontumorous human pituitary tissues. Lab Invest 69:570–575

36. Bassetti M, Spada A, Arosio M, Vallar L, Brina M, Giannattasio G 1986Morphological studies on mixed growth hormone (GH)- and prolactin (PRL)-secreting human pituitary adenomas. Coexistence of GH and PRL in the samesecretory granule. J Clin Endocrinol Metab 62:1093–1100

37. Sanno N, Teramoto A, Matsuno A, Itoh J, Takekoshi S, Osamura RY 1996 Insitu hybridization analysis of Pit-1 mRNA and hormonal production in humanpituitary adenomas. Acta Neuropathol (Berl) 91:263–268

38. Sanno N, Teramoto A, Matsuno A, Takekoshi S, Osamura RY 1995 GH andPRL gene expression by nonradioisotopic in situ hybridization in TSH-secret-ing pituitary adenomas. J Clin Endocrinol Metab 80:2518–2522

39. Matsuno A, Sasaki T, Mochizuki T, Fujimaki T, Sanno N, Osamura Y,Teramoto A, Kirino T 1996 A case of pituitary somatotroph adenoma withconcomitant secretion of growth hormone, prolactin, and adrenocorticotropichormone–an adenoma derived from primordial stem cell, studied by immu-nohistochemistry, in situ hybridization, and cell culture. Acta Neurochir(Wien) 138:1002–1007

40. Kovacs K, Horvath E, Stefaneanu L, Bilbao J, Singer W, Muller PJ, ThaparK, Stone E 1998 Pituitary adenoma producing growth hormone and adreno-corticotropin: a histological, immunocytochemical, electron microscopic, andin situ hybridization study. Case report. J Neurosurg 88:1111–1115

41. Matsuno A, Teramoto A, Takekoshi S, Sanno N, Osamura RY, Kirino T 1995Expression of plurihormonal mRNAs in somatotrophic adenomas detectedusing a nonisotopic in situ hybridization method: comparison with lactotro-phic adenomas. Hum Pathol 26:272–279

42. Childs GV, Ellison DG, Ramaley JA 1982 Storage of anterior lobe adreno-


Dow



corticotropin in corticotropes and a subpopulation of gonadotropes duringthe stress-nonresponsive period in the neonatal male. Endocrinology110:1676–1692

43. Moriarty GC, Garner LL 1977 Immunocytochemical studies of cells in the ratadenohypophysis containing both ACTH and FSH. Nature 265:356–358

44. Childs GV, Westlund KN, Unabia G 1989 Characterization of anterior pitu-itary target cells for arginine vasopressin: including cells that store adreno-corticotropin, thyrotropin-b, and both hormones. Endocrinology 125:554–559

45. Watkins-Chow DE, Camper SA 1998 How many homeobox genes does it taketo make a pituitary gland? Trends Genet 14:284–290

46. Childs GV, Unabia G, Rougeau D 1994 Cells that express luteinizing hormone(LH) and follicle-stimulating hormone (FSH) b-subunit messenger ribonucleicacids during the estrous cycle: the major contributors contain LHb, FSHb,and/or growth hormone. Endocrinology 134:990–997

47. Lew D, Brady H, Klausing K, Yaginuma K, Theill LE, Stauber C, Karin M,Mellon PL 1993 GHF-1-promoter-targeted immortalization of a somatotropicprogenitor cell results in dwarfism in transgenic mice. Genes Dev 7:683–693

48. Proesmans M, Van Bael A, Andries M, Denef C 1997 Mitogenic effects ofnerve growth factor on different cell types in reaggregate cell cultures ofimmature rat pituitary. Mol Cell Endocrinol 134:119–127

49. Lloyd RV, Cano M, Chandler WF, Barkan AL, Horvath E, Kovacs K 1989Human growth hormone and prolactin secreting pituitary adenomas analyzedby in situ hybridization. Am J Pathol 134:605–613

50. O’Dowd DK, Gee JR, Smith MA 1995 Sodium current density correlates withexpression of specific alternatively spliced sodium channel mRNAs in singleneurons. J Neurosci 15:4005–4012

51. Molesh DA, Hall JM 1994 Quantitative analysis of CD341 stem cells usingRT-PCR on whole cells. PCR Methods Appl 3:278–284


Dow



Target Cells of 3-Melanocyte-Stimulating Hormone Detected ...

Documents

Transcript of Target Cells of 3-Melanocyte-Stimulating Hormone Detected ...