Fungal Genetics and Biology 47 (2010) 392–398

Contents lists available at ScienceDirect

Fungal Genetics and Biology

journal homepage: www.elsevier .com/ locate/yfgbi

Sexual mating of Botrytis cinerea illustrates PRP8 intein HEG activity

Annika A.M. Bokor a,*, Jan A.L. van Kan b, Russell T.M. Poulter a

a Biochemistry Department, University of Otago, 710 Cumberland Street, Dunedin 9054, New Zealandb Laboratory of Phytopathology, Wageningen University, Droevendaalsesteeg 1, 6708 PB Wageningen, The Netherlands

a r t i c l e i n f o a b s t r a c t

Article history:Received 8 December 2009Accepted 13 January 2010Available online 20 January 2010

Keywords:InteinHomingHoming endonucleaseGene conversionHorizontal transferPrp8Splicing

1087-1845/$ - see front matter � 2010 Elsevier Inc. Adoi:10.1016/j.fgb.2010.01.003

* Corresponding author. Fax: +64 0(3) 4797866.E-mail address: annika.bokor@stonebow.otago.ac.n

Strains of Botrytis cinerea are polymorphic for the presence of an intein in the Prp8 gene (intein +/�). Theintein encodes a homing endonuclease (HEG). During meiosis in an intein +/� heterozygote, the homingendonuclease initiates intein ‘homing’ by inducing gene conversion. In such meioses, the homing endo-nuclease triggers gene conversion of the intein together with its flanking sequences into the empty allele.The efficiency of gene conversion of the intein was found to be 100%. The extent of flanking sequenceaffected by the gene conversion varied in different meioses. A survey of the inteins and flankingsequences of a group B. cinerea isolates indicates that there are two distinct variants of the intein bothof which have active HEGs. The survey also suggests that the intein has been actively homing duringthe evolution of the species and that the PRP8 intein may have entered the species by horizontal transfer.

� 2010 Elsevier Inc. All rights reserved.

1. Introduction

Homing endonucleases are encoded by rare genetic elements(homing endonuclease genes or HEGs) that occur in some self-splicing group I introns and inteins. They have been found in thegenomes of a variety of viruses, a few bacteria and archaea andthe organelles and nuclear genomes of some eukaryotes. It hasbeen suggested that HEGs could be employed as tools for the ge-netic engineering of natural populations of eukaryote pest species(Burt, 2003) such as the Anopheles mosquito (Windbichler et al.,2007). This suggestion is based on the belief that a HEG wouldspread through a gene pool. Homing endonucleases produce a dou-ble strand break in a unique target genomic sequence (‘home’); thisDNA break can then be repaired by gene-conversion. This results inthe copying of the intein or group I intron from an occupied alleleinto the empty target allele. It is intuitively attractive to assumethat, in a sexual eukaryote, HEG-containing elements will spreadthrough the gene pool until the element eventually reaches fixa-tion. The HEG would act as a ‘meiotic driver’, distorting the meioticsegregation frequency. In theory (Burt, 2003) such a system couldmodify a natural population of a species.

The behaviour of nuclear HEGs in natural populations has notbeen investigated. Goddard and Burt (1999) postulated that HEG-carrying group I introns (and by analogy other HEG elements) aregained by horizontal transfer, increase until they become fixed inthe gene pool of the species. Once fixed, no further homing can occur,

ll rights reserved.

z (A.A.M. Bokor).

and the HEGs degenerate and are lost. However, there is surprisinglylittle direct evidence to support the steps of this hypothesis, includ-ing the idea that HEG-carrying elements can achieve fixation withinthe gene pool of a species. An alternative hypothesis (Burt and Kouf-opanou, 2004) is that, depending on mutation rate and selection, anactive HEG could persist indefinitely in a species with a stable equi-librium between the occupied and empty target alleles. This alterna-tive equilibrium hypothesis would predict vertical transmission ofthe HEG rather than frequent horizontal transmission.

The nuclear HEG that has been most extensively studied is VDEwhich is encoded within the SceVMA intein of Saccharomyces cerevi-siae. The SceVMA intein (which is also known as PI-SceI) is the onlyintein in the nuclear genome of this yeast. VDE is a member of theLAGLIDADG endonuclease family (Gimble and Thorner, 1992;Moure et al., 2002). The SceVMA self-splicing intein is inserted intoa vacuolar ATPase gene (VMA-1). Mating of VDE+ and VDE� haploidyeast cells produces (stable) +/� diploid heterozygotes. Homing oc-curs at meiosis when the endonuclease protein is transported intothe nucleus by karyopherins (Nagai et al., 2003). VDE is transmittedto about 80–90% of the meiotic products, rather than the Mendelianprediction of 50% (Gimble and Thorner, 1992; Goddard et al., 2001).

Our understanding of HEG activity would be broadened bystudy of the behaviour of other nuclear HEGs. HEG-containing in-teins have now been described from 14 distinct non-homologoussites in the nuclear genomes of various microbial eukaryotes (In-Base; Liu and Yang, 2004). We recently described a eukaryote nu-clear intein found in the Prp8 gene (the Prp8 gene encoding aprotein involved in intron splicing) of a diverse group of fungi. Thisintein is found in ascomycetes (including Aspergillus, Neosartorya,

A.A.M. Bokor et al. / Fungal Genetics and Biology 47 (2010) 392–398 393

Emericella, Histoplasma and Botrytis species), basidiomycete yeasts(Cryptococcus) and the chytridiomycete Batrachochytrium dendro-batidis (14). We selected one of these species, Botrytis cinerea, forfurther study because it has a global distribution, a sexual cycleand because a preliminary study of a large number of B. cinerea iso-lates revealed the occurrence of strains with and without the PRP8intein. We have crossed strains carrying the intein (BciPRP8) withstrains that do not have the intein and present an analysis of theoutcome of meiosis in such heterozygous crosses. The results pres-ent the first evidence relating to the behaviour of eukaryote inteinsin a natural population. The analysis confirms the proposed stepsof intein homing and provides evidence that inteins can act asrecombinational hot-spots.

2. Materials and methods

2.1. Strains

The strains included in this study are presented in Table S1.Strain SAS405 carries the Daf1LR gene, conferring resistance tothe dicarboximide fungicide vinclozolin.

2.2. B. cinerea mating, asci and ascospore isolation

B. cinerea strain Bc18 and SAS405 were mated and spores iso-lated as described previously (van der Vlugt-Bergmans et al.,1993). SAS405 was used as the female parent. B05.10 and 705-1were crossed using the same protocol but the spores were allowedto discharge onto a sterile plastic lid. The spores were subsequentlywashed off with sterile water, diluted and allowed to germinate onYPD plates (13). Individual progeny were isolated on YPD platesand grown at 22 �C.

2.3. Genomic DNA extraction

For genomic DNA extraction, mycelia were added to 100 lLPrepMan™ Ultra (Applied Biosystems) in a MagNA Lyser tube withceramic beads. The suspension was shaken 3 � 60 s in a MagNA Ly-ser (Roche) at speed 5000, then boiled for 10 min, spun down andfinally the supernatant was diluted 1 in 10 with sterile water.Genomic DNA for mass-spore analysis from the B05.10 � 705-1cross was prepared accordingly: Ten individual colonies were com-bined and grown in 15 mL YPD at 22 �C for 3 days. The cultureswere centrifuged for 5 min at 3500 rpm and the supernatant re-moved. The pellets were resuspended in 5 mL of 1 M sorbitol0.1 M EDTA pH 7.5 and 1 mL was transferred to a MagNA Lyserceramic bead tube. The resuspended samples were vigorously sha-ken in a MagNA Lyser (Roche) 3 � 60 min at speed 5000. One vol-ume of 50 mM Tris 50 mM EDTA and 1% SDS was added and gentlyrocked until the solution cleared. The DNA was subsequently ex-tracted with chloroform and isopropanol. As a control, a strainwithout an intein, isolate 705-1 was added in a duplicate cultureand included in the mass-screen.

2.4. Vinclozolin screening

Mycelia were transferred to potato dextrose (PDA) plates con-taining 1 lg/ml vinclozolin and incubated 2–3 days at 22 �C.

2.5. PCR and sequencing

Standard PCR amplifications were carried out and visualised on1% agarose gels. Primers Next0.1 (50TCTTGGGAAGGCCTATTCTGG)and Cext0.1 (50CGATCTTTGAGCGTTTGTCAAT) were used to amplifythe full-length BciPRP8 intein. Primers rpBc2 (50GTTGGCTTTCGG

TAAGGGTCTATTAGC) and fpBc1 (50TATGGTTAGGAGATGGCAGCCGTAGCTCAAC) are internal to BciPRP8 and were used for sequencingof the intein. Primers Next1 (50TGAGACATGATGTCAACCTGGGA)and Cext1 (50GTTCACGCAAGACGTAGAGAGCT) were used to ampli-fy and sequence the empty Prp8 alleles following their identifica-tion with Next0.1and Cext0.1. Additionally, Next0.5 (50TGGATCACATATCCTCATTCCGA) and Cext0.5 (50GTCAGGTCTAATTGGACTTGGAA) were used to sequence the empty Prp8 alleles. To screenfor the presence of the intein amongst single ascospore progeny,internal HEG-specific primers fHEG1 (50TGCGCAAGAAGGGATCTGAGCGTTATA) and rHEG (50GTTGGCTTTCGGTAAGGGTCTATTAGC)were used together with and Cext0.5 and Next0.5 (50TGGATCACATATCCTCATTCCGA) respectively. Primers fNext18 (50CCAGCTTTCTCCCAACAAGGTGCTTA) and rNext18 (50GCTGAATGGAAAGTCATGTTCGCCTG) were used to amplify a �1 kb genomicregion �18 kb upstream of the insertion site. Primers fCext14(50CAGTGTCATCAGCATCAGCAAGTA) and rCext14 (50CATGGCGGCTCTGTTGGCTTTTGT) were used to amplify a �0.5 kb genomicregion�15 kb downstream of the insertion site. PCR products werepurified (Qiagen kit) and sequenced at the Allan Wilson CentreGenome Service at Massey University (http://awcmee.mas-sey.ac.nz/genome-service.htm) using an ABI 3730 DNA Sequencer.

3. Results

3.1. BciPRP8 intein distribution

B. cinerea strain B05.10 has been fully sequenced (www.broad.-mit.edu). The Prp8 gene of strain B05.10 carries a full-length,BciPRP8 intein (InBase; Liu and Yang, 2004), at exactly the sameposition as the inteins described in the Prp8 genes of other fungisuch as Aspergillus fumigatus and Emericella nidulans (Butler et al.,2006). An additional 48 B. cinerea isolates (Table S1) were screenedfor the presence or absence of the BciPRP8 intein. Forty isolates donot carry an intein in the Prp8 allele while nine of the isolates en-code a PRP8 full-length intein (Table S1). This distribution con-trasts with Aspergillus and Neosartorya species, where nopolymorphism for the presence or absence of the PRP8 intein hasbeen described (Butler et al., 2006). However, in most of these spe-cies only a few strains have been analysed, which may explain whypolymorphisms have not been detected. The intein carrying B. cine-rea strains are from a variety of geographical origins and were iso-lated from various host plant species (Table S1).

3.2. BciPRP8 intein polymorphisms

The DNA sequences of the nine inteins discovered in this studycould be assigned to two types, here designated as types A and B.Seven strains carry identical type B alleles and the remaining twocarry identical type A alleles. B05.10 (isolated in Germany) andAB-CL (isolated from a dried longan sourced from China) carrythe A allele. The type A and B alleles differ by six neutral SNPsand a 21 bp (7 amino acid) indel (Figs. S1 and S2). In the regionof the indel, the longer type A allele contains two 9 bp exact directrepeats separated by a 12 bp intervening sequence. The shorter Ballele could be formed by a recombination between the two 9 bprepeats, resulting in the deletion of one 9 bp repeat and the inter-vening 12 bp to yield the 21 bp polymorphic indel. This seven ami-no acid indel lies in a region of the PRP8 intein which showsconsiderable interspecific variation (Butler et al., 2006).

3.3. PRP8 extein polymorphisms

To detect SNPs in the sequences flanking the intein, the 1 kbextein regions flanking the integration site were sequenced. The

394 A.A.M. Bokor et al. / Fungal Genetics and Biology 47 (2010) 392–398

C-extein sequence (Fig. 1) contains two introns with lengths of62 bp (from position 15 to 76) and 376 bp (from 164 to 539),respectively (underlined in Fig. 1). In the C-exteins we found 17polymorphic sites. The empty alleles displayed seven polymor-phisms within the 376 bp intron (Fig. 1). These polymorphismsshow strong linkage disequilibrium or association. There is no evi-dence of recombination between them, the various haplotypespresent in the C-extein of the empty alleles can be derived froma common ancestral haplotype by a sequence of mutations (with-out recombination or homoplasy). The 25 bp sequence immedi-ately adjacent to the intein integration site (Fig. 1) contains 10polymorphisms, the majority of which are in the intron. The occu-pied alleles and empty alleles have distinct haplotypes in this25 bp sequence, all the empty alleles carry an identical haplotype.

Fig. 1. C-extein haplotypes of empty and occupied B. cinerea Prp8 alleles. The sequencesAG and B05.10 have intein occupied alleles. The remaining strains carry empty Prp8 allelehaplotype is also found in AB-AS2 and AB-TS2. B05.10 haplotype is also found in AB-CL. BP061. Haplotype SAS405 is also found in Bc26, T 501, Bc25, Bc12, Bc7, 961-009, 960-102, 9Haplotype AB-CG is also found in 705-1, 436, 671-1, 960-105, 964-1, 965-1, 965-3, 965Haplotype Bc21 is also found in 960-101. The two C-extein introns are underlined. One kshown.

Other polymorphisms are present in the remainder of the C-exteinsequences from the occupied alleles, each of these polymorphismsis also present among the empty alleles. The nine intein-carryingalleles have five distinct haplotypes (Fig. 1). In the N-extein se-quence only one polymorphism was found, a Neutral G/C SNPimmediately adjacent to the integration site. All the occupied al-leles carried a GCC (Ala) codon and all the empty alleles carried aGCG (Ala) codon.

3.4. HEG-mediated intein homing in B. cinerea matings

The sequences described above suggest that the intein sequenceis invariably associated with distinctive flanking sequences. Thismay mean that intein movement involves the obligate transfer of

are compared to the occupied Bc18 allelic sequence. Strains NZ964-3, NZ964-2, AB-s. NZ964-3 haplotype is also found in NZ964-4. NZ964-2 haplotype is unique. AB-AGut-WS haplotype is unique. SAS56 haplotype is also found in 965-2, 966-1, Bc29 and60-103, 702-1, 666-1, 678-1 and 658-1. Haplotype 960-104 is also found in 106-10.

-4, 966-4, 966-7, 966-10, P61 and T 602. Haplotype N6122 is also found in N6223.b of C-extein sequence was sequenced but SNPs were only found within the region

A.A.M. Bokor et al. / Fungal Genetics and Biology 47 (2010) 392–398 395

sequences that flank the intein integration site (putative gene con-version tracts). To test this possibility, matings were performed be-tween B. cinerea strains that differed in the presence of the BciPRP8intein. B. cinerea is a haploid filamentous ascomycete with a classi-cal biallelic mating system controlled by the MAT 1 locus (Faretraet al., 1988), which is unlinked to the BciPRP8 locus in the genomesequence of B. cinerea strain B05.10 (www.broad.mit.edu). StrainBc18 carries the B allele of the BciPRP8 intein and the MAT 1-1 al-lele. It was crossed with MAT 1-2 strain SAS405, which has no in-tein in the Prp8 locus and carries the 55 bp extein deletion in thelarge C-extein intron. A second cross was performed employingstrain B05.10, which carries the A allele of the BciPRP8 intein,and the MAT 1-1 allele. It was crossed with MAT 1-2 strain705.1, which has no intein in the Prp8 locus and carries the 55 bpinsertion in the large intron. Cultures of single ascospores collectedfrom the resulting apothecia (fruiting bodies) were analysed toinvestigate HEG-mediated intein homing. The progeny were ana-lysed either from individually dissected asci, randomly isolatedindividual spores, or in pools of randomly isolated spores.

3.5. Bc18 � SAS405 ascospore analysis

From the Bc18 � SAS405 cross, single ascospores were sampledfrom asci in ordered fashion by manual dissection and culturedindividually (van der Vlugt-Bergmans et al., 1993). A completeset of eight ascospores was isolated from five asci (A111, A211,A222, A311, and A322), six spores from one ascus (A113) and four

Homing Endonu

N-extein

Next0.5 rHEG1

1 kb

0.5 kb

Mar

ker

Bc18 x SAS405

1 kb1.2 kb

1 kb1.2 kb

1 kb1.2 kb

1 kb1.2 kb

A

B

C

Fig. 2. PCR screen of SAS405 � Bc18 offspring for the presence of the full-length BciPRP8 iscreened with Next0.5 and rHEG1. Progeny tested is coded by the number of the ascus (e.A111S1 is the first spore from ascus 111. From top: Lane 1–22: 100 bp ladder, offspring Aladder, offspring A212S3-S8, A222S1-S8, A223S1-S4, Bc18, SAS405, 100 bp ladder. Lane 1Lane 1–18: 100 bp ladder, offspring A3221-S8, A113S1-S6, Bc18, SAS405, 100 bp ladder. (C-extein indel region.

spores from another ascus (A223) (van der Vlugt-Bergmans et al.,1993). In ascus A113, two spores were lost during storage and inascus A223 half the spores never germinated. The presence ofBciPRP8 was determined by PCR with a HEG-specific internal pri-mer (fHEG1) and an external C-extein primer (Cext0.5) (Fig. 2a).All 50 progeny screened positive for the presence of the BciPRP8intein (Fig. 2b). Strain SAS405 carries the Daf1 gene conferringresistance to the dicarboximide fungicide vincozolin, while strainBc18 is sensitive to vinclozolin. Daf1 was inherited in the expectedMendelian 1:1 ratio in every ascus (Fig. S3 and Table S2). An addi-tional 350 random ascospore cultures were isolated and screenedfor the presence of the BciPRP8 intein. All these progeny carriedthe intein. Three-hundred-and-eleven (89%) of the randomly se-lected offspring carried the 55 bp insertion characteristic of the re-cipient SAS405 strain, while the remaining 39 carried the 55 bpdeletion (an example of the screen is shown in Fig. 2c).

3.6. B05.10 � 705-1 ascospore analysis

A total of 270 random spores were collected from theB05.10 � 705-1 cross. These were screened by PCR for the presenceof the BciPRP8 intein or the empty target allele. Fifty-one of theseprogeny were analysed individually, all of which screened positivefor the intein. The remaining 219 progeny were screened in poolsof ten. There was no evidence of any empty alleles. As a control,a duplicate pool of strains (progeny 210–219) was analysed to-gether with 705-1 as an undisputed empty allele control.

clease Gene

C-extein

55 bp indel

fHEG1 Cext0.5

Bc1

8progeny 1 - 20

SAS4

05

ntein. (A) Primer binding sites (Next0.5, rHEG1, fHEG1 and Cext0.5). (B) Ordered ascig., A111) and the number of the ascospore as it exited from the ascus (e.g., S1), hence

111S1-S8, A211S1-S8, A212S1-S2, Bc18, SAS405, 100 bp ladder. Lane 1–22: 100 bp–20: 100 bp ladder, offspring A311S1-S8, A313S1-S8, Bc18, SAS405, 100 bp ladder.

C) PCR screen of randomly isolated ascospores with fHEG1 and Cext0.5 including the

396 A.A.M. Bokor et al. / Fungal Genetics and Biology 47 (2010) 392–398

3.7. Extent of gene conversion in intein homing

The above result established that all meiotic progeny carriedthe intein, reflecting an efficient homing process. To investigatethe extent of the gene conversion region associated with HEG-mediated intein homing, sequence polymorphisms in intein-flank-ing regions were analysed in the strains derived from five completeascospore sets produced by dissection of asci from the crossBc18 � SAS405. There were several polymorphisms in the C-exteinthat could be used to deduce the extent of gene conversion. Imme-diately adjacent (within 21 bp) of the intein insertion site (Fig. 1)there were several SNPs and a 4 bp indel. All the progeny of theBc18 � SAS405 cross carried the Bc18 intein and both the Bc18SNPs and the indel adjacent to the intein. In addition there was a55 bp indel polymorphism 286 bp downstream from the insertionsite and two almost adjacent SNPs 449/451 bp from the insertionsite (Fig. 1). The 55 bp indel was inherited in a ratio of either 6:2(suggesting a single gene conversion, observed in two asci) or 8:0(two gene conversions, observed in three asci) (Table 1). The twoadjacent SNPs 449/451 bp downstream of the insertion site co-seg-regated, showing segregation ratios of 6:2 (observed in three asci)and 8:0 (observed in two asci). Notably, the A322 ascus showed 8:0segregation for the 55 bp indel but 6:2 for the distal SNPs. This sug-gests that one gene conversion extended to cover both the indeland the SNPs while the other covered the indel but not the SNPs.

A further SNP was identified in the C-extein �14 kb down-stream from the insertion site which introduced a PvuII site inthe SAS405 parent. PCR amplicons of this region were generatedfrom the five complete asci and all 40 amplicons were digestedwith PvuII. The digest revealed that all five asci showed 4:4 segre-gation for the PvuII polymorphism (Table 1). On the other side ofthe intein an additional SNP was identified in the N-extein�18 kb upstream of the insertion site which introduced a RsaI sitein the SAS405 DNA. PCR amplicons of this region were generatedfrom the five complete asci and all 40 amplicons were digestedwith RsaI. The digest revealed that in three asci this SNP showed

Table 1Summary of gene conversion region and HEG-induced recombination amongst SAS405 �

Ascus Spore no. RsaI 286 indel 449/451 SNP PvuII

A111 S1 + � AAC +S8 + � AAC +S3 + + GAA +S6 + + GAA +S2 � + GAA �S4 � + GAA �S5 � + GAA �S7 � + GAA �

A322 S6 + + AAC +S7 + + AAC +S2 + + GAA +S4 + + GAA +S1 � + GAA �S3 � + GAA �S5 � + GAA �S8 � + GAA �

A211 S1 + + GAA +S4 + + GAA +S6 + + GAA +S5 + + GAA �S8 � + GAA +S2 � + GAA �S3 � + GAA �S7 � + GAA �

The presence/absence of the 55 bp indel is indicated for each ascus as well as whether th18 kb into the N-extein and the PvuII site 14 kb into the C-extein. Both restriction sites aremarkers were only analysed in the complete octads. The spores are numbered in the or

a 4:4 inheritance ratio, in one (A311) there was a 5:3 segregation(RsaI+/�) and in one (A222) there was a 3:5 segregation (RsaI+/�) (Table 1). The spore order does not necessarily reflect the se-quence of meiotic divisions. This is explained by spindle overlapin the second meiotic division, terminal mitotic division and/orspore displacement during dissection of the ascus.

4. Discussion

The present analyses of the PRP8 intein of B. cinerea and the pre-vious analyses of the SceVMA intein of S. cerevisiae and relatedyeasts provide a number of similarities and contrasts. We havefound polymorphism for presence or absence of the intein in B.cinerea, resembling the polymorphism for presence/absence ofthe SceVMA intein of S. cerevisiae (Okuda et al., 2003; Poulteret al., 2007). Thus in neither case has the intein come to fixation.This polymorphic state provided an opportunity to experimentallystudy the activity of the HEG encoded within the B. cinerea inteinand to analyse its behaviour in the gene pool of a sexually compe-tent fungus. By performing sexual crosses between B. cinerea iso-lates carrying the intein and isolates containing an empty Prp8allele, we followed the gene conversion of the empty allele andthe segregation of the intein in progeny.

There are two intein types identified in this study. The type Aintein alleles, present in isolates B05.10 (from Germany) and AB-CL (from a dried longan sourced from China) are identical. The Aand B type intein alleles differ by six neutral SNPs and a 21 bp (se-ven amino acid) indel (Figs. S1 and S2). Both of these B. cinerea in-tein alleles contain the typical conserved motifs required for HEG-initiated movement (Perler et al., 1997) and both types were in-deed experimentally shown to be active. The strains carrying thetype A intein alleles share a T 3 bp downstream from the inteininsertion site (all other strains carry a C at this position). S. cerevi-siae similarly carries two distinct but related SceVMA intein alleles(Okuda et al., 2003).

Bc18 progeny.

Ascus Spore no. RsaI 286 indel 449/451 SNP PvuII

A311 S3 + � AAC +S4 + � AAC +S7 + + GAA +S8 � + GAA +S1 � + GAA �S2 � + GAA �S5 � + GAA �S6 � + GAA �

A222 S7 + + GAA +S2 + + GAA +S5 + + GAA +S6 + + GAA +S1 + + GAA �S3 � + GAA �S4 � + GAA �S8 � + GAA �

A113 S1 � AACS2 � AACS3 � AACS5 � AACS4 + GAAS6 + GAA

A223 S1 + GAAS2 + GAAS3 + GAAS4 + GAA

e gene conversion extends beyond the double 449/451 SNP. The RsaI site is locatedpresent in the SAS405 recipient parent and not in the Bc18 donor parent. The distal

der they exited the ascus during dissection.

A.A.M. Bokor et al. / Fungal Genetics and Biology 47 (2010) 392–398 397

Analysis of the S. cerevisiae VMA intein has shown that it is inac-tive during mitosis and that gene conversion (initiated by the HEG)occurs during meiosis in a proportion of tetrads, the frequency ofoccupied alleles being 80–90% (Gimble and Thorner, 1992; God-dard et al., 2001). In B. cinerea, gene conversion appears to be muchmore efficient. All 686 progeny of two separate crosses involvingfour distinct parental strains carried the intein. Thus HEG-initiatedgene conversion can apparently achieve 100% efficiency. Perhapsthe lower frequency of gene conversion by the S. cerevisiae VMA in-tein reflects a partial loss of activity. Notably, 11 of the 14 HEGsstudied in the saccharomycete inteins are completely inactive (Po-sey et al., 2004). B. cinerea is haploid during mitotic growth andtherefore the opportunity for HEG-initiated gene conversion is re-stricted to the sexual cycle (where the diploid state exists briefly).

One of the interesting aspects of the present analysis is the con-tribution to our understanding of gene conversion. Gene conver-sion and other systems of homologous recombination have beenthe subject of extensive analysis, for example see Mimitou andSymington (2009). Recently whole genome sequencing has beenused to characterise meiotic crossing over and gene conversionin S. cerevisiae (Qi et al., 2009). The intein-dependent meioticrecombination events are unusual in that they are initiated at aspecific site in the genome in contrast to spontaneous meioticrecombination events. This permits the detailed study of recombi-nation in a defined region of the genome. The experimental studiesin S. cerevisiae were performed with isogenic strains and thereforeprovide no direct proof of the occurrence of gene conversion offlanking sequences or the extent of such gene conversion. Thepolymorphisms in the C-exteins of the B. cinerea strains permittedthe direct detection of the gene conversion and the determinationof the boundaries of the recombination. All the dissected ascosp-ores (Table 1) of the Bc18 � SAS405 cross had both the Bc18 inteinand the Bc18 25 bp polymorphic tract adjacent to the intein, indi-cating that intein-initiated gene conversion always included thewhole of this 25 bp region. The analysis of the 55 bp indel in thefive individual asci from this cross showed two asci segregating6:2 and three asci 8:0. This indicates that gene conversion often ex-tends to this position, which is 286 bp from the intein insertionsite. Analysis of the polymorphisms at positions 449 and 451 indi-cates that gene conversion even extends as far as these sites (threeasci 6:2 and two 8:0). In two ascospores from ascus A322 (believedto be a mitotic pair) the gene conversion affected the 55 bp indel atposition 286 but not the 449/451 polymorphisms (that is, the geneconversion boundary fell between these positions). The C-exteinpolymorphism furthest from the integration site was the PvuII +/� SNP (almost 14 kb from the integration site). The digest revealedthat in all asci this SNP showed a 4:4 inheritance ratio. The RsaI +/�SNP in the N-extein (almost 18 kb from the integration site) segre-gated 4:4 in three asci, in one ascus (A311) there was a 5:3 segre-gation and in one (A222) a 3:5 segregation. This indicates thatrecombination initiated at the integration site often extends to18 kb.

The five completely characterised asci are each different andthese differences demonstrate a number of aspects of intein-initi-ated recombination. Ascus A111 shows gene conversion at the286 indel and the 449/451 SNP producing a 6:2 excess of the donorsequence at both sites. The detection of asci showing 6:2 segrega-tion (one of the empty targets gene converted and the other not al-tered) demonstrates that conversion and intein mobility occurs atthe four-strand stage (post-replication) when general meioticrecombination is occurring. Ascus A322 shows 8:0 segregation atthe 286 indel position and 6:2 at the more distal 449/451 SNP(with the donor sequence in excess at both sites). This indicatesthat the gene conversion is of variable length in different meioses.Ascus A211 demonstrates even more extensive gene conversionwith 8:0 segregation at both the 286 indel and 449/451 SNP sites.

In addition, the ascospores in ascus A211 cannot be arranged asidentical mitotic pairs (shown as an aberrant 4:4 pattern at the RsaIsite in Table 1). This indicates the presence of reciprocal heterodu-plex DNA in two of the pre-mitotic nuclei. Ascus A311 shows 6:2segregation (donor excess) in the 286 bp and 449/451 SNPs. TheRsaI site shows a 5:3 segregation (donor excess) suggesting eithera non-reciprocal heteroduplex formed by strand migration or alter-natively reciprocal heteroduplex formation followed by conversionof one heteroduplex strand. Ascus A222 shows 8:0 segregation atthe 286 bp and 449/451 bp sites and a 3:5 segregation (recipientexcess) at the RsaI site indicating reciprocal heteroduplex forma-tion followed by conversion of one heteroduplex strand (leadingto excess of the recipient allele).

These results established experimentally that the B. cinerea in-tein can jump into an empty target allele with a high efficiency(apparently 100% in the viable ascospores) and that this jumpwas associated with gene conversion of the adjacent polymorphicextein sites. This is only the second nuclear intein shown experi-mentally to perform this process and the first ever where gene con-version of the flanking sequences has been demonstrated. Havingestablished experimentally that the intein could jump it was ofinterest to see if there was evidence of these processes occurringin the natural population of B. cinerea.

There is no obvious geographical or host plant bias in B. cinereastrains carrying the intein. The inteins appear to be of world-widedistribution, although the sample size is small. The Bc18 intein al-lele is found in strains from Europe, Turkey, Australia and New Zea-land. The B05.10 intein allele is found in Europe and China.

The occupied alleles invariably have a unique C-extein se-quence immediately adjacent to the integration site. This sug-gests that when the intein jumps to an empty site it alwayscarries a gene conversion tract of 25 bp. The observation thatall occupied alleles have this identical C-extein 25 bp sequenceand the identical N-extein SNP at -1 suggests that both the Aand B intein types have a common origin. The A and B inteinshave however diverged quite significantly (six neutral mutationsand a 21 bp indel) suggesting that the common origin of the al-leles must be quite distant. The occupied alleles carry variouscombinations of the more distal C-extein polymorphisms. Thisis what would be predicted if intein gene conversion invariablyincluded the immediately adjacent 25 bp but showed variationin the gene conversion of the more distant C-extein polymor-phisms. The empty alleles show no evidence of recombinationbetween their polymorphic sites (the sites are in linkage disequi-librium). Seven distinct haplotypes occur in the empty alleles.Inteins have invaded at least five of these haplotypes showingthat the inteins have been active during the evolution of the spe-cies. Taken together with the two somewhat diverged intein al-leles both of which have been shown to have active HEGs, thisdemonstrates that an active HEG can persist in a species foran extended evolutionary period. There is no evidence of inteinloss in the present analysis. Intein loss from an occupied allelewould be expected to retain the distinctive flanking sequence(25 bp containing 10 polymorphisms as compared to emptyalleles).

One model of intein evolution (Goddard and Burt, 1999) pre-dicts that the intein will come to fixation, become defective andperhaps be lost. This hypothesis proposes that the intein remainsactive during evolution as a result of repeated horizontal trans-fers. An alternative equilibrium model proposes that the inteindoes not come to fixation but rather remains in equilibrium withthe empty allele and therefore the intein can remain active inthe absence of horizontal transmission (Burt and Koufopanou,2004). The results of the present analysis lend support to theequilibrium model in that the intein has not come to fixationand there is no evidence of intein inactivation (both A and B in-

398 A.A.M. Bokor et al. / Fungal Genetics and Biology 47 (2010) 392–398

tein alleles gave 100% gene conversion to the empty allele inexperimental crosses). This resembles the situation in S. cerevisi-ae where there are two VMA intein alleles neither of which havecome to fixation. It is possible that the BciPRP8 intein was ac-quired by horizontal transfer, but if so this must have been inthe remote past because the two intein alleles have divergedmarkedly from each other. This resembles the situation in S.cerevisiae where there are two VMA intein alleles with quitedivergent sequences (Okuda et al., 2003). The 25 bp highly diver-gent sequence in the C-extein immediately flanking the inteincould be evidence of a horizontal transfer from a distantly re-lated source species. The proximal codon of the empty exteinsis invariably TCG whereas the corresponding codon in the HEGoccupied alleles is AGY. This site is critical for intein splicing,the hydroxyl of the serine acts in the transesterification reaction(Paulus, 2000; Xu et al., 1993, 1994). It would be difficult for aTCG codon to mutate in one step to AGY, any intermediate stepwould not encode serine and would therefore be unable to splice(a lethal allele in a haploid fungus). The distinct serine codonstherefore support the idea that the intein and its immediateflanks may have been acquired by horizontal transfer from somedistant source species. This divergent flanking sequence wouldhave been retained because the gene conversion event extendsthrough this region without the possibility of recombination.However only this proximal divergent sequence would be re-tained, more distal sequences would be lost during the move-ment of the intein through the gene pool. We are currentlyanalysing the inteins in other species from the genus Botrytisto see which species have an intein and to determine the se-quence of the C-exteins.

The data presented indicate that the PRP8 intein of B. Cinerea isactive. The sequences of the empty and occupied alleles show thatgene conversion is occurring in the natural population. This dem-onstrates, for the first time, that an intein can maintain itself andspread through a gene pool. It is not clear if the incidence of the in-tein is increasing and will eventually achieve fixation or, alterna-tively, if the intein is in equilibrium with the empty allele. Theseresults support the feasibility of using HEGs to modify natural pop-ulations. Applying such a scheme to modify a pest species (such asAnopheles) would, however, depend on finding or creating a HEGwith the ability to spread through the gene pool of the targetspecies.

Appendix A. Supplementary material

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.fgb.2010.01.003.

References

Burt, A., 2003. Site-specific selfish genes as tools for the control and geneticengineering of natural populations. Proc. Biol. Sci. 270, 921–928.

Burt, A., Koufopanou, V., 2004. Homing endonuclease genes: the rise and fall andrise again of a selfish element. Curr. Opin. Genet. Dev. 14, 609–615.

Butler, M.I. et al., 2006. The distribution and evolutionary history of the PRP8 intein.BMC Evol. Biol. 6, 42.

Faretra, F. et al., 1988. Sexual behaviour and mating system of Botryotinia fuckeliana,telemorph Botrytis cinerea. Gen. Microbiol. 134, 2543–2550.

Gimble, F.S., Thorner, J., 1992. Homing of a DNA endonuclease gene by meiotic geneconversion in Saccharomyces cerevisiae. Nature 357, 301–306.

Goddard, M.R., Burt, A., 1999. Recurrent invasion and extinction of a selfish gene.Proc. Natl. Acad. Sci. USA 96, 13880–13885.

Goddard, M.R. et al., 2001. Outcrossed sex allows a selfish gene to invade yeastpopulations. Proc. Biol. Sci. 268, 2537–2542.

InBase, http://www.neb.com/neb/inteins.html.Liu, X.Q., Yang, J., 2004. Prp8 intein in fungal pathogens: target for potential

antifungal drugs. FEBS Lett. 572, 46–50.Mimitou, E.P., Symington, L.S., 2009. Nucleases and helicases take center stage in

homologous recombination. Trends Biochem. Sci. 34, 264–272.Moure, C.M. et al., 2002. Crystal structure of the intein homing endonuclease PI-SceI

bound to its recognition sequence. Nat. Struct. Biol. 9, 764–770.Nagai, Y. et al., 2003. Karyopherin-mediated nuclear import of the homing

endonuclease VMA1-derived endonuclease is required for self-propagation ofthe coding region. Mol. Cell. Biol. 23, 1726–1736.

Okuda, Y. et al., 2003. Occurrence, horizontal transfer and degeneration of VDEintein family in Saccharomycete yeasts. Yeast 20, 563–573.

Paulus, H., 2000. Protein splicing and related forms of protein autoprocessing. Annu.Rev. Biochem. 69, 447–496.

Perler, F.B. et al., 1997. Compilation and analysis of intein sequences. Nucleic AcidsRes. 25, 1087–1093.

Posey, K.L. et al., 2004. Evolution of divergent DNA recognition specificities in VDEhoming endonucleases from two yeast species. Nucleic Acids Res. 32, 3947–3956.

Poulter, R.T. et al., 2007. The nuclear-encoded inteins of fungi. Fungal Genet. Biol.44, 153–179.

Qi, J. et al., 2009. Characterization of meiotic crossovers and gene conversion bywhole-genome sequencing in Saccharomyces cerevisiae. BMC Genom. 10, 475.

van der Vlugt-Bergmans, C.J.B. et al., 1993. Genetic variation and segregation of DNApolymorphisms in Botrytis cinerea. Mycol. Res. 97, 1193–1200.

Windbichler, N. et al., 2007. Homing endonuclease mediated gene targeting inAnopheles gambiae cells and embryos. Nucleic Acids Res. 35, 5922–5933.

Xu, M.Q. et al., 1993. In vitro protein splicing of purified precursor and theidentification of a branched intermediate. Cell 75, 1371–1377.

Xu, M.Q. et al., 1994. Protein splicing: an analysis of the branched intermediate andits resolution by succinimide formation. EMBO J. 13, 5517–5522.