ISSN: 1524-4636 Copyright © 2007 American Heart Association. All rights reserved. Print ISSN: 1079-5642. Online

7272 Greenville Avenue, Dallas, TX 72514Arteriosclerosis, Thrombosis, and Vascular Biology is published by the American Heart Association.

DOI: 10.1161/ATVBAHA.107.155762 published online Oct 4, 2007; Arterioscler Thromb Vasc Biol

and Angelo Avogaro Elisabetta Iori, Elisa Pagnin, Gian Paolo Fadini, Mattia Albiero, Andrea Semplicini Giulio Ceolotto, Alessandra Gallo, Italia Papparella, Lorenzo Franco, Ellen Murphy,

Oxidase via AMPK-Dependent Mechanism Rosiglitazone Reduces Glucose-Induced Oxidative Stress Mediated by NAD(P)H

http://atvb.ahajournals.org/cgi/content/full/ATVBAHA.107.155762/DC1Data Supplement (unedited) at:

  http://atvb.ahajournals.org

located on the World Wide Web at: The online version of this article, along with updated information and services, is

http://www.lww.com/reprintsReprints: Information about reprints can be found online at  

journalpermissions@lww.com410-528-8550. E-mail:

Fax:Kluwer Health, 351 West Camden Street, Baltimore, MD 21202-2436. Phone: 410-528-4050. Permissions: Permissions & Rights Desk, Lippincott Williams & Wilkins, a division of Wolters 

http://atvb.ahajournals.org/subscriptions/Biology is online at Subscriptions: Information about subscribing to Arteriosclerosis, Thrombosis, and Vascular

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

Rosiglitazone Reduces Glucose-Induced Oxidative StressMediated by NAD(P)H Oxidase via

AMPK-Dependent MechanismGiulio Ceolotto, Alessandra Gallo, Italia Papparella, Lorenzo Franco, Ellen Murphy, Elisabetta Iori,

Elisa Pagnin, Gian Paolo Fadini, Mattia Albiero, Andrea Semplicini, Angelo Avogaro

Objective—Hyperglycemia is the main determinant of long-term diabetic complications, mainly through induction ofoxidative stress. NAD(P)H oxidase is a major source of glucose-induced oxidative stress. In this study, we tested thehypothesis that rosiglitazone (RSG) is able to quench oxidative stress initiated by high glucose through prevention ofNAD(P)H oxidase activation.

Methods and Results—Intracellular ROS were measured using the fluoroprobe TEMPO-9-AC in HUVECs exposed tocontrol (5 mmol/L) and moderately high (10 mmol/L) glucose concentrations. NAD(P)H oxidase and AMPK activitieswere determined by Western blot. We found that 10 mmol/L glucose increased significantly ROS production incomparison with 5 mmol/L glucose, and that this effect was completely abolished by RSG. Interestingly, inhibition ofAMPK, but not PPAR�, prevented this effect of RSG. AMPK phosphorylation by RSG was necessary for its ability tohamper NAD(P)H oxidase activation, which was indispensable for glucose-induced oxidative stress. Downstream ofAMPK activation, RSG exerts antioxidative effects by inhibiting PKC.

Conclusions—This study demonstrates that RSG activates AMPK which, in turn, prevents hyperactivity of NAD(P)Hoxidase induced by high glucose, possibly through PKC inhibition. Therefore, RSG protects endothelial cells againstglucose-induced oxidative stress with an AMPK-dependent and a PPAR�-independent mechanism. (ArteriosclerThromb Vasc Biol. 2007;27:000-000.)

Key Words: diabetes � AMPK � NAD(P)H oxidase � oxidative stress � rosiglitazone

Chronic hyperglycemia induces protein glycation, sys-temic low grade inflammation, and endothelial dysfunc-

tion.1 As a consequence, diabetes is one of the main riskfactor for cardiovascular disease. Hyperglycemia-inducedendothelial dysfunction is characterized by an enhancedproduction of reactive oxygen species (ROS), which areimportant actors in the development of vascular damage.Consistently, antioxidant agents are able to rescuehyperglycemia-induced vascular dysfunction.1,2

Recently, we have shown that, in human umbilical veinendothelial cells (HUVECs), high glucose (10 mmol/L)increases ROS generation through a NAD(P)H oxidase–dependent mechanism.3 Furthermore, vascular NAD(P)H ox-idase activity is increased in diabetic patients in vivo, andendothelial NAD(P)H oxidase activity is markedly increasedby high glucose levels in vitro.4,5 Therefore, NAD(P)Hoxidase appears as one of the major sources of ROS produc-tion after exposure to hyperglycemia.6

Thiazolidinediones (TDZs) are used clinically in type 2diabetic patients by virtue of their insulin-sensitizing action,

conveyed by the activation of the nuclear transcription factorperoxisome proliferator-activated receptor-� (PPAR�).7 Inaddition, these agents have remarkable pleiotropic activities:by improving endothelial function and systemic inflamma-tion, they are expected to exert direct beneficial effects oncardiovascular risk, which are not mediated by the improve-ment in glucose metabolism. In this regard, pioglitazone wasshown to abolish ROS production in 3T3-L1 adipocytes,8

whereas rosiglitazone (RSG) reduced NAD(P)H-stimulatedsuperoxide production in aortas from diabetic mice,9 andtroglitazone diminished ROS generation in leukocytes fromobese subjects.10 However, the molecular mechanism bywhich TZDs attenuate oxidative stress is not clear.

TDZs are specific ligands for the PPAR� family of nuclearreceptors, which are intimately involved in the regulation ofenergy homeostasis.7 However, several evidences suggestthat TDZs affect nitric oxide (NO), tumor necrosis factor(TNF)-alpha production and endothelial cell proliferation byPPAR�-independent mechanisms.11–14 Recently, it has beendemonstrated that TDZs also activate 5�-AMP-activated pro-

Original received September 10, 2007; final version accepted September 21, 2007.From the Department of Clinical and Experimental Medicine, University of Padova Medical School, Italy.G.C. and A.G. contributed equally to this study.Correspondence to Prof Angelo Avogaro, Department of Clinical and Experimental Medicine, University of Padova, Via Giustiniani 2 35128 Padova,

Italy. E-mail angelo.avogaro@unipd.it© 2007 American Heart Association, Inc.

Arterioscler Thromb Vasc Biol. is available at http://atvb.ahajournals.org DOI: 10.1161/ATVBAHA.107.155762

1 by on May 15, 2011 atvb.ahajournals.orgDownloaded from

tein kinase (AMPK), which represents the major regulator ofcellular and systemic energy homeostasis in liver and muscle.Moreover, AMPK plays an important role in protectingendothelial cells against the adverse effects of sustainedhyperglycemia.15–18 Therefore, the aim of the present studywas to dissect the molecular mechanisms underlying theeffects of RSG on hyperglycemia-induced ROS production.

Materials and MethodsFor detailed methods, please see the supplemental Materials andMethods, available at online at http://atvb.ahajournals.org. Humanumbilical vein endothelial cells (HUVECs) were incubated for 48 hoursin the presence of either normal (5 mmol/L) or elevated (10 mmol/L)glucose concentration, with or without RSG (20 �mol/L). Oxidativestress was measured by fluorescence microscopy and by electronspin resonance (ESR) using the free radical probe TEMPO-9AC. ForsiRNA experiments, cells were transfected with 15 nmol/L siRNAusing HiPerFect transfection reagent (Qiagen) according to themanufacturer’s protocol. Quantitative RT-PCR was performed usingan iCycler iQ system (BIO-RAD) and SYBR Green detection.Proteins were analyzed by Western immunoblot using standardprocedures.

ResultsEffects of RSG on ROS ProductionInduced by High GlucoseWe have previously demonstrated that high glucose increasesROS production.3 Here we first investigated the effect ofRSG on this phenomenon, by incubating HUVECs for 48hours with RSG (20 �mol/L) plus high glucose (10 mmol/L).Figure 1 shows a representative fluorescence image measuredby inverted microscope at the beginning (1 minute) and after10 minutes of the exposure to the TEMPO-9-AC probe. Asshown, fluorescence markedly increased in cells exposed to10 mmol/L glucose (Figure 1B) in comparison to 5 mmol/Lglucose (Figure 1A). After 10 minutes incubation, fluores-cence increases in proportion to the probe influx (Figure 1B).RSG significantly prevented the increase in ROS productioninduced by 10 mmol/L glucose (Figure 1C). Figure 1Dsummarizes these effects: 10 mmol/L glucose-stimulated

ROS production in comparison to cells exposed to 5 mmol/Lglucose (from 14.8�1.5 to 45�2 fluorescence rate, A.U.,P�0.005) and RSG completely blunted this effect (from45�2 to 17.01�2.5 fluorescence rate, A.U., P�0.01). Sup-plemental Figure IA and IB shows the dose-response and thetime-course of RSG action on ROS production induced by10 mmol/L glucose: ROS generation was significantly inhib-ited after at least 24-hour incubation with RSG concentrationsbetween 20 and 50 �mol/L.

To dissect the mechanisms involved in the inhibition ofglucose-induced ROS production by RSG, we explored the 2molecular pathways activated by TDZs: AMPK and PPAR�.Therefore, we determined the effects of a specific AMPKactivator, 5-aminoimidazole-4-carboxamide-1-beta-D-ribofuranoside (AICAR) and GW9662, a specific PPAR�inhibitor, on ROS production induced by 10 mmol/L ofglucose. As shown in supplemental Figure II, AICAR(500 �mol/L, 48 hours) decreased ROS production inducedby high glucose (10 mmol/L, 48 hour), similarly to whatobserved with RSG alone. On the contrary, GW9662(2 �mol/L, 48 hour) did not alter the effects of RSG on ROSproduction, suggesting that PPAR� receptors are not directlyinvolved in this phenomenon.

To validate these results, we also studied the effects ofGW1929, a PPAR� tyrosine derivate agonist by ESR tech-nique. As shown in supplemental Figure IIB, the PPAR�-agonist GW1929 (20 �mol/L, 48 hours) did not reduceglucose-induced ROS production, indicating that PPAR� isnot the mediator of the inhibition of glucose-dependent ROSproduction by RSG.

Effects of RSG on AMPK Activation,In Vitro and In VivoIn vitro, in cells grown at 5 mmol/L of glucose, the time-course of AMPK activation induced by RSG is shown insupplemental Figure III, which reports a representative im-munoblot of AMPK phosphorylation (p-AMPK). AMPKphosphorylation increased after 20 minutes and reached a

1 min 10 min

A

B

C 0

10

20

30

40

50

60

Glucose 5mM 10mM 10mMRSG (20µM) - - +

Flu

ore

scen

cera

te (

A.U

.)

D

*

Figure 1. Measurement of ROS in HUVECs. Fluorescence images for ROS in cells grown at 5 mmol/L glucose (A); 10 mmol/L glucose(B); 10 mmol/L glucose plus 20 �mol/L RSG (C), at 1 (left) and 10 (right) minutes. D, Bar graph representations. Mean�SE of 10 experi-ments. *P�0.01. RSG indicates rosiglitazone.

2 Arterioscler Thromb Vasc Biol. December 2007

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

significant activation after 24 hours RSG (20 �mol/L; sup-plemental Figure IIIA). In addition, RSG-induced AMPKphosphorylation was inhibited by Compound C (100 �mol/L,48 hours), a specific AMPK inhibitor, although it was notaffected by GW9662 (2 �mol/L, 48 hours) (supplementalFigure IIIB).

In vivo, in adult male Sprague-Dawley rats, ischemia/reperfusion significantly increased AMPK by 228�26%(P�0.01) as compared with basal state. Seven-day RSGtreatment, at the dose of 15 mg/kg body weight/d, activatedAMPK in rat skeletal muscles in basal conditions(�147�15%, P�0.05) and during ischemia/reperfusion in-jury (�258�18%, P�0.01 versus basal) with a net �30%increase, although not significantly different, when comparedwith control study (supplemental Figure IV).

Next, to investigate the functional role of AMPK activationby RSG on the ability of RSG to inhibit glucose-induced ROSproduction, we silenced AMPK gene expression usingsiRNA. As shown in Figure 2, transfection with AMPK�1siRNA for 72 hours efficiently reduced AMPK�1 mRNAlevel by 77% and AMPK�1 protein expression by 70%.Furthermore, in AMPK�1 siRNA cells, AMPK phosphory-lation by RSG was markedly decreased in comparison withcontrol siRNA cells (Figure 2C and 2D).

Then, we measured glucose-induced ROS production inAMPK-silenced cells by fluorescence microscope and ESRtechniques. In AMPK1� siRNA-transfected cells, reductionof AMPK�1 expression abolished the inhibitory effects of

20 �mol/L RSG on ROS production induced by 10 mmol/Lglucose (supplemental Figure VC) in comparison to cellstransfected with control siRNA in presence of RSG (supple-mental Figure VC). A similar effect was observed when thecells were incubated for 48 hours with 100 �mol/L Com-pound C, an AMPK inhibitor (supplemental Figure VC). Thefluorescence results were always confirmed by ESR measure-ments (supplemental Figure VE and VF).

Effect of RSG on p22phox, p47phox, gp91phox, p67phox,rac-1 Protein Expression, and TranslocationThe NAD(P)H oxidase is made up of 2 membrane subunits(p22phox and gp91phox) and 3 cytosolic subunits (p47phox,p67phox, and Rac-1). When the NAD(P)H oxidase is stimu-lated, the cytosolic subunits translocate from the cytosol tothe membrane and induce ROS production.20 To furtherdescribe the effects of RSG on NAD(P)H oxidase, we studiedexpression and translocation of NAD(P)H oxidase subunits inthe presence of glucose 10 mmol/L with or without RSG.p22phox protein expression was increased 2-fold (P�0.01) by10 mmol/L glucose in comparison with 5 mmol/L glucose,and this effect was inhibited by RSG. Remarkably, this actionof RSG was antagonized by Compound C (100 �mol/L, 48hours). Total p47phox, gp91phox, p67phox, and rac-1 expressionwere unaffected by high glucose (supplemental Figure VI).

Then, we found that high glucose induced the translocationof p47phox and Rac-1 from the cytosol to the membrane(Figure 3A through 3C). The activation of these NAD(P)H

AMPK

GAPDH

siCnt+RSG - + - -

siAMPK+RSG - - + -

siCnt+AICAR - - - +

Si-Cnt si-AMPK1?

GAPDH

P-AMPK

0

100

200

300

400

500

siCnt siAMPK siAMPK siAMPK24h 48h 72h

Fo

ldq

uan

tifi

cati

on

(∆∆

Ct)

pA

MP

K/G

AD

PH

(% v

sco

ntr

ol)*

*

A

B

C

**

0

0.2

0.4

0.6

0.8

1

1.2

Figure 2. AMPK expression and phosphorylation. HUVECs were transfected with siAMPK-1� or control scrambled siRNA (siCnt). A,AMPK-1� expression in siAMPK1� transfected cells at 24 hours, 48 hours, and 72 hours. B, Immunoblots of transfected cells forAMPK and GADPH. C, RSG-induced AMPK phosphorylation in siAMPK1� and control siRNA cells at 10 mmol/L glucose, with RSG orwith AICAR. (n�6) *P�0.01.

Ceolotto et al Rosiglitazone, Oxidative Stress, and AMPK 3

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

isoforms was prevented by the presence of the PKC inhibitorGF109203X, but not by the presence of PP2, a Src inhibitor,and by the presence of L-NAME, an NO inhibitor (Figure 3Athrough 3C). RSG prevented glucose-induced p47phox andrac-1 translocation to the plasma membrane, but not inAMPK1� siRNA- transfected cells or in the presence ofCompound C (100 �mol/L, 48 hour; Figure 3B through 3D).

These observations were confirmed by the determinationof glucose-induced ROS production in the presence ofGF109203X, and of L-NAME by fluorescence microscopy.GF109203X, a PKC inhibitor, significantly attenuated ROSproduction induced by glucose, while L-NAME did not haveany effect (supplemental Figure VII).

Further, we measured cellular DAG levels and PKCactivity to verify the interactions between RSG and PKC. Asexpected, cells exposed for 48 hours to 10 mmol/L of glucoseresulted in significant increase in total DAG levels and PKCactivity in comparison with the cells exposed to 5 mmol/L ofglucose (supplemental Figure VIII). Treatment with RSGsignificantly reduced both the DAG levels and PKC activity.This effect was not inhibited by the incubation of cells withGW9662, but it was abolished by the presence of CompoundC, suggesting that PKC is a target of RSG downstream ofAMPK activation.

DiscussionIn this study, we have demonstrated that RSG preventsglucose-induced oxidative stress in endothelial cells, an effectindependent from PPAR�, but distinctively dependent onAMPK activation. We also showed that the ability of RSG toquench oxidative stress is conveyed through the inhibition ofNAD(P)H oxidase. Furthermore, we demonstrated that,downstream of AMPK activation, the effect of RSG onglucose-induced NAD(P)H oxidase–derived ROS productionis mediated by the inhibition of the DAG-PKC pathway(Figure 4 depicts this model schematically).

Many studies have reported that TZDs act through PPAR�-dependent mechanisms, and this is also true in endothelialcells. For instance, RSG increased NO production inHUVECs through a transcriptional mechanism unrelated toeNOS expression but dependent on PPAR� activation.12,20

Interestingly, this effect has been attributed to the inhibitionof NO quenching by NAD(P)H oxidase–derived ROS.21 ThePPAR� agonists pioglitazone and RSG also exert directantiinflammatory effects by interfering with monocyte che-moattractant protein-1 and its receptor, CCR2.22,23 TZDs mayhave cardiovascular pleiotropic effects that are independentof their actions on glucose and lipid metabolism. In facts,clinical trials show that RSG ameliorated vascular function

Glu5

Glu10

Glu10+

RS

G

Glu10+

siRN

AA

MP

K

Glu10+

Com

poundC

Glu5

Glu10

Glu10+

GF109203X

Glu10+

PP

2

Glu10+

L-NA

ME

Glu5

Glu10

Glu10+

GF109203X

Glu10+

PP

2

Glu10+

L-NA

ME

Glu5

Glu10

Glu10+

RS

G

Glu10+

siRN

AA

MP

K

Glu10+

Com

poundC

* * *

* **

A

B

C

D

* * *

* * *

m-p47

c-p47

m-p47

c-p47

m-Rac1

c-Rac1

m-Rac1

c-Rac1

100

200

300

400

0

100

200

300400

0

100

200

300

400

0

400

300

200

1000

Figure 3. Effect of RSG and AMPK inhibitor on p47phox and rac-1 translocation. A through C, Cells exposed to 5 and 10 mmol/L glu-cose �20 �mol/L RSG, GF109203X 5 �mol/L, PP2 5 �mol/L, and L-NAME 100 �mol/L for 48 hours. B through D, Cells exposed to 5(Glu 5) and 10 mmol/L of glucose (Glu 10) for 48 hours, to RSG (20 �mol/L) alone, in the presence of Compond C (100 �mol/L), and insiAMPK1� cells. Data expressed as mean�SE of 3 experiments. *P�0.01. RSG indicates rosiglitazone.

4 Arterioscler Thromb Vasc Biol. December 2007

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

beyond its anti-hyperglycemic effects.24,25 The clinical poten-tial benefits of TZDs have been underscored by severalstudies: in type 2 diabetic patients, RSG reduced serum levelsof matrix metallo-proteinase-9 and C-reactive protein,26

whereas pioglitazone reduced carotid intima-media thick-ness,27 further suggesting a possible role in slowing athero-sclerosis. A substantial part of these positive effects of TZDsis mediated by distinctive antioxidative properties,28,29 espe-cially in the setting of glucose-induced oxidative stress.30,31

In this study, we demonstrate that RSG significantlydecreases glucose-induced oxidative stress and that this effectis independent of its ability to activate PPAR�. In support ofthis, we show that a specific PPAR� antagonist (GW9662),which is able to fully prevent PPAR� transactivation byRSG,12 did not abolish the antioxidant action of RSG. Thisobservation is also sustained by previous works. Davies andcolleagues have shown that, in isolated hepatocytes, troglita-zone inhibits the expression of the PEPCK gene by aPPAR�-independent, antioxidant-related mechanism.32 Sim-ilarly, Lennon and colleagues demonstrated that anotherPPAR� agonist, ciglitazone, activates p38 MAP kinasethrough a PPAR�-independent mechanism.33 Our presentdata suggest that most of the antioxidative activity of RSG isdetermined by its ability to activate AMPK. This is authen-ticated by the decreased production of ROS when cells wereincubated with AICAR, an artificial activator of AMPK, andby the neutral effect of RSG on oxidative stress when AMPKwas inhibited by Compound C or by knockdown by siRNA.Consistent with the notion that different TZDs have distinctpleiotropic effects,7 our data indicate that the antioxidativeproperty of RSG is not a “class effect” because the PPAR�-agonist GW1929 was unable to prevent ROS induction byhigh glucose.

To our knowledge, this is also the first study showing thata member of the TZD family activates AMPK in endothelialcells. Several works suggest that PPAR� agonists activateAMPK and have antioxidative properties, but the molecularconnections between these 2 phenomena were previouslyunknown. We found that RSG activates AMPK after 24 hoursof incubation and, in parallel, decreases glucose-inducedROS formation. LeBrasseur and colleagues found that trogli-tazone and pioglitazone activate AMPK in mammalian tis-

sues within minutes.34 It is possible that the PPAR�-independent activation of AMPK requires a longer lag phasein endothelial cells. Our results emphasize the protective roleof AMPK in endothelial cells, as already shown by anextensive literature.35,36 Recently, we proved that ROS induc-tion by high glucose is dependent on NAD(P)H oxidase.3 Thepresent results extend those observations by showing that theincubation of endothelial cells with RSG abolished glucose-induced activation of NAD(P)H oxidase and ROS production.A previous study reported that both PPAR� and PPAR�agonists decrease p22phox gene expression in HUVECs.37

Another study showed that ciglitazone downregulates phago-cyte p47phox oxidase.38 Here, we add significant pieces ofinformation to this picture, by showing that RSG inhibits notonly p22phox protein expression but also the translocation ofboth p47phox and Rac-1, crucial components of NAD(P)Hoxidase. Moreover, we show that the ability of RSG to inhibitNAD(P)H oxidase requires the activation of AMPK, becausethis effect is completely abolished by compound C. In fact,our data underscore that AMPK is an important inhibitor ofNAD(P)H oxidase. This concept has been supported byprevious works showing, for example, that �-lipoic acidsuppresses NAD(P)H oxidase activity by activating AMPK inhuman aortic endothelial cells.39 AMPK is also able tomodulate NAD(P)H in human neutrophils and in smoothmuscle cell.40,41

In compliance with our previous data showing that PKC isstimulated by hyperglycemia,3,19 we noted that the hyperac-tivity of NAD(P)H oxidase induced by high glucose wasprevented by PKC inhibition. In the attempt for a furtherdissection of the antioxidant mechanism of RSG, we showthat RSG inhibits the DAG-PKC pathway and that, again, thiseffect requires AMPK activation. Therefore, downstream ofAMPK phosphorylation, PKC is a critical target of theantioxidant effect of RSG.42

Finally, to determine whether this effect of RSG occurs invivo and whether there is evidence of AMPK activation inintact animals, we treated adult male Sprague-Dawley ratswith oral RSG for 7 days. We show that RSG activatesAMPK in vivo in basal conditions and during ischemia/reperfusion injury, a model in which oxidative stress plays amajor role in determining tissue damage. AMPK was acti-

Figure 4. Putative mechanisms by whichRSG prevents glucose-induced oxidativestress. RSG activates PPAR� and AMPKthrough distinct intracellular pathways. Dis-tinctively, RSG blunts PKC activation byhigh glucose via AMPK, thus preventingNAD(P)H oxidase to release excessive ROS.

Ceolotto et al Rosiglitazone, Oxidative Stress, and AMPK 5

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

vated by ischemia per se, an event that is supposed to protectthe target tissue from ischemic damage, and to stimulateneoangiogenesis.43 Interestingly, it has been suggested thatAMPK hyperactivation may also have negative impacts onsome adaptive responses in the cardiovascular system.44 Veryrecent clinical data warns that, despite its metabolic actionsand its strong theoretically favorable effects of TZDs on thecardiovascular system, RSG may not decrease the incidenceof myocardial infarction, or may increase it.45 Complexeffects of RSG on cell types other than the endothelium maybe responsible for this outcome. Unfortunately, we could notmonitor selectively AMPK activation in myocytes and endo-thelial cells. In any case, potentiation of AMPK signaling byRSG may have important clinical implications in the settingof ischemic diseases.

In conclusion, we report that RSG has a potent antioxidanteffect which is not mediated by PPAR� but is strictlydependent on its ability to activate AMPK. We also show thatRSG reduces ROS mainly by inhibiting NAD(P)H oxidase,with a mechanism that is dependent on AMPK activation andrelated to PKC inhibition.

Sources of FundingThis work was funded by the Italian Ministry of University andResearch (MIUR; to A.A., G.C., A.S.), Finanziamento di Ateneo2005.

DisclosuresA.A. has received an unrestricted grant (€15 000) from GSK, whichwas not used to carry out the present project.

References1. Ceriello A, Motz E. Is oxidative stress the pathogenic mechanism

underlying insulin resistance, diabetes, and cardiovascular disease? Thecommon soil hypothesis revisited. Arterioscler Thromb Vasc Biol. 2004;24:816–823.

2. Aronson D, Rayfield EJ. How hyperglycemia promotes atherosclerosis:molecular mechanisms. Cardiovasc Diabetol. 2002;1:1–10.

3. Gallo A, Ceolotto G, Pinton P, Iori E, Murphy E, Rutter GA, Rizzuto R,Semplicini A, Avogaro A. Metformin prevents glucose-induced proteinkinase C-beta2 activation in human umbilical vein endothelial cellsthrough an antioxidant mechanism. Diabetes. 2005;54:1123–1131.

4. Martın-Gallan P, Carrascosa A, Gussinye M, Domınguez C. Biomarkersof diabetes-associated oxidative stress and antioxidant status in youngdiabetic patients with or without subclinical complications. Free RadicBiol Med. 2003;34:1563–1574.

5. Schmidt AM, Yan SD, Stern DM. The dark side of glucose. Nat Med.1995;1:1002–1004.

6. Wautier JL, Schmidt AM. Protein glycation: a firm link to endothelial celldysfunction. Circ Res. 2004;95:233–238.

7. Yki-Jarvinen H. Thiazolidinedione. N Engl J Med. 2004;351:1106–1118.8. Houstis N, Rosen ED, Lander ES. Reactive oxygen species have a causal

role in multiple forms of insulin resistance. Nature. 2006;440:944–948.9. Calkin AC, Forbes JM, Smith CM, Lassila M, Cooper ME,

Jandeleit-Dahm KA, Allen TJ. Rosiglitazone attenuates atherosclerosis ina model of insulin insufficiency independent of its metabolic effects.Aterioscler Thromb Vasc Biol. 2005;25:1903–1309.

10. Miles PD, Higo K, Romeo OM, Lee MK, Rafaat K, Olefsky JM. Tro-glitazone prevents hyperglycemia-induced but not glucosamine-inducedinsulin resistance. Diabetes. 1998;47:395–400.

11. Sasaki M, Jordan P, Welbourne T, Minagar A, Joh T, Itoh M, Elrod JW,Alexander JS. Troglitazone, a PPAR-gamma activator prevents endothe-lial cell adhesion molecule expression and lymphocyte adhesion mediatedby TNF-alpha. BMC Physiol. 2005;5:1–12.

12. Polikandriotis JA, Mazzella LJ, Rupnow HL, Hart CM. Peroxisomeproliferator-activated receptor gamma ligands stimulate endothelial nitricoxide production through distinct peroxisome proliferator-activated

receptor gamma-dependent mechanisms. Arterioscler Thromb Vasc Biol.2005;25:1810–1816.

13. Liu HB, Hu YS, Medcalf RL, Simpson RW, Dear AE. Thiazolidinedionesinhibit TNFalpha induction of PAI-1 independent of PPARgamma acti-vation. Biochem Biophys Res Commun. 2005;334:30–37.

14. Artwohl M, Furnsinn C, Waldhausl W, Holzenbein T, Rainer G,Freudenthaler A, Roden M, Baumgartner-Parzer SM. Thiazolidinedionesinhibit proliferation of microvascular and macrovascular cells by aPPARgamma-independent mechanism. Diabetologia. 2005;48:586–594.

15. Lessard SJ, Chen ZP, Watt MJ, Hashem M, Reid JJ, Febbraio MA, KempBE, Hawley JA. Chronic rosiglitazone treatment restores AMPKalpha2activity in insulin-resistant rat skeletal muscle. Am J Physiol EndocrinolMetab. 2006;290:E251–E257.

16. Long YC, Zierath JR. AMP-activated protein kinase signaling in meta-bolic regulation. J Clin Invest. 2006;116:1776–1783.

17. Ouedraogo R, Wu X, Xu SQ, Fuchsel L, Motoshima H, Mahadev K,Hough K, Scalia R, Goldstein BJ. Adiponectin suppression of high-glucose-induced reactive oxygen species in vascular endothelial cells:evidence for involvement of a cAMP signalling pathway. Diabetes. 2006;55:1840–1846.

18. Kukidome D, Nishikawa T, Sonoda K, Imoto K, Fujisawa K, Yano M,Motoshima H, Taguchi T, Matsumura T, Araki E. Activation of AMP-activated protein kinase reduces hyperglycemia-induced mitochondrialreactive oxygen species production and promotes mitochondrial bio-genesis in human umbilical vein endothelial cells. Diabetes. 2006;55:120–127.

19. Ceolotto G, Bevilacqua M, Papparella I, Baritono E, Franco L, Corvaja C,Mazzoni M, Semplicini A, Avogaro A. Insulin generates free radicals byan NAD(P)H, phosphatidylinositol 3� kinase dependent mechanism inhuman skin fibroblasts ex vivo. Diabetes. 2004;53:1344–1351.

20. Calnek DS, Mazzella L, Roser S, Roman J, Hart CM. Peroxisomeproliferator-activated receptor gamma ligands increase release of nitricoxide from endothelial cells. Arterioscler Thromb Vasc Biol. 2003;23:52–57.

21. Hwang J, Kleinhenz DJ, Lassegue B, Griendling KK, Dikalov S, HartCM. Peroxisome proliferator-activated receptor-gamma ligands regulateendothelial membrane superoxide production. Am J Physiol Cell Physiol.2005;288:C899–C905.

22. Ishibashi M, Egashira K, Hiasa K, Inoue S, Ni W, Zhao Q, Usui M,Kitamoto S, Ichiki T, Takeshita A. Antiinflammatory and antiarterioscle-rotic effects of pioglitazone. Hypertension. 2002;40:687–693.

23. Han KH, Chang MK, Boullier A, Green SR, Li A, Glass CK, Quehen-berger O. Oxidized LDL reduces monocyte CCR2 expression throughpathways involving peroxisome proliferator-activated receptor. J ClinInvest. 2000;106:793–802.

24. Pistrosch F, Passauer J, Fischer S, Fuecker K, Hanefeld M, Gross P. Intype 2 diabetes, rosiglitazone therapy for insulin resistance amelioratesendothelial dysfunction independent of glucose control. Diabetes Care.2004;27:484–490.

25. Marx N, Imhof A, Froehlich J, Siam L, Ittner J, Wierse G, Schmidt A,Maerz W, Hombach V, Koenig W. Effect of rosiglitazone treatment onsoluble CD40L in patients with type 2 diabetes and coronary arterydisease. Circulation. 2003;107:1954–1957.

26. Marx N, Imhof A, Froehlich J, Siam L, Ittner J, Wierse G, Schmidt A,Maerz W, Hombach V, Koenig W. Antidiabetic PPAR�-activator ros-iglitazone reduces MMP-9 serum levels in type 2 diabetic patients withcoronary artery disease. Arterioscler Thromb Vasc Biol. 2003;23:283–288.

27. Koshiyama H, Shimono D, Kuwamura N, Minamikawa J, Nakamura Y.Inhibitory effect of pioglitazone on carotid arterial wall thickness in type2 diabetes. J Clin Endocrinol Metab. 2001;86:3452–3456.

28. Zhao Y, Patzer A, Herdegen T, Gohlke P, Culman J. Activation ofcerebral peroxisome proliferator-activated receptors gamma promotesneuroprotection by attenuation of neuronal cyclooxygenase-2 overex-pression after focal cerebral ischemia in rats. FASEB J. 2006;20:1162–1175.

29. Mehta JL, Hu B, Chen J, Li D. Pioglitazone inhibits LOX-1 expression inhuman coronary artery endothelial cells by reducing intracellularsuperoxide radical generation. Arterioscler Thromb Vasc Biol. 2003;23:2203–2208.

30. El Midaoui A, Wu L, Wang R, de Champlain J. Modulation of cardiacand aortic peroxisome proliferator-activated receptor-gamma expressionby oxidative stress in chronically glucose-fed rats. Am J Hypertens.2006;19:407–412.

6 Arterioscler Thromb Vasc Biol. December 2007

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

31. Majithiya JB, Paramar AN, Balaraman R. Pioglitazone, a PPARgammaagonist, restores endothelial function in aorta of streptozotocin-induceddiabetic rats. Cardiovasc Res. 2005;66:150–161.

32. Davies GF, Khandelwal RL, Wu L, Juurlink BH, Roesler WJ. Inhibitionof phosphoenolpyruvate carboxykinase (PEPCK) gene expression bytroglitazone: a peroxisome proliferator-activated receptor-gamma(PPARgamma)-independent, antioxidant-related mechanism. BiochemPharmacol. 2001;62:1071–1079.

33. Lennon AM, Ramauge M, Dessouroux A, Pierre M. MAP kinasecascades are activated in astrocytes and preadipocytes by 15-deoxy-Delta(12–14)-prostaglandin J(2) and the thiazolidinedione ciglitazonethrough peroxisome proliferator activator receptor gamma-independentmechanisms involving reactive oxygenated species. J Biol Chem. 2002;277:29681–29685.

34. LeBrasseur NK, Kelly M, Tsao TS, Farmer SR, Saha AK, Ruderman NB,Tomas E. Thiazolidinediones can rapidly activate AMP-activated proteinkinase in mammalian tissues. Am J Physiol Endocrinol Metab. 2006;291:E175–E181.

35. Morrow VA, Foufelle F, Connell JM, Petrie JR, Gould GW, Salt IP.Direct activation of AMP-activated protein kinase stimulates nitric-oxidesynthesis in human aortic endothelial cells. J Biol Chem. 2003;278:31629–31639.

36. Michell BJ, Chen ZP, Tiganis T, Stapleton D, Katsis F, Power DA, SimAT, Kemp BE. Coordinated control of endothelial nitric-oxide synthasephosphorylation by protein kinase C and the cAMP-dependent proteinkinase. J Biol Chem. 2001;276:17625–17628.

37. Inoue I, Goto S, Matsunaga T, Nakajima T, Awata T, Hokari S, KomodaT, Katayama S. The ligands/activators for peroxisome proliferator-acti-vated receptor alpha (PPARalpha) and PPARgamma increaseCu2�,Zn2�-superoxide dismutase and decrease p22phox messageexpressions in primary endothelial cells. Metabolism. 2001;50:3–11.

38. Von Knethen A, Brune B. Activation of peroxisome proliferator-activatedreceptor gamma by nitric oxide in monocytes/macrophages down-regulates p47phox and attenuates the respiratory burst. J Immunol. 2002;169:2619–2626.

39. Lee WJ, Lee IK, Kim HS, Kim YM, Koh EH, Won JC, Han SM, KimMS, Jo I, Oh GT, Park IS, Youn JH, Park SW, Lee KU, Park JY. �-LipoicAcid Prevents Endothelial Dysfunction in Obese Rats via Activation ofAMP-Activated Protein Kinase. Arterioscler Thromb Vasc Biol. 2005;25:2488–2494.

40. Alba G, El Bekay R, Alvarez-Maqueda M, Chacon P, Vega A, Monte-seirın J, Santa Marıa C, Pintado E, Bedoya FJ, Bartrons R, Sobrino F.Stimulators of AMP-activated protein kinase inhibit the respiratory burstin human neutrophils. FEBS Letters. 2004;573:219–225.

41. Nagata D, Takeda R, Sata M, Satonaka H, Suzuki E, Nagano T, Hirata Y.AMP-Activated Protein Kinase Inhibits Angiotensin II–StimulatedVascular Smooth Muscle Cell Proliferation. Circulation. 2004;110:444–451.

42. Verrier E, Wang L, Wadham C, Albanese N, Hahn C, Gamble JR,Chatterjee VK, Vadas MA, Xia P. PPARgamma agonists ameliorateendothelial cell activation via inhibition of diacylglycerol-protein kinaseC signaling pathway: role of diacylglycerol kinase. Circ Res. 2004;94:1515–1522.

43. Ouchi N, Shibata R, Walsh K. AMP-Activated Protein Kinase SignalingStimulates VEGF Expression and Angiogenesis in Skeletal Muscle. CircRes. 2005;96:838–846.

44. Arad M, Seidman CE, Seidman JG. AMP-Activated Protein Kinase in theHeart: Role During Health and Disease. Circ Res. 2007;100:474–488.

45. Nissen SE, Wolski K. Effect of rosiglitazone on the risk of myocardialinfarction and death from cardiovascular causes. N Engl J Med. 2007;356:2457–2471.

Ceolotto et al Rosiglitazone, Oxidative Stress, and AMPK 7

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

ONLINE DATA 

Ceolotto et al.

Rosiglitazone Reduces Glucose-Induced Oxidative Stress Mediated by

NAD(P)H Oxidase via AMPK-Dependent Mechanism

MATERIALS AND METHODS

Cell culture.

Human umbilical vein endothelial cells (HUVECs) were obtained from Clonetics Inc. (San

Diego, Ca. USA) and cultured in a Growth Medium (PromoCell, Heidelberg, Germany) with 10%

fetal bovin serum (FBS) (Euroclone, CELBIO, Milan, Italy), 0.02% Supplement Mix/Endothelial

Cell Growth Medium (PromoCell, Heidelberg, Germany ) and maintained in a humidified 5% CO2

incubator at 37°C. Thereafter, the cells were subcultured for 48h in the presence of either normal (5

mM) or elevated (10 mM) glucose concentration. All the experiments were carried out after 2 to 4

passages. To exclude potential toxic effects of RSG in our experimental conditions, we verified cell

viability after 48h of culture in the presence of different concentration of RSG (from 1 to 20 µM)

by cellular exclusion of propidium iodide followed by fluorescence microscopy analysis. The

experiments were performed in triplicate. Compared with the control, no significant difference in

cell viability was detected after 48h exposure to RSG.

Pharmacological compounds (AICAR, Compound C, GW9662, GW1929, GF109203, PP2,

L-NAME) were purchased from Calbiochem (La Jolla, CA). RSG was kindly gifted by

GlaxoSmithKline (UK).

Evaluation of Oxidative stress.

Measurement of oxidative stress was performed using two independent methods for ROS

detection, namely fluorescence microscopy and Electron Spin Resonance (ESR). For the sake of

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

ONLINE DATA  reproducibility between the two methods, ROS measurements was carried out using the free radical

probe TEMPO-9AC (4-((9-acridinecarbonyl)amino)-2,2,6,6-tetramethylpiperidin-oxyl, Invitrogen),

which is explicitly designed for Fluorescence and ESR measurements. The probe is permeable to

cells and produces a fluorescent signal and a decrease in the ESR signal after its oxidation by ROS.

The results, however, are obtained independently in the two methods, and the ESR results are

normally free from some fluorescence experimental artifacts.

The probe TEMPO-9AC is reported to react with several ROS but, from the point of view of

NADPH oxidase activity, the most relevant species to be considered are the superoxide radical and

the hydrogen peroxide. Previous results obtained with PEG-catalase and PEG–superoxide

dismutase showed that the TEMPO-9AC signal is blocked by catalase and not by SOD,

demonstrating that the probe preferentially reacts with H2O2.1

Fluorescence measurement of reactive oxygen species. Cells were loaded with TEMPO-9-

AC (10 µmol/l) for 10 min at 37°C in a physiological buffer at 5 or 10 mM of glucose. After

removing external TEMPO-9-AC, cells were visualized using an inverted Zeiss Axiovert 200

motorized microscope, as previously described.1 Fluorescence was monitored by quantifying

intensity changes over time at an excitation wavelength of 358 nm and an emission wavelength of

461 nm with a DAPI filter. The fluorescence rate was calculated as the slope of the linear least

squares fitting of fluorescence intensity. To measure the amount of ROS production induced by high

glucose, we compare the value of fluorescent signal with different H2O2 concentration in the

presence of TEMPO-9-AC.

Electron spin resonance measurement of free radicals. In order to measure the stimulated

production of ROS production by glucose 10 mM, we also used Electron Spin Resonance (ESR)

spectroscopy, which is able to detect paramagnetic species such as free radicals, which are the main

components of ROS.2 In this work, we used the spin clearance method,3-5 based on the ESR

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

ONLINE DATA  detection of the stable paramagnetic probe TEMPO-9-AC, that reacts with endogenous H2O2

generated by oxygen radicals, giving reaction products which are ESR silent. The ESR spectrum

intensity of the nitroxide probe TEMPO-9-AC decreases almost linearly during the first minutes

after mixing the probe with the cell suspension. Its decay rate (i.e. the slope of the ESR decay

curve) is proportional to the instantaneous concentration of endogenous ROS. HUVECs were

incubated for 48h with glucose 10 mM alone and with RSG (20 μmol/l ), and were removed from

the dishes, centrifuged at 3000g for 15 min and suspended in complete medium at a concentration

of about 4×106 cells/ml. Thereafter, the probe (20 μmol/l) was added to the cell suspensions. The

cell suspensions were inserted into capillary quartz tubes (20 μl) for ESR measurements. ESR

spectra were recorded with a Bruker ER200D spectrometer, and the ESR signal intensity of

TEMPO-9-AC was monitored for the first 15min. The spin clearance rate was calculated as the

slope of the linear least squares fitting of ESR intensity decay, as previously described.5

AMPK Silencing.

Before silencing, 2nd passage cells were cultured at 100% confluency. The day before the

experiment, the cells were harvested by trypsinization, resuspended in complete medium at the

concentration of 1×105 cells/mL, and kept at 37°C, while the transfection complex was being

prepared. Gene silencing of AMPK was performed by specific synthesized siRNA for AMPKα1

(validated siRNA, Qiagen, Hilden, Germany). The day of the experiment, transfection siRNA (15

nM) or scrambled sequence as control was incubated with HighPerfect Transfection Reagent

(Qiagen, Hilden, Germany) following manufacturer’s instructions. After 10 min incubation at room

temperature, the obtained complexes were added drop-wise onto the cells sub-cultured in replaced

culture medium. The cells were maintained in a 37°C incubator until analysis. After 24h, 48h and

72h from transfection, the cells were collected for protein and gene expression analyses of AMPK.

Cell viability of all the samples exceeded 80%. All the experiments were performed at least in

triplicate. In preliminary experiments, various concentration (5-30 nM) of siRNA were employed to

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

ONLINE DATA  determine the optimal condition for reducing AMPK expression without causing cell toxicity. We

found that the ideal concentration of siRNA was 15 nM.

Determination of AMPK expression by quantitative real-time PCR.

Total RNA was extracted from HUVECs by OMNizol (EuroClone, CELBIO, Milan, Italy)

in accordance with the manufacturer’s instructions. 1 μg of extracted RNA was transcribed into

cDNA using iScript Reverse Transcriptase (BIO-RAD, Hercules, CA, USA). Quantitative Real-

time PCR was performed using the iQ SYBRGreen Supermix kit (BIO-RAD, Hercules, CA, USA),

specific primers for AMPKα1 (TCTCAGGAGGAGAGCTATTTGATT forward, and

GAACAGACGCCGACTTTCTTT reverse) and for GAPDH

(CCCTTCATTGACCTCAACTACATG forward, and TGGGATTTCCATTGATGACAAGC

reverse,), as housekeeping gene, all the reactions were carried out using the iCycler iQ system

(BIO-RAD, Hercules, CA, USA) with the following steps: step 1, 95°C for 3 min; step 2, 95°C for

30 s; and step 3, 60°C for 1 min; with steps 2 and 3 repeated for 40 cycles. Relative quantification

of AMPK1α expression level was determined using ∆∆Ct method, as previously described.6

Western Blotting Analysis.

AMPK activity and AMPK protein expression. Cells were treated with a lysis buffer (12.5

mM Tris, 2 mM EGTA, 25 mM β-glycerophosphate, 2 mM Na3VO4, 10 μM PMSF, 1 μM

leupeptin, 5 μM aprotinin) and then sonicated at 4°C. The homogenates were centrifuged at

15,000g for 20 min at 4°C and supernatants were used as sample proteins. Samples were denatured

in SDS-PAGE sample buffer and then separated through SDS-polyacrilamide gel and transferred to

nitrocellulose membranes. The membranes were washed with Tris-buffered saline (TBS) (10

mmol/l Tris-HCl, pH 7.4, 150 mmol/l NaCl) containing 0.05% Tween-20 (TBS-Tween), blocked

for 1 h with TBS-Tween containing 5% non fat dry milk, and incubated overnight at 4°C with anti-

AMPK phosphothreonine 172-specific antibody (1:1500, Cell Signalling Technology, Beverly,

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

ONLINE DATA  MA) and anti-AMPKα1 antibody (1:3000,Upstate,Lake Placid,NY) in TBS-Tween.

Immunodetection was accomplished by incubating the membranes with the horseradish peroxidase-

conjugate secondary antibody (Amersham Biosciences, Buckinghamshire, UK) in TBS-Tween for

1h. Detection was performed using the enhanced chemiluminescence system (Pierce, CELBIO,

Milan, Italy). Blots were analyzed by the Quantity One program of VersaDOC 3000 (BIO-RAD,

Hercules, CA, USA). The results are expressed relative to the control(s), on the same blot, set at

100%, by pAMPK/AMPK densitometric ratio.

Expression of NAD(P)H oxidase subunits. Protein expression of NAD(P)H oxidase subunits

p22phox, gp91phox, p47phox, p67phox , and Rac-1 were determined by Western Blot analysis, as

previously described. Membranes were exposed to primary antibody for NAD(P)H oxidase

subunits: anti-p22phox , anti-gp91phox, anti-p47phox, anti-p67phox and anti-Rac-1 (1:1000, Santa Cruz

Biotechnology, Santa Cruz, CA, USA) and to anti-GADPH (Chemicon International, Temecula,

CA) overnight at 4oC. The results were expressed relative to the control(s), on the same blot, set at

100%, by the densitometric ratio between the specific protein and the housekeeping protein

(GAPDH) which guarantees the equal amount of the proteins into the immunoblot.

p47-phox and Rac-1 translocation to plasma membrane. Cells were lysed in hypotonic lysis

buffer (12.5 mM Tris, 2 mM EGTA, 25 mM β-glycerophosphate, 2 mM Na3VO4, 10 μM PMSF, 1

μM leupeptin, 5 μM aprotinin) and then sonicated at 4°C. The homogenates were centrifuged at

15,000g for 20 min at 4°C and then the supernatant was ultracentrifugated at 100,000g for 1h at

4°C. The pellet was defined as the membrane fraction and the supernatant as the cytosolic fraction

and subjected to Western Blot analysis for Rac-1 and p47phox using polyclonal antibodies (1:1000,

Santa Cruz Biotechnology, Santa Cruz, CA, USA).

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

ONLINE DATA 

Assay of total DAG contents.

The total diacylglycerol level was measured by its conversion into [32P]phosphatidic acid by

DAG kinase in the presence of [γ-32P]ATP, as previously described.7,8

PKC Assay.

PKC activity was measured as previously described.9 Briefly, phosphorylation reactions

were performed in the mixture containing 12 mM calcium acetate, 30 mM dithiothreitol 50 mM

Tris-Hcl, 900μM substrate peptide (RKRTLRRL), a detergent-dispersed solution of 400μM L-

phosphatidyl-L-serine and DAG, and [γ-32P]ATP. PKC activity was quantified by scintillation

counting and normalized with total protein levels.

Evaluation of the effect of RSG on AMPK in vivo.

To study the effects of RSG in vivo we treated adult male Sprague-Dawley rats (n=3) with

oral RSG 15 mg/kg daily for 7 consecutive days. RSG treatment was initiated on day 1; on day 5,

rats were subjected to a 2-hour hindlimb ischemia/reperfusion injury as previously described.10

Briefly, animals were anesthetized with inhaled isofluorane. Distal limb perfusion was monitored

with a laser Doppler flowmeter (Periflow, Perimed Italy). A 9 mm-large digit cuff (Perimed, Italy)

was placed around the thigh and connected to a standard manometer. The cuff was inflated with air

until the laser Doppler recorded biological zero flow and the pressure on the manometer was above

200 mmHg. Perfusion and pressure in the cuff were monitored during the experiment to assure

continuous and stable ischemia: additional cuff inflations were performed when pressure fall

occasionally below 200 mmHg or perfusion tended to rise. After 2 hours, the cuff was deflated.

Two days after ischemia (day 7), animals were anesthetized, and tibialis anterior muscles were

harvested for protein analyses. Euthanasia was then completed by overdose of Tanax (Intervet

International, Boxmeer, The Netherlands). Muscle tissue extracts were prepared by homogenization

followed by lysis with the extraction buffer (100 mmol/l NaCl, 50 mmol/l KCl, 0,1 mmol/l EDTA,

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

ONLINE DATA  20 mmol/l Tris-HCl pH 7,5, 10% glycerol, 0,2% Nonidet NP-40, 0,1% Triton X-100) and

treatment with a cocktail of protease inhibitors (Sigma Aldrich). AMPK activation in rat muscles

was determined as described above.

Statistical analysis.

All experiments were performed at least in triplicate. The results are expressed as mean±SE

of at least three individual experiments. Comparisons were performed using nonparametric two-

tailed tests for unpaired data with SPSS, Microsoft Excel, or Origin 7 (OriginLab, Northampton,

MA) software.

REFERENCES

1. Gallo A, Ceolotto G, Pinton P, Iori E, Murphy E, Rutter GA, Rizzuto R, Semplicini A,

Avogaro A. Metformin prevents glucose-induced protein kinase C-beta2 activation in

human umbilical vein endothelial cells through an antioxidant mechanism. Diabetes.

2005;54:1123–1131.

2. Kopàni M, Celec P, Danišovi L, Michalka P, Biró C. Oxidative stress and electron spin

resonance. Clin Chim Acta. 2006;364:61–66.

3. Sano H, Naruse M, Matsumoto K, Oi T, Utsumi H. A new nitroxyl-probe with high

retention in the brain and its application for brain imaging. Free Radic Biol Med.

2000;28:959–969.

4. Inoguchi T, Li L, Umeda F, Yu HY, Kakimoto M, Imamura M, Aoki T, Etoh T, Hashimoto

T, Naruse M, Sano H, Utsumi H, Nawata H: High glucose level and free fatty acid stimulate

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

ONLINE DATA 

reactive oxygen species production through protein kinase C-dependent activation of

NAD(P)H oxidase in cultured vascular cells. Diabetes. 2000;49:1939–1945

5. Ceolotto G, Bevilacqua M, Papparella I, Baritono E, Franco L, Corvaja C, Mazzoni M,

Semplicini A, Avogaro A. Insulin generates free radicals by an NAD(P)H,

phosphatidylinositol 3' kinase dependent mechanism in human skin fibroblasts ex vivo.

Diabetes. 2004;53:1344–1351

6. Semplicini A, Lenzini L, Sartori M, Papparella I, Calò LA, Pagnin E, Strapazzon G, Benna

C, Costa R, Avogaro A, Ceolotto G, Pessina AC. Reduced expression of regulator of G-

protein signaling 2 (RGS2) in hypertensive patients increases calcium mobilization and

ERK1/2 phosphorylation induced by angiotensin II. J Hypertens. 2006;24:1115–1124.

7. Inoguchi T, Battan R, Handler E, Sportsman JR, Heath W, King GL: Preferential elevation

of protein kinase C isoform beta II and diacylglycerol levels in the aorta and heart of

diabetic rats: differential reversibility to glycemic control by islet cell transplantation. Proc

Natl Acad Sci U S A. 1992;89:11059–11063.

8. Iori E, Marescotti MC, Vedovato M, Ceolotto G, Avogaro A, Tiengo A, Del Prato S,

Trevisan R. In situ protein Kinase C activity is increased in cultured fibroblasts from Type 1

diabetic patients with nephropathy. Diabetologia. 2003;46:524–530.

9. Ceolotto G, Gallo A, Miola M, Sartori M, Trevisan R, Del Prato S, Semplicini A, Avogaro

A. Protein kinase C activity is acutely regulated by plasma glucose concentration in human

monocytes in vivo. Diabetes. 1999;48:1316–1322.

10. Fadini GP, Sartore S, Albiero M, Baesso I, Murphy E, Menegolo M, Grego F, Vigili de

Kreutzenberg S, Tiengo A, Agostini C, Avogaro A. Number and function of endothelial

progenitor cells as a marker of severity for diabetic vasculopathy. Arterioscler Thromb Vasc

Biol. 2006;26:2140–2146.

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

ONLINE DATA 

LEGENDS TO THE SUPPLEMENTAL FIGURES.

Supplemental Figure I. Measurement of ROS in HUVECs. A) Dose-dependent response

of ROS production to different concentration of RSG for 48h. B) Time-course of RSG effect (20

µM) on. Fluorescence rate was calculated as the slope of the linear least squares fitting of

fluorescence intensity for 10 min. Data expressed as mean±SE of 10 experiments. *p<0.01. RSG,

rosiglitazone.

Supplemental Figure II. Effect of AICAR, GW96622 and GW1929 on ROS generation.

A) ROS production in HUVECs exposed to 10 mM glucose in the absence and in the presence of

RSG (20 µM), AICAR (500 μM) and the PPARγ inhibitor GW96622 (2 μM). Fluorescence rate,

calculated as the slope of the linear least squares fitting of fluorescence intensity for 10 min. Data

are expressed as mean±SE of 10 experiments. *p<0.01. B) ESR measurements of ROS production

in HUVECs grown at 10 mM glucose in the absence and in the presence of RSG (20 µM),

GW1929 (20 μM). ESR signal intensity of TEMPO-9-AC was monitored for the first 15 min. The

spin clearance rate was calculated as the slope of the linear least squares fitting of ESR intensity

decay. *p<0.01. RSG, rosiglitazone.

Supplemental Figure III. Activation of AMPK by RSG in HUVECs. A) Cells were

grown at 5 mM glucose in the absence and in the presence of RSG 20 μM at different time

intervals. B) Cells were grown at 10 mM glucose in the absence and in the presence of RSG (20

µM), of the PPARγ inhibitor GW96622 (2 μM), or of the AMPK inhibitor Compound C (100 µM),

for 48h. The upper panels show the representative immunoblots of AMPK phospshorylation and of

AMPK expression. The lower panels show the densitometric analysis of AMPK phosphorylation,

calculated as the ratio between pAMPK and AMPK total protein. Data expressed as percentage of

control (set as 100%) and are the mean of 3 experiments. *p<0.01. RSG, rosiglitazone.

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

ONLINE DATA 

Supplemental Figure IV. Effect of RSG on AMPK activation in vivo. Sprague-Dawley

rats (n=3) were subjected to a 5-day pre-treatment with RSG 20 mg/kg followed by a 2h/48h

ischemia/reperfusion (I/R) injury, during which RSG treatment was continued (A). Representative

western blot of total AMPK and phopho-AMPK (B), together with quantification of AMPK

activation (C) are shown. *p<0.05 vs control. ** p< 0.05 vs basal (RSG, rosiglitazone).

Supplemental Figure V. Measurement of ROS in HUVECs. Representative fluorescence

images for ROS measurement in siRNA-transfected HUVECs observed at 1 min and 10 min. A)

Control siRNA cells grown at 10 mM glucose. B) Control siRNA cells grown at 10 mM glucose

and in the presence of RSG (20 μM,48h). C) siAMPK1α cells grown at 10 mM glucose and in the

presence of RSG (20 μM,48h). D) Control siRNA cells grown at 10 mM glucose and in the

presence of Compound C and RSG. E) Quantitative fluorescence measurements of ROS production

in siRNA cells. F) ESR measurements of ROS in siRNA cells. Data are expressed as mean±SE of

10 experiments. *p<0.01. RSG, rosiglitazone.

Supplemental Figure VI. Effect of RSG and of AMPK inhibitor on NAD(P)H subunits

expression in HUVECs. Cells were grown at 5 and 10 mM glucose, in the presence of RSG 20 μM

and in the presence of RSG and compound C, for 48 h. Then, the cells were lysed and proteins

separated by electrophoresis and immunoblotted with anti-p22phox , anti-p47phox, anti-gp91phox, anti-

p67phox, anti-rac-1 and anti-GAPDH antibodies. The upper panels show the representative

immunoblots of total p22phox , p47phox, gp91phox, p67phox , rac-1 expression. GADPH was used to

confirm equal amounts of protein loading. The lower panel shows the relative protein levels

determined by densitometry and normalized to GADPH levels. Data expressed as mean±SE of 3

experiments. *p<0.01 vs Glu 5mM. RSG, rosiglitazone.

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

ONLINE DATA 

Supplemental Figure VII. Measurement of ROS in HUVECs. Cells were grown at 5 and

10 mM glucose, in the presence of RSG 20 μM, of GF109203X 5 μM, and of L-NAME 100 μM,

for 48h. Fluorescence rate, calculated as the slope of the linear least squares fitting of fluorescence

intensity for 10 min. Data expressed as mean±SE of 10 experiments. *p<0.01 vs Glu 5mM. RSG,

rosiglitazone.

Supplemental Figure VIII. DAG levels and PKC activity in HUVECs. Total cellular

DAG levels (A) and PKC activity (B) were determined in HUVECs exposed to 5 (Glu 5) and 10

mM of glucose (Glu 10) for 48h, in the presence of RSG (20μM, 48h) alone, in the presence of

RSG and GW9662, and in the presence of Compond C. Data are mean±SE of 3 experiments.

*p<0.01 vs Glu 5mM.

by on May 15, 2011 atvb.ahajournals.orgDownloaded from

Supplemental FIGURE I

A Bat

e (A

.U.)

40

50

ate

(A.U

.)

40

50

esce

nce

ra

20

30

* esce

nce

ra

*20

30

*

Fluo

re

*10

*

Fluo

re

10

*

00 0.02 2 20 50

RSG (μM)

00 5min 20min 24h 48h

RSG (20 μM)

by on May 15, 2011

atvb.ahajournals.orgD

ownloaded from

(A.U

.) *60

50A Supplemental FIGURE II

cenc

e ra

te (

40

30

Fluo

resc 20

10

Glu5 Glu10 Glu10+RSG

Glu10+AICAR

Glu10+RSG+GW9662

0

B

ESR

* *200

ctio

n fr

omsc

ontr

ol) 150

100

RO

S pr

odu

(%vs

50

R

Glu10+RSG

Glu5 Glu10 Glu10+GW1929

0

by on May 15, 2011

atvb.ahajournals.orgD

ownloaded from

Supplemental FIGURE III

A Bp-AMPKp-AMPK

A B

AMPKAMPK

K ) 350400

300350**

K )

* *

MPK

/AM

PKvs

con

trol

150200250300

150200

250300

MPK

/AM

PKvs

con

trol

)

Glu 10mM

pAM

(%

Glu 5 mM + + + + +0

5010050

050

100

pAM

(% v

+ + + +Glu 10mM RSG Compound C GW9662

Glu 5 mM + + + + + RSG 20 μM - 10’ 1h 24h 48h

- + + +- - - +- - + -

by on May 15, 2011

atvb.ahajournals.orgD

ownloaded from

SUPPLEMENTAL FIGURE IV

tissue collectionA C

reperfusion2-hour ischemia

C

300

Basal I/R

****1 2 3 4 5 6 71 2 3 4 5 6 7

oral RSG treatment (15 mg/kg/day)

(d )200

250

vatio

n

*

**

(days)

B100

150

K A

ctiv *

AMPK

50

100

AM

PP-AMPK

Basal Basal I/R I/R

0Control RSG

Control RSG Control RSG

by on May 15, 2011

atvb.ahajournals.orgD

ownloaded from

1 min 10 min

U.)E

SUPPLEMENTAL FIGURE V70

A

ce ra

te (A

.U

40

50

60

B uore

scen

c

*10

20

30

B Fl)

F0

200

C

prod

uctio

n%

vsco

ntro

l

*100

150

DR

OS

pES

R (%

*0

50

siCnt+Glu (48h,10mM) + + + +siCnt+RSG (48h,20μM) - + - +siAMPK+RSG (48h,20μM) - - + -

0

( , μ )Compound C (48h,1μM) - - - +

by on May 15, 2011

atvb.ahajournals.orgD

ownloaded from

p22phoxSUPPLEMENTAL FIGURE VI

p47phox

gp91phox

Rac1

p67phox

GAPDH

Glu 5 Gluc 10 Glu 10 + Glu 10+RSG RSG+Compound C300 22 h300

* *

p22phox

200p47phox gp91phox p67phox Rac1

100

0Glucose 5 + - - - + - - - + - - - + - - - + - - -Glucose 5 Glucose 10 RSG Compound C

- + + +- - + +- - - +

+ - - -- + + +- - + +- - - +

+ - - -- + + +- - + +- - - +

- + + +- - + +- - - +

- + + +- - + +- - - +

by on May 15, 2011

atvb.ahajournals.orgD

ownloaded from

SUPPLEMENTAL FIGURE VII

50

60A

.U.)

**

40

50

e ra

te (A

20

30

resc

enc

0

10Fluo

0

by on May 15, 2011

atvb.ahajournals.orgD

ownloaded from

SUPPLEMENTAL FIGURE VIII

A B600 50

l/min

/mg)* * *

*500

400

40

tivity

(pm

ol400

300

200

30

20

PKC

Act200

100 10

00

by on May 15, 2011

atvb.ahajournals.orgD

ownloaded from