Selenate-resistant mutants of Arabidopsis thaliana identify Sultr1;2, a sulfate transporter required...

Selenate-resistant mutants of Arabidopsis thaliana identifySultr1;2, a sulfate transporter required for ef®cienttransport of sulfate into roots

Nakako Shibagaki1,2, Alan Rose3, Jeffrey P. McDermott1, Toru Fujiwara2, Hiroaki Hayashi2, Tadakatsu Yoneyama2 and

John P. Davies1,*,²

1Department of Botany, Iowa State University, Ames, Iowa 50011, USA,2Department of Applied Biological Chemistry, Graduate School of Agricultural and Life Sciences, the University of Tokyo,

Yayoi, Bunkyo-ku, Tokyo 113-8657, Japan, and3Section of Molecular and Cellular Biology, Division of Biological Sciences, University of California, Davis, 1 Shields

Avenue, Davis, California 95616, USA

Received 20 August 2001; revised 1 November 2001; accepted 21 November 2001.*For correspondence (fax +1 503 670 7703; e-mail [email protected]).²Current address: Exelixis Plant Sciences, 16160 SW Upper Boones Ferry Road, Portland, Oregon 97224-7744, USA.

Summary

To investigate how plants acquire and assimilate sulfur from their environment, we isolated and

characterized two mutants of Arabidopsis thaliana de®cient in sulfate transport. The mutants are

resistant to selenate, a toxic analogue of sulfate. They are allelic to each other and to the

previously isolated sel1 (selenate-resistant) mutants, and have been designated sel1-8 and sel1-9.

Root elongation in these mutants is less sensitive to selenate than in wild-type plants. Sulfate

uptake into the roots is impaired in the mutants under both sulfur-suf®cient and sulfur-de®cient

conditions, but transport of sulfate to the shoot is not affected. The sel1 mutants contain lesions in

the sulfate transporter gene Sultr1;2 located on the lower arm of chromosome 1. The sel1-1, sel1-3

and sel1-8 mutants contain point mutations in the coding sequences of Sultr1;2, while the sel1-9

mutant has a T-DNA insertion in the Sultr1;2 promoter. The Sultr1;2 cDNA derived from wild-type

plants is able to complement Saccharomyces cerevisiae mutants defective in sulfate transport, but

the Sultr1;2 cDNA from sel1-8 is not. The Sultr1;2 gene is expressed mainly in roots, and

accumulation of transcripts increases during sulfate deprivation. Examination of transgenic plants

containing the Sultr1;2 promoter fused to the GUS-reporter gene indicates that Sultr1;2 is expressed

mainly in the root cortex, the root tip and lateral roots. Weaker expression of the reporter gene

was observed in hydathodes, guard cells and auxiliary buds of leaves, and in anthers and the basal

parts of ¯owers. The results indicate that Sultr1;2 is primarily involved in importing sulfate from the

environment into the root.

Keywords: sulfate uptake, Sultr1;2, Arabidopsis thaliana, mutants, selenate, b-glucuronidase.

Introduction

Plants import sulfur from the soil through the roots as

sulfate. Inside the plant, sulfate is metabolized in the

plastids where it is incorporated into amino acids and a

variety of other sulfo-organic compounds. Sulfate is a

relatively inert compound and must be activated by ATP

sulfurylase prior to being metabolized. Adenosine 5¢-phosphosulfate, the activated form of sulfate, is reduced

and incorporated into the amino acids cysteine and

methionine, and used in sulfation reactions to produce

sulfated lipids and polysaccharides.

As sulfate is imported into the roots and metabolized in

plastids, a network of transporters is required to move it

throughout the plant. Sulfate is imported from the soil into

the root symplast and transported across the root to the

central stele. It is then imported into the xylem, trans-

ported to the shoot, discharged into leaf cells, and ®nally

The Plant Journal (2002) 29(4), 475±486

ã 2002 Blackwell Science Ltd 475

transported into the chloroplast, the predominant site of

sulfur reduction. Sulfate is also transported across the

tonoplast into the vacuole where it can be stored at

relatively high concentrations (Saito, 2000). Furthermore,

the observed increase in sulfate uptake when plants are

deprived of sulfate (Smith et al., 1997; Takahashi et al.,

1997) may result from induced expression of speci®c

sulfate transporters. Fungi and algae synthesize new

high-af®nity sulfate transport systems when placed in

sulfur-de®cient conditions (Marzluf, 1970; Yildiz et al.,

1994).

Sequence analysis indicates that the Arabidopsis

thaliana genome has 14 putative sulfate transporter

genes. These transporters fall into four closely related

phylogenetic groups (Grossman and Takahashi, 2001;

Takahashi et al., 2000), 12 have 12 membrane-spanning

domains and a STAS domain at their carboxy-terminus

(Aravind and Koonin, 2000) the other 2 have 12 mem-

brane spanning domains but lack the STAS domain.

Plant sulfate transporters function as proton/sulfate co-

transporters, transporting three protons with each sul-

fate ion. The driving force for sulfate transport is the pH

gradient across the membrane set up by a proton

pumping ATPase (Hawkesford et al., 1993; Lass and

Ullrich-Eberius, 1984).

Several sulfate transporters from Arabidopsis have been

characterized. Kinetic analysis of two Arabidopsis sulfate

transporters in yeast cells has identi®ed Sultr1;1 as a high-

af®nity transporter and Sultr2;1 as a low-af®nity trans-

porter (Takahashi et al., 2000). Gene expression patterns of

four sulfate transporters have been analysed in transgenic

Arabidopsis plants expressing reporter genes from the

promoters of these genes. The results indicate that Sultr1;1

is expressed in the root tips and external cell layers of the

roots, Sultr2;1 in the vascular tissue of both the leaves and

the roots, Sultr2;2 in the phloem of roots and vascular

bundle sheath in leaves (Takahashi et al., 2000), and

Sultr4;1 in the chloroplast (Takahashi et al., 1999).

Because it has a high af®nity for sulfate and is expressed

in the root tip, Sultr1;1 has been proposed to be the

transporter primarily responsible for sulfate uptake from

the soil solution. Sultr2;1 is thought to be primarily

responsible for transport of sulfate inside the plant from

one tissue to another (Takahashi et al., 2000). Multiple

sulfate transporters with unique kinetic properties and

gene-expression patterns appear to be necessary for

plants to import sulfate from the soil solution and trans-

port it throughout the plant under a variety of environ-

mental conditions (Saito, 2000).

Although progress has been made in identifying sulfate

transporters and examining patterns of gene expression,

the role of most of the sulfate transporters in sulfur

metabolism remains unclear. To begin to dissect how

these transporters work together, we have used a genetic

approach to identify Arabidopsis plants containing lesions

in a speci®c sulfate transporter.

To identify sulfate transport mutants, we screened for

plants resistant to toxic analogues of sulfate. Selenate and

chromate are thought to be assimilated into modi®ed

forms of cysteine and methionine via the sulfate assimi-

lation pathway. Incorporation of these modi®ed amino

acids into proteins may disrupt protein structure and

enzymatic activity, and inhibit growth. We reasoned that

plants resistant to these compounds might contain lesions

in a sulfate transporter or an enzyme involved in sulfate

assimilation, and enable us to begin to dissect the sulfate

assimilation pathway of Arabidopsis. Identi®cation of

selenate- and chromate-resistant micro-organisms has

been invaluable for elucidating sulfur transport or assimi-

lation mechanisms in these organisms (Breton and Surdin-

Kerjan, 1977; Cherest et al., 1997; Marzluf, 1970; Smith

et al., 1995a).

Here we report on the identi®cation and characterization

of Arabidopsis mutants with lesions in the Sultr1;2 gene.

Our results indicate that Sultr1;2 is primarily expressed in

the root and is mainly involved in transporting sulfate from

the soil into the root. It does not appear to be involved in

transporting sulfate to the shoot.

Table 1. Genetic segregation of the selenate-resistant phenotype

Strain or cross Generation n Sena Resa c2 b

WT Col-0 85 85 0WT Ws 78 78 0sel1-8d M4 156 0 156sel1-9e T6 141 0 141Col-0 3 sel1-8f F2 300 228 72 0.124c

Ws 3 sel1-9f F2 89 64 25 0.45c

sel1-8 3 sel1-9f F1 22 0 22F2 54 0 54

sel1-8d 3 sel1-1f F1 6 0 6F2 21 0 21

sel1-9e 3 sel1-3f F1 6 0 6F2 21 0 21

aSen, sensitive; Res, resistant on medium lacking sulfate andcontaining 20 mM selenium and 40 mM chromate.bc2value calculated based on an expected ratio of 3 : 1 segrega-tion.cP > 0.1.dsel1-8 corresponds to mutant line from EMS mutagenizedpopulation (see text).esel1-9 corresponds to mutant line from T-DNA mutagenizedpopulation (see text).fAll crosses were performed reciprocally. There was no signi®cantdifference in the ratio of segregation between the reciprocalcrosses (data not shown). The above ®gures are the sum of allcrosses performed.

476 Nakako Shibagaki et al.

ã Blackwell Science Ltd, The Plant Journal, (2002), 29, 475±486

Results

Isolation and genetic characterization of selenate-

resistant mutants

Selenate-resistant mutants of Arabidopsis were identi®ed

by germinating M2 seeds of a mutagenized population on

solid medium containing 20 mM selenate and 40 mM

chromate, allowing the seedlings to grow for 2 weeks

and comparing root length. Under these conditions, the

roots of wild-type plants were very short (<1 mm). Plants

from the mutagenized population with longer roots (»3±

5 mm) were selected for further analysis. From ten thou-

sand EMS mutagenized M2 lines of the Columbia (Col-0)

accession, seven putative selenate-resistant mutants were

identi®ed. From one hundred thousand T4 seedlings of

9510 T-DNA tagged lines of the Wassilewskija (Ws) acces-

sion, 10 putative selenate-resistant mutants were identi-

®ed. After re-screening progeny of the putative mutants,

we identi®ed one mutant line from the EMS mutagenized

population, and another from the T-DNA mutagenized

population.

Genetic analysis indicates that the selenate-resistant

phenotypes of mutants are caused by single recessive

mutations (Table 1). F1 progeny of the both mutant lines

crossed to parental wild-type strains are sensitive to

selenate, indicating that the lesions are recessive.

Selenate sensitivity in F2 progeny of both mutant lines

segregates in a 3 : 1 ratio (sensitive : resistant), indicating

that the mutant phenotypes are caused by a mutation at a

single locus.

Genetic complementation tests indicate that the two

selenate-resistant mutants identi®ed are in the same

complementation group (Table 1). The mutant line from

the EMS mutagenized population and the line from the T-

DNA mutagenized population were crossed to each other,

and all F1 and F2 progeny tested were resistant to selenate.

The results indicate that these mutants contain lesions at

the same genetic locus. Rose (1997) previously isolated

seven allelic selenate-resistant mutants (sel1-1 to sel1-7)

by screening for plant growth on medium containing

10 mM selenate. To determine whether the mutants that we

isolated are allelic with sel1, genetic complementation

tests were performed by crossing the mutant from the

EMS mutagenized population with sel1-1, and the mutant

from the T-DNA mutagenized population with sel1-3. All F1

and F2 progeny from these crosses were selenate-resistant

(Table 1), indicating that the mutants are all alleles of sel1.

We have named the mutant isolated from the EMS

mutagenized population sel1-8, and the mutant from the

T-DNA mutagenized population sel1-9.

The selenate-resistant phenotype of sel1-9 co-segre-

gates with a T-DNA insertion. The sel1-9 mutant line was

isolated from a T-DNA tagged population generated by

Figure 1. Root growth in wild-type and mutant plants.The sel1-8 and sel1-9 mutants are resistant to selenate.(a,b) show pictures of seedlings germinated on solid medium. Wild-type(Col-0, Ws) and mutant (sel1-8 and sel1-9) seedlings were germinated onmedium lacking sulfate containing 5 or 10 mM selenate (a), or containing1600 or 0 mM sulfate with no selenate. (b) Seedlings were grown for7 days and photographed through a dissecting microscope. Bars are0.5 cm (a) and 1 cm (b).(c) Root length of 9-day-old-seedlings. Root length (mean standarddeviation, n = 20) of Col-0 (r) and sel1-8 (j) (upper panel) and Ws (m)and sel1-9 (d) (lower panel) was measured 9 days after sowing on solidmedium lacking sulfate and containing 0, 2.5, 5.0, 10, 20 or 40 mM

selenate.

Sultr1;2 is required for transport of sulfate into roots 477


transformation of wild-type Arabidopsis with a Ti plasmid

(Forsthoefel et al., 1992). This plasmid carries the neomy-

cine phosphotransferase (NPTII) gene that confers kana-

mycin resistance. Kanamycin resistance in the F2 progeny

of wild type and the sel1-9 mutant segregates 61 : 26

(resistant : sensitive), suggesting that the line sel1-9 car-

ries an NPTII gene at a single genetic locus (P > 0.1). In

addition, all 30 selenate-resistant F2 plants tested were

kanamycin-resistant, and all 12 kanamycin-sensitive F2

plants examined were sensitive to selenate, suggesting

that the T-DNA insertion caused the mutation conferring

selenate resistance.

Phenotypic characterization of the mutants

The selenate-resistant mutants sel1-8 and sel1-9 were

isolated based on their ability to grow longer roots than

wild-type plants on sulfur-de®cient medium containing

selenate and chromate. To test if the mutants were able to

grow roots more ef®ciently than the wild-type strains

under other conditions, root growth was compared on

medium lacking selenate and chromate, or containing

various concentrations of these compounds, both in the

presence and absence of sulfate. Root growth of mutant

and wild-type plants was identical on sulfate-replete and

sulfate-de®cient media in the absence of selenate and

chromate (Figure 1b). However, both sel1-8 and sel1-9

grew longer roots than the wild-type plants on sulfate-

de®cient medium containing selenate (Figure 1a,c).

Chromate did not signi®cantly affect root growth of wild-

type and mutant plants at the concentrations used for

screening (data not shown), suggesting that selenate was

the major cause for the defect in root elongation. Although

root growth in sel1-8 and sel1-9 is sensitive to selenate

under sulfur-de®cient conditions, it is less sensitive than in

wild-type plants (Figure 1c). Root growth in sel1-9 was also

less sensitive to selenate than the Ws wild-type strain in

the presence of 0.7 mM sulfate (data not shown).

The selenate-resistant phenotype of the mutants could

be caused by a defect in sulfate uptake or assimilation. To

determine if sulfate transport was disrupted in the

mutants, we compared sulfate uptake in sel1-9 and Ws

wild type. Plants were grown under sulfate-replete condi-

tions or starved for sulfate for 72 h and sulfate uptake was

measured at several different sulfate concentrations. The

results shown in Figure 2 indicate that in both mutant and

wild-type plants, the rate of sulfate transport is higher in

plants deprived of sulfate for 72 h than in plants main-

tained in sulfur-replete medium. However under both

sulfur-replete and sulfur-de®cient conditions, transport of

sulfate into the roots of mutant plants was slower than into

the roots of wild-type plants (Figure 2a). Similar results

were obtained when sulfate transport in sel1-8 and Col-0

was compared (data not shown). The results suggest that

these mutants are de®cient in a sulfate transporter that

contributes to sulfate transport into roots at a broad range

of concentrations under both sulfate-suf®cient and sulfate-

de®cient conditions.

The sel1-9 mutant shows no defect in the rate of

transport of sulfate into the shoot. These rates were

calculated by dividing the amount of radioactive sulfate

transported into the shoot by the fresh weight of the shoot

(Figure 2b). There was no difference in the mass of the

wild-type and mutant plants (data not shown). The sel1-9

mutant appears to be able to maintain sulfate transport

into the shoot despite lower rates of sulfate transport into

the roots.

Mapping and identi®cation of the mutations

To identify the gene responsible for the mutant phenotype,

the lesion in sel1-8 was genetically mapped. The mutant

(Col-0 accession) was crossed with a wild-type plant from

the Ler accession. The F1 plants were allowed to self-

fertilize and the resulting F2 plants used to genetically map

the mutation. F2 seeds were germinated on solid medium

containing 20 mM selenate and scored for selenate resist-

ance. Total DNA was isolated from F2 plants, and segre-

gation of molecular genetic markers was analysed.

Phenotypes were con®rmed by examining the F3 plants.

The mutation was mapped to the lower arm of chromo-

some 1 between the markers nF22K20 and SGCSNP253 by

Figure 2. Sulfate uptake rate is impaired in the sel1 mutants.Sulfate uptake rates in Ws (n, m) and sel1-9 (s, d) into roots (a)andshoots (b)of plants grown in sulfur-replete medium (®lled symbols, m, d)and sulfur-de®cient medium (open symbols, n, s). (a) The total amountof sulfate (pmol) imported into the entire plant through roots during1 hour uptake is divided by the root fresh weight (mg). (B) The amountof sulfate imported into the shoot (pmol) is divided by the shoot freshweight (mg). All the values represent the means of three to ®veexperiments, and each experiment was composed of three to sixmeasurements.



examining 197 F2 progeny. Seven recombinations among

372 chromosomes were observed between the mutation

and nF22K20, and ®ve recombinations among 394

chromosomes between the mutation and SGCSNP253.

This mapped the mutation to a region of »400 kbp (Figure

3a).

Seven BAC clones spanning the region between these

two markers had been sequenced and partially annotated

by the Arabidopsis Genome Initiative at the time of this

analysis. One of these, F28K19 (GenBank accession no.

AC009243), contained two genes encoding sulfate trans-

porters: Sultr2;2 (GenBank accession no. AB012047;

Takahashi et al., 1996) and Sultr1;2 (GenBank accession

no. AB042322; Yoshimoto et al., 2002). Because the

mutants were impaired in sulfate transport, we investi-

gated whether either of these genes contained a mutation.

Genomic DNA fragments corresponding to these genes

from sel1-8 were PCR-ampli®ed and sequenced. To exam-

ine the Sultr2;2 gene, a DNA fragment spanning the region

from 1.7 kbp upstream of the start codon to 0.9 kbp

downstream of the stop codon was ampli®ed by PCR. No

difference in DNA sequence between the ampli®ed frag-

ment from the sel1-8 mutant and the corresponding region

registered in GenBank was observed. To examine the

Sultr1;2 gene, the region from 0.7 kbp upstream of the

start codon to 0.2 kbp downstream of the stop codon was

ampli®ed and sequenced. A mutation was found in the

ninth exon at position +1532 relative to the start codon; the

Col-0 wild-type DNA contains a T while sel1-8 has a C. This

change in the nucleotide sequence alters codon 511 from

coding for Ile in the wild-type to Thr in sel1-8 (Figure 3b).

Ile 511 is located in the cytosolic extension of the trans-

porter located between of the 12th membrane spanning

domain (MSD) and the STAS domain. The change was

also observed in cDNA fragments of Sultr1;2 generated

from RNA isolated from the sel1-8 mutant plant; cDNA

fragments from selenate-sensitive lines did not have this

change.

Mutations were also detected in PCR products contain-

ing the Sultr1;2 genes of the selenate-resistant mutants

sel1-1 and sel1-3 (Rose, 1997). In sel1-1 the C at position

+287 is changed to a T, and in sel1-3 the G at +1526 is

changed to an A. The lesion in the sel1-1 mutant changes

Ser 96 to Phe and the lesion in sel1-3 changes Gly 509 to

Glu (Figure 3b). Interestingly, the lesions in sel1-3 and sel1-

8 cause changes at amino acids 509 and 511, respectively.

These amino acids are both within the region linking the

MSDs and the STAS domain (Aravind and Koonin, 2000).

Since the sel1-9 mutant phenotype co-segregates with a

T-DNA insert and is allelic with the other sel1 mutants, we

tested whether the sel1-9 mutant contains a T-DNA

insertion in the Sultr1;2 gene. We attempted to PCR

amplify DNA fragments from sel1-9 genomic DNA using

several sets of primers speci®c for the T-DNA and the

Sultr1;2 gene. One set, containing one primer speci®c for

the left border of the T-DNA and the other for the 3¢ end of

the Sultr1;2 gene, ampli®ed a 4.1 kbp fragment of genomic

DNA from sel1-9. The DNA sequence of this fragment

determined that the T-DNA integrated into the promoter

region of the Sultr1;2 gene, 434 bp upstream of the

translation initiation site and 374 bp upstream of the

putative transcription initiation site (Figure 3b). DNA gel-

blot and PCR analysis showed that the adjacent sulfate

transporter gene, Sultr2;2, was not disrupted in sel1-9

(data not shown). Furthermore, Sultr1;2 transcripts could

not be detected by either RNA gel blot or RT±PCR in sel1-9,

while transcripts of Sultr2;2 were readily detected (Figure

4; Table 2). These results indicate that transcription of the

Sultr1;2 gene but not the Sultr2;2 gene is disrupted by the

T-DNA insertion in sel1-9.

Functional complementation of a yeast mutant by

Sultr1;2 cDNA

The deduced amino acid sequence of Sultr1;2 is 72%

identical to Sultr1;1 and 54% identical with Sultr2;1, two

genes that have been demonstrated to have sulfate

transport activity (Takahashi et al., 2000; Vidmar et al.,

2000). Analysis of Sultr1;2 hydrophobicity using MEMSAT

2 (http://insulin.brunel.ac.uk/psipred/ Jones, 1998) pre-

dicted 12 putative MSDs. This topology is known to be

Figure 3. The sel1 mutations map to the bottom of chromosome I in theSultr1;2 gene.(a)Map of chromosome I. Seven recombinations in 372 chromosomesand ®ve recombinations in 394 chromosomes were observed betweenthe sel1-8 mutation and the markers F22K20 and SGCSNP253,respectively. The horizontal black bars represent BAC clones that mapbetween F22K20 and SGCSNP23.(b)The BAC F28K19 contains genes encoding the sulfate transportersSultr1;2 (hatched arrow) and Sultr2;2 (open arrow). The direction of thearrow indicates the direction of transcription. Asterisks represent theposition of the lesions in sel1-1, sel1-3 and sel1-8. T-DNA was integratedat 434 bp upstream of translation initiation site of Sultr1;2 in sel1-9. Thismap is based on data from the Arabidopsis Information Resource (http://www.arabidopsis.org).



common in all the eukaryotic proton/sulfate transporters

identi®ed to date.

To con®rm that the Sultr1;2 gene encodes a functional

sulfate transporter, a cDNA clone was used to functionally

complement the Saccharomyces cerevisiae methione

auxotrophic strain CP154-7B (Mata, his3, leu2, ura3,

ade2, trp1, sul1::LEU2, sul2::URA3). This strain carries

insertions in the sulfate transporter genes SUL1 and SUL2

(Cherest et al., 1997) and is therefore a methionine

auxotroph. A cDNA fragment of the Sultr1;2 gene includ-

ing start and stop codons was ampli®ed by RT±PCR using

total RNA isolated from the roots of the wild-type Col-0

plants as a template. The PCR fragments were cloned into

the yeast expression vector pYX222x (a gift from Dr Beom-

Seok Seo, Iowa State University, unpublished), generating

pYSultr1;2WT. In this plasmid, transcription of the Sultr1;2

cDNA is driven by the S. cerevisiae triose phosphate

isomerase promoter. The plasmid also contains the HIS3

gene to serve as a selectable marker for transformation of

his3 mutants. pYSultr1;2WT was introduced into CP154-B,

and transformed cells were tested for methionine proto-

trophy. Figure 5 shows that CP154-B cells carrying

pYSultr1;2WT can grow on minimal medium lacking

methionine and containing 0.5 mM sulfate as the sole

source of sulfur. Yeast cells carrying the vector alone or

mock-transformed cells (no DNA) were unable to grow on

this medium. This demonstrates that the Arabidopsis

Sultr1;2 gene encodes a functional sulfate transporter.

To examine if the mis-sense mutation in the Sultr1;2

gene in sel1-8 disrupts the ability of Sultr1;2 protein to

transport sulfate, Sultr1;2 cDNAs derived from sel1-8 were

cloned into pYX222x to form pYSultr1;2mut and intro-

duced into the S. cerevisiae strain CP154-7B. Unlike

transformants carrying the wild-type copy of the Sultr1;2

gene, transformants carrying the mutated Sultr1;2 gene

were unable to grow on medium lacking methionine

(Figure 5). Ten independent His+ transformants with

pYSultr1;2mut were tested and none could grow without

methionine in the medium. Sequence analysis of

pYSultr1;2mut con®rmed that the only difference with

the wild-type gene was the mis-sense mutation that alters

Ile 511 to Thr in pYSultr1;2mut. These results indicate that

the substitution of Thr for Ile at amino acid at position 511

in Sultr1;2 severely disrupts the sulfate transport activity of

this protein.

Figure 4. Transcript accumulation of the Sultr1;2 gene.RNA gel-blot analysis of Sultr1;2 and a-tubulin in roots and aerial tissue.Plants were grown for 5 weeks with 0.7 mM sulfate and transferred to0 mM sulfate at time 0. Total RNA was isolated at time 0 and 72 h. TotalRNA (9 mg) was separated by electrophoresis, blotted onto a membrane,and hybridized with probes speci®c for Sultr1;2 and a-tubulin.

Table 2. Relative accumulation of Sultr1;2 and Sultr2;2 transcripts

Plant parts

Sultr1;2/bTUB Sultr2;2/bTUB

Time after ±S treatment (h)0 72

Time after ±S treatment (h)0 72

Aerial Col-0 nd nd 4.0 6 1.8 2.9 6 0.8sel1-8 nd nd 2.5 6 0.6 5.5 6 1.2Ws nd nd 1.4 6 0.1 2.7 6 0.4sel1-9 nd nd 1.6 6 0.5 5.2 6 1.0

Roots Col-0 0.4 6 0.1 2.1 6 1.0 0.5 6 0.1 1.3 6 0.2sel1-8 1.0 6 0.3 3.3 6 1.6 0.8 6 0.2 2.0 6 0.3Ws 0.6 6 0.3 4.8 6 2.4 0.8 6 0.3 0.9 6 0.4sel1-9 nd nd 0.9 6 0.3 2.9 6 1.0

Plants were grown for 4 weeks with 1.5 mM sulfate and transferred to 0 mM sulfate at time 0. Total RNA was isolated at 0 and 72 h, and RT±PCR was performed in SmartCyclerTM. to monitor ampli®cation of each cDNA. All values represent relative accumulation of Sultr1;2 orSultr2;2 transcripts to that of the b-tubulin (bTUB) in three independent reverse transcriptase reactions followed by PCR (mean 6 SD,n = 3).nd, not detected.



Accumulation of the Sultr1;2 transcripts under sulfur

de®ciency

As sulfate transport increases when plants are deprived of

sulfate, we investigated whether accumulation of the

Sultr1;2 transcript increased when plants were moved

from sulfur-replete to sulfur-de®cient medium. Total RNA

was isolated from plants grown in sulfate containing

hydroponic medium for 5 weeks and then transferred to

medium lacking sulfate for 72 h. RNA was extracted

independently from roots and aerial parts of sel1-9 and

wild-type (Ws) plants. Transcripts of Sultr1;2 were

detected in both non-starved and sulfur-starved roots of

wild-type plants. No Sultr1;2 transcript was detected in the

aerial parts (Figure 4). Thus the Sultr1;2 gene appears to

encode a root-speci®c transporter that is expressed under

both sulfur-suf®cient and sulfur-de®cient conditions.

Table 2 shows the relative accumulation of the Sultr1;2

and Sultr2;2 transcripts in wild-type and sel1 mutant plants

grown in sulfur-replete medium and starved for sulfur for

72 h. RT±PCR was performed and relative rates of ampli-

®cation monitored in a SmartCycler (Cepheid, Sunnyvale,

CA). The Sultr1;2 transcript was ®ve to eight times more

abundant in the roots of sulfur-starved than non-starved

wild-type plants. Prior to sulfur starvation, the Sultr1;2

transcript is approximately twice as abundant in sel1-8

plants as in wild-type Col-0 plants. The Sultr1;2 transcript

is also more abundant in sulfur-starved sel1-8 plants.

Accumulation of the Sultr2;2 transcript is greater in the

sel1-8 and sel1-9 mutants compared to the corresponding

wild-type plants, especially under sulfate starvation, both

in aerial parts and roots. These results indicate that both

sulfur starvation and mutations in the Sultr1;2 gene cause

increased accumulation of transcripts encoding Sultr1;2

and Sultr2;2.

Expression of a Sultr1;2 promoter±GUS fusion gene

Analysis of transgenic plants expressing Sultr1;2 pro-

moter-b-glucuronidase (GUS) fusion constructs indicate

that Sultr1;2 is primarily expressed in root tissue. The

Sultr1;2::GUS gene was constructed by fusing 1.6 kbp of

sequence upstream of the Sultr1;2 start codon to the uidA

reporter gene in pCB308, a mini-binary vector plasmid

designed for promoter analysis (Xiang et al., 1999). Seeds

of transgenic plants were germinated on sulfate-contain-

ing solid medium, transferred to sulfate-containing liquid

medium for 5 days, and transferred to medium lacking

sulfate for 3 days. Plants were stained for GUS activity

either before or after sulfur starvation. No signi®cant

difference in the staining pattern was observed between

the 10 lines analysed.

GUS activity was visualized by staining with 5-bromo-4-

chloro-3-indolyl-b-D-glucronic acid (X-gluc) and observed

under a microscope. Figure 6a shows that there was

Figure 5. Functional complementation of yeast mutant CP154-7B.(a) Yeast strain CP154-7B and three transformants, carrying either an empty vector, or the Sultr1;2 cDNA derived from wild type Arabidopsis (Col-0) orfrom sel1-8 streaked on minimal medium containing 0.5 mM sulfate supplemented with 0.5 mM methionine.(b) The same cells streaked on minimal medium lacking methionine. pYX222x designates cells containing the empty yeast expression cassette;pYSultr1;2WT designates cells containing the expression cassette with the Sultr1;2 cDNA from wild-type (Col-0), and pYSultr1;2mut cells containing theexpression cassette with the Sultr1;2 cDNA from the sel1-8 mutant. `No DNA' indicates where cells that were not transformed were streaked.



abundant GUS activity in cortical tissue of primary roots in

the zone of elongation. Root tips of primary and lateral

roots (Figure 6b,c) were also stained. In aerial portions,

weak GUS staining was observed in hydathodes, guard

Figure 6. Tissue-speci®c expression of Sultr1;2.(a±d) Seedlings of transgenic plants carrying pSultr1;2proGUS were germinated and grown for 7 days on medium containing 1.6 mM sulfate, thentransferred to medium containing 0 mM for 3 days and stained with X-gluc as described in Experimental procedures. Staining in (a )root cortex; (b) in roottip; (c) in lateral root; (d) in guard cells.(e) Leaves from plants grown for 20 days in soils fed with Hyponex solution show staining in hydathodes.(f) Seedlings grown for 7 days on sulfate-containing medium then transferred to medium containing 1.6 mM (left) or 0 mM (right) sulfate. 3 days aftertransfer, seedlings were GUS-stained.Bars are 25 mm (a, b, d), 0.5 mm (c), 0.5 cm (e) and 1 cm (f).



cells in leaves (Figures 6d,e). Weak staining was also

observed in auxiliary buds, anthers and basal parts of

¯owers (data not shown).

There was no signi®cant difference in spatial pattern of

GUS-staining between plants grown in sulfate-suf®cient

and sulfate-de®cient media. However, the roots of sulfur-

starved plants appeared to have more GUS activity (Figure

6f), suggesting that the regulation of transcript accumula-

tion observed by RT±PCR (Table 2) is exerted mainly at the

level of transcription.

Discussion

Sulfate, the primary source of sulfur imported from the

environment by vascular plants, is taken up through the

roots and distributed throughout the plant. No single

transporter is likely to be able to carry out all of the

transport processes required. Genomic DNA sequence

indicates that Arabidopsis has at least 14 putative sulfate

transporter genes. Some of these transporters are synthe-

sized in speci®c tissues and are probably localized to

speci®c membranes within the cells of these tissues

(Takahashi et al., 2000). Our results show that transcripts

encoding Sultr1;2 are present in the roots of sulfur-replete

grown plants, and increase in abundance when plants are

deprived of sulfate (Figure 4; Table 2). Reporter gene

studies indicate that Sultr1;2 is expressed primarily in the

root cortex and cap where plant cells interface directly with

the soil solution. We also detected expression in the guard

cells, hydathodes and auxiliary buds of leaves (Figure 6).

The signi®cance of expression of Sultr1;2 in aerial tissues

is not understood at this time. Similar patterns of gene

expression were observed by Yoshimoto et al. (2002) using

Sultr1;2±GFP fusion.

We have isolated and characterized selenate-resistant

mutants of Arabidopsis defective in the sulfate transporter

Sultr1;2. Based on phylogenetic analysis of the amino acid

sequence, Sultr1;2 falls into group 1 of the sulfate trans-

porters (Takahashi et al., 2000). Among group 1 sulfate

transporters, Shst1, Shst2 (of Stylosanthes hamata), Hvst1

(of Hordeum vulgare) and Sultr1;1 (of Arabidopsis) have

been shown to be high-af®nity sulfate transporters when

expressed in yeast cells (Smith et al., 1995b; Smith et al.,

1997; Takahashi et al., 2000). Yoshimoto et al. (2001)

measured the kinetics of sulfate transport into S. cerevisiae

expressing Sultr1;2 and determined that it is also a high-

af®nity sulfate transporter with a Km of 6.9 mM.

The sel1 mutants were identi®ed by screening for plants

resistant to toxic analogues of sulfate (Figure 1). At least

one of these mutants, sel1-9, contains no detectable

Sultr1;2 transcript and appears to be completely defective

in this sulfate transporter, but this mutant is able to grow

to maturity in sulfur-suf®cient conditions (1.5 mM sulfate)

indicating that the gene is not essential. However, direct

measurement of sulfate transport into the roots of this

mutant demonstrated that sulfate transport is disrupted

(Figure 2a). The sel1-9 mutant, which contains a T-DNA

insertion in the promoter region of the Sultr1;2 gene,

imports sulfate at approximately half of the rate of wild-

type plants. It is unclear whether the defect in sulfate

transport in this mutant is compensated for by an increase

in activity or expression of other sulfate transporters.

Accumulation of the Sultr2;2 transcript was twice as high

in the mutant as in the wild type (Table 2), suggesting that

increased expression of other sulfate transporters may

compensate for the loss of Sultr1;2.

Although sel1-9 is clearly defective in transport of sulfate

into the root, there is no difference in the rate of transport

of sulfate into the shoots of mutant and wild-type plants

(Figure 2b). As most sulfate reduction and assimilation is

thought to occur in leaves, plants may have mechanisms

of maintaining high sulfate concentrations in the shoot,

even when sulfate levels in the root are low. When plants

are deprived of sulfur, sulfate content in the shoot

decreases less rapidly than in the root (Clarkson et al.,

1983; Lappartient and Touraine, 1996), supporting the

hypothesis that plants maintain sulfate in the shoot at the

expense of sulfate in the root. An alternative explanation

for the lack of an effect of the sel1 mutant on shoot sulfate

transport is that Sultr1;2 does not play a role in the

transport of sulfate to the shoot. There may be separate

transport systems for supplying sulfate to the root and

shoot, and Sultr1;2 may function solely to provide sulfate

to the root and may not participate in loading sulfate into

the xylem for transport to the shoot.

The sulfate transporters of plants are proton/sulfate co-

transporters, and their amino acid sequences are similar to

those of sulfate transporters found in animal cells.

Sequence analysis of the 12 of the sulfate transporters of

Arabidopsis predicts that they contain 12 MSDs and a

carboxy-terminal cytoplasmic STAS domain (Aravind and

Koonin, 2000). STAS domains are found in sulfate trans-

porters of both plants and animals, as well as in bacterial

antisigma-factor antagonists (ASAs) such as the Bacillus

subtilis SPOIIAA protein. ASAs physically interact with

antisigma factors to prevent them from binding to sigma

factors and inhibiting transcription. SPOIIAA binds GTP

and ATP, and possesses a weak NTPase activity (Naja®

et al., 1996). As ASAs are known to interact with other

proteins, STAS domains may facilitate the interaction of

sulfate transporters with other proteins and could regulate

sulfate transporter activity.

Two of the three mis-sense mutations identi®ed in this

work are located between the twelfth MSD and the STAS

domain (Figure 3b). This portion of the protein is con-

served among sulfate transporters, but has no similarity

with any known functional domain. In sel1-3 Gly 509 is

changed to a Glu, and in sel1-8 Ile 511 is a Thr. These



positions are highly conserved in the Arabidopsis sulfate

transporters. Gly 509 is conserved in all the Arabidopsis

sulfate transporters, while Ile 511 is either an Ile or Leu in

all the Arabidopsis transporters with the exception of

Sultr2;1 where it is a Met. The high level of conservation in

this region among plant sulfate transporters and the

mutations described here indicate that this domain is

critical for function of the sulfate transporter. The mis-

sense mutation in sel1-1 changes Ser 96 to a Phe. This

region of the protein is in the ®rst MSD (based on

MEMSAT2 prediction) that is conserved in sulfate trans-

porters of both plants and animals.

Selenate resistance has provided a useful tool for

identifying mutations in the Sultr1;2 gene. Nine of the 10

selenate-resistant mutants of Arabidopsis isolated to date

have lesions in this gene. The identi®cation of these

mutants, along with their functional characterization, indi-

cates a critical role for this transporter in sulfate uptake

into the roots of plants.

Experimental procedures

Plant growth

Plants were grown in a growth chamber on plant-nutrition (PN)medium containing 5.0 mM KNO3, 2.35 mM KH2PO4, 0.15 mM

K2HPO4, 2.0 mM Ca(NO3)2, 1.3 mM MgCl2, 70 mM H3BO3, 14 mM

MnCl2, 0.5 mM CuCl2, 1 mM ZnCl2, 0.2 mM Na2MoO4, 10 mM NaCland 0.01 mM CoCl2 (®nal pH 5.5). Sulfate was provided in themedia as MgSO4. MgSO4 was replaced with MgCl2 in PN-Smedium. The growth chamber was maintained at 22°C undercontinuous ¯uorescent illumination (75 mmol m±2 sec±1).Hydroponic cultures were grown according to Hirai et al. (1995).Soil-grown plants were grown in vermiculite and periodicallyfertilized with Hyponex (N-P-K = 8-12-6, Hyponex Japan Corp.,Ltd, Osaka, Japan).

Screening for selenate-resistant mutants

Ten thousand ethyl methanesulfonate (EMS) mutagenized M2

seeds (Columbia accession) and 100 000 T4 seeds of 9510 T-DNAtagged lines (Wassilewskija accession, kindly provided by ABRC,Ohio State University, Columbus, OH, USA) were surface-sterilized and germinated on PN-S medium containing 20 mM

selenate and 40 mM chromate. Petri plates containing PN-Smedium solidi®ed with 0.6% agarose were oriented vertically toallow seedlings to grow roots on the surface of the medium. After2 weeks, root lengths were compared. Seedlings with roots 3±5 mm long were selected for rescreening. Putative mutants weretransferred to PN medium lacking selenate and allowed torecover. Plants were then moved to soil and allowed to self-fertilize. Seeds from the putative mutants were rescreened underthe same conditions.

Sulfate uptake assay

Surface-sterilized seeds were sown on 300 mm mesh nylon screenembedded vertically in PN media containing 0.6% agarose,

700 mM sulfate and 0.5% sucrose in para®lm sealed Petri dishes.The plates were oriented vertically at 22°C with continuous¯uorescent illumination (60 mmol m±2 sec±1). Roots of the seed-lings grew through the mesh into the surface of medium. After14 days the para®lm seals on the Petri dishes were removed.Twenty-four hours later the dish covers were opened to let theplants adjust to ambient room humidity. After 4 hours, theseedlings were transferred to sulfate-replete or sulfate-de®cientliquid medium with aeration for 3 days. The liquid media waschanged once during this period.

At the start of the sulfate uptake experiments, the plants weresupported on the rim of a 5.5 ml plastic tubes containing 5.4 ml ofthe PN-S medium with 0.6±1.25 mCi ml±1 [35S] sulfate. At the endof the 1 h labelling period, the roots were rinsed in 300 ml of theice-cold PN medium containing 1.5 mM sulfate for 5 sec, thenincubated in 1 l of PN medium containing 1.5 mM sulfate at roomtemperature for 1 h. The PN medium was changed once duringthe incubation.

The fresh weight of shoots and roots were measured separatelyand the tissues transferred into scintillation vials containing 2 mlof scintillation cocktail (Safety-Solve, RPI Corp., Mount Prospect,IL, USA), and the incorporated radioactivity was measured in ascintillation counter. The uptake of [35S] sulfate to plants waslinear for at least 1 h under these conditions.

Mapping of sel1-8 mutation

M3 plants of the selenate-resistant sel1-8 line were crossed withLandsberg erecta (Ler). The F1 progeny were allowed to self-fertilize to generate a segregating population. F2 seeds werescored for selenate resistance by germinating them on 0.6%agarose-solidi®ed PN-S medium containing 20 mM SeO4

2± andmeasuring root length. Resistant plants had longer roots thansensitive plants. The selenate-resistant plants were transferred toagarose-solidi®ed PN media lacking selenate and then to soil.Genomic DNA was isolated from shoots of individual F2 plants asdescribed in Liu et al. (1995) and used as a PCR template in geneticmapping experiments. To con®rm the phenotypes of individual F2

plants, F3 seeds from self-fertilized plants were germinated onselenate-containing medium and scored for selenate sensitivity.

All primers for molecular marker-based mapping were pur-chased from Research Genetics, Inc. (Huntsville, AL, USA), exceptfor SGCSNP142 and SGCSNP253, which were synthesized by theDNA-sequencing facility at Iowa State University (Ames, IA, USA).The single nucleotide polymorphism in SGCSNP142 andSGCSNP253 between Col and Ler was assayed by PCR. ForSGCSNP142, the primers SNP142for (5¢ aaggtgatgaccgatccaaa 3¢)and SNP142rev (5¢ ccgatactgaactcgtggct 3¢) were used and forSGCSNP253, the primers SNP253for (5¢ tgggcgtgaagagttcgtat 3¢)and SNP253rev (5¢ gattccggagagttccatct 3¢) were used. The PCRproducts for both reactions were 288 bp. They were digested withSspI or ClaI, respectively. The SNP142 fragments derived from Lerbut not from Col were cleaved with SspI and the SNP253 fragmentderived from Col but not from Ler was cleaved with ClaI.

Identi®cation of T-DNA insertion in sel1-9

Six primers both in forward and reverse orientation weredesigned in the region containing Sultr1;2 and Sultr2;2. PCRwas carried out using these primers in combination with a primerdesigned in left border (LB) or right border (RB) of T-DNA withsel1-9 genome DNA as template. Among the combination tested,only the following primers ampli®ed a fragment of 4060 bp; LB (5¢



tctgggaatggcgtaacaaaggc 3¢) and rev3 (5¢ agatgtcgacttgacccc-ttggtgtgat 3¢). The ampli®ed fragment was sequenced to deter-mine the insertion site.

Northern hybridization

Total RNA was isolated from hydroponically grown Arabidopsisplants using SDS/phenol as described in Pawlowski et al. (1994).Total RNA (10 mg) was separated in 1% formaldehyde agarose geland blotted onto Zeta-Probe GT membrane (Bio-Rad, Hercules,CA, USA). RNA was ®xed to the membrane by UV irradiation andhybridized according to the manufacturer's recommendations. Agenomic clone containing coding sequence of Sultr1;2 was PCR-ampli®ed from Arabidopsis (Col-0) genomic DNA using primersSultr1;2FB (5¢ gtatggatccaacccaaaacgatgat 3¢) and Sultr1;2RSal (5¢agatgtcgacttgaccccttggtgtgat 3¢). The clone was truncated bydigestion with KpnI and the resulting 1.85 kbp fragment contain-ing the 3¢-half of the Sultr1;2 gene was used as a gene-speci®cprobe. The a-tublin cDNA was RT±PCR-ampli®ed with a-TUBfor(5¢ aaattagggtttctactgagagaag 3¢) and a-TUBrev (5¢ acgaatatttta-caggatttaaaca 3¢) and used as a probe.

Expression of Sultr1;2 in yeast

RNA was reverse-transcribed using AMV reverse transcriptasepurchased from Gibco BRL (Rockville, MD, USA). The products ofthis reaction were used as a template for PCR using the Expand´Long Template PCR system (Boehringer Mannheim, Mannheim,Germany) following the manufacturer's instruction.

cDNA clones containing the coding region of the Sultr1;2 genefrom the wild-type (Col-0) and sel1-8 mutant strains were amp-li®ed by RT±PCR using the primers Sultr1;2FE (5¢ atagaattcatgtcgt-caagagctcaccc 3¢) and Sultr1;2RXh (5¢ actctcgagtcagacc-tcgttggagaga 3¢). The ampli®ed DNA fragments were clonedinto the EcoRI±XhoI site of the yeast-expression vector pYX222x,which contains the HIS3 gene which serves as a selectable markerfor transformation of his3 mutants, and the triose phosphateisomerase promoter to drive constitutive expression of theinserted gene. The resulting plasmids, pYSultr1;2WT andpYSultr1;2mut were separately transformed into the S. cerevisiaemutant strain CP154-7B (Mata, his3, leu2, ura3, ade2, trp1,su1l::LEU2, sul2::URA3; Cherest et al., 1997) using the lithiumacetate transformation protocol (Rose et al., 1990). Cells wereincubated at 30°C on synthetic medium containing 0.5 mM

sulfate, 20 g l±1 glucose, 0.5 mM methionine and the requiredamino acids. After 2 days, His+ transformants were detectable.Transformants were tested for methionine auxotrophy on syn-thetic medium lacking methionine.

Quanti®cation of transcripts by RT±PCR

RNA isolated by RNeasy Plant Mini Kit (Qiagen, Germany) and®rst-strand cDNA was synthesized using MuLV ReverseTranscriptase (Perkin Elmer, Norwalk, CT, USA) by priming witholigo-d(T)16. The cDNA was ampli®ed by PCR in a SmartCycler(Cepheid, Sunnyvale, CA, USA) with SYBR Green PCR Master Mix(Applied Biosystem, Warrington, UK). The primers used in RT±PCR were: b-TUBfor 5¢ gctcgctaatcctacctttgg 3¢; b-TUBrev 5¢agccttgggaatgggataag 3¢; Sultr1;2for2 (5¢ ataggatccattcaacag-tatcctgaagcc 3¢); Sultr1;2rev2 (5¢ atactcgaggaaactgaatcctaggtaggc3¢); Sultr2;2for2 (5¢ cgacatgtcttgcgtgatgggcg 3¢); and Sultr2;2rev2

(5¢ gctcgcttcaatttgtgaagtaccct 3¢). The size of ampli®ed fragment(200 bp) was con®rmed by gel electrophoresis.

Arabidopsis transformation and GUS staining

A genomic fragment of the Sultr1;2 promoter correspondingnucleotide segment from 1393 bp upstream to 154 bp down-stream of the transcription initiation site was PCR-ampli®ed usingthe primers F (5¢ gfgtctagaggctaaaaagcgagatcgaa 3¢) and R (5¢tgaggatccagctatgtaactctgcaaac 3¢), and cloned into the XbaI±BamHI site of a binary vector pCB308 (Xiang et al., 1999) togenerate pSultr1;2proGUS. The Agrobacterium tumefaciensstrain GV3101 (Koncz and Schell, 1986) was transformed withpSultr1;2proGUS by electroporation. Arabidopsis plants weretransformed using the ¯oral dip method (Clough and Bent, 1998).Transformed T1 plants were selected in soil for herbicide resist-ance, and seeds of the T2 generation were geminated on agarose-solidi®ed plates prior to staining for GUS activity. Seedlings werevacuum-in®ltrated with staining solution containing 100 mM

Na2HPO4 pH 7, 0.1% Triton X-100, 2 mM K3Fe[CN]6, 2 mM

K4Fe[CN]6 and 0.5 mg ml±1 5-bromo-4-chloro-3-indolyl-b-D-glu-cronic acid (Wako, Japan) for 20 min followed by overnightincubation at 37°C. Pigments were cleared from GUS-stainedseedlings by treatment with 70% and 100% ethanol. Root cross-section was made from root tissues embedded in plastic resinTechnovit7100 (Heraeus Kulzer GmbH, Wehrheim, Germany) andmicrosliced into 10 mm by microtome LR-85 (Yamato-kouki,Japan).

Acknowledgements

We thank ABRC (Ohio State University, Columbus, OH, USA) forproviding seeds of T-DNA tagged lines, Dr Yolande Surdin-Kerjan(Centre National de la Recherche Scienti®que, France) for theyeast mutant strain CP154-7B, Dr Beom-Seok Seo (Iowa StateUniversity, Ames, IA, USA) for the yeast vector pYX222x, and DrChenbin Xiang (Iowa State University) for the binary vectorpCB308. Funds to ®nance this research were graciously providedby grants from the USDA (Grant no. 9900622 to J.P.D.), theMinistry of Education, Culture, Sports, Science and Technology ofJapan for the Japanese Junior Scientists (no. 5230 to N.S.), andthe Scienti®c Research on Priority Areas (B), MolecularMechanisms of Storage Activity in Plants (no. 12138201 to T.F.).

References

Aravind, L. and Koonin, E.V. (2000) The STAS domain-a linkbetween anion transporters and antisigma-factor antagonists.Curr. Biol. 10, 53±55.

Breton, A. and Surdin-Kerjan, Y. (1977) Sulfate uptake inSaccharomyces cerevisiae: biochemical and genetic study. J.Bacteriol. 132, 224±232.

Cherest, H., Davidian, J.-C., Thomas, D., Benes, V., Ansorge, W.and Surdin-Kerjan, Y. (1997) Molecular characterization of twohigh af®nity transporters in Saccharomyces cerevisiae.Genetics, 145, 627±635.

Clarkson, D.T., Smith, F.W. and Van den Berg. P.J. (1983)Regulation of sulfur tranport in a tropical legume,Macroptilium atropurpurum cv. Siratoro. J. Exp. Bot. 34,1463±1483.

Clough, S.J. and Bent, A.F. (1998) Floral dip: a simpli®ed method



for Agrobacterium-mediated transformation of Arabidopsisthaliana. Plant J. 16, 735±743.

Forsthoefel, N.R., Wu, Y., Schulz, B., Bennett, M.J. and Feldmann,K.A. (1992) T-DNA insertion mutagenesis in Arabidopsis:prospects and perspectives. Aust. J. Plant Physiol. 19, 353±366.

Grossman, A. and Takahashi, H. (2001) Macronutrient utilizationby photsynthetic eukaryotes and the fabric of interactions.Annu. Rev. Plant Physiol. Plant Mol. Biol. 52, 163±210.

Hawkesford, M.J., Davidian, J.-C. and Grignon, C. (1993)Sulphate/proton cotransport in plasma membrane vesiclesisolated from roots of Brassica napus L. increased transport inmembranes isolated from sulphur-starved plants. Planta, 190,297±304.

Hirai, M.Y., Fujiwara, T., Chino, M. and Naito, S. (1995) Effects ofsulfate concentrations on the expression of a soybean seedstorage protein gene and its reversibility in transgenicArabidopsis thaliana. Plant Cell Physiol. 36, 1331±1339.

Jones, D.T. (1998) Do transmembrane protein superfolds exist?FEBS Lett. 423, 281±285.

Koncz, C. and Schell, J. (1986) The promoter of TL-DNA gene 5controls the tissue speci®c expression of chimeric genes carriedby a novel type of Agrobacterium binary vector. Mol. Gen.Genet. 204, 383±396.

Lappartient, A.G. and Touraine, B. (1996) Demand-driven controlof root ATP sulfurylase activity and SO4

2± uptake in intact canola± the role of phloem-translocated glutathione. Plant Physiol.111, 147±157.

Lass, B. and Ullrich-Eberius, C.I. (1984) Evidence for proton/sulfatecotransport and its kinetics in Lemna gibba G1. Planta, 161, 53±60.

Liu, Y.G., Mitsukawa, N., Oosumi, T. and Whittier, R.F. (1995)Ef®cient isolation and mapping of Arabidopsis thaliana T-DNAinsert junctions by thermal interlaced PCR. Plant J. 8, 457±463.

Marzluf, G.A. (1970) Genetic and metabolic controls for sulfatemetabolism in Neurospora crassa: isolation and study ofchromate-resistant and sulfate transport-negative mutant. J.Bacteriol. 102, 716±721.

Naja®, S.M., Harris, D.A. and Yudkin, M.D. (1996) The SpoIIAAprotein of Bacillus subtilis has GTP-binding properties. J.Bacteriol. 178, 6632±6634.

Pawlowski, K., Kunze, R., deVries, S. and Bisseling, T. (1994)Isolation of total, poly(A) and polysomal RNA from plant tissue.In Plant Molecular Biology Manual (Gelvin, S.B. andSchilperoort, R.A., eds), Section D5. Dordrecht: KluwerAcademic Publishers, pp. 1±4.

Rose, A.B. (1997) Selenate-resistant mutants in Arabidopsis. InSulphur Nutrition and Sulphur Assimilation in Higher Plants(W. J. Cram et al., eds). Leiden, The Netherlands: BackhuysPublishers, pp. 217±219.

Rose, M.D., Winston, F. and Heiter, P. (1990) Methods in YeastGenetics. Cold Spring Harbor, NY: Cold Spring HarborLaboratory Press.

Saito, K. (2000) Regulation of sulfate transport and synthesis ofsulfur-containing amino acids. Curr. Opin. Plant Biol. 3, 188±195.

Smith, F.W., Hawkesford, M.J., Prosser, I.M. and Clarkson, D.T.(1995a) Isolation of cDNA from Saccharomyces cerevisiae thatencodes a high af®nity sulphate transporter at the plasmamembrane. Mol. Gen. Genet. 247, 709±715.

Smith, F.W., Hawkesford, M.J., Prosser, I.M. and Clarkson, D.T.(1995b) Plant members of a family if sulfate transporters revealfunctional subtypes. Proc. Natl Acad. Sci. USA, 92, 9373±9377.

Smith, F.W., Hawkesford, M.J., Ealing, P.M., Clarkson, D.T., Vanden Berg, P.J., Belcher, A.R. and Warrilow, A.G.S. (1997)Regulation of expression of cDNA from barley roots encodinga high af®nity sulphate transporter. Plant J. 4, 875±884.

Takahashi, H., Sasakura, N., Noji, M. and Saito, K. (1996) Isolationand characterization of a cDNA encoding a sulfate transporterfrom Arabidopsis thaliana. FEBS Lett. 392, 95±99.

Takahashi, H., Yamazaki, M., Sasakura, N., Watanabe, A.,Leustek, T., De Almeida Engler, J., Engler, G., Van Montagu,M. and Saito, K. (1997) Regulation of sulfur assimilation inhigher plants: a sulfate transporter induced in sulfate starvedroots plays a central role in Arabidopsis thaliana. Proc. NatlAcad. Sci. USA, 94, 11102±11107.

Takahashi, H., Asanuma, W. and Saito, K. (1999) Cloning of anArabidopsis cDNA encoding a chloroplast localizing sulfatetransporter isoform. J. Exp. Bot. 5, 1713±1714.

Takahashi, H., Watanabe, A.T., Smith, F., Blake-kalff, M.,Hawkesford, M. and Saito, K. (2000) The roles of threefunctional transporters involved in uptake and translocationof sulphate in Arabidopsis thaliana. Plant J. 23, 171±182.

Vidmar, J.J., Tagmount, A., Cathala, N., Touraine, B. and Glass,A.D.M. (2000) Cloning and characterization of a root speci®chigh-af®nity sulfate transporter from Arabidopsis thaliana.FEBS Lett. 475, 65±69.

Xiang, C., Han, P., Lutziger, I., Wang, K. and Oliver, D.J. (1999) Amini binary vector series for plant transformation. Plant Mol.Biol. 40, 711±717.

Yildiz, F.H., Davies, J.P. and Grossman, A.R. (1994)Characterization of sulfate transport in Chlamydomonasreinhardtii during sulfur-limited and sulfur-suf®cient growth.Plant Physiol. 104, 981±987.

Yoshimoto, N., Takahashi, H., Smith, F.W., Yamaya, T. and Saito,K. (2002) Two distinct high-af®nity sulfate transporters withdifferent inducibilities mediate uptake of sulfate in Arabidopsisroots. Plant J. 29, 465±473.



Selenate-resistant mutants of Arabidopsis thaliana identify Sultr1;2, a sulfate transporter required...

Documents

Transcript of Selenate-resistant mutants of Arabidopsis thaliana identify Sultr1;2, a sulfate transporter required...