1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 28 P o s t e r A b s t r a c t s

POSTER ABSTRACTS

Poster 01 - Bovine Reproduction P001 New Trends for Estrus Synchronization in Lactating Dairy Cows Amer, HA1, Abaza, F2* 1Department of Theriogenology, Faculty of Veterinary Medicine, Zagazig University; 2Department of Military Veterinary Services, Ministry of Defense, Egypt This study was conducted to through the light on estrus synchronization in dairy cows. Four treatments were performed on sixty Holstein Friesian cows. In treatment 1 (PP), cows received 2 injections of PGF2α on days 0 and 11 (n=14). In treatment 2 (PGP), cows injected twice PGF2α on days 0 and 11 and 100 ug of GnRH on day 3 after 1st injection (n=14). In treatment 3 (PGPE-0), cows treated with PGP and 1 mg of estradiol cypionate (ECP) at same time of 2nd PGF2α dose (n=16). In treatment 4 (PGPE-1), cows were treated with PGP and 1 mg ECP one day after 2nd PGF2α injection (n=16). Cows were examined rectally and ultrasonographically by B-mode System [Pie-Medical Scanner-240] with a 6-8 MHz linear probe. Every cow was blood sampled at selected intervals for progesterone and estradiol assay and inseminated at estrus. The results showed a higher percentage of GnRH-treated cows (PGP) ovulated after 1st PGF2α injection than non treated (PP) cows (64.3% vs 50%; P<0.05). The GnRH-treated cows tended to have a larger mature follicle present at 2nd PGF2α injection. Subsequently, percentage of ovulated cows after 2nd PGF2α injection was 71.4% vs 50% for GnRH-treated cows than none treated ones, respectively. Two days after 2nd PGF2α injection, cows PGP group had a higher (P<0.05) peak preovulatory concentrations of estradiol compared to PP treated cows (3.2±0.48 vs 2.6±0.45 pg/ml). Additionally, cows treated with ECP (PGPE-0 and PGPE-1) had a higher peak preovulatory concentrations of estradiol (6.3±0.43 and 6.99±0.63 pg/ml; P<0.01); and a higher percentage ovulation (75.0% and 87.5%) than the other treated groups. Thus, a higher percentage of PGPE-1-treated cows were observed in standing estrus and ovulated after 2nd PGF2α injection than other treated groups. Submission rates differed statistically across treatments, especially those treated with ECP, as well as; the conception and pregnancy rates were observed higher with ECP treated cows than the others. In conclusion, the combination of ECP and PGP (PGPE-1) enhanced the expression of estrus and increased ovulation percentage, thus it is potentially a new method to routinely synchronize estrus and ovulation in dairy cows during the timed artificial insemination regimes. P002 Effect of GnRH administration after artificial insemination on pregnancy rate and pregnancy losses in dairy cows Abd El-Razek, IM* Department of Anim. Prod., Faculty of Agriculture, Kafr El-Sheikh University, Egypt The aim of this study was to improve pregnancy rate in dairy cows by administering GnRH after artificial insemination. Thirty six dairy cows inseminated at standing estrus were divided into three similar groups after balancing for parity and days postpartum. Cows in Group 1 (control; n=12) were no treated and cows in Group 2 (n=12) received 50 µg GnRH i.m at d5 and d6, however, Group 3(n=12) received four consecutive injections of 50µg GnRH i.m from d11 to 14 and re-injected with another dose of 50 µg GnRH at d 21 post insemination. Pregnancy, accessory corpora lutea and progesterone concentrations were determined on day 28 and 56 post insemination. Serum progesterone concentration was greater (P<0.05) at d28 for cows treated with GnRH compared to cows in the control group. All cows

in the GnRH- treated groups developed an accessory corpus luteum, whereas in the control group did not. Pregnancy rate after GnRH treatment tended to be higher in Group 1(66.7%) and Group 3(75%) than in control one (50%). In contrast, pregnancy losses was lower for GnRH treated groups compared to control cows but did not significantly differ. In summary, the treatment of dairy cows with GnRH post insemination increased concentration of progesterone by developing an accessory corpus luteum and resulted in a tendency toward greater pregnancy rates. P003 Postpartum ovarian cyclicity and productive parameters in dairy cows under grazing conditions: effects of body condition at calving Adrien, ML*; Mattiauda, D; Carballo, C; Claramunt, M; Carriquiry, M; Artegoitia, V; Bruni, M; Meikle, A Agronomy Faculty, Uruguay Three months before calving, primiparous (L1, n=30) and multiparous (L2, n=30) Holstein cows were randomly assigned to differential forage assignments (15 or 30 kg DM/d) to induce groups with different body conditions score (BCS; Low, LO and High, HI) at -3 wk of the expected calving date. From this moment until calving animals were in the same paddock fed millet hay, corn silage, and concentrate. The effects of parity and BCS on length of postpartum anestrus and productive performance during the first 8 wk of lactation were investigated. After calving, all cows grazed the same implanted (Festuca arundinacea, Trifolium repens and Lotus corniculatus) pasture (20 kg MS/d) and were supplemented with 20 kg of corn silage, 0.5 kg of millet and 7 kg of concentrate. Body condition at calving was 3.0, 3.25, 2.7, and 3.1 ± 0.05 for LO-L1, HI-L1, LO-L2, and HI-L2, respectively. Days to first ovulation (days to plasma progesterone concentrations >1 ng/ml) were analyzed using PROC GENMOD and production data were assessed in a repeated measure analysis using PROC MIXED (SAS Institute). Results were considered to differ when P<0.05. Daily 4% fat-corrected milk yield was 1.8 kg/d greater for L2 than L1 cows and 3.8 kg/d for HI than LO cows. These differences were mainly due to increased milk yields for L2 than L1 cows and greater milk fat contents for HI-L1 than LO-L1 cows. Milk protein contents were increased and lactose contents tended (P=0.065) to be greater for HI than LO cows. Differences in BCS among groups were maintained throughout the study. Days to first ovulation were affected by parity and body condition at calving as anestrus postpartum was 12 d longer in L1 than in L2 cows and 13.5 d longer in LO than HI cows (51.5, 36.7, 38.5, 26.3 days; SEM: 6.2, for LO-L1, HI-L1, LO-L2, and HI-L2, respectively). Body condition at calving modified lactation performance and increased length of postpartum anestrus in both primiparous and multiparous cows. P004 Treatment of postpartum endometritis in dairy cows with an intrauterine application of hyperimmunue serum Ahmadi, MR1*; Hosseini, A2; Yavari, M1; Gheisari HR3 1Department of Clinical Sciences, 2Pathobiology and 3Food Hygiene,School of Veterinary Medicine, Shiraz University, P.O.Box:71345-1731, Shiraz, Iran The objective of this study was to evaluate, if hyperimmunue serum are efficacious in the treatment of postpartum endometritis. In a controlled field trial, cows with vaginal discharge, 25–35 days in milk (DIM) were randomly assigned to two treatment groups. Endometritis was classified into three categories, depending on the type of vaginal discharge: clear mucus with flakes of pus (E1), mucopurulent discharge or fluctuating contents in the uterus (E2), and purulent discharge (E3). In group hyperimmunue serum (n =42), cows received an intrauterine treatment with 50 ml hyperimmunue serum.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 29 hyperimmune serum were produced against Arcanobacterium pyogenes and E. coli that were isolated in Iranian dairy farms. Cows in group oxytetracycline (n=39) were treated with one intrauterine infusion of 5gr oxytetracycline (10%). Cows that did not show any clinical signs of postpartum endometritis were regarded as healthy control group (HC, n =91). In group hyperimmunue serum and oxytetracycline (OTC), all cows were re-examined 39–49 DIM. In group hyperimmunue serum and OTC, cows were re-treated with hyperimmunue serum if signs of endometritis were found. Cure rate after the first treatment, defined as the absence of vaginal discharge at the re-examinations, was 64.3 % and 61.5% in groups hyperimmunue Serum and OTC (P > 0.05). Reproductive performance measures showed no significant differences (P > 0.05) between the two treatment groups. There was no significant difference (P > 0.05) Service rate between treatments groups hyperimmunue Serum and OTC, compared to HC. Conception rates to all services and percentages of cows pregnant by 180 DIM were 90.48, 86.49 and 92.13 in groups hyperimmunue Serum, OTC and HC, respectively (P > 0.05). In both treatment groups, cure rate and reproductive performance measures were better for cows categorized E1 or E2, than for cows categorized E3 but the differences were not significant. Conception rate to all services for cows with endometritis (category E1, E2 and E3) was 52.94 in group hyperimmunue Serum and 57.14 in group OTC compared 66.67 in HC (P > 0.05). The results of this field trial suggest that hyperimmunue serum could be the alternative no antibiotic treatment of choice for postpartum endometritis in dairy cattle. P005 GnRH-induced LH and ovulatory responses in dairy heifers during diestrus and proestrus Ambrose, DJ1*, Colazo, MG1, Bhuwanee, A2, Kumpula, B2, Lamont, AL2, Salmon, F2, Suddaby, P2, Terletski, S2

1Agriculture Research Division, Alberta Agriculture and Food, Canada; 2Agricultural Food and Nutritional Science, University of Alberta, Canada The objective was to determine whether pituitary LH response to GnRH in Holstein heifers differed between diestrous and proestrous stages of the estrous cycle. Fifteen postpuberal heifers (13 to 14 mo of age, 404 to 479 kg body weight) were given 25 mg of dinoprost tromethamine (PGF; Lutalyse, Pfizer Animal Health) im. Estrus detection was done twice daily for 4 d after PGF treatment and ovulation (Day 0) confirmed by ultrasonography. On Day (Mean ± SE) 8.5 ± 0.6 after ovulation, 100 µg of gonadorelin acetate (GnRH; Fertiline, Vetoquinol Canada Inc.) was given im to all heifers (Diestrous stage treatment). Blood samples (n=15/heifer; from 15 min before to 8 h after GnRH) were collected and plasma analyzed for LH concentration. One blood sample taken prior to GnRH was analyzed for progesterone. Ovulation was determined by ultrasonography 48 h following GnRH treatment and heifers received an intravaginal progesterone (P4; 1.9 g) insert (CIDR; Pfizer Animal Health) for 7 d, with PGF administered at CIDR removal. Twenty-four h after CIDR removal (Day 15.9 ± 0.6), GnRH was given im (Proestrous stage treatment). Ovulatory response, P4 and LH concentrations were determined as in Diestrus. Data were analyzed by Proc MIXED, ANOVA, and Chi-square. Two heifers did not respond to PGF treatment; both were excluded from the study. Plasma P4 concentration (ng/mL) at GnRH treatment was higher (P < 0.01) in heifers treated during diestrus (5.7 ± 0.7) than during proestrus (1.0 ± 0.2). The ovulatory response to GnRH treatment was higher during proestrus than diestrus (P < 0.02; 61.5 vs 15.4%). GnRH-induced LH peak was lower (P < 0.04; 5.7 ± 0.8 vs 13.6 ± 3.0 ng/mL) and of shorter duration (P < 0.01; 5.4 ± 0.3 vs 6.8 ± 0.3 h) in heifers treated during diestrus than during proestrus. Regardless of the stage of the estrous cycle at treatment, heifers that ovulated after GnRH had a significantly longer interval from GnRH treatment to LH peak than those that did not ovulate (P < 0.01; 1.7 ± 0.1 vs 1.0 ± 0.1 h). However, in heifers treated with GnRH during proestrus, LH concentrations did not differ (P = 0.60) between those that ovulated and those that did not. In conclusion, heifers treated with GnRH during diestrus had lower peak LH concentrations, delayed attainment

of LH peak, shorter duration of elevated LH concentrations, and lower ovulatory responses than those treated during proestrus. P006 The Effect of Adding Cholesterol, Vitamin A, Cod Liver or Flax Oil Loaded Cyclodextrin on Bull Sperm Cryosurvival Amorim, EAM1,2*, Graham, J2, Spizziri, B2, Meyers, M2, Amorim, LS1,2, Torres, CAA1

1Department of Animal Science, Federal University of Vicosa, Brazil; 2Department of Biomedical Sciences, Colorado State University, USA Introduction Damage occurring to spermatozoa during cryopreservation results in a loss of motile cells and cells that are functionally normal, compared to fresh sperm samples. Treating bull sperm with cholesterol-loaded cyclodextrins (CLCs) prior to cryopreservation results in increased sperm cryosurvival, however, adding cholesterol to bull sperm membranes alters their ability to capacitate in vitro. This study compared the effect of adding four compounds, which should incorporate into and increase membrane fluidity at low temperatures thereby increasing cryosurvival. Method Twenty-five ejaculates from four bulls were collected using artificial vagina and extended with Tris, and then sub-divided into 11 treatments: No additive (negative control); 1.5 mg CLC/120 million sperm (positive control); and 0.75 mg, 1.5 mg and 3.0 mg/120 million sperm of cyclodextrin pre-loaded with vitamin A or Cod Liver oil or Flax oil. Methyl-β-cyclodextrin was preloaded with cholesterol as described by Purdy and Graham (2004). Spermatozoa were incubated for 15 min at 22 oC. Then, samples were diluted 1:1 (v:v) in Tris with 20% Egg Yolk (EY) and cooled to 5 oC. After dilution 1:1 (v:v) with Tris containing 10% EY and 16% glycerol, samples were allowed to equilibrate for 15 min before packaging into 0.5 ml straws, freezing in static liquid nitrogen vapor (4.5 cm above the liquid nitrogen) for 20 min and plunging into liquid nitrogen for storage. Straws were thawed in a water bath at 37ºC for 30 sec and the percentages of total motile in each sample were determined using a computer-assisted sperm analysis (Hamilton Thorne Motility Analyser). Results The percentages of motile total sperm cells were maintained after thawing for bull sperm treated with CLC (45%) compared to all other treatments (26-41%; P<0.05). Control samples and sperm treated with vitamin A, cod liver or flax oil loaded cyclodextrin exhibited similar percentages of motile sperm after freezing (P>0.05). Conclusion Therefore, increasing membrane cholesterol levels by adding CLCs to bull sperm, prior to freezing, is a simple technology that improved cell cryosurvival, whereas treatments with cyclodextrins preloaded with other molecules did not. Acknowledgments Supported by Colorado State University Experiment Station and CNPq/Brazil. P007 Bypass fat supplementation in zebu cows (Bos indicus) in the early postpartum: an alternative to decrease the open days period? Mesa, C1; Mahecha, L2; Ruiz, ZT1; Gallo, J3; Angulo, J1,2*; Olivera-Angel, M1 1Grupo de Reproducción - Fisiología y Biotecnología, Facultad de Ciencias Agrarias, Universidad de Antioquia, Colombia; 2 Grupo Grica, Facultad de Ciencias Agrarias, Universidad de Antioquia, Colombia; 3Soluciones Nutricionales S.A., Medellín, Colombia Introduction Traditional beef cattle production in tropical South America is extensive and based primarily on Bos indicus cattle and its crosses. This productive system involves the permanent contact of the cow with its calf, feeding with low nutritional value grass and the highly seasonal supply of forage. These characteristics are the main causes of postpartum anoestrus and the long calving to conception period (open days). Nowadays, there are some management strategies which help to decrease the postpartum anoestrus and the open days. The use of bypass fat in order to increase the energetic contribution of the diet, and the restricted suckling practices, are some of them. However, these practices are usually used in a separated way. The objective of this study was to evaluate the effect of mixing a temporal

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 30 P o s t e r A b s t r a c t s suckling restriction (TSR) practice with bypass fat supplementation (BFS) on the duration of the open days, and on pregnancy at day 100 days in a commercial beef cattle production in Colombia. Materials and methods 32 commercial zebu cows were used and three groups were designed: group I control (n=10) cow and calf in permanent contact, group II TSR (n=10) cows with a mean of 65.7 days postpartum and TSR during 72 hours with heat detection, group III TSR + BFS (n=12), cows supplemented from the 32 postpartum day with BFS and TSR of 72 hours in 62 postpartum day with heat detection. A chi-square test was realized to establish association between the different groups and pregnancy at day 100 of the experiment and a Kruskall-Wallis test was realized to establish differences between the groups in the open days number. These analyses were performed using SAS ver 8.0. Results Although there was no association between the different groups and pregnancy at day 100 of the experiment (X2 = 4.097, P-value = 0.1289), we found a tendency in the proportion of pregnant cows in group II TSR and group III TSR + BFS. Besides, we found statistical significative differences between the groups in the open days number (Kruskall-Wallis test, test value = 8,70259, p-value = 0,0128901). In the group III TSR + BFS we found less open days (83.3) followed by group II TSR (97.1) and group I control (136.3) respectively. Conclusions We recommend the use of bypass fat supplementation with temporal suckling restriction as an alternative to decrease the open days period in Colombian beef cattle production. P008 Color-Doppler ultrasonography: a non-invasive method to assess luteolysis in cattle Araujo, RR1,2*, Ginther, OJ1, Ferreira, JC3 , Siqueira, LGB4 , Beg, MA1 , Wiltbank, MC5 1Pathobiological Sciences, University of Wisconsin - Madison, United States; 2Dairy Science, University of Wisconsin - Madison, United States; 3Eutheria Foundation - Cross Plains - Wi, United States; 4Wcvm - Lacs, University of Saskatchewan, United States; 5Dairy Science, University of Wisconsin - Madison, United States Many studies have shown the relationship of corpus luteum (CL) echotexture with functional status using B-mode ultrasonography. Recently, Doppler ultrasonography was introduced as an additional method for evaluating the structural and functional attributes of the CL. Two ultrasound technologies (B-mode and Color-Doppler) were used for comparing CL morphology with systemic progesterone concentrations. Holstein heifers (n=14) were scanned using a duplex B-mode and pulsed-wave color-Doppler ultrasound instrument (Aloka SSD 3500; Aloka America, Wallingford, CT) equipped with a linear-array 7.5 MHz transducer. The scanning was performed daily starting 9 days after ovulation until the next ovulation. Real-time B-mode/color-Doppler images of the continuous scans were recorded with an online digital videotaping system. During each scanning, percentage of CL area with color-Doppler signals for blood flow was estimated. Blood samples were collected once a day for plasma progesterone assay. Computer-assisted analyses of B-mode images for mean pixel value, based on gray scale (0=black to 255=white), were performed using a custom-developed software. Luteal blood flow, mean pixel value and plasma progesterone were analyzed by SAS MIXED procedure with a REPEATED measures statement and differences among days were determined by paired t-tests. Pearson’s correlation coefficients were calculated between luteal blood flow, mean pixel value, and plasma progesterone. Data were normalized to the examination in each heifer when the decreasing plasma progesterone concentrations reached <1 ng/ml (Day 0, indication of luteolysis) and were analyzed from Day -7 until Day 2. The day effect was significant (P<0.0001) for all three end points and reflected a decrease during luteolysis. A significant decrease in plasma progesterone occurred one day earlier (Day -3) than for both CL blood flow and mean pixel value (Day –2). Plasma progesterone and CL blood flow continued to decline further and reached the lowest means by Day 2. However, the mean pixel value did not decrease further during the days of the continuing progesterone decrease (Days –1 to 2). Both CL blood flow (r=0.80) and mean pixel value (r=0.41) were

correlated (P<0.0001) to plasma progesterone concentrations. In conclusion, evaluation of CL by B-mode (mean pixel value) and blood flow by Color-Doppler ultrasound reflected morphologic and functional changes in CL. However, CL blood flow was a better indicator of continuing luteolysis in cattle. Key-words: Doppler ultrasound, corpus luteum, echotexture, blood flow, cattle. P009 Thyroid hormone concentrations in peripheral circulation and ovarian follicular fluid of cows Ashkar, FA1*; Bartlewski, PM1; Singh, J2; King, WA1 1Department of Biomedical Sciences, Ontario Veterinary College, University of Guelph, Guelph, Ont., Canada; 2Department of Veterinary Biomedical Sciences, Western College of Veterinary Medicine, University of Saskatchewan, Saskatoon, Sask., Canada The endocrine effects of triiodothyronine (T3) and thyroxin (T4) on ovarian function and embryonic development have been described in several mammalian species, but there is a paucity of information on circulating concentrations and follicular fluid content of both thyroid hormones in cows. The aim of this study was hence to determine and compare the concentrations of total (T) and free (F) T3/T4 in peripheral circulation and follicular fluid, in relation to ovarian follicular status in vivo (Experiment 1), and in slaughterhouse bovine ovaries (Experiment 2). In Experiment 1, estrus was synchronized in sixteen cows using Estrumate™ injections (2ml/cow i.m.) and the time of ovulation (Day 0) was confirmed by ultrasonography. Ovarian antral follicles were ablated on Day 5 and the superovulatory treatment commenced on Day 6. The treatment consisted of seven Folltropin®-V injections given twice daily from Day 6 p.m. to Day 9 p.m. (50 mg/cow i.m.), followed by two injections of Estrumate™ (Day 10 a.m. and p.m.; 2 ml/cow i.m.) and a single dose of Lutropin Alfa (10 ml/cow i.m.), administered in the afternoon of Day 11. Blood samples were drawn and follicular fluid samples obtained, by ultrasound-guided follicle aspiration, on Days 5 and 12. On Day 5, both TT3 and FT3 concentrations were greater (P<0.05) in serum than in follicular fluid from dominant (DFs) or subordinate antral follicles (SFs). Follicular fluid concentrations of TT4 were greater (P<0.05) in DFs compared with SFs. On Day 12, serum concentrations of FT4, TT3 and FT3 were greater (P<0.05) compared with those in follicular fluid (4 follicles/cow). Serum concentrations of FT4 were greater (P<0.05) on Day 12 than Day 5. In Experiment 2, bovine ovaries collected in the abattoir (n=20) were used to aspirate follicular fluid from the largest and all remaining follicles visible on the surface of the ovary; there were no differences (P>0.05) in the concentrations of total and free fractions of thyroid hormones between the two subsets of follicles. We concluded that the physiological status of bovine antral follicles (i.e., dominant versus subordinate) could impinge on the accumulation of TT4 in follicular fluid and hormonal ovarian superstimulation increased circulating levels of FT4 and FT3, without affecting follicular fluid content of thyroid hormones. P010 Effect of supplemental FSH during ovsynch in high producing holstein cows during summer Ayres, H1,2*, Ferreira, RM1,2, Cunha, AP2, Araujo, RR2; Wiltbank, MC2 1Department of Animal Reproduction, University of Sao Paulo, Sao Paulo, Brazil; 2Department of Dairy Science, University of Wisconsin, Madison, USA Fertility is reduced in high producing Holstein cows during the summer. Previous research in beef cattle indicated improved fertility in timed AI protocols supplemented with low doses of FSH (10 or 20 mg). We hypothesized that treatment with FSH during a timed AI protocol (Ovsynch) in summer could cause a potentially fertility-enhancing change in follicular dynamics and circulating progesterone (P4) and estradiol-17ß (E2) in high producing Holstein cows. This experiment was done during the months of June through August 2007 on a commercial dairy farm in south-central Wisconsin. Weekly, a cohort of 30 to 50 cows at 68±3 DIM were stratified by parity and randomly assigned to 1 of 2 treatments: Ovsynch (n=102) or Ovsynch+FSH (n=95). All cows received Ovsynch (GnRH[G1]-7d-

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 31 PGF2α[PG]-56h-GnRH[G2]-18h-AI). Ovsynch+FSH cows received 20 mg of FSH at time of PG. Ovarian ultrasound was performed at G1, PG, G2 and 6d after G2. Blood samples were collected at G1, PG, G2 and 13d after G2 to determine circulating P4 and/or E2. Luteolysis was defined as P4<0.5ng/ml at G2. Binomially-distributed data (i.e. ovulation rate) and data with normal distribution (i.e. concentration of P4, E2) were analyzed by logistic regression using Glimmix procedure of SAS. As expected, there were no differences in Ovsynch vs. Ovsynch+FSH in ovulation rate to G1 (77.0% vs. 76.7%; P=0.91), serum P4 at PG (3.34±0.19 vs. 3.36±0.29; P=0.91), or size of largest follicle at PG/FSH (12.00±0.33 vs. 11.93±0.42; P=0.82) because these measurements were prior to FSH treatment. There was no difference in luteolysis rate to PG (96.1% vs. 91.6%; P=0.20); however, P4 concentration at G2 was unexpectedly lower in Ovsynch than Ovsynch+FSH (0.15±0.01 vs. 0.27±0.06; P=0.03). Surprisingly, there was no effect of FSH on circulating E2 at G2 (3.64±0.32 vs. 3.24±0.19; P=0.88), size of largest follicle at G2 (16.33±0.33 vs. 16.09±0.36; P=0.63), ovulation rate to G2 (96.0% vs. 95.7%; P=0.69), or P4 concentration 13 days after G2 (3.37±0.16 vs. 3.54±0.19; P=0.36). Thus, a 20 mg dose of FSH during Ovsynch did not alter follicular dynamics or circulating E2 prior to AI or circulating P4 after AI; although, there was an unexpected indication that FSH inhibited completion of luteolysis (increased P4 at G2). Thus, these physiological data do not indicate a major fertility-enhancing alteration in follicular dynamics or circulating hormones after a single FSH treatment during Ovsynch high-producing cows during summer. (Acknowledgements: Bioniche) P011 Frequency and the possible background of luteal cavities and cysts in dairy cattle Balogh, OG1*, Sandor, CS2, Abonyi-Toth, Zs3, Turi, E4 and Gabor, G1 1Department of Cattle Breeding Research Institute for Animal Breeding, H-2053 Herceghalom, Hungary (balogh.orsolya@atk.hu), 2Agri-Indistrial CC of Bacsalmas, Bácsalmás, Hungary, 3SzIE-AOTK, H-1074 Budapest, Hungary Dramatically increased milk production was recorded in the last few decades in dairy farms. This resulted more frequent problems of the reproductive performance in dairy cows. One of the major problems is the appearance of numerous irregular luteal forms (ILF), which can cause several dysfunctions of the reproductive tract. Improvement of the diagnostic tools (such as imaging techniques), provided the opportunity for examination of those phenomena what were not detected earlier (e.g. different luteal forms). Our goal was to find interactions between the presence of irregular luteal forms and the reproductive status of the cows, temperature (season-months), and farm effect. In 2007 between 1st January and 31st October 1762 dairy cows were examined by an ultrasound scanner (Tringa linear, Pie Medical, Maastrict, The Netherland) with 7.5 MHz linear array on 17 dairy farms in Hungary. Data of cows (including calving and AI date, ovarian and uterine treatments, reproductive disorders, milk production) were recorded, and also the actual status and size of the uterus and the ovaries. Pearson's Chi-squared test and logistic regression model were used to find associations between diagnosed irregular luteal forms and the month (temperature), the stage of the uterus and/or the farm effect. The presence of ILF on ovaries was significantly higher (P<0.001) in 30-60 days post partum cows than in others. The correlation between month (temperature) and the presence of ILFs was significant too (P<0.001). The formation of these phenomena looked more frequent in February-March and July-August. The probably explanation of that is the cool or hot ambient temperature, because both of them could cause energy deficiency (in winter the lower energy content than necessary and in summer the low feed intake: the hot ambient temperature could cause decreased appetite). The most important circumstance seemed to be the farm effect (significant correlation, P<0.001) for the presence of ILFs. It is important because the farm effect correlates significantly (P<0.001) with the frequency of metritis. Based on these findings we are planning to check the effect of metabolic and/or inflammational background of formation these luteal forms.

P012 Association between growth hormone genotype (AluI polymorphism) and plasma levels of ketone bodies and metabolic hormones in post partum (PP) dairy cows Balogh, O1*; Kovács, K2; Kulcsár, M1; Fébel, H2; Zsolnai, A2; Fésüs, L2; Gilbert, RO3; Huszenicza, G 1 1Faculty of Veterinary Science, Szent István University, Hungary; 2Research Institute for Animal Breeding and Nutrition, Hungary; 3College of Veterinary Medicine, Cornell Unversity, USA A point mutation in the bovine growth hormone (GH) gene causes a change from leucine (L) to valine (V) in the amino acid sequence at position 127 (AluI polymorphism). Results of previous studies on the association between genotype and milk production traits were contradictory. We focused on the relationship between GH genotype and metabolic status (plasma β-hydroxy-butyrate [BHB], insulin and insulin-like growth factor I [IGF-I] levels) of dairy cows in the early PP period. Cows calving in spring in 8 large-scale dairy herds in Hungary (n=257, parity ≥2, milk yield ≥4500kg) were assigned to the study. Blood samples were taken to determine genotype and plasma levels of BHB, insulin and IGF-I on day 4-12 after parturition. Animals with overt clinical signs (e.g. inappetance, fever) of clinical mastitis and/or puerperal metritis were excluded. Statistical analysis was done with Pearson’s correlation test, ANOVA general linear model and repeated measures, nested design model. The majority of cows were homozygous for L allele (n=218, 84.8 %), 14.4 % (n=37) were heterozygous and 0.8 % (n=2) were homozygous for V allele. Allele frequencies were pLeucine= 0.92, qValine= 0.08. VV animals were not included in the statistical evaluation. Interestingly, 70.26% of the heterozygous animals (n=26) belonged to two herds (n=98). Production level (305-day milk yield, kg) was different (P<0.001) by herd, but did not vary between LL and LV cows (7769.6±130.1 kg vs 8136.6±278.7 kg, respectively; P=0.201). There was no significant association between genotype (LL and LV) and plasma levels of BHB (1.19±0.11 vs 1.21±0.19 mmol/l; P=0.906), insulin (15.51±1.40 and 17.52±2.23 pmol/l; P=0.320) and IGF-I (2.88±0.08 and 2.93±0.13 nmol/l; P=0.702, respectively). On the other hand plasma levels of BHB (P<0.001), insulin (P=0.002) and IGF-I (P=0.095) were different between herds. Insulin concentrations varied by the production level within herds, as well (P=0.062). Neither the number of days elapsed since calving nor parity affected any of the blood parameters. In two herds with the most LV animals the relationship between genotype and plasma hormones and metabolites was similar to that found in all herds. A negative correlation existed between BHB and insulin (R=0.387, P<0.001) and BHB and IGF-I levels (R=0.829, P<0.001), and a positive correlation was found between insulin and IGF-I (R=0.370, P<0.001). We could not demonstrate an association between genotype (AluI polymorphism) and plasma levels of BHB, insulin and IGF-I in the beginning of lactation in dairy cows, while the variation between herds was great. P013 PGFM 13,14-diidro 15-keto prostaglandin F2α release in response to oxytocin challenge during early postpartum in Nelore cows Barros, CM2*; Satrapa, RA2; Pinheiro, VG1; Ereno, RL1; Bertan, CM4; Piagentini, M1; Binelli, M3

1Department of Animal Reproduction, FMVZ, University of Sao Paulo State (UNESP), Botucatu - Sao Paulo, Brazil; 2Department of Pharmacology, Institute of Bioscience, UNESP, Botucatu - Sao Paulo, Brazil; 3VRA-FMVZ, University of Sao Paulo (USP), Pirassununga - Sao Paulo, Brazil; 4UNESP, Dracena - Sao Paulo, Brazil The study evaluated, in early postpartum anestrus of Nelore cows, if the increase in plasma estradiol (E2) concentrations in pre-ovulatory period and/or high concentrations of progesterone (P4) preceding ovulation (P4 priming), induced by hormonal treatment, reduces the endogenous release of PGF2α and prevents premature lysis of the CL.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 32 P o s t e r A b s t r a c t s Nelore cows were subjected to calf removal for 48 h and divided into 2 groups: GPE/eCG group (n=10) and GPG/eCG group (n=10). At random stages of the estrous cycle (D-8) animals of the GPE/eCG group were treated with a GnRH agonist (50 μg lecirelin, i.m.). Seven days later (D-1) they received 400 IU eCG, immediately after PGF2α treatment (250 μg d-cloprostenol, i.m.), and on Day 0 (D0), 1.0 mg estradiol benzoate (EB). Cows of the GPG/eCG group were similarly treated as those of the GPE/eCG group, except that EB was replaced with a second dose of GnRH. Ovarian ultrasonography was performed and blood samples were collected on days of hormone administration, to allow retrospective discrimination of cows based on the presence or absence of P4 priming, prior to induced ovulation. All animals were challenged with oxytocin (OT, 50 IU; i.v.) 6, 9, 12, 15 and 18 d after EB (GPE/eCG group) or GnRH (GPG/eCG group) administration and blood samples were collected before and 30 min after OT. Frequency distribution of animals, which underwent luteolysis before D18 was analyzed by the chi-squared test. ANOVA was used to estimate the effect of treatment, P4 priming and interactions for discrete variables. Split-plot ANOVA was used to estimate treatment effect, P4 priming, day of the estrous cycle and interactions for continuous variables. The mean P4 plasma concentration during synchronization was higher (p<0.01) in cows with P4 priming (3.3±0.4 ng/mL) than in cows without it (0.9±0.2 ng/mL). Irrespective of treatments, a decline in P4 concentration on D18 (1.7±0.2 ng/mL) was observed for cows without P4 priming. However, animals exposed to P4 priming, treated with EB maintained high P4 concentrations (8.8±1.2 ng/mL), whereas there was a decline in P4 on D18 (2.1±1.0 ng/mL) for cows that received GnRH (instead of EB) to induce ovulation (p<0.01). Production of PGFM in response to oxytocin increased between Days 6 and 18 (p<0.01), and this increase tended to be more evident in animals not exposed to P4 priming (p<0.06). In conclusion, increase in E2 during the preovulatory period was not effective in inhibiting PGFM release, which was lower in P4-primed than in non-primed animals. Treatment with EB promoted the maintenance of elevated P4 levels 18 days after ovulation in P4-primed animals, indicating a possible beneficial effect of hormone protocols containing EB in animals with P4 priming. P014 Parturition during warm season is correlated with a high incidence of anoestrus in high producing dairy cows in Northeastern Spain Bech-Sàbat, G1*; Garcia-Ispierto, I2; Yániz, JL3; Serrano, B4; Santolaria, P3; López-Gatius, F1

1Department of Animal Production, University of Lleida, Spain; 2Department of Animal Health and Anatomy, Autonomous University of Barcelona, Spain; 3Department of Animal Production, University of Zaragoza, Spain; 4Centro de Investigación y Tecnología Agroalimentaria, Zaragoza, Spain Relationship between increasing milk production and subfertility of dairy cattle has been a hot topic during last decades. Genetics, nutrition and management improvements are adapting the cow to high production. However, the long-term consequence on the basic reproductive physiology of the animal has not been often considered and reproductive disorders persist. Anoestrus is one of the most frequent causes of reproductive failure in modern high yielding dairy herds. Previous reports in our area have shown that worsening of reproductive parameters related to constantly increasing milk production occurs mainly in the warm period. Moreover, cows calving during the warm season are more likely to suffer anoestrus than cows calving during the cold season. The aim of the study was to contrast this issue in high producing dairy cows of last years. We analyzed data derived from a total of 8649 lactations on four high producing dairy herds of Northeastern Spain during last four years (2003-2006). Mean annual milk production of the herds for the study period was 11,232 kg per cow. Mean lactation number was 2,35 lactations and the mean culling rate was 30%. The herds were maintained on a weekly reproductive health program. Anoestrus was registered when a cow did not show oestrus during at least 21 days. Mean monthly percentage of anoestrus on day 60-90 postpartum was 37 % (3225/8649): 27 % (1385/5127) for cows delivering during the cool

season (October to April), and 52 % (1840/3522) for cows delivering during the warm season (May to September). Differences between seasons were significant (by using chi square test, P<0.0001). Despite of improvement in management of high-producing dairy cows, continuous heat stress in the postpartum period remains as a strong factor correlated to a very high incidence of anoestrus at starting the insemination period. P015 Effect of human chorionic gonadotropin on luteal blood flow and plasma progesterone in non lactating cows Beindorff, N; Honnens, A; Penno, Y; Bollwein, H* Clinic for Cattle, University of Veterinary Medicine Hanover, Germany In recent years a number of studies have suggested correlations between cyclic changes in progesterone (P4) synthesis and luteal blood supply. Until now, it is not clear, whether there is a dependency between these two parameters or only a collinearity in cyclic changes of both parameters. In previous studies it has been shown, that human chorionic gonadotropin (hCG) causes an elevation of plasma P4 levels. Therefore, we investigated, if there is a correlation between the increase of P4 and luteal blood flow (LBF) after the application of hCG in cyclic cows. Studies were performed in six non lactating German Holstein cows during two oestrous cycles. In a blinded study the animals received either 3000 IU of hCG or physiological saline solution on Day 7 (Day 1 = ovulation). To prevent the development of an accessory corpus luteum (CL), the dominant follicle was removed by transvaginal ultrasound-guided follicular puncture on Day 6. Transrectal colour Doppler examinations for the determination of LBF were performed just before (0 h) and 1, 3, 6, 12, 24, and 48 h after the injection of hCG or physiological saline. After each examination blood samples from the coccygeal vein were collected for determination of P4 by enzyme immunoassay. The coloured area of sectional planes of the CL depicted by colour Doppler sonography was used as a semi-quantitative parameter for LBF. For comparison of relative changes in LBF and P4, data for both parameters were related to the values at 0 h (= 100%). LBF showed only at 1 h after hCG injection a significant increase by 60% (P < 0.01). After that time point no significant changes (P > 0.05) in LBF compared to 0 h could be observed up to 48 h. No changes (P > 0.05) in LBF occurred after the injection of physiological saline. The injection of hCG resulted in an increase (P = 0.04) of P4 by 36% at 1 h and by 103% at 48 h (P = 0.02). Physiological saline did not cause alterations in P4 values (P > 0.05). These data show that hCG provokes a long-term rise in P4 levels but only a temporary elevation of LBF. The results implicate that an increase in P4 levels depends not necessarily on an increase in LBF. P016 Effect of antioxidant in the cryopreserved bovine semen evaluated by artificial insemination and in vitro fertilization

Borges, JC.2*; Silva, MR.2; Rodrigues, L.3; Vantini, R.2; Esper,CR.2; Franceschini, PH.2 1Financial support FAPESP – Brazil; 2Faculty of Agriculture and Veterinary Medicine, São Paulo State University, Jaboticabal – Brazil; julicborges@yahoo.com.br; 3Centre of Artificial Insemination Lagoa da Serra, Seratãozinho, Brazil Deleterious effects of free radicals cause lipoperoxidation of the plasmatic membrane of female and male gametes and in vitro cultured embryos, being responsible for losses in in vitro production of embryos and reduction in in vivo fertility. The objective of this study was to investigate the protective effects of semen extender containing antioxidant submitted to cryopreservation and evaluated by artificial insemination and in vitro fertilization. Ejaculates from 5 bulls were treated with Tris egg yolk extender (control-CE) alone or supplemented with 200μl Trolox in the extender (antioxidant-AE). The samples with the extenders with a final concentration of 25 x 10 6 spermatozoa/ml were placed into 0.25 ml

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 33 straws. Three hundred Nelore heifers were separated into 5 groups of 60 animals. For artificial insemination, the straws were thawed at 35°C for 20 sec and the females in each group were inseminated with semen of the same bull, using 30 female for each semen extender treatment. For in vitro fertilization, oocytes with homogeneous cytoplasm and compact cumulus, collected from ovaries of slaughtered cows were selected and maturated in groups of 25 in droplets of 100µl TCM 199 medium with FCS, FSH, hCG and estradiol, sodium pyruvate and amicacin, for 24 hours, under mineral oil, in atmosphere of 5% CO2 and 95% humidity in air, at 38.5ºC. After maturation, the oocytes were placed in droplets with TALP containing BSA, PHE and 10µg/ml of heparin with 1x 106 motile spermatozoa/ml. Four straws (two – CE and two – AE) from same bull and ejaculate were thawed and each straw was processed for one spermatozoa separation method for pellet recover: washing medium or Percoll gradient. After 22 - 24 hours, zygotes were stripped from cumulus cells and cultivated in droplets of SOF medium supplemented with 2.5% FCS and 0.5% BSA in 5% CO2 and 95% humidity in air, at 38.5ºC, for 9 days. The results were analyzed by Qui-square Test, in contingency table, with significance level of 5%. The pregnancy rates differed between bulls (P<0.001) and bulls with more abnormal spermatozoa were better with antioxidant in the extender (P<0.06). Blastocysts rates were different (P<0.05) for CE (31.74%) and AE (35.00%). Embryo development was higher (P<0.05) after in vitro fertilization using Percoll gradient (35.35%) compared to washing medium (31.55%). Antioxidant in the semen extender improved spermatic viability and increased blastocyst in vitro development and pregnancy rates. The use of Percoll gradient for sperm separation increased blastocyst production. P017 Early induction of ovulation in postpartum anestrous F1 Holstein x Zebu crossbred dairy cows Borges, AM1*, Alves, BRC2, Ruas, JRM3, Menezes, GCC, Carvalho, BC4, Amaral, TF5, Silva, SGB5, Pugliesi, G6 1Veterinary Clinics and Surgery, Faculty of Veterinary Medicine, Federal University of Minas Gerais, UFMG, Brazil; 2CNPGL EMBRAPA, Brazil; 3EPAMIG-CTZM, Brazil; 4EPAMIG-CTILCT, Brazil; 5Faculty of Veterinary Medicine-UFMG, Brazil; 6Animal Science Department-UFV, Brazil Dairy herds in Brazil are mainly composed by crossbred cows (1.100Kg/lactation). Holstein x Zebu (HZ) crossbred cows are well adapted to tropical environments and demonstrate high productive, reproductive efficiency and high profitability in pastures conditions, and has a great importance for Brazilian and other tropical dairy industries. The aim of this study was to evaluate the efficiency of a hormonal protocol for the induction of estrus and ovulation in early postpartum anestrous F1 HZ crossbred dairy cows. The study was done in the Experimental Research Center of EPAMIG (Minas Gerais Agricultural Research Corporation), Felixlandia-MG-Brazil. Fifty-four crossbred lactating dairy cows (7.0 ± 1.6 years old; 499.15 ± 59.27Kg BW; BCS of 3.76 ± 0.19; 18.0±3.5 Kg milk/day; 3,102.57 Kg/lactation) were submitted to ultrasound evaluation and the cows presented completed uterine involution, no uterine luminal fluid, absence of corpus luteum and dominant follicle diameter more than 9mm. Hormonal protocol were used in the early postpartum period (41.37±12.11 days), during the dry (July, n=32) or rainy (January, n=22) seasons. Anoestrous cows received a CIDR (Day 0) containing 1.9 g of progesterone (Eazi-Breed CIDR, Pfizer, Inc., Brazil) and a 1-mg i.m. injection of EB (Estradiol Benzoate, Estrogin, Farmavet, Brazil). On day 8, the CIDR device was removed and cows received a 1-mg i.m. injection of ECP (Estradiol Cypionate, Pfizer, Inc.). Non-parametric variables were compared by Fisher Exact test and the parametric variables were submitted to ANOVA and compared by t-test. Ovulation rate (93.75% and 81.82%), the maximum diameter of follicle at the day (D0) of intravaginal progesterone-releasing insert (1.26±0.21 and 1.33±0.23cm) and area of corpus luteum at day 6 or 7 after ovulation (3.24±1.15 and 3.37±1.09 cm2) did not differ (p>0.05) between dry and rainy seasons, respectively. Synchronization rate was higher (p<0.05) in cows presenting great (1.32±0.20cm) than small (1.06±0.22cm) dominant follicles at the day of CIDR insert. The

protocol was efficient in inducing estrous and ovulation in early postpartum of anestrous F1 HZ crossbred dairy cows, and the diameter of follicle at beginning of the protocol influenced the synchronization rate. P018 The effect of chloride ammonium, vitamin E and Se supplementation throughout dry period, on the prevention of retained placenta, reproductive performance and milk yield of dairy cows Brozos, C*; Kiossis, E; Georgiadis, M; Kourousekos, G; Boscos, C Faculty of Veterinary Medicine, Aristotle University of Thessaloniki, Greece In the present study we assessed the effect of the use of an anionic salt and supplementary administration of vitamin E and Se throughout the dry period, on the prevention of retained placenta (RP), milk yield and reproductive performance of dairy cows. Data were collected from three commercial farms and 456 dairy cows in total, which experienced similar environmental and managerial conditions. Each animal entering the dry period was assigned into one of two groups (treated group and control group). All animals were fed the same ration but animals of the treated group also received a blend containing 60gr chloride-ammonium, 1,000 iu of vitamin E and 0.05 ppm Se. Calving ease was evaluated and no manual removal of placenta was attempted. All animals experienced a 50-day (p.p.) voluntary waiting period before the first artificial insemination (AI). Treatment resulted in decrease in the percentage of animals with RP (10.6% vs 17.8%). This reduction was statistically significant (P<0.05) in animals, which had not required assistance during delivery, while it was substantial but not statistically significant in animals, which had required assistance during delivery. Occurrence of RP did not affect mean milk production (P>0.05) at either 30 or 60 days p.p. There was an overall shorter time intervals between calving and first AI in the treated group (P=0.08) but there was no difference in time-to-event for the rest of the examined reproductive parameters between treatment groups (P>0.05). The long-term administration of chloride ammonium (throughout dry period, accompanied with vitamin E and Se) has to be further evaluated to ensure safety and contribution to improvement of reproductive parameters. P019 Pregnancy rate in double purpose bovine herd under two protocols of timed insemination in tropical conditions Cárdenas, J*; Cabezas, M; Kowalski, AA. Laboratorio de Embriología y Endocrinología Molecular, Departamento de Producción Animal, Decanato de Agronomía, Universidad Centroccidental Lisandro Alvarado, Lara, Venezuela. Reproductive efficiency in Venezuelan bovine double purpose herds is variable. Open days from calving to pregnancy are longer than 150 days, while intervals between calving are 450 days or higher. Moreover, one of the main problems in reproductive management in tropical conditions is heat detection on insemination programs. The objective of this investigation was to evaluate two protocols for control of ovulation and pregnancy rates in bovine herds in tropical condition (Lara, Venezuela). Two groups of cycling cows (n=341) were subject to each protocol. The first group (n=166) was synchronized using ear implants of norgestomet (3mg; Crestar) on day 0 plus estradiol valerato (5mg) + Norgestomet (3 mg); on day 7 prostaglandin F2α (25 mg), and 500 U.I eCG on day 9 and finally removing the ear implants. After 56 hours of implants removal, cows were artificially inseminated (AI). The second group (n=175) was treated as follow: intravaginal sponge (Pregnaheat) with 250 mg of medroxyprogesterone acetate (MAP) for 7 days plus 50 mg of MAP and 2.5 mg estradiol benzoato (EB) in the first day of treatment; on day 6 50mg of prostaglandin F2α +500 U.I eCG; day 8 sponge removal, and on day 9 1mg EB and AI 56 h after sponge removal. Collected data was analyzed by logistic regression using SAS. Results showed that treatment using ear implants had better conception rates (P< 0,05) when compared to intravaginal sponges (48.48 % vs 37.33 %, respectively) in tropical conditions using double

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 34 P o s t e r A b s t r a c t s purpose cows. An important observation was the presence of vagina infection on the sponge treatment group. In conclusion, the use of progesterone devices can improve overall conception rate in double purpose herd. Therefore, the timed AI protocols can be used as tool for reproductive management in tropical farms. P020 The effect of high levels of proximal cytoplasmic droplets on sperm functional competence. Carreira, J1*; Koivisto, M1; Mingoti, G1; Leite, J1; Perri, S1; Rodrigues, L2

1São Paulo State University, Araçatuba, Brazil; 2Lagoa da Serra Artificial Insemination Centre, Sertãozinho, Brazil Introduction Semen conventional analysis may not adequately represent the diverse number of biological properties that this high-specialized cell can express (Hum. Repr.18:1023-1028,2003). The use of more objective techniques, such as fluorescent probes to assess the integrity of membranes and mitochondrial function of the sperm may provide data on the occurrence of cryoinjuries (Acta Sci.Vet.33:327-327, 2005). Frozen-thawed ejaculates with high levels of proximal cytoplasmic droplets (PCD) produces low fertility rates (J.Repr.Fert.51:109-116, 1997). The goal of this study was to evaluate plasma membrane integrity (PL), acrossome status (ACR) and mitocondrial function (MIT) of bovine semen with high levels of PCD after cryopreservation, comparing to samples with normal parameters. Methods Three batches of five (control group G1: with ≤ 15% of total defects) and eight Bos indicus bulls (G2: ≥15% PCD) were analyzed. The following tests were carried out: post thaw motility (MOT), vigor (VI), concentration (CO) and morphology. The samples were centrifuged (750rpm/ 5 min) twice with 500μL of TALP-Semen. CO was adjusted to 25x106sptz/mL. To an 30μL aliquot, 2μL of PI (0,2mg/mL), 1,6 μL of JC-1 (0,5mg/mL) and 10 μL FITC-PSA (100μg/mL) was added, after incubation at 38.5°C/8 min, 8μL was evaluated by epifluorescent microscopy. Data were analyzed with ANOVA. Results MOT, VI and CO were nor significant in both groups (MOT: 45.42 vs 40.31; VI: 4.47 vs 4.03; CO: 29.18 vs 31.23 x106 sptz/mL for G1 and G2, respectively). The percentage of PCD (G1= 0.51%; G2=24.35%), major defects (4.98% G1; 38.9% G2), and total defects (G1 10.32%; G2 48.38%) were significantly higher in G1 when compared to G2. Minor defects were not different between groups (G1= 5.38%; G2= 9.48%). G1 had significant higher results for ACR (38.48% vs 29.70% G2), PL (38.16% vs 21.39%) and also MIT (41.90% vs 23.22%) for G1 and G2, respectively. Conclusion The results indicate that semen with high levels of PCD may be functionally deficient and more susceptible to cryoinjuries as show the lower levels of acrossome, membrane integrity and mitochondrial potential. P021 Evaluation of slow-release parenteral natural progesterone and its effects in a modified Ovsynch protocol in Holstein dairy heifers Cavestany, D1,2*; Sanchez, A3; Fernandez, D3; Salazar, E3; Leyton, L4 Crespi, D2, Meikle, A5

1National Institute of Agricultural Research (INIA) Uruguay; 2Department of Reproduction, Veterinary Faculty, Uruguay; 3Private veterinarians, Uruguay; 4Faculty of Agronomy, University of El Salvador, San Salvador; 5Laboratory of Nuclear Techniques, Faculty of Veterinary, Uruguay The efficiency of the ovulation synchronisation (Ovsynch/TAI protocol) can be improved by progesterone (P4) supplementation and this increases the ovulation synchrony and pregnancy rate. The most common P4 sources are intra-vaginal devices impregnated by natural P4 and/or oral progestagens. In this experiment a slow-release parenteral natural P4 was tested in the above-mentioned protocol. Three trials were conducted. In trial 1, three multiparous milking Holstein-Friesian (HF) cows (511±28 kg) and 3 HF heifers (372±21 kg) received three prostaglandin (PG) treatments at weekly intervals, after which they received 400 mg of progesterone (4-pregnano-3.20-dione) (Laboratory Rio de Janeiro, Santa Fé, Argentina)

subcutaneously and were bled frequently for 5 days to check plasma P4 levels. Peak P4 levels were achieved 4 hours post treatment (10.2±0.8 & 6.2±0.7 ng/mL, P<0.05) for cows and heifers respectively. P4 plasma concentration decreased progresively, and 5 days later were 1.3±0.5 and 0.7±0.4 (P>0.1) for cows and heifers. In trial 2, one-hundred-eleven heifers (374±4 kg) were allocated into 2 groups (control: Ovsych and treatment: Ovsynch + 400 mg P4 SC at the time of the GnRH treatment). Oestrus detection was done from day 5, and heifers in heat were inseminated. While synchrony of ovulations improved in the treated group, 78% vs. 52% (P<0.05) fertility of fixed time inseminated heifers significantly decreased by the addition of P4 (23% vs. 69%; P<0.01). In trial 3, one-hundred-thirtytwo HF heifers (373±4 kg) were allocated into three groups, all received the Ovsynch protocol with the addition of different concentrations of P4; group P4-0 (0 mg of P4, control), group P4-200 (200 mg of P4), and group P4-300 (300 mg of P4) of parenteral slow-release P4. Oestrus detection was conducted from day 5 and heifers in heat were inseminated. Similarly to trial 2, the supplementation of P4 increased the synchrony of ovulation, as only 55% of the controls were inseminated at fixed time, vs. 73% and 80% (P<0.05) of the heifers of groups P4-200 and P4-300. Pregnancy rate was higher (P<0.05) in group P4-200 (50%) than in the control group (42%) or group P4-300 (31%). We concluded that this slow-release parenteral progesterone might be a good opportunity in oestrus synchronisation or ovulation induction protocols. Using the parenteral P4 would avoid the problems cause the discarding the vaginal devices, but the dose seems to be body weight dependent, that’s why further experiments need to work out an effective protocol. P022 Accessory corpora lutea induced by hCG treatment enhance survival of half-embryos in high-yielding lactating dairy cows Chagas e Silva, J*; Diniz, P; Lopes da Costa, L Reproduction and Obstetrics, CIISA, Faculty of Veterinary Medicine, Avenida da Universidade Técnica, Alto da Ajuda, 1300-477 Lisboa, Portugal This experiment used a in vivo model consisting of a low viability embryo (half-embryo) and a low endogenous progesterone (P4) concentrations recipient (high yielding lactating dairy cow) to evaluate the effect of accessory corpora lutea (aCL) induced by hCG stimulation on embryo growth and survival. At the first oestrous cycle after 60 days postpartum, on Day 7 (Day 0 = estrus), cows (n = 61) with a single mature corpus luteum (CL) received two half embryos (bilateral transfer) originated from bisection of one in vivo produced embryo. After ET, cows were randomly allocated to receive an IM injection containing 1500 IU of hCG (Chorulon, Intervet) (treated group; n = 30) or receive no treatment (control group; n = 31). Presence of aCL and of pregnancy on Days 25, 42 and 63 was evaluated by ultrasound (7.5 MHz rectal linear probe) and maximum embryo length and body diameter were measured on Day 42. Blood samples were collected for measurement of plasma P4 concentrations. Day 42 pregnancy rate of a inseminated fertility control group was 31.7% (19 of 60). Pregnancy rates on Days 25, 42 and 63 were respectively 36, 26 and 26% for the control group and 73, 53 and 50% for the treated group (P< 0,1 on Day 25). The twinning rate at Day 63 was 38 and 27% for the control and treated groups, respectively. Treatment induced aCL in 18 of 30 (60%) cows. Treated cows with aCL had a significantly higher (P < 0.05) pregnancy rate on Days 25 and 42 (100 and 78%, respectively) than control untreated cows (36 and 26%, respectively) and treated cows without aCL (33 and 17%, respectively). Mean maximum length and body diameter of Day 42 embryos were similar in treated (with or without aCL) and untreated cows (overall mean ± SD: 21.5 ± 2.3 mm and 11.4 ± 1.4 mm, respectively). The mean ± SD plasma P4 concentration on Day 7 was 3.5 ± 1.1 ng/ml (range: 1.1-6.0 ng/ml). On Day 14 (7 days after hCG treatment), plasma P4 concentrations of treated cows with aCL were significantly higher (P < 0.0001) than those of untreated cows (mean ± SEM: 8.6 ± 0.5 ng/ml versus 6.1 ± 0.3 ng/ml, respectively) and, showed a tendency (P =

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 35 0.06) for being higher than those of treated recipients without aCL (6.8 ± 0.8 ng/ml, respectively). In conclusion, luteal hCG treatment enhanced the survival of low-viability embryos (half-embryos) in low endogenous P4 concentrations recipients (high-yielding lactating dairy cows). This effect was associated to the increased plasma P4 concentrations in recipients with induced aCL. Acknowledgements – This experiment was funded by the grant CIISA 48 Embrio-ovárica. P023 A successful estrus synchronization method (Doublesynch) for timed artificial insemination in anestrous dairy cows Öztürk, ÖA; Cirit, Ü*; Baran, A; Ak, K Department of Reproduction and Artificial Insemination, Faculty of Veterinary Medicine, Istanbul University, 34320 Avcilar, Istanbul, Turkey Recently, Cirit et al. (2007) have developed a new synchronization method (Doublesynch) by injecting an additional PGF2α two d before the Ovsynch protocol. Doublesynch program increased pregnancy rates 22.2 percentage units (50.0% vs. 72.2%), however, statistical significance (P<0.05) was not obtained because of low number of cows used. Researchers have attributed this pregnancy increasing effect to the significant raise of ovulation rates (88.9% vs. 38.9%; P<0.05) after the first GnRH treatment by Doublesynch method. The aim of the study was to confirm the success of Doublesynch protocol, and to investigate the effect of this method on pregnancy rates in anestrous cows. Lactating holstein cows (n: 165), which were not detected in estrus though having at least 60 d post-partum, were scanned twice with 10-day intervals (on d -10 and 0) by ultrasonography and their blood samples were taken. Cows were classified as anestrous if both samples of progesterone (P) were <1 ng/ml, as “cyclic-high P” if the second samples of P concentrations (P#2) were ≥1 ng/ml and as “cyclic-low P” if P#2 were <1 ng/ml. Then, the cows classified as anestrus (n: 51), cyclic-high P (n: 51) or cyclic-low P (n: 63) were put into 2 treatment groups (Ovsynch or Doublesynch) randomly to form 6 groups. Cows in the Ovsynch group received a GnRH (Lecirelina 50 μg, im) on day 0, PGF2α (D-Cloprostenol 0.150 mg, im) on day 7, and a second dose of GnRH 48 h later. Cows in the Doublesynch group received a PGF2α on day 0, GnRH on day 2, second PGF2α on day 9 and second GnRH on day 11. Timed artificial insemination (TAI) was performed 16-20 h after the 2nd GnRH in both treatment groups. Mean follicle sizes at the 2nd GnRH treatment day and ovulation rates in cyclic-low P, cyclic-high P and anestrous cows were similar in Doublesynch and Ovsynch groups (p>0.05). Comparing with Ovsynch, anestrus (72.0% vs 23.1%, P<0.05), cyclic-low P (76.0% vs 46.2%, p<0.05) and cyclic-high P cows (71.0% vs 21.9%, p<0.05) in Doublesynch group had significantly higher pregnancy rates (p<0.05). In total (cyclic + anestrous cows), Doublesynch method (n: 81) increased pregnancy rates 43 percentage units (29.8% vs. 72.8%, p<0.0001) relating to Ovsynch (n: 84). It was concluded that this new synchronization method (Doublesynch) can be employed after the voluntary period without considering the cyclic stage even anestrus of lactating dairy cows with quiet satisfactory pregnancies after TAI. This study was supported by the Research Fund of Istanbul University. Project No. 182/15012004.

P024 The novel stimulation of growth hormone secretion and liver mRNA for metabolic hormone receptors by estrogen in dairy cows: The possible implication for ovarian influence on liver function Çolak, M1,4*; Shimizu, T1; Matsunaga, N1; Nagashima, S1; Kataoka, M1; Kawashima, C2; Matsui, M3; Miyamoto, A1 1 Graduate School of Animal and Food Hygiene, 2 Field Centre of Animal Science and Agriculture, and 3 Department of Clinical Veterinary Science, Obihiro University of Agriculture and Veterinary Medicine, Japan 4 Bahri Dagdas International Agricultural Research Institute, Turkey, Introduction Reproductive efficiency has a major impact on profitability of livestock production. In recent years, however, the decline in reproductive efficiency has become particularly alarming. After calving, a recovery of ovarian function and subsequent reproductive performance in ovulated cows within 3 weeks postpartum (PP) were superior compared to anovulated cows. The major metabolic hormones such as growth hormone (GH), insulin-like growth factor-I (IGF-I), and insulin were related to steroids in the first ovulation of dairy cows. Conversely, there is no information available so far on the possible regulation of somatic axis by ovarian steroids in dairy cows. The objective of this study was to determine the relationship among sex steroids and the secretion of GH, IGF-I, insulin and their receptors in the liver in dairy cows. Methods To determine the characteristic of GH and insulin pulses in OVX dairy cows, blood samples were collected at 15 min intervals for 16 h via jugular vein catheter after saline injection (control, n=3), 1 mg estradiol benzoate (EB) injection (E2 group, n=3), CIDR implantation for 7 days (P4 group, n=4) or EB injection after CIDR implantation (P4+E2 group, n=4). All hormones were analyzed by EIAs. GH pulses were identified by means of the PULSAR program. Liver samples were collected to analyze the expression of mRNA for GH receptor (GHR), IGF-I receptor (IGFR-I) and insulin (IR) receptor by using real-time PCR method. Results The injection of EB significantly increased number of peak (P<0.05), pulse amplitude (P<0.05) and the area under the curves (AUC) (P<0.01) for the plasma GH. The EB treatment also increased plasma IGF-I level (P<0.05), but had no effect on plasma insulin profile. The P4 group significantly decreased AUC (P<0.01) as compared with control group, whereas it did not affect the number of peak and the amplitude of GH pulses. P4+E2 group did not affect the GH pulse profile. E2 increased the mRNA expression for GHR, IGFR-1 and IR in the liver (P<0.05), but neither P4 nor E2+P4 changed these mRNA expressions. Conclusions The results of this study suggest that the pulsatile pattern of GH, and the expression of GHR, IGF-IR and IR mRNAs in the liver are regulated by sex steroids, particularly by estrogen. Our study can give an implication for a novel interaction between metabolic/somatic axis and reproductive axis in dairy cows, where they may regulate each other by complex feedback system to ensure the reproductive as well as metabolic function. P025 Plasma LH and CL development in cows given different doses or repeated treatments of GnRH Colazo, MG1*; Ree, T2; Emmanuel, DGV1; Ambrose, DJ1 1Alberta Agriculture and Food, Edmonton, AB, Canada; 2Lakeland College, Vermilion, AB, Canada The effects of different doses or repeated treatments of GnRH on plasma LH concentrations and CL development were investigated. In Expt 1, 9 ovariectomized (Ovx) Holstein cows, in 2 replicates, were given a progesterone (P4; 1.9 g) insert (CIDR; Pfizer Animal Health) for 10 d and 2 mg of estradiol cypionate (ECP; Pfizer Animal Health) im at CIDR insertion. Thirty-six hours after CIDR removal, all cows (6 each/group) were assigned to receive, 50, 100 or 250 μg of GnRH (Fertiline; Vetoquinol Canada Inc.). Blood samples (n=18/animal; from 30 min before to 8 h after GnRH treatment) were collected and plasma analyzed for LH concentrations. In Expt 2, ovary-intact beef

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 36 P o s t e r A b s t r a c t s cows were given a CIDR for 10 d and 500 μg cloprostenol (PGF; Estrumate, Schering-Plough Animal Health) at CIDR removal. Estrus detection (Estrus=D0) was done 3x/d for 5 d after CIDR removal. On D7-8, cows received 2 PGF treatments (12 h apart) and randomly assigned to receive 100 μg GnRH at 36 (Control; n=6), 36 and 38 (n=7) or 36 and 40 h (n=7) after first PGF. Ovulation was determined by ultrasonography. Blood samples (n=15/animal) were collected and plasma analyzed for LH as in Expt 1. Blood samples were also collected every second d from ovulation until 14 d after for plasma P4 concentrations. Data were analyzed using Proc MIXED and Kruskal-Wallis test. In Expt 1, mean (± SE) LH (ng/mL) concentration was affected by treatment (P<0.04) and time (P<0.01). Cows given 250 μg GnRH (8.4±1.0) had greater LH than cows given 50 (5.4±0.9) or 100 (4.8±1.0). In Expt 2, one cow from each group was removed from the study (one did not ovulate and two did not respond to PGF). Although LH increased (P<0.01) in all cows after second GnRH treatment, it was greater in cows treated at 38 vs those at 40 h after PGF (P<0.01; Median 41.9 vs 5.8). Mean LH concentration was greater (P<0.01) in cows treated with GnRH at 36 and 38 h after PGF (8.8±0.8) than in those treated with GnRH at 36 and 40 h after PGF (4.8±0.8) or Control cows (5.5±0.8). However, mean P4 (ng/mL) was higher (P<0.01) in Control cows (4.4±0.4) than in those given GnRH at 36 and 38 (2.9±0.3) or 36 and 40 (2.8±0.3) h after PGF. Treatment by time interaction did not affect (P>0.05) P4 concentrations but Control cows tended (P=0.10) to have higher P4 beyond 4 d after ovulation. In summary, Ovx cows treated with 250 μg GnRH had higher pituitary release of LH. Ovary-intact cows given GnRH treatments at 36 and 38 h after PGF had higher mean and peak LH concentrations but subsequent P4 concentrations were lower than in Control cows. P026 Effect of stage of cycle on the bovine uterine proteome Costello, LM1,2; Hynes, AC2; Diskin, MG1 and Morris, DG1* 1Animal Production Research Centre, Mellows Campus, Athenry, Co. Galway, Ireland; 2Department of Physiology, National University of Ireland Galway, Galway, Ireland From the arrival of the bovine embryo into the uterus until implantation, the embryo is free floating in the uterus surrounded by uterine fluid. The embryo is critically dependent on the uterine fluid for its normal growth and development, however, there is limited information on the protein composition of the fluid or how it is affected by stage of cycle. In this study we examined the intrauterine protein changes that occur between metestrus (Day 3) and late dioestrus (Day 15) in the bovine uterus using 2D electrophoresis. Twelve spontaneously cycling, lactating Holstein-Friesian dairy cows at least 50 days post-partum were used. Uterine flushings (UF) were collected non-surgically from the uterine horns, ipsilateral and contralateral to the corpus luteum (CL) on Days 3 and 15 of the oestrous cycle. UF were rehydrated on a 24 cm 3-10 pH non-linear Immobiline DryStrip gel and isoelectric focused for 90kVh. The second dimension separation was carried out on a 12% SDS-PAGE gel (230x190x1.5mm). Separated proteins were detected using silver staining and imaged at 180μm using a CCD system. Image analysis and statistical analysis was carried out using Same Spots software (Nonlinear Dynamics, UK). The differentially expressed proteins were excised from a preparative gel stained with Colloidal Coomassie Blue. The excised proteins underwent LC/MS on LTQ (Thermo-Finnegan) and Sequest database search for identification. Three proteins were found to be upregulated on Day 15 compared to Day 3 and were identified as aldose reductase (P<0.0001), plakoglobin (P<0.0001) and heat shock protein 27 (P<0.01). Aldose reductase is an enzyme directly involved in the production of sorbitol and indirectly of fructose. Plakoglobin is a component of cellular junctions and its up-regulation may have a role in the function of the uterine glandular epithelium. Heat shock protein 27 may respond to potential stresses in the uterus or act as a molecular chaperone. A local effect on uterine Hsp27 was also found, being higher (P<0.01) in the ipsilateral than the contralateral uterine horn. Overall, while a number of proteins were found to be upregulated on Day 15 compared to Day 3, the exact nature of their function or regulation is not readily explained. However, it is likely that progesterone may play a role.

This study indicates that the uterine environment of the cow is dynamic and that its composition is not only affected by stage of cycle but also by local environmental factors. P027 Prevalence of clinical endometritis and its impact on reproductive performance in Holstein cows in Argentina De La Sota, RL1*, Magnasco, M2, Magnasco, RP2 1Servicio De Reproduccion Animal, Facultad De Ciencias Veterinarias, Universidad Nacional De La Plata, Argentina; 2Estudio Magnasco, Canals, Cordoba , Argentina The objective of the study was to assess the prevalence of clinical endometritis (CE) and its impact on reproductive performance in Holstein cows under commercial conditions. A longitudinal study was conducted in one farm in Argentina in which 3014 cows that calved from January 2005 through July 2006 were included. At examination (EX1), cows between 15 and 50 days post partum (dpp) were first inspected for presence of fresh and/or dry discharge on the vulva, perineum, or tail. Then the mucus content of the vagina was evaluated for color, proportion of pus to mucus, and odor. A score was assigned as follows: clear mucus (0, [NOR]), predominantly clear mucus with flecks of pus (1, [CE1]), purulent mucus but not foul-smelling (2, [CE2]), or purulent or red-brown and foul smelling mucus (3, [CE3]). After clinical examination, cows with CE3 received a systemic treatment with 12 g of oxytetracycline im and 0.150 mg of cloprostenol im. Cows with a CE1 and CE2 did not receive further treatment. At the end of the voluntary waiting period (50 d), cows with NOR and CE1 were detected in heat twice a day and AI. Cows with CE2 and CE3 were not bred if detected in heat. All cows were re-examined 25-60 d after EX1 (EX2) following the same criteria for diagnosis and treatment of CE. Cows that in EX1 were diagnosed CE2 or CE3 and in the next monthly visit were diagnosed NOR or CE1, were cleared to be AI at detected heat. Cows diagnosed open at pregnancy diagnosis by transrectal palpation at 35-65 d post AI were treated with 0.150 mg of cloprostenol im and were detected in heat twice a day and AI. After editing the data set, 600 cows were removed from the study because incomplete records and/or incorrect data and only 2414 cows were included in the analysis (n=1070, primiparous; n=1344, multiparous). Primiparous cows has higher prevalence of CE compared to multiparous cows (27 % vs. 16%; P<0.001). At EX1, 79% of all cows were NOR, 11% were CE1, 8% were CE2 and 2% were CE3. At EX2, 66% of CE1, 52% of CE2 and 56% of CE3 were diagnosed NOR. NOR cows had less number of days open compared to CE1-CE3 (116±1 vs. 133±5, 161±7, 159±17 d; P<0.01). Also NOR cows had higher percentage of cows pregnant by 100 dpp compared to CE1-CE3 cows (51% vs. 43%, 27%, 33%; P<0.01). Furthermore, by 200 dpp, NOR cows had less open cows compared to CE1-CE3 cows (10% vs. 16%, 24%, 33%; P<0.01). In conclusion, cows diagnosed with CE between 15 and 30 d postpartum had more days open, fewer chances to be pregnant by 100 dpp and more chances to be open by 200 dpp compared to normal cow. P028 Andromed and Botu-Bov extenders on bovine semen cryopreservation Dell’Aqua Jr., JA1*; Papa, FO1; Crespilho, AM1; Felício, GB1; Zahn, FS1; Medeiros, ASL1; Siqueira Filho, E2, Garcia, LAD2 1Departament of Animal Reproduction – FMVZ, Unesp – Botucatu-SP, Brazil; 2Alta Genetics – Brazil Brazilian beef cattle production is increasing the number of artificial inseminations, due to the efficiency of fixed-time protocols. One of the main factors involved in the obtention of high fertility rates in these programs is the use of high post-thaw viability semen. Among variables associated to semen, the bull and the extender are factors that may lead to fertility rates ranging from 20 to 60%. As ovulations are not synchronized, semen samples with higher viability and longevity suits better to this insemination system, making the extender choice an important step. The aim of the present study was to compare post-thaw parameters of bovine semen frozen with Andromed and

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 37 Botu-Bov extenders. Eighteen ejaculates of bulls from Alta Genetics – Brazil were divided in two fractions and each one was frozen either with Andromed (Minitub) or Botu-Bov (Biotech Botucatu) extenders, according to the manufacturer recommendation. Andromed: initial dilution 1:1 (v:v), 10 minutes at 37oC, dilution again until final concentration, maintenance for 1 hour at 18oC, packing in 0.25mL straws, stabilizing at 5oC for 4 hours and freezing in the machine in a curve of -30oC/minute. Botu-Bov: total dilution at room temperature, packing in 0.25mL straws, stabilizing for 4 hours at 5oC and freezing by the same method. Straws were thawed at 37oC for 30 second in water bath, then maintained in dry block at 37oC for 4 hours. Motility characteristics were evaluated at 10 minutes and 4 hours after thawing by CASA (IVOS 12). Integrity of plasma and acrosomal membranes was evaluated 10 minutes after thawing by epifluorescence with Propidium Iodide, FITC-PSA and JC1. At 10 minutes after thawing, Botu-Bov extender was statistically superior (P<0.001) to Andromed in total motility (86 vs 80%), plasma membrane integrity (57 vs 35%), linearity (80 vs 69%) and straightness (52 vs 40%). There was no difference (P>0.05) between extenders in progressive motility and acrosomal integrity at this moment. At 4 hours after thawing, there were no differences (P>0.05) in total motility (57 vs 64%), progressive motility (25 vs 30%) and linearity (67 vs 75%) between Botu-Bov and Andromed, respectively, except for straightness (42 vs 50%, P<0.01). Botu-Bov extender present higher sperm viability immediately post-thawing, although this difference is not verified after a period of 4 hours. On the other hand, the procedure for semen freezing with Botu-Bov is more practical, which makes it easier to use in farm conditions. Fertility trials are necessary to verify in vivo effects of these extenders. P029 Effect of length of progesterone exposure during the growing phase of the ovulatory follicles on oocyte competence after superstimulatory treatment Dias, F1*, Costa, E1, Adams, GP1, Mapletoft, RJ2, Dochi, O3, Singh, J1 1Veterinary Biomedical Science, University of Saskatchewan, Canada; 2Large Animal Clinical Sciences, University of Saskatchewan, Canada; 3Rakuno Gakuen University, Japan The objective was to determine the effect of the duration of progesterone influence during the growing phase of pre-ovulatory follicles on oocyte competence after superstimulatory treatment. We tested the hypotheses that a short period of progesterone (P4) exposure improves oocyte competence, and that FSH starvation at the end of superstimulatory treatment does not affect oocyte competence. Forty cross-breed beef cows (weight, 515 to 795 kg) were allocated randomly to three groups (short P4, FSH-starvation, and long P4 group). To synchronize wave emergence and standardize the luteal phase among animals, transvaginal ultrasound-guided ablation of follicles ≥ 5mm was done 5 to 8 days after ovulation and CIDR (Pfizer Animal Health) was placed intravaginally. Cows in short-P4 and FSH-starvation groups received eight injections of FSH (Folltropin-V; Bioniche Animal Health) at 12-hour intervals, whereas the long-P4 group received 14 injections of FSH, starting on the day of wave emergence (Day 0). The short-P4 group were given 25 mg of PGF twice, (12 hours apart), on Day 3, whereas both the FSH-starvation and long-P4 groups received PGF on Day 6. The CIDR were removed at the time of second PGF treatment. Cows were given LH (25 mg Lutropin-V, im; Bioniche Animal Health) 24 hours after CIDR removal and inseminated 24 and 36 hours later. Reproductive tracts were collected at the time of slaughter 4 days after insemination. In the FSH-starvation group, 6 out of 13, and in the long-P4 group, 1 out of 13 failed to ovulate and were excluded from further analysis. Fewer ovulations (number of CL at slaughter) were detected in the FSH-starvation group than both the short-P4 and long-P4 groups (mean±SEM: 4.6±2.0, 11.6±2.2, and 16.7±3.0, respectively; P=0.02). The number of ovulations did not differ between short-P4 and long-P4 groups. Ova-embryo recovery rate had a strong tendency to differ among groups (1.7±1.1, 5.9±1.3, and 7.3±1.6; P=0.07). A greater proportion of unfertilized ova were collected from cows in the short-P4 group than in the FSH-starvation

and long-P4 groups (13/82, 0/12, and 5/87 in short-P4, FSH-starvation and long-P4 groups, respectively; P<0.03). In conclusion, the hypothesis that a short period of progesterone exposure improves oocyte competence was not supported. The hypothesis that FSH starvation at the end of superstimulatory treatment does not affect oocyte competence was supported; however, the FSH-starvation treatment used in this experiment led to a loss of ovulatory capability. Research supported by NSERC & ADF. P030 Effects of by-pass fat feeding on the reproductive performance of first-calf Brahman cows under tropical sabana conditions Diaz, T1*, Betancourt, R2, Hernandez, R2, Gallo, J3 1Animal Reproduction Institute, Facultad de Ciencias Veterinarias, UCV, Venezuela; 2Animal Nutrition, Facultad de Ciencias Veterinarias, UCV, Venezuela; 3Animal Nutrition, Universidad de Antioquia, Colombia First-calf beef cows located on tropical areas of the world are under a high degree of stress due to climatic conditions and a poor nutritional status. Bypass fat feeding decreases the negative energetic balance of the postpartum cow and improves the reproductive performance. To test the effect of bypass fat feeding as an alternative to decrease the negative energy balance, 27 first-calf cows, under savannah conditions, were divided into 3 groups, according to the number of days open: group 1 (n=10; G1), cows with a mean of 100+8d open; group 2 (n=9; G2), cows with 165+6d open in average and group 3 (n=8; G3) with 233+5d open. Cows were nursing a calf. Fat feeding started 85d before the onset of the breeding season (BS) under natural mating. Experiment was done during the dry-rainy transition period. Nutritional supplement contained 20% of by-pass fat (17% of linoleic acid) and was made to allow a consumption of 500g/d. Body weight (BW), body condition score (BCS; 1–9), cholesterol (CHOL), triglycerides were measured every month until the beginning of a 4 months BS, then every 2 months until the end of BS. Ultrasound scanning was performed at onset, middle and end of BS, to verify luteal activity (onset) and for pregnancy diagnosis (middle, end). Pasture (Brachiaria humidicola) quality and biomass availability tests were performed. Data were analyzed by ANOVA using SAS procedures. Cows in G1, G2 and G3 had BCS and BW 5+.4; 5.4+.4 and 5.1+.2; 349.3+26.1; 366+42.4 and 343.9+19.8 kg, respectively, at onset of BS. Fifty percent of cows in G1 had a mean area of luteal tissue (LT) of 1.56+.4 cm2, 66.5% of cows in G2 had 1.39+.7 cm2 of LT, whereas 75% in G3 had 1.85+.6 cm2 (P>.001). Pregnancy diagnosis 2 months from the beginning of the BS, showed that cows in G1, G2 and G3 had 30, 78 and 75% of PR (P<.07), respectively. On day 60 of BS 86% of open cows in G1 had an average of 1.7+.3 cm2 of LT; whereas in G2 and G3, 50% and 100% of open cows had 1.54 cm2 and 2.1+.4 cm2 of LT, respectively. Sixty days after onset of the BS, cows had 224 kg/Ha of forage availability, and forage had 5% of crude protein. At the end of the BS, G1, G2 and G3 had 70, 100 and 100% of PR (P>.1). In summary, 89.9% (24/27) of the cows were pregnant at the end on the BS. Mean levels of triglycerides, in all cows, decreased from 263+153.6 on d 0 to 124.7+31.2 mg/dL on d 90; whereas CHOL increased from 48.2+34.7 to 334.7+63.4 mg/dL, on the same days. In conclusion, feeding by-pass fat to first-calf beef cows could be an excellent alternative in tropical areas of the world to increase PR. P031 The use of reduced doses of Dinoprost Trometamita in combination with intravaginal device with progesterone in order to control the oestrous cycle in beef cattle Verellen, M1; Sarramone, C2; Dick, A1* and Callejas, S1 1Faculty of Veterinary Sciences, Tandil, U.N.C.P.B.A., Buenos Aires, Argentina; 2Private activity The objective of this trial was to evaluate the effect of dose of Dinoprost trometamina (Lutalyse®. Pfizer Animal Health), administered at the end of a treatment to control the oestrous cycle

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 38 P o s t e r A b s t r a c t s based on the utilization of an intravaginal device with progesterone (DEV), upon the pregnancy at first service, returns to service and final pregnancy (first service and returns). One hundred and fifty one cows were used, Aberdeen Angus with calves, 42 to 60 days postpartum with a mean body condition (± e.d.) of 3.04 ±0.24 (scale 1a 5). At day 0, a DEV (CIDR, Pfizer Animal Health)) of first use was administered, plus 2 mg of EB (Oestradiol Benzoate, Syntex S.A.). On day 8 the DEV was removed and the animals were randomly distributed to receive either 12.5 mg or 25.0 mg of Dinoprost Trometamina, (Lutalyse®, Pfizer Animal Health). On day 9, 1 mg of EB was applied. Return to service was resynchronized, administering a fourth time DEV (CIDR, Pfizer Animal Health) from day 23 to 31. At this time, the bases of the tail were painted (Ce-Lamark) to determine oestrus according to the degree of paint removal. Observations were made on days 33 and 34 twice in the day (am - pm). The AI was applied by fixed-time (51 - 55 h after DEV removal), using frozen semen in straws from two bulls. At return to service all cows, which at the time of detection showed a degree of paint removal between 0 and 3 (scale 1-5) were inseminated. Pregnancy diagnosis was by rectal palpation at 50 days from the return insemination. Evaluation of the treatment and bull effects and their interactions was carried out using pregnancy at first service percentages, return service and the two combined. Analysis was by the subprogram CATMOD of SAS. Dose reduction of the from 25.0 to 12.5 mg of Dinoprost Trometamina did not affect the pregnancy percentages (P>0.05) at first service (56.0% and 48.6%), return (63.1% and 73.0%) and combined (72.0% and 77.6%). Neither was there a bull effect nor an interaction (P>0.05). It is concluded that this reduction in Dinoprost Trometamina does not affect pregnancy percentages at first service, return or the two combined. P032 Influence of uterine involution and ovarian activity on pregnancy in dual purpose cows under different body conditions at calving and with two feed levels Dominguez, C1*; Ruiz, A2; Martinez, N3;Perez, R1; Drescher, K3; Pinto-Santini, L3; Rossini, M2 1Instituto para el Desarrollo Sostenible de Sistemas Agro-ambientales, Universidad Rómulo Gallegos, Venezuela; 2Facultad de Ciencias Veterinarias, Universidad Central de Venezuela, Venezuela; 3Facultad de Agronomía, Universidad Central de Venezuela, Venezuela. The influence of uterine involution (UI) and ovarian activity (OA) on pregnancy (PR) in dual purpose cows under different body conditions at calving (BCAC) and different feed levels (FL) was studied. Twenty seven cows (Bos taurus x Bos indicus) were randomly at one of the four treatments (T): T1, low BC (<2,5) + low FL (LCLFL, n = 6); T2, low BC (<2,5) + high FL (LCHFL, n = 7); T3, high BC (>2,5) + low FL (HCLFL, n = 7) and; T4, high BC (>2,5) + high FL (HCHFL, n = 7). Basal diet was made of hay from Cynodon nlemfuesis (11% crude protein, CP) plus supplement (23% CP), with a 70:30 ratio. To assess the UI, the following was considered: characteristic of cervical mucus (CCM), horn symmetry (HS), cervix diameter (CD), and uterus position (UP). Weekly, from 15 to 45 days postpartum (DPP), the reproductive tract was evaluated by transrectal palpation, ultrasonography (Aloka, 7.5 MHz), and plasma progesterone (P4) by RIA. The OA was evaluated through the ovarian follicles (OF), which were classified as: F1 (2-5 mm); F2 (6-9 mm) and; F3 (≥10 mm); and the presence corpora lutea (CL). The PR was verified by rectal palpation, ultrasound and P4. The metabolic changes were measured as total cholesterol (TC) and fructosamine (FRTS) at 3, 15, 30, and 45 DPP. The hypothalamic and ovarian expression of leptin receptors (EXPLEP) was determined by Western blot in 8 cows. The statistical analyses used were: Kendall’s test for correlation, multivariate (GLM), multiple regressions (Cox), and ANOVA. Results show a significant association (P<0.05) between T y F3, CD and F2, and F2 and F3, respectively. There was no association between F1 and T or UI. There was high negative correlation (P<0.01) among variables (CCM, CD, PU, HS) with DPP. A significant effect (P<0.05) of T and CD was detected on OA and T on the presence of CL (P<0.05). Cox value for CL depended of (P<0,001) CCM and HS. GLM for

accumulated P4 was significant among T (P<0.01) and BCAC had an effect on P4 (P<0.05) from 30 DPP. TC and FRTS were not different among T, but resulted significant differences among sample times (P<0.01).EXPLEP for hypothalamic receptor was higher for cow with high BCAC, independently from the FL. The PR was different for T (P<0.01). The values for PR after 120 DPP were: T3 (75%) and T4 (60%) vs. T2 (0%) and T1 (20%), respectively. In summary, T, BCAC, CCM and HS exerted a positive effect on OA. EXPLEP of the hypothalamic receptors corroborated the response of BCAC on OA. Consequently, there were more pregnant before 120 DPP in the cows with high BCAC. P033 Development of ovarian structure associated with changes in glucose and insulin levels due to body condition score at calving, and feed level in dual purpose cows during early lactation under Dry Tropical Forest conditions Drescher, K1*; Pinto-Santini, L1; Dominguez, C2; Ruiz, A ; Araneda, R3; Perozo, D1; Martinez, N1

1Facultad de Agronomía – Universidad Central de Venezuela, Venezuela; 2Facultad de Ingeniería, Universidad Rómulo Gallegos, Venezuela; 3Facultad de Ciencias Veterinarias, Venezuela An assay was conducted to evaluate the relationship among the development of ovarian structures, and changes in glucose (G) and insulin (In) levels due to body condition score at calving (BCS) and the feed level (FL) on postpartum (PP) cows. Twenty seven cows (3/4-3/8 Holstein x 1/4-3/8 Brahman) individually allocated were used. Treatments (T) were applied from day (d) 4 to 45 d PP. The T was the result of the combination of two factors at two levels: High BCS (h, > 2.5) and low BCS (w, < 2.5) and high FL (115%) and low FL (85%), according to the nutritional requirements. The experiment was randomly arranged in a 2 X 2 factorial design to assess the principal effects as well as the interactions. Basal diet consisted of hay (Cynodon nlemfuesis with 11 % crude protein, PC) and a supplement (23 % PC), with a 70:30 ratio. Blood samples were collected by jugular venopunction at 3, 15, 30 and 45 d PP. Serum G was measured by the glucose oxidase method (Henry, 1974) and serum In was determined by ELISA. Furthermore, at 22 and 37 d PP, plasma P4 was measured by RIA. Both the ovarian follicles (F) and corpus luteum (CL) were quantified using ultrasound equipment. The F was classified in classes as follows: F1 (2-5 mm); F2 (6-9 mm) and; (F3 ≥10 mm). The viability of CL was evaluated by P4 levels (≥1 ng/ml). The results of the present investigation show that FL did not produce significant effects on any variables. At the same time, no effects were seen on F1 y F2 by any T. BCS influenced (P < 0.05; Kruskal Wallis) F3 through all periods: h (6.6 ± 2.51) vs. w (1.4 ± 0.89) at 45 d and CL h (5.4 ± 1.14) vs. w (2.2 ± 0.84) at 45 d. The survival test (ST) detected BCS effect (P < 0.05) on F3 and CL by Logrank Test and Peto-Wilcoxon Test. More than 50 % of cows with h had F3 at 22 d, while cows with w achieved the same value at 37 d. ST for CL agreed exactly with these results because 50 % of the cows with h had CL at 30 d; 50 % of the cows with w did not have CL even at 45 d. G values were similar (P = 0.12) in all T. Nevertheless, In was different (P < 0.05) by BCS at 3, 15 and 22 d, after which no effect was detected. Additionally, In accumulated values were analyzed and the effect of h was detected at all times (P < 0.01). Probably, the best development of ovarian structures, typical of ovarian resumption (F3 and functional CL) was associated to cows with h due to the effects of In at the ovarian level. These results also suggest that In contributes to gonadotropin release at a central level.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 39 P034 Potency of several GnRH agonists (Buserelin, Dalmarelin, Gonavet and Gonazon) versus natural GnRH (Cystorelin) in an in vitro functional assay. Driancourt, MA1*, Fournier, R2, Ptaszinska, M3, Doornmalen, E4, Blomenrohr, M4 1Reproduction, Intervet Pharma R&D, France; 2Intervet France, France; 3Intervet International Bv, The Netherlands; 4Organon Bv, The Netherlands Natural GnRH and several GnRH analogues are widely used to synchronize oestrus and ovulation, as well as for treatment of reproductive pathologies (cysts) in cattle. However, the relative potency of each agonist relative to natural GnRH is not known. The aim of the present study was to use an in vitro test (measuring receptor activation) to compare the potency of natural GnRH (as Cystorelin) versus several GnRH agonists. The agonists included were Depherelin (D- Phe6-LHRH) (Gonavet, Veyx Pharma), Lecirelin (D-Tle6, ProNHEt9- LHRH) (Dalmarelin, Fatro/Virbac), Buserelin (D-Ser(But)6, Pro9-NEt- LHRH)(Receptal, Intervet) and Azagly-nafarelin (D-Nal(2)6, α-aza-Gly10-LHRH)(Gonazon, Intervet).The in vitro test used a CHO cell line expressing the human GnRH receptor gene together with a beta lactamase reporter gene. In this test, cells form β lactamase upon GnRH stimulation. B-lactamase, in turn, cleaves a fluorogenic membrane permeable substrate (CCF4). Non-responsive cells with low β lactamase appear green, while responsive cells with high β lactamase appear blue. In the present experiment, CHO-GnRH-R-β-lactamase bearing cells were plated for 16-20h before being challenged with GnRH. Cells were then incubated with a range of concentrations of each test compound. Five hours later, fluorogenic substrate (CCF4) was added to the cells and the cells were incubated for 2h . The microplate was read with 405nm excitation and 460 and 530nm emission. The data were plotted as a ratio of the emissions at 460 (blue) and 530nM (green). Two separate experiments were run, each dose response curve being generated by four replicates. The effects of the different concentrations of GnRH or GnRH agonists applied were compared using EC 50 (concentration of GnRH applied generating a half maximum response) for each compound. The sigmoid shapes of the dose-response curves were similar in both experiments. In both assays, the dose-response curves describing receptor activation by the different GnRH could be divided into two sub-groups. On one hand, Buserelin, Azagly-nafarelin and Depherelin displayed similar dose response curves resulting in similar EC50-values (0.7 to 1.6ng/ml). On the other hand, Cystorelin and Lecirelin (which behaved similarly) displayed higher EC50-values (8 to 15ng/ml). In both assays the slopes of the dose-response curves proved similar, irrespective of the compound tested. The use of this cell line therefore proved to be a potent tool to compare potencies of different GnRH agonists. P035 Screening of parturition time models of Holstein breed in a dairy herd in Karaj suburb Ebrahimi, A1*; Gharaghoozloo, F2; Vojgani, M2 1Department of Clinical Science, Faculty of Veterinary Medicine, Islamic Azad University, Garmsar Branch, 2University of Tehran, Iran The influences of breeding group, age of dam, sex, calving problems like dystocia, abortion and some calving abnormalities, like stillbirth on the time of day of parturition were studied. Cross-sectional surveys of 6606 calving records between 1989 and 2005 were analyzed by the least-squares and the chi-squared procedures. The cases were divided based on the time of parturition within 24 hours in four groups of six hours each, as follows: 0-6, 7-12, 13-18, 19-24 hour with their belonging calving numbers of 1762, 1787, 2031 and 1027, respectively. The distribution within these groups were characterized with the following percentages based on the calving process: normal calving: 86.8, 79.4, 78.7 and 84.8, dystocia (grade one): 2.5, 5.3, 6.6 and 2.2, dystocia (grade two): 10.6, 14.7, 14.3 and 12.6, severe dystocia (grade three): 0.2, 0.7, 0.4 and 0.4. The cases were divided in four groups according to the seasonal distribution of parturitions so 24,4% of all parturitions occurred during spring, 26.2% during

summer, 26% during autumn and 23.4% during winter. The seasonal occurrence of stillbirth were 3.9, 4, 3.8 and 5.5%, respectively (P=0.06). The seasonal occurrence of dystocia were16.8, 14.8, 18.7 and 22.4% with P<0.01, and for abortions 12.7, 9.8, 10.5 and 12.8%, respectively, with P =0.008. Parturitions were divided in eight groups based on the number of lactations (1 to 8 lactations) with the following percentages of abortions: 7.2 (first),11.9 (second), 13.5 (third), 15.3 (fourth), 14.7 (fifth), 16.3 (sixth), 13.3(seventh), 8.6 (eighth lactation), respectively (P=0.001). These conclude that the incidence of abnormal parturitions during daytime is significantly higher than during night (P<0.001). Stillbirth frequency during night is slightly but not significantly higher than during daytime (4.7% vs.3.9%). For night parturitions, the mean number of lactations is higher than for those occurred during daytime (P=0.02). No significant differences were found between the time of parturition and fetal sex. Calving frequency during August and September was higher than during February and March. P036 Effects of Dietary Polyunsaturated Fatty Acids on Ovarian Function and Prostaglandin Secretion in Lactating Dairy Cows Fatahnia, F1*, Zamiri, MJ2, and Ghasemzadeh, H3

1Department of Animal Science, University of Ilam, Ilam, Iran; 2Department of Animal Science, University of Shiraz, Shiraz, Iran; 3College of Veterinary Medicine, University of Tehran, Tehran, Iran In this experiment the effects of dietary polyunsaturated fatty acids on plasma metabolites, ovarian function and prostaglandin secretion of Holstein cows in early lactation was studied. Twenty primiparous Holstein cows, averaging 47 ± 11 DIM and 30.7 ± 4.8 kg/d milk yield, were randomly allotted to four groups, synchronized (Heat-synch method) and were fed with their respective diets for 35 days; allowing 14 days dietay adaptation, and 21 days for data collection. The experimental diets consisted of: 1) control diet; 2) a diet with 3% (DM basis) fish oil; 3) a diet with 3% soybean oil; and 4) a diet with 1.5% fish oil and 1.5% soybean oil. Blood samples for measurment of plasma metabolites and reproductive hormones were taken via coccygeal vein on d 6, 10, 12, and 14 of synchronizes estrous cycle. On d 15 of synchronized estrous cycle, cows were injected intravenously with oxytocin (100 U) to stimulate the release of PGF2α from uterine tissues (oxytocin challenge). Blood samples were taken at -60, -45, -30, -15, 0, 15, 30, 45, 60, 75, 90, 105, 120, 135, 150, 165, 180, 195, 210, 225 and 240 min relative to the time of the oxytocin injection. Ovaries of each cow were examined by transrectal ultrasonography using a Concept\MCV ultrasound scanner equipped with a linear array 7.5 MHz probe (Tokyo Keiki Co. Ltd., Tokyo, Japan) on d 6, 10, 12, 14, 16, 18 and 20 of estrous cycle. Concentration of plasma glucose, triglycerides and LDL-cholesterol were not affected by the treatments, but plasma total cholesterol and HDL-cholesterol concentrations were higher for cows that consumed the oil-containing diets (p < 0.05). The number of follicles, corpus luteum size and plasma estradiol, progesterone and PGFM concentrations were similar across treatments, but the size of the largest follicle was greater for cows that consumed 1.5 % fish oil and 1.5 % soybean oil containing diet (p < 0.05). Therfore, the polyunsaturated fatty acids can influence both ovarian and uterine function in cows. However, further studies using larger number of cows are required to test their effects. Keywords: Polyunsaturated fatty acids, ovarian function, prostaglandin, lactating cow.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 40 P o s t e r A b s t r a c t s P037 Treatment of Uterine Infections in Non Cycling Cows with Cloprostenol Fernandes, C1-2*; Figueiredo, A 1-2; Alves, B2; Oliveira, E2; Viana, J4, Gioso, M

1; Oba, E4

1Faculty of Veterinary Medicine, University of Alfenas, Brazil; 2Biotran LTDA, Brazil; 3Embrapa-Gado de Leite, Brazil; 4FMVZ-Unesp – Botucatu, Brazil Recent findings on the mechanisms of uterine defense show the eicosanoids as the main substances that modulate this activity. This observation open an excellent chance for the treatment of uterine infections, once the PGF2α and its analogous have activity on the production of these substances in the uterus. Moreover, they would provoke reduction in the progesterone (P4). P4 produces substances that inhibit the uterine defense mechanisms and partially block the production of eicosanoids. The application of PGF analogous was capable of stimulating the PGF2 and other related substances production in the uterus, as Leucotriene B4, which activate some leucocitary functions, associated to the neutrophile, the most important cell in the uterus defense mechanism. The aims of this study were to evaluate and compare the efficiency of protocols of Cloprostenol administration for the treatment of clinical endometritis in dairy cows (Holstein) without luteal ovarian activity. Cows of six herds were used, all presenting clinical endometritis, associated with a involuted uterus (30-118 days post-partum) and absence of corpus luteum. The diagnosis and classification of the endometritis was based on abnormal uterine discharge on vaginoscopic examination. In accordance with the infection degree (mucopurulent or purulent) the animals had been randomized in four groups, and received IM treatments: T1 (n=22): 2ml of saline solution; T2 (n=41): only one dose of 0.530mg of Cloprostenol (2ml Ciosin™ Schering Plough-Brazil); T3 (n=43): 2 doses of 0.530mg of Cloprostenol 24 hours apart and T4 (n=40): 2 doses 0.530mg of Cloprostenol with interval of 48 hours. The cows were evaluated by vaginoscopy 20 to 30 days later. The efficiency between the treatments was compared by the χ2 test. There was no herd effect in treatment results. The efficiency was 18.18a; 39.02b, 71.42c and 47.50%b for groups T1, T2, T3 and T4, respectively. The treatment with better efficiency was T3, (P<0.05). In relation to the Control group T1 (not treated), T2 and T4 were also efficient (P<0.05). The PGF can act in reducing the immunosuppressant effect of the P4, in this case in cycling cows, and also in a direct way, in this case of animals without corpora lutea, as in the present study, stimulating directly the uterine immunity. These results demonstrate that the PGF analogous can be used in the treatment of the clinical endometritis and mainly in dairy cattle, for the absence of antibiotics residues, it is an excellent alternative. Two doses of Cloprostenol with 24 hours of interval are the best protocol. P038 Effect of estradiol benzoate one day after follicular aspiration on follicular dynamics in high producing dairy cows Ferreira, RM1,2*, Ayres, H1,2, Araujo, RR2; Hackbart, KS2, Wiltbank, MC2 1Department of Animal Reproduction, University of Sao Paulo, Sao Paulo, Brazil; 2Department of Dairy Science, University of Wisconsin, Madison, USA Follicular aspiration and in vitro embryo production are routine reproductive biotechnologies. However, development of once-per-week follicular aspiration programs that conveniently align with once-per-week reproductive management programs are not routinely utilized because of reduced numbers of oocytes collected and embryos produced in once- vs. twice-weekly programs. We hypothesized that treatment with estradiol benzoate (EB) one day after follicular aspiration would delay emergence of the subsequent follicular wave and thus alter follicular dynamics to be more compatible with a once-per-week follicular aspiration program. High producing dairy cattle (n = 10), on a random day of the estrous cycle (D0) had ovarian ultrasound performed and all follicles ≥ 4 mm were aspirated. All cows received a P4-releasing intravaginal device (CIDR) that was kept in place for 7 days. On D1 the animals were randomly assigned to 1 of 2 groups: Control cows (n = 5) received no EB, while treated

cows (n = 5) received 3mg of EB i.m. on D1. Ovarian ultrasound was performed every 24 hours and the position of all follicles >4 mm were mapped on both ovaries. On Day 7, the CIDR was removed, ovaries were mapped and number of follicles ≥4 mm was determined. Growth rate of the largest follicle from D1 to D4, D4 to D7, and D1 to D7, day of follicular wave emergence (day previous to largest follicle reaching >5 mm), and number of follicles ≥4 mm on D7 were analyzed by logistic regression using Glimmix procedure. Daily size of follicles was analyzed by MIXED procedure. Surprisingly, treatment with EB did not delay emergence of the follicular wave (1.40±0.24 vs. 1.40±0.24 days, P=1.00) or alter largest follicle size at any day post-treatment. In addition, there was no difference between control and EB-treated cows in growth rate of the largest follicle from D1 to D7 (1.50±0.05 vs. 1.21±0.16 mm/d; P=0.34) or D4 to D7 (1.20±0.17 vs. 1.40±0.16 mm/d; P=0.53); but, EB decreased growth of the largest follicle from D1 to D4 (1.25±0.15 vs. 0.83±0.13 mm/d; P=0.03). Unexpectedly, EB treatment increased number of follicles ≥4mm on Days 5, 6, or 7 (D7; Control=7.2±0.8 vs. EB=21.2±5.3 follicles; P=0.03). Thus, a dose of EB that normally delays follicular wave emergence by ~4d was not effective in delaying emergence or growth of the dominant follicle after follicular aspiration perhaps due to absence of follicular products such as inhibin. However, EB treatment following follicular aspiration produced a dramatic increase in the numbers of small follicles even in the presence of a dominant follicle. P039 Ovarian Cysts Treatment with Fertirelin Associated or not to Cloprostenol Fernandes, C1-2; Figueiredo, A 1-2*; Alves, B2; Oliveira, E2; Viana, J4, Gioso, M1; Oba, E4

1Faculty of Veterinary Medicine, University of Alfenas, Brazil; 2Biotran LTDA, Brazil; 3Embrapa-Gado de Leite, Brazil; 4FMVZ-Unesp – Botucatu, Brazil The ovarian cysts was a of high occurrence pathology and for causes significant alterations in the reproductive performance of the animals. Its treatment must be effective, in the direction to minimize the reproductive losses. The result of the successful treatment would be the regression of the cystic structure and formation of a luteal mass (corpus luteum) and the fast return to the cyclical luteal ovarian activity and manifestation of regular estrous cycles. Braun et al. (2000) shows considerable occurrence of cystic structures with partially luteinized wall in dairy cows, and cite the possibility of beneficial effect in the application of prostaglandins associated to the analogous ones of the GnRH for treatment. The objective of this study was to evaluate and to compare the efficiency of the Fertirelin Acetate in association or not with the Cloprostenol for treatment of ovarian cysts in dairy cows. 133 holstein cows between 30 and 90 days post- partum had been used in four Farms. The cyst diagnosis was made by ultrasonography (Esaote-Falco), considering as cyst a anecoic structure above of 20mm beyond the absence of luteal mass in the two ovaries. The animals had been randomized into two groups that had received the following treatments, by IM way in only dose: G1 (n=51): 0,1mg of Fertirelin Acetate (Fertigen™ Schering Plough-Brazil); G2 (n=49): 0,1mg of Fertirelin Acetate + 0,530mg of Cloprostenol (Ciosin™ Schering Plough-Brazil) at the same time, and G3 (n=35): Control Group (non treated). All the animals again had been evaluated of 12 the 18 days later. The treatment was considered efficient where in the second ultrasonography evaluation it was detected the absence of the cystic structure and presence of luteal mass. The efficiency of the treatments was evaluated by the χ2 test. The results of the two treatments had been 54.91; 81.63 and 17.14%, for the groups G1; G2 and G3, respectively (P<0,05). There was no herd effect in treatment results. The association of the Cloprostenol to Fertirelin Acetate if showed beneficial in the treatment. According to Fernandes et al. (2004) some considerable number of ovarian cysts in dairy milk cows had varied amounts of luteal in the edge. Braun et al. (2000) showed that the destruction of the luteal border in the cysts, when existing, he can assist in the elimination of this structure. Probably one parcels out of the used animals presented cysts with luteinized wall, where the joint action of a luteolitic with the

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 41 analogous one of the GnRH, was beneficial for resolution of this pathology. P040 Bull and sire effect for the pregnancy rate and embryonic loss in dairy cow Gabor, G1*, Balogh, OG1, Abonyi-Toth, Zs2, Toth, F1 and Sasser, RG3,4 1Department of Cattle Breeding Research Institute for Animal Breeding, H-2053 Herceghalom, Hungary, 2SzIE-AOTK, H-1074 Budapest, Hungary, 3Department of Animal and Veterinary Science, University of Idaho and 4BioTracking LLC, 105 E. 2nd, Moscow, ID, USA Introduction The main limiting factors of reproductive performance in dairies are pregnancy rate (PR) (influenced by embryonic loss (EL)) and number of services per conception (NSC). Between 1st January and 31st October 2007 our laboratory checked early pregnancies of approximately 11200 AI’s. That required collecting data from cows of 13 dairies. PR and NSC seemed to be affected by the AI sire is why data were collected on the AI sires on the farm too. We also recorded ovarian treatments of cows before AI, pregnancy rates and embryonic losses in cows. Our main goal was to check sire and bull effect for PR and EL. Based on the above mentioned data statistical analyses were carried out to find out interactions between PR and EL with other factors (farm, ovarian treatment, age, number of AI). Materials and methods Blood samples were collected once a week, 30-36 days post insemination (PI), and sent to the laboratory by overnight mail. Data about the cow and AI were sent via email. BioPRYN® ELISA test (BioTracking, Moscow, ID, US) was run for detection of early pregnancy. All open cows and pregnant cows which had low optical density values (close to the cutoff) during the BioPryn test were assayed for serum P4 concentration. P4 was checked by an ELISA test (QuantiCheck, Veterinorg, Budapest). Re-check of pregnancy status was done 60-90 days PI by rectal palpation. Differences between the early and 60-90 days pregnancy detection were called late loss. Pearson's Chi-squared test and logistic regression was used to find the association among the data. Data from AI bulls (AIB) and the bull’s sires (BS) which had more than 100 AI’s, and fathers of cows (FC) whose daughters had more than 100 AI’s were used for statistical analysis. Results and discussion Significant correlation (P<0.001) was found between AIB and pregnancy rate (PR), BS and PR, and between FC, farm and age and PR. Ovarian treatments (especially single prostaglandin and Provsynch treatments) influenced the PR significantly (P<0.001). Embryonic loss does not seem to be relates to FC, BS and ovarian treatments but was correlated with AIB and/or farm (P<0.001). Based on these findings, the bull and sire effects seem to be high for PR; and AIB had a significant effect on embryonic loss too. P041 Association between metritis and glycogen concentration in neutrophils of lactating Holstein cows Galvão, KN1*; Brittin, SB1; Caixeta, L1; Sper, R1; Fraga, M1; Ricci, A2; Gilbert, RO1; 1Department of Clinical Sciences, Cornell University, Ithaca, NY, 14853-6401, USA; 2Facultà di Medicina Veterinaria, Università di Torino, Torino, Italia Neutrophils (PMN) depend on anaerobic glycolysis for the energy required for chemotaxis, phagocytosis, and microbial killing; therefore, periods of negative energy balance may deplete glucose stores and affect PMN function. The objective was to measure glycogen stored in PMN and to evaluate its association with clinical metritis in dairy cows. Holstein cows (82), had 60 mL of blood collected weekly for PMN isolation from calving until 21 d in milk (DIM). Ten million PMN were isolated and assayed for glycogen quantification. In summary, glycogen was hydrolyzed to glucose using amyloglucosidase and available glucose was determined by reacting 50 μL of supernatant with a 1 mL mixture of 1 mM ATP, 0.9 mM NADP, 5 μg G6DP, 0.3 M triethanolamine, 4 mM MgSO4, and recording the appearance of NADPH after the addition of 5 μL of

hexokinase (2 mg/ml) as ∆OD at 340 nm on a spectrophotometer. This ∆OD was compared to a standard curve of oyster glycogen assayed in similar fashion and results were expressed as μg glycogen/106 PMN. Metritis was characterized by fetid vaginal discharge and rectal temperature ≥ 39.5 oC in the first 14 DIM. Body condition score (BCS) and blood glucose concentration were also evaluated at sampling. Association between metritis, glycogen, and glucose concentration was evaluated using the MIXED procedure of SAS for repeated measures; the model also included the effects of BCS, DIM at sampling and interaction between metritis and DIM at sampling. Interaction was not significant. Glucose was not associated with PMN glycogen concentration; however, DIM at sampling, metritis, and BCS were. The PMN glycogen concentration was 29.8, 23.5, 21.4, and 23.5 μg glycogen/106 PMN at 0, 7, 14, and 21 DIM, and was greater (P = 0.02) at 0 than at 14 DIM. Cows that had metritis (21.9 vs 27.2; P = 0.04) and cows with BCS ≤ 2.5 (22.1 vs 27.0; P = 0.03) had lower PMN glycogen concentration. Metritis was not associated with glucose concentration; however, DIM at sampling, and parity were. Glucose was 72.2, 63.1, 65.1, and 64.1 mg/dL at 0, 7, 14, and 21 DIM and was greater (P < 0.001) at 0 than other days. Multiparous cows had lower glucose concentration (62.5 vs 69.9; P < 0.001). Multiparous cows also had lower mean BCS. We conclude from this study that metritis is associated with a decrease in PMN glycogen concentration, PMN glycogen and glucose although not showing a direct association, follow similar pattern after calving, and multiparous cows and cows with BCS ≤ 2.5 may be at greater risk of disease due to reduced oxidative fuels. P042 Assessment of luteal activity in three different selection lines for milk yield in the Norwegian Red breed Garmo, RT1*; Ropstad, E1; Waldmann, A2; Reksen, O1

1Department of Production Animal Clinical Sciences, Norwegian School of Veterinary Science, Oslo, Norway; 2Institute of Veterinary Medicine and Animal Sciences, Estonian University of Life Sciences, Tartu, Estonia The objective of the study was to reveal differences in commencement of luteal activity (CLA) between three selection lines of Norwegian Red cows with; a) high genetic merit for milk yield (HMP), b) low genetic merit for milk yield (LMP), and c) the combination of high genetic merit for milk yield and high genetic merit for non-return rate after 1st AI (HGM). Milk samples for progesterone analysis, defined as the first two subsequent measurements of progesterone concentration > 3ng/ml later than 10 d after calving, were drawn three times weekly in 181 lactations periods from 1994 throughout 1998. The distribution of lactations by selection lines was 29, 41, and 111 for LMP, HMP and HGM, respectively. The average number of days from calving to CLA was 24.2 d (SD ± 14.9), 40.8 d (SD ± 28.4), and 32.4 d (SD ± 22.5) for LMP, HMP and HGM, respectively. The difference between the selection lines in days to CLA was significant (P = 0.01). There was no significant difference between selection lines in average energy balance (EB) the first four weeks post partum (P = 0.44), but there was a significant difference between selection lines in average daily milk yield the first four weeks post partum (P = 0.02). Average daily milk yield was 20.5 kg (SD ± 4.4), 23.2 kg (SD ± 5.7), and 23.5 kg (SD ± 5.3) for LMP, HMP, and HGM, respectively. Following predictors were significantly associated with the natural logarithm of CLA in a multivariable regression model; parity (P < 0.01), selection line (P = 0.03), and EB (P < 0.01). Compared to LMP-cows, the HMP- and HGM-cows had 1.47 d and 1.20 d longer interval to CLA, respectively, after adjustment for parity and EB in the regression model. In conclusion, cows selected exclusively for high milk yield, had a longer interval from calving to CLA than cows selected for low milk yield or high genetic merit for milk yield and non- return rate. The decreased difference in CLA between HMP, HGM, and LMP after adjustment for EB in the statistical model indicated that EB explained the majority of the difference between the selection lines. The remaining difference in CLA between LMP-cows and HMP-cows may be explained by differences in endocrinological function, mobilisation of body reserves or other factors that have been unfavourably influenced by selection for high milk yield. The study also showed that an

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 42 P o s t e r A b s t r a c t s increase in days to CLA by selection for high yields can be reduced by including selection for non-return rate without reduction in milk yield, as evidenced by equal production levels in HMP- and HGM-cows. P043 Benchmarking in Reproductive Control Programs of tropical dual purpose crossbred herds González-Stagnaro, C Zootecnia, Universidad Del Zulia, Facultad De Agronomía, Instituto De Investigaciones Agronómicas, Venezuela Medicine of Production, TQM and HACCP has proved that reengineering livestock process, offer a new way to organize farm works, applying updated technologies to improve production and profit. In addition, has demonstrated that farmers are different, open for research, but reluctant to make changes and adopt new technologies; they only will take decisions, when the successfully farmer shows their technical changes and economical benefits. Benchmarking methodology adopted management practices from more profitable farms, supported by the records evaluation, computerized information and statistical process. This ¨strategic emulation¨ of success practices by the less efficient farms, will increase productive, reproductive and economic performance. The first objective of this benchmarking work was the study of the frequency of application of 33 technologies and biotechonogies in 32 dual purpose crossbred herds Bos taurus x Bos indicus: 16 improved (IM) and 16 traditional (TM) managed system, located in Zulia state, Venezuela (10ºNL, 32-36ºC, 1100mm). Differences between systems were analyzed by “t” test. There were differences (P<0.01) between the 33 technological criteria analyzed (65 vs 30% for IM and TM). Differences (P<0.01) were evident in heifers (61.4 vs 21.1%), heat and breeding (75.0 vs 34.3%), management (73.3 vs 31.3%), reproductive control (64.4 vs 21.2%) and reproductive efficiency (64.6 vs 31.3%). In a second objective, fertility was studied in 12 herds (5,629 cows IM and 7,070 cows TM); the eight fertility parameters analyzed showed a wide range of variation between herds and systems. Means global and first service fertility were 54.8 and 52.5% for IM and TM (P<0.05); probability of pregnancy was superior in IM than in TM (56.2 vs 52.9%; P<0.05), as well as, services per conception (1.89 vs 1.78; P<0.01) and frequency services ≥ 3 (23.5 vs 18.7%; P<0.01). Pregnant cows at 100d postpartum was higher in TM than in IM (66.8 vs 60.6%; P<0.01), in contrast to 150d open postpartum cows (21.2 vs 16.5%; P<0.01). Culling rate was higher in IM than TM (13.6 vs 10.7%; P<0.01). Benchmarks and the critical time for technical intervention were established in IM and TM. These results relate the main reproductive problems in farms with the lack of application of successful techniques and technologies. P044 Evaluation of the serum level of vitamin A and beta-carotene in repeat breeder cows in Ahwaz (center of Khouzestan province- Iran) Gooraninejad, S1*, Razijalali, M2 1Clinical Science(Gynecology & Obstetrics), Faculty of Veterinary Medicine, Shahid Chamran University, Islamic Republic of Iran; 2Clinical Science, Shahid Chamran University, Islamic Republic of Iran The repeat breeder cow has normal or nearly normal estrous cycles and estrous periods and has been bred 2, 3 or more times to a fertile fall or with fertile semen but failsto conceive. Repeat breeder is a complication of post ovulatory period in cattle and is associated with different factors such as deficiency of vitamin A and beta-carotene in serum. Therefore, this study was conducted to evaluate the serum level of vitamin A and beta-carotene in repeat breeder cows in Ahwaz (center of Khouzestan province ) during warm (40-50 ºC) and cold (0-12 ºC) seasons. Blood samples were collected from jugular vein of 41 (19 primiparous and 22 multiparous) repeat breeder cows and controls (40 primiparous and 40 multiparous cows). After collection, blood samples were kept at room temperature for 3 hours, and then

centrifuged for serum separation. Serum was harvested and stored at -20ºC until vitamin A and beta-carotene were measured by direct multicomponent spectrometric assay. The difference between affected and control groups were statistically analyzed with case-control matching intact by a 2-tailed paired t-test. Results showed that mean (±SEM) value of vitamin Aof affected (32.84±0.79 mg/dl) and control (32.27±0.78 mg/dl) groups were in normal range (>20 mg/dl) and the group difference was neither significant (P>0.05) between warm and cold seasons nor in terms of parity (P>0.05). Similar results were observed in the serum concentration of beta-carotene. The mean value of beta-carotene in repeat breeder cows was similar (P>0.05) to the control cows (127.83± 1.76 vs 118.49± 0.79 mg/dl, respectively). Like with vitamin A concentration, no seasonal or parity differences were found (P>0.05) in serum beta-carotene concentrationsof affected and control cows. In conclusion, the serum concentrations of vitamin A and beta-carotene in repeat breeder cows were not different from normal cows in this study. P045 Differential expression of Integrin subunit mRNA transcripts during bovine preimplantation embryo development Goossens, K1*, Van Soom, A2, Van Zeveren, A1, Peelman, LJ1 1Department of Nutrition, Genetics and Ethology, Faculty of Veterinary Medicine, Ghent University, Heidestraat 19, B-9820 Merelbeke, Belgium; 2Department of Reproduction, Obstetrics and Herd Health, Faculty of Veterinary Medicine, Ghent University, Salisburylaan 133, B-9820 Merelbeke, Belgium Extracellular matrix proteins (ECM) play important roles in processes involved in embryo development such as oocyte-sperm interaction, cell growth, cell migration and differentiation, implantation and placenta formation. Fibronectin (FN1) is an ECM molecule with differential RNA and protein expression during preimplantation embryo development, displaying low expression levels during the first stages of embryo developmental and a significant rise in expression from the morula towards the blastocyst stage (Goossens et al., 2007). A previous study (results not published) demonstrated the existence of an embryo specific splice variant of the bovine FN1 gene, in which the EIIIB region is absent whereas the EIIIA region and the full-length IIICS region are present. A consequence of the presence of the full-length IIICS region is the inclusion of an extra RGD-region (Arg-Gly-Asp) which is the recognition site for binding with fibronectin receptors such as integrins. Those integrins are transmembrane αβ heterodimers with an extracellular domain for ligand binding and a cytoplasmic tail for signal transduction and interactions with the cytoskeleton. So far 18 different α and 8 different β subunits have been described. The aim of this study was an mRNA expression analysis during preimplantation embryo development (oocyte, 2-cell, 8-cell, morula, blastocyst and hatched blastocyst) of integrins in order to find the possible receptor(s) for the embryo specific FN1 splice variant. Primers were designed for 8 different α subunits and 5 different β subunits, known from literature to be candidate receptors for FN1. Transcription profiles were determined on 4 single embryo replicates per developmental stage. The RT-PCR analyses revealed that the RNA expression pattern of ITGA5 was similar to the FN1 expression pattern in the way that it was absent in the early embryonic stages but highly expressed from the morula stage onwards. The RNA expression from both ITGA3 and ITGAV diminished toward the 8-cell stage, followed by an increase at the morula and blastocyst stages. ITGA4, ITGA9 and ITGA9 were only expressed in oocytes, 2-cell and 8-cell embryos but were absent in morulae and blastocysts, excluding them as candidate receptors for FN1. Among the β subunits, ITGB1 was continuously expressed during preimplantation embryo development confirming that it can be the binding partner for most α subunits. ITGB3, a possible association partner for ITGAV followed the ITGAV expression pattern. On the other hand, ITGB2 and ITGB6 were not expressed in bovine embryos

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 43 and both ITGAD and ITGB7 were only expressed at the hatched blastocyst stage. This study demonstrates the variability in integrin expression during preimplantation embryo development and pushes ITGα3β1, ITGα5β1 and ITGαVβ3 forward as candidate receptors for the embryo specific FN1 splice variant. Further research is necessary to reveal the subcellular distribution and organization of the integrin proteins as well as downstream adhesion and signal transduction pathways. P046 Reproductive management strategies to improve pregnancy rate following Ovsynch/TAI protocol in dairy cows and heifers Gordon, M1*, Dinn, N2

1Animal Science, University of British Columbia, Canada; 2Ubc Dairy Education & Research Centre, Canada Physiological and environmental stresses of high milk production and intensive management systems have affected the onset of postpartum ovarian activity, expression of estrus, embryonic development, and pregnancy in lactating dairy cows. Though prostaglandin (PGF2α) is still the most widely used drug for the induction and synchronization of estrus, the Ovsynch/TAI protocol, which strategically uses GnRH and PGF2α to synchronize ovulation offers potential freedom to dairy farmers from the time consuming chore of estrus detection. The ovulation rate and pregnancy rate (PR) with Ovsynch/TAI protocol in postpartum cows are around 80% and 30 to 40%, respectively and lower in heifers. However, pre-synchronization before Ovsynch/TAI protocol or the use of GnRH five to seven days after breeding has the potential to improve PR and this was tested in the current study. Multiparous and primiparous lactating cows (n=225) and nulliparous heifers (n = 87) were used. Animals were randomly assigned to one of three treatments for timed first service breeding (TAI) at about 75 days in milk (DIM) for cows and 15 months of age for heifers: A) Control - Ovsynch protocol (GnRH injection given 7 d before and another 48 h after one PGF2α injection); B) Presynch + Ovsynch (two injections of PGF2α 14 d apart followed by Ovsynch 14 d later); C) Ovsynch + post-AI GnRH (a GnRH injection given 6 d after TAI following Ovsynch). A total of 10 blood samples (from heifers) or milk samples (from cows) were taken from each animal (on days -38, -31, -24, -10, -3, 0 (TAI), 7, 14, 21, 28) for progesterone (P4) analysis. Pregnancy rate for heifers were 65%, 59%, and 59% and for lactating cows were 44%, 48%, and 46% for treatments A, B, and C, respectively, revealing no treatment effect on PR (p>0.05). However, there was an interaction of DIM and BCS at TAI with PR (p=0.008 and p=0.20, respectively). The trend for cows in less BCS and less DIM to have lower PR was seen most in the Ovsynch group. Moreover, pregnant animals in group B and C had higher P4 levels on day 21 and day 28 than did pregnant animals from control group (p=0.15), which could be indicative of better functioning CL’s and thus enhancing PR. These results show that the Ovsynch protocol can be used to achieve acceptable PR rates in heifers using a synchronized TAI protocol. Although differences in pregnancy were not significant among treatments, PR and P4 results from this study show that presynchronization and post insemination GnRH tend to benefit cows which are in more negative energy balance. P047 The effect of early or late breeding on milk production in lactating dairy cows Gumen, A1*, Keskin, A1, Yılmazbas, G1, Celik, Y2, Burucu, Y2 1University of Uludag, Faculty of Veterinary Medicine, Department of Obstetrics and Gynecology, Bursa, Turkey; 2Tarfaş A. Ş., Karacabey, Bursa, Turkey Milk production and reproduction are two important factors with respect to profitability of dairy farms and much attention has been given to fertility parameters and their association with milk production. Previous studies was reported that pregnancy adversely affect milk production. Delaying of first breeding in high producing dairy cows may increase overall milk yield. The objective of this

study was to compare effect of early or late breeding on milk production in lactating dairy cows. Dairy cows (n=52) were divided into two groups. In group 1 (early bred), cows (n=22) were inseminated between 45 to 75 postpartum and group 2 (n=30; late bred) were inseminated between 76 to 130 postpartum. All cows were in second lactation. Cows were fed twice daily with a high-energy lactating dairy cow ration fed as a TMR following NRC recommendations. Estrus detection was recorded with pedometer and visual observation. Milk yield was recorded every 5 days after calving first 45 days then every 15 days until 270 days. Breeding of cows were initiated after voluntary waiting period (45 days in milk) with artificial insemination. Cows were inseminated only once and became pregnant following their first postpartum estrus included in this study. Average days in milk in early and late bred cows at the time of artificial insemination were 65.2 and 102.6 days, respectively. Average milk yield first 270 days was 37.8 and 39.0 kg for early and late bred cows. Milk yield was not different between early and late bred cows from calving to 270 days after calving. There was no relationship between first 3 months milk yield and postpartum days of insemination. Also, there was no relationship between overall milk yied (calving to 270 days) and postpartum days of insemination. Thus, milk yield was not affected by early or late breeding of cows but further trials are needed to evaluate the repeatability of this response. P048 Effect of ketoprofen administration 15 and 16 days after AI on conception rates in lactating Holstein cows Guzeloglu, A1*, Erdem, H2, Cinar, M3, Kilic, K4, Talmac, M4, Gorgundur, A4, Gumen, A5 1Obstetrics And Gyneacology, Selcuk University Faculty of Veterinary Medicine, Turkey; 2Selcuk University Faculty of Veterinary Medicine, Turkey; 3Nigde University, Bor Vocational School, Turkey; 4Kocas Tigem Agricultural Station Aksaray, Turkey; 5Uludag University Faculty of Veterinary Medicine, Turkey It has been reported that timely administration of a non-steroid anti-inflammatory drug (NSAID), flunixin meglumine, around the time of luteolysis (day 15 and day 16) increased pregnancy rates in heifers (Guzeloglu et al., 2007) and lactating cows (Pfeifer et al., 2007). The objective of this study was to determine if two injections of ketoprofen would demonstrate the same effect as flunixin meglumine. Ketoprofen has no milk residue in contrast to flunixin meglumine. Two experiments were done in lactating Holstein dairy cows (milk yield average 25 kg/day, 3 to 10 years old, average DIM 125 days). In experiment 1, 86 cows were inseminated at detected heat and randomly assigned to receive treatment (n=45; ketoprofen, i.m., 3 mg/kg BW on day 15 and 16 after insemination; 24 hours apart) or control (n=41). In experiment 2, 84 cows were inseminated at fixed time (TAI) following ovsynch program and randomly assigned to treatment (n=43) and control (n=41) groups as described for experiment 1. Pregnancy diagnosis was performed by ultrasonography 30 days after TAI. Conception rates did not differ between treatment and control groups (In experiment 1, 47% (21/45) for treatment and 49% (20/41) control; in experiment 2, 30% (13/43) for treatment and 27% (11/41) control). In both experiments, no significant effects of sire, days in milk, milk yield and parity were detected. In conclusion, ketoprofen did not have beneficial effect on conception rates in lactating cows as flunixin meglumine. Moreover, data suggests that ketoprofen can be used in early pregnancy for treatment of possible inflammatory conditions without having detrimental effects on pregnancy. P049 Relationship between uterine involution and pregnancy rate in dairy cows Hajurka, J Equine clinic, University of Vterinary Medicine, Slovakia The objectives of this study were to assess uterine involution and pregnancy rate in dairy cows under field condition. Animals were

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 44 P o s t e r A b s t r a c t s divided into four groups according to the puerperium (normal or abnormal) and parity (primiparous or pluriparous). Uterine involution was monitored by gynaecological examination (vaginal and rectal) at 2-3 day intervals (three times per week). Criteria for involution were: (i) stable uterine size (ultrasound using a rectal probe; (ii) normal uterine tone and consistency (palpation per rectum); and (iii) absence of pathological cervical discharge (vaginal inspection). In both first-calf heifers and pluriparous cows uterine involution was longer after puerperal complications (retained placenta and/or uterine inflammation) compared to animals with a normal puerperium (primiparous: 23.0+/-5.3 days; n = 26 vs. 37.3 +/-7.4 days; and pluriparous: 27.3 +/-5.3; n = 122 vs.37.3 +/-8.2 days; n = 102; p 0.0001).All animals were inseminated at the first suitable heat observed beyond 40 days after calving. An abnormal puerperium delayed the time to first insemination in primiparous cows by average of 2 days an by 12.2 days in pluriparous cows (p 0.0001). First service pregnancy rates after a normal purperium were 61.5% in primiparous and 41.8% in pluriparous cows (p 0.05).Placental retencion and/or uterine inflammation decreased first service conception rates more in cows than in heifers (53.9% in primiparous vs. 37.3% in pluriparous; p 0.05). In conclusion, pregnancz rates would be improved if care taken to avoid complications in the puerperium, espacially in pluriparous cows. (Supported by Ministry of Education of the Slovak Republic, project AV 4/0009/07) P050 Uterine blood flow during the first three weeks of pregnancy in Holstein Friesian cows Honnens, A1*; Voss, C1,2; Herzog, K1; Beindorff, N1; Rath, D2; Bollwein, H1

1Clinic for Cattle, University of Veterinary Medicine, Hanover, Germany; 2Institute for Animal Breeding (FAL), Dept. Biotechnology, Mariensee, Germany Embryonic mortality during the first three weeks is one of the main reasons for the low fertility rate in high yielding dairy cows. Therefore, a number of studies have been carried out on the embryo-maternal communication during this time period. Investigations of blood flow in the uterine arteries during early pregnancy indicated that uterine blood flow ipsilateral to the embryo increases already in the third week of pregnancy; but due to the use of invasive methods they were carried out only in three cows. Since the introduction of transrectal colour Doppler sonography genital blood flow can be examined in clinical studies on a relatively high number of cows. The objective of this study was to compare changes in uterine blood flow between cyclic and early pregnant lactating dairy cows. Colour Doppler examinations were carried out in 50 multiparous lactating German Holstein cows on Days 3, 6, 9, 11, 13, 15, 18 and 21 (Day 0=oestrus). Fourteen cows were examined during the oestrous cycle and 36 cows after insemination with cryopreserved sperm. After each Doppler examination blood samples were collected for determination of total estrogens (E) and progesterone (P4) in plasma. Uterine blood flow was reflected by the time-averaged maximum velocity (TAMV) in the uterine artery ipsilateral to the corpus luteum. As eighteen cows, that were not pregnant on Day 25, were excluded from further analyses, data are from 14 cyclic and 18 pregnant cows. In cyclic cows TAMV values stayed at a constant level (P>0.05) between Days 3 and 13. Between Days 13 and 18 TAMV increased (P<0.05) from 26 to 33 cm/s. During early pregnancy TAMV values showed a distinct rise (P<0.05) between Days 9 and 11 from 25 to 30 cm/s, followed by a slow decrease (P<0.05) to minimal values (24 cm/s) until Day 18. By Day 21 TAMV increased (P<0.05) to a value that did not differ (P>0.05) from that on Day 11. Changes in blood flow were slightly related to the ratio of E and P4 in cyclic cows (r=0.24; P<0.05), but not in pregnant cows (P>0.05). The results of this study show that in dairy cows changes in uterine blood supply can be observed already during the first three weeks of pregnancy. There is an initial short-term rise in uterine blood supply on Day 11, which surprisingly is followed by a decline until Day 18. The reasons for these phenomenons are unclear. As no relationship could be observed with peripheral sexual steroid hormone levels, the alterations in uterine perfusion seem to be caused by local embryo-maternal interactions.

P051 Effect of lumpy skin disease virus in bull semen on in vitro embryo production Irons, PC1*, Luther, I1, Ebersohn, K2, Bosman, AM2, Annandale, CH1, Van Wilpe, E3, Colenbrander, B4, Venter, EH2

1Production Animal Studies, University of Pretoria, South Africa; 2Veterinary Tropical Diseases, Faculty of Veterinary Science, Univ. of Pretoria, South Africa; 3Anatomy and Physiology, Faculty of Veterinary Science, University of Preto, South Africa; 4Farm Animal Health, Faculty of Veterinary Medicine, Utrecht University, South Africa This study investigated the risks associated with the use of semen infected with lumpy skin disease virus (LSDV) in in vitro fertilisation. Six straws of frozen-thawed semen from uninfected bulls were spiked with LSDV and two straws from experimentally infected bulls shedding LSDV in their semen were used. The thawed semen from each straw was subjected to swim-up and then tested for virus by PCR and virus isolation. The samples from infected bulls were negative, but the spiked samples all tested positive by PCR but not virus isolation after swim-up. Virions could be demonstrated by transmission electron microscopy, of which 9% were attached to sperm cells, some lying below the plasma membrane. Semen was spiked with virulent LSDV after swim-up processing and used for the fertilisation of oocytes from abattoir ovaries. Control and treated groups consisted of 497 and 488 oocytes respectively. LSDV was detected by PCR at all steps of the embryo production system in the treated group, and in three control batches of 100 presumptive zygotes each at day two and five following fertilisation, but not day seven or ten. These batches were therefore included in the ‘treated’ group at day 5 for the purposes of calculating cleavage rates. Virus was isolated from two batches of day ten embryos. Of the 187 control and 798 treated oocytes at day 5, 100 (53.5%) and 415 (52.0%) underwent cleavage (p=0.75). Of the 497 control and 488 treated presumptive zygotes, 146 (29.4%) and 173 (35.5%) developed to embryos by day 7 respectively (p<0.05). Of 146 and 173 embryos in the control and treated groups, 26 (17.8%) and 12 (6.9%) had hatched by day ten (p<0.01). We conclude that lumpy skin disease virus can still be detected by PCR but not isolated following swim-up processing of spiked semen. Many virions adhere to or even enter the sperm cell following co-incubation. If oocytes are fertilised using semen infected after swim-up, viable virus does persist and infected embryos are produced. Low viral titers may imply a low risk of infection of susceptible embryo recipients. Embryo development is only negatively affected by the presence of virus once hatched from the zona pellucida. P052 Reproductive performance after target breeding program using twice administration of prostaglandin F2 alpha modified with hCG or estradiol Ishii, M1*, Noguchi, A3, Kaneko, E2, Kataoka, M2, Kawashima, C3, Sudo, N2, Matsui, M4, Miyamoto, A2 1Research Center For Animal Hygiene And Foof Safety, Obihiro University of Agriculture And Veterinary Medicine, Japan; 2Graduate School of Animal And Food Hygiene, Obihiro University of Agri And Vet Med, Japan; 3Field Centre of Animal Science And Agriculture, Obihiro University of Agri And Vet Med, Japan; 4Department of Clinical Veterinary Science, Obihiro University of Agri And Vet Med, Japan Introduction In order to improve the reproductive performance after calving, a target breeding program using synchronization of estrus may offer some advantage in shortening the calving to conception interval. To achieve the synchronization of estrus, prostagalandin F2 alpha (PG) was used to be injected in two separate doses, two weeks apart. Aim of present study was to examine the efficiency of the modification of a target breeding program (twice injection of PG) with hCG or estradiol (estradiol benzoate: EB) on the reproductive performance in dairy cow. Methods Total of 214 Holstein cows which had average milk product with 9000kg/305 days, calved from June 2004 to May 2005 at one commercial farm in Kushiro, Japan were used. In order to inseminate

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 45 by 60 days after calving, cows were received PG 25mg at six weeks and eight weeks after calving. Artificial insemination (AI) was performed only to the cow showing sings of estrus. Cows were divided in to five groups as follows; group A: twice PG + hCG 1500IU at AI, group B: twice PG + hCG 1500IU at 5 days after AI, group C: twice PG + EB 1mg at 2 days after second PG, group D: only twice PG, control: no treatment. Blood samples were collected weekly after calving and plasma progesterone (P4) level were measured by EIA. Conception and pregnancy rate at 70 and 100 days after calving and days open were recorded. Results There was no difference in insemination rate and days open among groups. At 70 days after calving, group B, C and D showed higher (p<0.05) conception rate (B: 46.7%, C: 43.3%, D: 48.5%) and pregnancy rate (B: 29.2%, C: 31.2%, D: 30.8%) than control (15.0 and 8.3%, respectively). Conception rate in group A (41.2%) at 100 days after calving was lower than group B (64.3%) had lower conception rate. There were no differences in conception and pregnancy rate between all four treated groups (A, B, C and D) and control at 100 days after calving. To evaluate luteal function after AI, P4 level at 10th week postpartum (an average of 11 days after AI) was examined. P4 in conception cows had higher than non-inseminated cows (5.4 vs 3.5 ng/ml, respectively). Conclusions The results showed that a target breeding program using twice injection of PG improves reproductive performance of dairy cow after calving. Modification of the program with hCG or EB has no additive effects on conception and pregnancy rate. These results suggest that a hormonal treatment for the synchronization of estrus before breeding period may have beneficial effects on reproductive function of postpartum dairy cows. P053 Possible treatment strategies of acute postpartum endometritis in Estonian dairy cows Jeremejeva, J1*; Orro, T2; Kask, K1

1Dept. of Therapy, 2 Dept. of Animal Health and Environment, Institute of Veterinary Medicine and Animal Sciences, Estonian University of Life Sciences Introduction Acute postpartum endometritis (APE) is a health problem what lead to prolonged calving intervals, reduced conception rates and increases culling. The aim of the study was to test the effect and success of different treatment models in case of APM. Complex post-treatment clinical investigations, uterine microbiology, acute phase proteins (APP) and conception rate results were done. Materials and methods Study was carried out in commercial dairy farm. Multiparous cows (n = 21) were divided into 3 groups, 7 in each. Parturitions were induced in all cows, 2 w before term using PGF2α (Dinolytic®, BI) for getting retained foetal membranes followed by APM. Treatment was started when APE was diagnosed (3rd d PP). Group A served as control group with no treatment. Group B was treated according to strategy commonly used at the farm where experiment was done: i.m. inj. of Carbetocin (Hypophysin® LA) during 3 d and i.u. administration of antibiotics (Metricure®) on the 15th and 30th d PP). In group C i.m. inj. of antibiotics (Ceftifour, Exenell®) during 5 days was done followed by 2 inj. of PGF2α (Dinolytic®, BI) with an interval of 12 h on the 8th d PP. For APP analyses blood samples were collected 2x a w. Evaluation of general health status, body Tº and vaginal discharge (existence and character of secretion) was done daily. Uterine biopsies for bacteriological examination were collected once a week during 7 w PP. Animals who had not shown oestrous during 70 days PP were allocated to heat synchronisation and success of synchronisation was evaluated. Ovarian activity was monitored through the analysis of progesterone (P4) from milk samples taken 2x a week. Results and discussion Differences in body Tº between groups were statistically significant. No statistical difference was found in vaginal discharge between groups. Highest incidence of bacteriological species was found during the first 3 w PP in all groups. Intensity of bacterial growth in uterine biopsies obtained from control group was higher during 2 w PP. The most frequently isolated bacterial species were A. pyogenes, F. spp., Bacteroides spp., and Enterobacter spp. Levels of APP after parturition were high in all groups and decline to

the baseline was seen after 3rd w PP. According to P4 results resumption of ovarian activity was detected in all animals during 70 d PP. Cows who were allocated to heat synchronisation were confirmed to be pregnant after 45 d. Results from this study indicate that there is no difference in impact of treatment or no treatment of APE. P054 Fatty Acid Profiles and Oocyte Maturation from Endophyte-Infected Tall Fescue Fed Heifers Jones, KL Animal Science, Food and Nutrition, Southern Illinois University Carbondale, United States Cattle consuming endophyte-infected (EI) Tall Fescue have reduced reproductive performance. The endophyte produces dopaminergic endotoxins that increase body temperature, vasoconstriction, and respiration rate and reduce body weight, and progesterone. Physiological actions of fatty acids (FA) particularly arachidonic acid (AA) metabolites also alter these responses. The objectives of this study were to evaluate fescue endotoxins’ effects on blood plasma and follicular fluid fatty acids (FA) as well as maturation of oocytes. Thirty heifers were fed fescue diets containing endophyte-free (EF), EI or EI seed plus domperidone (EID), a dopamine antagonist, as previously reported1. After 30 d treatment, plasma samples were collected and frozen. Follicular fluid and oocytes were aspirated from ovaries harvested from 9 luteal phase heifers (3/trt). Oocytes were isolated and cultured in TCM 199 with 10% fetal calf serum, 5 mg/ml LH, 5 mg/ml FSH for 22 hrs at 38.5OC in 5% CO2 in air. Oocytes were stained and evaluated for completion of meiosis I at 200x magnification. Follicular fluid samples from large (10 mm) and small (<3mm) follicles were frozen at -80OC. Plasma and follicular fluid samples were analyzed for fatty acid methyl esters using gas chromatography. Plasma and follicular fluid FA data were analyzed by ANOVA followed by LSD (SPSS v 11.5; Chicago, IL). No differences were detected in total amount of plasma or follicular fluid FAs, suggesting total FA content was similar in the EF and EI diets. Plasma comparisons revealed differences (P<0.05) between EF and EI treatments in the unsaturated FAs AA, C20:3n6, C22:4n6, C22:5n3, and C22:6n3. The EF diet produced lower means of these unsaturated FAs, tended (P=0.08) to lower cumulative polyunsaturated FAs, and tended (P=0.07) to lower the n-6:n-3 ratio than the EI diet. No differences were detected in follicular fluid FA profiles from small follicles. EI FA means from large follicles were higher (P<0.05) for C18:3n6 and C22:6n3, and tended (P=0.06) to be higher in AA than EF. More oocytes were collected from EF (n=39) and EID (n=40) ovaries than from EI (n=18). No grade 1 oocytes from EI completed MI (0/3). Grade 1 oocytes from EF (2/3) and EID (8/9) completed MI. These results suggest that fescue endotoxins alter plasma and follicular fluid FAs and reduce oocyte viability. 1. Jones KL, SS King, KE Griswold, D Cazac, DL Cross. 2003. Domperidone can ameliorate deleterious reproductive effects and reduced weight gains associated with fescue toxicosis in heifers. J Anim Sci. 81: 2568-74. P055 Association of abnormal ovarian activity with earlier rise in postpartum serum progesterone level in lactating dairy cows Kafi, M*; Mirzaei, A Dept. of Clinical Studies, School of Veterinary Medicine, Shiraz University, Shiraz, 71345, Iran A reduction in pregnancy rates and longer calving to conception intervals have been reported in association with ovulation in the early postpartum period in lactating dairy cows. This was attributed to the occurrence of prolonged luteal activity in cows with early ovulation post calving (Smith and Wallace, 1998. Reprod. Fertil. Dev., 10: 207-16; Opsomer et al., 2000. Theriogenology 53: 841-57). The aim of the present study was to investigate the effect first postpartum progesterone rise (P4≥1 ng/ml) on subsequent ovarian activity and fertility in postpartum (free of clinical puerperal diseases) dairy cows.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 46 P o s t e r A b s t r a c t s The study was carried out on 44 multiparous lactating Holestein cows (FCM = 7759.1 kg) in a commercial dairy herd. Scanning of the ovaries was performed by transrectal ultrasound (5 MHz, Ami, Canada) and blood samples for P4 analysis were collected twice weekly commencing from day 7 to day 66 after calving. Serum P4 concentration was measured by a commercial validated radioimmunoassay kit (Immunotech kit, France). Cows with normal or abnormal postpartum ovarian activities were defined based on the characteristics of their serum P4 profiles (Shrestha et al., 2004. Theriogenology 61:637-49). Of 44 cows studied, 22 (50 %) had normal ovarian activity (ovulation occurring ≤45 days after calving, followed by regular ovarian cycles); while, 17 (38.6 %) and 5 (11.4 %) had delayed first ovulation (DOV) and prolonged luteal phase (PLP), respectively. Data were statistically analysed using Anova. Logistic regression analysis indicated a significant interaction between P4 concentration on day 24 after calving and peak milk yield (kg/day, 75-d postpartum). With the limited number of PLP observed cows in the present study, statistical analyses showed that the likelihood of the occurrence of PLP increased by 1.1 for each 1 kg increase in peak milk yield of cows with P4 concentration ≥ 1 ng/ml on day 24 after calving (P=0.01, 95% CI=1.01-1.15). First postpartum P4 rise was observed significantly earlier in cows with PLP compared to that of the cows with normal ovarian activity (23.2 ± 4.0 vs 32.2 ± 8.38; P<0.05). Moreover, cows with PLP had a significantly greater mean (±SD) milk yield during 75 days postpartum (44.3 ± 5.7) than the cows with DOV (36.8 ± 5.7) and the cows with normal ovarian activity (36.6 ± 6.8). These findings suggest that early ovulation and hence early postpartum progesterone rise in addition to the high milk production could partly be responsible for the occurrence of prolonged luteal phase in dairy cows. P056 Estrus control regimes in large-scale dairy herds with impaired reproductive performance Kátai, L1*, Kulcsár, M1, Földi, J1,2, Driancourt, MA2, Huszenicza, G1 1Faculty of Veterinary Science, Szent István University, Budapest, Hungary; 2Intervet Pharma, Angers, France Increased milk production and connected changes in metabolism have been associated with declining fertility in dairy cows. The aim of this study was to monitor the ovarian response to three versions of treatment protocols in two herds with poor reproductive performance. Cows were treated as follows: (a) GnRH + 7 d: PGF2α + 2 d GnRH (GPG; n=62); (b) the same, but the 2nd GnRH was replaced by hCG (GPH; n=62); (c) two PGF2α 14 d apart (PP; n=57). Treatments were designed to produce estrus (E1) on d 55-70, when cows were inseminated (AI1). Resumption of cyclicity and post-treatment ovarian function was monitored by assaying progesterone (P4) in regularly collected milk samples. 57 of cows remained acyclic in the before-treatment period. Simultaneously with the (2nd) PGF2α most of the cyclic cows had elevated P4 levels indicating luteal activity, which was followed by luteolysis (although 16 cases of incomplete luteolysis were also observed). Most of the cows ovulated at the expected time, and thereafter P4 started to increase: CL was present not later than 8 d after the (2nd) PGF2α, and remained in function at least for 10 d (regular responders; n=99): 27 of them re-conceived at that time. 9 of the regular responders were inseminated when P4 started to increase (late AI). In some further cases the P4 profile indicated delayed ovulation/luteinization (n=31), development of sCL (n=14), or post-treatment acyclia (n=21): none of them re-conceived at AI1. More GPG than GPH and PP cows were inseminated (44=71% vs. 36=58% and 29=51%; P<0.05). The rate of regular responders and of those re-conceived within 150 days after calving was higher, and the incidence of post-treatment ovarian malfunctions (especially that of acyclia) was lower in GPG than in PP cows, whereas animals in the GPH group had an intermediate position. Regardless of treatments received the post-ovulatory rise of P4 was similar in regular responders. Only low number of cows re-conceived at the AI1 (11=18%, 9=15% and 7=12%; ns), and until d 150 after calving (26=42%, 20=32% and 16=28% of GPG, GPH and PP cows, respectively; P<0.05). 10, 10 and 62% of acyclic cows remained still

anovulatory in the GPG, GPH and PP groups. These data demonstrate the superiority of GPG to GPH and PP protocols. However, it can be concluded that (i) a lot of cows show irregular ovarian response to these treatments, (ii) neither the GPG nor the GPH are really suitable to enhance the postovulatory P4 rise, and (iii) in herds with impaired fertility the reproductive performance is only slightly improved by these treatments. P057 Plasma β-carotene levels during the peripartum period in ovular and anovular dairy cows at the first follicular wave postpartum Kawashima, C1*; Nagashima, S2; Kajimura, A1; Matsui, M3; Schweigert, FJ4; Sawada, K5; Miyamoto, A2; Kida, K1 1Field Centre of Animal Science and Agriculture, 2Graduate School of Animal and Food Hygiene and 3Department of Clinical Veterinary Science, Obihiro University of Agriculture and Veterinary Medicine, Japan; 4Department of Physiology and Pathophysiology, Institute of Nutritional Science, University of Potsdam, Potsdam-Rehbrüke, Germany; 5DSM Nutrition Japan K.K., Japan Introduction The plasma β-carotene levels decrease during the dry period, and reach nadir in about week (wk) 1 postpartum (pp) in dairy cows. This coincides with negative energy balance, which affects the occurence of the first ovulation. Thus, we assumed that plasma β-carotene levels during the peripartum period may affect the ovulation in the first follicular wave pp in dairy cows. The aim of our study was to investigate changes in profiles of plasma β-carotene levels during the peripartum period in ovular and anovular cows at the first follicular wave pp. Methods 28 multiparous Holstein cows were used for monitoring plasma β-carotene levels during the peripartum period. Twenty-two cows were fed a TMR consisting of grass, corn silage and concentrate during the peripartum period in winter, and another 6 cows were grazed during far-off period in summer followed by the feed management at close-up similar to that in winter. Blood samples for β-carotene and progesterone analyses were collected from onset of far-off in summer or close-up in winter to wk 3 pp. The first ovulation was confirmed using profile of progesterone levels and ultrasound. Results Number of ovular cows during the first follicular wave pp was 13 in winter and 3 in summer. Parity, the dry-off period, calving interval, mastitis episodes during the last lactation, and somatic cell count in the last month during the last lactation did not differ between two groups. In winter, β-carotene levels at wk 3 prepartum were higher in ovular cows than in anovular cows (P<0.001, 3.0 vs. 1.5 mg/l) and reached the lowest levels at wk 1 pp, whereas lower β-carotene levels at wk 3 prepartum in anovular cows remained unchanged during the peripartum period. In summer, β-carotene levels during the grazing period were higher compared with winter season and similar between two groups (ovular, 7.6; anovular, 7.5 mg/l). During the close-up period after the grazing during the far-off period, β-carotene levels decreased in both groups, although attainment of nadir β-carotene levels in anovular cows was observed at wk 2 prepartum which was 1 wk earlier than that in ovular cows. In both season, β-carotene levels during the pp period were similar in ovular and anovular cows. Conclusions The present study indicates that the lower plasma β-carotene levels during the prepartum period may be one of the factors which induces the anovulation during the first follicular wave pp, and the supply of β-carotene during the prepartum period may increase the occurrence of ovulation during the first follicular wave pp in dairy cows.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 47 P058 The effect of periparturient propylene glycol administration on metabolism and on reproductive performance in Holstein-Friesian cows Kerestes, M1*; Faigl, V1; Győrffy, A1; Márton , A2; Langer, D1, Kulcsár, M1; Gaál, T1; Fébel, H3; Húsvéth, F2; Gabor, G3; Bartha, T1; Szenci, O1; Huszenicza, G1

1Faculty of Veterinary Science, Szent István University, Hungary; 2Pannon University, Faculty of Agricultural Sciences, Keszthely, Hungary; 3Institute of Animal Husbandry and Nutrition, Herceghalom, Hungary Negative energy balance in the early lactation is often accompanied by decreased insulin secretion of the pancreatic β-cells and insulin resistance of the peripheral tissues. In dairy practice the propylene-glycol (1,2-propanediol, PGL) is often used for prevention of ketosis and fatty liver. We examined the effect of periparturient PGL supplementation on metabolic profile, liver lipid content, and on reproductive performance in Holstein Friesian (HF) cows. The glucose-induced insulin-response of the β-cells and the insulin-sensitivity of peripheral tissues were also investigated. Fifty-one multiparous HF cows (previous lactation milk yield: 8042±214 kg) in a large scale dairy herd were involved in the study. The supplemented group (n=20) received PGL powder corresponding to daily 5.05 MJ NE, from d14 before the expected calving date till d10 after calving, poured on the monodiet. The control group (n=30) did not received PGL. Blood samples were taken regularly for ßOH-butyrate (BHB), non esterified fatty acids (NEFA), glucose, insulin, insulin like growth hormone-I (IGF-I), thyroxine (T4) and 3,3',5, triiodtironine (T3). On d7-10 after parturition in a subsequent of 16 cows (Control=10; PGL=6) liver biopsy was taken to determine the hepatic total lipid content. After biopsy a simultaneous intravenous glucose and insulin challenge test was performed. During the glucose tolerance test we examined the glucose induced insulin-response area under the curve (AUC), the glucose-clearance rate, half time of glucose (T1/2), and maximum insulin-response time. From the insulin-tolerance test we measured the glucose response to the insulin. Resumption of cyclicity was monitored by milk progesterone profiles from samples collected 3 times per week. After pre-synchronisation of the ovarian activity with two PGF2a injections at 12 days interval, a GPG protocol and fixed time AI was performed. The PGL supplementation increased the insulin concentrations and decreased the BHB levels in the last days of pregnancy. The treatment had no effect on blood glucose, thyroid hormone and IGF-I levels. The parameters measured during the glucose- and insulin-tolerance test were not changed. In cows with subclinical form ketosis the glucose-induced insulin-response and the glucose T1/2 were notably lower. PGL administration had no effect on the time of the first pp ovulation (34.1±18vs. 34±16d) and on pregnancy rate (38% vs. 32%) of the animals. The periparturient PGL supplementation somewhat affected the metabolic status of the cows, but its effects remained below our expectations. P059 Corpus luteum function and morphology in relation to nutrition in dairy cows Knijn, HM1*, Uijttewaal, MJ1, Dieleman, SJ1, van den Hurk, R1, Zaaijer, D6, Vos, PLAM1 1Farm Animal Health, Faculty of Veterinary Medicine, Utrecht University, The Netherlands; 6DAP Future Fertility Systems, The Netherlands Anoestrus is an important problem in high yielding dairy cows, which can have different causes, for example, a prolonged luteal phase. Recently in veterinary practice, abnormal, large, spongy corpora lutea (CLs) were diagnosed in non-cyclic dairy cows post partum. These cows received a typical diet with low levels of sugar and rumen fermentable starch, and a relatively high fraction of rumen undegradable starch, in combination with high levels of protein. The aim of the present study was to create a model to induce spongy CLs by feeding this typical diet to dairy cows, and to investigate its effect on CL morphology and function in comparison to control diet.

Twenty-four animals were selected based on parity (1-3), lactation state (3-6 months in lactation) and normal cyclicity. All animals were synchronized and at the end of the following cycle they were allocated into three diet groups; rape- (high rumen fermentable protein > 18% mainly from rape, low fermentable energy), soya- (high rumen fermentable protein >18% mainly from soya, low fermentable energy) and control group. Blood samples for progesterone analyses were collected three times a week. The animals were ovariectomized at day 12 (day 0 is estrus) of the third cycle in which they were fed the 3 different diets. The obtained CLs were analysed histologically with regards to surface and size of luteal cells using as marker 3-β-HSD expression (a pivotal enzyme in the synthesis of progesterone). Furthermore, the mRNA expression for IGF-1 (which stimulates the steroidogenesis), and leptin (which is a elusive factor linking reproduction and metabolic status) and their receptors was quantified by Q-PCR technique. During this trial, no spongy CLs have developed but a large variety of both macro- and microscopic appearance of the CLs has been observed. Remarkably, this was the first time that adipose tissue was described in the CL, which was frequently observed near the centre or cavity of the CL. In this respect, a significant difference (p<0.05, using an one-way Anova followed by bonferroni test) was observed in the luteal cell surface between CLs from the rape- (43.8 ± 2.3) and the control group (51.1 ± 3.5). However the progesterone concentrations between the groups did not differ. No significant differences were seen in mRNA expression of IGF-1, IGF-1 receptor and leptin receptor between the diet groups. Leptin mRNA was not present in all samples. It can be concluded that spongy CLs are not directly induced by a high protein diet with a disbalance of protein and energy on rumen level. P060 Evaluation of timed artificial insemination after a presynch-ovsynch estrous synchronization program on first service pregnancy rate of high producing lactating Iranian Holstein cows Koolabadi, G1*, Farhoodi, M2, Sadjadian, R3, Danesh Mesgaran, M4 1Research and Extension, Dasht Co., Islamic Republic of Iran; 2Veterinary Science, Dasht Co., Islamic Republic of Iran; 3Veterinary Science, Azad University of Karaj, Islamic Republic of Iran; 4Animal Science, Ferdowsi University of Mashhad, Islamic Republic of Iran The present study examined the effect of timed artificial insemination after presynch-ovsynch estrous synchronization program on the first service pregnancy rate in Iranian high producing (average first 90 days actual milk production of 42 kg/d/cow) lactating Holstein cows. Two hundred-forty-one multiparous and 112 first parity lactating cows were selected from a herd with 750 milking cows. All multiparous cows had less than 400 days on milk at pre-partum. Animals were assigned randomly in two major blocks of their parity and 3 groups of timed insemination within each block. The experiment was carried out from May 2006 to September 2007. All cows received two set-up injections of 500 µg PGF2α [Parnell Laboratory (Aust) PTY. LTD.] i.m., 14 days apart starting at 15 days in milk. All cows received 100 µg of GnRH [Parnell Laboratory (Aust) PTY. LTD.] i.m. 12 days after the second pre-synchronization injection of PGF2α, followed by a third injection of 500 µg PGF2α i.m. 7 days later. Cows received a second injection of 100 µg of GnRH i.m. 48 h after the third PGF2α, and received blind artificial insemination at the time of the second GnRH injection (n= 113, group 1), 16 h (n= 108, group 2) or 24 h (n= 132, group 3) later. Ultrasonography was used to monitor the presence of an embryo at 35 days after insemination. Rate of pregnancy per first service was recorded and the data were statistically analyzed using GLM procedure of SAS. There was no significant effect of parity on first service pregnancy rate. No differences were found in the cows inseminated at groups 1 (24.2%) and 3 (15.4%). Cows of group 2 had greater (P< 0.05) first service pregnancy rate (33.1%) compared with the other groups. Data obtained in this study suggested that the time of blind insemination in a controlled breeding program such as presynch/ovsynch for initiating first artificial insemination service is a

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 48 P o s t e r A b s t r a c t s key point to exposes all cows in the herd to the risk of becoming pregnant at or very near the end of the voluntary waiting period. P061 A spontaneous delayed post-ovulatory progesterone rise discovered in Indigenous-Holstein cross-bred dairy heifers Kornmatitsuk, S1; Kornmatitsuk, B1; Chantaraprateep, P2; Larsson, B3 1Faculty of Veterinary Science, Mahidol University, Phutthamonthon, Nakhon Pathom, 73170; 2Council of Chulalongkorn University, Patumwan, Bangkok, 10330; 3Uppsala County Administrative Board, Uppsala County, Uppsala, Sweden SE-75186 Indigenous-Holstein (≥75%) cross-breed (Bos indicus × Bos taurus) is the majority of dairy cows/heifers in South-East Asia including Thailand and is claimed to well adapt to the tropical and sub-tropical environments. However, Bos indicus had less potential for production as well as lower fertility than Bos taurus cattle. These may contribute to certain problems and limited success, especially in reproduction aspect, in our dairy industries. The aims of the current study, hence, were to illustrate figures for the characteristics of oestrous cycles especially on follicular dynamics, corpus luteum and changes in progesterone, in the Indigenous-Holstein cross-bred dairy heifers. Twenty six healthy and sexual-mature virgin heifers were included. Their ovaries were sonically examined once a day and the numbers and the sizes of the follicles as well as of the corpus luteum were documented. Blood samples were drawn as the same frequency as ovarian examination and progesterone was determined by means of EIA (Enzyme-linked immunoassay). In our study, certain diversities comparing to of existed documents on dairy breeds were drawn for follicular dynamics, corpus luteum and its progesterone: 1) the follicle tended to quicker ovulate but with a smaller diameter at ovulation (12.4 ± 1.1 mm in diameter); 2) the corpus luteum exhibited 4.0−16.5 mm in diameter of central cavity. Connecting to the levels of progesterone, 3) the corpus luteum turned into active, as well as mid-luteal, period quite late (6.0 ± 1.7 days and 9.80 ± 2.49 days, resp.), and 4) the duration of the active period of the corpus luteum was shorter (12.5 ± 1.7 days), but 6) at the end of the cycle –around the day of oestrus, progesterone remained certain low but significant levels (range 0.15 to 0.60 ng/ml.). To conclude, a spontaneous delayed post-ovulatory progesterone rise was discovered, in connection to a series of following events: 1) smaller ovulatory follicle; 2) CL with cavity and delayed rise in progesterone and 3) delayed CL regression. It is of challenge to figure out an (or a combined) underlying cause of, and a precise manner to undo, the loop of the delayed rise in post-ovulatory progesterone, either at endocrine or at cell levels. P062 Leukotrienes as modulators of ovarian and uterine secretory functions in cattle in vivo Korzekwa, A*; Kurzynowski, A; Woclawek-Potocka, I ; Bah, MM ; Skarzynski, DJ Department of Reproductive Immunology, Institute of Animal Reproduction and Food Research, Polish Academy of Sciences in Olsztyn, Poland Leukotrienes (LTs) beside prostaglandins (PGs) and tromboxan belong to biologically active unsaturated fatty acids called eikozanoids. Leukotrienes are known as potential inflammatory factors and causing edema in respiratory tract diseases. The precursor of LTs is 20-carbonated Arachidonic Acid (AA) – the component of membrane fosfolipids. The enzyme which converts AA to LTs is lipoxygenase (LO). The role of lipoxygenase pathway products such as LTs in the regulation of bovine reproduction tract functions remains controversial. The aim of the study was the determination of the influence of LTs on changes in hormone homeostasis of reproductive tract in cattle in vivo. Heifers (15 Day of estrous cycle) were injected during 1 hour into aorta abdominalis with: LTC4 in doses: 10, 25 and 50 µg and LTB4 in doses: 10 and 25 µg. The levels of P4 and AA metabolites: PGE2 and PGFM were measured in plasma

by EIA. Leukotriene C4 and B4 did not influence on P4 level although the dose 25 µg LTB4 prolonged the duration of luteal phase. Leukotriene C4 in dose 10 µg temporally increased the secretion of PGE2 (from 8 to 10 h after infusion) but simultaneously increased the secretion of PGF2α (PGFM). The dose 25 µg of LTC4 caused the increase of PGF2α (PGFM) release, whereas 50 µg of LTC4 did not changed the secretion of hormones. Leukotriene B4 in dose 10 µg caused PGF2α (PGFM) release and 25 µg of LTB4 increased PGE2 secretion. Moreover the acceleration of luteolysis for the doses of leukotrienes: 10 µg, 25 µg LTC4 and 10 µg LTB4 was observed. Resuming, the action of LTB4 on reproductive tract depends on the dose, because 10 µg is luteolytic while 25 µg prolongs the duration of luteal stage. The action of LTC4 is luteolytic for doses: 10 and 25 µg but 50 µg of LTC4 caused to be not effective in experiment. Further studies are necessary for investigation of the influence of LTs on hormone homeostasis of bovine reproductive tract with the administration of LTs antagonists and other doses of LTs. The implication of LTs can be the alternative to PGs method of estrus synchronization or other cycle manipulation techniques in the future. P063 The slope of the postovulatory progesterone rise modulates pregnancy rate in Holstein-Friesian heifers Kulcsár, M1*, Kátai, L1, Földi, J1,2, Gáspárdy, A1, Fébel, H3, Gabor, G3, Driancourt, MA2, Huszenicza, G1

1Szent István University, Faculty of Veterinary Science, Budapest, Hungary; 2Intervet Pharma, Angers, France; 3Institute of Animal Husbandry and Nutrition, Herceghalom, Hungary During peak lactation, the negative energy balance and its metabolic consequences may interfere with the postovulatory progesterone (P4) rise, hence affecting pregnancy rate and incidence of embryonic/early fetal mortality (EM) in dairy cows. The aim of this study was to explore whether metabolic markers could also be related to fertility in heifers. In the hot summer season, sixty, 14-15-month-old Holstein-Friesian heifers with medium or higher body condition score (BCS:≥3.0) were inseminated (AI) at synchronized estrus (Norgestomet impl. for 9 days combined with PGF2α and eCG, 2 days before and simultaneously with implant removal, respectively; AI: 56h later; AI=d0). Blood samples were collected on d0 and analyzed for βOH-butyrate (BHB), non-esterified fatty acids (NEFA), insulin, IGF-1, T4, T3 and leptin. Progesterone (P4) was determined every 12 hours for 7 days following implant removal, every 24 hours thereafter until d 14 and again on d 16, 19, 21, 23 and 36. 17β-estradiol (E2) was assayed during the first 4 days. Pregnancy was checked on day 36 by (i) ultrasound (US) and (ii) plasma Pregnancy-Specific Protein B (PSPB) measurement, and (iii) on day 45-60 by rectal palpation (RP). The E2 patterns indicated well-synchronized growth and maturation of follicles. The P4 profiles allowed conception (P4 at the time of AI: <3.2 nmol/l, d 2-6: elevated) in most (52/60) heifers. However, only 28 of them proved pregnant. Elevated P4 levels on d 16-23 and PSPB+US on d 36 suggested or confirmed only 2 and 1 cases of EM. There were no further cases of EM between d 36 and d 45-60. Between 60 hours following AI and d 7, P4 levels were higher (P=0,001 to 0,098) in pregnant than non-pregnant heifers. BCS and leptin levels were lower in pregnant than non-pregnant females. All hormones and metabolites were within the physiological range for this age group, with high leptin, insulin and IGF-1 levels. Our data suggest that the postovulatory P4 rise may also interact with fertility in dairy heifers. P064 Pregnancy rate in anestrous Bos taurus/Bos indicus crossbred cows given a CIDR insert and estradiol, with or without an injection of progesterone Lamothe, C1*; Montiel, F1; Cuicas, R2 1Faculty of Veterinary Medicine, University of Veracruz, Mexico; 2Faculty of Veterinary Medicine, Autonomous University of Yucatan, Mexico

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 49 Introduction Cattle predominant in the Mexican tropics are Bos taurus/Bos indicus crosses. Bos indicus influenced cattle have long intercalving periods and poor estrus detection rates, which are the main limitations to improve their reproductive efficiency. The protocols for estrus induction and synchronization that eliminate estrus detection by using timed artificial insemination (TAI) are useful for this type of cattle. The use of an intravaginal insert impregnated with 1.9 g of progesterone (CIDR®, controlled internal drug-releasing device) has induced cyclicity in anestrous cows. Administration of synthetic progesterone (P4) and estrogen during CIDR treatment has proved to enhance synchronization rate. We evaluated the pregnancy rate in postpartum anestrous lactating Bos taurus/Bos indicus crossbred cows treated with a CIDR, estradiol and synthetic P4. Methods On days -9, -6, -3 and 0 (day 0=start of treatment), anestrus status was confirmed by transrectal ultrasonography and determination of serum P4 concentrations (<1 ng/ml P4 in each sample). On day 0, 104 cows were assigned to the following treatments: 1) CIDR+ECP+P4 (n=24): one CIDR insert + i.m. 2 mg of estradiol cypionate (ECP) and 100 mg of P4; 2) CIDR+ECP (n=22): a CIDR + 2 mg of ECP; 3) CIDR+EB+P4 (n=20): a CIDR + 10 mg of estradiol benzoate (EB) + 100 mg of P4; 4) CIDR+EB (n=21): a CIDR + 10 mg of EB; 5) Control (n=17): i.m. 5 ml of saline solution as a placebo. The CIDR inserts were removed on day 9. The CIDR-treated cows received TAI 48 to 56 h after its removal, and the control cows were AI 12 h after detected estrus. Detection of estrus was performed twice daily from 24 h after CIDR removal until three days later. Results Pregnancy rate was 58.3% (14/24) for CIDR+ECP+P4, 63.6% (14/22) for CIDR+ECP, 45% (9/20) for CIDR+EB+P4, 47.6% (10/21) for CIDR+EB (P>0.05) and 17.6% (3/17) for the control group (P<0.05). CONCLUSIONS Treatment with CIDR + estradiol + synthetic P4 for TAI in anestrous lactating Bos taurus/Bos indicus crossbred cows resulted in acceptable pregnancy rates. However, neither the addition of synthetic P4 to the treatment protocols, nor the use of EB or ECP as the estradiol source had an effect on the results. Because of the difficulties for estrus detection in cattle of Bos indicus breeding, the use of the protocols for TAI included in this study may provide greater opportunities for achieving acceptable pregnancy rates than AI after estrous detection in Bos indicus influenced cattle. P065 Andrologic, zootechnical and endocrinologic characterization of Nelore bulls at puberty Lima, F 1Depto Clínica e Cirurgia, Escola de Veterinária - UFMG - Brasil, Brazil Introduction Puberty initiates the reproductive phase and is influenced by difference in the genetic potential among breeds and by the husbandry, and its knowledge facilitates an early selection of bulls and also the discard of those with late puberty (4). Associations between weight characteristics, testicular measures and seminal characteristics for zebu bulls are yet limited. The goal of this study is to obtain parameters in pubertal bulls to be used in selection criteria. Material e methods Nelore bulls (Bos taurus indicus) (n=24) at twelve months of age were divided in groups of eight animals each based on the scrotal circumference (SC). G1 (SC > 22,8cm); G2 (SC 21,6-22,6cm) and G3 (SC 20,1-21,2cm). Zootechnical, seminal and endocrinologic traits were taken and analyzed as the animal achieved puberty (4). Statistics was done and the mean values compared with SNK test (2). Results and discussion There was statistical difference of G1 compared to G2 and G3 for age, weight and testosterone concentration at puberty. The G1 at twelve months had the higher SC and the lowest weight at weaning in relation to other groups. Bos taurus taurus reached puberty with a mean value of SC 27,8cm (1) and similar values were described in Nelore bulls (3), which are similar to those found in this work. The age at puberty in Nelore bulls has decreased in the past years, due to genetic improvement and animal selection. Parameters as SC and weight at weaning are relevant markers of genetic selection for sexual precocity.

P066 Comparison of reproductive performance in dairy cows bred by Natural Service or Timed Artificial Insemination Lima, F1*; Risco, C1; Thatcher, M1 and Thatcher, WW2

1College of Veterinary Medicine, University of Florida, USA; 2Department of Animal Sciences, University of Florida, USA Despite the compelling advantages of artificial insemination (AI), a significant number of dairy producers use natural service (NS) for their breeding program. The most common use of NS was after unsuccessful AI attempts due difficult to do heat detection. Estrus detection in order to AI cows is inefficient because not all cows are identified in estrus due to: human errors, attenuated expression of estrus in high producing cows, and adverse responses to heat stress. Therefore, dairy producers claim that more cows are bred by NS compared to AI because human errors in estrus detection are avoided when bulls are used. Systematic breeding programs for AI at a predetermine time (Timed AI; TAI) without the need for estrus detection, coupled with early rebreeding of non pregnant cows are successful options for reproductive management of lactating dairy cows. The objective of this study was to compare the reproductive performance of two breeding system without estrus detection. Six hundred and forty one lactating Holstein dairy cows from a single farm located in Florida were randomized at 42±3 days post partum into two groups TAI and NS, and. Cows in the TAI group were pre-synchronized with 2 injections of PGF2α 14 days a part. Fourteen days later an Ovsynch modified program was started. Eighteen days after TAI, cows received a CIDR insert followed by insert removal and GnRH administration 7 days. Cows were diagnosed for pregnancy by ultrasonography examination at 32 days after TAI. Cows diagnosed pregnant were re–examined by palpation per rectum of the uterus 28 days later. Cows diagnosed open at 32 days after TAI were given PGF2α , followed with an injection of GnRH at 56 hours after PGF2α and TAI 16 hours later. Cows not pregnant were re-synchronized again with the same protocol until diagnosed pregnant or at a maximum of 223 days post partum. Cows in the NS group received PGF2α at days 42 and 56 and moved to a bull pen at 70 days post partum. After 42 days of being turned in with bulls, cows underwent an ultrasonography examination to determine pregnancy status. The same interval pos partum was observed for cows at NS group. Median times to conception estimated from 32 d after breeding for TAI and NS bred cows were 104 d (95 % CI = 100 to 104) and 103 d (95 % CI = 72 to 105), respectively. However, analysis of pregnancy rate (PR) for first service differed through 91 d postpartum (P < 0.01). Twenty five per cent of all pregnant cows conceived 11 d (69 vs. 81 d) earlier in the TAI group at the end of the voluntary waiting period (VWP). Cows bred to TAI become pregnant at a faster rate for the first service at the end of the VWP than NS bred cows. Because PR from NS was good for the first service in our study, this difference is attribute to the TAI management and not necessarily better fertility. P067 Oxidative Stage in Bovine Corpus Luteum López-Ortega, A1*, MáRquez, A1, MáRquez, Y1, Fuentes, M2

1UNIHM, Centroccidental " Lisandro Alvarado" University, Venezuela; 2Socials Science, Centroccidental "Lisandro Alvarado" University, Venezuela The reactive forms of oxygen (ROS), also known as free radicals (FR), are constantly produced by the organism as part of many physiological functions. However, excessive production of FR can be toxic and conduced to Oxidative Stress (OS). The objectives of the present study were: (1) to measure the amount of malondialdehyde (MDA), and conjugated dienes (CD); (2) to determine the antioxidative capacity of the superoxide dismutase enzyme (SOD); (3) to detect the presence of SOD, in mature and in regression corpus luteum (CL). Measurement of MDA and CD were performed in 30 CL from slaughter Holstein cows, placed in buffer Tris-saccharose (250 mM pH 7.2) at 4ºC and homogenized to obtain the supernatant. Technique of TBARS was used to determine MDA and isopropanol extraction was used to analyze CD. Calbiochem kit was used to quantify SOD activity from 26 CL following kit instructions. Indirect

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 50 P o s t e r A b s t r a c t s immunefluorescence (IFI) was used to detect CuZn-SOD presence from 133 CL slides. Statistical differences were determine by t-test (p<0.05) and IFI results were described based on frequency of immunefluorescence (high, medium, and low). Means of MDA were 25.94±2.68 and 6.65±0.87 MDA/mg of proteins in mature and regressive CL, respectively (p<0,001). Means of CD were 14.76±2.60 x 10-3 and 6.66±1.76 x 10-3 nmoles/mg proteins in mature and regressive CL, respectively (p<0.05). Activity of the CuZn-SOD in mature CL reached values of 119.01±42.38 U/mg proteins but decline sharply in regressive CL reaching 26.28±4.38 (p<0.001). The presence of the enzyme CuZn-SOD was demonstrated in all CL analyzed. However, 71.3% of mature CL presented high fluorescence as compared to regressive CL, while the majority of regressive CL (71.7%) presented low fluorescence. In conclusion mature CL had a higher activity of SOD than regressive CL in the present study. These results suggested that mature bovine CL had an increased production of ROS accompanied with an increased antioxidative activity as compared to regressive CL. Possibly this increment could be due to the high esteroidogenic capacity of CL during maturity stage. Thus, the increase in the antioxidative capacity of the luteal cells, prevent the oxidative stress even though there is an increase of ROS assuring that CL could complete its physiological cycle. P068 A new reproductive performance indicator for dairy herds adjusted for voluntary waiting period Löf, E1,3*; Emanuelson, U1; Gustafsson, H2,3 1Department of Clinical Sciences, Division of Ruminant Medicine and Veterinary Epidemiology, and 2Division of Reproduction, Swedish University of Agricultural Sciences, P.O. Box 7054, SE-750 07 Uppsala, Sweden; 3Swedish Dairy Association, P.O. Box 210, SE-101 24 Stockholm, Sweden Introduction There are a variety of measurements and indices that are used to monitor overall reproductive performance of dairy herds. The most commonly used indicators are time interval measurements such as calving interval, days to first service and days to conception. these is that they can only be calculated for animals that either have a next calving or have inseminations or natural services, thus introducing possible selection bias. This problem can be alleviated by using survival analysis. The 100-day-InCalf-rate (100IC) is an increasingly popular indicator that utilizes this methodology. However, most indicators, including the 100IC, do not take into account the different strategies that are applied at farm level, e.g. the herd’s voluntary waiting period (VWP). The aim of this study was to use survival analysis to construct a new reproductive performance indicator that is adjusted for the herd’s VWP and to compare it with 100IC. Material and methods We studied all animals that calved from 2004-09-01 to 2005-08-31 in 512 Swedish dairy herds registered in the Swedish Official Milk Recording Scheme (SOMRS). The herds were randomly selected from all herds (n=2728) that had more than 45 milking cows. Registrations were extracted from the SOMRS and from the AI-recording system for each animal. A dataset was built containing calving date and, when known, the date of the consecutive calving, date of pregnancy checks, the date the cow was culled or sold and date of AI or natural service. From this dataset days from calving to conception or to censoring was calculated. A survey asking for the VWP was sent to the herds, with a resulting response rate of 59%. Because herd VWP was not available for all herds, it was also estimated as the days postpartum by which 5% of the cows in the herd-year had received a first insemination. The correlation between the reported and the estimated VWP was calculated. The proportion of cows pregnant 30 days after the herd VWP (PPW+30) was estimated using survival analysis, stratified by herd and accounting for potential censoring, as was also the 100IC. The correlation between the indicators was calculated. Results The reported VWP had a mean of 58 days and an inter-quartile range (IQR) between 50 and 60 days. The estimated VWP for the herds had a mean of 51 days and an IQR between 45 and 57 days. The correlation between the reported and the estimated VWP was 0.51. The new performance indicator PPW+30 had a mean of 0.19

and an IQR between 0.12 and 0.24, which means that on average 19% of the cows at a herd where pregnant 30 days after the herd’s VWP. The 100IC had a mean of 0.30 and an IQR between 0.21 and 0.38, which means that on average 30% of the cows at a herd where pregnant 100 days postpartum. The correlation between PPW+30 and 100IC was 0.73. Conclusion Estimation of the PPW+30 on herd level was feasible and the indicator performed well. The PPW+30 is related to, but slightly different than, 100IC and may be useful to assess other aspects of the herds’ fertility status. P069 Effects of flunixin meglumine (FM) in reproductive events in fixed-timed artificial inseminated cows Lucacin, E Master's degree in Animal Science, Paranaense University-UNIPAR, Brazil Introduction In cows, the maternal recognition of pregnancy is a critical period between 15th and 19th days of estral cycle, when estrus is zero day. Many strategies to improve the reproductive indexes are based in mechanisms that prevent luteolisys through inhibition of PGF2α synthesis, such as the use of flunixin meglumine, a selective COX-2 anti-inflammatory agent. The objective of this study was to evaluate the effects of FM on progesterone concentration, pregnancy rate, and follicular dynamics. Methods There were studied 57 pure-breed beef cows (34 Bos indicus and 23 Bos taurus) from the same farm, ranging from one to eight parturitions. All animals were kept on pasture of Brachiaria brizhanta, supplemented with mineral salt and water ad libitum. After a commercial fixed-timed AI protocol the cows were separated in two homogeneous groups: control (CG, n=30) and experimental (EG, n=27). The synchronization protocol first consisted in the IM administration of estradiol benzoate (EB, 1.0mg) and implanting a 1.9g progesterone intravaginal device (CIDR, Pfizer). Seven days after the implant was removed and the cows received PGF2α, and 24 hours after, a new EB IM injection, being the IA performed 30 hours after EB. The experimental animals received 1.1 mg/kg of FM between 11th and 16th days (FTAI = day 0). Blood samples were collected from six animals per group on days 0, 6, 9, 11 to 18, and 21.The cows that returned to heat were inseminated and returned in original groups. Thirty days after the AI there was performed ultrasonographic pregnancy diagnosis. Follicular dynamics test was performed in non-pregnant cows at the 34th day after the last AI, being considered persistent the follicles that presented minimum diameter of 12 mm at the 30th day and not ovulated until the 34th day. Serum progesterone analysis was performed by RIA. Results and discussion There were no difference on progesterone concentrations and so in pregnancy rate between EG and CG (38.24% - 13/34 and 37.84% - 14/37, respectively) (p>0.05). However, in non-pregnant females of EG the number of anovulatory large follicles was higher than in non-pregnant CG females (78.14% - 11/14 and 33.33% - 5/15, respectively) (p = 0.0253). This effect on follicular dynamics and ovulation was probably caused by the FM action on the synthesis of intra-follicular PGs, consequently affecting the ovulation. Conclusions It was concluded that FM influences follicular dynamic and ovulation, but not progesterone concentrations and pregnancy rate in fixed-timed artificial inseminated cows. P070 The relationships between peri-ovulatory events, progesterone and IGF-I and subsequent embryo survival rate in heifers Lynch, CO1, 2*; Childs, S1, 2; Kenny, DA1; Diskin, MG2

1Teagasc, Animal Production Research Centre, Athenry, Co., Galway, Ireland; 2School of Agriculture, Food Science and Veterinary Medicine, College of Life Sciences, University College Dublin, Ireland The relationships between time of AI relative to ovulation (OV), ovulatory follicle size, plasma progesterone (P4) and IGF-I around the time of oestrus and subsequent embryo survival are equivocal. This

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 51 study investigated the relationships between these factors. A total of 84 normal beef heifers had their oestrous cycles synchronised using two injections of prostaglandin (PG), 11 days apart and were fitted with HeatWatch® devices. The time of initial standing event followed by successive mounting activity was taken as the onset of oestrus (D0). Heifers recorded in oestrus were inseminated 5 – 21hrs after onset using semen from a single ejaculate from a high fertility bull. Ovarian structures were ultrasonically examined with a 7.5-MHz probe starting 12 hours after onset of oestrus and repeated every 6 hours thereafter until ovulation (OV) occurred. Time of OV was determined from the time of the first scan on which the dominant follicle (DF) had disappeared minus 3 hrs. Ovaries were re-examined on day D7 to confirm OV and to measure luteal structures. Blood samples were collected at 12 hour intervals on D -1, D0 and again on D7 for IGF-I and P4 which were measured by IRMA and RIA, respectively. Embryo survival (EmSurv) was confirmed by ultrasonography at D30 and D100 post AI. The relationships between EmSurv and continuous variables were evaluated using logistic regression. EmSurv at D30 was 69% with two of the heifers suffering foetal loss between D30 and D100. OV occurred (Mean±S.D) 27.4 ± 5.9 h after the onset of heat. There was no relationship between the interval from onset of heat to OV or the interval from AI to OV and EmSurv. (P>0.05). There was evidence of a relationship between the size of the ovulatory follicle and EmSurv (Odds ratio=0.79; P=0.07). There was a positive relationship between concentration of P4 on Day 7 and EmSurv (Odds ratio=1.4; P<0.05) but there was no relationship (P>0.05) between P4 on D7 and ovulatory follicle size, CL volume or concentrations of IGF-I on D-1, D0 or D7. Similarly there was no relationship (P>0.05) between IGF-I concentrations and EmSurv. We conclude that there was considerable variation in the timing of OV relative to the onset of oestrus. Time of AI relative to heat onset and or time of ovulation had no effect on embryo survival rate. There was a positive association between P4 on day 7 and embryo survival but not for IGF-I. Plasma P4 was not related to the size of the ovulatory follicle, CL volume or plasma IGF-I. Oocytes produced from large dominant follicles may have impaired embryo survival. P071 Prevalence of clinical and subclinical endometritis in dairy cows and the impact on reproductive performance Madoz, L1*, Ploentzke, J2, Albarracin, D3, Mejia, M4, Drillich, M2, Heuwieser, WS2, De La Sota, RL1 1Catedra y Servicio de Reproduccion Animal, Facultad de Ciencias Veterinarias, Universidad Nacional de La Plata, Argentina; 2Bovine Reproduction Clinic, Fac. Veterinary Sciences, Free University of Berlin, Germany; 3Catedra de Patologia, Fac.de Cs. Veterinarias, Univ. Nac. de La Plata, Argentina; 4Practica privada, Argentina The aim of this study was to evaluate the prevalence of clinical (CE) and subclinical (SE) endometritis and their impact on reproductive performance in dairy cows. Samples were collected from 211 Holstein cows in three farms in Argentina. Cows were examined for diagnosis of clinical endometritis (CE) between 21 and 62 days postpartum (dpp) at a monthly herd visit. At examination, cows were first inspected for presence of fresh and/or dry discharge on the vulva, perineum, or tail. Then the mucus content of the vagina was evaluated for color, proportion of pus to mucus, and odor; and a score was assigned as follows: clear mucus (0, [NOR]), predominantly clear mucus with flecks of pus (1, [CE1]), purulent mucus but not foul-smelling (2, [CE2]), or purulent or red-brown mucus and foul smelling (3, [CE3]). After clinical examination, if mucus content was NOR, cows were examined (EX1) for diagnosis of SE by endometrial cytology (n=165). Cows were reexamined 14±3 d later (EX2). Endometrial cytology samples were collected using a cytobrush modified for use in cattle. Cytology slides were prepared by rolling the CB on a clean glass microscope slide, air dried, fixed with ethylic alcohol and stored in a slide box. Slides were stained with a modified Wright-Giemsa stain and the degree of endometrial inflammation was assessed by counting a minimum of 200 cells at 400 x magnifications and expressed as the percent neutrophils (PPMN). The diagnosis criteria for SE was >18% PPMN in samples collected 21-33 dpp, >10% neutrophils in samples collected 34-47 dpp and >5% PPMN in

samples collected 48-62 dpp. At 50 dpp, cows with normal mucus were detected in heat twice a day and AI. All AI cows were diagnosed pregnant by transrectal palpation at 35-65 d post AI. At examination, 78.2% (165/211) of cows were diagnosed NOR and 21.8% with CE (56.5% [26/46] CE1, 37.0% [17/46] CE2 and 6.5% [3/46] CE3). The cytobrush was done in 149 of 169 NOR cows. The prevalence of SE was 10.1% (15/149). At EX2, 87.5% (49/56) remained negative, 10.7% (6/56) changed from positive to negative and 1.8% (1/56) remained positive. Cows with SE needed more services per conception (2.77±0.45 vs. 1.96±0.18, p<0.06) and they tended to have a more days open (162.6±23.1 vs. 110.7±9.8, p<0.04) and lower percentage of cow pregnant by 120 dpp (27.3 vs. 60.4%, p<0.01) than negative cows. In conclusion, the prevalence of CE was 21.8%, the prevalence of SE was 10.1% and cows with SE had 52 open days more and needed nearly 1 service more to become pregnant. P072 Oestrous detection in a large commercial dairy herd; a comparison of the effectiveness of radiotelemetric activity with milk progesterone measurements Mällo, GK1*; Kaart, T1; Oherd, P2; Sveberg, G3; Reksen, O4; Ropstad, E4; Waldmann, A1

1Institute of Veterinary Medicine and Animal Sciences, Estonian University of Life Sciences, Estonia; 2Estonia Ltd, Estonia; 3GENO, Norway; 4Department of Production Animal Sciences, Norwegian School of Veterinary Science, Norway Introduction The oestrous detection rate has fallen, in the modern dairy cow, due to reduced expression of oestrous behaviour. High yielding dairy cows have extended periods of anovulatory anoestrus caused by negative energy balance. Electronic devices have been developed to alleviate the need for oestrous detection by visual observation. Objectives 1) To evaluate the efficiency and accuracy of the activity sensor ALPRO® (ALPRO; DeLaval International AB, Tumba, Sweden) for detection of oestrus compared to ovulations/oestruses determined by milk progesterone (P4) profiles and visual observations; 2) To study the effect of resumption of ovarian cyclicity on the accuracy of oestrous detection by ALPRO. Methods Milk samples, from 42 multiparous cows on a 1,100 cow dairy herd with mean milk production of 8,112 kg, were taken twice weekly, commencing one week after parturition until either confirmed pregnancy or decision to cull. Concentrations of P4 in milk were measured by EIA. Ovulations/oestruses were determined from milk P4 profiles and compared with the respective activity alarm lists of ALPRO Windows®. The limit values in the ALPRO® processor were set at 38, 50, and 60 for activity levels 1, 2 and 3, respectively. Visual oestrus observation was performed twice daily by two herdsmen. Delayed resumption of ovarian cyclicity was defined as the first measurement of P4 concentration >3 ng/ml occurring later than 50 days postpartum (PP). Results A total of 144 ovulations/oestruses were detected using P4 profiles. Efficiencies for detection of oestrus by ALPRO, determined by comparing detected periods with the 144 ovulations were 24%, 10% and 31% for activity levels 1, 2 and 3, respectively, and 65% for all activity levels. During the observation period 260 oestrous activity events were registered by ALPRO of which 117 (45%) coincided with ovulations/oestruses determined from milk P4 profiles. Among cows in activity level 1, 28% were actually in oestrus. Corresponding values for activity level 2 and 3 were 45% and 87% respectively. Accuracy of oestrous detection by ALPRO in cows resuming ovarian cyclicity before 50 days PP was significantly higher (P<0.001), compared to cows which resumed ovarian cyclicity later than 50 days PP (53% and 29%, respectively). Oestrus was visually observed in only 21% of the ovulations/oestruses. Conclusion The efficiency of ALPRO for detection of oestrus was superior compared to visual observations. Delayed resumption of ovarian cyclicity postpartum had a negative effect on the accuracy of oestrous detection by ALPRO.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 52 P o s t e r A b s t r a c t s P073 Incidence of postpartum endometritis in dairy cows in Argentina evaluated by vaginoscopy and endometrial cytology Mapletoft, RJ1*, Chesta, PM2, Bonomini, Y2, Ramos, M2, Rogan, D3, Bo, GA2 1Large Animal Clinical Sciences, WCVM, University of Saskatchewan, Canada; 2Instituto de Reproduccion Animal Cordoba, Argentina; 3Research and Development, Bioniche Life Sciences, Canada; As part of a larger experiment, data were collected to determine factors influencing the incidence of postpartum endometritis in dairy herds in Argentina. Lactating Holstein cows (67 first parity and 179 second or more parity), 25 to 35 days in milk and with body condition scores between 2 and 3.5 (1 to 5 scale), from seven different herds located on the same dairy farm in Cordoba province, Argentina were used. Cows were examined by rectal palpation, vaginoscopy and by cytobrush for evaluation of endometrial cytology and classified into the following groups: normal cows (with no evidence of clinical or subclinical endometritis) and cows with endometritis. Cows with endometritis were further subdivided into those with subclinical endometritis (with no evidence of purulent discharge but with >18% neutrophils in endometrial cytology) and cows with clinical endometritis (purulent discharge and >18% neutrophils). Data were analyzed by logistic regression to evaluate the effects of herd, month of the year (December to May), milk production, parity, body condition score and ovarian status on the incidence of postpartum endometritis. The presence of purulent material was not always indicative of endometritis. Based on the percentage of neutrophils found in the endometrial cytology samples, 15.5% (9/58) of cows with purulent material in the anterior vagina had <18% neutrophils and would have been misdiagnosed as having clinical endometritis. These cows were considered as normal in the logistic regression analysis. The incidences of clinical and subclinical endometritis were 19.9% (49/246) and 23.6% (58/246), respectively. Month of year (P<0.001), body condition score (P<0.009) and herd (P<0.028) significantly influenced the incidence of postpartum endometritis. The incidence was higher in the samples taken in December (67.3%, 33/49) than in other months, decreasing to 24.0% (12/50) in May. Furthermore, the incidence ranged from a high of 61.8% (21/34) on one farm to 34.9% (15/43) on another. Finally, the incidence of endometritis decreased as body condition score increased from 81.1% (9/11) in cows with a body condition score of 2.25 to 27.8% (5/18) in cows with body condition score of 3.5. In summary, season, body condition score and herd influenced the incidence of postpartum endometritis, and data suggest that the addition of endometrial cytology to clinical observations will improve the diagnosis of endometritis as compared to traditional methods, and that clinical observations alone are subject to misdiagnosis due to false negatives and positives. P074 Description of a technique for corpus luteum biopsy in Nelore cows (Bos taurus indicus) Martin, I*; Marques Filho, WC; Fujihara, CJ; Maziero, RRD; Biscarde, CEA; Meira, C; Oba, E; Ferreira, JCP

Department of Animal Reproduction and Veterinary Radiology, Faculty of Veterinary Medicine and Animal Science, UNESP, Brazil The aim of the present study was the collection of luteal samples by an incision in the vaginal vault in 14 Nelore (Bos taurus indicus) cows. The animals were maintained inside a palpation shoult in standing position by girths around the thoracic and pelvic region and each cow received an epidural anesthesia with the combination of 2% lidocaine hydrochloride without adrenaline (Xylestesin® 2%, Cristália LTDA, Brazil) at a dose of 0,15 mg/kg and xylazine hydrochloride (Rompun®, Bayer S.A., Brazil) at a dose of 0,025 mg/kg. Additionally, it was performed a local (vaginal vault) anesthesia around the incision region with 20 to 30 mL of 2% lidocaine hydrochloride. Prior to the biopsy a washing procedure was performed at the perineal area using a disinfectant solution (Kilol®-L, Quinabra LTDA, Brazil) in a dilution of 1:250 mL. The biopsies were

performed 10 minutes after the epidural anesthesia by a incision in the vaginal vault with a scalpel blade and then the tissue were dissected until it was possible to access the pelvic cavity and to retract the ovary inside the vagina. The luteal samples were obtained by a Yomann biopsy nipper. The postoperative consisted of antibiotic therapy with benzathine penicillin (20.000 UI/kg, IM, Septipen®, Vallee S.A., Brasil) and flunixin meglumine (Banamine®, Schering Plough, Brazil) at a dose of 2,2 mg/kg, IM. The cows were reevaluated after 7 days by rectal palpation to access the presence of adhesion and clinically to check for peritonitis. Animals didn't show any signs of pain (vocalization, excessive salivation, unrest or escape behavior) during the vaginal vault incision, ovarian tension or during the luteal biopsy. However, these signs were observed in some females during the vaginal wall and peritoneum dissection (3/14 animals). The occurrence of ataxia was observed in 3 (3/14) animals, being usually related with a longer time of the procedure and not being related with pain signals. It was also observed the occurrence of ovarian adhesions ipsilateral to the incision in 3 (3/14) animals. All the signs described above occurred independently from each other. The protocol used for anesthesia followed by the technique described above provided a safe and efficient method in acquiring samples with adequate size to be used in molecular biology techniques like immunohistochemistry and RT-PCR. However, the occurrence of ovarian adhesions can limit subsequent biopsies and the cow’s reproductive potential, which deserve further investigations. P075 Effect of body condition score at calving on zoometric index of corporal stage and postpartum ovarian activity in dual purpose cows at the tropic Martinez, N1*; Drescher, K1; Pinto-Santini, L1; Ruiz, A2; Dominguez, C3; Perez, R3; Benezra, M1 1Facultad de Agronomía, Universidad Central de Venezuela, Venezuela; 2Facultad de Ciencias Veterinarias, Universidad Central de Venezuela, Venezuela; 3Facultad de Ingeniería, Universidad Rómulo Gallegos, Venezuela The body tissue reserves at calving and postpartum (PP), feed level and energy balance (EB) play a role on ovarian resumption (OR) due to their effect on hypothalamus – hypophisis – gonadal axis mechanism control. Therefore was designed this study to determine changes on different zoometric indexes of corporal stage (ZICS) by body condition score at calving (BCSc), and its relation with ovarian structures changes. Twenty seven cows (3/4 to 5/8 Bos taurus x 1/4 to 3/8 Bos indicus) were distribute randomly in these treatments (T): combination of two factors: BCSc (NIRD 1 to 5), high (hB: > 2,5) and low (lB: < 2,5) and, feed level (FL) (energy requirement to maintenance + body weight and milk production first 60 days (d) from previous lactancy) high (hF: 115%) and low (lF: 85%). From fourth PP day all cows were located individually and fed with hay (Cynodon nlemfuensis), multinutritional block and supplemented in each milking 2x. ZICS evaluated were: body mass index (BMI) on penultimate and last ribs by ultrasound (Aloka SSD 900. Co. LTD, Tokio, Japan; proveed with transrectal sound of 7.5 MHZ). Corporal live weight (CW) (kg), wither height (WH) (m), corporal mass index (CMI) = CW/WH2 (Kg/m2) and BCS were determined at 3, 15, 22, 30, 37 and 45 d PP; for OR by transrectal palpation and through ovarian ultrasonography were quantified the classes of the follicles (F) as follow: (F1 < 5mm), (F2: 6-9 mm), (F3 > 10mm) and corpus luteum (CL) in each time. The statistical analysis for ZICS was by MANOVA, by measurements repeated in the time and by means of a factorial adjustment 2x2. For OR the analysis was by χ2 and survival test. The ZICS were affected (P < 0.01) by BCSc in all the times, being better hB, and not showing FL effect or of the interaction. Additionally, were observed correlations (P < 0.01) among the different ZICS. In variables related to OR an effect (P < 0.01) was demonstrated in the number of F3 and CL according to the BCSc; upper in the hB cows, not statistical differences were founded for F1 and F2. The test of survival showed effect (P < 0.01) by BCSc at time OR PP for F3 and CL, in the statistical Logrank Test and Peto-Wilcoxon Test, showing a faster fall of the curve in the hB animals.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 53 As conclusion the BCSc could be associated positively with the ZICS and inversely with the time of ovarian activity postpartum. P076 Evaluation of COX-2 and PGES gene expression in whole blood during the peripartum of dairy cows Silva, E1; Gaivão, M1; Leitão, S1; Costa, L1; Mateus, L1* 1Department of Reproduction and Obstetrics, C.I.I.S.A., Faculty of Veterinary Medicine, Portugal During the peripartum period dairy cows are immunosupressed and predisposed to develop uterine infections. This has been associated to abnormal leukocyte function and to changes in neutrophil gene expression. High intra-uterine levels of prostaglandin E2 (PGE2) were associated with delayed uterine involution and with the severity and persistence of endometritis. PGE2 production is stimulated by LPS of gram-negative bacteria that contaminate the puerperal uterus and act as a mediator of the inflammatory response. PGE2 synthesis is accomplished by cyclooxygenase 2 (COX-2) and prostaglandin E synthase (PGES). The objectives of this study were to evaluate in whole blood: i) the pattern of COX-2 and PGES gene expression during the peripartum period and, ii) the gene expression response to LPS stimulation during peripartum. Blood was collected from 17 dairy cows (9 had a normal puerperium and 8 developed uterine infection) at 1 and 2 weeks before parturition (wbp), at parturition and at 1 week after parturition. COX-2 and PGES gene expression, before and after whole blood stimulation with LPS, were quantified by Real Time PCR. Results were normalized with the housekeeping gene ß2MG. COX-2 gene expression decreased until 6 hours before parturition and then significantly increased (p<0.0001). PGES gene expression significantly decreased (p<0.0001) until 6 hours after parturition and then increased. After LPS stimulation, COX-2 and PGES gene expression significantly increased (p=0), compared to non-stimulated samples: COX2 gene expression significantly (p<0.0001) increased until 6 hours after parturition and then was kept fairly constant; PGES gene expression decreased from 1 wbp until parturition and then significantly increased (p<0.0001). This higher gene expression after parturition upon LPS stimulation suggests a higher potential inflammatory response. This can be of clinical relevance as at parturition neutrophils migrate to the uterus and mammary gland. COX-2 and PGES gene expression were similar in animals with or without uterine infection and therefore were not suitable markers of predisposition to infection. P077 The characteristic of ovarian function and endocrine status in pregnant cows during early period after insemination Matsui, M1*; Shimada A1; Yagi, K1; Kida, K2; Miyamoto, A3; Miyake, YI1; 1Department of Clinical Veterinary Science, 2Field Centre of Animal Science and Agriculture, and 3Graduate School of Animal and Food Hygiene, Obihiro University of Agriculture and Veterinary Medicine, Japan Introduction Management to maximize reproductive performance is one of the highest priorities in dairy production. However, in the last decade conception rate of artificial insemination (AI) has been declined. The importance of progesterone (P4) released from corpus luteum (CL) during early pregnancy in cows is well established. However, characteristics of CL during early pregnancy are not well known. Full understanding of the ovarian function during early pregnancy is necessary to improve conception rate after AI. The objective of this study was to determine the characteristic of ovarian function of pregnant cow during early period after insemination. Methods To determine the characteristics of ovarian function of pregnant cow, AI was performed on 49 cows. Ovulation was confirmed in all cows on the day following AI (day 1= D1). To examine ovarian structures ultrasound examination was performed on D6 and D14. Diameters of CL (at D6 and D14) and follicle (the largest follicle at D6) were recorded. Blood samples were also

collected on D6 and D14. Plasma P4 (on D6 and D14) and estrogen (E2, at D6) were analyzed by EIAs. Pregnancy diagnosis was performed on D35 and D60 using ultrasonography. Results Thirty-two cows were pregnant. CL diameter of pregnant cows increased (p<0.05) from D6 to D14. In contrast, CL size did not change in non-pregnant cows. At D14, diameters of CL in pregnant cows were larger (p<0.05) than that of non-pregnant cows. Plasma P4 levels increased from D6 to D14 in both pregnant and non-pregnant cows. There was no difference in P4 level between pregnant and non-pregnant cows at D6 and D14, respectively. In pregnant cows, the ratio of increase of P4 from D6 to D14 (P4 at D14 / P4 at D6) tended to be higher (p=0.09) than that in non-pregnant cows. At D6, plasma E2 levels in non-pregnant cows were higher (p<0.05) than that in pregnant cows. However, the diameter of a largest follicle in non-pregnant cows at D6 was not different from that in pregnant cows. Conclusions The results showed that the development in size and P4 secretion of CL from D6 to D14 in pregnant cows were higher than in non-pregnant cows, and E2 secretion from a dominant follicle in first follicular wave after insemination had an inhibitory effect on conception. These results suggest that characteristic of ovarian function and endocrine status in pregnant cows is already formed during early period after insemination. P078 Relationships between seminal plasma proteins (SPPs) and fertility in tropically adapted beef bulls McGowan, M1*; Mayes, J1; Moura, A2; Burns, B3; Holroyd, R3

1School of Veterinary Science, University of Queensland, Australia; 2Department of Animal Science, Federal University of Ceará, Brazil; 3Animal Science, Department of Primary Industries and Fisheries, Australia Introduction There is a large amount of variation in calf output from individual bulls in multiple-sire mating groups in northern Australian beef herds. Part of this variation can be explained by the findings from standard bull breeding soundness examinations, particularly percentage of normal sperm in the ejaculate of each bull prior to mating, but does not account for all of the variation. Some of this variation might be explained by a relationship between various SPPs. Significant relationships have been found between various SPPs and conception rates in Holstein bulls in the USA (Killian et al., 1993). Objective Implement a preliminary study to determine if seminal plasma from tropically adapted bulls contain similar SPPs to those detected in Holstein bulls. Methods Seminal plasma samples from 20 two year old tropically adapted (Brahman and composite) bulls with >70% normal sperm were analysed using 2-dimensional electrophoresis at the Pennsylvania State University, USA. Proteins were separated by 2-dimensional SDS-PAGE followed by staining with Coomassie blue and analysis of polypeptide maps using PDQuest software. Proteins were identified by capillary liquid chromatography nanoelectrospray ionization tandem mass spectrometry (CapLC-MS/MS). Results Some fertility related proteins present in the semen of Holstein bulls are also present in the seminal plasma of Australian tropically adapted bulls. These proteins include Albumin, Osteopontin, Clusterin, BSP-30kDa, Prostaglandin D-synthase, Spermadhesin Z13 and BSP A1, A2 and A3 complex. There was substantial variation between these bulls in the concentrations of many of the SPPs detected. Conclusions Our preliminary study showed that similar SPPs were present in the seminal plasma of tropically adapted beef bulls. Further investigations will be conducted on larger numbers of bulls to establish the relationships between SPPs and other male fertility traits. Killian, G.J., Chapman, D.A., Rogowski, L.A., 1993. Fertility-associated proteins in bull seminal plasma. Biology of Reproduction 49, 1202-1207.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 54 P o s t e r A b s t r a c t s P079 Evaluation of oestrus detection efficacy and accuracy by three methods in a confinement or pasture management system with Holstein–Friesian cows Mee, JF1*; Palmer, MA2; Olmos, G1,3; Boyle, LA1

1Dairy Production Department, Moorepark Dairy Production Research Centre, Teagasc, Ireland; 2Royal (Dick) School of Veterinary Studies, University of Edinburgh, Scotland; 3School of Agriculture, Food Science and Veterinary Medicine, National University of Ireland The objective of this experiment was to compare the efficacy of three methods of oestrus detection [visual observation (VO), tail paint (TP) and radiotelemetry-HeatWatch® (HW)] in two management systems [cubicle housing with a total mixed ration (HOUSED) and rotational pasture with concentrate supplementation (GRASS)]. The 46 randomly allocated and blocked, spring-calving Holstein-Friesian cows were monitored by the three oestrus detection methods simultaneously from ten days postcalving for nine weeks on the same farm. The occurrence of nine selected behaviours associated with oestrus was also recorded during the thrice daily 20 minute visual observation sessions. Thrice weekly milk sampling for progesterone analysis (EIA) was used to determine the dates of true standing oestrus events (oestrus detection accuracy). Data were analysed by proc Frequency, Genmod, Npar1way, Ttest and Univariate, as appropriate, in SAS. All three detection methods had a higher oestrus detection efficacy in the GRASS (VO 59, TP 65 and HW 69%) compared to the HOUSED treatment (VO 20, TP 26 and HW 37%) (P<0.001). There was no difference in the accuracy of oestrus detection between treatments. Within each treatment there was no difference between the efficiency and accuracy of the three detection methods. More cows expressed sub-oestrus (39 vs 13%) and fewer expressed standing oestrus (52 vs 91%) in the HOUSED compared to the GRASS treatment, respectively (P<0.05). The intervals between calving and first, second and third standing oestrus were longer in the HOUSED than the GRASS treatment, significantly so for second standing oestrus (69 and 55 days, respectively, P<0.05). During the observation sessions there was a higher frequency of standing to be mounted in GRASS than in HOUSED cows (median, Q1, Q3: 3,2,4 and 1,1,1.5, respectively, P<0.01). These results have implications for management of oestrus in confinement systems indicating that irrespective of the oestrus detection method employed, significantly less oestrous events will be detected than if cows were given access to pasture. P080 Prognostic assessment of endometrial biopsy findings in clinically healthy cattle Merbach, S1*; Ellenberger, C1; Schult, J2; Hoedemaker, M2; Heilkenbrinker, T3; Sobiraj, A4; Schoon, D1; Schoon, HA1 1Faculty of Veterinary Medicine, Institute of Veterinary Pathology, University of Leipzig, Germany; 2University of Veterinary Medicine Hannover, Clinic for Cattle, Germany; 3Chamber of Agriculture Lower Saxony, Animal Health Department, Germany; 4Faculty of Veterinary Medicine, Large Animal Clinic for Theriogenology and Ambulatory Services, University of Leipzig, Germany Introduction Current studies show, that endometrial biopsy in cattle is a meaningful diagnostic tool for fertility related alterations such as subclinical endometritis, periglandular fibrosis (‘bovine endometrosis’) and angiosclerosis. There aren’t any confirmed results about the prognostic relevance of the findings, especially considering the quantity of alterations. Hence, the aim of this study was to document the current endometrial status of clinically healthy cows with at least one calving having artificial insemination later on. According to clinical data the animals were separated into 2 groups (pregnant/non pregnant) and by comparing histological and clinical results it should be investigated which endometrial findings, considering their degree, are compatible with pregnancy. Material and methods 2 endometrial biopsies were postpuerperally taken from 262 dairy cows (aged 2-12 years) with 1-10 calvings and examined by lightmicroscopy. Clinical data of 200 animals were

available. Data were analysed by one-way ANOVA and chi2-test (P≤0.05). Results Only 38 cows showed an endometrium without pathological findings. Endometritis was diagnosed in 98 animals, 10% having purulent, 90% nonpurulent character varying in degree. Bovine endometrosis was found in 129 cases (78% mild). A statistically significant influence of endometrosis on pregnancy could not be confirmed. Combined endometritis and endometrosis could be assessed in 65 cows, a statistically firm connection between the 2 alterations does not exist. Angiosclerosis was diagnosed in 178 cows, the degree increasing with the number of calvings (P=0.046). In 175 animals pregnancy testing was positive, 25 remained empty. Endometritis can be considered as main reason therefor as with a higher degree of inflammation the number of pregnant cows decreases (P=0.004) while the number of required inseminations per cow (up to 5 times) increases (P=0.005). Conclusions Due to the low number of empty cows in this study it can be assumed that, as in the mare, the sampling of endometrial biopsy does not have any negative influence on the reproductive performance of dairy cattle. The same applies for mild endometrial lesions (endometritis and endometrosis), while moderate and severe predominantly non purulent endometritis not detectable by any clinical examination including cytology does have a negative influence on reproductive performance. The current study cannot come to any prognostically relevant conclusion about endometrosis of a higher degree as there are only very few animals with such alterations. P081 Effect of linoleic acid in the production of PGF2α in bovine endometrial cells in vitro Mesa, C*, Giraldo, CA., Angulo, J, Ruiz, ZT, Olivera-Angel, M. Grupo de Reproducción - Fisiología y Biotecnología, Facultad de Ciencias Agrarias, Universidad de Antioquia, Colombia Introduction In the traditional beef cattle production in Colombia (Bos indicus and their crosses) the postpartum cows decrease their body condition and reduce their productivity because the energy supply fails to satisfy the animal’s requirements. We have developed a bypass fat supplementation system with a correct proportion of omega-6 to reduce the negative energy balance and improve productive and reproductive parameters. It is widely known that one of this polyunsaturated fatty acids (linoleic acid, C18:2) is essential to produce arachidonic acid, which is a precursor of PGF2α. This prostaglandin plays a major role in luteolysis, uterine involution, and birth contractions. Objective The purpose of this work was to understand the effect of the linoleic acid in the production of PGF2α in bovine endometrial cells in vitro, associating the degree of apoptosis in luteinized granulosa cells with the amount of PGF2α produced from endometrial cells treated with linoleic acid. Materials and methods Endometrial and granulosa cells were isolated from reproductive tracts collected in the local slaughterhouse. Endometrial cells were cultured for 48 hours with 250 nM of oxytocin and four groups of linoleic acid supplementation were designed (0, 1, 10 and 100uM). After linoleic acid supplementation the endometrial culture medium was extracted and placed in luteinized granulose cells during four exposure times (48, 50, 62 and 86 hours). Then the proportion of granulose apoptosis was measured by AO/EB test. Results The percentage of apoptotic granulosa cell treated with culture medium from endometrial cells increased as linoleic acid dose and exposure time increased, especially between the 50 and 62 hours. Conclusions We speculate that this dose-time effect is dependent on PGF2α production by endometrial cells treated with linoleic acid but we did not measured PGF2α directly.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 55 P082 An abnormal gonadal development in bovine XY female may be caused by the formation of iso-Y chromosome during meiosis Miyake, YI1*, Matsui, M1, Moriyama, C2, Kamimura, S2 1Department of Clinical Veterinary Science, Obihiro University of Agriculture and Veterinary Medicine, Japan; 2Department of Veterinary Science, University of Miyazaki, Japan Introduction It has been reported that some types of chromosomal aberration relate with some types of abnormal development of genital organs in domestic animals, especially in cattle. Those animals with absolute or relative sterility are the object of that research; 1) to eliminate them from herd, and 2) to understand the abnormal conditions. Here, we would like to report some results about the cases of bovine XY female. Results 1. Clinical findings: A total of 9 cases were composed of Holstein (n=7), Japanese Black (n=1) and Jersey (n=1). Although all cases showed a female type in appearance, they did not show any estrous symptoms until 23 month old after the birth. Genital organs The ovaries and uterus were very small. Moreover, follicles and corpus luteum were not observed in ovaries. However, none of male reproductive organs were detected after slaughter. Chromosomal analysis The cells derived from blood, skin, spleen and kidney cultures showed 60,XY only. In the one smallest metacentric Y chromosomes, the only centromere was darkly stained by G-banded staining, although the short arm was darkly stained in normal Y chromosome. Detention of Sry gene by PCR method In the normal bull (60,XY), the Sry gene was detected by PCR method. On the other hand, the Sry gene was not detected in normal female (60,XX) and in the present cases (60,XY). Analysis of structure of Y chromosome by FISH method In Y chromosome from normal bull, one signal of the bovine Y-specific primers, BC 1.2 was hybridized to the distal area of short arm, but in Y chromosome from the present cases, two signals of BC 1.2 were hybridized to same position of both arms. In Y chromosome from normal bull, one signal of another bovine Y-specific primers, btDYZ-1 was hybridized in close proximity to the centromere of short arm, while in Y chromosome from the present cases, two signals of btDYZ-1 were hybridized to the same position of both arms. 6. Endocrinological measurements by RIA: The high levels of peripheral FSH and LH, and low levels of peripheral P4, E2, T and ir-inhibin were maintained during 23 days. Furthermore, the cyclic changes of hormones as normal female were not observed. Conclusion It was assumed that the abnormal Y chromosome from the present cases is iso-Y chromosome composed of double short arms which may be formed during spermatogenesis. Furthermore, a set of Y chromosome without Sry gene and X chromosome will induce gonadal dysgenensis and also abnormal endocrinologicalte status in the present bovine XY female. P083 Ovarian structures and ovulation rate following GnRH and progesterone treatment in anestrous Bos indicus cows Montiel, F1*; Lamothe, C1; Severino, V2 1Faculty of Veterinary Medicine, University of Veracruz, Mexico; 2Faculty of Veterinary Medicine, Autonomous National University of Mexico, Mexico Introduction Bos indicus cattle predominant in tropical regions exhibit low reproductive efficiency because of prolonged periods of postpartum anestrus, characterized by a pronounced delay of development of dominant follicles and first ovulation. Many treatments used for the re-establishment of postpartum ovarian cyclicity include the use of a vaginal insert impregnated with 1.9 g of progesterone (CIDR®, controlled internal drug-releasing device). In these protocols, GnRH has been used to synchronize follicular wave emergence and ovulation for timed artificial insemination (TAI). We evaluated the effect of treatment with CIDR plus GnRH on the

ovarian structures and ovulation rate of postpartum suckled anestrous Bos indicus cows. Methods On days -14, -7 and 0 (day 0=start of treatment), ultrasonography (US) was performed in all cows to confirm anestrus, but with the presence of ovarian follicles ≥10 mm diameter on day 0. On day 0, 68 cows received one of the following treatments: 1) GnRH+CIDR+GnRH (n=15): cows were given i.m. 100 μg of a synthetic GnRH (Gonadorelin) plus one CIDR, which remained in situ 7 days, plus 100 μg of GnRH at 24 h after the CIDR removal; 2) GnRH+CIDR (n=14): 100 μg of GnRH plus one CIDR (7 days in situ); 3) CIDR+GnRH (n=15): one CIDR (7 days in situ) and 100 μg of GnRH at 24 h after its removal; 4) CIDR (n=12): one CIDR (7 days in situ); 5) Control (n=12): no treatment. From days 1 to 7, US was performed daily to characterize changes in the ovarian structures as a result of treatment. From days 8 to 10, US was performed every 6 h to determine the time of ovulation. Results The groups treated with CIDR and GnRH showed greater number of follicles and larger average follicular size, compared to the control group (P<0.05). The ovulation rate was greater for the treatments that included GnRH (P<0.05). Ovulation rate was 93.3% (14/15) for GnRH+CIDR+GnRH, 85.7% (12/14) for GnRH+CIDR, 93.3% (14/15) for CIDR+GnRH, 41.6% (5/12) for CIDR and 25% (3/12) for the control group. The mean time for ovulation of follicles after CIDR removal was shorter for the treatments that included GnRH, averaging 56±4 h (P<0.05), compared to 75±2 h for the CIDR and control groups (P>0.05). Conclusions The use of GnRH at the start and end of treatment with CIDR was more effective for inducing resumption of ovarian activity and synchronizing ovulation in postpartum suckled anestrous Bos indicus cows, compared to the use of CIDR alone. This suggests that the combination of CIDR+GnRH can be useful for achieving TAI in Bos indicus cattle. P084 Alterations in FSH secretion and pituitary responsiveness to follicular fluid after ovariectomy of dairy cows with high versus low number of antral follicles Jimenez-Krassel, F1, Berry DP Butler, S2, Mossa, F3*, Folger, J1, Smith, J1, Lonergan, P3, Ireland, JJ1, Evans, ACO3 1Department of Animal Science, Michigan State University, United States; 2Moorepark Dairy Research Centre, Teagasc, Ireland; 3Agriculture Food Science and Veterinary Medicine, University College Dublin, Ireland Introduction Number of antral follicles during follicular waves is variable among cattle but highly repeatable within individuals. High follicle numbers, while having no effect on peripheral oestradiol levels, are inversely associated with serum FSH concentration. The aim of this study was to compare FSH concentrations after ovariectomy and to determine the effect of follicular fluid (FF) treatments on suppression of FSH secretion in ovariectomized cows initially classified as having high versus low follicle numbers. Hormonal concentrations in dominant follicles of the surgically removed ovaries were also studied. Materials and methods Non lactating dairy cows (n=27), initially selected from 116 animals as having the highest or lowest numbers of ovarian follicles ≥ 3 mm in diameter after a single transrectal ultrasonographic examination, were synchronized and the number of follicles counted daily during an oestrous cycle. Based on peak number of follicles, cows with <20 (Low, n=6; mean age=4.5 y) and ≥30 follicles (High, n=6, mean age=4.7 y) were synchronized and ovariectomized at oestrus. Ovaries were weighed and measured. The dominant follicle was dissected, measured and FF isolated for each animal. Oestradiol, progesterone, inhibin-A, activin-A, follistatin and AMH concentrations were analysed. Blood samples were collected frequently between 1h before and 8d after ovariectomy. After one month, animals received 4 injections at 1h intervals (5ml/injection i.v.) of FF aspirated from bovine follicles. Blood samples were collected from 1h before to 2d after the first injection. Serum FSH concentrations were measured. ANOVA was used to compare High vs Low groups and independent t-tests were used to determine if individual means differed (P<0.05).

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 56 P o s t e r A b s t r a c t s Results Number (±SEM) of follicles (34±1.16 vs 14±1.39, P<0.01) ovarian volume (17.78±2.12 vs 12.59±1.12 cm3, P<0.05) but not ovarian weight or size of dominant follicles were greater in cows with high versus low follicle number. FF hormonal concentrations were not different between groups. FSH concentrations differed only (P<0.05) at 6h (High 0.30±0.02, Low 0.17±0.02 ng/ml) and 8h (High 0.33±0.02, Low 0.21±0.03 ng/ml) after ovariectomy, while there was no difference in the response to the FF challenge between the two groups. Conclusion We conclude that number of follicles during follicular waves of dairy cows is positively linked to ovarian size, but not to intrafollicular hormonal concentrations in dominant follicles, serum FSH levels after ovariectomy or capacity of FF to suppress FSH secretion. P085 Effect of oocyte collection techniques on blastocyst formation rate in South African indigenous Nguni cattle breed Raito, MB1, Mapeka, MH1, Mantiziba, CW1, Mphaphathi, ML1, Munyai, PH1, Schwalbach, LM2, Greying, JPC2 and Nedambale, TL1* 1Agricultural Research Council-Livestock Business Division, Germplasm and Reproductive Biotechnologies, Private Bag X2, Irene, 0062, RSA; 2University of Free State, Department of Animal, Wildlife and Grassland Sciences, PO Box 339, Bloemfontein 9300, South Africa; *lucky@arc.agric.za In vitro maturation, fertilization and culture of indigenous South African Nguni cattle oocytes to blastocyst (BL) stage will permit germplasm of valuable or unique females to be preserved for future use. The objective of this study was to compare two oocytes collection techniques (slicing vs. aspiration). A total of 60 ovaries (15 per treatment) from Nguni and Holstein cattle were harvested from a local abattoir and randomly allocated between the slicing and aspiration method. Holstein ovaries served as a control. The quality and quantity of oocytes recovered with either technique were evaluated under the stereo microscope; then matured in M199 supplemented with 10% fetal bovine serum, 1μg/ml for both FSH and LH at 39 oC in 5% CO2. Thereafter, fertilized in vitro per treatment group at 39 oC in 5% CO2 incubator. Following fertilization in Brackett and Oliphant’s (BO) medium, presumptive zygotes were cultured in vitro at 39 oC in 5% CO2, O2, and 90% N2. Total cleavage and blastocyst rate were recorded post-fertilization. Data were analyzed by ANOVA. There were no statistical differences in the rate of oocyte per ovary between the two oocyte collection techniques in Nguni or Holstein cattle. However, the rates of total cleavage, 8-cells and blastocyst were significantly higher for Holstein slicing group compared to Nguni group. Nguni groups resulted in lowest rate of blastocyst formation. In summary, Holstein group yielded better cleavage, 8-cells and blastocyst formation rate compared to Nguni group. This study also demonstrated that Nguni oocytes can be matured, fertilized and cultured to blastocyst stage in vitro. However, more studies are needed to improve the blastocyst formation rate of the Nguni breed. P086 A scoring system for oestrus detection in tethered dairy heifers Nordéus, K1*; Gustafsson, H1, 2; Båge, R1; Lundeheim, N3; Söderquist, L1 1Department of Clinical Sciences, Division of Reproduction, Swedish University of Agricultural Sciences, P.O. Box 7054, SE-750 07 Uppsala, Sweden; 2Swedish Dairy Association, P.O. Box 210, SE-101 24, Stockholm, Sweden; 3Department of Animal Breeding and Genetics, Division for Pig Breeding, Swedish University of Agricultural Sciences, P.O. Box 7023, SE-750 07 Uppsala, Sweden Introduction Deteriorating reproduction performance is a growing concern to the dairy industry. This decline may be due, in part, to weaker and shorter display of oestrus, resulting in insemination at an inappropriate time. To facilitate oestrus detection, we developed a scoring system for objective evaluation of different oestrous signs. In

the present study we evaluate if this system can be used to determine the onset of oestrus in tethered dairy heifers. Material and methods Six heifers of the Swedish Red Breed were kept isolated from each other and from other animals and monitored during a total of 16 oestrous cycles. From the onset of pro-oestrus until ovulation the animals were subjected to visual oestrus detection and ultrasonographical monitoring of the ovaries at four hourly intervals. Five oestrous signs were evaluated and scored: position (standing, getting up or lying), restlessness (strong, average or calm), lordosis (induced by eye contact, approach or touch), vaginal discharge (clear with high viscosity or cloudy with low viscosity) and appearance of external genitalia (red and/or swollen). The range of the scoring scale for each of the five signs was set according to the estimated relative importance of the sign. The sum of the scores for the five traits could range from 0-29 points. For the statistical analysis the observations during the 84 hours preceding ovulation were divided into ten different time groups. Results We found that the sum of the scores made 12-36 h before ovulation were significantly higher (approximately two times higher) than the scores before or after that period. The highest score was found for the period 18-24 h before ovulation. The average time from the end of oestrus (defined as the absence of lordosis) until ovulation was 12 ± 5 h 30 min. (mean ± SD), which implies that the period with the highest score occurred during early to mid-oestrus. Conclusions We suggest that this scoring system can be used as a practical tool for oestrus detection. However, the emphasis lies on the registration of lordosis, which is the only reliable sign of oestrus in tethered heifers. This is a problem in heifers that do not display lordosis during oestrus. The benefit of combining the five scores in a synergistic manner, i.e. to give a higher score when several signs are present at the same time, will therefore be the focus of further studies. P087 Comparison of plasma concentrations of insulin-like growth factor-I and blood metabolites in dairy cows with different milk production during periparturient period Novotny, F*; Valocky, I; Posivak, J; Morvayova, H; Valencakova, A; Iviciak, J; Cernota. S; Leso, B University of Veterinary Medicine in Kosice, Slovakia Negative energy balance associated with metabolic changes have importance effect on resumption of ovulatory activity following parturition. A total of 26 Slovak spotted breed and its crossbreds multiparous cows were used for the study. These were categorized into groups with lower than 7000 kg milk production (LPC) (n = 11) and higher than 7000 kg milk production (HPC) (n = 15) (mean 305 day milk yield). Dosage and quality of nutrition were adjusted precise according milk production calculated by computers schedule using in farm. Blood samples for analysis of IGF-I; NEFA (non-esterified fatty acids); urea; TG (triglycerides); glucose and AST (aspartate amino transferase) were collected twice weekly, from 21 days prepartum to 28 days postpartum. In all cows three weeks before parturition was body BCS (body condition score) 4. IGF-I were determined by radioimmunoassay (RIA) using kits S-2143 (Linco Ltd.) validated for bovine samples and metabolites by automatic biochemical analysis ALIZE (Lisabio) and by diagnostic tests (bio Mérieux and Randox). NEFA was determined in blood serum by spectrophotometry SPECOL 211 (Carl Zeiss Jena). LPC cows loosed after parturition 0,3-0,5 BCS and HPC cows 0,5 - 1,5 BCS. During three weeks before parturition we found significantly lower concentrations of IGF-I in LPC (172,6 ± 19,3 ng/ml) vs. (201 ± 36,7 ng/ml) in HPC (P<0,05) in third week prepartum and (157,7 ± 2,7 ng/ml in LPC vs. 182 ± 9 ng/ml in HPC) (P<0,05) one week prepartum. In postpartum period we recorded higher concentrations of IGF- I in LPC opposite HPC (108 ± 47 ng/ml vs. 93 ± 45 ng/ml) (P>0,05) in first week postpartum. Significantly difference in concentrations of IGF-I between LPC and HPC we found in second and third week postpartum (112 ± 37,4 ng/ml LPC vs. 82,5 ± 42,07 ng/ml HPC) ) (P<0,05). In four week postpartum we recorded only slightly differences in levels of IGF–I between groups. During first three weeks postpartum were detected significantly higher concentrations of

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 57 NEFA in HPC (0,44 ± 0,08 mmol/l) opposite LPC (0,23 ± 0,11 mmol/l) ((P<0,01). In postpartum period we found also slightly increase of concentrations of glucose in LPC and slightly decrease of glucose in HPC (P>0,05). We recorded no significantly changes of concentrations of TG, urea and AST between groups during ante and postpartum period. Dynamic changes IGF–I, NEFA and glucose in plasma or serum may help predict and evaluate relationship between milk yield, nutrition and subsequent reproductive status of high producing cows. (Funded by VEGA 1/3484/06 and AV 4/0009/07) P088 Effect of restricted suckling on superovulatory response and reproductive performance in early postpartum Japanese Black cows Oshima, K1*; Ochiai, Y1; Pradhan, R2; Kojima, T1; Yamamoto, N1

1National Agricultural Research Center for Western Region, Oda, Shimane, Japan; 2Graduate School of Hiroshima University, Higashi-Hiroshima, Hiroshima, Japan

Factors such as suckling and nutrition affect the reproductive performance after parturition in cows. The objective of this study was to investigate the effect of restricted suckling on the superovulatory response and subsequent reproductive performance in early postpartum Japanese Black cows. Fifty cows were used in this study. During the postpartum period, these cows were fed 100% of the estimated daily nutrient requirements according to the Japanese Feeding Standard for Beef Cattle (2000). Body weights of cows and calves were measured twice monthly. The average daily gain (ADG) was calculated for each month. At 7 days postpartum, the cows were classified into 2 groups: (1) continuous access of calves to them from birth to weaning at 3 months postpartum (ad libitum suckling; n = 21) and (2) twice daily suckling by calves that were penned adjacent to them (restricted suckling; n = 29). All cows received a controlled internal drug releasing device (Easi-Breed; InterAg, Hamilton, New Zealand) at 40 days postpartum and were subsequently superstimulated with a total dose of 20 armour units FSH (Antrin 40; Kawasaki-Mitaka, Kanagawa, Japan) twice daily, with gradually decreasing doses from day 45 until day 47. Embryos were nonsurgically collected 7 to 8 days after estrus. The ovaries were examined by ultrasonography and the number of CL and remaining follicles (RF) were counted. After uterine flushing, the cows were re-employed for reproductive purposes. The intervals to first estrus and conception after flushing and days open were examined. Data were analyzed by Student’s t-test. ADG of cows in the second month postpartum in the ad libitum suckling group was significantly smaller than that in the restricted suckling group (P < 0.05). There were no significant differences between the ad libitum and restricted suckling groups in the number of CL (20.7 ± 10.0 vs.17.0 ± 9.2), RF (4.7 ± 3.6 vs. 5.9 ± 7.0), recovered ova or embryos (10.6 ± 7.4 vs. 11.1 ± 8.8), and transferable and freezable embryos (6.4 ± 5.4 and 5.2 ± 5.0 vs. 7.4 ± 7.0 and 6.2 ± 6.9). In contrast, the intervals to first estrus and conception after flushing and days open in the restricted suckling group were significantly shorter (P < 0.05) than those in the ad libitum suckling group (9.0 ± 5.6, 27.1 ± 27.5, and 83.7 ± 27.5 vs. 28.0 ± 23.6, 44.2 ± 30.1, and 101.0 ± 30.2). These results suggest that restricted suckling in early postpartum Japanese Black cows does not affect the superovulatory response and embryo quality; however, it does affect their reproductive performance after flushing.

P089 Integration of CIDR in timed artificial insemination protocol in lactating dairy cows Pancarci, SM1*, Gurbulak, K2, Gungor, O1, Orkun Demiral, O3, Thatcher, WW4 1Department of Obstetrics,Gynecology & Reproduction, Faculty of Veterinary Medicine, Kafkas University, Turkey; 2Department of Obstetrics,Gynecology & Reproduction, Faculty of Veterinary Medicine, Erciyes University, Turkey; 3Department of Artificial Insemination and Reproduction, Faculty of Veterinary Medicine, Erciyes University, Turkey 4Department of Animal Sciences, University of Florida, United States The objective of this study was to investigate the use of a controlled internal drug [progesterone] release (CIDR) device inserted concurrently with or the day after initiation of Ovsynch/TAI protocol. Lactating Holstein dairy cows in central Turkey (n=162) were assigned to receive the Ovsynch protocol (OVSYNCH; synchronization of ovulation by injecting GnRH 7 d before and 56h after PGF2α, followed by one fixed-time AI [TAI] 16 to 18 h after the second GnRH injection; n=49], Ovsynch plus a CIDR insert for 7 d, beginning at the first GnRH injection (OVSYNCH + CIDR7; n=63) or Ovsynch plus a CIDR insert for 6 d, beginning the day after the first GnRH injection (OVSYNCH + CIDR6; n=50). All cows used in this study were restricted to not having a detected estrus prior to TAI and had a palpable follicle at TAI. Pregnancies were diagnosed with transrectal ultrasonography and palpation per rectum 32 and 45-60 days after TAI, respectively. Pregnancy rates at 32 days after TAI were 30.6% (15/49), 39.7% (25/63) and 54.0% (27/50) in OVSYNCH, OVSYNCH + CIDR7 and OVSYNCH + CIDR6 groups, respectively. The stepwise logistic regression procedure indicated that cows in OVSYNCH + CIDR7 group had 0.56 (0.26-1.19) times less chance to get pregnant than those in OVSYNCH + CIDR6 group at 32 days after TAI. Similarly, cows in OVSYNCH group had 0.38 (0.17-0.86) times less chance to get pregnant than those in OVSYNCH + CIDR6 group at 32 days after TAI. Pregnancy rates 45-60 days after TAI were 14.3% (7/49), 20.6% (13/63) and 38.0% (19/50) in OVSYNCH, OVSYNCH + CIDR7 and OVSYNCH + CIDR6 groups, respectively. Significant differences (P<0.05) indicated that cows in OVSYNCH + CIDR7 group had 0.42 (0.18-0.98) times less chance to get pregnant than those in OVSYNCH + CIDR6 group when examined at 45-60 days after TAI. Likewise, cows in OVSYNCH group had 0.27 (0.10-0.73) times less chance to get pregnant than those in OVSYNCH + CIDR6 group at 45-60 days after TAI. Embryonic losses between day 32 and days 45-60 were not significant: 53.3% (8/15), 48% (12/25) and 29.6 (8/27) in OVSYNCH, OVSYNCH + CIDR7 and OVSYNCH + CIDR6 groups, respectively. Higher pregnancy rates in OVSYNCH + CIDR6 group at 32 and 45-60 days after TAI may be attributable to a better follicle turnover during the Ovsynch protocol leading to a higher pregnancy rate at 32 days and lower embryonic mortality between 32 to 45-60 days. Such reproductive management strategies warrant further investigation. Key words: CIDR, Ovsynch, pregnancy, cow P090 Predicting time of parturition in Holstein Friesian cows by using C6 Birth Control® Paolucci, M.1*; Di Giambattista, A.1; Sylla, L.1; Menichelli, M.2; Banchio, A.3; Monaci, M.1 1Department of Pathology, Diagnostic and Veterinary Clinics, via San Costanzo 4, 06126 Perugia, Italy & 2University of Perugia’s Dairy Farm, 06051 Casalina, Italy; 3Sisteck Electronic Systems, via Atene 3, 41049 Sassuolo, Italy Introduction Predicting of the calving is of critical value as it enables the rescue of new born calve. In dairy herds, it may be difficult to monitor individual animal in the pre partum period. Several findings such as the decrease of rectal or vaginal temperatures, blood progesterone and mammary electrolyte levels were proposed in order to predict the onset of parturition (Aoki et al., 2005, Anim. Reprod. Sci. 86:1-12; Bleul et al., 2006, J. Dairy Sci.89:3059–3065). Recently, it has been validated in equine industry an electronic system whose generates a radio frequency signal transmitted to the Global System

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 58 P o s t e r A b s t r a c t s for Mobile communications upon activation of the device due to the pressure of foetus and fluid engaged into the birth canal http://www.sisteck.com/. There has been no such report in calving management, therefore the objective of the present study was to determine the onset of delivery by using the C6 Birth Control® on both calving Holstein Friesian heifers and cows. Materials and methods The study has been carried out on 17 heifers and 15 Holstein cows. Upon observation of signs of approaching parturition the C6 birth control® device was applied just upon the ventral commissure of the vulva. At the onset of parturition the obstetric examination was carried out in order to determine the extent of cervical dilation, foetal presentation, position and posture. Length of parturition time from alarm activation to complete foetal expulsion was recorded. Results The meantime needed to apply the device was 5.36±0.04 and 4.54±0.03 min. for heifers and cows, respectively (P<0.01). All calving occurred with foetus in anterior presentation and dorso-sacral position. The length of parturition was 71.41±23.50 min. and 48.73±27.87 min. for heifers and cows, respectively (P<0.01). At alarm activation, 62.5% of the calves presented the forelegs protruding from the vulvar outlet. Calving progression in heifers were 44.90±15.99, 60.30±19.31 and 71.41±23.50 min., for complete carpal junction, head and hind legs movement throughout vulvar outlet, respectively, whereas for cows were 36.56±19.60, 39.92±21.52 and 48.73±27.87 min., respectively. 41.18 % of heifers have required pulling assistance and 17.65% of them presented dystocia due to postural defects. Only 13.33 % of cows have required easy pulling and all calves survived during the trial. Conclusion Application of the C6 birth control® is suitable in dairy calving management as previously reported in the mare. Calve losses could be prevented by timely observation and appropriate timing of obstetrical assistance P091 Reproductive efficiency of three categories of Nelore (Bos taurus indicus) females submitted to two different breeding systems Patrício, FAC.*, Souza, FA; Gonçalves, PEM, Andrade, VJ; Martins, JAM; Vale Filho, VR; Emerick, LL; Leite, TG. Medicine Veterinary School – Federal University of Minas Gerais – Brazil; e-mail: vejoan@gmail.com Introduction Pregnancy rate is an important characteristic for production systems in beef cattle, once it can increase economic retuns, and allow the application of different animal breeding programs based on a greater annually replacement rate. However, the optimization of fertility does not only mean to promote higher birth rates every year with indiscriminate use of input, but also the control of reproduction, considering that not always a single technology is useful for any production system and the animals used are normally different. The aim of this study was to compare the reproductive efficiency of three classes of Nelore females under two distinct breeding systems. Material and methods A total of 862, two year old heifers (T1), 1046 three year old cows (T2) and 3299 over three years old cows (T3), were randomly divided into two management groups: G1 = bred by artificial insemination (AI) and G2 = natural matings. Gestation diagnostic was realized 45 and 90 days from beginning of breeding season, by rectal palpation. Pregnancy rates at 1st and 2nd gestation diagnostics were compared within each treatment (G1T1; G1T2; G1T3; G2T1; G2T2 and G2T3) by chi-square test at 5% level. Results and discussion It was registered differences in pregnancy rates for G1 among the three animal categories (P<0.05), with T1 showing the best results. For the G2, differences were recorded only between T1 and T3 (P<0.05). Comparing the two breeding managements, there were no differences (P>0.05) among the same reproductive categories when bred by AI or natural matting, eventhough differences were registered among G1T1, G1T2, G1T3, G1T1, G2T2 and G2T3 (P<0.05). Conclusion The breeding system did not affect pregnancy rate within each animal category of Nelore females, suggesting that even in large

herds artificial insemination did not compromised the final reproductive efficiency. P092 Risk factors associated with the development a ND severity of puerperal metritis Pécsi, A1*, Földi, J2, Abonyi-Toth, Zs3, Huszenicza, G4 1Animal Health and Physiology, Faculty of Agricultural Science, University of Debrecen, Hungary; 2Clinical Study Team, Registration, Intervet International B.V. Boxmeer, The Netherlands; 3Biomathematics and IT, Fac Veterinary Sci, Szt István Univ, Budapest, Hungary; 4Obstetrics and Reproduction, Fac Veterinary Sci, Szt István Univ, Budapest, Hungary Puerperal metritis is the bacterial complication of the early puerperium, which occurs during the first two weeks after calving. Its more severe form accompanied by systemic signs of disease (dullness, prostration) including pyrexia is often called toxic puerperal metritis. A case-control study was performed in two large-scale dairy herds to evaluate the influence of certain risk factors i.e. (1) manual intervention at calving; (2) retained fetal membranes and (3) uncompensated negative energy balance characterized by (3a) ketonuria or (3b) hyperketonaemia. During the statistical analyses, we separately evaluated the effect of different predisposing factors on the development and severity of puerperal metritis. In the case of manual intervention (assistance) during calving and retained placenta significantly (P<0.001) more cases of PM developed; however, these factors did not have an effect on the severity of the disease. Studying the influence exerted by energy-deficient status of the cow we demonstrated that higher BHB levels predispose cows to the development of metritis and increase the probability that the severe form of metritis will develop. A ketonuric reaction of at least 2+ predisposes cows to metritis, while a more strongly positive test increases the likelihood that the more severe form of metritis will develop. Presence of certain predisposing and influencing factors together with early indicator symptoms are good predictor of the disease. Risk of PM is significantly higher, when manual intervention during calving and/or RFM and/or NEB characterized by ketonuria or hyperketonaemia is present, while elevation of rectal temperature between pp days 3-5 is the indicator of the disease. TPM occurs more frequently, when, beside the above mentioned factors, milk yield at the previous lactation was >9400 l and milk yield between pp days 3-5 is decreased. By means of our results the post partum monitoring of cows on large scale dairy farms can be better organized, which enhances the timely diagnosis of PM and may result in a more efficacious therapy and consequently, decreasing of economic losses due to the disease. We also exhibited the relationship between PM and other diseases of involution. By means of our observations a realistic estimation can be made on the relationship of PM with milk yield and its detrimental effect on reproduction performance. P093 The effect of maternal protein during pregnancy and pelvic diameter on dystocia and birthweight in the bovine Perry, V1*, Micke, G1, Sullivan, T1, Perkins, N2 1VetSchool,UQ,Goondiwindi,QLD,Australia; 2Ausvet Health Services, Toowoomba, Qld. 4350 There has been a major experimental focus on determining the impact of low protein diets on experimental laboratory animals but few on large ruminants of agricultural importance. Protein is the most deficient nutrient in the Australian Rangelands. To determine if low dietary protein concentration in the first two trimesters of pregnancy alters calf growth and dystocia levels in heifers, 120 Bos indicus cross heifers were inseminated with semen from the same bull on a single day and allotted to four treatment groups. These were fed sorghum and cotton seed meal diets that were high (13.4 CP/KgDM) or low (4.7 CP/KgDM) protein and contained 7.7 MJME/KgDM during the first and second trimesters. During the third trimester all heifers received a ration of 11.2 CP/KgDM and 7.6 MJME/Kg. A total of 71 heifers calved (Low/Low n=19, Low/High n=17, High/Low n=18, High/High n= 17). Birth weights for these groups were (means ± se)

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 59 29.9±0.9, 33.4±1.0, 31.3±0.9, 32.9±1.0, respectively. At calving birth was coded as 0 (eutocia; n=61) or 1 (dystocia including easy and hard pulls, malpresentation, caesarean section; n=10). Pelvic area of the heifers was taken by Rice Pelvimeter two months prior to mating and at four months gestation. There was a relationship between pelvic area at selection with dystocia (p=0.08) such that a unit increase in pelvic area reduced the likelihood (odds) of dystocia by 0.956 fold (p=0.07). There was no relationship between pelvic area taken at 4 months and dystocia. There was no effect of nutrition in trimester 1 on calf birth weight. There was a significant effect (p=0.011) of nutrition in trimester 2; high nutrition resulted in heavier calves (8.2%). The odds ratios indicate that a one unit rise in calf weight (1kg) results in a 1.44 fold increase in the likelihood (odds) of dystocia (p=0.003). The effect of nutrition during critical periods of pregnancy on birth weight, and the relationship between high birth weight and dystocia, is evident. This effect of high nutrition on birth weight during this window may indicate sensitivity of the developing fetoplacental unit to insult at this time. Reports that feto-pelvic disproportion accounts for the majority of losses in extensively managed herds (1) is supported. As well as economic loss for the grazier of the calf and or heifer there are welfare considerations which need to be addressed in the effective management of the heifer herd. 1. Johnson et al (1988) J Anim Sci; 66:1081 P094 Effect of body condition at calving on glucose, insulin and progesterone concentrations postpartum in dual-purpose cattle under tropical conditions Pinto-Santini, L1*; Drescher, K1; Martinez, N1; Ruiz, A2; Dominguez, C3; Rossini, M2 1Facultad de Agronomía, Universidad Central de Venezuela, Venezuela; 2Facultad de Ciencias Veterinarias, Universidad Central de Venezuela, Venezuela; 3Área de Agronomía, Universidad Rómulo Gallegos, Venezuela To evaluate postpartum (PP) changes in the glucose (G) and insulin (Ins) concentrations of dual propose (DP) cows with different body condition score (BCS) at calving, and their relation with the return of the ovarian activity (OA) through the plasma P4 levels, 28 cows (3/4 a 5/8 Bos taurus x 1/4 a 3/8 Bos indicus) were randomly assigned to 1 of 4 treatments (T) in a 2x2 factorial arrangement with 2 levels of BCS at calving (NIRD 1 to 5): high BCS (BCS1>2.5) and low BCS (BCS2<2.5), and 2 levels of feeding (FL): high and low: 115 and 85% of the maintenance energy requirements (MER), respectively (NRC, 1989). MER was estimated from individual body weight, and milk energy output was calculated using the 60 days of the previous lactation daily milk yield and its energy content. From the 4th day PP the cows were allocated individually and were fed with hay and a supplement during milking (6:00 and 16:00 hours). Serum samples were collected at 3, 15, 30, and 45 days PP, and G and Ins were determined by the glucose oxidase method (Henry, 1974) and ELISA (Insulin ELISA kit, GLight Diagnostic, USA), respectively. For P4, plasma samples were collected at 3, 15, 21, 30, 37 and 45 days PP, and assayed by RIA (DSL-3900 kit, Diagnostic Systems Laboratories Inc., Houston, TX). The data were analysed through MANOVA for repeated measurements in time (SAS, 1997), including the main effects and their interactions. On day 45 there was no effect of FL on the variables evaluated. The concentrations of G were similar for all T (P>0.05), but on day 45 there was a trend (P=0.08) the BCS in accumulated G levels (mg/dL) (BCS1=262.6; BCS2= 239.4). BCS affected Ins levels on all days evaluated with concentrations for days 3, 15, 30, and 45 of 9.3, 17.1, 25.8 and 34.2 mUI/ml for BCS1 and, 4.4, 8.6, 13.4 and 19.3 mUI/ml for BCS2, respectively. For P4, there was found only effect of the BCS at 37 and 45 days. The concentrations of P4 (ng/ml) for BCS1 and BCS2 were: 3.214 vs. 0.731 at day 37 (P<0.01) and, 4.321 vs. 0.885 at day 45 (P<0.01). The results provide evidence that there is a positive relationship between concentrations of Ins and BCS. Ins could be an indicator of nutritional status or EB of crossbred DP cows. The levels of Ins could play a direct central or local role in the reproductive function and could stimulate the secretion of leptin in the adipose tissue and indirectly

stimulate GnRH liberations from the hypothalamus. On ovary, Ins may stimulate the cellular proliferation and differentiation and steroid synthesis measures though P4. P095 Comparison of three diferent methods of bovine sperm separation: swim up, isolate and percoll on the viability and in vitro embryo production Polisseni, J1,2*; Carvalho, BC1; Pereira, MM1; Serapião, RV1; Batista, RITP1; Camargo, LSA1; Viana, JHM1; Sá, WF1; Iguma, LT1

1 Embrapa Dairy Cattle, Juiz de Fora, MG, Brazil1, Federal University of Juiz de Fora, Juiz de Fora, MG, Brazil2

Introduction The separation of bovine spermatozoa from seminal plasma is necessary to use in asssisted reproductive techonologies. The aim of this work was to compare three methods of sperm preparation, two of them based on colloidal silica particles, Percoll® and Isolate®, and another method based on sperm migration: swim up. We assessed the overall motility before and after the above mentioned procedures and in vitro embryo production rates (cleavage , 8 cell and embryo yield). Materials and methods A group of 453 cumulus oocyte-complexes (COCs) were obtained from slaughterhouse ovaries, matured, and fertilized in vitro at 38.8°C with 95% humidified air and 5% CO2. Frozen semen from one ejaculate of a single bull was used for all treatments and the 5 replicates. The sperm quality parameters were evaluated immediately after thawing and after sperm preparation for in vitro fertilization (IVF). After in vitro maturation, the COCs were distributed randomly across the three treatments: swim up, Percoll® and Isolate®. The presumptive zygotes were semi-denuded and cultured in CR2aa medium under the same atmosphere conditions used for IVF. Embryo morphology and quality were evaluated as previously described in the International Embryo Transfer Society manual (1998). The sperm motility were statistically analysed by ANOVA (P<0.05). The overall sperm motility and the number of embryos at the inicial stages of development were analysed with Kruskal-Wallis test. The rates of cleavage and blastocyst were compared with chi-square test. P<0.05 was considered significantly different. Results The sperm parameters before and after the three treatments were similar (P>0.05): 41±16.73 (before) and 64±8.94 (after); 46±9.62 (before) and 74±5.48 (after); 48±13.51 (before) and 71±8.94 (after) for swim up, Percoll® and Isolate®, respectively. When in vitro embryo production was performed, swim up (80.95%) technique produced higher (P<0.01) number of overall embryos than Percoll®

(75.0%) and Isolate® (65.92%). The percentage of 8 cells embryos (on day 3 after fertilization) was similar for swim up (37.95±6.77) and Isolate® (29.71±14.10). In contrast, both methods showed higher 8-cells rate than Percoll® (18.18±10.21) . W, blastocyst production rate (Day 8) was high (48.41% vs. 25.70% vs. 22.35) when swim up was used compared with Percoll® and Isolate®. We concluded that, in our condition, swim up technique had a better performance for sperm selection and enhanced capacity for embryo production in comparison with the Percoll® and Isolate® procedures. P096 Effect of winter nutritional management on the onset of puberty in beef heifers under range conditions Quintans, G1*, Scarsi, A2, Costa, S2, Moreira, R2, Ayala, W1 and Ibañez, W1 1National Institute of Agricultural Research, INIA, 33000, Ruta 8 km 281, Uruguay; 2University of Agronomy, Garzón 780, 12900, Uruguay After weaning, beef female calves loose weight when they are managed on native pastures during the winter season and this may delay the initiation of reproductive activity compromising the possibility of advancing the age of first mating (15 or 18 months old). Previous studies have shown that winter live weight gain (LWG), but not live weight (LW), is a very good predictor of fertility in heifers that are first mated at 18 month old. The objective of this study was to evaluate the effects of winter nutritional systems under grazing

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 60 P o s t e r A b s t r a c t s conditions on the onset of puberty in beef heifers in Uruguay.Thirty six Angus x Hereford heifer calves weaned (8 month old, 138.7+3.1 kg) were managed to achieve three gains of weight rates for 16 weeks (winter period): i) grazing on native pastures to loose weight (Low=L; n=12), ii) grazing on improved pastures of a mixture of Lotus corniculatus, Trifolium repens and Lolium multiflorum to allow animals to present moderate LWG (Medium=M; n=12), and iii) grazing on the same mixture pasture but to present high LWG (High=H; n=12). After, all heifers were managed on the same improved pastures during the following 27 weeks (spring and summer). Animals live weight (LW) was recorded at biweekly intervals. All heifers were blood sampled weekly for progesterone analysis from week 18 to 43 and puberty was defined as the first of two consecutive samples with progesterone greater than 1 ng/ml. During winter period daily LWG was 0.134±0.03, 0.385±0.03 and 0.535±0.03 kg/a for heifers in L, M and H treatments, respectively (P<0.05). Daily LWG during the spring was but during summer heifers in L group achieved higher (P<0.05) daily LWG than heifers in M and H groups (0.590± 0.05, 0.312± 0.05 and 0.363±0.05 kg/a for L, M and H respectively). The number of heifers that presented luteal activity at the end of the experiment was different between groups: 2/12 (17 %), 9/12(75%) and 7/12 (58%) for L, M and H treatments, respectively (P<0.05), being L lower than M and H. LW reached at puberty was similar between groups and heifers in H tended to attain puberty earlier (P=0.09) than heifers in L (434±13 vs 488±27 days of age). Winter LWG is a good predictor of ovarian cyclicity in heifers that are first mated at 15 or 18-20 month old. P097 Evidence for Interleukin-8 secretion in the bovine corpus luteum during mid-luteal phase and pregnancy in vitro Raddatz, S1,2*; Langner, K1; Hettel, C2; Beindorff, N2; Bollwein, H2; Schuberth, HJ1

1Institute of Veterinary Immunology, University of Veterinary Medicine Hannover, Germany; 2Clinic for Cattle, University of Veterinary Medicine Hannover, Germany Chemokines play a key role in the recruitment and activation of immune cells in the corpus luteum (CL). It has been reported previously that chemokines secreted by cells of the bovine CL attract monocytes and eosinophils and mediate the luteolytical activity of macrophages. Studies in other species revealed evidence for an additional involvement of neutrophils in the luteolytic process. In the present study, we investigated the possibility for CXCL8 (Interleukin-8)-mediated neutrophil recruitment in the bovine CL by analysis of the chemotactic activity of CL in vitro. Corpora lutea of 14 cows were collected in the mid-luteal phase and during pregnancy. Slices of each CL were incubated with Medium 199 at 37 °C up to 19 h to collect secreted chemokines. The supernatant was subsequently examined in a quantitative transmigration system with freshly prepared granulocytes from healthy, non pregnant cows. Total numbers of vital migrated neutrophils were quantified flow cytometrically. In addition, the presence of CXCL8 in the supernatant was determined by matrix-assisted laser desorption/ionization time of flight mass spectrometry (MALDI-PSD) and gel electrophoresis. The expression of CXCL8 was verified by quantitative RT-PCR analysis of total RNA extracted from frozen CL slices. Both, supernatants obtained from the mid-luteal CL (69% ± 6.9; p = 0.001) and CL graviditatis (56% ± 9.3; p = 0.01) resulted in significant migration rates of neutrophils compared to medium controls. Mass spectrometry analysis of the different supernatants revealed a distinct peak with a molecular mass of ~9.8 kDa corresponding with the mass of recombinant human CXCL8. A protein band of similar molecular mass was detected on silver-stained 10-20% Tris-tricine gradient gels. The expression of CXCL8 by cells of the bovine CL was shown by real-time PCR analysis, however, no significant differences were found between mid-luteal CL (2397 copies per 100 ng RNA) and CL graviditatis (2347 copies per 100 ng RNA). In conclusion, the present study revealed evidence for the expression and production of neutrophil chemoattractant factors by bovine CL in the mid-luteal phase and during pregnancy. In addition, it was proven that CL-generated neutrophil-chemotactic factors are functionally active. Whether this

leads to attraction of neutrophils into the CL in vivo and whether attracted neutrophils support or destroy luteal cells is subject of further investigations. P098 The effect of PMSG on tightness of estrus synchrony after treatment of norgestomet in association with GnRH or steroids in cattle Rastegarnia, A1*, Afsharnia, M2 1Department of Clinical Sciences, Faculty of Veterinary Medicine, Islamic Azad University, Urmia branch, Urmia, Iran; 2Graduated from Faculty of Veterinary Medicine, Islamic Azad university Urmia branch, Urmia, Iran Norgestomet-based programs hare been developed to synchronize estrus in cattle; estrus is suppressed in presence of a norgestomet implant, but occurs relatively synchronously following implant removal. The purpose of this study was to control of ovarian follicular growth using norgestomet implant with along either GnRH or steroids and also investigation the effect of PMSG on the tightness of estrus synchrony in dairy cattle. One-hundred-and-five Holstein cows with parity ranging from 1 to 4 and post partum period of > 60 days at unknown stages of estrus cycle were selected. Females in both groups received norgestomet ear implant (3mg of norgestomet) for 9 Days, and were randomly assigned into two groups considering their age, body condition score and parity. Females in group1 (n=53) received of steroids i..m.(norgestomet 3mg, estradiol valerate 5mg) at the time of implant insertion. Group2 females (n=52) received 0.25mg of gonadorelin i..m. at this time. All females were given 500μg of prostaglandin on day 7 and 400 IU of PMSG at the time of implant removal (day 9). Estrus detection was carried out every 6 hours for 7 days, commencing from 12 hours after removal of implant. Females that allowed to be mounted were identified (standing estrus) and inseminated with frozen semen 12 hours later. The results revealed that the addition PMSG had no effect on the frequency of estrus response in both groups (group1: 73.5% , group 2: 69.2%; P>0.05). The tightness of estrus synchrony (%), the interval from the end of treatment and the start to estrus and conception rates were similar (P>0.05) between group1 ( 91.6%, 41.2±1.6 h and 48.9%) and group2 (89.7%, 39±1.2 h and 55.8%). In conclusion using norgestomet implant for 9 days with combined of steroids or GnRH on day 0 and PG and PMSG on day 7 and 9 after implant insertion can be used to synchronize estrus cycle with acceptable pregnancy rates in dairy cattle. In this program injection GnRH or steroids has no significant effect on the reproductive indices. P099 BOVINE RENIN GENE EXPRESSION IN PREOVULATORY FOLLICLES AND CYSTIC OVARIAN DISEASE Rizzo, A,.*, Guaricci, AC., Minoia, G., Spedicato, M.*, Mutinati, M., Manca, R., Trisolini, C., Sciorsci, RL. Department of Animal Production, Faculty of Veterinary Medicine, Bari, Italy Recent evidence indicates that the ovarian renin-angiotensin system (RAS) may play a significant role in the process of ovulation and it may be involved in the etiopathogenesis of polycystic ovarian syndrome, in women. The aim of this study was to evaluate the renin mRNA expression in ovarian cystic wall and preovulatory follicle in cow . Total RNA was extracted from wall strips of bovine preovulatory follicle and cystic follicle, from ovaries collected at a local slaughterhouse, using a commercial kit allowing DNAse treatment on column during preparation. Retrotranscription of 2 micrograms total RNA was performed using SuperScript III First Strand (Invitrogen, Milan, Italy) and cDNA underwent PCR with specific intron-spanning primers chosen on the alligned sequences of Homo Sapiens renin gene (Genebank accession AY436324.1) and a partial Bos Taurus renin gene (Genebank accession XM589248.3). A test was conducted to check the exponential phase amplification of renin gene. This test employed 120μl final volume PCR mixture (200 ng of cDNA, 1 unit of HotMaster taq polymerase, 0.25mM dNTPs, 1

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 61 mM each primer) taking 10μl from the tube starting from cycle 28 up to 35. The same procedure was followed for the house-keeping β-actin gene utilized to demonstrate the integrity of extracted RNA and for the semi-quantization of renin gene expression relative to a normalized level of transcription. PCR amplification profile includes a denaturation step of 94°C for 2 min, 34 cycles of 94°C for 45s, 58°C (56°C for β-actin) for 45s, 72°C for 1min, and a final step at 72°C for 5min. All the amplification products, together with a 100 bp DNA ladder, were ran on 1.5% agarose gel stained with Ethidium Bromide and images were digitally captured with a CCD camera. Densitometric analysis was performed using the QuantityOne software (BioRad, Milan, Italy) and mRNA renin expression was normalized against the level of β-actin mRNA. A high renin gene expression was evidenced in both preovulatory and cystic bovine follicles. The expected size fragments: 188 bp for renin and 243 bp for β-actin were observed after gel electrophoresis. The PCR quantification of Renin expression was performed calculating the ratio between the amount of PCR product in the linear amplification range of the target gene and the endogenous reference gene. The relative Renin gene expression level in the preovulatory follicle is 1.15 time higher than in the cystic follicle. These results well correlate with previous evidence, conducted by Doppler ultrasonography. In fact, our studies evidenced a more abundant vascularization in the preovulatory follicle than in the cyctic one. Low levels of renin in the cystic follicles are supposed to be an expression of a consistent involvement of RAS in the development of cysts pathology. P100 Pathological findings in the female genital tract of infertile / subfertile cattle with focus on endometrial biopsy Rodenbusch, S1*; Ellenberger, C1; Hauffe, C2; Lenz, M2; Kießling, A3; Sobiraj, A2; Schoon, HA1 1Institut für Veterinär-Pathologie, Universität Leipzig, Germany; 2Ambulatorische und Geburtshilfliche Tierklinik, Universität Leipzig, Germany; 3Forschungsprojekt der Interessengemeinschaft der Erzeugerzusammenschlüsse (IGE) in Sachsen e.V., Projekt zur Erarbeitung von Strategien zur Verbesserung der Fruchtbarkeit in Hochleistungsherden der Sächsischen Milcherzeugung, Germany Fertility disturbances are common in high-performance dairy cows. In many cases, alterations of the endometrium are clinically not detectable. The genital tracts of 97 cows culled either due to symptomless, clinically not definable infertility (70%) or deficiencies like low milk yield (30%, fertility status not available) were collected. Ovaries, fallopian tubes and uteri were examined macroscopically and histologically. Of these animals, 30 cows were examined clinically and gynaecologically with two endometrial biopsies taken of each 1-3 days before slaughter. Regarding the ovaries, 59 animals did not show any alterations. Pathological findings were luteinized (n=15) or Graafian follicle cysts (n=15) or ovarian neoplasms (granulosa cell tumor, n=2, and rete adenoma, n=6). Concerning the fallopian tube, in 11 % a hydrosalpinx was diagnosed, 32 % revealed intraepithelial cysts, 36 % showed mild to moderate salpingitis, and 32 % were without pathological findings. By macroscopical examination, 81 uteri showed no alterations, 12 revealed clear mucus within the lumen and in 4 cases a purulent endometritis was found. In contrast, by histopathological examination only one uterus was without any pathological findings. Histological alterations, varying in quantity and quality, could be detected in 96 uteri: 86 cows showed a periglandular fibrosis (“bovine endometrosis”), 69 angiopathies, and 61 an endometritis, mostly nonpurulent. In most cases, several alterations occurred simultaneously. Due to sampling artefacts, only 47 of 60 biopsies could be examined histologically. In 29 of 30 cases, at least one of the two biopsies was evaluable. There is a far-ranging conformity comparing the findings in the biopsy with those in uterine samples collected post mortem. In conclusion the majority of cows with subclinical fertility disturbances exhibited endometrial findings which are not apparent by

conventional clinical or macroscopical examination but are detectable by lightmicroscopy. A comparison of histopathological findings in biopsies and in the uteri examined post mortem revealed nearly identical alterations taking the quality and quantity into account. Therefore, the endometrial biopsy is a potential tool to diagnose subclinical endometrial alterations in infertile or subfertile cattle. Nevertheless, in order to establish the potential diagnostic tool “endometrial biopsy” in cattle as a prognostically meaningful method, further investigations, especially in fertile animals, are necessary. P101 The use of immunodulation with Mycobacterial Cell Wall - DNA Complex (MCC) as a potential treatment for endometritis in cattle Rogan, D1*, Bo, GA2, Chesta, PM2, Bonomini, Y2, Ramos, M2 1Bioniche Life Sciences, Canada;2Instituto de Reproduccion Animal Cordoba, Argentina An experiment was designed to evaluate varying doses of Mycobacterial Cell Wall - DNA Complex (MCC) on neutrophil (PMN) infiltration on the endometrium of 243 Holstein cows 25 to 35 days in milk. On Day 0, cows were examined by rectal palpation, vaginoscopy and endometrial cytology (cytobrush) and grouped into one of two disease categories: cows with no evidence of clinical endometritis (further subdivided into normal and cows with subclinical endometritis based on >18% PMN in the endometrial cytology sample), and cows with clinical endometritis (purulent cervical discharge). Cows in each disease category were then assigned at random and by replicate into one of four treatment groups to receive 1500, 4500 or 13500 µg of MCC diluted in 10 ml of endotoxin-free water for injection or 10 ml of water (control treatment). Endometrial cytobrush samples were taken on Days 2 and 7 to measure PMN response. Time-series data were analyzed using the MIXED procedure for repeated measures and proportions were compared by chi-square test. There was a day by treatment interaction (P<0.03) in the numbers of PMN following MCC treatment in the normal cows and those with subclinical endometritis. In normal cows, MCC treatment resulted in a significant increase in the number of PMN on Day 2 (27.2 ± 4.5, 42.7 ± 4.4, 48.2 ± 5.8, 34.0 ± 5.0 for cows in the control, 1500, 4500 and 13500 µg MCC treatment groups, respectively) and a subsequent decrease by Day 7 (19.3 ± 5.1, 19.3 ± 4.5, 9.9 ± 2.2 and 16.0 ± 4.3, respectively). In cows with subclinical endometritis, MCC also resulted in a significant increase in the percentage of PMN on Day 2 (41.3 ± 7.7, 58.2 ± 7.2, 58.1 ± 6.7, 56.6 ± 4.6 for cows in the control, 1500, 4500 and 13500 MCC treatment groups, respectively) and a subsequent decrease by Day 7, with a significantly lower percentage of PMN in cows treated with 13500 µg (7.4 ± 2.1) than in the control group (25.0 ± 7.6). Cows treated with 1500 µg (20.6 ± 6.8) or 4500 µg (17.2 ± 4.8) groups were intermediate. The percentage of endometrial PMN in cows with clinical endometritis did not differ between MCC-treated groups and controls on Days 0, 2 and 7. However the proportion of cows with <20% PMN on Day 7 was lower (P<0.05) in the 4500 µg (40.0%; 8/20) and 13500 µg (42.9%; 9/21) groups than in the control group (14.3%; 3/21); the 1500 µg group was intermediate (28.6%; 6/21). It appears that MCC treatment will increase PMN activity on the endometrium; the possible use of MCC as an alternative treatment for postpartum endometritis in lactating dairy cows warrants investigation.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 62 P o s t e r A b s t r a c t s P102 Oestrus synchronization and non return rate in dairy cows treated by two types of prostaglandin Córdova, A1*; Ruiz, CG1; Córdova, MS2; Córdova, CA3; Guerra, JE4; Tapia, B5 1Departamento de Producción Agrícola y Animal. Ecodesarrollo de la Producción Animal. Cuerpo Académico: Salud y Bienestar Animal. Universidad Autónoma Metropolitana-Xochimilco. Calz. del Hueso 1100 Col. Villa Quietud CPP. 04960, México, D.F. * aci57@prodigy.net.mx; 2Laborarotorios Brovel, S.A.de C.V.; 3Becario de CONACYT-México. Estudiante de Doctorado. Universidad de León, España; 4Facultad de Agronomía. Universidad Autónoma de Sinaloa, México; 5Estudiante de Doctorado. Facultad de Veterinaria. Universidad Complutense de Madrid, España Introduction The implementation of technical and innovative biotechnologies in the bovine production, improves the reproductive efficiency, the oestrus synchronization it is an example; they can be used similar of prostaglandins F2α to shorten the cycle oestrus; that which improves the oestrus presentation, facilitates the artificial insemination (AI), it can decrease the return percentage to oestrus; obtaining a better handling of the cluster, since more homogeneous partitions is obtained in the Unit of animal Production. Objetive Value the effect of the administration of two prostaglandins types F2α (Sodium Cloprostenol and right-handed Cloprostenol) on the synchronization percentage and not return to oestrus in dairy cows. Methods 20 cows were used in production of race Holstein Friesian, which were divided in two groups of 10 animals each one. Before beginning the study, the animals were selected, by means of the ecography use, to verify the ovarian health. In the group 1, 10 cows were used, to which were administered 25 mg via intramuscular of sodium Cloprostenol. The group 2, with animals, to which were administered 25 mg of right-handed Cloprostenol via intramuscular. The oestrus detection was carried out realized for observation of characteristic clinical signs and AI was carried out by means of the method AM/PM. The not return to the oestrus it was verified to the 21 days after the AI. Results The results of oestrus synchronization for the first group (sodium Cloprostenol) they were from 10% to the 12 hours, 20% at the 24 hours, 40% to the 48 hours and 30% at the 72 hours after the administration of the prostaglandin. The group 2 (right-handed Cloprostenol), the synchronization percentage was from 20% to the 48 hours, 10% to the 56 hours and 70% at the 72 hours. In both groups 90% was obtained of not return to oestrus. Conclusion The administration of sodium Cloprostenol could represent an alternative to be used in synchronization programs and not return to oestrus in dairy cows in production. P103 Effect of body condition on uterine involution, ovarian activity and ovarian IGF-1 receptor expression in dual purpose cattle during the postpartum period under tropical conditions Ruiz, A1*; Dominguez, C3; Martinez, N2; Perez, R3; Pinto, L2; Drescher, K2; Rojas, J1 Fernandez, A1 1Facultad de Ciencias Veterinarias, Universidad Central de Venezuela, Venezuela; 2Facultad de Agronomía, Universidad Central de Venezuela, Venezuela; 3 Instituto para el Desarrollo Sostenible de Sistemas Agroambientales, Universidad; Experimental Rómulo Gallego, Venezuela Differential responses on the reproductive performance of cattle, depending on the body condition (BC) at calving and during the postpartum period, have been shown. Insulin like growth factors (IGFs) act modulating gonadotrophin action at a cellular level. Eight (8) crossbred (Bos taurus x Bos indicus) dual purpose cows were used and assigned randomly to one of two treatments: T1, low body condition (BC < 2.5) and low feed level (LF, 85% of the nutritional requirements) or high feed level (HF, 115% of the nutritional requirements); T2, high BC (> 2.5) and LF or HF levels. Reproductive activity and uterine involution (UI) were evaluated once a week by means of transrectal palpation and ultrasound (Aloka SSD 900 Co.

Ltd., Tokyo, Japan) from 15 to 45 days post-partum (DPP) using a 7.5 MHz linear probe. Plasma progesterone (P4) levels were measured by RIA (DSL, Diagnostic Systems Lab, Inc., TX, USA) at 3, 15, 22, 33, 37, and 45 DPP. Uterine involution, characteristics of cervical mucus (CCM), symmetry of uterine horns (SUH), uterine position (UP), and cervix diameter (CD) were studied. Ovarian structures (corpora lutea and follicles) were evaluated by ultrasound. Ovarian follicles were classified according to their diameters: Class 1 (≤ 5 mm); Class 2 (6-9 mm) and; Class 3 (≥10 mm). At 45 DPP, ovaries were collected within 30 min after slaughter. One ovary was used to evaluate the morphology of oocytes, which were categorized as follows: type A (oocyte with the presence of a clear and compact cumulus oophurus and translucent ooplasm); type B (oocyte with dark and compact

cumulus oophurus and dark ooplasm) and; type C (oocyte with dark and expanded cumulus oophurus and dark ooplasm). The other ovary was used to study the IGF-1 receptor expression by Western blot analysis. Results were analyzed by the SPPS (version 10), using a non-parametric correlation and the Kruskal and Wallis tests. The non-parametric ANOVA showed that BC at calving affected type C oocytes (P< 0.01). A similar result was found by the correlation analysis (-.816*). There was not any effect of BC at calving on UI and follicle classes. Plasma P4 levels were affected by BC at calving from 33 DPP. The ovarian IGF-1 receptor showed a higher expression in animals under T1, compared with those animals in T2. The results suggest that BC at calving is one of the factors involved in the resumption of the reproductive activity during the postpartum period under tropical conditions. Also, it appears that IGFs act as modulators of gonadotrophin functions at the ovary level in this species. P104 Ultrasonographic detection of embryo and its development in crossbred cows Sahatpure,SK.*, Pardhi.SM. & Khillare,KP. Postgraduate Institute of Veterinary &Animal Science Akola Maharashtra India-444104 (Under Maharashtra Animal &Fishery Science University Nagpur ) Ultrasound was used for the detection of embryo and its development in 6 cyclic crossbred cows from day 20 to day 60 after breeding. In the present study, synchronization of estrus was carried out by administrating Lutalyse (PGF2α). The number of cows responded to treatment was 100 per cent and the average time required for onset of estrus was 59.83 ± 1.14 hours. In the present study all artificially inseminated crossbred Cows were scanned with diagnostic ultrasound scanner equipped with a linear array, 7.5 MHz transducer designed for intrarectal placement. All animals were scanned ultrasonographically with an interval of 5 days from day 20 to day 60 after breeding. The embryonic vesicle was first visible on day 20. The embryo proper was first time observed in all cows on mean day 25. The heart beats of the embryo proper was detected on day 27.5 ± 1.44. The allontois, amnion, forelimbs, hind limbs and optic area were first identified on day 28.75 ± 1.25; 30; 32.5 ± 1.44; 33.75 ± 1.25 and 28.75 ± 2.39, respectively. The spinal cord, ribs and fetal movements were observed on average day of 47.5 ± 2.39; 55 and 53.75 ± 1.25, respectively. The accuracy of early pregnancy diagnosis in means of ultrasonography were 66.66, 83.33 and 100 per cent on day 20th, 25th and 30th day of gestation, respectively, whereas, sensitivity and specificity of ultrasound pregnancy diagnosis was 75 and 50 per cent on day 20 respectively and 100 per cent on day 25 and 30 of gestation. P105 Frequency of detection of estrous behavior accompanying early postpartum ovulations in fertile dairy cows Sakaguchi, M National Agricultural Research Center for Hokkaido Region, NARO Introduction Increased milk yield in dairy cattle causes a continuous and serious decline in their fertility. Many factors such as genetic

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 63 selection and management are involved with this problem, and expression of estrous behavior is one of the important factors determining the dairy cows’ fertility. It has been well known that anestrous ovulations often occur during early postpartum period, but the details on the frequency and timing of the events are not clear. Materials and methods To confirm the occurrence of ovulation 100 lactations of Holstein cows were examined by ultrasonography or rectal palpation 1 - 3 times per week. The cows were visually observed at least 2 times per day to detect estrous behavior with the aid of a heatmount detector or tail painting. Cows exhibited standing estrus (ST) or mounting activity with other estrous symptoms (MT) were considered to be in estrus, and that was confirmed by subsequent ovulation. After 45-day of voluntary waiting period, estrous cows with normal cyclicity were served AI. Conception was confirmed by ultrasonography at 35-40 days after AI. Data were analyzed by ANOVA, and P < 0.05 was considered significant. Results Because 8 lactations were not accompanied with conception, total 368 ovulations from 92 lactations of 69 cows were analyzed. Total number of anestrous ovulation was 136 (37 %), and the frequencies of first postpartum estrus expression were 11, 55, 28, 4, and 2 % at 1st, 2nd, 3rd, 4th, and 5th ovulations, respectively. From 2nd to 5th ovulations, the frequencies of expressing ST were increased from 10 to 74 %, while 19 – 24 % of ovulations were accompanied with MT only. In 14 lactations, total 17 times of anestrous ovulation was confirmed after the postpartum first estrus, and almost all of the occurrences of returning to anestrus were observed at 2nd to 4th ovulations. Mean 305-day milk yield was 8,067 kg (n = 36), 10,063 kg (n = 23), and 10,595 kg (n = 33) for 1st, 2nd, and > 3rd or later lactations, respectively. The frequency of anestrous ovulations in 1st lactation cows were 32 %, while those in 2nd and > 3rd lactation cows were 42 and 38 %, respectively. Cows exhibited first estrus at 2nd (n = 50) and 3rd (n = 26) ovulation had significantly shorter days open (92 and 85 days) than those at 1st (n = 10) and 4th or 5th (n = 6) ovulation (118 and 127 days) Conclusions These results on the frequency of estrus expression and subsequent fertility in high-yielding dairy cows can be useful information to study and improve their reproductive performance. P106 Association among andrologic selection, semen freezing, acrosome induced reaction by heparin (AIR) and profiles of heparin binding proteins (HPB) of semen in young Nelore bulls Salvador, DF1*; Andrade, VJ.2; Nogueira, LAG.3; Vale Filho, VR.2; Silvano, JO.4; Santoro, MM.4; Folhadella, I2; Salvador, RRS4

1Center of Science and Distance Education, Fundação CECIERJ, Brazil; 2Faculty of Veterinary Medicine, Universidade Federal Minas Gerais, Brazil; 3Faculty of Veterinary Medicine, Universidade Federal Fluminense, Brazil; 4Institute of Biology Science, Universidade Federal Minas Gerais, Brazil Introduction The profile of heparin binding proteins (HPB), andrologic parameters, profile of semen freezing and acrosome reaction was evaluated from the semen of young Nelore bulls. Material Andrologic and semen freezing parameters were evaluated from 55 young Nelore pre-selected bulls. However, the functional tests of the sperm quality was performed in 16 bulls, as well as their associations with proteins profile from seminal plasma, searching for andrologic markers for high fertility and semen freezing. A specific analysis for “heparin binding proteins”(HBP) and their association with “acrosome induced reaction” (AIR) was performed. The analysis of proteins was made a system of fast performance liquid chromatographic (FPLC) with a column of affinity to heparin and after by electrophoresis of poliacrilamide. Results and discussion The overall mean for sperm motility, vigor and viability were, respectively, 66.4±5.7; 4.8±0.4 and 76.3±8.5% pre-freezing, and 29.4±8.5; 4.6±0.6 and 34.5±11.1% post-freezing. The post-freezing recovery mean was 44.5±13.4%. The overall average of post-freezing acrosome integrity was 84.9±6,05% reducing to 76.1±8.14% after four hours of incubation. The mean of post-freezing AIR was 18.53±9.59, ranging from 8 to 43%. Differences (p>0.05) were not registered, when comparing bulls of high and low

AIR for the parameters: acrosome integrity, andrologic and sperm freezing. The concentration of total proteins in the seminal plasma ranged from 3,18 to 52,7 mg/ml, with average of 26,8±20,5 mg/ml. The profile of the gel filtration in proteins of the seminal plasma showed eight different fractions. In the seminal plasma there were identified five different picks of proteins with affinity of heparin, being identified 16 bands of proteins with different molecular weights. The forth and fifth picks of seminal plasma proteins with affinity of heparin were associated to the high percentages of AIR, as well as the frequency of the proteins of 14, 18, 21 and 29 kDa. In the proteins of the sperm membrane were identified three different picks of heparin affinity, containing seven different bands. However, this pool has only a 56 kDa protein which was associated to AIR. Conclusions Semen freezing tests, acrosome integrity and AIR are important complementary tests in bull selection for fertility, since they showed high variability even in andrologicaly pre-selected bulls. The evaluation of proteins with affinity to heparin in seminal plasma was shown effective for prediction of AIR rate, and could act as biochemical markers. P107 The significance of uterine E. coli infection in the early postpartum period of diary cows Santos, NR*; Galvão, KN; Brittin, SB; Gilbert, RO Department of Clinical Sciences, College of Veterinary Medicine, Cornell University, United States We studied postpartum uterine bacterial infection, endometrial cytology and follicular function in 58 Holstein cows in a single dairy herd in central New York. During the first postpartum week Escherichia coli was the commonest organism isolated from the uterus. Arcanobacterium pyogenes, which is more commonly associated with persistent uterine disease, appeared later, peaking in prevalence at around 3 weeks postpartum. Cows with E. coli infection at one week postpartum were at increased risk for A. pyogenes infection at 3 weeks postpartum (OR = 8.07, 95% CI = 2.22 – 29.27; z = 3.18; P = 0.0015). These cows were also at increased risk of being infected with anaerobic bacteria at 3 weeks postpartum (OR = 4.53, 95% CI = 1.06 – 19.41; z = 2.037; P = 0.04). In turn, cows infected with A. pyogenes at 3 weeks postpartum had greater numbers of neutrophils in endometrial cytology samples at 5 weeks postpartum (31.1 +/- 25.7% vs. 10.5 +/- 12.1%; P = 0.0008) and were at decreased risk of pregnancy by 150 days postpartum (OR = 0.24, 95% CI = 0.06 – 0.95; z = 2.031; P = 0.04). A known detrimental effect of postpartum uterine infection is impaired ovarian follicular growth and function. In our study, the first postpartum dominant follicle reached a significantly smaller maximum diameter in cows infected with E. coli on the day of calving than in cows free of E. coli at that time, regardless of infection with any other bacteria (9.44 +/- 2.44 mm vs. 14.39 +/- 2.57 mm; P < 0.0001). Follicular size was not related to infection with other bacterial species. Our results indicate that uterine infection with E. coli in the first week postpartum mediates impaired follicular function and increased risk for subsequent infection with known uterine pathogens, leading to development of subclinical endometritis, and reduced chance of pregnancy by 150 days postpartum. P108 The Effect of LH Surge on Regulation of Agiogenic Factors (VEGF and Angiopoietin) and Matrix-Metallo Proteinases (MMP) in Bovine Follicles Berishak, B; Kliemk, H; Meyerk, HHD; Schamsk, D* Physiology Weihenstephan, Technical University of Munich, Freising, Germany The aim of this study was to evaluate the regulation pattern of VEGF-A (isoforms 121, 165, 189, VEGF-R1, VEGF-R2), Angiopoietin (ANPT-1, ANPT-2, Tie-1, Tie-2) and Matrix-Metallo Proteinases (MMP-1, MMP-2, MMP-14, MMP-19, TIMP-1, TIMP-2) in time

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 64 P o s t e r A b s t r a c t s defined follicle classes before and after GnRH application. Ovaries containing periovulatory follicles or new corpora lutea (CL day 1-2) were collected at 0h, 4h, 10h, 20h, 25h (follicles) and 60h (CL) relative to injection of GnRH. The MMP-1 mRNA increased rapidly 4h after GnRH (during LH surge) and remained high during the whole experimental period. In contrast, the MMP-19 mRNA increased significantly only after ovulation. The TIMP-1 mRNA increased 4h after GnRH and again after ovulation. Transcripts of VEGF isoforms (VEGF121, 165, 189) were upregulated 4h after GnRH. All VEGF isoforms and their receptors were upregulated again after ovulation. The VEGF peptide content in follicular fluid decreased 20h followed by an increase in follicle class 25h after GnRH. ANPT-1 mRNA decreased significantly in follicles 4h after GnRH. ANPT-2 decreased 10h after GnRH and in the follicle group around ovulation. Tie-1 and Tie-2 mRNA expression decreased in follicle group around ovulation, with a further increase in early CL tissue. It is likely that the decrease of ANPT-1 and therefore the increase of the ANPT-2/ANPT-1 ratio during the LH surge is a basic mechanism of vascular remodelling in follicles during periovulation. In conclusion, the temporal expression pattern of angiogenic factors ANPT and VEGF as well as member of MMP during periovulation suggests them to be important mediators of the ovulatory process and the early CL formation (angiogenesis) in cow. P109 Changes of the cow’s endometrium, distribution of growth stimulating and degradation factors in postparturition period Sematovica, I1*; Jemeljanovs, A1; Pilmane, M2 1Research Institute of Biotechnology and Veterinary Medicine „Sigra”, LUA Latvia; 2Institute of Anatomy and Anthropology, RSU, Latvia Introduction Remarkable morphological and physiological changes occur in the uterus tissue, blood vessels, and nerves during the reproductive cycle and gestation. AIM of the research was to reveal inflammatory factors, neuropeptide-containing innervation, distribution of the growth stimulating and degradation factors, and the apoptosis in the cows’ endometrium in after parturition period. Materials and methods Nine cows were biopsied twice – in the first and the fifth week after parturition. At the Institute of Anatomy and Anthropology of Riga, Stradins University were performed analyses: immunohistochemically (IMH) were detected matrix metalloproteinases type 2 and type 9 (MMP–2 un MMP–9, working dilution 1:100, R&D, England), tumor necrosis factor–α (TNF–α, 1:100, Abcam, England), interleukin–10 (IL–10, 1:400, Abcam, England), vascular endothelial growth factor (VEGF, 1:50, DakoCytomation, Denmark), nerve growth factor receptors p75 (NGFR p75, w.d. 1:150, DakoCytomation, Denmark) protein gene product 9.5 (PGP 9.5, 1:1600, DakoCytomation, Denmark), and TUNEL method was used for detection of apoptosis. Also staining for hematoxylin and eosin was performed for each sample. Results There were detected a significant increase of the number of inflammatory cells, TNF–α amount, and expression of VEGF, NGFR p75 (p<0.05). A mild positive correlation (p<0.05) was observed between amount of inflammatory cells and TNF–α (r=0.52), PCD and TNF–α (r= 0.58), TNF–α with NGFR p75 (r=0.51), NGFR p75 and PGP 9.5 (r=0.49), VEGF and PCD (r=0.59), VEGF and NGFR p75 (r= 0.64). A strong positive correlation (p<0.01) was seen between TNF–α and VEGF (p<0.01; r=0.72), as well as VEGF with NGFR p75 (r=0.64). Conclusions The increase of NGFR p75, VEGF and TNF–α expression in the cow’s endometrium from the first up to the fifth week after parturition seems to correlate with the ischaemia of tissue onereased by inflammatory action. The later also seems to stimulate the apoptosis and proliferation of nerve fibres in the cow’s endometrium.

P110 The sexing in vitro cow embryos, using citogenetic analisis, at different stages Agüera, S*; Castejón, FJ; Agüera, EI; Escribano, BM and Gardón, JC Dpt Fisiología. Fac. de Veterinaria, Univ. de Córdoba. España The aim of this study was to use the cytogenetic analysis for sexing in vitro produced (IVP) bovine embryos at different stages of development. A total of 519 IVP bovine embryos were divided in 3 groups: A (n=123) 4 to 8 cells; B (n=189) less than 32 cells and C (n=207) more than 32 cells. Then embryos were placed in 1% of trisodiumcitrate-dihydrate for 20 min., fixation with methanol-acetic acid glacial (1:1) for 10 min. at room temperature and additional fixing for 12 h at 4ºC in methanol-acetic acid glacial (3:1). Finally the embryos were stained in Giemsa 10% for 10 min. Chromosomes evaluation was done at 1000 x magnification. Data were analyzed by Chi-square test. The differences were considered significant for (p<0.05). After evaluation the percentage of sexed embryos were for group A: 71.54%, B: 71.42% and C:71.98%. No significant differences were found among groups, allows sexing in 51% of bovine embryos. Other reports inform that 57% of IVP bovine embryos from 2 to 16 cells were suitable for analysis. In our work, allows the confirm of sex in approximately 72% of the embryos for all groups. However, the smallest number of cells in embryos of A group, hindered the obtaining of metaphases of good quality what blocked the identification of those male individuals. This inconvenience in sexing embryos with low number of cells was also previously described. In conclusion our results demonstrate that IVP bovine embryos can be sexed in different stages of development by cytogenetic analysis. P111 Proinflammatory cytokines regulate prostaglandins secretion in the cultured epithelial cells of bovine oviduct Skarzynski, DJ; Siemieniuch, M*; Lukasik, K; Pienkawa, M; Woclawek-Potocka, I; Korzekwa, A; Bah, MM Institute of Animal Reproduction and Food Research, Olsztyn, Poland The oviduct plays a key role in the gametes transport; fertilization and early embryo development. Prostaglandins have the key role in the regulation of oviductal contractions and secretary functions. Whereas luteolytic PGF2α is known to be a potent activator of the oviductal contractility, luteotropic PGE2 may inhibit it. Hence, we decided to examined the effects of selected proinflammatory cytokines (TNFα, IL1α, IL6, INFγ) and an embryo signal (IFNτ) on the PGs secretion in the cultured epithelial cells of bovine oviduct. In the medium, PGF2α and PGE2 concentrations were measured by EIA, nitric oxide (NO) metabolites (nitrite/nitrate) were estimated using colorimetric methods. The effects of cytokines on the enzymatic mechanisms engaged in PG(s) synthesis (expression of COX II, and specific PG synthases: PGFS, AKR1B5, PGES) in the cells was measured by Western Blot (protein level) and by Real-Time PCR (gene level). Cell number/viability was estimated by MTT. Only IL6 and IFNγ inhibited the cell viability (35 and 80 %; P<0.05). IL1α, TNFα and IFNγ strongly stimulated PGF2α and NO release (260%; P<0.01). IFNτ stimulated PGE2 release (186%; P<0.001). The expression of mRNA for PGFS protein was higher after IL1α, IFNγ, TNFα treatment then in control (P<0.05). The expression of mRNA for AKR1B5 was 2-times higher after TNFα, IL1α, IL6 and IFNγ (P<0.05).The expression of mRNA for PGES was higher after IL1α, IL6 and IFNγ (P<0.05). IFNτ increased the immunoreactivity of COX II and PGES (130%; P<0.05). We revealed that, investigated cytokines (TNFα, IL1α, IL6, INFγ) affect the secretary function of oviductal cells oppositely to the embryo signal. Cytokines stimulated mainly the release of luteolytic PGF2α, but IFNτ stimulated synthesis of the luteotropic PGE2. Obtained results indicate that cytokines are potent regulators of PGF2α and PGE2 secretion in the bovine oviduct and thereby modulate oviductal environment to facilitate gametes and blastocysts transport and early embryo development.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 65 P112 Genomic characterization of Arcanobacterium pyogenes isolates recovered throughout the puerperium of dairy cows Silva, E1*; Gaivão, M1; Leitão, S1; Jost, B2; Carneiro, C3; Vilela, C3; Costa, L1; Mateus, L1

1Department of Reproduction and Obstetrics, C.I.I.S.A., Faculty of Veterinary Medicine, Portugal; 2Department of Veterinary Science and Microbiology, University of Arizona, USA; 3Department of Microbiology and Immunology, C.I.I.S.A., Faculty of Veterinary Medicine, Portugal In dairy cows, the establishment and persistence of the puerperal uterine infection is related to the characteristics of the bacteria that colonize the uterus. The clinical signs and reproductive consequences of the uterine disease are generally attributed to the presence of a few pathogens, mainly Arcanobacterium pyogenes (A. pyogenes) alone or in synergy with other bacteria. In order to identify factors that might be associated with the establishment and persistence of uterine infection, we characterized A. pyogenes isolates obtained throughout the puerperal period of dairy cows from two unrelated herds. The isolates were recovered from 26 cows (8 had normal puerperium and 18 developed uterine infection). The genomic characterization of A. pyogenes (n= 57) was performed by BOX-PCR typing and by screening of putative virulence factors through conventional PCR. Considering a genomic similarity of at least 86%, a total of ten different clonal types (5 in each herd) were identified. These clonal types were totally herd-specific and a single type appeared to predominate in each herd. Only one clonal type was not associated with endometritis, while four others were always associated with uterine disease. However, 5 clonal types were present in cases of both normal puerperium and endometritis. Throughout the puerperal period, 1 to 3 clonal types were sequentially or simultaneously isolated from the same animal. In order to identify virulence factors associated with the development of infection, all isolates were tested for the presence of 8 putative A. pyogenes virulence genes: plo (encoding pyolysin), nanH and nanP (encoding neuraminidases), cbpA (encoding a collagen-binding adhesin) and four different fimbrial genes (fimA, fimC, fimE, fimG). The 8 genes were present in 66% of the isolates, 5 of 8 genes (plo, nanH, nanP, cbpA, fimA) were detected in all isolates, fimE in 97%, while fimC and fimG were only present in a subset of isolates. There was no association between BOX-PCR type, presence of the above genes and development of uterine infection. The results of this study suggest that the type of A. pyogenes may not be a determinant factor in the development of uterine infection. Host intrinsic factors and/or the synergism between A. pyogenes and other bacteria may play a more relevant role in the establishment of puerperal infections. This research was funded by the grant POCTI/CVT/48773/2002 from “Fundação para a Ciência e Tecnologia”. Maria Elisabete Silva is a post-doc fellow from FCT. P113 Bacteriological and histological studies of cow’s uterus without and with retained fetal membranes Skuja, S1*; Antāne, V1 ; Feldmane, L2 1Faculty of Veterinary Medicine, Latvian University of Agriculture, Latvia; 2Department of Pathological Anatomy, Riga Stradins University, Latvia Introduction Retention of fetal membranes is economically important disturbances during the postpartum period in cattle in Latvia. Several methods have been suggested for the treatment of retained fetal membranes, and controversial results have been published. The aim of the study was to investigate the postpartum period of cows without and with retained fetal membranes. Materials and methods Bacteriological samples of the cow’s uterus and biopsies of the uterus mucous membranes were collected from 29 Holstein cows. The bacteriological examination was performed in cows with and without retained fetal membranes (RFM) two, 14, 40 – 50 days postpartum (PP). On day 40-50 all cows were biopsied from the uterus endometrium and the uterus status was estimated

histologically. According to the 3rd stage of parturition process (expulsion of fetal membranes), cows were divided into the following groups:Control group – fetal membranes were expelled in 6-12 h PP;Group 1 – cows with RFM, removed manually and treated;Group 2 – cows with RFM, it was not removed manually.Group 2 cows with health disturbances (fever, milk fever, mastitis) were treated adequately. Results Bacterial isolates of uterus on day two PP in all cows (100%) contained a wide spectrum of microorganism associations: in 41% of cases there were single isolates – E. coli 33%, Streptococcus spp. 5% and Clostridia spp. 3% , and in 59% there were mixed isolates – E. c. 27%, Streptococcus spp 3%, Clostridia spp 26%, Staphylococcus spp. 3%. On day 14 PP, 93% of cows had microorganisms in the uterus. In addition to the above findings there was one isolate of A. pyogenes in the cow with RFM that was removed manually two days PP. In the next bacteriological examination (40-50 days PP) no bacteria were found, and in 84 days PP after two times of artificial insemination the cow became pregnant. In group 2 cows, which were treated, the number of isolated bacterial species increased on day 14 PP. At the same time cows of group 2, which were untreated, the number of isolated bacterial species remained the previous one, and the number of isolates decreased. On day 40-50 PP, bacterial isolates were found in 86.2% of cows. Cows with a normal parturition process were 50% with single bacterial isolates (Streptococcus spp. and Corynebacteriom spp.). There were no differences between the bacterial species and their number of group 2 treated and untreated cows. In 82.8 % of all investigated cows, histological findings showed evidence of mild to moderate endometritis.At this time, 33.3% ( 8 cows) become pregnant. P114 Identifying AI bulls associated with poor fertility and high rates of embryo loss Sunde, J.1* and Refsdal, AO.2 1Team Semin BA, P.O. Box 8146 Dep., N-0033 Oslo, Norway; 2Geno Breeding and AI association, N-2326 Hamar, Norway The relationship between fertility and semen quality is not always clear. Occasional AI bulls may show poor fertility even though semen passes quality testing. These bulls represent a potential loss for the dairy farmer, and may even possess undesirable genetic traits that could affect fertility in future generations. It is therefore important that these bulls are identified at an early stage in the breeding programme as soon as insemination data are available for analysis. Norwegian Red (NRF) is the dominant dairy breed in Norway and semen is distributed by Geno, a farmer-owned cooperative. Close to 100% of inseminations are reported back to Geno and 95 % of farmers also report data on calvings, stillbirths and culls through the Norwegian Dairy Herd Recording System. These data allow calculation of accurate non-return rates (NRR) and calving rates (CR) on sire basis. At present, bulls with NRR60 < 65 % after approx. 1000 first inseminations of semen for progeny testing are routinely culled. However, this parameter alone may not be sufficient to identify animals with potential negative impacts on fertility traits. It was therefore investigated whether further analysis of sire fertility data would yield additional information. The data set consisted of 479330 first inseminations on Norwegian Red (NRF) heifers and cows, with semen from 692 qualified NRF test and elite sires. Inseminations were performed between January 2000 and Oct 2007. The first day of return-to-service was registered as a second insemination within 92 days after first insemination (pfi), and a minimum of 1000 first inseminations per bull was required to qualify for the study. NRR curves were modelled using survival analysis, with day of return as outcome parameter, adjusted for confounding factors. Sires were classified as having either‘poor’ or ‘good’ fertility if their NRR92 deviated from the mean by more than 3 standard deviations. Compared to high fertility sires, poor fertility sires showed a more abrupt fall in NRR from 21 days onwards, suggesting a lower rate of fertilisation and/or higher incidence of early embryo death (before maternal recognition). These sires also displayed a higher number of returns-to-service outside of the normal oestral cycle length. This

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 66 P o s t e r A b s t r a c t s suggests delayed oestrus indicative of late embryo death (after maternal recognition on day 17). This may suggest a sire-specific effect on embryo survival that partly could have a genetic component. Further studies will include flow cytometric studies of sperm from poor fertility sires. P115 Na+/K+ATPase regulates tyrosine phosphorylation and capacitation in bovine sperm through multiple signal transduction pathways Thundathil, J1*; Newton, L1; Kastelic, J1,2; Wong, B3; van der Hoorn, F4 1Department of Production Animal Health, Faculty of Veterinary Medicine, University of Calgary, Canada; 2Lethbridge Research Centre, Agriculture and Agri-Food Canada, Canada; 3Regional Fertility Program, Calgary Health Region, Canada; 4Department of Biochemistry and Molecular Biology, University of Calgary, Canada Introduction Cryopreservation prematurely capacitated bovine sperm, reducing the fertile life-span of sperm in the female reproductive tract. Understanding the cellular and molecular regulation of sperm capacitation will have implications for improving the fertility of frozen semen, as well as predicting bull fertility. In somatic cells, inhibition of Na+/K+ATPase (a cell membrane protein) with its specific inhibitor ouabain initiated cellular responses similar to signalling mechanisms leading to sperm capacitation, suggesting a role for this protein in the regulation of sperm capacitation. Although the α1ß1 isoform of this protein is ubiquitous, α4ß3 is testicular specific; both are sensitive to ouabain. We previously reported that specifically inhibiting this protein with ouabain induced tyrosine phosphorylation and capacitation in bovine sperm. The objective of this study was to investigate the molecular regulation of tyrosine phosphorylation and capacitation induced by inhibition of Na+/K+ATPase Methods Fresh sperm from Holstein bulls was incubated with specific inhibitors of protein kinase A (PKA), protein kinase C (PKC), receptor tyrosine kinase (rTK), or non-receptor tyrosine kinase (Src), alone or in combination, for 30 minutes prior to a 4 hours incubation with or without ouabain (100 µM). Sperm preparations were electrophoresced and immunoblotted with anti-phospho-tyrosine antibody. Capacitation status of sperm from parallel sperm preparations were determined, based on their ability to undergo an acrosome reaction. Results Inhibition of Na+/K+ATPase activity with ouabain initiated tyrosine phosphorylation in a cohort of sperm proteins and capacitation in bovine sperm. However, pre-treatment with inhibitors specific for rTK, PKA or PKC partially inhibited these processes, suggesting involvement of these signalling molecules. Additionally, there was evidence of cross-talk between signalling molecules. Simultaneous inhibition of Src and rTK or Src, rTK and PKC in combination resulted in greater inhibition of tyrosine phosphorylation and capacitation than the individual effects of these inhibitors. Conclusion We inferred that Na+/K+ATPase regulated tyrosine phosphorylation and capacitation through multiple signalling pathways involving protein kinase A, protein kinase C, receptor tyrosine kinase and nonreceptor tyrosine kinase. However, since ouabain inhibited both α1ß1 and α4ß3 isoforms, the unique role of the testicular specific isoform of Na+/K+ATPase in the regulation of sperm function remains to be elucidated. P116 Effect of different energy sources on milk production, body condition score and reproductive performance of dairy cows during the transition period Torres Artunduaga, MA*, Gesteira Coelho, S; Campos, BG; Quintao Lana, AM; Matana Saturnino, H; Maia Borges, A; Braga Reis, R; Castro Meneses, G

Federal University of Minas Gerais, UFMG, Brazil Introduction Solving reproductive problems of post partum dairy cows has become one of the main targets of the scientific community even thought the advances in this field are partial in most of the

conducted research, that is, some work is done with nutrition only and others just focus on reproduction. Today there is a need to get throughout the problem by a multidisciplinary strategy involving nutrition and reproduction issues. However, the effects of negative energy balance on reproductive performance have been elucidated and formulation of balanced rations for post partum dairy cows in order to minimize the decrease in dry matter intake and mobilization of body reserves during post partum have been utilized, the reproductive efficiency parameters such as conception rate, days open, interval between parturition, among others, still show that dairy farms have this problem without a practical solution. Objective Based on the above mentioned considerations the objective of this study was to evaluate the effect of the addition of different energy sources such as calcium salts of polyunsaturated fatty acids (Megalac –E), toasted soybean and propylene glycol on milk production, body condition score and reproductive performance of dairy cows during the transition period. Material and methods 48 multiparous Holstein cows were used on this trial. Cows received the energy sources from 28 days before the expected calving date until 21 days post partum. Cows were distributed randomly in 4 treatments (control, Megalac-E, toasted soybean and propylene glycol). Body condition score was performed at 21 days pre-partum and once per week until 46 days post partum. Milk production was recorded on days 10, 20, 30 and 40 post partum. All cows were scanned using ultrasound from 10 days post-partum every two days until day 46 post-partum. Before each ultrasound scanning, uterine involution was evaluated and scores were given according to position of uterus on cavity and uterine content. Results Milk production for control, Megalac-E, toasted soybean and propylene glycol was 24, 25, 20, and 25 kg respectively. Body condition score between groups did not differed but cows consuming Megalac-E showed the more uniform score through the entire trial. Expulsion of placenta on Megalac –E group was observed at 3,5 hours after parturition. For control, toasted soybean and propylene glycol this average time was 7,5, 9,5 and 4,5 hours after parturition. Cows on control group had their first ovulation after parturition at 29 days while cows receiving Megalac –E had it with 23 days after delivery. The cows fed toasted soybean and propylene glycol had their first ovulation at 30 and 35 days respectively. Conclusions These preliminary report, indicate that the use of energy sources such as calcium salts of polyunsaturated fatty acids could be advantageous regarding animal health and reproductive performance. P117 Evaluation of strategies to improve cyclicity in Bos indicus-influenced heifers Tribulo, HE1*, Chesta, PM2 , Brandan, A3 , Cuestas, G2 , Lozano, P3 1Facultad de Ciencias Agropecuarias, Universidad Nacional de Cordoba, Argentina; 2Area de Investigacion, Instituto de Reproduccion Animal Cordoba -IRAC-, Argentina; 3Produccion, Compania Anglo Cordoba de Tierrras SA, Argentina A study was designed to evaluate strategies to increase cyclicity prior to breeding in 15 month-old Bos indicus-influenced heifers. The first experiment evaluated the effect of progesterone (P4) priming, beginning 40 or 20 days before breeding. Fifteen month-old, Bos indicus X Bos taurus heifers (n = 547) with body condition scores of 3 to 3.5 (1 to 5 scale) were examined by ultrasonography (Chison Vet 500, 5 Mhz) 40 days before (Day -40) and at the beginning of the breeding season (Day 0) to determine the presence or absence of a CL (cyclicity). Heifers were allocated to one of three treatment groups: an untreated control group and two P4-treated groups that received a P4-releasing vaginal device (0.75 g of P4, Prociclar, Zoovet, Argentina) for 8 days followed by 1 mg estradiol benzoate (Zoovet) at time of device removal, beginning 40 or 20 days prior to the breeding season. The percentage of cycling heifers on Day -40 did not differ among groups (65.6%, 118/180; 65.0%, 115/117 and 66.8%, 127/190 for heifers in the P4 on Day -40, P4 on Day -20 or the control groups, respectively). However, the percentage cycling heifers on Day 0 was significantly higher (P<0.05) in the P4-treated on Day -40 group (81.7%, 141/180) than in the control group (67.9%, 129/190), with the P4-treated on Day -20 group (79.7%, 141/177) intermediate. A second

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 67 experiment was designed to compare P4-priming with the biostimulatory effect of vasectomized bulls beginning 30 days before the breeding season. The experiment involved 639 15 month-old Bos indicus X Bos taurus heifers from the same farm. Heifers were examined by ultrasonography on Days -30 and 0 and allocated into three treatment groups: a P4 treated group that received a Prociclar for 8 days followed by 1 mg of estradiol cypionate (Zoovet) at the time of device removal, beginning on Day -30, a group that was exposed to seven vasectomized bulls for 30 days and an untreated control group. The percentage of cycling heifers on Day -30 did not differ among groups (55.0%, 115/209; 55.7%, 117/210 and 55.5%, 122/220 for P4-priming, bull-exposed and control groups, respectively). However, the percentage of cycling heifers on Day 0 was significantly higher (P<0.05) in the P4-treated group (70.8%, 148/209) than in the bull-exposed (57.6%, 121/210) or control (54.5%, 120/220) groups. In summary, data indicate that P4-priming beginning 30 or 40 days prior to breeding in 15 months Bos indicus cross heifers, increased cyclicity, while biostimulation with bulls had no effect. P118 Insemination of heifers with frozen-thawed, sex-sorted, refrozen-thawed dairy bull sperm close to the time of ovulation Underwood, SL*; Bathgate, R; Maxwell, WMC; Evans, G REPROGEN, Centre for Advanced Technologies in Animal Genetics and Reproduction, Faculty of Veterinary Science, The University of Sydney, Australia A highly motile sub-population of acrosome-intact sperm is recovered after sex-sorting of frozen-thawed (FT) ram sperm. These sperm have been re-frozen and thawed and used for AI of ewes1 with high resultant fertility. However, despite excellent recovery of frozen-thawed, sex-sorted and re-frozen-thawed (FSF) bull sperm, their longevity may be compromised and only a few pregnancies have been obtained after AI with FSF sperm2. It was hypothesised that the reduced longevity may be overcome by AI close to the time of ovulation by monitoring follicle growth with ultrasonography. Semen (n= 2 bulls x 3 ejaculates) was collected and frozen in straws. Sperm were thawed and sorted for sex, then refrozen at 4x106 sp/straw. Heifers (n=24) were synchronised for oestrus using CIDR™ (7d; Pfizer Animal Health, Australia) and prostaglandin (25mg Lutalyse™; Pfizer). Once standing heat was observed, the size of the pre-ovulatory follicle was tracked by ultrasound every 6h, until the time of ovulation was judged to be imminent. Heifers were inseminated with 4x106 X-bearing FSF, or FT sperm within 6h of ovulation. Ovaries were scanned 6h post AI to ensure ovulation had occurred. Heifers were observed for return to oestrus from 21d, and diagnosed for pregnancy 7 weeks post AI. All 24 heifers responded to synchronisation and displayed standing oestrus, with 20 of these subsequently ovulating. The average length of standing oestrus was 16.8 ± 0.4h and on average, ovulation occurred 27.6 ± 1.1h post onset of standing heat. The pre-ovulatory follicle diameter prior to ovulation was 16.1 ± 0.3mm. All 12 heifers that received FSF sperm returned to oestrus <26d post AI. Of the 8 heifers that received FT sperm, 75% (n=6) were confirmed pregnant at ultrasound 7wks post AI. While the method of AI and herd fertility were sound, factors other than the timing of AI need to be addressed to ensure fertilisation occurs after AI with FSF bull sperm. These may include the low numbers of sperm inseminated, or embryo degeneration during early embryo development. An alternative solution for use of FSF sperm may be IVF and embryo transfer, or insemination with larger numbers of viable sperm. 1de Graaf et al (2007). Theriogenology, 76, 391-398 2Underwood et al (2007). Reproduction in Domestic Animals, 42 (suppl. 2), 78 With thanks to The Geoffrey Gardiner Dairy Foundation, XY, Inc. & Total Livestock Genetics for funding this research, Pfizer Animal Health for CIDRs & Lutalyse. Also to Dr. M Ruckholdt, Dr. G Collyer, Dr. M Izzo, K McKean, Corstorphine Dairy staff, K Dunn, K Heasman, K Beilby & H Smith.

P119 Glycoprotein characterization in the uterine glands from cows with normal and cystic ovaries Ventriglia, G1*; Desantis, S1; Zizza, S1; Di Summa, A1; Losurdo, M1; Mutinati, M2; Lacalandra, GM2; De Metrio, G1

1Department of Animal Health and Well-being, Faculty of Veterinary Medicine

– University of Bari, Italy; 2Department of Animal Production, Faculty of Veterinary Medicine – University of Bari, Italy Uterine glands secrete a variety of molecules, including glycoproteins, collectively termed “uterine milk”, that are essential for maternal support of conceptus survival and growth in mammals. Although it is well-known that glycoproteins can undergo changes related to normal and pathological conditions, the glycans of bovine uterine glands have received scarce attention. The aim of this study was to investigate the distribution and the characterization of the glycoconjugates in the uterine glands from pre-pubertal (PO), periovulatory (PE) normal and cystic ovary (CO) cows by means of conventional and lectin histochemistry. Uterus fragments were fixed in 4% (w/v) neutral formalin and embedded in paraffin wax. Sections were stained to evaluate the neutral mucosubstances/glycoproteins using the PAS reaction, as well as carboxylated and sulphated mucosubstances with Alcian blue (AB) pH 2.5 and AB pH 1.0, respectively. The analysis of oligosaccharides was performed by means of 4 lectins (SNA, PNA, DBA Con A) in association with sialidase (s) treatment. Conventional histochemistry showed no AB staining in all the investigated samples, whereas a weak presence of neutral glycans was found in the cytoplasm and lumen content of the uterine glands from PR and CO cows. The latter also showed supra-nuclear PAS-positive granules. Lectin histochemistry showed: 1) Terminal Forssman pentasaccharide (Fp) and Neu5Ac-FP (DBA and s-DBA reactivity) throughout the gland cytoplasm of PR and PO cows, 2) Terminal Fp, Neu5Acα2,6Gal/GalNAc, terminal Galβ1,3GalNAc (SNA and PNA affinity) in the luminal surface of normal cows and terminal/internal αMan (Con A staining) only in PE cows, whereas Neu5Ac-Fp appeared in the apical surface of CO which expressed a non constant presence of SNA and PNA reactivity; 3) Terminal Fp, Neu5Acα2,6Gal/GalNAc, Galβ1,3GalNAc and terminal/internal αMan in the lumen glands of normal cows as well as Neu5Acα2,3Galβ1,3GalNAc appearance, unsettled Neu5Acα2,6Gal/GalNAc presence and αMan lack in the lumen glands of CO cows. Lastly, supra-nuclear granules reactive to SNA and DBA were only found in the uterine glands of CO cows. These findings show the existence of modifications in the glycoconjugates of the bovine uterine gland linked to physiological and pathological conditions. P120 The effect of semen dilution to low-sperm number/dose on motility and functionality of cryopreserved bovine spermatozoa using LDL (Low Density Lipoproteins) extender: comparison to Triladyl® and Bioxcell® Vera-Munoz, O1,3*, Briand, L1; Diaz, T3; Vásquez, L3; Bencharif, J1 ; Anton, M2 Tainturier, D1 1Laboratory of Biotechnology and Pathology of Reproduction, National Veterinary School of Nantes, BP 40706, 44307 Nantes, France; 2Group Physico-chimie des Emulsions, Laboratoire d´Etude des Interactions des Molécules Alimentaires, Institut National de la Recherche Agronomique, BP 71627, 44316 Nantes Cedex 3, France; 3Universidad Central de Venezuela, Facultad de Ciencias Veterinarias, Instituto de Reproducción Animal Abraham Hernández Prado, Venezuela It has been demonstrated that sperm cryopreservation process impairs sperm cell function and reduce the fertility. Hen egg yolk is widely used as a cryoprotective agent in semen freezing extender protecting the spermatozoa. Its action is due to low density lipoproteins (LDL) contained in the hen egg yolk. Dilution of semen to low cell number/dose can result in a reduction of the post-thaw viability of cryopreserved bovine sperm. It is possible that essential seminal plasma components are lacking at the greater dilution rates. The use

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 68 P o s t e r A b s t r a c t s of artificial insemination (AI) with dose containing low-sperm numbers have been used to optimize use of elite bulls. The objectives of the present study were to evaluate the effects of the semen dilution to low-sperm number/dose on sperm motility and integrity of sperm plasma membrane in the cryopreservation process, using 2 commercial extenders (Triladyl®, Bioxcell®) and LDL extender prepared in our laboratory, 97 % purity. 15 ejaculates were collected from 5 fertile crossbred bulls (Bos taurus x Bos indicus). After collection, semen volume and concentration were assessed. Sperm motility was evaluated by computer-assisted semen analysis (Hamilton Thorne Biosciences), morphological sperm characteristics were evaluated by differential interference microscopy and the integrity of plasma membranes was determined using the hypo-osmotic swelling test (HOST). The semen was subsequently divided into 3 aliquots and diluted with the 3 extenders. 15 ejaculates from 5 bulls were diluted to 120, 60 and 20 x 106 sperm /mL. The different semen dilutions were packaged in 0.25 mL straws and frozen. Two straws of semen from each treatment were thawed, and the semen parameters were evaluated. The sperm motility post thawing at 120, 60 and 20x106 sperm/mL dilutions with the different extenders respectively were: LDL 53.06 ± 4.6 %, 41.72 ± 4.6 %, and 29,33 ± 7.3 %, Bioxcell 45.79 ± 7.8 %, 33.33 ± 12.2 %, and 18.19±+ 6.2 %, and Triladyl 46.39 ± 4.5 %, 32.59 ± 6.26 %, and 17,13 ± 5.7 %. With respect sperm plasma membrane integrity the respective values for each dilution with the 3 extenders were: LDL 52,59+/-2.08%, 41,40+/-7.31% and 30,35+/-6,29%, Bioxcell 46,12+/-3.45%, 34,12+/3,45% and 18,98 ± 4,86% and finally Triladyl 46,87 + 3,28 %, 35,06 + 5,52 % and 24,26 + 4,45 %. The statistical analysis (ANOVA) revealed that LDL extender was more effective in preserving sperm motility and integrity of sperm plasma membrane than Bioxcell® and Triladyl® (p<0.05), increasing the number of straws for AI and the use of elite bulls. P121 Evaluation of factors affecting pregnancy rate in bovine embryo recipients after estrous synchronization for fixed-time embryo transfer Siqueira, LGB1, Viana, JHM2*, Arashiro, EKN2, Torres, CAA3, Camargo, LSA2, Palmer, CW1 1Large Animal Clinical Sciences, University of Saskatchewan, Canada; 2Animal Reproduction Laboratory, Embrapa Dairy Cattle Research Center, Brazil; 3Animal Science, Vicosa Federal University, Brazil The aims of this study were to evaluate the efficacy of a hormone protocol for fixed time embryo transfer, and to investigate factors usually associated with the achievement of high pregnancy rates in bovine recipients. Crossbred non-lactating cows, and heifers (n=259) were treated with the following protocol: 2mg of estradiol benzoate (EB) plus an intravaginal progesterone device (CIDR; day 0); 400 IU of eCG (day 5); PGF2α and CIDR withdrawal (day 8); and 1mg of EB (day 9). Ultrasonographic examinations of the ovaries and venous blood sample collections for the determination of plasma progesterone [P4] concentrations by RIA were performed on day 17. Recipients selected based on the presence of one or more corpora lutea received a single, fresh, quality #1 or #2 (IETS) embryo, recovered after superovulation (MOET; n=94) or in vitro culture (IVP; n=88), on day 17 and were examined for pregnancy 23 days later using ultrasonography. Differences among means of plasma progesterone; CL area; pixel value; pixel heterogeneity; embryo source and pregnancy diagnosis were evaluated using student’s t-test. Low (0.8 to 1.99 ng/mL), medium (2.0 to 5.99 ng/mL) and high (>6.0 ng/mL) categories of plasma [P4] in pregnant and non-pregnant animals were compared using chi-square analysis. No CL was identified on the ovaries of 58 (22.3%) animals. At least one CL was found on the ovaries of 77.6% (201 of 259) of the recipients; but because the quantity of embryos was limited only 182 received embryos. Pregnancy rates were 56.4 and 30.2% for MOET and IVP derived embryos, respectively. Plasma [P4] was greater in MOET recipients that were later diagnosed as pregnant than in non-pregnant animals (5.88±0.77 vs. 3.98±0.48 ng/mL, respectively; P<0.05), but there was no difference between pregnant and non-pregnant IVP recipients (P4

= 3.97±0.57 vs 3.52±0.23 ng/mL, respectively; P>0.05). Pregnancy rates also did not differ among animals showing low, medium or high plasma [P4] (P>0.1). Plasma [P4] was correlated with CL area (r= 0.60; P<0.0001), however, CL area did not correlate with pregnancy status. There was no difference in the mean pixel value (71.8±11.4 vs 71.1±11.5; P>0.10), nor pixel heterogeneity (14.8 vs. 14.5; P>0.1) amongst pregnant and non-pregnant MOET or IVP recipients. In conclusion, corpus luteum area and echotexture was not a useful predictor of pregnancy status in recipients. Plasma [P¬4] relationship with pregnancy rate was evident for recipients inovulated with MOET but not for IVF embryos, in which embryo quality seems to be a more critical variable. P122 Effects of breed and feed system on milk production, body condition score and reproductive performance Walsh, S1,2*; Buckley, F1; Pierce, K2; Byrne, N1; Patton, J1; Dillon, P1 1Teagasc, Dairy Production Research Centre, Moorepark, Fermoy, Co.Cork, Ireland; 2School of Agriculture, Food Science & Veterinary Medicine, UCD, Belfield, Dublin 4, Ireland Introduction Intense genetic selection for milk production within the Holstein-Friesian breed has resulted in marked improvements in milk production, but has predisposed animals to decreased reproductive performance. The correlated response in feed intake to selection for milk yield is approximately half, resulting in a greater degree of body tissue mobilization in early lactation, the duration and magnitude of which can impact health and fertility. The aim of this study was to investigate differences in milk production, reproductive performance and BCS between alternative breeds and crossbreds. Materials and methods The dataset consisted of 749 records from 309 cows across 5 years: 79 Holstein-Friesian (HF), 54 Montbeliarde (MB), 24 Normande (NM), 57 Norwegian Red (NRF), 57 MB×HF (MBX) and 38 NM×HF (NMX). Breeds were randomized to either a low concentrate (LC~500kg/cow) or high concentrate feed system (HC~1090kg/cow). Milk yield (kg/day) was recorded daily. Body condition score (BCS) was recorded every 3 to 4 weeks. Reproductive parameters included 24 day submission rate (SR24), pregnancy rate to first service (PREG1), overall pregnancy rate (FINALPR) and calving to conception interval (CCI). Milk yield, BCS and CCI were analyzed using PROC MIXED, while SR24, PREG1 and FINALPR were analyzed using PROC GENMOD (SAS, 2006). The model included the effects of breed, feed system, parity, year and calving day of year. A pre-experimental covariate was created for milk yield and BCS to adjust for differences that may have existed in pre-experimental performance. Interactions between breed and feed system were not significant. Results Breed and feed system influenced milk yield and BCS (P<0.001). The MB (5604kg) and NM (5464kg) had lower milk yield (P<0.05) compared to all other breeds. The HF had lower BCS (2.77 BCS; P<0.001) compared to all breeds. Cows on HC diet produced higher milk yield and had higher BCS. Compared to HF, NRF (OR=1.57) and MBX (OR=3.11) had increased likelihood of SR24 (P<0.05). The MB had a later CCI (95.3 days) compared to all breeds (P<0.05) with the exception of HF (89.9 days). The NRF (OR=1.57) and NMX (OR=1.62) tended to have higher PREG1 compared to HF. The MB (OR=1.99), NRF (OR=2.48), MBX (OR=2.40) and NMX (OR=2.37) had higher likelihoods of FINALPR (P<0.05) compared to HF. Feed system did not influence reproductive performance. Conclusion Differences observed between the breeds may reflect differences in the breeding goals between the breeds, namely the inclusion or otherwise of traits aimed at maintaining or improving cow health and fertility.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 69 P123 Comparison of ovulation, fertilization and early embryonic survival in low-fertility beef cows as compared to fertile cows and virgin heifers Warnick, AC.*, and Hansen, PJ Department of Animal Sciences, University of Florida, Gainesville Florida USA The objective of this research was to determine physiological causes of low fertility in beef cows. Fertility was compared between low-fertility beef cows (34 British cows during 2 years and 93 Brahman crossbred cows during 3 years; defined as cows that did not get pregnant when mated to fertile bulls in one or two breeding seasons); fertile cows (16 Brahman crossbreds; defined as cows having a calf in several of preceding breeding seasons) and virgin heifers (40 Brahman crossbreds at 2 years of age). All females tested were negative for Brucella and Vibrio fetus. Females were mated by fertile bulls and killed at either 3 or 34 days after breeding to obtain reproductive tracts and determine ovulation, fertilization, and condition of embryos. There were no differences between groups in ovulation or fertilization rate at Day 3 of pregnancy. Overall, ovulation rate was 85.9%, rate of recovery of oocytes/embryos was 82.1% and fertilization rate was 76.4%. The proportion of cows that were not detected in estrus before Day 34 of pregnancy was lower (P<0.01) for low-fertility British cows (5 of 16 cows, 31.3%) than for other groups including low-fertility Brahman crossbred cows (23/32, 71.9%), fertile cows (8/9, 88.9%), and heifers (21/24, 87.5%). All cows that did not return to estrus by Day 34 had an identifiable embryo. The proportion of embryos recovered at Day 34 that were classified as normal (based on weight and length) was lower (P<0.05) for cows with low fertility (British: 2/5, 40%; Brahman crossbred: 9/23, 39.1%) than for fertile cows (8/8, 100%) or heifers (18/21; 85.7%). Similarly, the proportion of inseminated cows in which a normal embryo was recovered (cows with normal embryos/number of cows inseminated) was lower (P<0.001) for low-fertility British cows (2/16, 12.5%) and low-fertility Brahman crossbred cows (9/32, 28.1%) than for fertile cows (8/9, 88.9%) and heifers (18/24, 75.0%). In conclusion, cows that were infertile in previous breeding seasons did not experience reduced ovulation or fertilization rate but had greater embryonic mortality. These data point out the importance of ovulation and fertilization failure and embryonic mortality as important determinants of pregnancy success after insemination. Overall, 14.1% of cows failed to ovulate and 23.6% of animals that ovulated failed to undergo fertilization. The estimated embryonic loss between fertilization and Day 34, calculated using estimates of ovulation, fertilization and normal embryo recovery, was 40.9% for infertile cows and 0.0% for fertile cows and heifers. P124 Duration of induced estrus and conception rate in Holstein heifers after synchronization of estrus with Selectsynch and CIDR-Selectsynch protocols Yoshida, C1,2*; Nakao, T1; Inayoshi, Y3 1Department of Veterinary Medicine, Faculty of Agriculture, Yamaguchi University, Japan; 2Faculty of Agriculture, Niigata University, Japan; 3Yamaguchi Prefectural Livestock Research Center, Japan

Introduction Selectsynch, Ovsynch, and Heat Synch are most commonly used protocols in dairy cows with a high synchronization rate and an acceptable conception rate. The use of the protocols in dairy heifers, however, often results in poor synchronization rate and fertility. Addition of CIDR to the protocols has been known to improve the efficacy in heifers. Aims of this study were to show the effectiveness of the addition of CIDR to Selectsynch protocol on estrous synchronization rate, duration of estrus and conception rate. Methods Ninety Holstein Friesian heifers being reared at Yamaguchi Prefecture Heifer Raising Farm, south-western region in Japan were used. The experimental period was from Aug. 2004 to Jul. 2005. The farm was visited monthly and the animals were divided into two groups at each visit. Thirty-nine heifers were first injected with 100

μg fertireline acetate, GnRH analog, and 7 days later injected with 500 μg cloprostenol (Selectsynch group). In the other 42 heifers, CIDR was applied on the day of fertireline injection and was removed 7 days later on the day of cloprostenol injection (CIDR-Selectsynch group). The estrous signs were checked twice a day with the help of heat detection aids such as Heat Mount Detector, Paint Stick, and Estrus Alert. In addition, intensive visual observation of estrous signs at 4 h interval to estimate the duration of estrus was conducted in 24 heifers in Selectsynch group and 25 in CIDR-Selectsynch group. Animals were submitted either AI or ET on the 7 days after induced estrus. Results Estrus was synchronized in 82.1% in Selectsynch group and in 81.0% in CIDR-Selectsynch group. AI submission rate and conception rate in each of the two groups was 76.5% and 76.9%, and 72.2% and 46.2%, respectively. ET submission rate and conception rate were 40.9% and 44.4% in Selectsynch group and 45.8% and 36.4% in CIDR-Selectsynch group. There was no significant difference in the duration of estrus in the both groups; 10.1±6.0 h (mean±S.D.) and 9.4±4.9 h, respectively. Duration of estrus in CIDR-Selectsynch group of heifers showed a normal distribution pattern with a peak at 8 h, while Selectsynch group showed an abnormal distribution with a peak at less than 4 h and longer than 16 h. Conclusions It is likely that the addition of CIDR to Selectsynch protocol was effective to reduce the variation in time from the completion of the protocol to expression of estrus, whereas it did not improve the estrous synchronization rate and conception rate. P125 The cryoprotective effect of ascorbic acid supplementation on bovine semen quality Zan, LS1*, Hu, JH1, Li, QW1,2, Wang, LQ1, Jia, YH3, Zhu, DN3 1College of Animal Science and Technology, Northwest A & F University, Yangling, ShaanXi Province 712100, P.R. China; 2Department of Biological Engineering, College of Environment and Chemistry Engineering, YanShan University, Qinhuangdao, HeBei Province 066004, P.R. China; 3Domestic Animal Improving Station in ShaanXi Province, Jingyang, shaanXi 713702, P.R. China To investigate the effects of ascorbic acid supplementation in extender on sperm motility and movement characteristics during freezing-thawing, bovine ejaculated semen was collected by artificial vagina from eight Holstein bulls and ascorbic acid was added at concentrations of 2.5, 4.5, 6.5 and 8.5 mg/ml to semen cryoprotective medium. The characteristics of sperm motion were assessed with the WLJY-9000, a computer-aided sperm analysis (CASA) system. Acrosome status was evaluated by the fluorescein isothiocyanate-conjugated peanut agglutinin (FITC-PNA).The plasma membrane integrity was evaluated by the hypotonic swelling test (HOST). Analysis of results showed that the motility and motion characteristics were improved in the presence of ascorbic acid in extender, as compared with the control. The results indicated that the motility and VSL, LIN, VAP, WOB, ALH values and the percentage of “grade a” spermatozoa of cryopreservation sperm supplemented with 4.5 mg/ml ascorbic acid were significantly higher than that of other concentrations (p<0.05). However, ascorbic acid significantly decreased sperm motion characteristics and the percentage of “grade a” spermatozoa at a concentration of 8.5 mg/ml in extender. The percentages of acrosome-intact and membrane-intact spermatozoa was significantly improved (p<0.05) by supplementation with 4.5 mg/ml ascorbic acid. With all parameters measured, the concentration of 4.5 mg/ml ascorbic acid showed better effects on the quality of bovine frozen semen. In conclusion, we propose that addition of 4.5 mg/ml antioxidant ascorbic acid to the cryoprotective medium reduce the production of free radicals and improve bovine frozen semen quality. Key words: Bovine semen; Ascorbic acid; Cryopreservation; Sperm motility; CASA

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 70 P o s t e r A b s t r a c t s P126 Accuracy of ultrasonography in the diagnosis of silent heat in cows compared to plasma progesterone concentration Zdunczyk, S*; Janowski, T; Ras, M; Baranski, W Department of Animal Reproduction, University of Warmia and Mazury in Olsztyn, Poland Silent heat is defined as the lack of behavioral oestrus symptoms although the genital organs are undergoing the normal cyclical changes. It is the main reason of post-partum anoestrus in dairy cows causing elongation of service period and, in consequence, substantial economical losses. Rectal palpation is a main method used for clinical evaluation of ovarian activity in dairy herds, but it may cause high proportion of misdiagnosed and incorrectly treated animals. Ultrasonography is considered an important diagnostic aid to rectal palpation. The aim of this study was to assess the accuracy of ultrasonography for the diagnosis of silent heat compared to plasma progesterone concentration. The study was carried out in 5 dairy herds in North-East Poland. Cows, which showed no visible oestrus signs until day 60 postpartum were examined by ultrasonography twice, in a 10-day interval. A real-time, B-mode scanner (Honda 1500) with 5 MHz probe was used. Blood samples were collected simultaneously from the tail vein into heparinised evacuated tubes. Progesterone concentration in blood plasma was determined using RIA. Presence of physiological ovarian structures (follicles, corpus luteum) was an indication of cyclicity in anoestrous cows. High progesterone level on the first, but low on the second examination or low on the first and high on the second examination were interpreted as a silent heat. Based on progesterone values silent heat was diagnosed in 145 anoestrous cows, whereas ultrasonographically 106 cows were found with silent heat. The accuracy of ultrasonography in diagnosis of silent heat in cows was 89.0 %. The sensitivity and specificity of this method for diagnosis of corpus luteum were 94.7 % and 84.0 %, respectively. Our results showed that ultrasonography is useful tool to diagnose of silent heat in cows. Poster 02 - Reproduction of Small Ruminants P127 Trehalose improves ram semen cryopreservation when it is present in conventional extenders Aisen, E.*, Pelufo, V., Malcotti, V., Morello, H., Medina, V., Venturino, A. Laboratorio de Teriogenología, Facultad de Ciencias Agrarias, Universidad Nacional del Comahue. C.C. 85 (8303), Cinco Saltos (Río Negro), Argentina It is well known that trehalose improve the post-thawing sperm viability and fertility when it is added in hypertonic conditions. The aim of this study was to apply trehalose in three different extenders used commonly in ram semen cryopreservation. The solutions (with or without trehalose 100 mosm/L), containing Tris, citric acid, fructose or glucose, glycerol, egg yolk and antibiotics, were B1 (experimental), S (Salamon’s extender) and Tri (Triladyl®). Ejaculates from four Merino rams were evaluated and pooled at 30°C. The semen was diluted to contain 1x109 cells/mL, cooled to 5°C, loaded into 0.25-mL straws, frozen and stored in liquid nitrogen. Post-thaw evaluation was based on sperm motility (MI), supravital stain (Eo), acrosome integrity (AI), hyposmotic swelling test (HOST), middle piece function (PI) and incubation resistance at 39ºC, 4 h (TR). Majority, post-thaw parameters were higher in those treatments with trehalose, specially MI, AI, PI and TR, indicating that this disaccharide in this conditions improve the morphology and function status of cryopreserved spermatozoa. The extender S with trehalose showed the best results: MI=63,0%; Eo=58%; TR=50%, PI=0,92; AI=75,8%. We conclude that, in that trial, trehalose protects membranes integrity and physiological parameters, and could improve the fertility results in artificial insemination programmes with cryopreserved ram semen.

P128 Measurement of sperm capacitation and acrosome reaction - like changes by chlortetracycline test (CTC) can predict the freezability of ram semen? Azevedo, HC.1*; Bicudo, SD.2; Sousa, DB.2; Maia, MS.3; Rodello, L.2; Sicherle, CC.2

1Embrapa Coastal Tablelands, Aracaju, Brazil; 2Faculty of Veterinary Medicine and Anim. Science, São Paulo State University, Brazil; 3Embrapa Tropical Semi-Arid, Petrolina, Brazil The purpose of this study was to know if the chlortetracycline test (CTC) applied to fresh semen can predict the performance of ram spermatozoa in cryopreservation. Ejaculates of 25 Santa Inês rams were collected and the CTC assay was applied in fresh semen diluting a sample (24 x 106 spermatozoa) in 1000 μL of PBS (37oC) and submitting it to centrifugation (900 g/4´) to remove the seminal plasma. The sperm pellet was then resuspended (150 μL – PBS) and an aliquot (10 μL) was mixed with 10 μL of 1mM CTC (20mM - Tris; 130mM – NaCl; 5mM - L-Cysteine). The mixture was homogenized for 20 seconds and then it was added to 10 μL of 1% of glutaraldehyde solution (2M - Tris). A 10 μL-sample of this suspension was placed on a heated slide (37oC) and mixed with 10μL of 0.22 M 1,4-diazabicyclo[2.2.2]octane (DABCO – PBS:Glycerol - 1:9). The mixture was covered with coverslips, compressed, sealed and stored at 4oC in the dark to be evaluated within 1 hour using an epifluorescent microscope under oil (1000x). A total of 100 cells were counted for each slide and distributed into 3 categories: uncapacitated with intact acrosome (F), capacitated with intact acrosome (B) and acrosomal reaction sperm (AR). To frozen semen, the ejaculates were diluted in egg yolk Tris extender (100 x 106 spermatozoa/0.25mL), cooled (0.25°C/minute to 5°C - 120 minutes), frozen (-20°C/minute to -120°C) and thawed (42°C/20´´). The frozen-thawed semen was evaluated as for spermatic plasmatic membrane integrity (PMI) by association of propidium iodide (PI – 0.5 mg/mL) and Pisum sativum agglutinin conjugated with fluorescein isothiocyanate (PSA-FITC - 100 g/mL). The rams were grouped in three cryoresistence levels (CRYO) according to general average of PMI (X=22.1%), such as: 1 – inferior (X≤10.3%); 2 – intermediate (10.3%>X≤29.9%) and; 3 – superior (X>29.9%). To all the variables it was used the variance analysis (ANOVA) in a completely randomized design and Tukey method was used to compare the averages (P<0.05). The CRYO level influenced (P<0.05) the CTC pattern distribution. The averages and standard deviations (X ± σ) of spermatozoa classified as F, B and AR were 64.7 ± 15.3; 21.0 ± 14.7 and 14.3 ± 10.8% for CRYO 1, 84.9 ± 6.8; 7.1 ± 6.1 and 8.0 ± 6.0% for CRYO 2 and 87.0 ± 7.9; 7.4 ± 5.6 and 5.6 ± 5.1% for CRYO 3 respectively. In CRYO 1 the proportion of F spermatozoa was lower and the proportion of B and AR was higher, both compared to CRYO 2 and 3 (P<0.05). It was concluded that the CTC test can be used to select semen donor rams with less susceptible spermatozoa to cryopreservation. P129 Birth and weaning weight of F1 lambs of pelibuey and blackbelly ewes sired with specialized meat production breeds Baeza, J1*, Quintal, J1, Ramón, J2, Bores, R1 1INIFAP-C.E. Mococha, Yuc, Mexico; 2CeSyRO, Instituto Tecnologico Conkal, Yuc., Mexico; *baeza.juanjose@inifap.gob.mx The objective of this work was to evaluate the paternal breed effect above birth(BW) and weaning(WW) weight of cross lambs of Pelibuey (PB) and Blackbelly (BB) ewes sired with PB, BB, Dorper Black Head (DPN), Dorper White (DPB), Katahdyn (K) and Ile of France (Ile). The data reported here were collected in four seasons (Summer and Fall (2006); Winter and Spring (2007)) at the Mococha research station of INIFAP, Mexico, and in the last Spring season, we incorporated another two more farms, which only have PB ewes. They are located at tropical weather with rain season in Summer. What we use were 434 BW and 318 WW records, from 39 sires and 231 dams. Ewes were fed in Star Grass irrigated pastures + 300 g/hd/d

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 71 of a 14% CP supplement. The lambs were fed with at libitum access of a 18% PC supplement since 15th days old until 60th days old. The data on BW and WW were analyzed by Mixed Model procedures of SAS program. The fixed effects utilized Breed of sire (BS), Breed of ewe (BE), Sex (Sx), Litter size(L) and season(T) nested in BE (T(BE). The random effects were Sire(S) nested in BS and Ewe(E) nested in BE. BW and WW were influenced by BS, L , T(BE) (P<0.05). No differences were observed among BE and Sx (p > 0.05). K lambs ranked first in both measures, 3.42 ± 0.36 kg. and 11.62±1.53 kg. for BW and WW, respectively. Ile(3.06±0.33) were intermediate and DPN (2.96±0.32), DPB (2.87±0.33), BB(2.74±0.35) and PB(2.82±0.33) were last for BW. For WW, Ile(9.95. ±1.44), DPN (9.85±1.40), DPB(9.69±1.44), were intermediate and BB(8.77±1.53) PB(8.45±1.45) were last. Singles lambs (3.69±0.32) had higher weights than double(2.92±0.32) or multiple litter(2.32±0.34) for BW. Also Single lambs (11.21±1.4) were higher than doubles (9.19±1.39) which were higher than multiples (8.76±1.5). We observed that the birth weight is affected by Specialized beef Breed of sire used, without being a serious risk because they are low. Also the weaning weight is improved although it is a trait more influenced by the ewe performance than sire. Notice that the BB and PB ewes have a small frame and multiple litters. Project sponsored by CONACYT-SAGARPA-2004-C01-150 P130 Systemic concentrations of endo- and exogenous FSH in anestrous ewes superovulated with Folltropin®-V after pretreatment with medroxyprogesterone acetate (MAP)-releasing vaginal sponges and a single dose of estradiol 17β (E2 17β) Bartlewski, PM1*; Alexander, BD2; King, WA1 1Department of Biomedical Sciences, Ontario Veterinary College, University of Guelph, Guelph, Ont., Canada; 2Department of Farm Animal Production and Health, Faculty of Veterinary Medicine and Animal Science, University of Peradeniya, Peradeniya, Sri Lanka The synchronization of follicular wave emergence with progestin and estradiol 17β (E2 17β) prior to superovulation in anestrous ewes reduces the variability in ovarian responses by an unknown mechanism. Follicle stimulating hormone (FSH) is a primary promoter of antral follicular growth and maturation, but the relevance of changes in circulating FSH concentrations to the superovulatory performance in ewes remains unknown. This report is comprised of retrospective analyses of serum FSH concentrations in anestrous Rideau Arcott ewes (May-June), which were superovulated with Folltropin®-V (porcine FSH), with (n=8; treated ewes) or without (n=10; control ewes) a 14-day pretreatment with medroxyprogesterone acetate (MAP)-releasing vaginal sponges (60 mg), and a single i.m. dose of 350 μg E2 17β given 6 days after insertion of sponges. The superovulatory treatment, started 6 days after E2 17β injection, consisted of six i.m. doses of Folltropin®-V (2.5 ml x 1 and 1.25 ml x 5) given twice daily, followed by the bolus injection of GnRH (50 μg i.m.). In order to avoid the effects of inter-batch variations in pFSH bioactivity, separate batches of Folltropin®-V were pooled to prepare sufficient quantities to treat all 18 animals. Serum samples obtained during the superovulatory treatment were analyzed by radioimmunoassays (RIA) for concentrations of ovine (oFSH) and porcine FSH (pFSH), using species-specific standards and primary antibodies. Both gonadotropins have been found to cross-react with the heterospecific antibody; therefore, cross-reactivity was subtracted from all FSH concentrations. The control ewes exceeded E2

17β-treated animals in serum concentrations of oFSH at 2, 2.5 and 3 days after the first Folltropin®-V injection (P<0.05). There were no differences (P>0.05) between the two groups in pFSH concentrations. The mean ovulation rate and number of recovered embryos did not differ between the two groups of ewes (P>0.05), but the variability in the number of luteal structures and in overall embryo yields was lower in E2 17β-treated ewes (F test; P<0.05). In conclusion, FSH secretion was significantly diminished during the superovulatory regimen in anestrous ewes that had been pretreated with MAP and E2 17β. The

possible effects of changes in endogenous FSH concentrations during ovarian superstimulation with pFSH should not be ignored, as they may contribute to the variability in the ovulatory response an in vivo embryo production in ewes. P131 Comparison of three short estrus synchronization protocols in Santa Ines ewes employing Crestar Bartolomeu, CC1*; Delrei, AJ2; Gomes, RRR3; Alvares, CTG3; Carvalho, JA3 1Unidade Academica de Garanhuns, Universidade Federal Rural de Pernambuco, Brazil; 2Centro Biotecnologico de Reprodução Animal, Universidade Estadual do Sudoeste da Bahia, Brazil, 3Departamento de Ciencias Agrarias, Universidade Estadual de Santa Cruz, Brazil Introduction Its is known that in Brazil the subsistence of the sheep culture occurs in the majority of the production systems and the technological level employed are deficient which leads to low production. In the Northeast of Brazil, the low production is observed due the low employment of biotechnology and also low nutrition. The attainment of an efficacious protocol of estrus synchronization will favor the management at the farms by the application of a technology, which will facilitate the formation uniform lots, which will attend the consumer market. Methods This experiment was conducted in the State of Minas Gerais, Brazil Latitude 15o 48' 09" (S) and longitude 43o 18' 32" (E). The climate in this region is dry, with a precipitation index of 915mm/year. The ewes were kept in Coast Cross pasture from 7am until 5pm with salt and water ad libitum. Thirty four Santa Ines ewes with age varying from 2.5 to 3.5 years, with a mean weight of 52.3 Kg and presenting a BSC of 3 (scale 1-5) were allocated into four treatment groups: Control (n=9); GnRH (n=8), EV (n=8) and EB (n=8). All ewes received at the first day of treatment an auricular Crestar implant, except the control group, which was removed 8 days later at the time when 2 mL of PGF2α (Prolise®, IM) were administered. The GnRH group received at first day of treatment 0.7 mL of GnRH (burserelin acetate, IM), The EV group 0,5 mL of estradiol valerate and the EB group 0.7 mL of estradiol benzoate. After the removal of the Crestar implant a sheep was put together with the ewes for a period of 72 hours to identify the beginning and duration of estrus. The sheep was marked with ink in the chest to mark the ewes at the time of mounting, and this ink was changed, at the end of each observation period, to a different color. The observations were done every 6 hours for a period of 72 hours. Results In the GnRH group (8/8; 100%) of the ewes presented estrus behavior with a mean of 56.5 ± 14.07 hours after implant removal, EV group (5/8; 62.5%) of the ewes presented estrus behavior with a mean of 52.8 ± 17.55 hours after implant removal, group EB (6/8; 75%) of the ewes presented estrus behavior with a mean of 66.0 ± 10.95 hours after implant removal and Control group (2/9, 22.22%) of the ewes presented estrus behavior 12.0 ± 6.0 hours after the time of Crestar removal in the other groups, (P<0.05). The mean estrus duration was 11.25 ± 5.0; 9.6 ± 5.3; 7.0 ± 2.4 and 12.0 ± 8.4 hours for groups GnRH, EV, EB and Control, respectively, (P>0.05). The lambing rate was 37.5; 37.5; 37.5 and 22.22% for groups GnRH, EV, EB and Control, respectively, (P>0.05). Conclusion These data indicate that the short protocols for ewes tested in the present experiment despite the percentage of estrus behavior have been high, especially in the GnRH group it was not observed statistical difference between the treated groups cornering the lambing rate. Possibly with the addition of ovulation inducers after the Crestar implant removal at the end of treatment, the lambing rate may increase.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 72 P o s t e r A b s t r a c t s P132 Freezing of goat semen in AndroMed®, a soybean lecithin based extender Becker-Silva, SC.1; Holtz, W.2 1Santa Cruz State University, Ilhéus, Brazil; 2Inst of Animal Husbandry and Genetics, Georg-August-Univ., Goettingen, Germany Introduction The composition of semen extenders containing products of animal origin such as milk or egg yolk remains undefined, making standardization impossible. Furthermore the risk of contamination with infectious agents and introduction of animal diseases into other regions or foreign countries must be considered. Consequently, chemically defined extenders with no animal components are desirable. In the past, several such extenders have been examined with variable results. A commercially available semen extender for the bovine (AndroMed®, Minitueb, Tiefenbach, Germany), containing soybean lecithin instead of material of animal origin has been shown to be suitable for the freezing of ovine semen. This investigation was designed with the intention of examining in vitro the suitability of AndroMed for the cryopreservation of caprine semen. Materials and Methods From 4 mature Boer goat sires, 26 ejaculates were collected with the aid of an artificial vagina. Each ejaculate was split into half. One part was diluted at 30°C with conventional TRIS-egg yolk extender containing 6.8% glycerol (TYG), the other with AndroMed extender. Both were treated in a similar way, i.e. cooling to 4°C within 2h, aspiration into 0,25ml straws, freezing in nitrogen-vapor at -120°C and storage in liquid nitrogen. After thawing at 38°C, motility (MOT, expressed as percentage of native semen) and membrane integrity (MI) after eosin-nigrosin staining (as percentage of TYG results) were assessed. After 3 h of incubation at 38°C, MOT was assessed once again. Results The post-thaw MOT of goat semen cryopreserved in AndroMed diluent was 54% as compared to 55% in semen frozen in conventional TYG extender. The corresponding MI values were 118 and 100%. After 3h of incubation, the MOT for the AndroMed samples was 31% vs. 37% for the TYG samples. None of these differences were statistically significant (P > 0.05, Student’s t-test). Conclusion On the basis of in vitro assessment, the cryopreservation of caprine semen in AndroMed®, a diluent free of animal protein originally designed for bovine semen, was just as successful as freezing in conventional TRIS-egg yolk-glycerol extender, and may be considered a microbiologically safer option for storing and shipping of goat semen. A final assessment will require large-scale insemination trials. P133 Effect of pre-ovulatory luteinizing hormone surge on the mRNA expression of angiogeneic growth factors in the ovine ovary Chowdhury, WH1*, Scaramuzzi, RJ2, Wheeler-Jones, C2, Khalid, M1 1Veterinary Clinical Sciences, The Royal Veterinary College, University of London, United Kingdom; 2Veterinary Basic Sciences, The Royal Veterinary College, University of London, United Kingdom Introduction Angiogenic factors are essential for neo-vascularisation and development of ovarian follicles. Vascular Endothelial Growth Factor (VEGF) and the angiopoietins (Ang-1, Ang-2) are important and their expression in follicles differs with stage of the oestrous cycle. However, their physiological control in follicles is unclear. This study tests the hypothesis that the mRNA expression for VEGF, Ang-1 and Ang-2 in antral follicles is regulated by pre-ovulatory LH surge. Methods Twenty eight ewes were made hypogonadotrphic with GnRH agonist (Buserelin) after which a combination of FSH and LH was administrated for normal development of follicles. This was followed by intravenous infusion of 0, 50, 100 or 200μg of LH over 4 or 8h as pre-ovulatory LH surge. Ewes were killed 8h after the LH infusion. The ovaries were serially section (10μm) at -20°C. All follicles ≥2.0mm in diameter were analysed for VEGF, Ang-1 and Ang-2 mRNA by in situ hybridization using ovine riboprobes. mRNA

expression was quantified and the data were analysed using a mixed model ANOVA. Results Pre-ovulatory LH surge significantly increased (P<0.05) mRNA expression for Ang-1, Ang-2 and VEGF in both granulosa and theca cells of the ≥2.0mm follicles. 4h LH surge increased (P<0.05) VEGF expression at medium (100μg) and high (200μg) doses, whereas Ang-1 expression was increased (P<0.05) only with the high dose compared to controls. 8h LH surge increased (P<0.05) expression for VEGF and Ang-1 at both medium and high doses. However, Ang-2 expression was increased (P<0.05) with all the doses of LH surge of both durations compared to controls. A higher expression was observed for all the three genes with 8h compared to 4h LH surge. Expression for all the genes was also higher (P<0.05) in large (≥4.0 mm) compared to small (≥2-2.5 mm) or medium (2.5-4.0 mm) follicles with no difference between small and medium follicles. Although LH surge increased both Ang-1 and Ang-2 expression in follicles, Ang-1 expression was significantly lower (P<0.05) compared to Ang-2 that led to a higher Ang-2:Ang1 ratio. Conclusions The results obtained demonstrate that the preovulatory LH surge increases the mRNA expression for VEGF, Ang-1, and Ang-2 as well as Ang-2:Ang-1 ratio in follicles, and a higher dose and longer duration of LH surge was more effective in this respect. The higher Ang-2:Ang-1 ratio when coupled with an increase in VEGF expression observed as a result of pre-ovulatory LH surge may lead to formation of new blood vessels and increased vascularization of the antral follicles. P134 Characterization of lipid rafts in ram spermatozoa Colás, C1*; Ollero, M2; Pérez-Pé, R1; Muiño-Blanco, T1; Cebrián-Pérez, JA1

1Department of Biochemistry and Molecular and Cell Biology, Faculty of Veterinary Medicine, University of Zaragoza, Spain; 2 Faculty of Medicine Necker, París, France The lipid architecture of the sperm plasma membrane plays an important role in the capacitation process. A strong case has been made that sterol-rich microdomains (rafts) form organizing centers that affect the distribution of membrane proteins, activation of receptors and triggering of signalling cascades. Cholesterol has been associated with the formation of detergent-insoluble membrane microdomains in many cell types, and mammalian sperm have been shown to contain detergent-resistant membranes (DRMs). In this study, we investigated changes in lipid composition of DRMs isolated from control, capacitated and acrosome-reacted ram spermatozoa. For the development of the isolation technique, we carried out a comparative analysis using sperm samples lysed with 1% non-ionic detergent, 30 min at 4ºC (Triton-X100) or 37ºC (Brij98) followed by two times of centrifugation, 2 h and 20 h, in an Optiprep density gradient. Analysis of cholesterol and ganglioside GM1 (lipid-raft markers) revealed that after 20 h centrifugation, DRMs were located at the bottom of the gradient (highest density) while two bands enriched in cholesterol and GM1 of low (DRMs fraction) and high density were separated after 2 h centrifugation. The results obtained with both detergents were very similar. The isolation of DRMs by Triton-X100 (2 h centrifugation) from samples either capacitated (73.9±2.9% CTC capacitated pattern) or ionophore-induced acrosome reaction (43.3±3.7%) revealed a loss of cholesterol in all fractions of the gradient (control, 25.3±8.5; capacitated, 4.8±1.1 µM; acrosome-reacted, 3.9± 0.8 µM), which indicate the loss of cholesterol in both raft and non-raft regions. However, the content of GM1 (relative percentage) increased in capacitated (7.7±1.8% versus 5.3±1.4%) and acrosome-reacted (14.6±7.7%) samples, which would suggest a reunification of raft-type microdomains enriched in this ganglioside, together with differences in the functionality of different lipid rafts in ram sperm. The cytochemical analysis of GM1 on ram sperm by fluorescent cholera toxin showed the presence of GM1 in post-acrosome and flagellum with no modifications during capacitation. Similarly, Caveolin-1 (protein usually found in rafts) was immunolocalized in the acrosome, and capacitation did not induce any modification. Grants: CICYT-FEDER AGL 2005-02614, CICYT-FEDER AGL 2007-61229 and DGA A-26/2005.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 73 P135 Synchronization of oestrus and ovulation in non-seasonal West African ewes treated with cloprostenol during early stages of luteal development Contreras-Solis, I1*; Vasquez, B2; Diaz, T1; Lopez-Sebastian, A3; Gonzalez-Bulnes, A3

1Facultad de Ciencias Veterinarias, Universidad Central de Venezuela, Venezuela; 2Instituto Nacional de Investigaciones Agrícolas, Venezuela; 3Instituto Nacional de Investigación y Tecnología Agraria y Alimentaria, Spain

Cloprostenol (prostaglandin F2 alpha analogue) has been commonly used to synchronise oestrus in non-seasonal and seasonal ewes during the breeding season. The most usual protocol consist of two injections 9 to 11 days apart; however, the most recent studies indicate the possibility of increasing efficiency of the treatment by applying cloprostenol in early luteal phase (Contreras-Solis et al., in press). On the other hand, information about efficacy of cloprostenol injection during early stages of luteal development is controversial. Therefore, the aim of this study was to assess if a low dose of cloprostenol (43.75 µg; Planate®, Schering Plough) is capable to induce synchronization of oestrus and ovulation during the early stage of luteal growth in non-seasonal hair sheep. Twenty-four adult West African ewes were randomly assigned to three groups treated with cloprostenol at Day 3 (D3 n = 8), 5 (D5 n = 8) and 7 (D7 n = 8) after ovulation. Transrectal ultrasonographies were performed at Day 0 (day of injection), 1 and 10 to detect the presence of luteal tissue and luteolysis. Oestrous behaviour was detected every 4h from 20h after treatment using a trained teaser ram, whilst ovulation was detected by ultrasonographic scanning every 4 h from 16 h of the onset of oestrus. Assessment of luteal function was performed by determining plasma progesterone levels by radioimmunoassay. Seven out of eight ewes (87.5%) from D3 and D5 groups and all ewes from D7 group showed functional corpora lutea at timing of injection (P < 0.001; 1.4 ± 0.3, 3.0 ± 0.4 and 3.9 ± 0.3 ng/mL of mean plasma progesterone concentration, respectively). Cloprostenol was effective to induce luteolysis and oestrus in all ewes. Oestrous activity was observed at 28.6 ± 3.3, 34.3 ± 2.1 and 36.5 ± 3.2 h after treatment for D3, D5 and D7 groups, respectively. Onset of ovulation was detected at 51.4 ± 1.4, 52.0 ± 1.8 and 55.0 ± 1.7 h for D3, D5 and D7, respectively; with oestrus-ovulation intervals of 22.9 ± 3.1, 18.4 ± 2.7 and 18.5 ± 3.4 h. The number and function of corpora lutea were also similar among groups (D3: 1.9 ± 0.2 and 5.6 ± 0.5 ng/mL; D5: 1.7 ± 0.2 and 5.6 ± 0.4 ng/mL; D7: 1.4 ± 0.2 and 4.5 ± 0.7 ng/mL). Thus, current study indicates that cloprostenol is effective to induce luteolysis, oestrus, ovulation and corpora lutea with normal life span in hair sheep when is administered from Day 3 after ovulation. Funded by FONACIT S1-2002000413 and CDCH-UCV. Contreras-Solis et al., Anim. Reprod. Sci. In press. P136 Conservation in refrigeration of the ovine semen Córdova, A1*; Cortés, S1; Córdova, MS2; Córdova, CA3; Guerra, JE4; Tapia, B5 1Departamento de Producción Agrícola y Animal, Ecodesarrollo de la Producción Animal, Universidad Autónoma Metropolitana-Xochimilco, Cuerpo Académico: Salud y Bienestar Animal. Calz. del Hueso 1100 Col. Villa Quietud CPP. 04960, México, D.F.(Córdova A. aci57@prodigy.net.mx); 2Laborarotorios Brovel, S.A.de C.V., Mexico; 3Becario de CONACYT-México. Estudiante de Doctorado. Universidad de León, España; 4Facultad de Agronomía. Universidad Autónoma de Sinaloa, México; 5Estudiante de Doctorado. Facultad de Veterinaria. Universidad Complutense de Madrid, España Introduction The preservation of semen allows the use of genetic resources for long term, so that the cooling sheep sperm lets more time preserve the ability of sperm fertilization after obtaining an ejaculate. The rate of fertilization is used when cooled semen has a fluctuation between 45 and 65%, when using fresh semen this parameter is about 84%, this is because sperm got harm at the plasma membrane, with the unavoidable reduction of motility and acrosome

damage during the process of preservation, which encourages further works on the preservation of semen in the cooling of this kind. Objective Evaluate the effect of the conservation in refrigeration of the ovine semen on the spermatic quality: motility, viability and acrosome integrity (NAR). Methods Four lambs race English Suffolk 2 years were used, obtaining 3 to 4 ejaculated per week and 24 samples were collected from ejaculate with artificial vagina. The progresses of motility, viability, pH, NAR were evaluated. Extenders 1 (Rangel, 1985); extenders 2 (Tris-fructose egg-yolk ram semen - Salamon, 1990) and extensor 3 basis triladyl were used in proportion of 1:3; semen keep on chilling at 4 ° C for 24 hours and the variables were assessed at 0, 2, 4 and 24 hours. Results There was found that the pH remains unchanged during the first 24 hours in the three extenders. The motility and viability were better with diluter than triladyl during the experiment. However, the NAR had a better behave with the extenders 1 and 2. The results were analyzed using descriptive statistics, which showed averages for each variable and there was not found difference statistically significant between the three tests. Conclusion The diluter with the help of triladyl can represent an alternative for the conservation of the ovine semen in refrigeration. P137 Effect of glycerol concentration on the motility and viability of cooled-stored ram semen Crespilho, AC1*; Papa, FO1; Dell’Aqua Jr., JA1; Zahn, FS1; Martins Jr, A2; Araujo, GHM1; Oba, E1 1 Department of Animal Reproduction and Veterinary Radiology, São Paulo State University, Botucatu, Brazil; 2São Paulo State University, Araçatuba, Brazil Several studies demonstrate the efficiency of glycerol as a sperm membrane protector in many species during cryopreservation procedures. However, few studies investigated its effect on the maintenance of ram sperm viability during refrigeration. The aim of the present study was to evaluate the effect of the addition of different concentrations of glycerol on ram sperm viability under 5°C refrigeration for until 120 hours. One ejaculate of five Santa Inês rams, obtained by electroejaculation, were used. Each ejaculate was divided into 4 equal samples, diluted to a concentration of 10× 106 sperms/mL in TRIS (Tris(hydroximethyl)-aminomethane, sodium citrate and fructose) extender without or with 1.5, 3.0 or 6.0% glycerol (G1, G2, G3 and G4, respectively). Samples were packed in 0.5mL straws and cooled in a Minitüb® adjustable refrigerator at -0.25ºC/min until 5ºC. Samples were maintained at 5ºC and were evaluated at moments 0, 24, 48, 72, 96 and 120 hours for sperm motion characteristics by CASA (IVOS – 12) and for integrity of plasma and acrosomal membranes and mitochondrial potential by epifluorescence with propidium iodide, FITC-PSA and JC-1 probes. Data were analyzed by a Student’s t-test and a ‘t’ test with repeated measures to compare each group in a function of time of refrigeration and to evaluate the efficiency of each treatment to maintain sperm viability at 120 hours of refrigeration. There were no significant differences on parameters of motility and integrity when different treatments were compared at moments 0, 24, 48, 72, 96 and 120 hours. However, a significant decrease in total motility (MOT, P=0.018), sperm beat cross frequency (BCF, P= 0.0292) and acrosome integrity (P=0.0088) was observed in G1 samples at 120 hours of refrigeration. The addition of glycerol enhanced the preservation of MOT during the period of refrigeration and this effect was directly correlated to the concentration of cryoprotectant in the extender (G2, P<0.06; G3, P<0.07; and G4, P=0.3196). There was no significant effect of glycerol addition in relation to the maintenance of plasma membrane integrity and mitochondrial potential evaluated by fluorescent probes. The use of glycerol significantly decreased the damages on ram semen caused by the 120 hours period of refrigeration, thus preserving MOT, BCF and acrosomal integrity and probably inhibiting premature sperm capacitation during cooling storage. The addition of glycerol has proved to be a viable alternative to best preserve refrigerated

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 74 P o s t e r A b s t r a c t s semen samples used on artificial insemination programs in ovine herds. P138 The End of Breeding Season in Subtropical Female Goats Results From the Development of Refractoriness to Winter Short Days Delgadillo, JA1*; Aguilar, J1 ; Malpaux, B2 1Centro de Investigación en Reproducción Caprina, Universidad Autónoma Agraria Antonio Narro, Torreón, Coahuila, México; 2Physiologie de la Reproduction et des Comportements, UMR 6175 INRA-CNRS-Université de Tours-Haras Nationaux, Nouzilly, France This study was carried out to determine if the end of the breeding season of local female goats from subtropical Mexico results from refractoriness to the stimulatory effect of short days of winter or to the inhibitory effect of increasing day length following the winter solstice. Does were ovariectomized and treated with a subcutaneous implant constantly releasing estradiol-l7 ß (OVX+E). The control group (n = 6) remained in open sheds under natural day length. The experimental group (n = 6) was placed in a light-proof building and exposed to constant short days (10 hours of light by day) from the winter solstice. LH plasma concentrations were measured twice a week. The seasonal decrease in LH secretion, indicative of the end of the breeding season, was defined as the first of three consecutive samples with LH concentrations lower than 1 ng/ml. The seasonal decrease in LH secretion did not differ (P > 0.05) between experimental (February 4 + 10 days) and control (February 3 + 5 days) groups. These results allow us to conclude that, as in temperate latitudes, the end of the breeding season in female goats raised in a subtropical latitude is not driven by winter increasing day length, rather it appears to result from short day refractoriness. This suggests the implication of an endogenous circannual rhythm in regulating seasonal changes in reproduction in subtropical latitudes. Supported by CONACyT grant (28420N). P139 Effect of dietary supplement of phytoestrogens on thyroid hormones, steroid production and localization of carbonic anhydrase in testis, efferent ductules and thyroid gland of male goat kids Ekstedt, E1*; Holm, L1; Ridderstråle, Y1; Selstam, G2; Madej, A1 1Department of Anatomy, Physiology and Biochemistry, Swedish University of Agricultural Sciences, Box 7011 S-750 07 Uppsala, Sweden; 2Department of Molecular Biology, University of Umeå, 90187 Umeå, Sweden Exposure of xenoestrogens to humans and animals is an increasing concern due to their effects on reproduction. Phytoestrogens are non-steroidal substances in many plants with capacity to bind to oestrogen receptors (ER). Presence of ER in the efferent ductules of the mature male goat indicates the importance of estrogens for male reproduction, which in turn have an effect on carbonic anhydrase (CA) activity (Zhou et al., 2001). The present study was undertaken to investigate whether a low addition of phytoestrogens to a normal diet affects thyroid hormone secretion, the establishment of testosterone production and histochemical localization of CA in testis, efferent ductules and thyroid gland during puberty in male goat kids. Four male goat kids were given a standard diet and 3 were given an addition of 3 - 4 mg phytoestrogens/kg body weight in tablets containing genistein, daidzein, biochanin and formononetin. The treatment commenced at 3 months of age and continued until slaughter at 6 months of age. Plasma testosterone, oestrone sulphate, total and free triiodothyronine (T3) and thyroxin (T4) were measured weekly. Testosterone and cyclic AMP were measured in testicular tissue and CA was localized histochemically in thyroids and reproductive organs. After four weeks of treatment, total T3 concentrations were significantly higher in the phytoestrogen treated animals than in the control ones (2.3 ± 0.3 vs. 1.2 ± 0.2 nmol/l, P < 0.01). Plasma testosterone concentrations at week 7 were significantly (P < 0.05) higher in the phytoestrogen treated animals than the control ones (37.5 ± 6.0 vs. 19.1 ± 5.2 nmol/l). Free T3 concentrations in kids exposed

to phytoestrogens were significantly higher than in control animals during week 8 and 9 of the experiment. At the end of the experiment plasma testosterone concentrations were slightly lower in treated goats, testosterone and cyclic AMP levels were lower in testicular tissue. Strong staining for CA activity was present in testicular capillaries, nuclei and apical membranes of the non-ciliated cells of the efferent ductules. The thyroid gland showed strong CA activity in the basolateral membranes of the epithelium. No difference was shown between groups. In conclusion, the exposure of male goat kids to low doses of phytoestrogens has an impact on the hormonal changes during puberty as well as the content of cyclic AMP in the testis, but did not alter CA localization in thyroids or reproductive organs. This study was supported by Formas P140 Efficiency of transabdominal ultrasonography in pregnancy diagnosis during late embryonic and early fetal stages of pregnancy in Konya Merino ewes Erdem, H1*, Saribaym MK2, Tekeli, T1 1Obstetrics and Gyneacology, Selcuk University Faculty of Veterinary Medicine, Turkey; 2Obstetrics and Gyneacology, Mustafa University Faculty of Veterinary Medicine, Turkey Objective of this study was to evaluate the efficiency of location (right ingiunal region [RIR] or left ingiunal region [LIR]) of transabdominal ultrasonography to determine pregnancy and number of embryo/fetus during late embryonic and early fetal stages of pregnancy in Konya Merino ewes. Eighty-four ewes were diagnosed as pregnant 34 days after mating by transrectal ultasonograhy. Of these ewes, 45 had single embryo and 39 had twin embryos. On days 34 and 50, these ewes were again examined by RIR and LIR transabdominal ultasonography. The results were compared with transrectal ultrasongraphy and lambing records. On day 34, 62 % (28/45) and 64% (29/45) of single pregnancies and 33 % (13/39) and 28 % (11/39) of twin pregnancies could be detected through RIR and LIR transabdominal ultrasonography, respectively. On day 50, 88 % (40/45) and 91 % (41/45) of single and 53 % (21/39) and 46 % (18/39) of twin pregnancies were detected through RIR and LIR transabdominal ultrasonography, respectively. Data were analysed by paired simple t-test and there were no significant differences between the days (day 34 vs day 50) and locations of examinations (RIR vs LIR). In conclusion, twin pregnancies can not be effectively diagnosed through transabdominal ultasonography during the first 50 days of pregnancy. However, when detecting number of embryo/fetus is not important, pregnancy diagnosis can be performed with this method starting on day 34. P141 Melatonin-based induction of cyclicity in intensive dairy (Awassi) flocks Faigl, V1*; Keresztes, M1; Árnyasi, M2; Kulcsár, M1; Nagy, S3; Szenci, O1; Cseh, S1; Huszenicza, G1 1Faculty of Veterinary Science, Szent István University, Budapest, Hungary; 2Faculty of Agricultural Sciences, University of Debrecen, Hungary; 3Awassi Corporation, Bakonszeg, Hungary Our aim was to compare three different cycle induction / synchronisation protocols used out of the breeding season in Awassi ewes. In the first experiment (Exp.1) 85 autumn lambing ewes of a commercial dairy farm were used. Milk progesteron (P4) or fecal gestegen metabolits were determined 3 times 7 days apart on d0, d7, d13 (Exp.1 d0:10th Febr). Gest group was treated in April with gestagen sponge(d56-d70)+600IU eCG(d70). Mel+Gest group was implanted with melatonin (Mel, Melovin®, CEVA, Libourne, France) on d0 and synchronised as Gest group 56 days later. Mel+GPG animals were treated with Mel (d0) and synchronised with GnRH(d63)–PGF2α(d70)–GnRH(d72). Ewes were inseminated twice (fix AI) and were introduced to rams 14 days later. Individual P4 profile was followed from d45 to d99. Pregnancy associated glucoprotein was assayed on d99 and d133. Date of conception was

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 75 determined according to lambing dates. In Exp.2 the whole protocol was repeated with 115 spring lambing dams (Exp.2 d0:22th June). In Exp.1 39% of ewes were still cycling in Febr, however only 6% remained cyclic by the end of April (NS). Significantly higher percent of gestagen treated groups ovulated following synchronisation (Gest:96% vs Mel+Gest:95% vs Mel+GPG:45%;P=0.040). 14% of Gest and Mel+Gest group vs 3% of Mel+GPG concieved from Fix AI (NS). 10% Gest, 5% Mel+Gest, 3% Mel+GPG became pregnant after ram introduction (NS). Great proportion 31-43% conceived in the following breeding season. 38-62% remained unpregnant for more than 220 days. In Exp.2 4% of dams were cycling by d0 (June, NS). Proportion of cyclic animals in Mel treated groups tended to be higher by d45-d56 (19% Gest vs 44% Mel+Gest vs 47% Mel+GPG;P=0.109). 100% of Gest and Mel+Gest vs 88% of Mel+GPG ewes ovulated following synchronisation (NS), however only 24% (Gest), 22% (Mel+Gest), 8% (Mel+GPG) conceived from fix AI (P=0.190). In all treating groups 65% became pregnant after ram introduction (NS). 8-27% of dams remained unpregnant until d150 (NS). Survival analysis of day of conception showed no significant difference between treatment groups (Exp.1 P=0.361;Exp.2 P=0.131). Concuding our findings reproductive activity of Awassi sheep became markedly seasonal under temperate latitude. Slow release melatonin implant inserted in Febr could not induce cyclic ovarian function; however the same treatment had beneficial effect when used in June. GPG protocol as a possible alternative of longterm gestagen treatment for synhronisation for AI can only be effective when used near to the natural breeding season. P142 Effects of different egg yolk concentration and sodium dodecyl sulfate during the freezing step of cryopreservation on motility and viability of Markhoz goat spermatozoa Farshad, A.*, Khalili, B. and Fazeli, P. Laboratory of Animal Reproduction of Department of Animal Science, College of Agriculture, University of Kurdestan, Sannandaj, Iran (Farshad, A. AFarshad@uok.ac.ir) Cryopreservation induces cold shock and partially irreversible damage to sperm membranes. Egg yolk and addition of sodium dodecyl sulfat (SDS) to extenders prevents the effects of cold shock. Therefore, the objective of our study was to evaluate the effects of egg yolk and SDS on the cryopreservation of spermatozoa of goat. In Experiment 1, effects of different concentrations of egg yolk were investigated. Semen diluted (1: 4) with Tris-citric acid-fructose-glycerol solution containing 5, 10, 15 and 20 % (v/v) egg yolk were packed in 0.25 ml French straws at 37°C and cooled to 5°C over 2 h. Than, samples were frozen in vapor of liquid nitrogen, stored in liquid nitrogen for 24 h and thawed at 37°C for 1 min. After thawing, samples were evaluated for motility (%), progressive motility (%), viability (%) and morphological abnormality (%). The results shows, the rates of motility, progressive motility, viability and morphological abnormality in the dilution containing 5% egg yolk (55.7±4, 42.3±6, 60.2±4 and 89.5±3, respectively) were significantly higher (P<0.05) than in the dilutions with 10% (49.9±4, 36.0±6, 54.9±4 and 86.2±3, respectively), 15% (49.2±4, 37.0±6, 53.7±4 and 85.7±3, respectively) and 20% (45.4±4, 32.4±6, 49.5±4 and 83.6±4, respectively) egg yolk groups. The data shows no significant difference (P>0.05) between the 10 and 15 % egg yolk groups. The parameters of spermatozoa diluted in extender containing of 20 % egg yolk were significantly decreased (P<0.05). Based on the results of Experiment 1, the effect of 0.1 % (v/v) SDS added to extenders with 5, 10, 15 and 20 % (v/v) egg yolk was studied. Semen freezing and evaluation methods were performed as in Experiment 1. The results of experiment 2 shows, the parameters of spermatozoa in dilutions with 0.1 % SDS and 15 % egg yolk (53.5±4, 40.9±5, 59.5±4 and 88.5±3, respectively) were significantly higher (P<0.05) than 5 % (49.3±3, 36.2±5, 54.8±3 and 86.3±3, respectively), 10 % (50.4±4, 37.7±5, 55.9±4 and 88.5±3, respectively) and 20 % (46.6±4, 34.3±5, 51.2±4 and 84.7±3, respectively) egg yolk groups.

These results indicate the use of 5% egg yolk without SDS or of 15% egg yolk with 0.1 % SDS in Tris dilution to be suitable for cryopreservation of Markhoz goat spermatozoa. P143 Feasibility of transrectal ultrasound method for determination of early pregnancy in Sarda breed lambs Ferrari, MV1,2*; Catone, G1; Petralia, P1; Baroni, M1; Castellucci, B1; Chiodi, S1; Ferrari, LDR2 1Faculty of Veterinary Medicine, University of Camerino, Italy; 2Faculty of Veterinary Medicine, Federal University of Paraná, Brazil This experiment was performed to evaluate the feasibility of using transrectal ultrasound method in field conditions for determination of early pregnancy in Sarda breed lambs, considering yearling lambs have a medium frame and a relative small body size. Transrectal ultrasound was carried out daily from day 12th to 25th and once on day 35th after breeding on sixty-three 11 month-old lambs which had oestrus cycle synchronized with FGA-intravaginal sponges and PMSG. The date of oestrus and mating was observed by visualization of rump marks on the lambs. To perform the examinations, the animals were restrained by neck with an adequate capture equipment and kept in stand-stationary position without previous fast or water restriction. A real-time ultrasound scanner equipped with an 8 MHz linear array transducer (Titan®) was used and all examinations were conducted by the same and previously experienced operator. After introduction of the lubricated transducer into the rectum, uterus and ovaries were scanned by careful rotational movements performed from the outside by a plastic rod taped to the transducer. In 45% of the examinations was necessary to empty out the rectum and reinsert the transducer. In 3 animals (4,76%), was impossible to perform the examination due the small dimension of the anus and rectum. Was possible to observe uterus and urinary bladder in all lambs from the first day of examination (day 12th), whereas ovarian structures were clearly observed only in 51 animals (85%), while in 9 (15%) was impossible to observe the ovaries. On the second day of examination (day 13th), 94,12% of the lambs showed a important rectal meteorism that practically made impossible the observation of uterine and ovarian structures. On days 14th and 15th in all lambs was possible only to observe ovarian structures and uterine folds. Extraembryonic fluid and membranes were observed by the first time on day 16th in 47% of the pregnant lambs and in 69% of them on day 17th. On day 18th was possible to observe a clearly gestational sac in 77% of lambs and in 90% of them on day 19th. Heartbeat was detected from day 19th. Embryo diameter could be evaluated in 50% of the lambs on day 20th and in 100% from day 21st to 25th. Allantoid membrane was noticed at first time on day 21st and amniotic sac on the 22nd. Twin pregnancies were detected as early as by day 21st and all pregnancies previously noticed were confirmed on day 35th. We could conclude that transrectal ultrasound method can be used for early pregnancy diagnosis in yearling lambs of medium frame breeds. P144 Lack of risk of transmission of caprine arthritis-encephalitis virus (CAEV) after an appropriate embryo transfer procedure Ali Al Ahmad, M1; Chebloune, Y2,3; Baril, G4; Leboeuf, B5; Pepin, M6; Russo, P7; Manfredi, E9; Fieni, F.1* 1Department of Sanitary Risks and Biotechnology of Reproduction, National Veterinary School of Nantes, ENVN/DGER, Atlanpole-Chantrerie Nantes CEDEX 03, 44307 FRANCE; 2MMD Labs, Kansas University of Medical Center, USA ; 3INRA, Department of Animal Health, France; 4INRA, UMR85 Physiologie de la Reproduction et des Comportements, F-37380 Nouzilly, France; 5 INRA de Rouillé, France; 6AFSSA-LERPAZ, Maisons-Alfort, France; 7AFSSA Sophia Antipolis, France; 8UR631-INRA de Toulouse, France Introduction The aim of this study was to demonstrate that embryo transfer can be used to produce CAEV-free kids from CAEV-infected biological mothers when appropriate procedure is implemented.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 76 P o s t e r A b s t r a c t s Methods Twenty-eight goats that had tested positive for CAEV using PCR on vaginal secretions were used as embryo donors. Embryos with intact ZP were selected and washed ten times; they were then frozen and used for transfer into CAEV-free recipient goats. Nineteen of the forty-nine recipient goats gave birth, producing a total of 23 kids. Three blood samples were taken from each recipient goat, ten days before, during, and ten days after parturition; these were tested for CAEV antibodies using ELISA and for CAEV proviral DNA using PCR. The mothers were then euthanized. Tissue samples were taken from the lungs, udder, and retromammary and prescapular lymph nodes. The kids were separated from their mothers at birth. Seven of them died. At 4 months of age, 16 kids were subjected to drug-induced immunosuppression. Blood samples were taken every month from birth to 4 months of age; samples were then taken on day 15, day 21, and day 28 after the start of the immunosuppressive treatment. The kids were then euthanized and tissue samples taken from the carpal synovial membrane, lung tissue, prescapular lymph nodes, inguinal and retro-mammary lymph nodes, and uterus. Results All samples from the 19 recipient goats and 23 kids were found to be negative for CAEV antibodies and/or CAEV proviral DNA. Conclusion This study, performed under field conditions, clearly demonstrates that embryo transfer can be used to produce CAEV-free kids from CAEV-infected biological mothers. Indeed, none of the 16 kids collected from infected mothers at the embryonic stage, transferred to CAEV-free recipient goats, and subjected to immunosuppressive treatment at 4 months of age, were found to be positive for CAEV with any of the diagnostic methods used in all of the analyzed target tissues of the virus. Similarly, none of the 20 recipient goats seroconverted, and none of the sampled tissues tested positive for CAEV proviral DNA. P145 Effects of a mutation in Bone Morphogenetic Protein 15 gene (BMP15) on natural ovulation rate and on the response to superovulatory FSH treatment in Rasa Aragonesa ewes Folch, J1*; Alabart, JL1; Martínez-Royo, A1; Echegoyen, E1; Cocero, MJ2; Jurado, JJ3; Bodin, L4; Calvo, JH1

1Unidad de Tecnología en Producción Animal. CITA. Av. de Montañana, 930. 50059-Zaragoza, Spain; 2Dpto. Reproducción Animal. INIA. Av. Puerta de Hierro s/n. 28040-Madrid, Spain; 3Dpto. Mejora Genética animal. INIA. Ctra. La Coruña Km 7.5. 28040-Madrid, Spain; 4INRA, UR631 Station d'amélioration génétique des animaux, F-31326 Castanet-Tolosan, France A MOET Program is applied to improve the efficiency of a selection scheme for prolificacy in Rasa Aragonesa ovine breed. We have recently found a new mutation in BMP15 gene (1) in the highest prolific ewes of the Scheme. Since similar mutations are associated to higher ovulation rate (OR) in heterozygous females in other ovine breeds, we carried out a study to confirm the effect of this new mutation on OR in Rasa Aragonesa, in both natural conditions (Experiment 1) or after superovulation with oFSH (Experiment 2). Experiment 1 Two lots of ewe lambs of similar age, body weigh and body condition score were compared: BMP15 group (mutant animals) and control group (non-mutant, non-selected). All animals were maintained indoor and feeded ad libitum. At 9 months of age, lambs received FGA sponges. The OR was recorded six days after sponge withdrawal by laparoscopy and was repeated 17 and 34 days later. No males were used for heats detection. OR in Control group was similar to previously reported values in non-selected Rasa Aragonesa ewe lambs, while BMP15 group presented about 0.6 extra ovulations.

Genotype n OR1 OR2 OR3 OR (Pooled)

BMP15 15 1.85 a 1.69 a 1.58 c 1.71 a Control 18 1.09 b 1.14 b 1.13 d 1.12 b

n: Number of ewe lambs; OR: Ovulation rate in lambs ovulating a, b: P<0.01; c,d: P<0.05 Experiment 2 Two sets of highly prolific ewes were used: BMP15 (mutant animals) and Control (prolific, non-mutant). The mean genetic value of both sets was similar. Animals were superovulated two or three consecutive times along one year, following the standard methodology used in the MOET Program (8.8mg of oFSH/ewe in 8 decreasing doses after a FGA treatment, followed by intrauterine insemination with fresh semen) (2). Embryos were surgically obtained 7 days later and morphologically evaluated. A percentage of fresh embryos were transferred to FGA + eCG treated recipients. Genotype n OR RE / ewe VE / ewe LB / TE (%) BMP15 11 15.4 ± 1.1 13.2 ± 1.4 10.4 ± 1.3 47/69 (68.1) Control 10 14.7 ± 2.7 11.0 ± 2.5 10.5 ± 2.6 33/60 (55.0)

n: Number of ewes; OR: Ovulation rate; RE: Recovered embryos; VE: Viable embryos; LB / TE: Lambs born / transferred embryos. Data expressed as means ± SEM. Differences were non-significant. This work confirms the foreseen effect of this type of mutations on natural OR in other breeds. However, BMP15 mutation does not affect either the quantity or the quality of the embryos recovered after superovulation with FSH, at least when compared with highly prolific non-mutant ewes. (1) Martinez-Royo et al., (2007). Anim Genetics (submitted). (2) Folch et al., (2004). Reprod Fert Develop 16: 512 P146 Evaluation of semen and soluble proteins of the seminal plasm in goat of the Alpine Brown breed Martins, LF1*; Guimarães, JD1, Pinho, RO1, Torres, CAA2, Borges, MCB1, Castilho, EF1, De Oliveira, RR1, Barros, MHC1 1Department of Veterinary Medicine, University of Viçosa, Brazil; 2Department of Zootechnics, University of Viçosa, Brazil The objective of this work was to study the in vitro seminal quality analyzed by complemental tests and compare them with physical, morphologic and biochemical aspects of the semen of male goats of the Alpine Brown breed. Two experiments were accomplished in the Caprinocultura Section of UFV of the Department of Zootecnia of the Federal University of Viçosa in the city of Viçosa. The first experiment was done during the months of January and February of 2001 and four adult male goat of the Alpine Brown breed were used in intensive conditions. The semen was collected three times a week for all male goats, by artificial vagina method. Physical and morphological analysis of the semen were accomplished by test hipoosmótico and isoosmotic’s incubation as control group. The male goats presented difference in the physical and morphologic aspects, in the hyposmotic test and term-resistance test (p < 0,05). Results of the slow term-resistance tests and hyposmotic test were highly correlated (0,67). The second experiment was done in February and April of 2001 in the same place. Samples were collected twice a week from 4 adult male goats of the Alpine Brown breed that were in breeding season. All semen samples besides the physical and morphological analysis, the hypoosmotic test, the isoosmotic’s incubation and the protein concentration of the seminal plasm were done. Difference was detected among male goats in the total protein concentration of the seminal plasm (p < 0,05), but differences were not detected in the hipoosmótico test (p > 0,05) and gestation rate (p < 0,05). It was concluded that the hypoosmotic test can be an important tool for the evaluation of goat semen and the protein concentration of the seminal plasm cannot be used as a parameter to predict the seminal quality of male goats of the Alpine Brown breed.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 77 P147 The Effect of an Opioid Antagonist on Blood Progesterone levels of crossbreed ewes with GnRH induced short luteal phase during the anoestrus season Fuentes, HV-O.1*, Fuentes, CPI.2, Moreno, H.3, Parra, VM. 1Centro Universitario de los Altos, Universidad de Guadalajara, Km 7.5 Carretera a Yahualica, Tepatitlan de Morelos Jalisco CP47600 (Víctor Octavio Fuentes Hernández Ph.D. victoro@servidor.unam.mx; vfuentes@cualtos.udg.mx); 2 Department of Anesthesiology, Hospital Pemex Sur Alta Especialidad DF , Mexico; 3 Facultad de Medicina Veterinaria y Zootecnia, Universidad Michoacana de San Nicolas Hgo, Mexico With the objective of studying the effect of an opioid antagonist on progesterone levels in ewes with induced short luteal phase during the anoestrous season. A group of 20 crossbreed ewes was used. Age flutuated between 2 and 6 years. Housed in oppen paddocks with food and choped barly hay ad libitum and complemented with 250 g of concentrated feed. 10 ewes selected at random were implanted with 15 mg naloxone using cristaline microcelulose as a vehicle. The remainig 10 ewes were used as control and were implanted with a capsule of cristaline microcelulose free of any medicament. Seven days after implant both groups; treated and control; were injected with GnRH (250 ng iv at two hour intervals during 24 hours) at the end of treatment 125 µg of GnRH was injected iv. Blood samples were collected at 12th hrs intervals since the comencement of the experiment and sampling continued for 15 days after the last injection of GnRH. It was observed that in two of the control ewes progesterone levels increased 36 hrs after GnRH treatment, reaching a highest level on day 7, on the 8 remaining control ewes short luteal phases were observed with maximal progesterone concentrations of 1 ng/ml. 3 ewes treated with naloxone showed short luteal phase, while in the remaining 7 ewes treated with naloxone, progesterone levels were similar to those observed in control ewes with normal luteal phase. During the statistical analysis a significant effect fue to treatment was detected (P<0.01). These results leads us to the conclusions that endogenous opioids are important factors involved in the physiological control of reproduction in the ewe. P148 Immunochemical study of oestrogen and progesterone receptors distribution in the vagina of cycling ewes and anoestrous ewes treated with GnRH with or without progesterone priming Garófalo, E*; Acuña, S; López, C; Tasende, C Department of Molecular and Cellular Biology, Veterinary Faculty, University of the Republic, Uruguay The distribution of oestrogen receptor alpha (ERα) and progesterone receptor (PR) in the vagina of cycling ewes and anoestrous ewes treated with GnRH with or without progesterone (P) priming was investigated. Nineteen Corriedale ewes were synchronized during the breeding season and killed at 1 (n=7), 6 (n=6) or 13 (n=6) after oestrus detection with vasectomized rams with marking crayon. Twenty two Corriedale ewes in seasonal anoestrus were assigned to two groups: GnRH (n = 11) and P+GnRH (n = 11). The GnRH ewes were treated every 2 h with 6.7 ng of GnRH (i.v.) for 16 h, followed by bolus injection of GnRH (4 μg, Day 0) at 18 h. The P+GnRH ewes were treated with 0.33 g of P (CIDR) for 10 Days and immediately after CIDR removal they were treated according to the same protocol than in the GnRH group. Ewes were killed on Day 1 (n=6, for each treatment) and Day 5 (n=5, for each treatment) after bolus injection (Day 0). The ERα distribution was studied by an immunohistochemical technique validated for ovine in the Epithelium (E), Superficial Stroma (SS) and Deep Stroma (DS) of the vagina. The immunostaining of the nuclei was scored as negative (0), faint (1), moderate (2) or intense (3) and the proportion (n) of cells per field exhibiting the corresponding score expressed in a scale 0 to10. The average staining intensity was calculated as = 1 x n1 + 2 x n2 + 3 x n3. The data were analysed by ANOVA. In cycling ewes, the vaginal ERα distribution was influenced by tissular type, day of the cycle and

interaction of both (P<0.05), while the PR distribution was affected only for the day of the cycle (P<0.001). The ERα intensity was greater in DS than in E at days 1 and 13 (P<0.05) and for PR the staining intensity was greater in DS and SS than E at days 1, 6 and 13 (P<0.05). In anoestrous ewes, the vaginal ERα distribution was influenced by treatments (P<0.001), and the PR was not detected. In DS the ERα intensity was greater in GnRH than P+GnRH ewes (P<0.05) at days 1 and 5. The results suggest that the expression of ERα and PR and their distribution in E, SS and DS of the vagina, are regulated in a different manner in ewes during the oestrous cycle and in anoestrous ewes treated with GnRH with or without P priming. P149 Embryo survival and recipient pregnancy rates after direct and indirect transference of frozen and vitrified ovine embryos Green, RE1*, Santos, BFS2 , Sicherle, CC1 , Landim-Alvarenga, FC1 , Bicudo, SD1 1Departament of Animal Reproduction, University of São Paulo State, Brazil; 2Departament of Animal Science, University of São Paulo State, Brazil; The aim of this study was to evaluate the viability of sheep embryos cryopreserved using OPS vitrification or traditional freezing after direct and indirect transference. An amount of 137 in vivo produced sheep embryos, which were classified as good or excellent by morphological criteria, were obtained. Morulae and blastocysts were distributed randomly into three groups. In a first set of experiments, embryos at morula and blastocyst stages were dived in ethylene glycol (1.5M) and frozen in an automatic freezer. After being thawed, they were directly or indirectly transferred to ewes recipient. A second group of embryos were drawn into open pulled straw (OPS) and plunged into liquid nitrogen after being exposed at room temperature for one minute and forty-five seconds in 10% EG plus 10% dimethyl sulphoxide (DMSO), then again for thirty seconds in 20% EG + 20% DMSO + 0.5 M sucrose. After being warmed, embryos were also directly transferred using a French mini straw as the catheter for the transplantation process or after in vitro dilution of cryoprotectants (two-step-process). For each recipient just one embryo was transferred. Pregnancy rates were recorded 30 days after embryo transference. No significant difference was observed among fresh, frozen or vitrified embryos on pregnancy rate (50.0%, 38.6% and 55.8%) and embryo survival (50.0%, 36.4% and 51.2%). However, when we evaluated only the direct transference, the pregnancy rate of OPS vitrified embryos was higher than that of frozen embryos (57.1% versus 34.8%) (P=0.07). In addition, vitrified morulae had a higher pregnancy rate than the one with frozen embryos (64.0% versus 38.9%) (P=0.07). In conclusion, the OPS vitrification technique in association with direct transference gives rise to a high pregnancy rate and embryo survival rate and will no doubt have applications in rearing sheep. P150 The first isolation of Actinobacillus semnis in ovine Dorper breed with unilateral epididymitis in the state of São Paulo, Brazil Gregory, L1*, Rizzo, H2, Lins, GPV3, Lins, GJV4, Scarcelli, E5 1Fac. de Medicina Vet. e Zootecnia; Clinica Médica, University of Sao Paulo, Brazil; 2VCM, University of Sao Paulo, Brazil; 3Private Clinic, Brazil; 4Private Clinic, Brazil ; 5Instituto Biologico, Brazil Actinobacillus semnis was first isolated in ovine at Australia, 1960 by Baynes e Bosman. They found many animals with diagnose of epididymitis. After that it was related in the EUA, 1964; South Africa, 1968; New Zealand, 1974; Hungary, 1987; Argentina, 1990 and United Kingdom, 1992. In Brazil at the state of Rio Grande do Sul, it was reported in one Texel ram in 1992 and 2001. In January, 2007 a 3.5 years old Dorper ram, that had great genetic value was examined in the region of Itu state of Sao Paulo, Brazil. The diagnose was clear of epididymitis , because one of the testicle presented a palpable

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 78 P o s t e r A b s t r a c t s unilateral growth of the head of epididymis. The animal presented right testicular enlargement, with higher temperature at the affected testis and lower testicular mobility. This animal had a history of haematuria and was treated with Pentabiotico® (penicillin) associated with sexual rest. After that the ram was reintroduced to breeding with 30 ewe and ten days later he showed the clinical signs of epididymitis. The pregnancy diagnose from these ewes by ultrasonography after 40 days showed 20 pregnant ewes (66,7%) of 30. In the andrological exam it was found many inflammatory cells and low motility. It was made specific bacteriological exam for Brucella sp, Mycoplasma sp., Ureaplasma sp and Campylobacter sp resulting negative. It was isolated only Actinobacillus semnis. The ovine production at the State of São Paulo, Brazil grows over the last 5 years. It has not many information about reproduction diseases in ram in this state. P151 Determination Sex and Scrapie Resistance Genotype 6f Preimplantation Caprine Embryos Guignot, F Physiologie de la Reproduction et des Comportement, INRA, France The aim of this study was to test the accuracy of sex and PrP genotype diagnosis after whole amplification of DNA extracted from biopsies obtained by microblade cutting of goat embryos, and to evaluate the viability of biopsied embryos after freezing / warming and transfer to recipients. Before genotyping, whole genome amplification was performed using Repli-g® kit. Sex diagnosis was done by PCR amplification of ZFX/ZFY and SRY sequences (duplex PCR) and PrP genotype determination was performed on five codons: 142, 154, 211, 222 and 240. Embryos were recovered at Day 7 after oestrus from superovulated goats. Blastocysts and expanded blastocysts were biopsied immediately after recovery and frozen by vitrification. Whole embryos were kept as control and also vitrified. After thawing, two embryos were transferred directly into each synchronized recipient. Transfer was performed on 28 recipients, 18 with biopsied embryos and 10 with whole embryos. At Day 21 and 42 after oestrus, pregnancy rate was assessed by progesterone RIA and ultrasonography respectively. PrP genotyping was performed on kids at birth. Pregnancy rates at Day 21, Day 42 and at kidding were not significantly different between biopsied (83, 39 and 39%, respectively) and control (100, 50 and 50%, respectively) embryos. The embryo survival rate was 25% (9 kids from 36 transferred embryos) and 35% (7/20) for biopsied and control embryos, respectively. At birth, all diagnosed sexes were right (9/9; 100%). Kid PrP genotyping and prediction were compared: among the 90 predetermined codons for PrP scrapie, 88 codons were accurately predicted (97.8%). Kid PrP profiles were in agreement with parental genotype. PrP genotyping results of biopsies from embryos who did not induce pregnancy was compared to parent genotypes. Among 270 analysed codons (27 biopsies), 8 discrepancies were found, so 97% of PrP genotype determination were concordant to parent genotype. Whole genome amplification with Repli-g® kit coupled with sex diagnosis and PrP genotype determination are very accurate techniques to genotype goat embryo before transfer. This technique will increase the efficiency and reduce the cost of selection process aimed at scrapie sensitivity alleles eradication in French goat population. Moreover, other target genes linked to other diseases or to production traits could be analysed on the same biopsy conferring more economical value to the multiple ovulation embryo transfer (MOET). P152 Cyclic female goats respond to males with an increase in LH secretion during the breeding season Hawken, P *; Esmaili, T; Jorre De St Jorre, T; Martin, G 1School of Animal Biology, University of Western Australia, Australia Introduction The male effect is currently only used during anoestrus because the long periods of elevated progesterone in cyclic females are presumed to block the response. However, in a recent study in

sheep, we found that cyclic ewes respond to rams with an increase in LH secretion [1]. In the present study, we tested whether cyclic, female goats would respond to males with an increase in pulsatile LH during the early, mid- and late luteal phases of the oestrous cycle. Methods During May (breeding season; Southern Hemisphere) the oestrous cycles of 16 Australian Cashmere goats were synchronised using intravaginal progesterone pessaries. Pessary insertion was staggered to produce early luteal (EL; n=8) and late luteal phase groups (n=8). The late luteal phase group was further subdivided into mid-luteal (ML; n=4) and late luteal (LL; n=4) groups, based on differences in oestrous cycle length after progesterone withdrawal. Results Exposure to males stimulated an increase in LH pulse frequency in the EL (0.36 ± 0.06 versus 0.61 ± 0.08 pulses/h; P < 0.01) and LL groups (0.42 ± 0.08 versus 0.68 ± 0.09 pulses/h; P < 0.01). However, a significant increase was not observed in the ML group (0.33 ± 0.07 versus 0.45 ± 0.05 pulses/h; P > 0.1). Exposure to males caused an increase in mean concentrations of LH in the LL group (0.20 ± 0.05 versus 0.34 ± 0.05; P < 0.05) but not in EL (0.14 ± 0.03 versus 0.21 ± 0.05 ng/mL; P < 0.1) or ML groups (0.12 ± 0.02 versus 0.12 ± 0.03 ng/mL; P > 0.1). There was no effect of male exposure on LH pulse amplitude at any stage of the cycle (P > 0.1). Progesterone concentrations differed among all groups on the day of male exposure (EL: 3.50 ± 0.49; ML: 5.25 ± 0.47; LL: 0.72 ± 0.13 ng/mL; P ≤ 0.05) and declined significantly over the 12-h sampling period in the LL group (0.72 ± 0.13 versus 0.32 ± 0.05 ng/mL; P < 0.05). There was no change in this variable in the EL (3.5 ± 0.49 versus 2.96 ± 0.56 ng/mL; P < 0.1) or ML groups (5.25 ± 0.47 versus 5.99 ± 0.66 ng/mL; P > 0.1). Conclusion Exposure to males induced an increase in pulsatile LH secretion in female goats in the early and late luteal phases of the oestrous cycle. However, the high concentrations of progesterone during the mid-luteal phase appear to block any effect of the male on LH release. [1] Hawken PAR, Beard AP, Esmaili T, Kadokawa H, Evans ACO, Blache D, Martin GB. The introduction of rams induces an increase in pulsatile LH secretion in cyclic ewes during the breeding season. Theriogenology 2007;68:56-66. P153 Effect of the progestagen treatment length and different eCG dosages on the pregnancy rate of ewes after fixed-time superficial transcervical insemination Iwamura, J1*, Oba, E1; Souza, MIL2; Pampani, FE; Leal, LS1; Pavão, G1; Bittencourt, RF1 1Department of Animal Reproduction and Veterinary Radiology, São Paulo State University, Brazil; 2 Center of Biological Science and Health , Mato Grosso do Sul Federal University, Brazil The aim of this study was to analyze the Santa Ines sheep’s fertility after estrous and ovulation synchronization with short, intermediate and long-term protocols with progestagen (Progespon®, Syntex, Argentina) and different eCG dosages (Foligon®, Intervet, Spain) through fixed-time superficial transcervical insemination. Fifty and three adult ewes were divided into 6 groups, according to the estrous synchronization protocols (P) employed. In the P1 and P2, the animals were synchronized with intravaginal sponges containing 60 mg of acetate of medroxyprogesterona (MAP) during 6 days plus 500 or 350 i.u. eCG at the sponge removal, respectively. P3 and P4 animals had the sponge removal after 9 days and received in this moment 500 or 350 i.u. eCG, respectively. In P5 and P6, the synchronization was accomplished by MAP administration over 13 days with an injection of 500 or 350 i.u. eCG, respectively, at sponge removal. The estrous detection was carried out twice daily by sexually experienced adult rams with proven high fertility, fitted with a marking harnesses, introduced in the flock at the sponge removal. The semen was collected by artificial vagina and the dilution (1/2) was carried out in skimmed milk. The superficial transcervical insemination was performed with 100µL of the diluted semen in fixed-time 48 hours after the sponges withdrawal. The pregnancy diagnosis was performed by ultrasonography exam, with a 5 MHz transducer, 60 days after the artificial insemination. The blood samples were collected from all ewes for progesterone determination by a direct solid-phase

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 79 radioimmunoassay (Coat-A-Count progesterone; Diagnostic Products Co., USA). The progesterone were measured in samples on the beginning treatment, before the sponge introduction, on the sponge removal day and 48h after the MAP removal. Data regarding the pregnancy rate and progesterone concentration were analyzed by using the qui-square test and the SNK test of the SAS statistical package (version 5.0, 1996). The fertility rate in the protocols P1, P2, P3, P4, P5 and P6 was of 30.0 %; 20.0%; 33.3%; 37.5%; 33.3% and 40.0%, respectively. No statistical difference for pregnancy rate was observed among protocols, hence we can conclude that length of progestagen treatment and the eCG dosages used had no influence on fertility rate. The authors suggest the necessity of more studies with a larger number of animals to verify the short-term estrus synchronization protocol effectiveness in Santa Ines ewes and the effect of the superficial cervical artificial insemination on the pregnancy rates. P154 Seasonal changes in physiologic and biochemical parameters of Iranian Abadeh breed buck semen Jelodar, G *, Razmi, N Department of Physiology, Shiraz University, Islamic Republic of Iran Introduction Goat is a seasonal breeder animal,the aim of this study was to evaluate seasonal changes in physiologic and biochemical semen characteristics of native Abadeah breed buck goats. Methods Five Abadeah goats (3-4 years old) were trained to serve the artificial vagina. Semen collection was performed every 2 weeks, commencing in October (at onset of autumn) 2005 to September (end of summer) 2006. Semen ejaculates were evaluated for volume, sperm concentration, individual motility and the percentage live sperm. Moreover, changes in the seminal plasma proteins of the goats were also recorded and considered at the end of semen collection whit providing electrophorogram (SDS PAGE Electrophoresis) of seminal plasma proteins. Result Semen of superior quality and quantity was especially collected in late summer and throughout autumn (seasonal breeder). during the autumn bucks recorded the highest (P<0.05) ejaculate volume(1.02 ml) and maximum mean of molecular weight of seminal plasma proteins, as well as a lower percentage of dead sperm(5.27) and the minimum sperm concentration (3.23 x 109). This was accompanied by a increase in proteins with 54.96-90.24 Kd molecular weight and decrease in proteins with 96.34-143.98 Kd molecular weight. Conclusion In conclusion, albeit there were seasonal changes in physiologic and biochemical semen characteristics of Abadeah buck goats, the semen has the capability and quality to be used for artificial insemination all year round but to reach highest fertility in artificial insemination should be used of semen that collected in last of the summer and during the autumn. P155 Association among ovulation rate, serum concentrations of FSH, response to exogenous FSH and fertility in ewes heterozygous for the Booroola gene (FecB) Juengel, JL*; Proctor, LE; Farquhar PA; Davis, GH AgResearch, Reproductive Biology, Invermay Agricultural Centre, New Zealand Progeny testing of homozygous Booroola rams whose dams had divergent lifetime ovulation rates (ORs) has lead to the identification of two half-sib homozygous Booroola rams whose heterozygous daughters have significantly different (p<0.001) ovulation rates (28 daughters of ram 48, OR 3.9 ± 0.1; 20 daughters of ram 41, OR 3.2 ± 0.1). These daughters were evaluated to determine the association between the divergent basal OR and differences in plasma FSH concentrations, responsiveness to exogenous FSH and fertility. Concentration of FSH during the non-breeding season was greater (p<0.01) in daughters of ram 48 (0.69 ± 0.4 ng/ml; n= 26) than in daughters of ram 41 (0.52 ± 0.2; n=18). OR response to exogenous

FSH treatment was less (p < 0.05) in daughters of ram 48 (17.3 ± 1.9; n=20) compared to ram 41 (21.6 ± 1.8; n=18). Fertility of the ewes was assessed by determining the number of lambs born relative to the observed OR. As there is a negative relationship between OR and fertility of individual oocytes, analyses were limited to observations over two seasons where 3 or 4 corpora lutea were observed as these were the most common record for both sire groups. A regression model was fitted in which both ovulation rate and genotype significantly altered (p<0.05) the distribution of ewes with 0, 1, 2, 3 or 4 lambs. Oocytes of daughters of ram 48 were less likely to result in a lamb (OR 3 = 64%, n = 11; OR 4 = 51%, n = 27) than oocytes of daughters of ram 41 (OR 3 = 84%, n = 21; OR 4 = 67%, n= 18). The large difference in lifetime ORs of the homozygous Booroola dams of sire 48 and 41 (dam ORs =7.7 ± 0.3 and 4.6 ± 0.5 respectively) and the 0.7 difference in OR of their progeny is suggestive of a second major gene segregating in this flock and further progeny testing has been undertaken to test this hypothesis. In conclusion, in heterozygous carriers of the Booroola gene, increased basal ORs were associated with increased basal concentrations of FSH but decreased responsiveness to a regimen of exogenous FSH to induce multiple ovulations and decreased fertility. P156 Comparison of the effects of fixed timed insemination and natural mating on the sex ratio of offspring in Ewes Saberi, Z1, Khoramian, B2*, Afzali, N1, Hosseini Vashan, SJ1, Eslampour, MA2, Mohammadi, HR2 1Department of Animal Science, College of Agriculture, University of Birjand, Khorasan, Birjand, Iran; 2Department of Clinical Sciences, School of Veterinary Medicine, University of Tehran, Tehran, Iran Sex ratio manipulation can sensibly enhance the effectiveness of selection and genetic improvement programs, through the differential increment of males or females born after AI. For a number of years, the time of insemination or mating during estrus has been believed to influence the sex ratio of offspring, with early insemination resulting in more females and late insemination, more males. Studies on sheep indicate a trend for more females to be produced from early inseminations and more males from late inseminations. Also Gutierrez-Adan et al. found a possible in vivo effect of oocyte maturational stage or aging on sex ratio in sheep. Berry et al. (2006) indicated a strong significant different between natural mating and AI on sex ratio and reported that AI increase the probability of a male calf in dairy and beef cattle. In sheep, there is not any study on relationship between sex ratio and type of mating. Therefore, the objective of present study was to determine whether natural mating or fixed timed artificial insemination in synchronized sheep influences the sex ratio of the offspring and fertility. A flock of two hundred Balochi ewes were randomly divided into two groups. In both group, lambing rate, Fecundity, Litter size and sex of lambs were recorded after parturition. Statistical analyzes of results was performed using the Genmod procedure of the SAS package and compared by chi-square analysis. As a result, sex ratio (female/male) was 61.37%/38.36%, 48.49%/51.51% in artificial insemination and natural mating groups respectively. The difference with two groups were statistically significant (P<0.05). However, Lambing rate decreased significantly in AI group (P<0.05). Furthermore, Fecundity was 54% and 44% in natural mating and AI, respectively and there is not statistically significant between two treatments (P>0.05). Therefore, Results of this study indicate that although artificial insemination decrease lambing rate but it can increase the probability of a female lamb in flock.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 80 P o s t e r A b s t r a c t s P157 Role of exogenous leptin and season on thyroxine release from thyroid gland in ewes Klocek-Górka, B1*, Szczęsna, M1, Sechman, A2 and Zięba, DA1

1Department of Sheep and Goat Breeding, Agricultural University of Krakow, Poland; 2Animal Physiology Dept., Agricultural University, Krakow, Poland Through its circadian release of melatonin, the pineal gland plays a key role in integrating circannual responses in day length within the neuroendocrine axis of the ewe. Leptin, which synthesis and release are sensitive to acute changes in nutritional status, acts on target sites within the brain that regulate appetite and energy balance. The pituitary-thyroid system is regulated at multiple levels, one or more of which might account for nutritional adaptation. Thyroid hormones are obligatory for the annually recurring termination of reproductive activity in a spectrum of seasonal breeders, including sheep. The presence of leptin receptors in the thyroid gland has been reported and some leptin effects may be, directly or indirectly, mediated by hypothalamo-pituitary-thyroid axis. It was shown that, in the ewe, the interaction between the thyroid gland and reproductive neuroendocrine axes changes dynamically throughout the year. The present study addresses questions related to timing of the interaction between thyroid hormone - thyroxine (T4) and leptin in seasonal breeding ewes. Studies were carried out on thyroid glands’ explants in short-term culture. Glands were collected from nine ewes selected randomly during long days (LD, i.e. Apr., May and July) and from additional nine ewes during short days (SD, i.e. Sept., Oct, Nov). The explants (approximately 30 mg) were equilibrated in 2.5 ml of RPMI/F12 medium with 0.5% FCS for 30-min, followed by a 4.5 h incubation in medium containing either 0, 50 or 100 ng/ml of recombinant ovine leptin (roleptin) with melatonin (100 ng/ml) and with or without TSH (100 ng/ml). Concentrations of T4 were determined by RIA and expressed as means ± SEM. Thyroxine concentrations in explants media were affected (P < 0.05) by season, and melatonin had inhibitory effect (P < 0.05) on T4 secretion during both long and short days. In explants cultures from thyroid glands collected during SD, roleptin in both doses together with TSH stimulated (P < 0.01) T4 release, however, those effects were diminished by melatonin. In LD, high dose of roleptin applied with TSH increased T4 secretion in comparison to control (P < 0.01), and this effect was again inhibited by melatonin. The data obtained provide an evidence for seasonal interactions between leptin and thyroxine in ewes with higher T4 secretion during long days when thyroid hormones are necessary for quiescence of the reproductive activity in ewes. P158 The use of melatonin and progestagen to advance puberty in Awassi ewe lambs Kridli, R1*; Jawasreh, K2; Sawalha, M1 1Department of Animal Production, Faculty of Agriculture, Jordan University of Science and Technology, Irbid 22110, Jordan 2The National Center for Agriculture Research and Extension, Baqaa, Jordan Introduction Ewes are generally culled at 6 to 7 years of age after having produced 5 to 6 lamb crops. Advancing puberty age allows ewe lambs to enter the breeding season at around 7 to 8 months of age thus obtaining one more lamb crop per female during her productive life. Attempts to breed ewe lambs at an earlier age in Jordan resulted in limited success as only 20 to 30 % of the females lambed at one year of age (personal communication). Thus, the objective of this study was to advance puberty and initiate the breeding season in Awassi ewe lambs through hormonal treatments. Methods This experiment was conducted at the Khanasry Station for Small Ruminant Development to evaluate the effect of administering hormonal treatments [melatonin, progestagen and pregnant mare\'s serum gonadotropin (PMSG)] on advancing puberty in Awassi ewe lambs. Fifty one, 6-month old ewe lambs of similar body weights (around 28 kg) were randomly assigned into four treatment groups; no hormonal treatment (CON; n=14), melatonin (M; n=13), progestagen and PMSG (PP; n=13) and melatonin plus progestagen and PMSG

(MPP; n=11). Ewe lambs in the PP and MPP groups were treated with intravaginal progestagen sponges for 14 days. Four hundred IU PMSG were administered to each of these ewe lambs on the day of sponge removal. Ewe lambs in the M and MPP groups received subcutaneous melatonin implants (Regulin®, 18 mg melatonin) 36 days before sponge insertion. The melatonin implants were applied in mid May, around 6 to 7 weeks before the natural breeding season for Awassi. Fertile, harnessed Awassi rams were introduced at the time of sponge removal. Results Hormonal treatment had no effect on body weight. Estrus expression tended to be greater (P = 0.1) in the M, PP and MPP compared with CON ewe lambs (92%, 92%, 100% and 71%, respectively). The duration from ram introduction to onset of estrus was shorter (P < 0.001) in PP and MPP than in M and CON ewe lambs (12±3.5, 5.7±3.7, 23.9±3.5 and 26.5±3.9 d, respectively). Pregnancy rate (evaluated by ultrasonography 60 days post ram introduction) was similar among treatments although being numerically greater in the MPP group (50%, 61.5%, 53.8% and 81% in CON, M, PP and MPP ewe lambs, respectively). Conclusion Results indicate that a combination of melatonin, progestagen and PMSG appears to be effective in advancing puberty in Awassi ewe lambs. The lack of significant differences in estrus expression and pregnancy rate may be attributed to the low number of animals. P159 Luteinizing hormone (LH) and Follicle stimulating hormone (FSH) induce the expression of Cyclooxygenase -2 mRNA in cervical tissue of non-pregnant ewes Leethongdee, S1,2*, Khalid, M1 and Scaramuzzi, RJ1 1The Royal Veterinary College, University of London, United Kingdom; 2Faculty of Veterinary Medicine and Animal Sciences, Mahasarakham University, Thailand Introduction The ovine cervix contains both LH and FSH receptors and their concentrations are greatest at oestrus indicating physiological roles in relaxation of the cervix. Cervical relaxation at oestrus is mediated by prostaglandin E2 whose synthesis is regulated by the inducible enzyme, COX-2. Consequently, the high level of FSH and LH during the peri-ovulatory period may stimulate COX-2 regulated PGE2 synthesis leading to cervical relaxation at oestrus. Our objective was to determine the effect of intra-cervical LH and FSH on the expression of COX-2 mRNA in the cervix of the ewe during oestrus. Methods Eighteen ewes were assigned to 4 groups of 5 (groups 1 and 2) or 4 ewes (groups 3 and 4). Oestrus was synchronised using progestagen pessaries and 500 IU PMSG at pessary removal. Intra-cervical hormone was applied 24h after pessary removal: Group 1: FSH 2 mg; Group 2: LH 2 mg; Group 3: Vehicle; Group 4: Control. Cervices were collected 54h after sponge removal or 30 h after hormone treatment and divided transversely into 6 sections; alternate sections were formalin fixed, wax embedded and sectioned at 7μm. The expression of COX-2 mRNA was determined by In situ hybridization using a digoxigenin-11-UTP labelled riboprobe. COX-2 expression in cervical tissue was analysed in five tissue layers (epithelium, stroma, circular, longitudinal and transverse muscle) and three cervical regions (vaginal end, middle region and uterine end). Results The expression of COX-2 mRNA in cervical tissue of ewes treated with FSH was greater than in the gum vehicle (P = 0.004) and control (P = 0.003) groups. Similarly, the expression of COX-2 mRNA in cervical tissues of ewes treated with LH was also greater than in the gum vehicle (P = 0.007) and control (P = 0.006) groups. The highest expression of the COX-2 mRNA was at the vaginal end of the cervix. The expression of COX-2 mRNA at the vaginal end and the middle region were significantly greater than at the uterine end (both P < 0.001).There was no difference in COX-2 mRNA expression between the vaginal end and the middle region (P = 0.683). Among the tissue layers expression was highest in the luminal epithelium and lowest in the stroma. The expression of COX-2 mRNA in smooth muscle and luminal epithelium were higher than in the stromal layer (both, P < 0.001).

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 81 Conclusions The results show that both FSH and LH stimulated COX-2 mRNA in the sheep cervix at oestrus. The increased COX-2 induced by FSH and LH is probably associated with increased PGE2 synthesis and cervical relaxation during the peri-ovulatory period. P160 Synchronization with progestagen affects LH receptor and function of corpus luteum in sheep Letelier, C1,2*; Garcia, RA3; Contreras, I1; Garcia-Palencia, P3; Sanchez, B3; Sanchez, MA3; Gonzalez-Bulnes, A1; Flores, JM3

1Reproducción Animal, INIA, Spain; 2Facultad Cs. Veterinarias, UACh, Chile

3Facultad de Veterinaria, UCM, Spain Introduction Pregnancy in mammals is the consequence of an adequate equilibrium between embryo and maternal factors; mainly luteal activity, in terms of progesterone (P) secretion. The gonadotrophin LH is the primary luteotropic hormone, supporting the development and function of the CL, through LH receptors expressed in ovary. Thus, we aimed to discern possible effects of synchronization treatment on LH secretion and/or LH receptors expression around the implantation. Methods Oestrus was synchronized in 30 Manchega sheep; half of the animals were treated with three injections of prostaglandin, 10 days apart (group, PGF), and the remaining 15 ewes, were synchronized with intravaginal progestagens, applied for 14 days (group FGA). Appearance of oestrus behaviour was detected with rams and considered Day 0. Number and size of all CL were determined daily by 7.5 MHz transrectal ultrasonography until Day 13, 15 and 17 of pregnancy. Blood samples were taken coincidentally and plasma progesterone concentration and LH concentration were measured by radioimmunoassay and ELISA, respectively. Ovaries with corpora lutea of PGF and FGA group were collected on days 13, 15, 17 post mating, routinely processed in 4% paraformaldehyde and paraffin-embeded. The corpora lutea (n= 45) were studied using conventional immunohistochemical techniques for determining LH receptor (LHr) expression. Results In both groups, the total luteal tissue in sheep showed a linear growth (p<0.05) from Day 1 (0.43 ± 0.04 cm2 in PGF and 0.40 ± 0.02 cm2 in FGA) to Day 17 (2.03 ± 0,09 cm2 in PGF and 1.74 ± 0,02 cm2 in FGA), without differences between groups. Differences in luteal function, determined by the plasma progesterone, were found to be significant on Days 16 (5.80 ± 0.49 ng/ml in PGF vs 4.60 ± 0.37 ng/ml in FGA, p< 0.05). The basal LH levels were similar between groups (0.15 ± 0.01 ng/ml in PGF vs 0.18 ± 0.01 ng/ml in FGA, n.s.). The LHr expression was different in groups PGF and FGA at Days 13 (p< 0.01), 15 (p< 0.005) and 17 (p< 0.05). Conclusion Current results showed no differences in growth dynamics and macroscopic morphology of corpora lutea by effect of synchronization treatment, but a lower progesterone secretion in progestagen-treated sheep that would be related with a lower expression of LH receptors. This work was supported by a grant CYCIT AGL2005-02669. P161 Comparison of transrectal ultrasound and plasma pregnancy associated glycoproteins (PAG) as pregnancy tests of reindeer Savela, H1; Vahtiala, S2; Lindeberg, H3*; Dahl, E4; Ropstad, E4; Beckers, JF5; Saarela, S6 1Centre for Arctic Medicine, University of Oulu, Finland; 2Co-operative Breeding Service, Muhos, Finland; 3Institute of Applied Biotechnology, University of Kuopio, Finland; 4Department of Domestic Animal Clinical Sciences, Norwegian School of Veterinary Sciences, Norway; 5Department of Physiology of Reproduction, University of Liège, Belgium; 6Department of Biology, University of Oulu, Finland Early pregnancy detection of reindeer by ultrasound or hormonal pregnancy test would allow the culling of non-pregnant females in early winter and save the costs of their winter feeding. It would also allow the separation of young, pregnant females for more intensive

feeding to ensure their growth and optimal calving. Altogether 195 female reindeer from Salla in North-Finland (66.83 N, 28.67 E) were scanned by transrectal ultrasound in Dec 2005 and 2006 (n=33 and n=92) and in Jan 2007 (n=70). Pregnancy associated glycoproteins (PAG) were analysed by radioimmunoassay from blood plasma samples obtained at the times of ultrasound scannings. Sensitivity, specificity and the overall accuracy of the ultrasound and PAG tests were calculated based on the calving records. When calculating the diagnostic values for the PAG test, plasma PAG concentrations of 0.5, 1.0, 1.5, 2.0, 2.5, 3.0 and 3.5 ng/ml were compared as threshold levels, above which a positive pregnancy diagnosis was made. The overall pregnancy rate based on the calving records was 86.2 %. According to preliminary analysis of the results, the overall accuracy of the ultrasound test was 99.5 %. The sensitivity and specificity of the ultrasound test in diagnosing pregnancy were 99.4 % and 100 %, respectively. The overall accuracy of the plasma PAG radioimmunoassay test decreased from 88.7 % to 50.3 % when the plasma PAG threshold level increased from 0.5 to 3.5 ng/ml. At the same time, the sensitivity of the test decreased from 99.4 % to 58.3 %. The specificity was lowest (77.8 %) at the plasma PAG threshold level 0.5 ng/ml, and reached 100 % at the plasma PAG threshold level 3.0 ng/ml. In conclusion, the ultrasound test had a higher overall accuracy than PAG as a pregnancy test for reindeer, with the advantage that the diagnoses could be made on the spot in the field conditions. P162 Follicle growth in relation to circulating gonadotrophins during postnatal development of sheep Mahdi, D1*; Monniaux, D2 1Center of Larbi Ben M’hidi, Department of Animal Biology and Physiology, Institute of Biology, Oum El Bouaghi, Algeria; 2Unit of Physiology of Reproduction and Behaviour (UMR6175), INRA, Nouzilly, France The aim of this study was to investigate the number and different sizes of ovarian antral follicles in relation to plasma follicle stimulating hormones (FSH) and luteinizing hormone (LH) concentrations from birth to 26 weeks of age in ewe lambs of the Ouled Djellel breed, a non-seasonal breed of sheep. Plasma was collected from 10 ewe lambs at 0 (<24 hours), 1, 4, 6, 8, 10, 12, 14, 16, 18, 20, 22, 24, and 26 weeks. Four of the ewe lambs were slaughtered at each of the time points, the ovaries recovered and weighed; antral follicles were counted and their size were measured on histological ovarian sections. The pattern for plasma FSH and LH showed a peak at week10, a smaller peak at week 18 but, the peak at 24 was very small for FSH and very prominent for LH. Paired ovarian weight increased rapidly from birth to four weeks and then more slowly to 10 weeks, followed by a decline at 12 weeks and a gradual increase from 14 to 24 weeks of age. The mean number and total diameter of follicles ≥3mm increased gradually from birth to 14 weeks, declined to 16 weeks, and then increased more rapidly to a peak at 24 weeks. Maximum follicle diameter declined between the birth and one week, rose rapidly to 4 weeks, increased gradually to week 14 and, thereafter, a more rapid increase to a peak of 7.23±0.16mm at 24 weeks old. The number of follicles (<3mm diameter) increased rapidly between birth and 10 weeks, and then decreased to levels seen at birth and four weeks. First behavioural oestrus was observed at week 24 and a corpus luteum was present on the ovary of one lamb at week 24 and two lambs at week 26. In conclusion, two or three peaks in plasma FSH and LH levels precede puberty and first ovulation in Ouled Djellel ewe lambs, and first ovulation occurred at 24–26 weeks of age. The increase in follicle number and size generally reflected the pattern of plasma FSH and LH levels.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 82 P o s t e r A b s t r a c t s P163 Ram sperm morphometry: intra-individual variation and relation with fertility Mata-Campuzano, M.2*; Garcia-Macias, V.1; Anel, L.1, Alvarez, M.1; Bernardo, J.1; Chamorro, C3; De Paz, P.2 1Animal Reproduction and Obstetrics, University of Leon, 24071, León, Spain; 2Cell Biology, University of Leon, 24071, León, Spain; 3Veterinary Anatomy; University of Leon, 24071, León, Spain Sperm head morphometry provides an objective analysis of a semen sample since the development of computer assisted analysis technology. Relationship between fertility and normal shape of spermatozoa morphology has been studied widely in both humans and animals. This work has to main objectives: 1. to determine if sperm head morphometry and fertility are related in ram sperm (assessing ejaculates from 24 Assaf rams), 2. to test if there were differences among the ejaculates of the same animal (6 animals, 3 separated ejaculates, two weeks interval). All ejaculates were collected by artificial vagina and diluted in extender (tris 3.322 g, citric acid 1.737 g, fructose 0.954 g and distilled water 100 ml) to a final concentration of 400×106 spermatozoa/ml. Samples were fixed in 2% glutaraldehide in BL1 medium (glucose 2.9 g, sodium citrate dehydrated 1.0 g sodium bicarbonate 0.2 g and distilled water 100mL). Microscope slides were prepared by placing a 5µl drop of the extended semen at the edge of a frosted slide and dragging the drop across it. Slides were air dried for at least two hours and stained using a Diff-Quik staining method (QCA, Tarragona, Spain). Subsequently, slides were rinsed in distilled water and air dried, then examined with a bright field microscope at a magnification of 600x. At least 100 properly digitized sperm heads for each sample were analyzed with a computer assisted sperm morphology assessment (CASMA, integrated semen analysis system v 1.0.9 PROISER, Valencia, Spain) system. Each sperm head was measured for length (L, µm), width (W, µm), area (A, µm2), perimeter (P, µm); and four derived parameters of head shape: elipticity (ELI): L/W; rugosity (RU): 4πA/P2; elongation (ELO): (L-W)/(L+W); and regularity (RE): π LW/4A. Mean values were L: 8.67; W: 4.92; A: 36.37; P: 24.12; ELI: 1.76; RU: 0.78; ELO: 0.27; RE: 0.94. In experiment 1 our results show statistically significant differences (p<0.05) among individuals for the morphometric parameters assessed. However, no differences were found between the 3 ejaculates obtained from the animals, so there is homogeneity in sperm head morphometry for each ram during the studied period. In experiment 2 no correlation was found between the considered morphometric parameters and fertility. Although not significant, W (mean value 4.92) shows the best correlation (r=0.07, p>0.05) with fertility. Sample preparation and analysis techniques should be improved in order to obtain more accurate results. This work was supported in part by CICYT (AGL2005-07601), Diputación de León and Junta de Castilla y León. P164 Effects of aflatoxin B1 on ram epididymal and ejaculatory sperm motility Mirshokraei, P1*, Tajik, P2, Khosravi, A3 1Department of Clinical Sciences, Faculty of Veterinary Medicine, Shahrekord University, Shahrekord, Iran; 2Department of Clinical Sciences, Faculty of Veterinary Medicine, University of Tehran, Iran; 3Department of Microbiology, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran In order to study the effects of aflatoxin on ovine spermatozoa, epididymal and ejaculatory sperm were added different concentrations of aflatoxin B1. When ram epididymal sperm were exposed to different concentrations of aflatoxin, one-hour post incubation in control group, 68.16% were motile, significantly (P<0.05) higher than in medium with 7.81 ppb concentrations of aflatoxin and above but not different from motility in medium with 1.96 ppb aflatoxin. The lowest motility was observed in medium with 62.5 ppb aflatoxin. In the second hour of incubation in media containing 7.81, 31.25 and 62.5 ppb aflatoxin the motility decreased to the values of 45.63, 20

and 2.5%, respectively. Sperm motility was not affected in the control group during incubation; however it reduced dose dependently in the other groups. In ejaculated sperm, after one hour incubation in the control group, 62.38% of sperm were motile, significantly (P<0.05) higher than the motility value in the media with 7.81 ppb aflatoxin concentrations and higher, of but not different with 1.96 ppb aflatoxin. The lowest motility (7.20%) was observed in the medium with 62.5 ppb aflatoxin. In second hour of incubation the motility was not significantly changed in control, as well as in 1.96 and 7.81 ppb aflatoxin containing medium. However, it decreased in media with 31.25 and 62.5 ppb aflatoxin to the motility value of 14.24 and 4.00% respectively. Sperm motility was not altered in control the group during incubation; however it was reduced dose dependently in other groups. Sperm motility patterns for both the epididymal and ejaculated spermatozoa were different after incubation in different concentrations of aflatoxin. The results of the present experiment showed that aflatoxin could decrease sperm motility obtained from ejaculation or from epididymis. P165 Seasonal changes in semen characteristics of Merghoz bucks in west of Iran Moghaddam, A2*; Souri, M1; Talebi, J1; Mirmahmoodi, R. 1Department of Animal Clinical Science, Razi University, Veterinary Faculty, Islamic Republic of Iran; 2Large Animal Clinical Science, Department of Theriogenology, Razi University, Kermanshah, Iran Introduction One of the limiting factors in goat reproduction is semen quality and quantity. Assessing these parameters is essential to determine the best period(s) to perform mating or semen collection for AI. This study was undertaken to investigate seasonal variation in semen quality and quantity of Merghoz bucks in west of Iran. Methods Ten Merghoz bucks were housed and fed according to standard recognized practices. Semen was collected monthly with an electro-ejaculator and examined immediately after collection from July 2006 to June 2007. Results Semen volume was greater (P<0.05) during the autumn (1.2 ± 0.06) and summer (1.0 ± 0.03) than those in the spring (0.6 ± 0.03) and winter (0.7 ± 0.03). Sperm concentration was lower (P<0.05) in the autumn (0.9 ± 0.6 × 106) than those in the winter (1.2 ± 0.1 × 106) and spring (1.3 ± 0.2 × 106). The difference between summer (1.1 ± 0.06 × 106) and autumn was significant (P<0.05). Sperm gross motility (1-5) was higher (P<0.05) in the autumn (4.2 ± 0.2) than those that in the summer (3.3 ± 0.3) and spring (3.4 ± 0.2). This index was higher (P<0.05) in winter (4.1 ± 0.1) than those in the summer and spring. The percentage of live sperm and sperm progressive motility were significantly greater in the autumn (90.7 ± 0.8 and 83.9 ± 1.6, respectively) than those in the winter (84.9 ± 1.5 and 71.5 ± 3.5, respectively) and spring (80.2 ± 3.5 and 71.5 ± 4.4, respectively). These indexes were different between summer (88.2 ± 1.2 and 82.0 ± 1.9, respectively) and winter (P<0.05). Live sperm percentage was significantly higher in the autumn than in that the summer. The least percentage of abnormal sperm were observed in the autumn (5.0 ± 0.4) and summer (9.2 ± 0.4) and the highest percentage of abnormal sperm were seen in the spring (12.9 ± 0.4) and winter (11.2 ± 0.8), the differences were significant between four seasons (P<0.05). Semen PH was significantly (P<0.05) lower in the autumn (7.1 ± 0.03) than that in spring (7.3 ± 0.06). Conclusions In conclusion, significant seasonal variation in semen quantity and quality of the Merghoz bucks, born and raised in west of Iran, were observed. The best semen is produced during late summer and autumn. However, the presence of differences among season in semen characteristics makes it necessary to perform semen evaluations on an individual basis in order to select the best season or month for breeding and thus optimizing reproductive performance.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 83 P166 Short term nutritional supplementation improves reproductive performance in ewes maintained under extensive conditions in arid central Mexico Muñoz-Gutiérrez, M1*; Scaramuzzi, RJ2; Escobedo Alcántara, JC3; Trejo-González, A4; Retana-Márquez, MS1; Damian-Matzumura, P1 and Borregos de Patria Nueva, AC5 1Reproductive Biology Departament, Universidad Autónoma Metropolitana Iztapalapa 09340 Mexico City, Mexico; 2Department of Veterinary Basic Sciences, Royal Veterinary College, Hawkshead Lane, North Mimms Herts AL9 7TA, United Kingdom; 3Fundación Mexicana para el Desarrollo Rural Tepeji del Río A.C. 42850 Hidalgo, México; 4Medicina Veterinaria y Zootecnia. Facultad de Estudios Superiores Cuautitlán, Universidad Nacional Autónoma de México, 54700 Cuautitlán Estado de México, Mexico; 5Comunidad de Patria Nueva Hidalgo, Mexico In the arid regions of Mexico (Hidalgo, Central Mexico) sheep are managed under extensive conditions on pastures that are of poor nutritive value. The development and transfer of a simple and inexpensive technology to improve the reproductive performance of these flocks would be a significant economic benefit to these subsistence farmers. Short-term nutritional supplementation of ewes with a high energy and high protein diet for the last three days of the oestrous cycle increases litter size of sheep managed under more favourable grazing conditions in Australia, Uruguay and Europe. The present trial was carried out to determine if short-term nutritional supplementation of ewes grazing poor quality pasture in the arid zone on central Mexico could improve their fertility. Seventy five mixed breed (Corriedale X Rambouillet X Suffolk) adult cycling ewes (median BCS = 2) were treated in the breeding season for 11 days with progestagen sponges and 500 IU of eCG injected on the day of sponge removal. The animals were supplemented for seven days with a diet consisting of 250 g of rolled corn, 140 g of soya bean and 950 g of alfalfa hay per animal per day. The diet was offered to the animals starting three days before sponge removal and continuing until four days after sponge removal. Twenty seven control ewes were allowed to graze the available native pasture and their oestrous cycles were not synchronized. The proportions were analyzed using the Chi squared test. Following the introduction of fertile males, 81% (61/75 females) of the ewes fed the supplement displayed oestrous behaviour 1.54 ± 0.05 days (mean ± SEM) after sponge removal and all 61 animals became pregnant at the induced cycle. Of the 27 control ewes only 8 (30%) mated and only 5 (18.5%) became pregnant (P <0.001). Short-term nutritional supplementation at a time when very poor fertility is normal has resulted in a very marked improvement in fertility. In conclusion, short-term nutritional supplementation of ewes at a synchronised oestrus improves oestrus and pregnancy rate (fertility) compared to ewes mated at a natural oestrus grazing natural pasture in an arid environment. Further controlled experiments are planned to fully confirm this finding. P167 The effect on addition of seminal plasma and orvus es paste over frozen-thawed ram semen Navarrete, L1*, Cob, L1, Ramón, J1, Sierra, A1, Medrano, J2 1Ovine Selection and Reproduction Center, Technical Institute of Conkal, Yuc., México. (L Navarrete email: jramon @itaconkal.edu.mx); 2Faculty of Veterinary Medicine, Cuautitlán –Izcalli UNAM., México The objective of this study was to evaluate the effect of adding seminal plasma and a commercial detergent (Orvus Es Paste) to Triladyl ® diluent over the spermatozoa viability post-thawing. A factor design 2x2 for cryopreservation was realized from the ejaculates of 9 rams from different breed (BlackBelly, Pelibuey, and Dorper) after the pool of semen. The dilution of the semen was performed always with Triladyl with 20% (v/v) of egg yolk at ambient temperature. After the dilution the samples were divided in two groups, the first with 10% (v/v) of seminal plasma and the second without it (control group). Each one of these groups was also divided in other two, one with 0.5% (v/v) of Orvus Es Paste and the other without it. All the samples were stored at 5°C during 3 to 4 hours and

packaged in 0.25 ml French straws and frozen in nitrogen vapors during 15 minutes and immediately immersion in liquid nitrogen. The thawing was performed at 37°C for 15 seconds. The variables measured post-thawing were progressive motility, viability, morphological abnormalities, acrosome integrity. The results were analyzed by SAS and the increase was observed in semen quality post-thawing with the sample added with the seminal plasma and Orvus Es Paste against the control sample (P<0.05); 41.15% vs 19.90% for progressive motility, 39.96% vs 21.83% for viability, and 84.00% vs 69.83% for acrosome integrity. No difference was found (P>0.05) for morphological abnormalities 8.40% vs 9.13%. In conclusion the addition of seminal plasma and Orvus Es Paste to the Triladyl® diluent increased in approximately 20% the spermatozoa viability post-thawing. P168 Cyclic ovarian function of Hungarian Prolific Merino and Tsigai ewes out of the breeding season and its association with MT1 receptor gene polymorphisms Árnyasi, M1, Novotni Dankó, G1*, Kulcsár, M2, Faigl, V2, Keresztes, M2, Czeglédi, L1, Magyar, K1, Jávor, A1

1University of Debrecen, Centre of Agricultural Sciences, Institute of Animal Sciences, H-4032 Debrecen, Böszörményi str. 138, Hungary; 2Szent István University, Faculty of Veterinary Sciences, Department and Clinic of Reproduction, H-1400 Budapest, Pf. 2, Hungary Although depending on their breed, genetics, age and body fat content several ewes can ovulate year round in flocks of the Carpathian basin, the most of the animals have cyclic ovarian function only from mid August till late January. Seasonal differences in daylight and the related circadian pattern of melatonin are known as key factors regulating this process. Melatonin effects through binding to specific receptors called melatonin receptor 1a (MT1). The MT1 gene has been extensively studied as a potential marker of ability for continuous ovarian cyclicity: different single nucleotide polymorphisms (SNPs) were identified in its exon II. Mainly two RFLP sites (RsaI and MnII) were studied if they are in association with seasonal pattern of reproduction. Our aim was to investigate these RFLP sites and make association between genotypes and the out-of-season ovarian function in two local breeds, Hungarian Prolific Merino (HPM; crossing of Booroola and Hungarian Merino, selected for ability of lambing three times within each two-year period; n=54) and Tsigai (TS; a known seasonal breeder; n=30). Ewes were genotyped for the two RFLP sites, and out of the breeding season (April-May) the cyclic vs. acyclic character of ovarian activity was determined by assaying progesterone (P4) in blood samples taken 3 times 7 days apart, >70 days after lambing. Ovarian activity was considered as cyclic if the P4 level was more than 3.2 nmol/l at least in one sample, e.g. in 20 (37%) and 13 (43%) of the HPM and TS ewes, respectively. The distribution of various MnII and RsaI genotypes was quite similar in the two breeds (in HPM: MnII AA=19%, AB=51%, BB=31%; RsaI AA=23%, AB=56% BB=21%; in the TS: MnII AA=14%, AB=54%, BB=32%; RsaI AA=11%, AB=61%, BB=28%; in case of both RFLP sites allele “A” means the absence of the cleavage site). Association between genotypes and seasonality was significant (P<0.05) in MnII genotypes (higher number of “AA” ewes had cyclic ovarian activity), and almost significant (P=0.058) in RsaI genotypes. Despite of the limited number of animals involved it can be concluded that in HPM and TS ewes the MnII RFLP site seems to be a promising candidate for detection of ability for cyclic ovarian activity out of the breeding season.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 84 P o s t e r A b s t r a c t s P169 Early sonographic diagnosis of embryo/fetal compromise in sheep cloned derived pregnancies using heart rate, crown rump length and abdominal circumference measurements Panarace, M*; Suarez, G; Cané, L; Garnil, C; Medina, M GOYAIKE S.A.A.C.I. y F., Biotechnology Area, Carmen de Areco CC37, CP 6725, Buenos Aires, Argentina Introduction Sheep cloning has been associated with an increased incidence of abnormal development of the conceptus and a high rate of pregnancy and neonatal loss. The overall efficiency remains low and the production of live offspring is still an unpredictable event. Thus, early prediction of the outcome of pregnancies initiated from cloned embryos has became an important issue, both for reutilization of recipients and also to prevent potential harm to the recipient, the lamb or both. Ultrasonography has proven to be an important, non-invasive method of screening that can be used as predictor of embryo/fetal loss. Objective The aim of this study was to determine if and which of the in vivo ultrasound and Doppler observations of fetal and placental development could be of predictive value for diagnosis of high-risk pregnancies. Materials and methods Forty-five natural-mated derived singleton pregnancies were used as the control group (A). In addition, 113 Merino breed recipients bearing clones were split into three groups according to the outcome of their pregnancies: (B) clones that died between 31 and 90 days (n = 78), (C) clones that died between 91 days and 48 hours after birth (n = 33) and (D) clones alive with more than six months old (n = 2). Measurements were taken every two weeks by ultrasonography (Toshiba Nemio 20, Tokyo, Japan) using two different convex probes, a 5-10 MHz from days 31 to 60 of gestation (transrectal) and a 3-6 MHz thereafter (transabdominal). Three parameters were measured: heart rate (HR, bpm) was determined by Doppler interrogation of umbilical arteries; crown rump length (CRL, mm) was measured in a longitudinal section of the embryo and abdominal circumference (ABC, mm2) was registered in a cross section of the fetus abdomen. Data were analyzed by Chi-square test and differences were considered significant when P < 0.05. Results While fetal losses were relatively rare in ewes carrying naturally mated ewes, losses were considerable in the cloned fetuses (4% versus 97%, respectively). At 31 days of pregnancy 32% of embryos that died before 90 days (B) and 21% of those that died after 90 days (C) had a HR < 188 bpm; the incidence of this abnormality was higher (P < 0.05) in (B) and (C) than in (A) (0%). Also at 31 days, CRL < 16.5 mm was found in 14% of embryos in (B) being different (P < 0.05) to that observed in (A) and (C), (0%). At 87 days of gestation, 38% of the fetuses in (C) had ABC values > 228 mm2, this incidence was higher (P < 0.05) than that in (A), (0%). Given these findings, it is entirely plausible that the early losses recorded in our current study resulted partly from developmental defects of the embryo/fetus proper and partly from placental failures (most of the fetuses with enlarged ABC were simultaneously found with hydrops). Conclusion A HR < 188 bpm or a CRL < 16.5 mm detected with ultrasonography at 31 days of pregnancy were important markers for clones that died between 30 and 90 days of gestation. In addition, ABC at 87 days was a predictor of fetuses that developed large offspring syndrome. P170 Hyperglycaemia in day 9 of the estrous cycle did not increase ovulation rate in ewes but modified plasma IGF-I concentrations Pérez-Clariget, R1*; López-Mazz, C1; Regueiro, M1; Crooker, BA2; Carriquiry, M1 1Department of Animal Production and Pastures, School of Agronomy, UDELAR, Uruguay; 2Department of Animal Sciences, University of Minnesota, USA To evaluate the effect on ovulation rate of increased glycaemia during 24 h in the luteal phase of cycling ewes, thirty-four non-lactating adult

Corriedale ewes (44.6±4.5 kg of body weight and 3.2±0.5 body condition, in a scale 1-5) that grazed native pastures were used. Estrus was synchronized with 2 doses of cloprostenol 8 d apart and on day 9 of the synchronized estrous cycle, ewes were randomly assigned to receive an oral administration of a neoglucogenic solution (125 ml; 70% glycerol, 20% propilenglycol, 10% distilled water; n=17; Group-G) or saline (n=17; Group-S), administrated every 6 h for a 24 h-period. All ewes were inseminated with fresh semen at the following (natural) estrus and number of corpus luteum (CL) was observed by laparoscopy at day 8 of the natural estrous cycle. Means were considered to differ when P<0.05. The interval from second injection of cloprostenol-estrus was 47±0.8 h. Plasma glucose concentrations increased for Group-G during the 24 h that treatment was applied. Administration of the neoglucogenic solution did not affect length of the estrous cycle, and ewes ovulated at 8.3±0.4 d after treatment. Ovulation rate (1.2 and 1.1±0.09 for Group-S and Group-G, respectively) and percentage of embryo retention at first service (53 and 76 ± 10% for Group-S and Group-G, respectively) were similar for both groups. Plasma IGF-I concentrations from -24 to 96 h of initiation of treatment did not differ between groups. However, there was a trend (P=0.065) for an interaction between treatment group and sampling time, as compared with Group-S, plasma IGF-I of Group-G was reduced during the 24 h that treatment was applied and plasma glucose was elevated, did not differ between 48 and 72 h, and increased at 96 h. When data were normalized to day of the following estrus (-8 to -3 d), plasma IGF-I tended (P=0.058) to be greater for ewes that had 2 CL (133.6 vs 155.6±7.3 ng/ml for ewes with 1 or 2 CL, respectively). Results support the concept that increased glycaemia can decreased plasma IGF-I and indicate 24 h of increased glycaemia during the luteal phase was not sufficient to alter the subsequent ovulation or first service conception. P171 Effect of the addition of different mono- and di-saccharides on cooled ram sperm survival Pérez-Pé, R*; Del Valle, I; Mendoza, N; Cebrián-Pérez, JA, Muiño-Blanco, T Department of Biochemistry and Molecular and Cell Biology, Faculty of Veterinary Medicine, University of Zaragoza, Spain Introduction The development of an appropriate cryopreservation protocol for ram semen is still a failed subject. Apart from the experimental difficulties inherent to the freezing process, the use of natural components, such as milk or egg yolk, results in a big variability of the obtained results. Changing these natural additives for “chemical defined solutions” would allow us to assign a specific function to each compound and, hopefully, to obtain more reproducible results. Therefore, we studied the effect of the addition of mono- and di-saccharides to the dilution medium on motility, viability, capacitation state and oxygen consumption of a refrigerated sample. Methods Ram semen was diluted (6x108cells/ml) and cooled up to 5ºC (0.2ºC/min). After 1 h incubation, samples were re-warmed until 37º and maintained during 1 further h at this temperature. Three refrigeration mediums were assayed: one containing sucrose and glucose (typically used for ram sperm selection in our laboratory, swim-up medium or MS), another one supplemented only with disaccharides (D), and the last one with a mix of several mono and disaccharides (D+M). Cell viability was assessed by the fluorescent staining with 6-CFDA and propidium iodide. Computer-assisted sperm motility analysis (CASA) was performed using the ISAS software. Respiration of the sperm suspension was measured polarographically at 37ºC using an Oxytherm respirometer, and capacitation state was evaluated by CTC staining. Results Preliminary results showed that sperm viability was better maintained in the MS medium (72.3% of maintenance vs. 59.4% and 50.31% in D and D+M, respectively) but progressive motility was better preserved in the another two mediums (88.8% in D and 85.7% in D+M vs.70.7% in MS), although differences were not significant. The percentage of viable non-capacitated sperm after cooling and re-warming was higher and sperm oxygen consumption was lower in MS than in D and D+M, which would suggest a minor induction of the cryocapacitation.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 85 Grants: CICYT-FEDER AGL 2005-02614, CICYT-FEDER AGL 2007-61229 and DGA A-26/2005. P172 Plasmatic progesterone and cortisol concentrations in non-pregnant, pregnant and lactating Saanen breed goats De Paula, M1; Peruca Baldini, L1*; Greco, G1; Bittencourt, RF1; Maia, L2; Oba, E1

1Department of Radiology and Animal Reproduction, São Paulo State University -UNESP- Botucatu, Brazil; 2Department of Veterinary Clinics and Pathology, Fluminense Federal University -UFF, Brazil

Progesterone is well known as being the main hormone capable of maintaining pregnancy in domestic animals. Cortisol, on the other hand, is released during stress, being responsible for the induction of parturition through stimulation of progesterone catalysis. In the bovine species, high cortisol concentrations have been detected moments before birth and during the puerperal period. In comparison to other domestic ruminants, few studies have been published regarding the variations in the plasmatic concentrations of cortisol in goats, according to their reproductive state. The present work had as objective to determine the plasmatic concentrations of progesterone and cortisol in non-pregnant, pregnant and lactating Saanen breed goats. Forty-three (43) female Saanen goats, aging 24 to 32 months, were assigned into three different groups according to their reproductive state. Group 1 was composed of 15 non-pregnant goats. Thirteen (13) goats experiencing their last month of pregnancy were assigned to group 2. As for group 3, it was composed of 15 lactating goats, whose kids were at most one month old. Blood was collected between 8:00 and 10:00 am through jugular venipuncture into tubes containing heparin, which were centrifugated at 3000 x g for 15 minutes. Plasma obtained was immediately stored at – 20 degrees Celsius. Progesterone and cortisol concentrations were estimated through radioimmunoassay, using Diagnostic Products Corporation® (DPC) kits. The obtained data was statistically analyzed through the Statistical Analysis System®, version 6.1, 1996. The concentrations of progesterone and cortisol were compared between the groups using the Student-Newman-Keuls test. The correlation between both hormones measured concentrations was established using the PROC CORR procedure. Significance levels were set as P < 0.05. No correlation was found between cortisol and progesterone concentrations (P > 0.05). Mean progesterone concentrations were 1.71 ng/mL +/- 2.18, 13.56 ng/mL +/- 5.21 and 0.2 ng/mL +/- 0.08 in groups 1, 2 and 3, respectively. Pregnant goats had higher (P < 0.01) progesterone concentrations than lactating and non-pregnant animals. As for cortisol, mean concentrations were, respectively, 1.75 μg/dL +/- 1.04, 1.21 μg/dL +/- 0.4 and 1.17 μg/dL +/- 0.6 in groups 1, 2 and 3. Plasmatic cortisol concentrations were similar between the analyzed groups. Progesterone concentrations were higher in pregnant than in lactating and non-pregnant animals. No correlation between both hormones was found. P173 Reproductive parameters of dairy goats submitted to artificial bioclimatic conditions similar to the Eastern Amazon Region Pinho, RO.1; Guimarães, JD.1*; Martins, LF.1; Castilho, EF.1; Borges, MCB.1; Paraizo, RM.1; Torres, CAA2; Vasconcelos, GSC1. Veterinary Medicine Department, Viçosa Federal University, Brazil; 2Zootechnics Department, Viçosa Federal University, Brazil This work deals with the reproductive behavior of Alpine and Saanen female goats submitted to artificial bioclimatic conditions similar to those of the Eastern Amazon Region, when compared to female goats raised under normal typical bioclimatic conditions of regions where they demonstrate seasonality. The study was conducted during the reproductive season for goats, consisting of an adaptation period of 30 days and an experimental period of 60 days, in the bioclimatic chamber. Group 1 (n=4) animals remained in the bioclimatic chamber with temperature and air humidity control (8:00-12:00 hours: 30 ºC; 12:00-18:00: 36 ºC; 18:00-8:00: 26 ºC; with 60 % of average

humidity; and a 12 hour fotoperiod), thus simulating bioclimatic conditions of the northern region of Brazil (next to the Equator line), whereas group 2 (n=4) was kept under influence of the natural climatic variations of the season. Physiological parameters were measured twice a day, with daily follicular dynamics accompaniment, besides blood collection twice a week for cortisol, progesterone and estrogen dosages. During the experimental period, a difference was observed (p<0.05) for the studied physiological parameters between the morning and the afternoon, being the afternoon values always higher than the ones in the morning. With regard to cortisol concentrations behavior as a function of the days, in the different groups and experimental and adaptation periods, no difference was registered between the obtained values during the experimental period (p>0.05). There was no difference (p>0.05) in the duration of estral cycle and estrus for the animals of groups 1 and 2. There was no difference (p>0.05) in relation to the number of follicles observed in the day of the estrus and to the ovulatory follicle diameter, as a function of the groups and number of estrus evaluated, with average values of 4 and 3.5 in the 1st estrus, 5 and 3 in the 2nd estrus, and 4 and 4.5 in the 3rd estrus, for groups 1 and 2, respectively. The number of follicular waves observed varied from 4 to 5 in group 1 and 2 to 4 waves in group 2. Although the animals of group 1 demonstrated higher values of progesterone and estrogen in relation to the animals of group 2, the endocrine secretion standard of these hormones revealed to be similar for both groups in all the studied estral cycles, as a function of time. The results indicated that female goats can be raised under bioclimatic conditions, without modifying the related physiological standards. P174 Relation between superovulatory response and embryo quality with hematological and biochemical blood variables in hair ewes Ramón, J1*, Sauri, I2, Navarrete, L1, González, E2, Cervera, D1, Sierra, A1, Piña, R3 and Quintal, J4 1Center of Ovine Selection and Reproduction, Technical Institute of Conkal, Yuc., Mexico (J. Ramón jramon@itaconkal.edu.mx); 2Central Regional Laboratory of Merida, Yuc, Mexico. 3Faculty of Medicine, Autonomous University of Yucatan, 4INIFAP-Mococha, Yucatán, México Our aim was to correlate hematological (hematocrit and hemoglobin) and biochemical blood variables (plasmatic proteins, total proteins, albumin, glucose, cholesterol, creatinine, urea, ureic acid, alanine aminotransferase, aspartate aminotransferase and alkaline phosphatase) with ovulation rate and embryo quality in Pelibuey sheep. No significant relationships were found (P > 0.05) between ovulation rate and such variables. However, significant difference was found (P < 0.05) between ureic acid and embryo quality a correlation of 0.4686. By using a regression analysis, this equation was obtained: embryo quality = 3.4050 + 1.5549*Ureic acid. This equation expresses that for every 0.3 mg/dL increment in ureic acid levels, the embryo quality improves 1.55 units of score. The levels of ureic acid were proportionally inverse to urea, showing a tendency (P < 0.1) only with creatinine over embryo quality. The supplementation before and after the superovulatory treatment showed differences, on hematocrit (P < 0.01), hemoglobin (P < 0.01), glucose (P < 0.05), urea (P < 0.05) and alkaline phosphatase (P < 0.01). These results suggest that biochemical parameters such as ureic acid, urea and creatinine, may be involved together with methabolic pathways that contribute to predict or explain levels of superovulatory response and embryo quality with the applicattion of exogenous gonadothropins. Supported by: DGEST 509.07-P and CONACYT-SAGARPA-2004-C01-150/A-1

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 86 P o s t e r A b s t r a c t s P175 Expression of VEGF in Corpora Lutea of progestagen synchronized-sheep Sanchez, MA1*; Garcia-Fernandez, RA1; Letelier, C2-3; Sanchez, B1; Garcia-Palencia, P1; Gonzalez-Bulnes, A2; Flores, JM1 1Faculty of Veterinary Medicine, UCM, Spain; 2Animal Reproduction Dpt, INIA, Spain; 3Faculty of Veterinary Medicine, UACh, Chile Introduction Vascular endothelial growth factor (VEGF) is expressed in blood vessels in thecal derived compartiments and granulosa derived-parenchymal lobules in corpora lutea (CL)1,2 but there are some discrepancies about its expression in luteal cells2,3,4 in different species. Though, our aim was to study VEGF expression in different compartiments of the CL in progestagen-induced sheep and elucidate its potential relation with different synchronization treatments. Methods Ovaries from progestagen synchronized (n= 30) and natural cycling (n= 30) Manchega ewes were collected on days 9, 11, 13, 15, 17 and 21 post mating, routinely processed in 4% paraformaldehyde and paraffin-embeded. Later, 41 CL of progestagen synchronized and 48 CL of natural cycling ewes were studied using conventional immunohistochemical techniques with a monoclonal anti VEGF. In every CL were considered 4 different compartiments to evaluate VEGF expression: CL peripheral blood vessels, thecal derived compartiments, granulosa derived-parenchymal lobules and luteal cells. Results VEGF was positive in capillaries and small and medium arteries in the different compartiments studied as well as in luteal cells, but with differences in the intensity of immunostaining among different CL. However, regarding treatments, only on day 9 and in the peripheral blood vessels and granulosa derived-parenchymal lobules capillaries was possible to see a significant increase (p<0.01) for natural cycling ewes. At the same time, though not statistically demostrated, VEGF expression showed a tendency to be enhanced in luteal cells from day 13 onwards in both groups. Conclusions Considering the role for VEGF in angiogenesis of the newly formed CL seems that on day 9, natural cycling ewes showed better vascularized CL, which reduced its probability of luteolysis. Likewise, the expression of VEGF in luteal cells suggests a role for this factor in maintaining the CL during early pregnancy. 1. Redmer et al. (2001). Biology of Reproduction, 65, 879-889; 2. Gazul-Bliska et al. (2006). Reproduction Research 132, 579-587; 3. Berisha et al (2000). Biology of Reproduction 63, 1106-114; 4. Kashida et al (2001) Biology of Reproduction 64, 317-323 This work was supported by a grant from CYCIT AGL2005-02669 P176 Ovarian re-modulation, endocrine function restoration, and complete follicular development from frozen-thawed, auto-transplanted caprine ovarian cortex Santos, RR1*, Knijn, HM1, Vos, PLAM1, Oei, C1, Colenbrander, B2, Gadella, BM1,3, van den Hurk, R4, Roelen, BAJ1 1Dept. of Farm Animal Health, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands; 2Dept. of Equine Sciences, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands; 3Dept. of Biochemistry and Cell Biology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands; 4Dept. of Pathobiology, Faculty of Veterinary Medicine, Utrecht University, Utrecht, The Netherlands Cryobanking ovarian tissue is of high importance for conservation purposes. Twenty-six adult, non-pregnant normal cycling goats (Saanen and Alpine, 55–80 kg) were divided into three groups: (i) controls (n=5): without surgery, (ii) fresh transplantation (n=11): goats were completely ovariectomized under general anaesthesia, where after 15 small cortical pieces (~1 mm3) were immediately grafted onto the curvature minor site of the uterus, and (iii) frozen-thawed transplantation (n=10): ovarian tissue was completely removed, 15 small cortical (~1mm3) fragments were cryopreserved, thawed and then auto-transplanted onto the uterus two 2 weeks after the first surgical procedure. Ovarian tissue was recovered after euthanasia of the animals at various time points (from 1 week to 1 year after transplantation), for histological analysis. Thrice weekly,

blood was collected from the jugular vein for plasma estrogen and progesterone determination. Early-staged follicles survived cryopreservation, but only primordial follicles presented normal histological morphology after transplantation. Re-vascularization and re-modulation of transplanted fragments was observed by histological analysis within 1 week and 1 month post-transplantation, respectively. Pre-ovulatory follicles or corpora lutea were found in three (60%) and four (80%) from five of the goats that received fresh or frozen-thawed grafts, respectively. The average time required to complete follicular development was 71,8 ± 13,9 and 71,2 ± 7,9 days in fresh and frozen-thawed grafts, respectively, which was accompanied by estrous behavior and significant increased plasma estrogen concentrations. In three from five animals with fresh as well as frozen-thawed transplanted tissue, a rise in estrogen concentrations was followed by a rise in plasma progesterone concentration, indicative for ovulation and corpus luteum activity. Three goats (one per treatment) were kept under observation for one year, and all of them presented estrous after the seasonal anestrous period (6 months). The present study shows the formation of a well-vascularised ovarian-like structure and recovery of complete follicular development and endocrine function after cryopreservation and auto-transplantation of caprine ovarian cortical tissue. Keywords goat ovary; cryopreservation; transplantation; folliculogenesis; steroids P177 Superovolatory response in Saint Inês breed in Amazonian region of Brazil Santos Filho, A1*, Neves, AC2, Guerra MP2, Reis, JDC3 1Research, Pernabuca Agricultural Research Company, Brazil; 2Veterinary Medicine, Federal Rural University of Pernambuco, Brazil,; 3Zootecnia, Federal Rural University of Pernambuco, Brazil Introduction The sheep breeding is one of the alternatives for the production of animal protein in the North area of Brazil. The animals of the breed Santa Inês, because of adaptation to the climatic conditions of this area, it is one of the alternatives for the sheep breeding. Embryos transfer, for being a biotechnology that makes possible a larger speed in the genetic improvement, is a tool that certainly can have a valuable contribution to improve the efficiency of the sheep breeding, more specifically of the state of Rondônia. Methods For this reason, the main objective in this research was to investigate the effect of two times of permanence (7 and 14 days) of the progestagen Acetate of Medroxiprogesteron (MAP) and of three doses of FSHp (0, 100 and 200 IU) on the number of total structures (NTS), total ovulatory response (TOR), number of viable embryo (NVE) in 48 Santa Inês sheep (30±6.2 months age), in the state of Rondônia, in the North area of Brazil . The estrus of the animals was synchronized through intravaginal sponges impregnated of MAP and FSHp i.m was injected. The number of total structures, number of degenerate embryos, number of ova, and the total ovulatory response , number of corpus luteum and number of anovulatory follicles were counted. Results Regarding the total structures, only significant effect of treatment was observed (P 0,05) for NVE and NTE, and for this last variable there was significant effect (P 0,05) of time of permanence of the progestagen (t), dose of FSHp (d) and of the interaction t x d. The largest values of NVE and NTE were observed in the treatment T6 (2,66 and 3,38,respectively), treatment this with t = 14 days and d = 200 IU. Regarding to the ovulatory response, significant effect was observed (P 0,05) of treatment, of time of permanence, of the dose of FSHp and of the interaction t x d on NCL and TOR, with the largest values of those two variables being observed in the treatment T6 (4,50 and 5,75), in the time of permanence of 14 days (2,33 and 3,29), and in the dose of 200 IU (2,94 and 4,00). Based in the results of this research, it was concluded that, in sheep Santa Inês when the wished is to obtain larger values for NTE and TOR, is preferable to keep the time of permanence progestagen of 14 days and dose of 200 UI of FSHp.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 87 P178 Echo-Doppler evaluation of umbilical blood flow during pregnancy in sheep Suarez, G1*; Panarace, M1*; Cané, L1; Garnil, C1; Medina, M1 1GOYAIKE S.A.A.C.I. y F., Biotechnology Area. Carmen de Areco CC37. CP 6725. Buenos Aires. Argentina. Introduction Placental blood flow and vascular development are essential components of normal placental function and are critical to fetal growth and development. Umbilical Artery Doppler is an ultrasound technique that allows one to gauge how much resistance fetal blood encounters during its passage through the placenta. Ideally, fetal blood should encounter very little resistance; with certain placental abnormalities, increased resistance to flow may limit oxygenation transfer to fetal blood. Therefore, blood flow in umbilical arteries can be used to monitor placental development and fetal hemodynamics and use these findings for assessing the condition of the fetus. Objective Based on the above mentioned considerations, and considering that most of the studies of umbilical arteries in sheep has been done in instrumented and/or anesthetized fetuses, we aimed to characterize, noninvasively, the Doppler flow velocity waveform in umbilical arteries of ewes with apparently normal pregnancies. Materials and methods Fifteen multiparous, nonlactating Merino breed ewes with singleton pregnancies achieved after natural mating were examined weekly from 4 to 20 weeks of gestation. Ultrasonography (Toshiba Nemio 20, Tokyo, Japan) was performed using two different convex transducers, a 5-10 MHz (transrectal) from 4 to 8 weeks of gestation and thereafter using a 3-6 MHz (transabdominal). Three resistance indices were calculated: S/D ratio, Resistance index (RI) = (S-D)/S, and Pulsatility Index (PI) = (S-D)/M. [S = systole, D = diastole, and M = mean maximum Doppler-Shift frequency over the cardiac cycle]. A repeated measure ANOVA was used to detect differences between mean values of each Doppler index for every week of gestation using the Fisher test (InfoStat V1.5, FCA, Universidad de Córdoba, Córdoba, Argentina). Correlation between Doppler indices was also calculated. All data are shown as mean ± S.D. Results The duration of pregnancy was 148 ± 1.5 days, all lambs were born naturally without any type of assistance. All three Doppler indices were highly correlated: S/D versus RI versus PI, r > 0.84. From weeks 4 to 9 of pregnancy, blood flow was characterized by a systolic pattern (i.e. high resistance with absence of diastolic flow). At 10 and 12 weeks of gestation, 50% and 100% of the fetuses showed a diastolic flow consistent with low resistance, respectively. All three resistance indices decreased (by > 45%, P < 0.05) from week 10 (SD = 7.62 ± 1.82; RI = 0.86 ± 0.03; PI = 1.70 ± 0.23) to week 16 (SD = 2.72 ± 0.52; RI = 0.62 ± 0.07; PI = 0.95 ± 0.18) of pregnancy, with no substantial changes thereafter (P > 0.05). Conclusion Umbilical artery blood flow pattern in ewes was initially systolic (high resistance) but became diastolic (low resistance) from week 11 of pregnancy onwards. Noninvasive Doppler sonography was useful for assessment of umbilical blood flow from 4 to 20 weeks of pregnancy, these reference values may be useful for assessing placental function in high-risk pregnancies e.g. cloned derived pregnancies. P179 Estrogen and Progesterone Receptors in the vagina of progesterone primed and GnRH treated anoestrous ewes Tasende, C*, Acuña, S; López, C; Garófalo, E Cellular and Mollecular Biology, Faculty of Veterinary Medicine, Uruguay The Estrogen and Progesterone Receptors (ER, PR) concentrations were investigated in vagina of anestrous Corriedale ewes treated with GnRH or with Progesterone (P) plus GnRH. Twenty two ewes were assigned to two groups: GnRH (n = 11) and P+GnRH (n = 11). The P+GnRH ewes were treated with 0.33 g of P (CIDR) for 10 Days and immediately after CIDR removal they were treated every 2 h with 6.7 ng of GnRH (i.v.) for 16 h, followed by bolus injection of GnRH (4 μg, Day 0) at 18 h. The GnRH ewes were treated according to the

same protocol without P pre-treatment. Ewes were killed on Day 1 (n = 6, for each treatment) and Day 5 (n = 5, for each treatment) after bolus injection. Samples of vagina and blood were taken for receptors and P determinations when the ewes were killed. The ER and PR determinations were performed by ligand binding assay. The ligands used were 3H-E2 for ER or 3H-ORG-2058 for PR, while nonlabelled ligands were diethylstilbestrol and ORG-2058 respectively. The ER, PR and P concentration were analyzed by ANOVA. On Day 5 the P concentration (mean ± pooled s.e.) were higher in the P+GnRH ewes than in the GnRH ewes (6.5±0.54 vs. 3.1±0.61 nmol/L, respectively, P<0.001). The concentration of receptor sites was expressed in fmol/mg protein (mean ± pooled s.e.). There was a significant effect of treatment, day and interaction between them on the ER while for PR only interaction between treatment and day was found (P<0.05). The ER and PR concentrations on Day 1 were similar in P+GnRH and GnRH ewes (154±16, 150±16 and 124±15, 98±15, for ER and PR respectively). On Day 5 the ER and PR concentration were lower in the P+GnRH ewes than in the GnRH ewes (57±18, 147±18 and 65±17, 141±17 for ER and PR respectively). Receptor concentrations in the P+GnRH ewes decreased from day 1 to 5. In the GnRH ewes, ER did not differ amount days but there was a tendency to increased for PR on Day 5 (p=0.07). The low ER and PR concentrations at Day 5 in the P+GnRH ewes could be due to down regulation effect of the higher levels of P on the receptor expression. For ER similar results were found by immunohistochemistry in the stromal cells. These results demonstrated that P priming induces a different pattern of ER and PR at Day 5, in the vagina of ewes treated with GnRH to induce the ovulation during the anestrous season. P180 Evaluation of the ultrasound image attributes of developing ovarian follicles of different follicular waves in normal cyclic ewes Toosi, BM1*, Seekallu, SV1, Pierson, RA2, Rawlings, NC1 1Veterinary Biomedical Sciences, Western College of Veterinary Medicine, University of Saskatchewan, Canada; 2Obstetrics Gynecology and Reproductive Sciences, Royal Hospital, University of Saskatchewan, Canada Computer-assisted quantitative echotextural analysis of ultrasound images has recently been applied to the study of growth and regression of ovarian antral follicles. The aim of this study was to evaluate image attributes of developing ovine antral follicles in the follicular waves of an estrous cycle. The ewe has 3 or 4 waves per cycle. A wave is the emergence or growth of 1 to 3 small follicles (1-3 mm in diameter) to reach a diameter of ≥5mm before regression or ovulation. Seven healthy, cyclic Western White Faced ewes underwent daily ovarian ultrasonography for a complete estrous cycle. Scanning of the ovaries was performed with a B-mode ultrasound instrument equipped with a 7.5 MHz transrectal transducer. Images of the antral follicles emerging in each follicular wave were recorded and digitized for computer-assisted analysis of echotexture. Image attributes of the follicular wall and antrum were analyzed separately. All data are presented as mean±sem. Anovulatory follicles in all follicular waves of the cycle showed the same growth pattern with no differences in the length of the growth (3.58±0.23 d), static (2.53±0.25 d) and regression (3.47±0.22 d) phases between different waves (P> 0.05). The mean pixel value for the wall of anovulatory follicles emerging in the third wave of the cycle was significantly higher than wave 1 and 2 at the time of emergence (21.22±4.04, 27.39±1.58 and 41.94±5.12 in the first, second and third wave respectively) and it decreased as those follicles reached maximum follicular diameter on day 5 after emergence (P= 0.005). There was no change in the mean pixel value of the follicular antrum over the lifespan of anovulatory follicles (P= 0.607), nor difference between different follicular waves (P= 0.067). Area Under the Curve (AUC) or the total area for the wall and antrum of the follicles studied, were correlated with follicular diameter in all follicular waves (r2= 0.938, P< 0.001 and r2= 0.941, P< 0.001 for the wall and antrum respectively). Both AUC for the follicular wall and antrum increased from follicle emergence (5.73±1.81 and 3.35±0.73 respectively) to the time of maximum follicle diameter (14.18±1.34 and 15.53±2.17) and

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 88 P o s t e r A b s t r a c t s decreased to the end of the regression phase (6.23±0.95 and 5.94±1.23) (P<0.05). In conclusion, changes in the image attributes of the follicular wall and antrum of follicles in a follicular wave do not seem to reflect their stage of development; however, physiological changes after mid-cycle in sheep, affect the image attributes of follicles growing in the concurrent follicular waves. P181 Calm Merino ewes have more multiple pregnancies than nervous Merino ewes due to higher ovulation rate Hart, K1,2; Van Lier, E3*; Vinoles, C1; Paganoni, B1; Blache, D1

1School of Animal Biology, Faculty of Natural and Agricultural Sciences, University of Western Australia, Australia; 2Department of Agriculture and Food Western Australia, Narrogin, Western Australia, Australia; 3Animal and Forage Sciences Department, Faculty of Agriculture, Montevideo, Uruguay In 1990 divergent selection lines of Merino sheep were established for calm and nervous temperament at The University of Western Australia’s research farm. Selection for calmness has a positive impact on the reproductive performance of ewes. Previous works have shown that selection has increased lamb survival, and ultrasound scanning at Day 45 of pregnancy showed that calm ewes carried more fetuses than nervous ewes (1.39 v 1.21; P<0.0001). We hypothesised that the better reproductive performance of the calm ewes compared to the nervous was due to a higher ovulation rate rather than lower embryo mortality. At the beginning of the breeding season, the number of corpora lutea (CL) was counted by ultrasound (7.5 MHz transrectal probe, Aloka 900) in 91 calm and 91 nervous ewes of similar live weight (57.6±0.5 kg) and body condition score (2.8±0.02). The ewes were then synchronised for laparoscopic timed artificial insemination (TAI, Day 0) with intravaginal sponges for 14 days, then received eCG at sponge withdrawal and were inseminated 50 h later. The number of corpora lutea (CL) was counted by ultrasound on Day 11 after TAI. On Day 30 and Day 74, the number of embryos present was diagnosed by transrectal and abdominal ultrasound, respectively. Before synchronisation calm ewes had a higher ovulation rate compared to nervous ewes (1.63 v 1.26, P=0.003), but the same proportion of calm and nervous ewes were cyclic (Calm, n=30; Nervous, n=34). In both groups the same proportion of ewes responded to the synchronisation treatment (Calm, n=82; Nervous, n=83). On Day 11, calm ewes had a higher ovulation rate than nervous ewes (1.83 v 1.57, P=0.0307). Pregnancy rate was similar for both groups on Day 30 (51.1%) and Day 74 (48.4%) post TAI. However, more multiple gestations were observed in calm ewes on Day 30 (Calm 1.72 v Nervous 1.32, P=0.0013) and Day 74 (Calm 1.60 v Nervous 1.35, P=0.0314). On Day 30 and Day 74 fewer embryos were counted than the number of CLs counted on Day 11 and most of the losses occurred before Day 30 (Calm 91.0%, and Nervous 94.4%). Our results showed that temperament affected ovulation rate: calm ewes had a higher ovulation rate than nervous ewes. This explains why calm ewes had more multiple gestations than nervous ewes. Reduction in reproductive potential (probably as embryo loss) was similar in both groups but due to the low number of ewes needs further research to be ruled out. The mechanisms by which temperament affects ovulation rate are not yet understood. (Ken Hart is supported by Meat and Livestock Australia). P182 Posthawing viability and fertility of buck spermatozoa frozen with different extenders Vera, T.*; Alberio, R.; Hozbor, F.; Sanchez, E.; Aguilar, D. y Aller, J. Laboratorio de Biotecnología de la Reproducción, INTA- Balcarce EEA Balcarce (INTA), INTA-EEA La Rioja y Universidad Nacional de Mar del Plata The objective of this study was to compare these 3 possibilities on in vitro spermatozoa evaluations and fertility after artificial insemination. Semen of bucks of two breeds (4 Saanen and 4 Creole) was collected in 5 sessions with artificial vagina. The ejaculates of each animal for breed and session with more than 0.4 ml, 3x109

spz/ml and 4 of masal motility (range 1 to 5) were pooled and divided in three equal volumes, one for treatment (T). T1: Tris-Citric acid- fructose (TCF) and 2% of EY; T2: elimination of SP through centrifugation and resuspension in TCF extender with 12% EY and T3: dilution in commercial extender based in soybean lecithin (“Bioxcell” ®-IMV). Diluted semen was cooling to 5ºC at 0.5ºC/min, freezing in pellets (5x107Spz/150µl) and stocked in liquid nitrogen. After thawing in sodium citrate, each dose was maintained at 37ºC during 2 h and evaluated. Individual progressive motility (IPM) and vigor (V) were determined at 0 and 2 h and live (L) spermatozoa (eosina stain) and functionality (F) of plasmatic membrane (HOS Test) only at thawing (0 h). Intracervical insemination was done in 114 milking goats in regular body condition with previously synchronized estrus and using two sperm doses (100x106 spz/goat) only with Saanen sperm. As Control, fresh collected sperm of the same Saanen males was used at the same dose. Gestation was ultrasonographically determined 35 days after insemination. In vitro data were analyzed using a DBCA considering session as a block with GLM procedure of SAS and gestation rate by X2 test. For IPM and V, T2 results were higher (P<0.05%) than T1 and T3 at 0 and 2 h (IPM at 2 h T2 38,6±1,3 vs T1 18,4±1,1 and T3 13,1±1,0 and V at 2 h for T2 2,5±0,1 vs T1 1,4±0,1 and T3 0,8±0,1). No effect of breed was observed at 0 h but Creole was superior (P<0.05) to Saanen at 2 hs. It was a breed x treatment interaction (P<0.05) in L spermatozoa (T3 superior to T2 in Creole and vice versa in Saanen). For F, the best results (P<0.05) were in T2 in relationship to T1 and T3. Pregnancy rate for Control 37 (10/27), T1 25 (7/28), T2 30 (9/30) were higher than T3 6 (2/29) (P<0.05). These results show that 1) Creole sperm would resist better freezing than Saanen sperm, 2) vegetable lecithin is not suitable to freeze goat sperm and to replace egg yolk 3) the reduction of egg yolk in presence of seminal plasma is not enough to depress the negative effect of the interaction and 4) the elimination of seminal plasma is the better solution for frozen goat sperm semen Keywords Buck, frozen-thawed sperm, Soybean Lecithin, in vitro and in vivo evaluation. P183 Fetal programming and short-term nutrition act differently on the growth of ovarian follicles and ovulation rate in Merino ewes Vinoles, C.1*, Paganoni, B.1, McNatty, KP.2, Heath, DA.3, Thompson, AN.4, Glover, KMM.1, Milton, JTB.1 and Martin, G.1 1UWA Institute of Agriculture, Faculty of Natural & Agricultural Sciences, University of Western Australia, Crawley 6009, WA, Australia (cvinoles@adinet.com.uy); 2Victoria University of Wellington, New Zealand; 3AgResearch, Wallaceville Animal Research Centre, New Zealand; 4Department of Primary Industries, Hamilton, Victoria, Australia We have been studying the effects of nutrition during fetal life on the reproductive performance of ewe lambs after puberty. In the present study, we tested whether adequate nutrition during fetal life increases i) the potential for twin ovulations, and ii) the response to short-term lupin supplementation, leading to higher circulating concentrations of metabolic hormones and more ovarian activity. We used 4-6-year-old single-born ewe lambs from mothers that were in condition score 3 at mating and maintained on either a high (HP, n = 20) or low plane (LP, n = 20) of nutrition throughout pregnancy. Ewe lambs were allocated to a factorial design for plane of nutrition during pregnancy (HP vs LP) and supplementation (yes or no). All ewes received 3 injections of prostaglandin (PG) 7 days apart using the ‘one-wave model’®. The supplemented group was fed lupins to provide double the requirement for maintenance from 2 days after the second PG injection (Day 0) until the third PG injection. From the second PG injection until sacrifice, the development of ovarian follicles and corpora lutea were evaluated by ultrasonography. Blood was sampled daily for the assay of plasma insulin, leptin and IGF-I. The ovaries were recovered from 5 ewes of each group on Day 3 of supplementation and from another 5 ewes from each group about 30 h after the last PG injection. All follicles ≥ 3 mm diameter were dissected and classified as atretic or healthy. Ovulation rate was 25% higher in HP ewes (1.5 ± 0.1) than in

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 89 LP ewes (1.2 ± 0.3; P < 0.05), but this was not associated with differences in numbers of atretic or healthy follicles, follicular dynamics or metabolic hormone concentrations. Supplemented ewes had 2.3 ± 0.6 and 2.2 ± 0.6 healthy follicles on Days 3 and 7, less than control ewes on Day 3 (4.6 ± 0.6; P < 0.01) but the same as controls on Day 7 (2.0 ± 0.6). The largest healthy follicle from supplemented ewes was larger (6.1 ± 0.2 mm) with more granulosa cells (3.7 ± 0.2 million) than in non-supplemented ewes (5.4 ± 0.2 mm and 3.0 ± 0.2 million; P < 0.05). Insulin, leptin and IGF-I concentrations were higher in supplemented than in control ewes (P < 0.01). These results suggest that, while metabolic hormones explain the positive effect of short-term supplementation on follicular growth, they are not involved in the increase in ovulation rate promoted by nutrition during pregnancy. Meat & Livestock Australia and the University of Western Australia supported this work. P184 The use of artificial long days is not effective to induce reproductive activity in Mediterranean goat does without isolation from males Zarazaga, LA1*, Gatica, MC2, Guzmán, JL1, Celi, I1 1Universidad de Huelva, Carretera de Palos de la Frontera s/n, 21819, Huelva, Spain; 2Universidad Arturo Prat, Avda. Arturo Prat, 2120, Iquique, Chile One experiment was designed to investigate whether the treatment with artificial long days is effective to induce and synchronize reproductive activity during the normal seasonal anoestrous in Mediterranean goat does that were not isolated from males. Two balanced groups of does according to their body weight (BW) and body condition score (BCS) were used. One group was subjected to artificial long days treatment (16L:8O) (LD, N=24) from 17th November to 5th February, and the control group was maintained under natural photoperiod (C, N=23). From November to May BW and BCS were measured weekly. Oestrous activity was tested daily using entire aproned males from the end of the photoperiodic treatment to the end of the experimental period. Ovulation rate was evaluated by laparoscopy 7 days after positive identification of oestrous. Effect of LD treatment and month on BW, BCS, was tested. The effect of treatment was studied on the date of the first detected oestrous after the end of LD treatment during the normal seasonal anoestrous, on the ovulation rate of the first detected oestrous and on the percentage of females that showed oestrous. No effect of LD treatment, month or interaction between both variables on BW was observed. However, BCS was influenced by all analyzed factors (at least P<0.05). The mean BCS was 2.46 ± 0.01 vs 2.44 ± 0.01 for LD and C group, respectively and it was higher during March, April and May for the LD group than the C group (P<0.01). The date of the first detected oestrous for the LD group was the 6th April and not reproductive activity was detected on C group. Only the 16.6% of the LD group showed oestrus after the photoperiodic treatment. The mean ovulation rate of the first detected oestrous for the LD group was 1.5 ± 0.29. Due to the reduce percentage of animals that showed reproductive activity during the normal seasonal anoestrous, we can conclude that LD treatment is not effective to induce and synchronize reproductive activity in Mediterranean goat does without previous isolation from males. Most research is necessary to determine if the photoperiodic treatment in females requires isolation from males to induce reproductive activity during seasonal anoestrous. P185 Seasonal effects of intracerebroventricular leptin on prolactin and growth hormone secretions in non-lactating ewes Zięba, DA1*, Szczęsna, M1, Klocek-Górka, B1, Molik, E1, Misztal, T2, Romanowicz, K2, Keisler, D3, Murawski, M1

1Agricultural University, Krakow, Poland; 2Polish Academy of Science in Jablonna, Poland, 3University of Missouri, USA In temperate latitudes, sheep are seasonal breeders with its reproductive activity controlled mainly by photoperiod through pineal

hormone – melatonin. Recent experiments showed photoperiodic changes in leptin sensitivity in seasonal mammals. Leptin, a hormone produced primarily by adipocytes, regulates energy expenditure and food intake. However, contradictory results have been obtained regarding the secretion of growth hormone (GH) and prolactin (PRL) in sheep under non-lactating conditions, in response to leptin. Prolactin, an essential hormone for mammary gland development and milk production, modulates adipose tissue lipid metabolism. Growth hormone, a metabolic regulator, exhibits many effects on growth and development. Herein we examined how interactions of long-(LD) and short-day (SD) seasons and different doses of recombinant ovine leptin (roleptin) affected PRL and GH concentrations in mature ewes. Twenty four Polish longwool sheep, a breed that exhibits strong seasonal reproduction, were housed in natural photoperiod (longitude: 19°57’ E, latitude: 50° 04’ N). Ewes were surgically fitted with third ventricle cannulas. All experiments started at the sunset on 12 ewes selected randomly during LD and on additional 12 ewes during SD. Ewes were infused centrally three times at 0, 1 and 2 h with the first sample collected immediately before the first infusion at time 0 with: Ringer-Locke buffer (Control), or 2) roleptin (0.5 µg/kg BW; L1 trt) and 3) roleptin (1.0 µg/kg BW; L2 trt). Leptin caused an increase (P < 0.001) in circulating leptin concentrations compared to controls during both seasons in a dose-dependent manner. PRL concentrations during LD was much higher (P < 0.001) compared to value in SD. Leptin in both doses decreased concentration of PRL during SD (P < 0.001) and increased during the LD. Central leptin infusions in both doses increased (P < 0.001) GH concentrations compared to control group during SD. Leptin decreased (P < 0.001) GH concentrations depending on dose during LD. Data provide evidence that secretions of pituitary hormones such as PRL and GH are effectively and directly regulated by leptin and are depended on photoperiodic conditions. This work was supported by a grant from the Polish National Research Council (KBN 2PO6D 003 29). Poster 03 - Reproduction of Buffalo and Exotic Bovidae P-186 Effect of the polymorphism of MT1 melatonin gene receptor on reproductive activity of Mediterranean Italian buffalo (Bubalus bubalis) Carcangiu, V*; Pazzola, M; Marchi, B; Vacca, GM; Dettori, ML; Mura, MC; Bini, PP Department of Animal Biology, University of Sassari, Italy The Mediterranean Italian buffalo (Bubalus bubalis) has a seasonal reproductive activity, which obviously influences productions. Photoperiod, through the melatonin secretion, is the main environmental factor affecting the regulation of sexual activity. Melatonin exerts its action through binding to receptors located in the hypothalamus, MT1 is the receptor implicated in the control of the reproductive seasonality and its polymorphism affects the sensibility to photoperiod in sheep and goats. The aim of this research was to study the polymorphism in MT1 gene and its effect on reproduction in Mediterranean Italian buffaloes reared in Sardinia. The study was carried out in a herd made up of about 300 buffaloes, located in the South of Sardinia (39° N). 55 pluriparous female, 5.8 ± 4.5 year-old, were selected and their reproductive activity monitored by transrectal ultrasonography and calving date, in the previous years, was achieved from the farm software. A blood sample was collected from each animal. 100-150 μl of the extracted DNA was utilized for the amplification of exon II of MT1 gene, by means of the primers corresponding to position 285-304 (sense primer) and 1108-1089 (antisense primer). PCR product obtained by 20 samples was sequenced. Alignment of the sequences led to the identification of a mutation in position 82 of MT1 gene (a substitution cytosine-thymine, C→T) using the endonuclease HpaI. Later, all the samples were amplified and digested with endonuclease HpaI with the aim to identify the polymorphism. Data was analysed using χ2-test to assess the effect of MT1 genotype on the reproductive activity. Furthermore,

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 90 P o s t e r A b s t r a c t s allele and genotype frequencies and Hardy-Weinberg equilibrium were calculated. Allele frequency is 0.44 % for allele C and 0.56 % for allele T; population is in Hardy-Weinberg equilibrium. Genotype frequency is 20% for the genotype C/C, 34.5% for T/T and 45.5% for C/T. Statistical analysis indicated that buffaloes carrying the genotype C/C showed their reproductive activity (7 vs. 4; P<0.01) mainly during the short-day photoperiod (September-December), while the majority of T/T (12 vs. 7; P<0.01) showed their reproductive activity during the long-day photoperiod (January-June). C/T had a reproductive activity both during short-day and long-day photoperiod (12 vs. 13; P>0.05). In conclusion, even if our sample was small, we can state the polymorphism of MT1 melatonin gene receptor affects the seasonality of buffaloes sexual activity, but it should be involved a greater number of buffaloes in a future research. P187 Molecular characterization of the CFTR channel protein in buffalo sperm cells Castellana, E1*, Ciani, E1, Guerra, L1, Minoia, R2, Lacalandra, GM2, Cianci, D1, Casavola, V1

1Department of General and Environmental Physiology, University of Bari, Italy; 2Department of Animal Production, University of Bari, Italy

Despite the growing interest on buffalo, evidenced by the worldwide increase in the number of reared animals, advances in the assisted reproductive techniques are still limited. Several studies highlighted the poor fertilizing ability of cryopreserved buffalo semen both in vivo and in vitro. Cystic Fibrosis Transmembrane Conductance Regulator (CFTR) is a glycosylated protein that functions as a cAMP-regulated anion channel, known to conduct both Cl- and HCO3-. A recent work suggests that HCO3- secretion through the CFTR channel protein in endometrial cells plays a role during in vivo sperm capacitation. In addition, a significant decrease of sperm fertilizing ability in heterozygous mutant mice carrying a CFTR mutation compared to homozygous wild-type mice has been observed. Moreover, in vitro CFTR inhibition has been shown to significantly reduce mouse sperm capacitation, preventing intracellular pH increase and membrane hyperpolarization, by blocking the influx of chloride and bicarbonate ions into the cell. Sperm plasma membrane hyperpolarization has been proposed to remove inactivation of T-type calcium channels, thus allowing Ca++ influx into the cell. All the above results suggest that CFTR may play a functional role in sperm physiology and fertilizing ability. We therefore carried out a preliminary immunoblot analysis to confirm the presence and characterize the channel protein in buffalo sperm cells. Western blot was performed on crude membrane lysate from both buffalo and bovine sperm cells by using a monoclonal anti-hCFTR antibody. Two different bands were observed in both samples: one weak band at around 165 kDa, with an apparent mass similar to that commonly observed in different cell lines by several authors and another higher-intensity band at around 125 kDa, similar to that previously observed in human and mouse sperm. These data enlarge knowledge about the distribution of the CFTR channel protein in mammalian sperm cells. Further studies are going to be performed in order to evaluate both CFTR activity and its specific localization in buffalo sperm cells. This will allow to elucidate the role of the channel protein in sperm capacitation. P188 Comparison of two Ovsynch protocols in dairy buffalo cows during the favorable and unfavorable reproductive seasons Del Rei, AJ1*, Bartolomeu, CC2, Carvalho, JA3, Silva Filho, NM4, Balbino, SC4, Alvares, CTG3 1Centro de Biotecnologia da Reprodução Animal, Universidade Estadual do Sudoeste da Bahia, Brazil; 2Unidade Academica de Garanhuns , Universidade Federal Rural de Pernambuco , Brazil ; 3Departamento de Ciências Agrárias , Universidade Estadula de Santa Cruz , Brazil; 4Centro Biotecnológico de Reprodução Animal , Universidade Estadual do Sudoeste da Bahia , Brazil

Introduction Despite of the advances that have already been reached in buffalo reproduction, there is still the need of establishing protocols for timed artificial insemination with reduced costs. In this experiment it was tested two Ovsynch protocols to observe the efficiency of the Ovsynch protocol and a reduction to half of the dose of the second GnRH during the favorable reproductive season as well as in the unfavorable reproductive season. Methods This experiment was conducted in the State of Bahia, northeast of Brazil, in 2007, during the months of June-July (winter) and October-November (summer) in the favorable and unfavorable reproductive seasons, respectively. Eighty three multiparous milking Murrah Buffaloes in good body score condition (BSC ≥ 3); scale (1 to 5) were randomly allocated into two groups G1 (June-July; n=42) and G2 (October-November, n=41). Each group was submitted to two treatments. For G1, T1 (n = 21) and T2 (n=21). In T1, the protocol employed consisted of 100µg of GnRH (Ferterilin Acetate) at D0, 0.530µg of PGF2α (Sodic Cloprostenol) at and 100µg of GnRH at D9. In T2 the protocol employed consisted of 100µg of GnRH (Fertirelin Acetate) at D0, 0.530µg of PGF2α (Sodic Cloprostenol) at D7 and 50µg of GnRH at D9. For G2, T1 (n=20) and T2 (n=21) it was used the same protocols as described for G1. Fixed time artificial insemination was performed 16 hours after second GnRH application in all treatments. Conception was diagnosed by rectal palpation 45 days after insemination and conception rate was analyzed by Qui-square Test (SAS, 2001). Results Conception rate presented no statistical difference when comparing treatments of the same group. For G1; T1 = 57.1% (12/21) and T2 = 52.4% (11/21) P > 0.05 and for G2, T1 = 15.0% (3/20) and T2 = 14.3% (3/21) P> 0.05. Although, when comparing treatments of the two different groups T1 from G1, 57.1% vs T1 from G2, 15.0%; P< 0.05 and T2 from G1, 52.4% vs T2 from G2, 14.3%; P< 0.05 and T1 from G1, 57.1% vs T1 from G2, 15.0%, P< 0.05, it was observed statistical difference. Conclusions Although in the northeast of Brazil, the buffaloes are not submitted to a marked day length variation between the favorable and unfavorable reproductive seasons, the Ovsynch protocol did not show acceptable conception rate in the unfavorable season what may be due to the lack of progeserone during this period. Yet, the use of half of the dose of GnRH in the second application showed to be as efficient as the full dose what reduces the cost of the protocol without compromising the conception rate. P189 Production of sex-preselected embryos and offspring in water buffalo (Bubalus bubalis) Lu, YQ1*; Liang, XW2; Chen, MT2; Zhang, XF2; Lu, SS1; Zhang, M1; Pang, CY2; Lu, KH1 1Animal Reproduction Institute, Guangxi Key Laboratory of Subtropical Bioresource Conservation and Utilization, Guangxi University, Nanning 530004, China; 2Guangxi Buffalo Research Institute, Chinese Academy of Agricultural Science, Nanning 530001, China Buffalo is an important livestock resource in many Asian and Mediterranean countries. Sex-preselection via sperm sexing would be of great interest in buffalo species both in biological and economic terms. The objective of the present study was to evaluate the potential of OPU-IVEP system to produce sexed embryos and offspring in buffalo species. Buffalo sperm was sorted into X-sperm enriched population following the general procedure described by Johnson and Welch (Theriogenology 1999;52:1323-41). Oocytes were picked up from fertile Murrah and Nili-Ravi buffalo cows by ultrasound transvaginal ovum retrieval. The oocytes (grade A and B) derived from OPU were matured in TCM199 supplemented with 5% estrous cow serum and 10 μg/mL FSH and then fertilized in vitro with sexed or unsexed sperm in modified Tyrode’s medium supplemented with 0.6% BSA, 2.0 mM caffeine and 20 µg/mL Heparin (Anim Reprod Sci, 2007;100:192-6). Twenty cycling Murrah and Nili-Ravi buffaloes were repeatedly submitted to OPU in this study. An average of 4.6 oocytes was retrieved per session per animal, 70.9% of which was Grade A and B. A total of 1064 oocytes were submitted to in vitro maturation and fertilization. The results indicated that the developmental competence of oocytes fertilized with sexed and

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 91 unsexed sperm was not statistically different in terms of cleavage rate (sexed 50.5% versus unsexed 50.9%, P>0.05) and blastocyst development rate (sexed 15.3% versus unsexed 19.1%, P>0.05). Of the embryos produced in OPU-IVEP system, nine out of 34 sexed fresh embryos (26.5%) and 5 out of 43 sexed frozen embryos (11.6%) transferred to recipients established pregnancies, while 7 out of 26 unsexed fresh embryos (26.9%) and 6 out of 39 unsexed frozen embryos (15.4%) transferred to recipients established pregnancies. Among embryos produced by sexed spermatozoa, eleven buffalo calves were delivered (10 females and 1 male) and 3 abortions (2 females and 1 male) recorded following embryo transfer. Among embryos produced by unsexed spermatozoa and following their transfer into suitable recipients, ten calves were delivered (6 females and 4 males) and 3 abortions (3 males) were recorded. These data would suggest that fresh as well as frozen-thawed embryos produced from OPU derived oocytes have similar viability, together with a similar potential to implant into the uterus and to establish pregnancies. Finally, the birth of sex-preselected buffalo calves indicated the full developmental competence of embryos produced in OPU-IVEP system using sexed sperm. This work was jointly supported by National Science and Technology Supporting Program (No. 2006BAD04A18.), Guangxi Key Technology R&D Programs (No. 0537001-1 and 0447001) and Guangxi University Key Program (No. 2005ZD05). P190 Serial ovarian ultrasonography in wild-caught wood bison (Bos bison athabascae) McCorkell, R* Department of Veterinary Biomedical Sciences, Western College of Veterinary Medicine, Canada The Committee on the Status of Endangered Wildlife in Canada has defined the wood bison (Bos bison athabascae) as a threatened species. One method to ensure bison conservation is the cryopreservation of gametes and embryos. To do this, a detailed understanding of female bison reproductive physiology is required. This study’s objectives were to determine if wood bison are amenable to daily examination and to characterize ovarian function during the non-breeding season. Ten two-year-old wood bison heifers obtained from Elk Island National Park were placed in a corral adjacent to a handling system designed for restraining bison. The handling system was left open to the corral allowing the bison to freely explore it for 2 months. Active acclimation followed for a 2-week period during which the bison were herded daily through the handling system and rewarded with whole oats. Finally, the bison were restrained in the handling system and then rewarded with whole oats upon release. Once conditioned, daily transrectal examination of the ovaries was successfully completed in 100% of attempts for 30 days (January-February) using a B-mode scanner with a 5-10 MHz linear-array transducer (SonoSite Titan, Markham, Ontario). Follicle size and numbers were recorded, and individual follicles were identified serially. Blood samples were collected daily and the serum was analyzed for FSH and cortisol concentrations. In 3 bison, ovarian follicles did not exceed 5 mm in diameter during portions of the study, 2 had elevated serum cortisol concentrations relative to the others and the third had the lowest body weight of the 10. Therefore, data from 7 animals was used. There were non-random changes (P<0.05) in the number of follicles ≥4 mm in diameter detected per day. Each peak in follicle numbers was associated with the development of a single dominant follicle. Non-random changes in daily serum FSH concentrations were detected (effect of day, P<0.05) with peaks 1 to 2 days after emergence of the dominant follicle. The interval between the emergence of successive dominant follicles was 6.8 ± 0.6 days (mean±sem). The maximum diameter of the dominant follicle was 9.9 ± 0.4 mm. In conclusion, wood bison were amenable to daily examination and blood sampling, and ovarian dynamics were characterized by anovulatory, wave-like development of antral follicles associated temporally with surges in circulating concentrations of FSH. This research was supported by the Agri-Food Innovation Fund, Advancing Canadian Agriculture and Agri-Food Program, Parks Canada and the World Wildlife Fund.

P191 Mu opioid receptor affects buffalo sperm cells viability and capacitation Minoia, R1*, Albrizio, M1, Guaricci, AC1, Carrino, C2, Sassone, FA1 1Department of Animal Production, University of Bari, Italy; 2Italy The buffalo (Bubalus bubalis) is expanded dramatically in the number of reared animals. Despite the expansion breeding, only a moderate increase in the reproductive efficiency has been obtained, due to difficulties in the transposition of modern reproductive biotechnologies to this species. Several studies highlighted the poor fertilizing ability of cryopreserved buffalo semen both in vivo and in vitro. Many types of opioid receptors (OR) are present on male and female germ cells in different animal species. Some studies evidenced that the administration of opioid antagonists to raw or frozen semen significantly improves the capacity of sperm cells to acquire the conditions essential to fertilize oocytes. The aim of the present study was to investigate, by indirect immunofluorescence, the presence of mu-OR on buffalo sperm cells and to analyze the effects of naloxone (Nx), an opioid antagonist, added to incubation media on sperm cells viability and capacitation. Straws of buffalo semen were thawed for 30 sec in a 37°C water bath; the semen recovered was washed with a modified Tyrode medium. Five microliters of suspension were smeared onto slides and incubated over night with a 1:1250 dilution of a primary anti mu OR antibody. Slides were then incubated with a 1:200 dilution of a FITC-conjugated secondary antibody and observed. Buffalo sperm cells showed a positive staining for the mu OR on the acrosome region and on the distal segment of the tail. For the functional test, sperm cells were incubated at the concentration of 25 millions/ml at 38°C in the absence (control condition) and in the presence of different Nx concentrations (10-3, 10-6 and 10-8 M) or heparin (10 IU/ml) as known capacitation inducer. Viability and capacitation were detected by Chlortetracycline and Hoechst 33258 staining at 0, 1 and 3 hours incubation time points. Fluorescence microscope analysis clearly allowed differentiation of dead/live and capacitated/non capacitated cells. The statistical analysis of obtained data revealed that Nx at the concentrations of 10-3 and 10-6 M significantly (p<0.05; 0.001 respectively) improved sperm cell viability after 1h, whereas the effects of Nx (10-6 M) on capacitation resulted efficacious after 3h of incubation in respect to the control condition. Moreover 10-6M Nx at 1 and 3h statistically increased (p<0.001) the rate of viable cells compared to heparin determining, at the same time, a comparable rate of capacitated. These results indicate that Nx at 10-6M could be considered a better capacitating agent in IVF protocols than heparin. P192 Effect of plasma progesterone concentration on recovery and in vitro maturation of oocytes obtained from buffalo ovaries – partial results Leal, LS; Oba, E*; Moya, CF; Martins, LR; Fernandes, CB; Bittencourt, RF; Pavão, G; Landim-Alvarenga, FC

Department of Animal Reproduction and Radiology Veterinary, FMVZ/ São Paulo State University, Botucatu-SP, Brazil The aim of the present study was to investigate the effect of plasma progesterone concentration on recovery and in vitro maturation of buffalo oocytes. For this, buffalo blood samples (n=48) and ovaries (n=96) were collected from slaughterhouses (Frigol, Better Beef and Frivale, Brazil), each animal separately. The ovaries were transported to the laboratory in saline solution at 36ºC. Cumulus-oocyte complexes (COCs) were recovered by aspiration of 2-8 mm follicles. Selected COCs (grades 1 and 2) were matured in TCM 199 supplemented with 10% fetal bovine serum, sodium pyruvate, LH, FSH, estradiol and gentamicin. In vitro maturation was carried out at 38.5ºC under a controlled gas atmosphere of 5% CO2 in humidified air for 22-24 h. For the evaluation of the nuclear maturation the oocytes were placed in TCM 199 medium added with type v hyaluronidase where the granulosa cells were extracted. The denuded oocytes were transferred to Hoescht 33342 (1.0 mg/mL) and the chromosomic configuration was evaluated. The oocytes were classified according to

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 92 P o s t e r A b s t r a c t s meiosis stage in: Germinal Vesicle, Germinal Vesicle Breakdown, Metaphase I, Metaphase II and Degenerated. Plasma progesterone concentration was measured in the blood samples by use of a solid-phase radioimmunoassay (Coat-A-Count, Diagnostics Products Corporation, Los Angeles, EUA) according to the manufacturer’s protocol. The SAS statistic program was used to evaluate mean, standard deviation and Pearson’s correlation between the studied characteristics. For statistic analysis, the progesterone concentrations were divided in four groups: ≤1.0; >1.0 to ≤3.0; >3.0 to ≤ 5.0 and >5.0 ng/mL. The plasma progesterone concentration was 3.70 ng/mL in average. The average proportions of grade I (GI, homogenous cytoplasm with several layers of granulosa cells), II (GII, homogenous cytoplasm with one layer of granulosa cells) and III (GIII, denuded and expanded) oocytes recovered and of oocytes that reached metaphase II (MII) stage were 29.00%; 34.81%; 36.19% and 59.63%, respectively. There was no statistic difference between the progesterone concentrations and the values of GI, GII, GIII and MII. In this study, there was no effect of plasma progesterone concentration at slaughter on recovery and in vitro maturation of buffalo oocytes. Acknowledgments: Frigol, Better Beef and Frivale slaughterhouses. This study was supported by CAPES and FAPESP (05/51151-2) – Brazil. P193 Relationship between reproductive performances and somatic cell count in dairy buffaloes raised in northern Italy Stelletta, C.1*, Guizzo, L. 1, Sabino, D. 2, Romagnoli, S. 1 1Department of Veterinary Clinical Sciences, University of Padua; 2Castello di Silea Farm, Treviso, Italy Subclinical mastitis reduces reproductive performances in dairy cows. Intramammary infection influences reproductive performance through the effect of endotoxins on pulsatility and surge of LH and/or the effect of inflammatory mediators on corpora lutea maintenance. Also in dairy buffaloes it has been reported that intramammary infections are characterized by increases in somatic cell count or somatic cell score (SCS). The aim of this study was to investigate the relationship between SCS (Log10 of somatic cell count), calving intervals (CI) and calving-conception interval (CCI) (considering a pregnancy length of 315 days). A total of 1850 calving intervals and the related monthly milk controls (N = 14267) were analysed depending on calving month. The mean SCS increased with days in milk (DIM) and tended to be greater in Winter and Spring months (December to May) than Summer and Fall (June to November). CI and CCI ranged from 475 to 567 days and from 175 to 300 days, respectively, for October and April as calving months. There was no significant influence of SCS on CI or CCI, however there was an evident increase of both parameters in parallel with the increase of SCS up to a score of 5.6. Beyond this score there were other animal bands which would restart with a low CCI (irrespective of the calving month) and increase up to the score of 5.9. These two animals bands observed could be indicative of two different levels of immune response and/or productive status. Further detailed investigation is suggested to examine the effects of other relevant factors (granulocytes adhesion/migration capacities and production) on the reproductive performances of dairy buffaloes for appropriate intervention. P194 Optimization of the cryopreservative conditions increases viability and longevity of post-thawing semen in Thai swamp buffaloes (Bubalus bubalis) Swangchan-Uthai, T1*; Jongejans, TI 2; Reijneveld, NJ 2; Tharasanit, T1; Sirivaidyapong, S1 1Department of Obstetrics, Gynaecology and Reproduction, Faculty of Veterinary Science, Chulalongkorn University, Thailand; 2Faculty of Veterinary Medicine, Utrecht University, The Netherlands Introduction Semen cryopreservation is a valuable tool to preserve genetic material and to accelerate the desired genetic improvement in

swamp buffaloes. However, overall success of this technique is relatively poor. The purposes of this study were to compare the effect of ethylene glycol (EG) with glycerol (G) on cryopreservability of swamp buffalo spermatozoa with different equilibration times in egg-yolk TRIS extender (EYT) and to investigate the advantage of Equex STM paste on post-thaw sperm quality. Materials and Methods 16 ejaculates from two fertile buffaloes were collected over 4 weeks. The pooled semen was divided into 3 aliquots. Semen from 2 aliquots was diluted with an EYT containing either 6% G or 6% EG to a concentration of 120 x 106 mL-1and consequently divided in 2 fractions, then equilibrated at 4ºC for 2 or 4 hours respectively (Exp. I). The remaining aliquot was equilibrated in 6% G plus 1% Equex STM Paste at 4ºC for 4 hours, whereas semen equilibrated in EYT without Equex served as a control (Exp. II). Semen samples were packed in 0.5 ml straws and conventionally frozen. After thawing at 37ºC for 30 sec, the semen was assessed for motility, viability, plasma membrane functional integrity and acrosome integrity. Semen samples from the Exp. I were evaluated immediately after thawing, while the semen samples from the Exp. II were evaluated at 0, 10, 30, 60 and 120 min after thawing. Results Exp. I, the post-thaw sperm quality did not significantly differ between cryoprotectants employed and also equilibration times. In addition, acrosome integrity of buffalo bull sperm was preserved well for both cryoprotectants (% intact > 90%). Exp. II, freezing and thawing significantly reduced sperm motility and viability. Sperm motility and viability at 30 min were significantly greater in the Equex group than control, which were 61.9 ± 1.3 vs. 46.9 ± 3.7 % (P <0.001) and 68.6 ± 3.2 vs. 53 ± 5.9 % (P < 0.05), respectively. In contrast, plasma membrane functional integrity of the control was significantly greater than that obtained in Equex group at 30 min (P < 0.05), 60 min (P <0.001) and 120 min (P <0.001). However, there was no significantly different in acrosome integrity within both extenders. Conclusions EG and G are potentially cryoprotectants for sperm cryopreservation in buffalo. EG with 2h equilibration time can be used instead of a 4h traditional glycerol equilibration without compromising semen quality post-thaw. The addition of Equex STM paste in EYT increases post-thaw sperm quality and longevity of swamp buffaloes. P195 Management effect on body weight, testicular development and semen quality of young Murrah buffaloes bulls from 16 to 24 months of age, raised in Amazon valley, Brazil Vale, WG*, Rolim Filho, TS; Barbosa, EM, Ribeiro, HFL Universidade Federal Rural da Amazônia, UFRA, Instituto da Saúde e Produção Animal – ISPA, Setor de Reprodução Animal, SRA, 66.077-530, Belém, Pará, BRAZIL During the breeding procedure, male buffaloes are selected for high body weight gain, and improved milk production of their progenies. Beside these basic criteria they are also checked testicular development, acceptable semen production and fertility in the early age. Thus management, nutrition and health condition from the birth throughout the pre-puberty and puberty will have influence on their sexual maturation as well. Buffalo is known to be a “poor breeder” with late puberty in males. Some data in the literature reported that buffalo males reach the sexual maturity later than 40 months of age. In this study two groups of 8 buffaloes (age >15 months) were chosen for studying them for one year. Group1 (G1) was maintained on an adequate intensive management in a shaded half-wall sheds. They received shopped Napier grass, Penicetum purpureum, ad libitum, and 3 kg of commercial feed with 16 per cent of crude protein - made from corn bran (70 %), wheat bran (20 %) and toasted soybean (10 %) - 3 kg/day and mineral salt supplement ad libitum. The other group, (G2) was managed in artificial pasture of Brachiaria humidicola and Brachiaria brizantha with an inadequate level of protein intake for about one year. Body weight (BW), scrotal circumference (SC) and andrological and clinical examinations were carried out in order to check the sexual maturity and semen quality. Semen was collected by electro-ejaculation. For statistical analysis the standard chi-square (χ²)

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 93 test and ANOVA were used. Significant differences (P<0.001) were found between the experimental groups in BW (G1: 536±18 kg ; G2: 389±21 kg), SC (28.8 ± 3.8 and 23.2 ± 4.3 cm) sperm motility (63.6 ± 8.5 and 38.2 ± 4.4 %) major sperm defects (36.6 ± 9.4 and 59.3 ± 16.6 %) and total sperm defects (49.3 ± 3 and 68.1 ± 14.8 %) respectively. On the basis of these results can be concluded, that the significant differences between the two groups stated the high impact of management conditions for productivity and reproduction of the young male buffaloes raised in the humid tropical areas of the Amazon valley. The authors also concluded the possibility of the accelerated puberty and sexual maturity of buffalo males at 18 months of age in case of the improved management conditions because of their normal sexual behavior and a normal seminal quality. It would ensure using them in breeding programs in a younger age than usual. P196 Cloning and analyzing the 5’region of follicle stimulating hormone receptor (FSHR) gene on Swamp Buffalo Zhang, M 1,2*; Niu, JT1,2; Lu, YQ1,2; Fu, Q2; Qin, WS1,2; Ren, ZL1,2; Lu, SS1,2; Lu, KH1, 2 1Animal Reproduction Institute, Guangxi University, China; 2Guangxi Key Laboratory for Subtropical Bio-Resource Conservation and Utilization, Guangxi University, China Introduction Follicle stimulating hormones (FSH), which are secreted by pituitary, target to ovary and stimulate the growth, development, differentiation, maturation and ovulation of follicles. As a large biology molecular, FSH can’t penetrate the cell membranes of the target cells. In order to exert their biology function, FSH have to bind to the follicle stimulating hormone receptors (FSHR) lying on the membrane of the target cells. At present, many domestic and researchers have detected the sequences of FSHR on cattle, goat and so on. However, there’s no report about the 5’region sequence of FSHR on Buffalo. In this study, the 5’region sequences of this gene was cloned and analyzed and the comparison between the homology sequences of this gene on cattle and goat was also investigated. The aim of this study is to find the singlenueleotide polymorphisms (SNP) mutation point in the buffalo FSHR gene and to set the base for further studies on its polymorphisms and the subsequent use of the gene on buffalo reproduction. Methods The buffalo genome DNA was extracted from blood and the primers used for PCR were designed according to the bovine FSHR gene. After PCR amplification, the sequence was detected, recovered and purified. Then the sequence was inserted into PMD18-T vectors, and the positive clones were detected. The vectors carrying the target sequence were extracted and sequenced. The target sequence was also translated into amino acid sequence and homology was analyzed by GeneBank. Results The PCR product of buffalo FSHR was 939 bp. Compared with the Chinese Simmental, the homology of this sequence was 97.44％ and there was 1 bp absence in－720 bp. Compared with goat, the homology of this sequence was 94.78％ and there were 7 bp inserts between－625～－619 bp. A part of sequence (－530～－526) in the 3’ region of the hormone reaction element of buffalo was the same with that of goat, both of which were TGACC, but different from the Chinese Simmental, which was CGACC. However, the three species shared the same sequence GGTCA in the 5’ region (－679～－675 bp). There were TATA box and several CAAT box –like sequences detected in the promoter region of FSHR gene in buffalo, goat and cattle and there were no differences among the three species, while there were no such boxes to be detected in human and rat yet. Further study should be carried out to illustrate the promoting and expressing regulation of buffalo FSHR gene.

Poster 04 - Reproduction of Camelidae P-197 Characterization of uterine estrogen receptor alpha and progesterone receptor A and B during the different phases of the follicular wave in llamas (Lama glama) Bianchi, C1,2*; Sahlin, L2; Meikle, A3; Masironi, B2; Cavilla, M1; Aba, M1

1Facultad de Ciencias Veterinarias, Universidad Nacional del Centro de la Provincia de Buenos Aires, Argentina; 2Swedish Institute, Department of Woman and Child Health, Karolinska Institutet, Sweden; 3Facultad de Veterinaria, Universidad del Uruguay, Uruguay Estrogen (ER) and progesterone (PRs) receptors are thought to be critical in determining cell responsiveness to steroid hormones. Several studies have demonstrated that the preovulatory surge of estrogens increases the expression of ERα and PR in other ruminants. Llamas do not present the typical surge of estrogens around the time of ovulation. They are induced ovulators requiring a stimulus in presence of a mature follicle to trigger the ovulatory process. In the absence of stimulus, they undergo follicular waves during which, a follicle becomes dominant, grows to maturity and finally regresses. These waves tend to overlap and are associated with increases in plasma estrogens concentrations which are responsible for long periods of estrous. The aim of the study was to detect differences in the population of ERα and PRs during the different phases (growth, plateau and regression) of the follicular waves in llamas. Six llamas were examined daily by transrectal ultrasonography and a transcervical biopsy was obtained when a follicle at the growing, plateau or regressing phase was recorded. Phases were defined as previously (Chaves et al., 2002). Blood samples were collected at the time of biopsy to determine plasma progesterone (P4) and 17-β estradiol (E2) concentrations using RIA kits. An immunohistochemical technique was used to detect ERα and PRA and B immunostaining in the luminal (LE) and glandular epitheliums (GE) and stroma (Str) which was then evaluated throughout a Colorvision Software. The average of total positive area was analyzed using SAS. Mean follicular diameter was 6.9, 8.5 and 5.1 during the growing, plateau and regressing phases, respectively. Plasma P4 concentrations indicated the absence of a functional corpus luteum. Plasma E2 concentrations ranged from 16 to 37 during all the study, as it was expected. Lower immunostaining of ERα was observed in the LE during the growing phase (P < 0.05), but not significant differences were recorded in the other cell types. The higher percentage of cells positives to PRB was observed in the LE and GE during the plateau phase (P < 0.05) while the PRA immunostaining was similar among phases.These increases of the population of ERα and PR (B in this study) at the moment of female receptivity are in agreement with a similar raise, observed in ewes and cows around estrous. Changes in receptors populations observed in this study do not correlate to variations in plasma E2 concentrations, suggesting some other factor, probably from the ovary, could be involved. P198 Morphological and molecular changes in dromedary uterine glands during pregnancy Desantis, S1*; Ventriglia, G1; Zizza, S1; Hammadi, M2; Sedik, MM2; Deflorio, M1; De Metrio, G1; Lacalandra, GM3

1Department of Animal Health and Well-being, Faculty of Veterinary Medicine,

University of Bari, Italy; 2Livestock and Wildlife Laboratory- Institute of Arid Lands, Médenine, Tunisia; 3Department of Animal Production, Faculty of Veterinary Medicine, University of Bari, Italy The uterine glands synthesize and secrete substances essential for the survival and development of the conceptus and associated extra-embryonic membranes. In dromedary, morphological and glyco-histochemical studies have been carried out on the feto-maternal interface but investigations regarding the glycoconjugates produced in the uterine glands during gestation are lacking. The aim of this study was to investigate the morphological and molecular changes of dromedary uterine glands during pregnancy. Uterus fragments from

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 94 P o s t e r A b s t r a c t s 3rd and 6th month pregnant dromedaries were fixed in 4% (w/v) neutral formalin and embedded in paraffin wax. Morphometric examinations were carried out on Haematoxyline-Eosin stained sections. Histochemical reactions were performed to evaluate the secretion of proteins with the bromophenol blue method and carbohydrates by means of PAS (neutral mucosubstances / glycoproteins), Alcian blue (AB) pH 2.5 (carboxylated mucosubstances) and AB pH 1.0 (sulphated mucosubstances). In addition, the analysis of oligosaccharides was performed with 5 lectins in association with sialidase (s) treatment.Uterine glands from 6 month pregnant dromedary (6mp) were larger and the columnar epithelium was taller than 3 month pregnant (3mp) ones. Mean gland diameter was 60.0 ± 10.6 μm in 6mp and 47.8 ± 17.9 μm in 3mp (p<0.05); mean epithelium height was 16.2 ± 3.0 μm in 6mp and 13.8 ± 2.5 μm in 3mp (p< 0,05). 6mp contained dilated glands in the deep zone of the endometrium. The mean diameter of these glands was 104.7 ± 19.5 μm and the cuboidal lining epithelium was 9.7 ± 1.8 μm tall. Lumen glands from both 3mp and 6mp dromedaries contained glycoconjugates with terminal Galβ1,4GlcNAc (PNA) and with internal/terminal αMan (Con A affinity). The lumen of dilated glands of 6mp was full of proteins, neutral glycoconjugates, as well as glycans terminating with Neu5Acα2,6Gal/GalNAc, GalNAcα1,3GalNAcα1,3Galβ1,4Galβ1,4GlcNAc (SNA and DBA reactivity). The results of this study show that during gestation, in addition to morphological changes, variations also occur in the substances secreted from dromedary uterine glands and that the secretions mostly consist of proteins and neutral glycoconjugates, whereas acidic substances are scarcely secreted. As in other mammals, the morphology and molecules produced in the uterine glands during pregnancy show changes as pregnancy progresses. These findings are related to the morpho-functional effects of changes occurring in hormone secretion during gestation in the dromedary. P199 Relationship between embryo survival and the corpus luteum position in lamas (Lama glama) Huanca, W1*, Carnero, S1, Cordero, A2, Huanca, T3 and Ratto, M4

1Laboratory of Animal Reproduction – Faculty of Veterinary Medicine, San Marcos University, Perú; 2Department of Animal Nutrition, Agrarian University; 3National Institution Agrarian Research (ILLPA – INIA); 4Universidad Austral de Chile Introduction South American Camelids (SAC) are species induced ovulators with a low reproductive efficiency associate with high embryo mortality. The ovulation rate is similar between both ovaries but ninety nine percent of embryo develop in the left horn suggest that the embryonic migration would be a possible cause of embryo mortality. Use of embryo technology would contribute to improve knowledge on embryo migration and embryo survival in llamas. Objective Study was design to determine the relationship between embryonic transfer survival and the corpus luteum position in llamas. Methods Ten adult female lamas were used as donor and forty three as recipient. Fresh embryo in blastocyst stage and similar quality were transferred to each recipient whose luteal stage was coinciding with that of the donor. Non surgical embryo transfer technique was used. The site of transfer was either ipsilateral uterine horn right (T1, n= 10) and contralateral uterine horn right (T2, n=10) or ipsilateral uterine horn left (T3, n=15) and contralateral uterine horn left (T4, n=8). The ipsilateral uterine horn refers to the horn on the same side as the corpus luteum and the contralateral uterine horn refers to the horn on the side opposite to the corpus luteum. Pregnancy rate was determined by ultrasound on day 30 after transfer. Results Result were: T1: 60 % (6/10); T2: 30 % (3/10); T3: 75 % (12/15) and 25 % (2/8) of pregnancy rate to treatments. Only three of ten recipients where embryos were transferred in contralateral uterine horn right and two of eight recipients where embryos were transferred in contralateral uterine horn left conceive. Results suggest that contralateral embryo position to the corpus luteum would affect embryo survival in llamas and that a possible ipsilateral embryo position to corpus luteum mechanism would be involved in maintenance of corpus luteum in llamas.

P200 Ovarian activity in dromedary camels (Camelus dromedarius) during the non breeding season Lacalandra, GM1*, Matarrese, R1, Sedik, MM2, Khorchani, T2; Nicassio, M1, Aiudi, G1, Binetti, F1, Hammadi, M2 1Department of Animal Production, Faculty of Veterinary Medicine, University of Bari, Italy; 2Physiologie Animale, Lab. Elevage & Faune Sauvage, Institut des Régions Arides, 4119 Médenine, Tunisie Camelids are seasonal breeders in which ovulation is induced by mating. During the breeding season (November to March, in Tunisia), in non-mated camels, successive follicular waves occur with a growing phase of about 10 days during which the largest follicle reach 16-17 mm, then, after about 5-7 days (heat), undergoes regression and disappears (Skidmore et al., J Reprod Fert, 1996). Little it is known about follicular dynamic during the non-breeding season. In this report, ovarian status was examined by real-time ultrasonography with the aim to explore the possibility to induce ovulation in camels during the non-breeding season. The experiment was carried out in July 2007 in south Tunisia, on 7 pluriparous, suckling she-camels, in good conditions, housed at Livestock & Wildlife Laboratory Arid Land Institute (IRA). All animals were restrained in sternal recumbent posture and few minutes before the beginning of the examination, 4 mg/100 kg bw of Xylazine 2% (Rompun, Bayer, Italy), were injected iv for sedation. Follicular development (follicles larger than 5 mm), was daily assessed by rectal palpation and ultrasonography (Chison 8300Vet, 5MHz, Italy). Animals were treated with 20 µg of Buserelin (Receptal, Intervet, Italy) to induce ovulation when follicles reached a minimum size of 1 cm, uterus was tonic and females showed estrus behaviour at male parade. Serum progesterone from blood samples taken daily from 0 (day of Buserelin injection) to 22 days, was measured. The main size of follicles at the time of GnRH injection was 1.3±0.4 cm (range: 1.1-2.16) and she-camel with sign of estrus were mated by a fertile male 24h (n=6) later. Main serum progesterone in 3 camels before GnRH injection from 0.77 µg/ml increased progressively until 6.2 µg/ml, as pick value, 9 days later, indicating the induced ovulation and corpus luteum formation. Any change of progesterone was observed in one camel (P4<0.5 µg/ml). In the other 3 animals mean progesterone level, before GnRH injection, was high (7.7 µg/ml) and remained at the same level for all the observation period, so indicating the presence of luteal structures non found at ultrasonography before the treatment. Although any camels became pregnant, the results reported here indicate that the breeding season of dromedaries in managed conditions can be extended until summer months utilising appropriate stimulus (hormonal and/or male effect). Moreover the finding of elevated blood progesterone in non treated camels allow to suppose the occurrence of spontaneous ovulations, as reported by Nagy et al. (Theriogen., 2005). P201 Assessment of apparent viscosity and analysis of rheological profiles in llama ejaculates Miragaya, M1*; Martínez Sarrasague, M2; Casaretto, C1; Rubin de Celis, E2; Carretero, I1; Giuliano, S1 1Facultad de Ciencias Veterinarias, University of Buenos Aires, Argentina; 2Facultad de Farmacia y Bioquímica, University of Buenos Aires, Argentina Introduction South American Camelid semen is characterized for its high viscosity. Viscosity in llama and alpaca ejaculates has been indirectly estimated by evaluating the length of the thread formed by pipeting the samples. The physiological function of seminal plasma hiperviscosity is still unknown, as are the effects of this characteristic on spermatozoa and it’s consequences on the reproductive capacity of these species. Due to this it has become important to start studies to estimate the rheological characteristics of South American Camelid ejaculates. The aims of this study were to determine the apparent viscosity and to analyze the rheological profiles of llama ejaculates. Materials and methods Twenty ejaculates, obtained by electroejaculation from 10 males, were processed. The apparent viscosity coefficient (AVC) was measured at 37° C using a cone plate

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 95 CP 42 rotational viscometer Brookfield model DV-I at a speed gradient of 0 s-1 to 230 s-1. Shear stress (γ) was calculated from the measured viscosity profiles and the corresponding rheograms were plotted. Similar to what has been described in human semen, a pseudoplastic behavior which fit the following model: τ = K γn (τ = shear stress; K= structural viscosity; γ= share rate; n= coefficient of consistency) was observed. Based on the rheogram, K and n were calculated. Descriptive analysis of the rheological characteristics was performed. Results The results obtained (Referential Values) were (mean +/- SD): (i) Apparent Viscosity at 11.5 s-1 = 46 +/- 15 cpoise, VC % 33%; (ii) Apparent Viscosity at 115 s-1 = 14 +/- 4 cpoise, VC % 29%; (iii) Structural Viscosity (K) = 2.3 +/- 0.5 dyne s / cm2, VC% 22%; (iv) Coefficient of Consistency (n) = 0.40 +/- 0.11. Conclusion Measuring viscosity using a cone plate rotational viscometer improves the repeatability and objectivity on semen viscosity evaluation. The rheological variables determined and the analysis of the rheological profile confirms the pseudoplastic behavior of llama semen. These results will offer a better understanding of the hiperviscosity in ejaculates of this specie, providing the basis for future studies on the effects of this characteristic on llama reproductive physiology. P202 Effect of different GnRH analogues and follicular size on ovulation and CL development in dromedary camels (Camelus Dromedarius) Nagy, P*, Juhasz, J Production & Veterinary Department, Emirates Industries for Camel Milk & Products, United Arab Emirates Buserelin is frequently used in dromedaries to induce ovulation, but Deslorelin, another synthetic GnRH analogue has not been tested yet (Tibary and Anouassi 1997). Recent data suggest that development of the corpus luteum is influenced by the size of the ovulatory follicle (Nagy et al 2005). The aim of these studies were (1) to compare the efficiency of two GnRH analogues, Buserelin and Deslorelin to induce ovulation; (2) to compare CL development after ovulation of small (< 1 cm) and large (1.5-2 cm) size dominant follicles. Two studies were carried out during the breeding season. In the first, 20 female dromedary camels were randomly selected into 2 treatment groups. Trans-rectal ultrasonography was performed daily. Animals were treated either with Buserelin (20 mikrog/animal, i.v.; Receptal, Intervet, Holland) or Deslorelin (2.1 mg/animal, sc. implant; Ovuplant, Peptid Technologies, Australia) when the dominant follicle reached 1.4-1.5 cm. Ovulation was detected with frequent ultrasonography. Blood samples for progesterone were collected on alternate days. In the second study, 4 dromedaries were given Buserelin twice: (a) when the dominant follicle exceeded 1.5 cm, (b) shortly after selection of the dominant follicle (< 1 cm). Blood samples were collected daily. Plasma progesterone in the first and second study was determined with RIA and ELISA, respectively. In the first study, all but one, Deslorelin treated camel ovulated. There was no significant difference in the mean time of ovulation between Buserelin (mean ± SEM; 28.9 ± 0.38 hours) and Deslorelin (30.9 ± 2.07 hours) treated animals. There was larger variation in the time of ovulation after Deslorelin (27 to 48 hours) than after Buserelin (27 to 30 hours). CL development and plasma progesterone concentration were similar after both treatments. In the second study, all camels ovulated large (mean ± SEM; 1.57 ± 0.05 cm) and small size (0.87 ± 0.06 cm, P<0.001) follicles. Size of the ovulatory follicle significantly influenced CL development. Several end points (maximum size, AUC of CL, maximum P4, AUC of P4) of CL development from large follicles were significantly higher (P<0.001) than those from small follicles. We conclude that Deslorelin, in short-term subcutaneous implant could be an alternative to induce ovulation in dromedaries. Dominant follicles smaller than 1 cm in diameter already have the ability to ovulate, but CL development is impaired. (1) Tibary A, Anouassi A. Theriogenology in Camelidae, 1997; 169-241. (2) Nagy P, Juhasz J, Wernery U. Theriogenology, 2005. 64. 292-304.

P203 Single norgestomet implant does not influence follicle growth in Bactrian camel Nikjou, D1, Niasari-Naslaji, A1*, Moghiseh, A1, Ghanbari, A2, Razavi, K3

1Department of Clinical Sciences, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran; 2Research Centre for Agriculture and Natural Resources, Ministry of Jihad-e-Agriculture, Ardabil, Iran; 3Animal Science Research Institute, Karaj, Iran The purpose of this study was to investigate the effect of a single norgestomet implant on ovarian follicle growth in Bactrian camel. Bactrian camels (n=8; 6-14 years old) were randomly assigned into two groups. Norgestomet treated camels (n=4) received single implant of norgestomet (Crestar®; Intervet, Holland) under the skin of ear for 10 days (Day 0= Day of implant insertion). Camels in control group (n=4) did not receive any treatment. Daily ultrasound examination using trans-rectal linear probe (Aloka 500, Japan) was conducted from Day -1 to Day 17 of the experiment to determine ovarian follicle status. Mature follicle was defined as a growing follicle at the size of 13-17 mm in diameter. In both experimental groups, there was a female (Camel Nos: 2 & 9) with a persistent follicle throughout the experiment and a new follicle wave which was emerged on Day 6-7 of the experiment. The latter follicle did not reach mature size on Day 10 of the experiment. At the time of implant insertion, there was a female (Camel Nos: 1 & 7) in both experimental groups that had a growing follicle which became at the range of mature size by the termination of treatment. In both experimental groups, there was a female (Camel Nos: 12 & 8) with a regressing follicle throughout the experiment and a growing follicle which became mature on Day 10 of the experiment. One female in the control group (Camel No: 10) had a persistent follicle throughout the experiment and a new follicle emerged on Day 9. One female in the norgestomet treated group (Camel No: 3), had a persistent follicle throughout the experiment and a growing follicle that ovulated spontaneously on the Day before implant removal. In conclusion, single norgestomet implant for 10 days does not influence ovarian follicle growth in Bactrian camel. P204 Map of lectin reactive sites in the testis and epididymal spermatozoa of the alpaca Parillo, F.1*, Scoccia, I.1, Mancuso, R.2 and Catone, G.1 1Department of Veterinary Science, Faculty of Veterinary Medicine, University of Camerino-UNICAM, via Circonvallazione 93-95, 62024 Matelica, Italy; 2Veterinary Practitioner, Italy In the present study, lectin histochemistry in combination with sialidase digestion and chemical pre-treatments was applied to examine a map of lectin reactive-sites in the alpaca testis and epididymal spermatozoa, the oligosaccharide sequences of glycoconjugates and the type of the carbohydrate linkage at light microscopy level. The testes and epididymides were taken following castration from 4 to 10 year-old alpaca (n=5) without reproductive abnormalities and showing complete spermatogenesis. The specimens were immediately fixed and processed for lectin histochemistry according to the procedures previously described. The following lectins were used: Con-A, UEA-I, LTA, WGA, GSA-IB4, SBA, PNA, ECA, DBA, MAL-II and SNA. Sialidase digestion, β-elimination reaction to eliminate O-linked oligosaccharides and hydrolysis of N-linked oligosaccharides with endo-β-acetylglucosaminidase F/peptide N-glycosidase F were also employed. The cytoplasm of the Sertoli cells contained α-Fuc, β-GalNAc, β-Gal-(1-3)-GalNAc, β-D-Gal-(1-4)-GlcNAc, α-Gal, Neu5Acα2,3Gal and Neu5Acα2,6Gal/GalNAc moieties in O-linked oligosaccharides as well as α-Man/α-Glc and GlcNAc residues in N-linked oligosaccharides. Spermatogonia expressed cytoplasmic N-linked glycoproteins with α-Man/α-Glc residues. Spermatocytes displayed β-GalNAc and α-Gal in O-linked glycans as well as α-Man/α-Glc and GlcNAc in O-linked glycans. The acrosomes of Golgi-phase spermatids exhibited α-Fuc, β-GalNAc, β-Gal-(1-3)-GalNAc and α-Gal in O-linked glycans and GlcNAc in N-linked oligosaccharides. The acrosomes of cap-phase

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 96 P o s t e r A b s t r a c t s spermatids lacked α-Fuc and GlcNAc, while having β-D-Gal-(1-4)-GlcNAc. The acrosomes of elongated spermatids did not express α-Fuc and α-Gal residues. Spermatozoa from ductuli efferentes and caput, corpus and cauda epididymal regions showed different expressions mainly consisting of GlcNAc and Gal residues. Sialic acids (Neu5Acα2,3Gal and Neu5Acα2,6Gal/GalNAc) were probably incorporated into the spermatozoa along the extratesticular ducts. These findings indicate that the development and maturation of spermatozoa in the alpaca are accompanied by changes in glycoproteins expression, which is consistent with other mammalian species. P205 Endocrine changes during pregnancy in the guanaco (Lama guanicoe) Riveros, J1,3*; Urquieta, B1; Bonacic, C2; Bas, F3; Hoffmann, B4; Schuler, G4

1Department of Animal Biological Science, Universidad de Chile, Chile; 2Fauna Australis Laboratory, Pontificia Universidad Católica de Chile, Chile;

3Department of Animal Science, Pontificia Universidad Católica de Chile, Chile; 4Clinics for Obstetrics, Gynecology and Andrology of Large and Small Animals, Justus-Liebig-University Giessen, Germany

Plasma concentrations of progesterone (P4), oestradiol-17 beta (E2), estrone (E1) and estrone sulphate (E1S) were measured during gestation in eight guanacos held in captivity in the Mediterranean ecosystem of Chile (33º 38’ 28” S, 70º 34’ 27” W). Blood samples were obtained every 15 days from 1st to 10th month of gestation. Afterwards sampling increased every second day until 2 days after parturition. Plasma P4 and estrogens profiles were measured by radioimmunoassay. Gestational length was 346.1 +/- 9.8 days. Plasma P4 concentrations increased concomitant with the formations of the corpus luteum and remained elevated (> 4.0 nmol/l) until the last month of pregnancy. However, during the last 3 weeks of gestation, they gradually decreased to (< 4.0 nmol/l) until the last 4 days of gestation, when a precipitous decline occurred. They returned to basal concentrations (< 1.0 nmol/l) two days after parturition. Mean E2 levels increased to 100pg/ml at day 250 of gestation and remained over 200pg/ml until 3 days before parturition. They decreased to basal level 1 day after parturition. Plasma E1S, increased to 2.0nmol/l from day 300 of gestation, remained over 4 nmol/l during the last three weeks and decreased to basal level one day after parturition. For E1, only basal levels <1 nmol/l were measured throughout gestation and at parturition. The gradual decline of P4 already starting 3 weeks prior to parturition indicates that guanacos could have a different hormonal support of gestation from alpacas (Lama pacos) and llamas (Lama glama) in late gestation. It may reflect a gradual preterm loss of luteal function, an increased P4 metabolism or a shift from luteal P4 to placental progestins exhibiting only a weak cross-reactivity with the antiserum used for P4 measurement. P206 Llama sperm binding to oviductal epithelium involves n-acetyl galactosamine recognition Apichela, SA; Jiménez-Diaz, MA; Valz Gianinet, JN.; Roldán Olarte, EM; Miceli, DC. Biological Research High Institute INSIBIO, Tucumán, Argentina Introduction Sperm binding to oviductal epithelium would be involved in the sperm reservoirs formation. In other animals, a species-specific carbohydrate recognition take part in the sperm –oviduct interaction but in llama it remains unknown. Knowing the type of carbohydrate residues that could participate in the sperm adhesion to the llama oviductal epithelium was one of the objectives of this study. Material and Methods The distribution of glycoconjugates in llama oviducts was examined by lectin- histochemistry. Uterotubal Junction (UTJ), Isthmus and Ampulla where separated, fixed, and embedded in paraplast. Cross-sections where labelled with WGA, WGAs, UEA 1, DBA, RCA 120, Con A, PSA, LCA, PHA E, PHA L, GSL and SJA lectins-FITC/rhodamine conjugated and observed by Confocal Laser

Scanning Microscopy. Competition binding assays with carbohydrates and lectins were used for assessing the sperm binding to oviductal epithelium in vitro. Epithelial cell explants (CEC) were obtained from UTJ oviductal epithelium of non mated females. CECs were incubated with 10 ug/ml of DBA, WGA, UEA1 or PNA for 20 min (39°C, 5% CO) and then aliquots of washed fresh motile sperm (obtained by artificial vagina) were added. In parallel, fresh sperm were incubated with 10 ug/ml of glucose, manose, galactose or N-acetyl galactosamine and then co-incubated with CECs. After one hour, the explants were fixed, stained, rinsed, and the sperm binding index (BI=sperm number / 0.1 mm2) was calculated. Results and Discussion No differences where found between oviductal segments regarding the carbohydrate residues distribution on the apical cell surface. Abundant ∝-mannopyranosyl, ∝-glucopyranosyl, N-Acetyl glucosamine, and N-acetyl-neuraminic acid residues and scarce ∝-linked N-acetyl-galactosamine and β-galactosyl residues were detected. Neither ∝-L- N-acety- galactosamine fucopyranosyl nor β-N-acetyl-galactosamine residues were distinguished. N-Acetyl galactosamine and galactose were the main carbohidrate that inhibited sperm-CECs binding, as well as DBA lectin. Taken into account these results, the binding sites for Nacetyl galactosamine on sperm were corroborate by using N-acetyl galactosamine-PAA-FITC conjugate. In agreement, sperm were strongly labelled suggesting that N-Acetyl galactosamine could be implicated in a specific interaction between llama sperm and UTJ oviductal epithelium. P207 Parturition in guanacos (Lama guanicoe) maintained in captivity: A behavioral and endocrine approach Urquieta, B1*, Araya, R1, Riveros, J1, Bonacic, C2 1Departamento de Ciencias Biologicas Animales, Universidad de Chile, Facultad de Ciencias Veterinarias y Pecuarias, Chile; 2Ciencias Animales, Pontificia Universidad Católica de Chile, Facultad, Chile Parturition in guanacos in captivity was studied through characterization of behavioral signs and plasma concentrations of progesterone [P4], 17β-estradiol [E2] and cortisol [C]. Eight gestating guanaco females were used. Daily visual monitoring and registering during the birth season was performed. Blood samples were obtained in alternated days, from 15 d before expected delivery up to 30 d after, centrifuged at 800 g x 15 min and plasma stored at -18 ºC until radioimmunoanalysis. Descriptive statistic was used for timing and behavioral signs data analysis and hormonal data submitted to ANOVA and Tukey-Kramer test. All births occurred during the day, with 85.7% between 08:00 and 14:00 h. Parturition process duration was 160 ± 71.8 min (average ± S.D.) and three phases were distinguished. First phase extended from isolation of the female until fetus appeared through the vulva, varying from 27 to 181 min. The 2nd, corresponded to fetal expulsion, lasted from 19 to 87 min and the 3rd, from total fetal expulsion until complete expulsion of fetal membranes was the shortest (4-57 min). Female restlessness was maximal during fetal expulsion, diminished during mother recognition of the newborn and reappeared with medium intensity until the end of 3rd phase. The behavioral signs registered were continuous lye down and stand up, urinate, defecate, roll about, turn backwards, watch their sides, scratch the ground and make noises. Though the same signs were detected along the process, their presentation frequency varied according to labor phase. They are described in decreasing order as labor advanced. On respect to hormones, [P4] was highest (11.3 ± 3.8 nmol/L) at 16-15 d before and a trend to diminish was observed until parturition day when an abrupt and significant decrease occurred (0.5 ± 0.3 nmol/L). Values remained stable during post-partum period (1-2 d to 31-32 d). An increase in [E2] (n.s.) was detected 8-7 d previous to parturition (183.5 ± 30.6 pmol/L), diminishing until day -2 to -1 (117.9 ± 51.6 pmol/L), being an abrupt significant decrease (7.6 ± 10.8 pmol/L) on parturition. Post-partum [E2] diminished for 3-4 d (1.2 ± 1.4 pmol/L), showing an increase (12.2 ± 9.3 pmol/L) on 11-12d. The [C] were not statistically different, but a trend to increase was observed (40.7 ± 9.4 nmol/L) at parturition. Results allow concluding that parturition behavior in captive guanaco is similar to

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 97 that in wild. Parturition timing and endocrine patterns show similarities to those in domestic camelids. P208 In vitro maturation of dromedary camel (Camelus dromedarius) oocytes: effect of different protein supplementations and epidermal growth factor Wani, NA*, Skidmore, JA Camel Reproduction Center, United Arab Emirates The present experiment was aimed to compare the effect of different protein supplementation sources, fetal calf serum (FCS), estrous dromedary serum (EDS) and BSA, and the effect of different concentrations of epidermal growth factor (EGF) on in vitro nuclear maturation of dromedary camel oocytes. Ovaries collected from a local slaughterhouse were brought to the laboratory in a thermos flask containing warm normal saline solution (NSS) and cumulus oocyte complexes (COCs) were harvested by aspirating the visible follicles using an 18G hypodermic needle attached to a 20 mL syringe containing PBS supplemented with 5% FCS. Pooled COCs were randomly distributed to 4-well culture plates containing 400 μL of the maturation medium and cultured at 38.50C in an atmosphere of 5% CO2 in air for 36 h. The basic maturation medium consisted of TCM-199 supplemented with 0.1 mg/mL L-glutamine, 0.8 mg/mL sodium bicarbonate, 0.25mg/mL pyruvate, 50 μg/mL gentamicine, 10 μg/mL bFSH, 10 μg/mL bLH and 1 μg/mL estradiol. In experiment 1, this medium was supplemented with either 10% FCS, 10% EDS or 0.4% BSA whereas, in experiment 2, the maturation medium was supplemented with 0, 10, 20 or 50 ng/mL of EGF. At the end of the culture period all intact COCs were denuded of cumulus cells. The oocytes with a visible polar body, considered to be in metaphase-II stage, were used for other experiments, while as all other oocytes were fixed in ethanol: acetic acid (3:1) for 24 h and stained with 1% (w/v) aceto-orcein stain. The slides were examined under phase contrast microscope at magnification of 400X to evaluate the status of nuclear maturation. Oocytes were classified as germinal vesicle (GV), diakinesis (DK), metaphase-I (M-I), metaphase-II (M-II) or others (those with degenerated, fragmented, scattered, activated or without visible chromatin). In experiment 1, no difference (P < 0.05) was observed in the proportion of oocytes reaching M-II stage between the media supplemented with FCS (71.5 ± 4.8), EDS (72.8 ± 2.9) and BSA (72.7 ± 6.2). In experiment 2, a high proportion (P < 0.05) of oocytes reached M-II stage when the maturation medium was supplemented with 20 ng/mL of EGF (81.4 ± 3.2) compared with the media supplemented with 10 ng/mL (66.9 ± 4.1) and control (67.2 ± 7.1) groups. It may be concluded that all the three protein supplementation sources used in this study are capable of supporting oocyte nuclear maturation equally and a supplementation of 20 ng/mL of EGF increases the maturation rate of oocytes in this species. Poster 05 - Equine Reproduction P209 Effect of an immunomodulator on estrogen alpha and progesterone receptor expression in endometrial tissue of healthy, endometritis resistant mares during the estrous cycle Acuña, S1*, Tasende, C2, Rivulgo, M3, Alzola, R3, Felipe, A3, Rogan, D4, Fumuso, E5 1Cellular and Molecular Biology, Veterinary Faculty, Uruguay; 2University of the Republic, Uruguay, Uruguay; 3Argentina; 4Bioniche Life Sciences Inc., Canada; 5Universidad Nacional del Centro de la Provincia de Buenos Aires, Argentina The estrogen alpha and progesterone receptor (ERα and PR) expression was investigated in endometrial biopsies of healthy, endometritis resistant mares treated by intrauterine administration at estrous (ovarian follicles >29mm, folds and endometrial edema) with

1500 μg Mycobacterial Cell Wall-DNA Complex (MCC). The follicular dynamic was followed by ultrasonography. Endometrial biopsies were taken repeatedly from the same mares at diestrous (in the previous estrous cycle on day 6 post ovulation, n=3, group D), estrous (immediately before treatment, n=7, group E), 24 h post treatment (n=7, group 24hPT), ovulation (n=7, group OvPT) and diestrous (6 days post treatment, n=7, group DPT). An immunoperoxidase staining technique was used to visualize ERα and PR immunoreactivity. The immunoreactivity was analyzed in Luminal Epithelium (LE), Glandular Epithelium (GE) and Stromal (St) cells. Ten fields were analyzed for each cell types at a magnification of 1000x. The average staining for each cell types was calculated according to the following procedure = 1 x n (SI1) + 2n (SI2) + 3n (SI3), where n = amount of cells per field exhibits SI (1), moderate (2) and intense (3). The total positive cells (LE + GE + St) and average staining was analyzed by ANOVA test. The model included the effect of group, cell types and the interactions between them. The level of significance was considered to be P<0.05. The E group had higher ERα total positive cells and higher average staining in St cells than D group. After treatment with MCC no differences in the total positive cells and average staining between groups were found. The average staining of ERα was higher in the GE than LE and St cells in all groups. The PR, total positive cells were higher in the E group than the other groups. The DPT group had higher PR total positive cells and higher average staining in GE than D group. The differences in the ERα and PR expression found during the estrous cycle suggest specific cells type regulation. The higher expression of ERα and PR found in the E group is consistent with the known up-and down-regulation exerted by estrogens and progesterone on the receptors expression. The MCC treatment did not modify ERα expression; however PR expression was affected by the immunomodulator (D vs DPT). These results suggest that the PR could be involved in the immune mechanism in the endometrium of healthy, endometritis resistant mares. P210 Effects of a delta opioid receptor agonist, [D-Pen2-Pen5]-enkephalin (DPDPE) on equine sperm cells motility Albrizio, M*; Nicassio, M; Micera, E; Surdo, N; Lacalandra, GM; Zarrilli, A Department of Animal Production, University of Bari, Italy Reproductive physiology is affected by endogenous opioid peptides (EOP) that act as a multimessenger system in the Central Nervous System, pituitary gland and testis with a direct role on spermatozoa. In humans, a reduced motility is the principal disease of opiate addicts with both normal and abnormal serum gonadotropin levels. Opioid receptors (OR) have been identified on human spermatozoa and also on equine sperm cells. OR are grouped in at least three different classes:mu, delta, kappa (MOR, DOR, KOR) and all three interact with heterotrimeric G proteins. DPDPE, a selective DOR agonist, inhibits high-threshold voltage-operated calcium channels (HVA-VOCCs) and reduces intracellular cAMP levels. In the horse, we demonstrated that DOR and L-type HVA-VOCCs are co-localized on the sperm cell and we hypothesized that they could play a role in the control of equine sperm motility. The aim of this work is to elucidate the possible involvement of DOR in equine sperm motility by performing an in vitro motility test. During the reproductive season, semen samples were collected by an artificial vagina from stallions with good reproductive performances. Spermatozoa were washed and resuspended in Tyrode-modified-medium to approximately 40x106 cells/ml and incubate at 37°C for 3hours in the presence of DPDPE at the concentration of 10-5, 10-6, 10-7 M. Motility analysis was conducted by computer-assisted sperm analysis (CASA; IVOS, Hamilton Thorne Biosciences, Beverly, MA, USA) at time: 0, 30’,90’ and 180’ after the addition of the agonist to the culture medium. Setting parameters were those suggested by the manufacturer for the equine species. At least 200 spermatozoa were monitored for each condition. Results were analyzed by Student’s t test and differences were considered statistically significant for p<0.05. We observed that, the addition of the delta opioid receptor agonist at the medium causes an immediate decrease of sperm cells total motility that was statistically significant (p<0,05) for 10-7 M DPDPE; the reduction

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 98 P o s t e r A b s t r a c t s was also evident at 30’ and 90’ and was statistically significant for all concentrations tested. At 180’ motility of spermatozoa incubated in the presence of 10-5 and 10-7 M DPDPE showed velocity values comparable to those of the control. This work reports for the first time a functional test on equine spermatozoa describing the involvement of DOR in the control of sperm cells motility and provides new insights to the concept of EOP as “local modulators” of reproductive activity. P211 Use of day 3 postovulation embryo transfer recipient mares Alonso, MA1*, Fleury, P1, Alvarenga, MA2 1Fleury Reproducao Equina, Brazil; 2Department of Animal Reproduction, FMVZ-UNESP Botucatu, Brazil In order to have a successful embryo transfer programme, proper selection of the recipient mare is mandatory. This selection is based on synchrony in relation to the donor, absence of uterine folds and fluid, presence of a corpus luteum and uterine and cervical tone. Normally a window of synchrony of +1 (recipient ovulation one day after donor) to – 3 (recipient ovulation 3 days after donor) is accepted and good pregnancy rates are achieved. In some cases, this degree of synchrony is not possible, and one must find another alternative. The use of recipients earlier after ovulation allows a more flexible synchronization between donor and recipient. The objective of this study was to evaluate the use of recipient mares 3 days after ovulation for embryo transfer. Donor mares were of different breeds, age between 3 to 26 years old, maintained in different breeding farms and in Fleury Reprodução Equina Center. Embryos were recovered nonsurgically 7, 8 or 9 days after ovulation. Upon identification, embryos were assessed for size, grade and developmental stage. Only grade I embryos were used in this experiment. The embryos were transferred nonsurgically into synchronized recipients, from 3 to 8 days after ovulation. The selection of recipients was done based on uterine tone and echogenicity on day of transfer, being chosen the mares presenting a homogenous and tubular uterus, with good tone. A total of 905 embryo transfers were used. Recipients were of different breeds from 3 to 14 years of age.. All of them were at Fleury Reprodução Equina Center. Pregnancy test was performed 5 to 7 days after transfer. Data was analyzed by Chi-square test. Pregnancy rates were similar among mares on all different days after ovulation (d3, 75,90% (83); d4, 71,72% (198); d5, 71,49% (228); d6, 69,36% (173); d7, 76,87% (147), d8, 68,42% (76) ). In conclusion, recipient mares can be successfully used as early as day 3 post ovulation, with adequate pregnancy rate, without exogenous progesterone supplementation, being an interesting possibility when closer synchrony is not possible. However, an appropriate selection based on uterine tone and echogenicity is needed to obtain these results. P212 Osmotic stress of stallion sperm exposed to hipertonic solution of diferents cryoprotectants Alvarenga, MA*; Papa, FO; Araujo, GHM; Freitas, CP; Dell’Aqua Jr., JA; Medeiros, ASL Department of Animal Reproduction and Veterinary Radiology – FMVZ / UNESP, Botucatu- SP, Brazil The osmotic stress induced on spermatozoa during the cryopreservation process is an important feature on sperm viability, the permeability of the cryoprotectants play also an important role on osmotic injury during frozen thaw process. Recents works have shown that Glicerol has a low membrane permeability inducing a severe osmotic damage on stallion spermatozoa. The present study aimed to evaluate the stallion sperm viability after induction of an osmotic stress with hypertonic solution of amides (Dimethylacetamide DA, Methylformamide MF, Dimethylformamide DF) and Glycerol using a final concentration of 1 Molar. Ten stallions (two ejaculates) were utilized. The semen was centrifugeded (600xg/10 minutos), the pellets resuspended in the cryoprotectants hipertonic solutions and incubated for ten minuts at room temperature. After this, the solutions were diluted 6:1 (solution of 300 mOsm : cryprotectants solution)

aiming to return to a normal osmolarity (isoosmolarity). Motility by CASA and Membrane integrity (fluorecents probes) were evaluated before, during and after osmotic stress induction. A significant decrease on total motility were observed after the incubation on hypertonic solution (12,93±15,22d; 61,53±16,17b; 44,67±22,68c; 41,73±24,28c, DA, MF, DF e GL respective) when compared with the control group (81,4±9,15a). The lower motility was observed on the DA treatment (p<0,0001). Also a higher decrease in the membrane integrity was observed in the solution of DA, MF, DF e GL (48,47±9,49bc, 49,20±8,47bc, 53,07±12,04b, 42,33±12,15c respectively) compared with control (61,87±13,62a). The GL treatment induced a higher membrane damage (p<0,0001). When the sperm returned to an isosmolarity condition (300 mOsm) the total motility was higher for all amides (p<0,0001) compared with glycerol (66,33±15,03b , 72,8±11,43b, 66,73±13,44b, 43,33±24,56c DA, MF, DF e GL respectively). Also the membrane integrity was superior fro the of amides solutions (p<0,0001) compareted glycerol solution (37,67±9,47b , 40,47±8,47b, 38,13±1,65b, 22±13,49c DA, MF, DF e GL respectively). Based on the results of this experiment we can conclude that the amides were superior to Glycerol in the ability to preserve sperm viabilty after osmotic stress. We can hypothesize that the smaller viscosity of the studied amides associated with the lower molecular weight when compared with glycerol, probably, permit a better permeability of this compounds to the plasma membrane, with a consequent less osmotic damage to stallion spermatozoa. P213 In the horse, upregulation of MxA transcript in pregnant endometrium is associated with type I interferon transcript abundance in early embryos Budik, S1*, Palm, F2, Koblischke, P1, Kolodziejek, J3, Nowotny, N3, Aurich, C1 1Centre for Artificial Insemination and Embryo Transfer, University for Veterinary Sciences, Vienna, Austria; 2Clinic for Obstetrics, Gynecology and Andrology, University for Veterinary Sciences, Vienna, Austria; 3Zoonoses and Emerging Infections Group, Clinical Virology, University for Veterinary Sciences, Vienna, Austria The aim of the present study was to investigate the expression of genes possibly involved in maternal recognition of pregnancy in both, early equine embryos and corresponding maternal endometrium. The abundance of transcripts of type-1 interferon in equine embryos and interferon-induced MxA protein in the endometrium was determined. Endometrial biopsies from pregnant (n=13) and non pregnant mares (n=8) were accessed after total RNA extraction and twofold DNAse digestion by Taq-Man quantitative RT-PCR for expression of MxA transcript in comparison to ß-actin and GAPDH. Twofold DNAse digested RNA preparations of corresponding embryos (day 10: n=1; day 12: n=3; day 14: n=3, day 16: n=6) were tested for abundance of interferon α-1 and ω-2 previously detected in early equine embryos by qualitative RT-PCR by our group. In endometrium from pregnant mares, MxA transcript was significantly upregulated (p<0.02) in comparison to non-pregnant endometrium with both endogenous controls. From days 12 to 16, a significant increase in embryonic size was detected (day 12: 11.7±1.9mm, day 14: 15.6±0.9mm, day 16: 20.8±1.6mm; p<0.01). In all embryos, transcript of α1 and ω2-interferon was abundant, however, due to the small number of embryos, no significant differences in relation to their age could be found. Transcription of α1-interferon was signicantly correlated to transcription of ω2-interferon, irrespective of the housekeeping gene used (ß-actin: R=0.925, p<0.0001, GAPDH: R=0,900, p<0.0001). These results demonstrate an interferon-related transcription of MxA in the endometrium of early-pregnant horse mares and are in agreement with findings in sheep where MxA protein was detected at high levels between day 13 and 20 of pregnancy (Charleston and Stewart, 1993, Gene 137:327-331). In this species, MxA protein is induced by ovine trophoblast interferon. In conclusion, in the horse as in other species, type-1 interferons may be involved in the embryo maternal communication during the preimplantative phase of gestation. The authors are grateful to the Mehl-Mülhens foundation for financial support.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 99 P214 Efficiency of the use of sodic cloprostenol (Ciosin®) and fertirelin acetate (Fertigen®) on the estrous cycle control in mares Bustamante-Filho, IC1*, Ferreira, BG2, Neves, AP2, Arruda, CV2, Petrucci, BPL2, Jobim, MIM3, Mattos, RC3 1Laboratório de Inseminação Artificial, Faculdade de Veterinária, Universidade Federal do Rio Grande do Sul, Brazil; 2Centro de Ciências Rurais - Bagé , Universidade da Região da Campanha , Brazil; 3Faculdade de Veterinária , Universidade Federal do Rio Grande do Sul , Brazil Estrous cycle control in mares is difficult due to their long follicular phase and variability of time until ovulation. Drugs commonly used for estrus synchronization are PGF2α and its analogues; hCG (Human chorionic gonadotrophin); and GnRH (gonadotrophin releasing hormone) and its analogues. The aim of this study was to evaluate the use of sodic cloprostenol and fertirelin acetate on estrous cycle manipulation in cycling mares. Forty adult, cycling mares of mixed breeds were used. Twenty of them were given cloprostenol in the presence of a functional corpus luteum, without further administration of fertirelin, while the other group had cloprostenol plus administration of fertirelin in the presence of a ≥ 35mm diameter follicle. Analyzed parameters were: number of days to ovulation since the cloprostenol injection; number of hours to ovulation since the fertirelin injection; and pregnancy rates. There was no significant difference between groups (p=0,10) in number of days until ovulation. The group that had the fertirelin administration showed a significantly lower (p=0,02) number of hours until ovulation. Pregnancy rates were higher (p<0,01) in the group that had cloprostenol and fertirelin. These results show that this protocol may be useful to estrous cycle control in mares. P215 Equine semen transport with different extenders and its capability for cryopreservation Gardón, JC; Castrillo, F; Escribano, BM; Castejón, FJ* Biología Celular, Fisiología E Inmunología, Universidad De Córdoba, Spain The objective of this study was to evaluate the effects of different extenders for semen transport on cryopreservation capability in Pure Bred Spanish horses. Single ejaculates from six stallions were collected using an artificial vagina. Gel-free fraction of the ejaculate was evaluated for volume, sperm concentration and percentage of motile sperm. Samples containing at least 60 x 106 spermatozoa/ml and 50% progressively motile spermatozoa (PMS) were split into two aliquots of 10 ml. Then was placed into 50 ml conical tubes and diluted 9:1 (v:v) in two different extenders. Skin milk-egg yolk-sugar extender (SMEYS; 277.5 mM glucose, 24 mg/ml skim milk powder, 1 mg/ml ticarcillin, 2% egg yolk by volume, adjusted pH 7.0) or skin milk-egg yolk-HEPES-buffered extender (SMEYH; 154.8 mM glucose, 4.2 mM lactose, 0.5 mM raffinose, 0.85 mM sodium citrate dihydrate, 1.25 mM potassium citrate, 29.8 mM HEPES, 51.5 mg/ml skim milk powder, 1 mg/ml ticarcillin, 2% egg yolk by volume, adjusted pH 7.2). Samples were packaged into a polystyrene container for transport to the laboratory within 3 hs. Semen was then centrifugated at 400 x g for 12 min, and pellets were resuspended in freezing extender (SMEYH plus 4% glycerol by volume) to get a final concentration of 100 x 106 spermatozoa/ml. The spermatozoa were packaged into a 5 ml straw and then frozen in static nitrogen vapor 4 cm above liquid nitrogen for 10 min before plunging the straws into liquid nitrogen for storage at -196 °C. After 3 days straws were thawed in a water bath at 50°C for 45 sec. After thawing the percentage of PMS was estimated using a phase-contrast microscope. Abnormal cells (AC) and percentage of live sperm (LS) was evaluated by dual-staining procedure for detection of live, normal, and morphologically altered sperm by phase-contrast microscopy at 1000x. Acrosomal damage was evaluated in a fixed sample with glutaraldehyde 4% using a phase-contrast microscope at 400x. A total of 200 cells per sample were evaluated. Data were analyzed by analysis of variance. Values of p < 0.05 were considered significant. For SMEYS extender percentage of LS was 27.0±11.72, AC was

22.19±5.63, cells with non damage acrosome (NDA) was 55.04±8.30. For SMEYH percentage for LS was 25.58±11.05, AC was 20.0±5.60, NDA was 49.04±7.30. For both extenders PMS was 20%. Non significant differences were found between extenders. In conclusion both extenders can be used for transport equine semen prior cryopreservation. However, additional studies are needed for the evaluation of potentially using in commercial semen processing. P216 The Cervical Collector Conde, T1*; Fondevila, J2; Martín, T3; Montejo, M3; Vicario, E3; Fernandez, A1 1Animal Pathology, Veterinary Faculty, Zaragoza University, Spain; 2Clinician from Yeguada Aragón, Utebo s/n, Zaragoza, Spain; 3Veterinary´s students in Zaragoza Purpose of the study During this study we compared two methods used to collect semen; the collection through an artificial vagina and the use of the cervical collector. The cervical collector is a glass device which is introduced into the cervix, sealing it and allowing a natural covering. It collects all the semen that the stallion ejaculates without allowing any of the semen to pass into the inside of the uterus. Material and methods The cervical collector consists of a glass container with a constant thickness of 2.2 to 3 mm. Its length must be in relation to the length of the mare’s uterus and its width in relation to the degree of dilation in the cervix. The collector has the capacity to collect a volume of between 50 and 120 cm3 depending on its size. It is very important that the collector be the correct size for the cervix of the mare that it is going to be used on. 1) Total numbers: The number of the stallions and mares were 17 and 42, the extractions were 104; this number represents the population of 850 breeding mares and stallions in our region and supposes 21.5% of the breeding stallions in Aragon. 209 inseminations were carried out on mares in the region. 2) Period of semen collection: Samples were taken during the reproductive seasons. During these 9 months it is considered that the equines have their reproductive season, without interfering in the behaviour of a normal sexual cycle with external factors. The extractions were carried out using the cervical collector and the artificial vagina indiscriminately. In total 46 collections were carried out with the cervical collector and 58 with the artificial vagina. Results obtained Both methods were compared using the t-student method. With reference to microbiological analysis in the mares’ uterus, no significant differences in the percentage of infections that appeared were found between the collection methods. A) Infections caused using the cervical collector: 3.84%, B) Infections caused using the artificial vagina: 2.88%. Conclusions 1) The cervical collector is a technically valid method of extracting semen, which allows not only the extraction of semen for reproductive uses but also as a method for evaluating the stallion’s covering technique. 2) No significant microbiological differences were found between the collections carried out with the artificial vaginal and the cervical collector. 3) The seminal parameters do not significantly change from one method to another. 4) The number of people is notably reduced. 5) The behavioural parameters visibly improve. P217 Assessment of Sperm DNA fragmentation for Assisted Reproduction in the Equidae by means of the Sperm Chromatin Dispersion test Crespo, F1*, Lopez-Fernandez, C2, Cortes-Gutierrez, E3, Arana, P4, De La Torre, J2, Johnston, SD5, Gosalvez, J2 1Universidad FESCCR, Ministerio De Defensa, Deposito De Sementales De Avila, Spain; 2Biology, Universidad Autónoma De Madrid, Spain; 3Biologia, Instituto Mexicano Del Seguro Social, Mexico; 4Genetics, Universidad Complutense, Spain; 5Departament of Animals Studies, University Of Queensland, Australia Sperm DNA fragmentation is an important parameter in the assessment of sperm quality yet such information is scarce for the domestic stallions and non-existent for donkeys and rare and

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 100 P o s t e r A b s t r a c t s endangered breeds at risk of extinction. This study reports on the validation and use of a sperm DNA fragmentation test for domestic stallion and donkey spermatozoa in which the sperm chromatin dispersion test (SCD) was applied to both chilled and frozen semen samples. The SCD test was conducted on spermatozoa that been processed for routine chilled and frozen-thawed insemination. The SCD test was applied to sperm that were subsequently incubated at 37ºC for 0, 4, 6, 24 and 48h in an attempt to try and emulate post-insemination conditions within the mare's reproductive tract. The results of this investigation revealed that there was no significant difference in the sperm DNA fragmentation index (sDFI) of sperm evaluated initially after collection compared to those tested immediately after chilling or cryopreservation. However, within 1h of incubation at 37ºC, both chilled and frozen-thawed spermatozoa showed a significant increase in the proportion of sDFI; after 6 h the sDFI had increased to over 50% and by 48 h almost 100% of the spermatozoa exhibited DNA damage. While the sDFI of individual stallions and donkeys at equivalent times of incubation was variable, an analysis of the rate of change of sDFI revealed no significant difference between animals or the way in which the semen was preserved. In terms of sperm DNA fragmentation dynamics, the highest intensity of sperm DNA damage occurred in the first 6 h of incubation. SDF dynamics varied with respect to individual animals and it was possible to separate animals on the basis of the rate of DNA degradation. In the case of donkeys, the analysis of sperm DNA fragmentation coupled with other classical parameters of semen quality provided a useful measure of the fertility of each animal. Additionally, the application of the SCD in this study leads us to conclude that sperm chromatin organization is analogous in stallions and donkeys, although they do differ with respect to the actual rate of protein depletion after a standard lysing treatment. We conclude that the SCD methodology originally developed for domestic stallions can also be applied for the assessment sperm DNA fragmentation in the donkey or in related wild Equid species such about which there is limited information about sperm quality. P218 Is there an effect of dose rate of Cloprostenol given in dioestrus on interval from treatment to ovulation in mares? Cuervo-Arango, J1*; Newcombe, JR2

1Royal Veterinary College, Department of Veterinary Clinical Science, University of London, UK; 2Equine Fertility Unit, Warren house farm, Brownhills, UK Introduction Although the ovulatory effects of prostaglandins are well documented in several domestic species included horses, there has been little attention paid to the use of this drug for clinical purposes. Mares often grow large follicles during the luteal phase which may or may not ovulate before progesterone levels decline. Clinical observations of administering prostaglandins in dioestrus mares with large follicles suggest that there may be a negative correlation between follicular diameter and interval from treatment to ovulation (ITO). The aims of this study were two fold: a) to assess the effect of different doses of Cloprostenol (a PGF2 alpha analogue, Estrumate®) when given to dioestrus mares with a dominant follicle larger than 28mm on the ITO and b) to evaluate the effect of the diameter of the dominant follicle at the time of treatment on ITO. Materials and methods Data from 529 TB mares from several stud farms and breeding seasons were analysed. Mares with a dominant follicle > 28mm were given either 12.5µg (n=99), 75µg (n=203), 250µg (n=108) or 625µg (n=119) of Estrumate® (250µg Cloprostenol/ml) while in dioestrus as identified by ultrasonographic examination of a visible CL and absence of uterine oedema. For data analysis mares were classified as having a dominant follicle of either 28-31mm (n=190), 32-35mm (n=163) or >36mm (n=176). Mares were scanned every other day until ovulation was detected. A general linear model of variance was used to test the effect of dose rate and follicular diameter on ITO. Results There was a significant effect of dose rate (P=.003) and follicular diameter (P=.000) on ITO. Higher doses of Cloprostenol

induced ovulation faster than lower doses (4.5, 4.4, 3.8 and 3.2 days for 12.5, 75, 250 and 625µg respectively) regardless of follicular diameter. In the same way, mares with larger follicles at the time of prostaglandin induction ovulated faster than those with smaller follicles (4.5, 3.9 and 3.4 days for follicles of 28-31, 32-35 and >36mm respectively) regardless of dose. The fastest ITO was induced by 625µg of Cloprostenol in mares with a dominant follicle >36mm (mean ITO 2.4 days). Conclusion Prostaglandin dose and follicular diameter at the time of induction have a significant effect on interval to ovulation and therefore can be useful tools for the prediction of ovulation. Doses as low as 12.5µg of Cloprostenol (0.05ml Estrumate®) are sufficient to induce luteolysis, oestrus and ovulation when the CL is mature. P219 Histological characterisation of mucus secreting cells in the lower equine reproductive tract Cummins, C*, Duggan, V, Fitzpatrick, E, Reid, C, Carrington, S UCD Veterinary Sciences Centre, UCD, Belfield, Dublin 4, Ireland Introduction Surface epithelial cells of the equine cervical and vaginal mucosa secrete a mucus gel which fulfils a defensive function by preventing colonisation of the epithelium by pathogens. The physical characteristics of this gel vary at different stages of the reproductive cycle depending on the secretion of steroid hormones. Around the time of ovulation, the low viscosity of the mucus gel allows transport of sperm. During dioestrus, the mucus becomes more viscous preventing migration of pathogens into the uterus and during pregnancy a thick mucus plug forms. Recent studies on normal cervical mucins in women have identified neutral, sialic acid- and sulphate-containing oligosaccharides. We have undertaken an initial histological characterisation of the mucus of the equine cervix and vagina. This knowledge improves our understanding of the normal equine reproductive tract and its defence mechanisms and will be useful in detecting pathologies such as ascending placentitis. Materials and Methods Samples of tissue were taken from 19 post-mortem mares, of these 6 mares were in oestrus, 12 were in dioestrus and 1 mare was pregnant. Serum progesterone levels were measured to determine the stage of the reproductive cycle. No vaginal sample was available from the pregnant mare. Samples were fixed in 4% paraformaldehyde. Mucins were demonstrated in paraffin sections using the periodic acid Schiff (PAS) and alcian blue staining methods. Lectin binding was also investigated to detect specific sugars. Results Cervix: Positive staining for mucins during oestrus was confined to the apical cytoplasm of surface epithelium. During dioestrus and pregnancy, staining extended throughout the supranuclear cytoplasm. During pregnancy, the cervical mucus plug can be identified as positively-stained secreted material. Epithelial cells stained positively for both acidic and neutral mucins. Neutral staining appeared to predominate. With lectin binding epithelial cells stained positive for (α-2,6)-linked sialic acid in the cervices of both dioestrus and oestrus mares. Staining was positive only in low levels in the pregnant mare’s sample. Vagina: The normal vaginal epithelium is non-keratinised stratified squamous epithelium. The epithelial cells are covered by a thin layer of mucus. The author has found no reference to mucus secreting cells in the equine vagina. However, columnar secretory epithelial cells were found on squamous epithelium in the cranial part of the equine vagina. This description is similar to that of the bovine vagina. The columnar secretory cells produced both acidic and neutral mucins. Acidic staining appeared to predominate. The cells stained positively for (α-2,6)-linked sialic acid. Conclusions Previous studies suggest that the cervix is solely responsible for the secretion of mucus in the lower equine reproductive tract. Our histological study suggests that the vagina may play an important role in mucus production such as the formation of the mucus plug of pregnancy. This may be important in ascending placentitis where failure of the mucus plug is thought to be an important factor.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 101 P220 A retrospective study on the effect of prostaglandin and hCG on double ovulation in mares Dalin, AM.1*; Hellström, A.1; Gånheim, A.3, Öhagen, P.2

1Div. of Reproduction, Dept of Clinical Sciences, Swedish University of Agricultural Science, Uppsala, Sweden; 2Div. of Ruminant Medicine and Epidemiology, Dept of Clinical Sciences, Swedish University of Agricultural Science, Uppsala, Sweden; 3Flyinge AB, Flyinge, Sweden During the breeding season at studs, treatment with prostaglandins (PG) to induce oestrus and treatment with hCG to induce ovulation are common. However, it has been reported that PG and hCG can affect the incidence of twin pregnancies. The aim of the present study was to retrospectively study the effect of PG and/or hCG on the incidence of multiple ovulations. Data from manual stud records [identity, breed, age, lactation or not, treatment (PG, hCG, combination PG and hCG), oestrus, ovulation (single, double), pregnancy (single, twin, not pregnant) and type of AI (fresh, chilled, frozen)] was collected on 454 Swedish Warmblood mares (of total 662 mares) including totally 658 oestruses for two different years (I and II). The routines for treatment differed between yrs I and II due to different veterinarians working at the stud. Results: The proportions of lactating mares were 34.6 and 25.7% for the different yrs I and II, respectively. The proportions of young mares (< 6 yrs) were the same for the two years (13%) but differed for old mares (>15 yrs; 27 % and 45 %, resp.). The incidence of treated mares was the same for the two years, 46 %. However, the distribution of the different treatments varied (based on number of treated oestruses, totally 362). Yr I, for PG, hCG and PG + hCG it was 36.7%, 45.7% and 17.6%, and for yr II it was 76.4%, 14.9% and 8.6%. Mares inseminated in more than one oestrus and being both treated and not treated at different oestruses were picked out, i.e. the mares became their own controls when studying results of treatment on double ovulations (175 mares and 272 oestruses for yr I and 160 mares and 228 oestruses for yr II) The proportion of oestruses with double ovulations after “no treatment”, PG, hCG or PG and hCG were for yr I : 6.0%, 21,7%, 7.0% and 9.1% and for yr II 14.8%, 24.1%. 11.5% and 26.7%, resp. PG treatment resulted in the significantly highest incidence of double ovulation compared with no treatment, secondly came PG combined with hCG which differed significantly from untreated yr II. Age and lactation also had a significant influence on the incidence of double ovulations. The incidence of twin pregnancy was also significantly higher in PG treated mares than in non treated, 16.1% and 3.7% for yr I and 12.8% and 8.2% for yr II, resp. Conclusion: this retrospective study of stud records showed that PG treatment for induction of oestrus in mares significantly affected the incidence of double ovulations. The result of hCG differed depending on treatment routines. Also age and lactation significantly influenced. P221 Seasonal effects on follicular sensitivity to IGF-1 in mares Doyle, LK1*; Donadeu, FX1,2 1Easter Bush Veterinary Centre, Royal (Dick) School of Veterinary Studies, University of Edinburgh, Roslin, Midlothian EH25 9RG, UK; 2Roslin Institute, Roslin BioCentre, Midlothian EH25 9PS, UK Insulin-like growth factor-1 (IGF-1) is a key component of the follicle selection mechanism and intrafollicular IGF-1 injection has been shown to promote follicle growth and ovulation in cycling mares. Since equine follicles during the transition into the ovulatory season have reduced IGF-1 activity, IGF-1 administration could potentially be used to hasten the onset of the ovulatory season in mares, provided follicles maintained their responsiveness to IGF-1 during the transitional period. To assess this, follicular sensitivity to IGF-1 was compared between the transitional period (February to April) and the ovulatory season (ovulatory period; June to August) in eight mares. Granulosa cells were collected by ultrasound-guided transvaginal follicle aspiration from small (15-24 mm) or large (25-34 mm) follicles during the two periods and expression of IGF receptor type 1 (IGF-1r), FSH receptor (FSHr) and LH receptor (LHr) was determined by qPCR. In addition, 10 μg recombinant human IGF-1 or

vehicle were injected into the largest follicle (transitional period) or the second largest follicle (ovulatory period) of a follicular wave before the beginning of diameter deviation between the two largest follicles (mean diameters at injection, 19.2±0.3 and 20.0±0.5 mm during the transitional and ovulatory periods, respectively). Follicular fluid was collected 24 h after injection for determination of IGFBPs, Inhibin-A and estradiol levels. Granulosa cells from large follicles expressed higher levels of IGF-1r (P=0.01), FSHr (P<0.007) and LHr (P=0.09) during the ovulatory period than during the transitional period but there were no differences (P>0.1) in receptor expression in small follicles between the two periods. Follicular IGFBP-5 levels were higher (P<0.05) during the ovulatory period than during the transitional period whereas IGFBP-2 levels were not different (P>0.1) between periods or treatments. IGF-1 injection before the beginning of deviation induced a ~2 fold increase (P=0.01) in follicular Inhibin-A levels during each period and did not affect estradiol levels (P>0.1). These results indicated that the sensitivity of equine follicles to IGF-1 before the beginning of deviation during a follicular wave is similar during the transitional period and the ovulatory season. Therefore, IGF-1 administration could potentially be used to induce early ovulations during the transitional period in mares. P222 Inflammatory lesions in the oviducts and its relationship with endometritis and ovarian activity in the Criollo mares Fiala, S1*, Amaral, MG1, Pimentel, CA1, Rodrigues, RF1, Cruz, LA1, Mattos, RC2 1Department of Morphology, Institute of Biology, Brazil ; 2Reprolab., Faculty of Veterinary Medicine, Brazil The oviduct of a mare is 20-30 cm long and runs a tortuous course in the mesosalpinx. Their functions in the mammalian are to serve as a conduct for the oocyte and spermatozoa and to maintain the embryo after fertilization until its arrival in the uterus. Salpingitis is a common disease in domestic animals; especially the cattle, but there are a few reports of inflammatory lesions in the mare’s oviducts. Nevertheless this condition can impair fertility in this species. The objective of this work was to study the frequency of salpingitis in mares and its relationship with endometritis and ovarian activity, particularly in the Criollo breed. With this purpose 150 genital tracts, from Criollo mares sent to slaughter in an abattoir located at parallel 32° south in southern Brazil, were collected once a week in April and from October until December. Ovaries, uterus, cervix and vagina were collected. Ovaries were weighed, dissected, and ovarian structures recorded (corpus luteum and follicles). Mares were considered cyclic, in anestrus or in the transitional period. The oviducts (n=300) and a sample from the endometrium (n=150) were fixed in Bouin solution and processed for histological examination of inflammatory lesions. Inflammatory cells were present in 56.7% (170/300) of the oviducts studied. Bilateral inflammation of the oviducts was observed in the most of the mares (57.4%). Slight inflammation was observed in 74.3% (126/170), moderate in 18.1% (31/170) and severe in 7.6% (13/170). Chronic inflammation was observed in 151 mares (88.8%), acute in 5 (3%), and subacute in 14 mares (8.2%). Endometrial inflammation was detected in 81.3% (n=122) of the mares. However, only 58.0% of the mares showed inflammation of the oviduct and of the endometrium. No correlation was observed between the intensity of the endometritis and the salpingitis. The most of the mares in this study were cyclic mares (69.3%) (104/150), while 28 mares (18.7%) were in anestrous and 18 (12%) were in the transitional period. No differences were observed between the intensity of inflammation and ovarian activity. We concluded that salpingitis in Criollo mares sent to slaughter is frequent and can be a cause of infertility in this species.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 102 P o s t e r A b s t r a c t s P223 Effect of a steroidal anti-inflammatory drug on the viability of equine semen cooled for 24 hours Fioratti, EG*; Melo, CM; Villaverde, AISB; Papa, FO; Alvarenga, MA

Department of Animal Reproduction and Veterinary Radiology - Faculty of Veterinary Medicine and Animal Science, UNESP, Botucatu, Brazil Post-breeding endometritis in mares is related to exacerbated inflammatory process, which is stimulated by the presence of sperm cells inside the uterus leading to the major cause of infertility. The use of ecbolic drugs associated with uterine flushing and AI with reduced sperm quantity provides the most common treatment. Based on efficiency of steroidal anti-inflammatory drugs in minimizing uterine fluid accumulation by its systemic administration and its possible intra-uterine use, the present study aimed to evaluate the effect of adding dexamethasone to the extender on equine sperm viability during two hours of incubation at 37°C and after a 24 hours cooling period. Four stallions from different breeds were collected twice using an artificial vagina, obtaining a total of eight ejaculates. After evaluation of sperm motility and concentration, two aliquots containing 800 x 106 of viable sperm were diluted in a milk-based extender (Botu-Semen®) reaching a volume of 15 mL for each previous diluted aliquot. These samples were re-diluted with 15 mL of Botu-semen® non-supplemented (control group) or supplemented with 2 mg of dexamethasone (treatment group), resulting in a final concentration of approximately 0.067 mg/ mL. One part of the samples from both groups were cooled at 5°C for 24 hours in an equine semen transport box (Botutainer®) and the other part was incubated in a dry-block at 37°C during two hours. Sperm analyses were performed at 0, 30, 60 and 120 minutes following dilution and after a cooling period of 24 hours using CASA and a combination of fluorescent probes to assess plasma (Iodide Propidium) and acrosomal (FITC-PSA) membrane integrity and mitochondrial transmembrane potential (JC-1). Comparing both groups among all evaluated incubation moments, no significant difference (p < 0.05) was observed for total motility, plasma membrane integrity and mitochondrial transmembrane potential. Progressive motility and percentage of rapid spermatozoa values were higher (p < 0.05) in the control group. The treatment group showed lower (p < 0.05) values for VAP at 30 and 60 minutes and higher (p < 0.05) values for percentage of acrosomal membrane integrity at 0 and lower (p < 0.05) at 60 minutes of incubation compared to the control group. The results obtained in 24 hours cooled samples were not different (p < 0.05) between both groups for all parameters mentioned above, except for VAP, which was lower (p < 0.05) for the treatment group. In conclusion, although the treatment group exhibited poor sperm velocity, the steroidal anti-inflammatory drug did not impair sperm viability. P224 The effect of equine growth hormone and its interaction with gonadotropins, estradiol and fetal calf serum on cytoskeleton distribution in equine oocytes matured in vitro Gabriel Pereira, G1*, Liu, IKM1, Carneiro, GF1, Pegoraro, LM2, Lorenzo, PL3 1Population Health and Reproduction, University of California, Davis, UCD, United States; 2Animal Reproduction, Temperate Climate Research Corporation-EMBRAPA, Brazil; 3Animal Physiology Department, Universidad Complutense de Madrid, Spain Microtubules and microfilaments are cytoskeletal components that support cell architecture and modulate cyto- and karyokinesis. We hypothesize that the limited success achieved with in vitro maturation (IVM) of horse oocytes is due to abnormalities associated with cytoskeleton structures. The objective of this research was to investigate the effect and the interactions between equine growth hormone (eGH), estradiol (E2), gonadotropins, and fetal calf serum (FCS) on the IVM and cytoskeleton organization of equine oocytes. Equine oocytes aspirated from each follicle <25-mm in diameter were obtained from euthanatized mares from a slaughterhouse and in vitro

matured for 30 h at 38.5 °C in air with 5% CO2. Selected cumulus oocyte complexes were randomly allocated into experimental groups as follow: a) control (no additives); b) 400 ng/mL eGH; c) 1 μg/ml E2; 5 IU/ml follicle-stimulating hormone (FSH); 10 IU/ml luteinizing hormone (LH); and 10% heat-inactivated FCS; and d) eGH + E2 + LH + FSH and FCS. In vitro matured oocytes were used to evaluate the effect of eGH in the presence or absence of E2, gonadotropins and FCS on oocyte development. Oocytes were stained with markers for microtubules (anti-α-tubulin antibody), microfilaments (AlexaFluor 488 Phalloidin) and chromatin (TO-PRO3). Following incubation with 400 ng/ml of eGH, E2, gonadotropins and FCS, 37.93% of oocytes were classified as mature vs. 17.65% of oocytes in the control group (p=0.05). Incubation with eGH alone showed 40.0% of oocytes reaching maturity when compared with the control group, however no difference after maturation was observed. Microfilaments were distributed throughout the cytoplasm of oocytes as a thin network of filaments and as maturation proceeded, they became concentrated within the oocyte cortex. Microtubules were detected at the metaphase spindle and showed a symmetrical barrel shaped structure with chromosomes aligned along its midline. These configurations were more evident in the majority of oocytes matured in presence of GH + hormones. We conclude that the uses of E2, gonadotropins and FCS in the presence of eGH increase the number of oocytes reaching metaphase-II stage. We also observed that microfilaments and microtubules were seen to reorganize dramatically to enable chromosomal alignment at the metaphase plate of equine oocytes matured in vitro. These findings emphasizes that further studies at the molecular level are needed to understand different oocyte handling procedures, including, IVM, in vitro fertilization, cryopreservation and nuclear transfer in equine. P225 Equine semen quality before and after cryopreservation: search for cryopreservation markers Galli, A*; Vanni, R Istituto Sperimentale Italiano Lazzaro Spallanzani, Milan, Italy Introduction Equine frozen semen has been recently accepted from the major horse breeds associations therefore the interest in breeding mares with frozen semen has been increased. One limiting factor to its use is the reduced fertility of frozen thawed semen in some stallions. The cryopreservation variability among stallions is perhaps the most important problem, because it affects the standardization of semen quality in artificial inseminations centres. The aim of this research is to verify the presence of semen quality markers in ejaculates, useful to predict semen quality after thawing. Materials and methods The research was conducted analyzing 208 ejaculates, collected from 26 stallions reared in two artificial insemination centres. The ejaculates collecting time and semen evaluation and cryopreservation protocols were standardized. The solutions and the extender used were described by Pickett & Amann (Equine Reproduction, Lea&Febiger: 769-789, 1993). Diluted semen was centrifuged for 15’ at 400g, packaged in 0.50 mL French straws, cooled at 0.2°C/min rate and frozen by automatic freezing machine using the same freezing curve. Semen quality was evaluated on gel-free ejaculates (F-) and after thawing (T-). The variables analysed were: mL volume, 106/mL concentration, % total motility (TM), % progressive motility (PM), μm/sec mean velocity (VAP), % normal acrosomes (NA), % membrane integrity (MI) and % acrosome reaction (AR). The methods used were: CASA system for motility, DIC microscopy after fixation with glutaraldehyde for morphology, flow cytometry after propidium iodide and carbossifluorescein diacetate staining for membrane integrity and before and after treatment with Calcium Ionofore and the lectin PSA labelled with phycoerythrin for acrosome reaction. STALLION and EJACULATE effects on semen variables were studied by general linear model. Associations among variables were evaluated by Pearson linear correlation and multiple linear regressions. Results STALLION effect was always present (with the only exception of T-AR), while EJACULATE effect was present for the following variables: F-TM, F-PM, F-VAP, F-AR, T-TM, T-PM, T-VAP, T-MI. The highest association was between F-MI and T-MI

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 103 (r=0.45). There were not multiple linear regressive models with R-square > 0.2. Conclusions No markers of fresh semen quality useful to predict semen quality after thawing were found. P226 Expression of the Cytokines TNFalpha and IFNgamma and their Receptors in the Cyclic Equine Corpus Luteum Galvão, A1*; Silva, E2; Mateus, L2; Korzekwa, A3; Skarzynski, DJ3; Ferreira-Dias G1

1C.I.I.S.A., Department of Physiology, Faculty of Veterinary Medicine, T.U. Lisbon, Portugal; 2C.I.I.S.A., Department of Reproduction, Faculty of Veterinary Medicine, T.U. Lisbon, Portugal; 3Department of Reproductive Immunology, Institute of Animal Reproductive and Food Research of PAS, Olsztyn, Poland Corpus luteum (CL) development is characterized by differentiation and proliferation of cells derived from the postovulatory follicle, and changes in microvascularization. It presents an extremely rapid growth and regression dynamics. This process is controlled by different regulatory factors, such as prostaglandins, growth factors, leukotrienes, cytokines (interferon-gamma - IFNγ, tumor necrosis factor - TNFα, Fas Ligand - FasL) and nitric oxide (NO), among others. The cytokines that are produced locally might have an important role in CL function. Therefore, the main objective of this study was to evaluate the expression of TNFα and IFNγ and their receptors, in equine luteal structures from different stages of the luteal phase. Corpora lutea were obtained post mortem from 16 cyclic mares and classified into early luteal phase CL (Early-CL, n= 5), mid luteal phase CL (Mid-CL; n=6) and late luteal phase CL (Late-CL, n= 5), based on plasma progesterone concentration and ovarian structures. Specific primers for target genes TNFα, IFNγ, TNFα receptor 1 and IFNγ receptor 1, and for housekeeping gene (B2MG), were designed and tested by conventional PCR. After primers optimization, relative quantification of the genes expression was accomplished by Real Time PCR (ΔΔCt method). TNFα expression was four fold reduced in Mid-CL, with respect to Early-CL (p≤0.01), and two fold decreased with respect to Late-CL (p≤0.01). IFNγ presented the lowest expression in Early-CL, increasing afterwards. From Early to Mid-CL a four fold increase for IFNγ was observed (p≤0.01), while from Early-CL to Late-CL there was a nine fold increase (p≤0.01). The expression of TNFα receptor 1 was two fold higher during Early-CL, compared to Mid-CL (p≤0.05) and Late-CL (p≤0.01). IFNγ Receptor 1 did not show a significant variation during the luteal phase. These data suggest that TNFα might play a predominant role during early luteal formation and regression, while IFNγ only shows a significant action during luteal regression. The lack of variation in receptors expression might be explained by the fact that they behave as structural proteins. To the best of our knowledge, these data are the first evidence that both TNFα and IFNγ expression varies in the mare’s CL during the luteal phase. These results suggest an important (auto-, paracrine) role of these cytokines in the regulation of CL function including growth and luteolysis. P227 Endocrinology of the estrous cycle in Miniature ponies Gastal, MO1*; Neves, AP2; Petrucci, BPL2; Mattos, RC2; Beg, MA3; Gastal, EL3; Ginther, OJ1,3 1Eutheria Foundation, Cross Plains, WI 53528, USA; 2Department of Animal Medicine, Federal University of Rio Grande do Sul, Porto Alegre, RS, Brazil; 3Department of Pathobiological Sciences, University of Wisconsin, Madison, WI 53706, USA Information on mare reproductive endocrinology has relied on studies in larger breeds, owing to the lack of scientific study directly in Miniature mares. Considering the small body size (approximately 100 kg) and selective breeding of Miniature mares, direct studies of the endocrinology, as well as other aspects of reproductive physiology, are needed. The purpose of the present study was to characterize the circulating concentrations of FSH, LH, estradiol, and progesterone

during the estrous cycle of Miniature mares. Blood samples were taken daily from 4 days before the first ovulation to 4 days after the second ovulation of the interovulatory interval (IOI). Plasma concentrations of FSH, LH, estradiol, and progesterone were studied daily during 12 IOIs and 21 periovulatory periods in nine Miniature ponies. Assay of ir-inhibin was done only on Days 10 and 18 to represent the days of expected high and low concentrations of FSH, respectively. The peak of the FSH surge that was temporally associated with emergence of the future ovulatory follicle occurred when the follicle was about 9 mm, compared to a reported diameter of 13 mm in larger breeds. The ovulatory LH surge involved a slow increase between Days 13 to 18 (ovulation = Day 0; 0.6 ± 0.1 ng/day), a minimal increase or a plateau on Days 18 to 21 (0.04 ± 0.1 ng/day), and a rapid increase after Day 21 (2.2 ± 0.4 ng/day; P < 0.0001). The end of the plateau and the beginning of the rapid increase in LH occurred on the day of maximum concentration in the preovulatory estradiol surge. An unexpected mean increase and decrease in LH occurred (P < 0.04) on Days 5 to 9. Changes in concentrations of estradiol and progesterone seemed similar to reported results in larger breeds. Concentration of ir-inhibin was greater (P < 0.0001) on Day 18 than on Day 10, consistent with an FSH/inhibin relationship. Apparently, the largest follicle in Miniature ponies begins to produce adequate ir-inhibin for FSH suppression at a smaller diameter than for larger breeds. Results indicated that in Miniature ponies the peak of the FSH surge associated with emergence of the future ovulatory follicle occurred at a smaller diameter of the future ovulatory follicle than in larger breeds, the ovulatory LH surge increased in three phases, and the ovulatory LH surge was followed by an LH increase and decrease during the early luteal phase. P228 Uterine blood flow and perfusion evaluated by color- and power-Doppler ultrasonography in mares with uterine cysts Gastal, EL1; Ferreira, JC2; Ginther, OJ1,2

1Department of Pathobiological Sciences, University of Wisconsin, Madison, WI 53706, USA; 2Eutheria Foundation, Cross Plains, WI 53528, USA Uterine cysts have been described in diverse species of animals, including horses, cattle, ewes, pigs, cats, dogs, elephants, and humans, but the etiopathogenesis of uterine cysts is uncertain. Considering the reports of a high incidence of cysts in older mares and reports of degenerative changes in the uterine artery walls in older mares, there may be a relationship among the presence of uterine cysts and decreased uterine vascular perfusion. Transrectal color- and power-Doppler ultrasonography was used to study uterine blood flow and perfusion in mares with and without uterine cysts. Vascular perfusion of the uterus and blood-flow velocities, vascular perfusion, diameter, circumference, and area of a cross section of the mesometrial attachment were evaluated. To study the effect of internal cysts, two matched groups (cystic and control, n = 21 mares/group) were used. Uterine vascular perfusion in mares with cysts was less (P < 0.0001) in the cystic region than in the noncystic region and less (P < 0.0009) than for controls. The vascular perfusion in the uterine regions without cysts did not differ from the controls. Mares with cysts had lower (P < 0.04) pulsatility index (PI) and greater end diastolic velocity (EDV; P < 0.03) and time-averaged maximum velocity (TAMV; P < 0.05) of the mesometrial vessels than controls. To study the effect of size of internal uterine cystic area, paired mares were arranged in four groups (n = 8-11/group): small uterine cystic area (≤ 275 mm2) versus controls and large uterine cystic area (> 410 mm2) versus controls. A small uterine cystic area did not affect mesometrial blood flow. Mares with large uterine cystic area had lower PI (P < 0.05) and greater PSV (P ≤ 0.05), EDV (P < 0.009), and TAMV (P < 0.005). To study the effect of age in mares that were not bred during the last 10 yr, old versus young mares without cysts were compared (n = 11/group). Old mares had greater EDV (P < 0.02) and TAMV (P < 0.01) than young mares, but uterine vascular perfusion was not affected by age. Results demonstrated, for the first time in any species, reduced uterine vascular perfusion in uterine segments that contained cysts and a positive association between size of the cystic

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 104 P o s t e r A b s t r a c t s area and disturbed uterine hemodynamics at the mesometrial attachment. P229 Effect of protein source in stallion semen diluent on the motility, acrosome integrity and morphology of sperm Gibb, Z1*, Morris, L2, Grupen, C1, Evans, G1, Maxwell, C1 1Faculty of Veterinary Science, The University of Sydney, Sydney, Australia; 2EquiBreed Ltd., Cambridge, New Zealand Introduction Most stallion semen diluents utilise skim milk to provide protective proteins for sperm. However, milk based diluents impede sperm motility assessments and reduce the effectiveness of staining procedures used to process sperm for flow cytometric sorting. In addition, the variable protein levels and the presence of unidentified toxic products in milk may vary results. Therefore, a more precisely defined diluent protein composition is needed. The aim of this study was to ascertain the optimal source of protein in a traditional stallion semen diluent, Kenney’s Modified Tyrode’s1 (KMT) Medium, for handling and processing stallion sperm prior to flow cytometric sex-sorting. Methods and Materials Two ejaculates were collected from each of three Standardbred stallions. Each ejaculate was diluted in traditional KMT that contained skim milk or KMT without skim milk and supplemented with 0.25mg per ml of either bovine serum albumin (BSA), β-lactoglobulin, glycine or fetal bovine serum (FBS). Diluted semen samples were incubated at 34ºC or 5ºC. Subjective motility, acrosome integrity and morphology were assessed over a 24 h period. Results and Discussion After incubation for 3 h at 34ºC, there was no significant difference between the diluents for total motility, progressive motility or acrosome status of spermatozoa. After incubation for 24 h at 34ºC in KMT, there was a lower incidence of sperm tail abnormalities compared with the other diluents (9.3 vs. 23.2 – 24.5 %; p<0.05). There were no significant differences between the diluents for the motility parameters of sperm stored at 5ºC at any of the time points examined. The glycine-based diluent increased the incidence of acrosome damage compared with KMT containing skim milk, FBS or BSA (40.3 vs. 27.6 - 34.9%; p<0.05). At 5ºC there were no significant differences between diluents for the proportion of sperm displaying morphological abnormalities. These findings indicate that at the concentrations investigated, skim milk proteins provide the most suitable protection for stallion sperm. However, further studies are required to determine the optimal concentration of each protein source. P230 GH-IGF system and insulin in plasma and preovulatory follicles of well fed or restricted mares Guillaume, D1*, Chaboche, S2, Salazar-Ortiz, J2, Leveau, M2 1Animal Physiology, UMR 6073 INRA-CNRS-HN-Univ. F. Rabelais de Tours, France; 2UMR 6073 INRA-CNRS-HN-Univ. F. Rabelais de Tours, France We have previously demonstrated that the follicular growth is more active in fat than in thin mares. This difference is associated to insulin like growth factors (IGF) system. IGF system is composed by IGF-I , IGF-II and 6 binding proteins (IGFBPs), which modulate the action of the IGFs. An enzyme, PAPPA, is able to degrade certain IGFBPs and locally liberate IGFs. The aim of this experiment was to describe the variations of IGF-I and –II, IGFBPs, GH, insulin, LH, FSH and progesterone (P4) in blood and in preovulatory follicle in relation with the feeding level in mare. Non-lactating Welsh pony mares (n=19) were assigned in a restricted (R) or in a well fed (WF) group, from 3 years prior to the experiment. Follicular development was daily scanned. Follicular fluid (FF) of preovulatory follicles was collected by ultrasound-guided follicular aspiration. Blood samples were collected daily. Plasma and FF samples were assayed for insulin, IGF-1, IGF-2, GH, LH, FSH and P4 with validated radioimmunoassay and IGFBPs with Western ligand blotting. The number of total follicles in the R group was 53% lower than that in the WF group. The follicular growth of the dominant follicle did not vary between the 2 treatments. Insulin and IGF-I concentrations were systematically higher in WF mares than in R mares. Interestingly, in WF animals group, we found

that the intrafollicular concentrations of insulin were higher than those of the plasma. GH concentrations were higher in plasma of R mares than in plasma of WF mares but the difference is not significant in FF. IGF-II concentrations were higher in FF of R mares than in FF of WF mares but the difference is not significant in plasma. IGFBP-2/IGFBP-3 ratios were not affected by the feeding in FF, but they were increased by the feed restriction in plasma. In R mares, IGFBP-2/IGFBP-3 ratios were dramatically decreased in FF in comparison with plasma. No difference was found on LH concentration but FSH concentrations were increased in plasma of R mares. P4 concentrations were not affected by the feeding but were higher in follicular fluid than in plasma. Overall, chronic under nutrition in mares affects recruitment and selection process of ovarian folliculogenesis by the decrease in IGF-I and insulin concentrations and in the bioavailability of the IGFs in plasma and in follicular fluid. P231 First vaginal hysterotomy in a mare Guvenc, K*; Kilicarslan, MR; Senunver, A Department of Obstetrics and Gynecology, Faculty of Veterinary Medicine, University of Istanbul, Avcilar- Istanbul Turkey Introduction Five percent of the more serious equine dystocia are of maternal origin, and mainly uterine torsions. About half of torsions occur during parturition, the other half from 7.5 months of gestation until term. A number of surgical and non-surgical techniques have been described for the correction of equine uterine torsion. However, the prognosis for the survival of mares and foals after uterine torsion is 60-70% and 30-70%, respectively. In this report, we describe for the first time a different approach in the management of a mare with uterine torsion. Materials and methods A 6-year old Thoroughbred mare that had not been able to foal despite of ~18 h labour contractions was examined for dystocia in a horse boarding house located in a village 90 km north to the Istanbul. The mare was in full term, with no history of known recent health problems, and had foaled two times earlier without assistance. Amniotic waters did not leak out, and the mare had periodic contractions throughout all night rolling sometimes in the stable, and no one assisted the mare to resolve the dystocia during the past one night. Upon arrival, the mare was lying in her stable, sweating, and with forceful labour contractions. The foal was found alive in transrectal palpation. In the vaginal palpation, the cervix was found closed, and a vaginal rupture of ≅ 7cm was diagnosed in the right vaginal fornix dorsolaterally to the cervix. Through the rupture, 4 fingers could be passed into the abdominal cavity and the foal’s feet could be palpated at each straining, the rupture was assed to be 10 cm far away from the cervical opening lying on the symphsysis pelvis left to the median line. A counter clockwise uterine torsion of undetermined degree was judged to be the reason for the closed cervix based on the twist in the cranial vagina. A decision of vaginal hysterotomy was made to deliver the foal. Neither sedatives nor epidural anesthesia were applied. Abdominal cavity was reached through the vaginal rupture by the right hand. One of the legs of the fetus was caught and pulled into the vaginal cavity. The uterus was incised and the foal in longitudinal posterior presentation was delivered alive pulling from its legs in the rhythm of contractions. Neither the uterine nor the vaginal wall was sutured. Placenta was expelled spontaneously ~ 5 h following the operation. The mare was given broad spectrum antibiotics for 10 days combined with flunixin meglumine and oxytocin for the first two days. Results and Discussion The foal was delivered alive, and the mare completed the postpartum period better than expected, conceived and foaled again without assistance. The idea of performing vaginal hysterotomy was totally incidental and was possible because we were able to palpate the uterus through the vaginal rupture. The good long and short term results without suturing the tears and incisions in the uterus and vagina are surprising. In emergency situations in field circumstances, where aseptic surgery and general anesthesia are not possible, this inexpensive and quick technique gives an option to save the life of the mare and the foal.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 105 P232 Fertility of Thoroughbred stallions with special respect to their use as dual-hemisphere (shuttle) stallions Aurich, C1, Höhndorf, U2* 1Dept. for Animal Breeding and Reproduction, Centre for Artificial Insemination and Embryo Transfer, Austria; 2Veterinaermedizinische Universitaet Wien Thoroughbred stallions with a high genetic potential are often used for breeding on the northern (NH) and southern hemisphere (SH) in the consecutive breeding seasons of the same year. These stallions are called shuttle stallions. It was the aim of this study to compare fertility data of shuttle stallions to data of stallions that were just used for one breeding season, i.e. on one hemisphere. Data from the breed registries of Argentina, Australia, Great Britain/Ireland, New Zealand and the USA on number of covered mares per stallion, number of live foals per stallion and the rate of live foals per stallion and season were statistically compared. Data from a total of 6686 stallions (year 2005) were included, 144 of them were used for breeding in at least one country of the NH and the SH in that year and thus were defined as shuttle stallions. In the shuttle stallions, the number of covered mares (62.4±3.1), live foals (42.7±2.2) and live foal rate (69.5±1.3%) per season (average of the two breeding seasons in 2005) was significantly (p<0.05) higher than in non-shuttle stallions (average of one breeding season in 2005). In non-shuttle stallions, respective values were 16.9±0.3, 10.0±0.2 and 49.9±0.4%. When data of stallions used for breeding on the NH and SH were compared independently from their status as shuttle or non-shuttle stallion, stallions on the SH had a significantly higher number of covered mares (NH: 18.8±0.5, SH: 23.5±0.8, p<0.05), live foals (NH: 11.4±0.5, SH: 14.7±0.6, p<0.05) and a significantly better live foal rate (NH: 50.4±0.5, SH: 52.1±0.6, p<0.05). In contrast, shuttle stallions during their season on the NH covered a significantly higher number of mares (NH: 83.9±5.0, SH: 61.4±4.2, p<0.05) and produced a significantly higher number of live foals (NH: 57.0±3.7, SH: 42.1±3.0, p<0.05) than on the SH. However, no differences in the life foal rate of shuttle stallions during the breeding season on the NH (67.1±1.5%) and SH (65.2±2.1) could be detected (n.s.). It can be concluded that the use of stallions for breeding during two consecutive breeding seasons in the same year and their transfer from one hemisphere to the other has no negative effects on fertility. Apparently, an excellent management of shuttle stallions results in above-average reproductive performance. P233 Lack of association between low vitamin E levels and retentio secundinarum in Belgian Draught Horses (BDH) and Warmblood (WB) mares Govaere, J; Hoogewijs, MK*; De Schauwer, C; De Vliegher, S; Saey, V; de Kruif, A Department of Reproduction, Obstetrics and Herd Health, Faculty of Veterinary Medicine, Ghent University, Belgium Introduction In the Belgian Draught Horse (BDH) population, a high prevalence of retained placenta (RP) has been reported (Vandeplassche et al. 1972). In cattle, low serum vitamin E serum levels were shown to play a role in the pathogenesis of RP (Leblanc et al. 2002). The objective of this study was to evaluate whether a similar association could be observed in BDH mares. Methods Blood samples were collected from 10 BDH mares and 9 Warm Blood (WB) mares, foaling without any complications. All mares were housed in boxes for at least one month before foaling and were without known history of RP. They were fed with grass silage and hay and WB mares were supplemented with concentrates. All mares foaled between March 1st and the 1st of May. Blood samples were obtained from the jugular vein within 1 h of foaling (Vacutainer Systems; Becton Dickinson & Co, Franklin Lakes, NY, USA) and were centrifuged at 2000g. Serum was stored at -18°C to be processed for α tocopherol (high performance liquid chromatography, HPLC). The mares were diagnosed as suffering from hypovitaminosis when serum levels were below 3 mg/ml vitamin E. RP was defined as the

failure to expel all or a part of the foetal membranes within 3h after delivery of the foal (Sevinga et al. 2002). Statistical analysis was done using the Mann-Whitney U test. Results Only two out of ten BDH mares and none of the WB mares had low vitamin E levels. Five mares out of the ten BDH suffered from RP (50%), only one of them having a slightly lowered serum vitamin E concentration (2.3 mg/ml). In the WB group 30% (3/9) suffered from RP, but all WB mares had sufficient serum vitamin E concentrations. Conclusions The absence of significant differences in blood vitamin E concentration between the RP mares and mares that expelled the placenta in time is different from the findings in cattle (Leblanc et al. 2002). Possible explanations might be the limited numbers of mares included, breed differences, species differences and/or the timing of blood sampling. P234 Sperm chromatin integrity in fractionated stallion ejaculates Kareskoski, M1*, Johannisson, A2, Rodriguez-Martinez, H2, Katila, T1 1Faculty of Veterinary Medicine, University of Helsinki, Finland; 2Faculty of Veterinary Medicine and Animal Science, SLU, Sweden The sperm chromatin structure assay (SCSA) measures the susceptibility of sperm DNA to acid-induced denaturation, which is inversely correlated to fertility. Stallion ejaculates are formed by several consecutive fractions of different composition. This study compared sperm chromatin quality in three different semen fractions using SCSA, and evaluated the effect of seminal plasma (SP) on spermatozoa during storage. Ejaculates from 43 stallions were collected as three fractions: (FR1) sperm-rich fractions with possible pre-ejaculatory fluid, (FR2) the latter portion of the sperm-rich fraction and (FR3) the last portion of the ejaculate with low sperm concentration. After collection, 2 x 106 spermatozoa from each fraction were extended in TNE-buffer and frozen in LN2 (samples frozen before storage, SP0). Two samples from each fraction were diluted 1:1 with Kenney extender and centrifuged (500g, 10 min). The supernatant was removed and one of each centrifuged sample was re-suspended in only Kenney extender (samples stored without seminal plasma, SP-), and the other in a mixture of extender and supernatant (samples stored with seminal plasma, SP+). During storage, the ratio of SP to extender was 1:2 and the sperm concentration was 50x106 sperm/mL. Samples were frozen in LN2 after storage (+5ºC, 24 h). The susceptibility of sperm DNA to denaturation was measured using SCSA. Sperm DNA fragmentation index (DFI) was calculated by dividing the amount of red fluorescence (abnormal spermatozoa, denatured DNA) by the total (red plus green) fluorescence, indicating the amount of denatured sperm DNA over total DNA. Differences in %DFI between fractions and storage groups were analyzed using nonparametric tests. There were significant differences between fractions in the SP0 and the SP- samples. The %DFI values were lowest in FR1 (15.7±2.4% before storage, 18.3±1.4% after storage) and highest in FR3 (19.2±2.9% before storage, 26.8±2.2% after storage). The differences between fractions in the SP+ samples were non-significant. The differences in %DFI between storage groups (SP0, SP- and SP+) were significant in all fractions. The highest values were found in the SP+ samples (26.4±2.1% in FR1, 29.5±2.5% in FR2 and 30.4±2.8% in FR3). SP has negative effects on chromatin quality during storage. However, spermatozoa in the first sperm-rich part of the ejaculate are the least susceptible to DNA damage by denaturation, suggesting that differences in the ratio of SP to sperm or the composition of SP in the different fractions may be related to these findings.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 106 P o s t e r A b s t r a c t s P235 Prolactin Activity During the Follicular Phase in the Mare: Evidence of an Extra-Pituitary Prolactin Source King, SS1*, Roser, J2, Jones, KL1 1Southern Illinois University Carbondale, IL; 2University of California, Davis, CA Prolactin (PRL) activity in the equine follicle has been documented in the form of PRL receptors on the corpus luteum1 and PRL in the follicular fluid2 (FF). The objective of this study was to identify locations and possible sources for PRL in the follicular phase ovary. Circulating PRL concentrations were analyzed from three studies (61 cycles, 17 mares). Plasma PRL was determined by homologous double antibody RIA3. PRL concentrations around ovulation (0-1d postovulation) were compared with the early luteal phase (2-10 d). The granulosa/theca layer was removed postmortem from anonymous mares (n=10) and stored frozen (-80°C). Equine pre-PRL mRNA was extracted and prepared for quantitative PCR using primers and reaction conditions previously described4. Equine pituitary mRNA was used to generate a standard curve from which concentrations of pre-PRL mRNA transcripts were determined. Presence of PRL in ovarian structures was determined by immunohistochemistry (IHC). Whole ovaries (n=6) from cycling mares were fixed in 4% paraformaldehyde, embedded in paraffin and cut into 5 um sections. Sections were incubated with R4 PRL rabbit anti-porcine first antibody (DL Thompson, Louisiana State Univ) and goat anti-rabbit IgG-biotinylated (avidin-biotin complex) second antibody. Slides were developed with DAB chromagen-Ni and counterstained with nuclear fast red stain. Equine pituitary served as a positive control. Plasma PRL demonstrated a short-term (1-2 d) increase (P=0.001) around ovulation. Equine pre-PRL mRNA was detected in all granulosa/theca samples in concentrations inversely correlated to follicle size (P<0.05). Granulosa/theca from smaller, growing follicles (≤ 20 mm or 21-34 mm) had greater transcripts than pre-ovulatory follicles (≥35mm). IHC revealed PRL staining in the granulosa and in vascular structures around the follicles. Prior research indicates FF PRL concentrations increased in small and medium sized follicles and plateaued in large follicles2. This FF PRL pattern is consistent with the quantity of mRNA coding for PRL production in the granulosa/theca measured in the present study. IHC localization confirms the presence of PRL not only in the FF, but in the cellular layers surrounding the follicular antrum. Collectively, these results suggest that the equine follicle is a site of PRL synthesis, and that PRL accumulates in the FF during estrus. The release of this fluid into the peritoneal cavity at ovulation may contribute to the short-term increase in circulating PRL concentrations measured at this time. The influence of local PRL on ovarian function remains to be elucidated. P236 Effects of an antiinflammatory treatment on pregnancy rates, endometrial histology and hormone profiles after transcervical embryo transfer in the mare Koblischke, P1*; Witte, T1; Budik, S1; Walter, I2; Hoppen, HO3; Kindahl, H4; Aurich, C1

1Dept. Animal Breeding and Reproduction, University for Veterinary Sciences, Vienna, Austria; 2 Dept. Pathobiology, University for Veterinary Sciences, Vienna, Austria; 3Section for Chemical Analysis and Endocrinology, School of Veterinary Medicine, Hannover, Germany; 4Dept. for Obstetrics and Gynaecology, Swedish University of Agricultural Sciences, Uppsala, Sweden

The objective of the study was to evaluate the influence of an antiinflammatory treatment on pregnancy rates, endometrial histology and hormone profiles after transcervical embryo transfer. Embryo recovery and transfer were performed on day 7 after ovulation of the donor mare. Recipient mares were divided into three groups (n=9 per group) dependent on the antiinflammatory treatment: Group M (meclofenamic acid 1g per day orally), Group F (flunixin meglumine 1,1mg per kg/twice daily i.v.), Group C (control, 10ml 0.9% NaCl once daily i.v). Treatment was performed from one day before to 4 days after transcervical embryo transfer. On day 4 after transfer, embryos were recovered from the uteri of the recipient mares and an

endometrial biopsy was collected for histological analysis. Blood samples for determination of progesterone and 15-keto-13, 14-dihydro-PGF2α (PGFM) were collected from 1 hour before to 4 days after embryo transfer. Four embryos were recovered from group M and 3 embryos from group F and C, respectively (n.s.). Histological examination of the endometrial biopsies showed a significantly higher number of polymorph nuclear neutrophils per microscopic field in group C (13.5±5.6) when compared to M (1.6±0.6) and F (1.4±0.2, p<0.01). In 3 mares of group C, luteolysis without signs of clinical endometritis occured between days 2 and 4 after transfer (decrease of progesterone to <1.0 ng/ml), but in no mare of groups M and F. PGFM release in group C increased significantly after 48 hours when compared to constant low levels in group M and F (e.g. 96h after transfer: group C: 316.3±153.1 pg/ml, M: 17.5±11.5 pg/ml, F: 36.3±14.1 pg/ml, p<0.05). It can be concluded that an antiinflammatory treatment of recipient mares with meclofenamic acid or flunixin meglumin results in inhibition of an endometrial inflammatory response after transcervical transfer. The treatment thus prevents a subsequent release of PGFM and preterm luteolysis. This study was supported by the Austrian Ministry for Agriculture (BMLFUW). P237 Chemical enucleation of equine oocytes destined to nuclear transfer using different concentrations of Demecolcine Fernandes, CB1; Martins, LR1; Devito, LG1; Rascado, TS1; Saraiva, NS2; Garcia, JM2; Landim-Alvarenga, FC1* 1FMVZ – UNESP, Botucatu, Brazil; 2FCAV – UNESP, Jaboticabal, Brazil Introduction During mechanical enucleation, for production of cytoplasts destined to nuclear transfer (NT), the exposure to fluorescent light and the removal of an excessive amount of cytoplasm can damage the oocyte. Alternatively, Demecolcine can be used for chemical enucleation minimizing the damage. This experiment aimed to establish a dose/response trial using tree different concentrations of Demecolcine for chemical enucleation of equine oocytes. Methods Equine oocytes were obtained from slaughterhouse ovaries and matured (IVM) in 4 well dishes with 400μl HTF:BME (1:1) media with 0.3% BSA, 100ng/ml IGF-1, 50ng/ml EGF, 100ng/ml eGH, 5μg/ml eFSH, 500ng/ml estradiol and 75µg/ml gentamicin at 5% CO2 in air at 38. 5oC. Nuclear maturation was evaluated with Hoechst 33342. After 30 hours of IVM, the oocytes were striped and treated with 0.05 μg/mL, 0.1 μg/mL and 0.2 μg/mL of Demecolcine for 2 hours. Three replicates were made with 20 oocytes/group/replicate. The oocytes were selected in an inverted microscope, by the presence of the 1st polar body (PB) and a protrusion containing the metaphase plate (MII). The nuclear material inside the protrusion was confirmed by staining the oocytes with Hoechst 33342. For statistic analysis Fisher test was used (p<0.05). Results The MII rate observed in non treated oocytes was 30%. The percentage of equine oocytes that presented a visible PB associated with a protrusion after Demecolcine treatment was 34 %, 30.6 % and 44.9 % (p=0.07) for 0.05 μg/ml, 0.1 μg/ml and 0.2 μg/ml respectively. No statistics differences were observed among treatments, but compared with the maturation rate of the control group, the use of Demecolcine in higher doses were more efficient for the detection of the PB and MII. Conclusions The results showed that the use of Demecolcine is a viable method for preparing equine oocytes for NT. Although no differences were observed between treatments, the higher dose presented a tendency (p=0.07) for superiority. However further experiments are needed to verify the effect of the Demecolcine dose in the developmental competence of treated oocytes. Acknowledgments FAPESP (Grant 04/00822-1), Santa Fe Slaughterhouse, Dr. Gercio Bonesi, Ms Carla Fredrichsen Moya and Ms Gustavo H. M. Araújo.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 107 P238 Immunocytochemical localization of leptin (Ob) and leptin receptor (Ob-R) in preovulatory and in vitro matured horse oocytes related to prepuberty and different weight breeds Lange Consiglio, A1*, Arrighi, S2, Bosi, GP2, Aralla, M2, Cremonesi, F2 1Veterinary Clinical Sciences, Reproduction Unit, University of Milano, Faculty of Veterinary Medicine, Italy; 2Department of Veterinary Science and Technologies, University of Milano, Faculty of Veterinary Med, Italy The onset of puberty in humans and animals is associated with an increase in fat and consequent increase in circulating leptin, suggesting that leptin may be required for normal growth and development of reproductive organs. Moreover, leptin amount in the blood is proportional to body energy stores and/or body mass, so, inadequate nutrition might impair reproductive function leading, for example, to the delayed onset of puberty. A similar relationship between nutrition and reproductive efficiency is not understood in the mare where, besides many reports quantifying the correlation of circulating concentration of leptin with body condition scores, only few informations exist about the presence of leptin (Ob) and leptin receptor (Ob-R) in the ovary or in the oocyte. Taking this into account, we carried out an immunocytochemical study to investigate the presence of Ob and Ob-R in compact cumulus oocytes recovered from fillies and from mares of light or heavy body weight breeds after slaughtering during the autumnal transition. The occurrence of immunofluorescence was determined by scanning laser confocal microscopy in oocytes immediately upon collection and after in vitro maturation (IVM) using monoclonal antibody conjugated to a fluorescent label. IVM was accomplished in TCM199 supplemented with 1 mM pyruvate, 0.1 IU LH, 0.1 IU FSH, 100 ng IGF, 50 ng EGF, 1 µl ITS and 1 µl estrogen per ml. Oocytes were incubated for 40 h at 38°C at 5% CO2. Both Ob and Ob-R, detected in immature oocytes of all kinds of animals analyzed, were uniformly distributed throughout the ooplasm, but the intensity of reaction was lower either in light weight mares or in fillies oocytes, than in oocytes of heavy weight mares. After IVM, heavy breed mares had a higher proportion of oocytes that reached metaphase II than light mares and fillies (35.53±2.71%, 19,84±1.48% and 15,82±1,52 respectively; P<0.05). In matured oocytes both Ob and Ob-R were localized to the oocyte cortex and concentrated at one pole of the oocytes. This distribution within the oocytes was indipendent from animal group and once again with lower intensities in light mares and in fillies. The results of the present study support the hypothesis that, also in the horse, leptin is differently localized during oocytes IVM showing diverse immunoreaction intensity related to the kind of horse breed and to the reproductive pubertal development. Moreover, leptin may be involved in the determination of the animal pole of the oocyte and in the establishment of the inner cell mass and trophoblast in the embryo. P239 Equine semen cryopreservation using previously cooled sperm diluted with two different extenders Lorenzoni, SLG*; Zarabanda, YP; Faria, MB; Silva, AEF; Silva, DS and Rodrigues, JL Laboratory of Embryology and Biotechnics of Reproduction, Faculty of Veterinary Medicine, Federal University of Rio Grande do Sul, Porto Alegre, RS, Brazil Introduction Frozen stallion semen is commonly associated with poor quality and decreased pregnancy rates as compared with those produced during normal mating or with cooled semen techniques. The aim of this experiment was to investigate the progressive motility of stallion spermatozoa after previous cooling and freezing using INRA82 or a lactose egg-yolk based semen extender in presence of two glycerol concentrations. Material and Methods During October 2007 nine ejaculates from 3 stallions obtained by artificial vagina with sperm progressive motility higher than 70% were used in the experiment. After each semen collection, the ejaculate was initially evaluated for total volume, gel-

free volume, sperm concentration and progressive motility. First the semen was diluted (1:2) using a modified Kenney extender, after that transferred into 8 plastic conical tubes, and then centrifuged at 400 x g during 10 min. The supernatant of each tube was removed and the pellets were ressuspended with one of the following extenders: E1 = INRA82 + 4% glycerol; E2 = INRA82 + 5% glycerol; E3 = 11% lactose + 20% egg-yolk + 4% glycerol; E4 = 11% lactose + 20% egg-yolk + 5% glycerol, adjusting the sample concentration to 200 X 106 spermatozoa/mL. After that, the ressuspended semen from each extender was loaded in 8 straws (0,5 mL), from which 4 were immediately frozen (F) by exposure to liquid nitrogen vapor during 15 min and finally stored into liquid nitrogen. The remaining four straws were cooled (PC) from room temperature (+24°C) at 0,25°C/ min to 5°C. After holding the straws during 15 min at 5°C they were submitted to the same freezing treatment as described above. All sperm samples were thawed at 37°C during 30 seconds and progressive motility was immediately assessed. Data were analyzed via analyses of variance and T- Student test. Results: The sperm samples subjected directly to the freezing process showed immediately after thawing the following progressive motility: FE1: 29.44%; FE2: 26.67%; FE3: 27.22% and FE4: 24.44%. The post thawing progressive motility of the samples submitted to previous cooling before freezing was: PCE1: 43.89%; PCE2: 43.33%; PCE3: 44.44% and PCE4: 41.11%. Conclusion The data showed that the previously cooled sperm samples resulted in significantly higher spermatozoa progressive motility rates after thawing (P<0.05), when compared with those directly frozen. There were neither differences in the observed spermatozoa progressive motility rates among the extenders nor among the glycerol concentrations. P240 Characterization of pre-ovulatory uterine environment in mares Melo, CM*; Papa, FO; De Vita, B; Zanh, FS; Dell’Aqua Jr., JA; Alvarenga, MA Faculty of Veterinary Medicine, São Paulo State University, Botucatu-Brasil Introduction Healthy uterine environment offers ideal conditions to sperm transport to fertilization site and subsequent embryo development. Uterine fluid is important to sperm capacitation, fertilization, embryo development and the beginning of gestation and also contains substances responsible for immune defense, as chemoattractants and immunoglobulins. The aim of the present study was to evaluate uterine environment of mares at pre-ovulatory period. Material and methods Twenty-five samples were collected from mares at Animal Reproduction and Radiology Department and at Lageado Farm from FMVZ – UNESP/Botucatu. Rectal ultrasonographyc examinations were made, and if corpus luteum was detected, estrus was induced with prostaglandin. Samples were collected when mares presented a 35mm follicle, associated to uterine edema grade II-III. Uterine swabs for antibiogram were collected, followed by samples for uterine cytology. Uterine swabs were maintained in Stuart medium, cultured on ovine blood agar (5%) and MacConkey agar, then maintained under anaerobic conditions at 370C for 72 hours. A cotton tampon (o.b.®-Johnson&Johnson) was introduced into uterine body and maintained for one hour in order to obtain uterine fluid (UF). After this period, tampons were removed with a 20mL seringe then compressed and the resultant UF was transferred to 15mL tubes. Immediately after collection, pH and osmolarity of UF were evaluated. Mares were separated into two groups – normal and endometritis - according to the results of microbiologic culture and uterine cytology. Values of UF volume, pH, osmolarity and percentage of neutrophils were analyzed by ANOVA, followed by T test. Results and discussion Uterine fluid volume, pH and osmolarity were similar between groups (3,42 vs 4,6; 7,62 vs 7,62 and 281,13 vs 285,8, respectively for normal and endometritis mares). However, the percentage of neutrophils on uterine cytology was higher on mares with endometritis than on normal mares (29,4 vs 1,46%, p<0,001). Conclusion As the present results evidenced no differences on pH and osmolarity between normal and endometritis mares, but did evidence an increased number of neutrophils inside the uterus of

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 108 P o s t e r A b s t r a c t s problem mares, one may conclude that uterine cytology is the first choice exam to detect endometritis in mares. Acknowledgements: FAPESP 05/53112-4 and FAPESP 06/59003-5. P241 Sperm morphology variation of stallion ejaculates in different breeding seasons Morrell, JM*, Dalin, AM and Rodriguez-Martinez, H Division of Reproduction, Dept of Clinical Sciences, SLU, Box 7054, 75007 Uppsala, Sweden Previous reports have described seasonal variation in the proportion of stallion spermatozoa with normal morphology but there is a paucity of data on variation between different years. The present report is a retrospective analysis of morphology evaluations from 8 stallions over several years. The stallions were all from a commercial stud (Flyinge AB, Flyinge, Sweden). Three or four ejaculates were collected from each stallion under a three-week period in June 2006. Aliquots of each ejaculate were used to prepare air-dried stained smears or fixed in formol saline for later evaluation as wet smears, using the procedure described by Lagerlöf. The evaluation of sperm morphology was performed by skilled, experienced technical personnel at SLU. The proportion (%) of morphological spermatozoa was estimated and used to establish a 95% confidence interval (CI) for normal morphology for these stallions. Analyses were also available for individual ejaculates from the same stallions in previous years and in 2007. The results from other years were compared with the 95% CI for 2006: if the results lay within the 95% CI, they were considered not to be significantly different from the 2006 values; if they lay outside the 95% CI, they were considered to be significantly different. Therefore, of the 21 evaluations made in years other than 2006, 12 were outside the 95% CI and were considered to be significantly different from the 2006 means. Of these, 10 were higher than the 95% CI, whereas two were lower. However, nine ejaculates were not statistically different from the 2006 mean values. Interestingly, stallion R showed a steady decrease in the proportion of spermatozoa with normal morphology over 13 years. In conclusion, considerable variation in normal morphology occurs between ejaculates from any individual stallion in different breeding seasons, and this difference varies among stallions. Acknowledgments: Funded by the Swedish Equine Research Organisation, Stockholm. We thank Karen Selin-Wretling and Annika Rikberg for their skilled sperm morphology analysis, and Flyinge AB for semen samples. P242 Impact of a single administration of hcg on free thyroid hormone levels in mares at oestrus Mutinati, M*, Rizzo, A; Nicassio, M; Matarrese, R; Spedicato, M; Minoia, G; Lacalandra, GM; Sciorsci, RL Department of Animal Production, Faculty of Veterinary Medicine, Bari, Italy Human chorionic gonadotropin (hCG) is a glycoprotein hormone sharing a high structural resemblance with the molecule of the thyroid stimulating hormone (TSH). Furthermore, the extracellular domain of the LH/CG receptor and TSH receptor, share 45% homology. The aim of the study was to evaluate the effect of a single intra-muscular administration of hCG, on serum concentrations of free triiodothyronine (fT3) and free thyroxine (fT4) in mares. Twenty healthy, adult mares in oestrus, were divided in two groups: group A consisting of 10 subjects, treated with 5 ml of sterile saline solution, (NaCl 0.9%); group B consisting of 10 subjects, treated with 4000 I.U. of hCG (Chorulon®, INTERVET). All mares underwent 7 blood collections: T1, contextually to drug administration; T2, T3, T4, 2, 6 and 24 hours after drug administration, respectively; T5, T6, 3 and 6 days after drug administration. All mares were inseminated with refrigerated semen belonging to the same, proved stallion, soon after T3 and underwent a pregnancy diagnosis 14 days after insemination. Dosages of fT3 and fT4 were performed on all the blood samples collected, with immunoenzymatic competitive kits (EIA WELL®, RADIM, Pomezia, Italy). Data were statistically analyzed with chi squared, one way ANOVA and Student’s t-test. The conception rate

of group A was 40%, whereas in group B it reached 80% (p<0.05). The concentrations of fT3 didn’t show any statistically significant difference within and between the groups, at all times considered. As for fT4, at T4 and T6 a statistically significant difference was found between the two groups (p<0.05). In both groups, fT4 concentrations maintained a constant trend until T2 (group A) and until T3 (group B) and then they decreased. In group A, this decline gave rise to a statistically significant difference between T2 and T4 (p<0.05). These results show that in the group treated with hCG higher levels of fT4 were detected and that the decrease in its concentrations was postponed, in comparison with the control group. This may be due to the thyreotropic action exerted by hCG on thyroidal TSH receptors. Thus these results may suggest a positive correlation between hCG and fT4 concentrations and eventually they may attest the influence exerted by fT4 on conception rate (group B). Free thyroid hormones were in fact shown to be involved in the ovulation process, in the synergism with FSH to induce the expression of LH receptors and synthesis of progesterone in granulosal cells. Besides, thyroid receptor α1 and α2 were recently detected in rat uteru s and oviduct (epithelium, muscular layer, basal portion of cilia), suggesting free thyroid hormones to be co-inducers of the fertilization process. P243 Follicle dynamics in Miniature ponies Neves, AP1,2*, Gastal, EL3, Mattos, RC2, Petrucci, BPL2, Gastal, MO4, Ginther, OJ5 1Faculty of Veterinary Medicine, Região da Campanha University (URCAMP), Bagé –RS, 96400-110, Brazil; 2Department of Animal Medicine, Federal University of Rio Grande do Sul, Brazil; 3Department of Pathobiological Sciences, University of Wisconsin, Madison, United States; 4Eutheria Foundation, Eutheria Foundation, Cross Plains, WI, United States; 5Department of Pathobiological Sciences, University of Wisconsin, Madison, United States Interest in Miniature ponies/horses has grown during the past 10 years. The Miniature horse industry has over one hundred thousand registered horses throughout the world. Studies in ovarian follicle dynamics would have fundamental and practical importance for formulating and testing hypotheses and diagnosing and prognosing reproductive events in Miniature mares. The aims of these experiments were to study follicle dynamics during an interovulatory interval, with emphasis on the ovulatory follicle during the preovulatory period, and to compare number of follicles per ovulatory wave and diameter and growth rate of the ovulatory follicle among Miniature ponies, larger ponies, and Breton horses. Twelve interovulatory intervals (IOIs) and 36 preovulatory periods were studied in 9 and 13 non-lactating Miniature pony mares, respectively. The mares were of mixed breeds, aged 4 to 12 yr (7.3 ± 0.9 yr), weighed 110 to 136 kg (124.3 ± 3.5 kg), and measured 80 to 100 cm at the withers. The present study was done in the Southern Hemisphere (latitude, 30ºS) where the animals are classified as the Brazilian pony breed. Daily transrectal ultrasonography was used to evaluate follicle population and maintenance of individual follicle identity. The percentage of IOIs with the following follicle events was: ovulatory wave with only one follicle ≥10 mm (55%), diameter deviation similar to previous reports in larger mares (25%), and minor waves emerging before or after the ovulatory wave (55%). A preliminary comparison was made among Miniature ponies, large ponies, and Breton horses (n = 12 IOIs/breed). The IOI was longer (P < 0.001) in Miniature ponies (23.3 ± 0.9 d) and in large ponies (23.9 ± 0.5 d) than in Breton horses (20.3 ± 0.7 d). The Miniature ponies had fewer (P < 0.0001) growing follicles ≥10 mm per ovulatory wave (1.5 ± 0.3) and more (P < 0.0004) ovulatory waves (6/11) with only one follicle ≥10 mm than large ponies (9.8 ± 0.8 and 0/12) and horses (5.8 ± 0.9 and 0/12). Maximum diameter of the preovulatory follicle was smaller (P < 0.003) in the Miniature ponies (38.3 ± 0.7 mm) than in the horses (44.5 ± 1.4 mm), but the difference between breeds was slight (6%) compared to the difference in body weight (65%). Growth rate of the ovulatory follicle between Days –3 and –1 (ovulation = Day 0) was not different between Miniature ponies and horses. Considering the small number of follicles per ovulatory wave,

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 109 Miniature mares are a potential model for comparative studies in folliculogenesis within and among species. P244 The effect of interval from mating to ovulation on pregnancy rates and incidence of intra-uterine fluid in the mare Newcombe, JR1*; Cuervo-Arango, J2

1Equine Fertility Unit, Warren house farm, Brownhills, UK; 2Royal Veterinary College, Department of Veterinary Clinical Science, University of London, UK Introduction Persistent mating-induced endometritis (PMIE) is known to be one of the main factors affecting pregnancy rates in the mare. There has been extensive research on causes and treatments of PMIE, however the interval from mating to ovulation (IMO) has never been considered as a possible factor affecting the outcome of PMIE and pregnancy rates. It is thought that natural cover is best performed close to ovulation (0-48 h prior to ovulation) in order to achieve optimum pregnancy rates. However, to date it is not known whether mating “problem mares” at that interval will be detrimental for pregnancy rates (PR). The objectives of this study were: a) to assess the effect of IMO on PR and on the incidence of intra-uterine fluid (IUF) 72 h post-mating (PM); and b) to determine the effect of free IUF 72 h PM on PR. Material and methods A total of 439 cycles from 315 Thoroughbred mares were analysed. Mares were examined by transrectal ultrasonography every other day until the mare was free from IUF (up to 96 h from mating). Pregnancy diagnosis was preformed by ultrasound 12-13 days post-ovulation and rechecked by 30 days. For each mare, age, date of mating, name of stallion used, number of services, IMO and depth of IUF 72 h PM were recorded. For data analysis, three groups of IMO were used (0-48, 48-96 and 96-144 h). A statistical general model of analysis of variance was used to assess the effect of stallion, IMO, age and presence of IUF 72 h PM on PR. Chi-square test was used to analyse the association among IMO, PR and IUF 72 h PM. Results Stallion, age and IMO had no effect (P > 0.05) on overall (all services) PR. Pregnancy rates in mares with IUF 72 h PM was reduced by 17.7 % (P < 0.01). Mares mated at the interval 0-48 h pre-ovulation were more likely (P < 0.01) to have IUF 72 h PM than at 48-96 and 96-144 h (68, 42 and 41 % respectively). Pregnancy rates on first service were (69.3, 73.3 and 68.4 % for intervals 0-48, 48-96 and 96-144 h respectively, P > 0.05). However, on second service (n = 88 mares) they were lower (P < 0.05) in mares mated 0-48 h (54.5 %) than in those mated 48-96h before ovulation (79.1 %) . Conclusion Incidence of IUF 72 h PM is highest in mares mated 0-48 h before ovulation. Mating 0-48 h before ovulation is detrimental for PR in mares which failed to conceive in first service. It appears that in “problem mares” with delayed uterine clearance, a longer IMO gives the mare an “extra” time to clear the uterine inflammation before the cervix closes under progesterone influence. P245 Apoptotic markers can be used to forecast the freezeability of stallion spermatozoa Ortega Ferrusola, C1*, Gallardo Bolaños, JM1, Gonzalez Fernandez, L2, Rodriguez-Martinez, H3, Tapia, JA2, Pena, FJ1 1Reproduction, University of Extremadura, Spain; 2Physiology, University of Extremadura, Spain; 3Reproduction, SLU, Sweden In an attempt to identify valuable markers for potential freezeability of the equine spermatozoa, three ejaculates were collected from five Andalusian stallions and frozen using a standard protocol. Before freezing, three apoptotic cell markers were studied by flow cytometry (early changes in sperm membranes, mitochondrial membrane potential and caspase activity). Post-thaw, spermatozoa were again evaluated for these parameters and for sperm kinematics using CASA. Receiving operating system curves were used to evaluate the relative value of the apoptotic markers herein studied, as forecast for potential freezeability. From all parameters studied, the outcome of JC-1 (as

proportion of spermatozoa showing simultaneously orange and green fluorescence) had the highest diagnostic power. For potentially bad freezers (less than 25% of intact spermatozoa post-thaw), the significant area under the ROC-curve was 0.985, with a 100% sensitivity and 99.8% specificity for a cut off value of 55.7. P246 Effect of altrenogest-treatment in late pregnant-mares on parturition, neonatal adaptation and adrenocortical function in new-born foals Palm, F2*; Neuhauser, S1; Ambuehl, F1; Moestl, E3; Aurich, C1 1Centre for Artificial Insemination and Embryo Transfer; 2Clinic for Obstetrics, Gynaecology and Andrology; 3Institute for Biochemistry, University of Vet. Sciences, Vienna, Austria In mares with compromised pregnancies, treatment with the synthetic gestagen altrenogest (allyltrenbolon) is common to maintain gestation until term. However, there are no controlled studies on the effects of altrenogest administration during late pregnancy on parturition and development of the foals in the immediate postpartum period. In our study, pony mares with normal pregnancies were treated with altrenogest (0.088 mg/kg bwt; n=6) from day 280 of gestation until spontaneous parturition or were left untreated as controls (n=7). Stages of labour and clinical parameters were analysed and blood samples were collected from immediately after birth until 48 hours post natum for analysis of cortisol concentration, haematolgical and acid base parameters. In order to assess adrenocortical function, an ACTH stimulation test with 0.125 mg ACTH (Synacthen, Novartis) was performed on days 1 and 5 after birth and cortisol release calculated as area under the curve for the time period 0 to 120 min after cortisol injection. Altrenogest-treated mares tended to have a shorter gestation length (320±4 days) than control mares (327±2 days) and showed a prolonged second stage of labour (p<0.05). More foals born to alterenogest-treated mares showed adaptive problems in the immediate postpartum period compared to foals born to control mares (3/6 vs. 0/7; p<0.01). Foals born to altrenogest-treated mares had a lower respiratory rate during the first 30 min of life than foals born to control mares (e.g. 30 min after birth 52±4 vs. 88±10; p<0.05). Also pH was significantly higher at 45 (7.41 ± 0.01 vs. 7.37 ± 0.01; p<0.05) and 60 min after birth (p<0.05) in these foals. Base excess was higher (p<0.05) in foals of treated mares compared to control foals until 12 hours post natum. No difference in haematological parameters existed between the groups of foals. Basal cortisol levels in foals of altrenogest-treated mares were higher immediately after birth compared to foals of untreated mares (29.7±12.6 vs. 16.2±7.0 µg/ml). Cortisol release in response to ACTH did not differ between groups of foals but was significantly higher on day 1 than on day 5 (p<0.01). In conclusion, altrenogest treatment during late gestation until term did not prevent or delay foaling but increased the duration of parturition. Prolonged parturition may cause problems in neonatal adaptation and lead to increased cortisol levels immediately after birth. P247 Botu-Crio Egg Free® for freezing equine semen Felício, GB.1; Papa, FO.1*; Dell’Aqua Jr., JA.1; Alvarenga, MA.1; Melo, CM.1; De Vita, B.1; Medeiros, ASL.1; Trinque, C.2

1Department of Animal Reproduction and Veterinary Radiology, FMVZ – UNESP Botucatu; 2Agromen Stud farm The use of equine frozen-thawed semen in artificial insemination programs has been widely accepted as a tool for genetic improvement in horse breeding, due to the pursuit of new technologies in the last decade, such as the inclusion of different compounds in semen extenders to obtain satisfactory semen freezability and fertility rates. Although chemically defined extenders have been already developed for bovine semen freezing procedures, there are still few reports concerning its use for equine semen. The aim of the present study was to evaluate the efficiency of a new chemically defined extender for equine semen cryopreservation. One ejaculate from fifteen stallions with variable freezability potentials was used. After collection, semen

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 110 P o s t e r A b s t r a c t s was diluted 1:1 with Botu-Semen® (skim-milk based extender), split in two aliquots and centrifuged at 600xg for 10 minutes. Pellets were ressuspended using Botu-Crio® (egg-yolk based extender with aminoacids, 1% glycerol and 4% amides - Biotech Botucatu®, Brazil), or Botu-Crio® Egg Free® extender (same basis without egg-yolk - Biotech Botucatu®, Brazil), to a final concentration of 100x106sperms/mL. Samples were prepared at room temperature. After ressuspension, samples were loaded into 0.5mL straws, stabilized for 20min at 5°C in refrigerator then placed 6 cm above nitrogen level in isopor box (42L) filled with 3 cm of liquid nitrogen for 20 min and finally immersed. Samples were thawed at 46°C for 20s and maintained in 1.5mL plastic tubes in dryblock at 37°C and evaluated for sperm motility by CASA (IVOS 12) and plasma membrane integrity with fluorescent probes (PI and CFDA). ANOVA and Tukey test were performed by GraphPad InStat program. Results obtained for Botu-Crio® and Botu-Crio Egg Free® extenders were: total motility (61.4±16.2 x 61.4±15.9%), progressive motility (27.0±9.8 x 26.7±10.6%), VAP (path velocity) (92.6±13.3 x 97.1±13.8µm/s), VSL (straight line velocity) (73.0±8.8 x 75.0±10.3µm/s), VCL (curvilinear velocity) (167.5±21.7 x 176.3±22.9µm/s), ALH (amplitude of lateral head displacement) (6.7±0.5 x 7.0±0.4µm), STR (straightness) (78.1±5.2 x 77.0±2.4%), LIN (linearity) (46.2±5.1 x 43.3±1.9%) and plasma membrane integrity (53.4±11.5 x 57.4±7.0%), respectively. No difference (P>0.05) was observed between extenders. In conclusion, as Botu-Crio Egg Free®, which is a completely chemically defined media, has shown similar results when compared to Botu-Crio®, it may be an alternative for freezing equine semen. Further researches are necessary to evaluate in vivo fertility when using this extender. P248 Vaginal biotic flora and its antibiotic resistance profile in terras de miranda jennets Payan-Carreira, RM1*, Mota, VR2, Barroso, AT2, Quaresma, M3, Saavedra, MJ4 1Zootecnia Dept., University of Trás-os-Montes e Alto Douro, Portugal; 2University of Trás-os-Montes e Alto Douro, Portugal; 3Veterinary Teaching Hospital, University of Trás-os-Montes e Alto Douro, Portugal; 4Veterinary Clinics Dept., University of Trás-os-Montes e Alto Douro, Portugal In this work authors report the preliminary results on the characterization of the biotic flora found in the vagina of Terras de Miranda jennets. Vaginal swab samples were obtained from the vestibule and transported in transport medium for delivery to the Microbiology Lab. This work was carried in a group of 21 jennets, aged between 4 to 20 years old and the samples were obtained in two retractions (15 animals + 6 animals). For the bacteriological analysis of the vaginal samples different and selective culture media were used, aiming a more significant bacterial growth. For the preliminary identification of the isolated ones a set of biochemical tests was carried through (oxidase, catalase, indol production, use of the citrate, metil red, vogues proskauer and lactose fermentation). Antimicrobial susceptibility testing was performed by disc-diffusion methods to twenty seven antimicrobials (by CLSI recommendations), including different beta-lactams, quinolone and aminoglicoside antibiotics. From the vaginal samples, bacteria’s pertaining to the different generic groups were found: Gram-positive bacteria, such as Staphylococcus spp. and Enterococcus spp.; and Gram-negative bacteria, such as Enterobactereaceae (E. coli, Klebsiella and Enterobacter) and not Enterobactereaceae (Pseudomonas spp.). Regarding to the resistance profile to antibiotics, the most frequently observed resistance was to amoxicillin and ticarcillin (penicillins), even when associated to the beta-lactamases inhibitor (acid clavulanic), as well as the cephalosporin of 1st generation studied (cephalotin). Resistance to aztreonam (antibiotic beta-lactam of the group of the monobactams) was also observed in some cases.

P249 Does the microbial flora in the ejaculate affect the freezeability of stallion sperm? Pena, FJ1*, Ortega Ferrusola, C2, Gonzalez Fernandez, L2, Macias Garcia, B2, Rodriguez-Martinez, H2, Tapia, JA2, Alonso, JM2 1Reproduction, University of Extremadura, Spain; 2Spain In an attempt to evaluate the possible relationship between the microbial flora in the stallion ejaculate and its ability to freeze, 3 ejaculates from 5 stallions were frozen using a standard protocol. Before freezing, an aliquot was removed for bacteriological analysis. Bacterial growth was observed in all the ejaculates studied. The non-parametric Mann–Whitney U-test was used to directly compare pairs of values. The Spearman non-parametric test was used to study correlations between microbiological findings (presence and quantity, as number of CFU) and sperm quality post-thaw. The isolated microorganisms were: Staphylococcus spp and Micrococcus spp (in all the stallions), β-haemolytic Streptococcus (in stallions 3 and 4), Corynebacterium spp (in stallions 1, 3-5), Rhodococcus spp (in stallion number 2), Pseudomonas spp (in stallion number 1) and Klebsiella spp in stallions 1, 3 and 5. The presence and richness of Klebsiella and β-haemolytic Streptococcus in the ejaculate were related to two sperm variables post-thaw, namely the proportion of dead spermatozoa (EH+ cells; r=0.55, P<0.05), and the amplitude of lateral displacement of the sperm head (ALH, µm; r= -0.56, P<0.05), respectively. The degree of growth of Corynebacterium spp and of Rhodococcus spp in the ejaculate were positively correlated with the percentage of spermatozoa showing high- respectively low caspase activity post-thaw (r=0.62, P<0.05; r= 0.67, P<0.01) while presence and colony numbers of β-haemolytic Streptococcus was negatively correlated (r= -0.55, P<0.05) with low sperm caspase activity. The microbial flora of the equine ejaculate may be responsible for some of the sub-lethal damage experimented by the spermatozoa during cryopreservation. P250 Genetic diversity of S. equi ssp. zooepidemicus and E. coli isolated from the reproductive tract of the mare Bindslev, MM1, Villumsen, MH1, Petersen, MM2*, Nielsen, JM3, Bøgh, IB4, Bojesen, AM5 1Denmark; 2Department of Large Animal Sciences, Faculty of Life Sciences, University of Copenhagen; 3Ansager Veterinary Clinic, Denmark; 4Production Animals and Horses, Denmark; 5Veterinary Pathobiology, University of Copenhagen The aim of this study was to evaluate the genetic diversity between isolates of S. equi ssp. zooepidemicus and E. coli isolated from the fossa clitoridis, vagina and the uterus of mares. Furthermore, the study aimed at evaluating a possible correlation between the presence of polymorphnucleated neutrophils (PMN’s) in the endometrium and infection with S. equi ssp. zooepidemicus or E. coli. A total of 89 mares were included in this study. The samples were collected from two groups of mares; one group of individual mares with no epidemiological relationship and one group of mares (21) from a closed herd. Swabs from clitoris and the vagina and an endometrial biopsy from the uterus were examined for growth of E. coli and S. equi ssp. zooepidemicus. Up to three isolates of each bacterial species from either anatomical site were investigated. In addition, cytological smears from uterine biopsies were evaluated for the presence of PMN’s. A sample was considered positive when more than 0.5 % of all cells in the sample were PMN´s. Samples with less than 200 cells were not evaluated. The results of the cytological studies showed that 8 out of 12 (67 %) mares infected with S. equi ssp. zooepidemicus were positive, whereas only 3 out of 9 (33%) mares infected with E. coli had a positive cytological profile. The genetic diversity of the isolated E. coli and S. equi ssp. zooepidemicus was determined by Amplified Fragment Length polymorphism. Out of 213 E. coli isolates, 127 different fragment profiles were identified, whereas 54 profiles were recorded among the 90 S. equi ssp. zooepidemicus isolates investigated, indicating a high genetic diversity among the isolates. Endometritis caused by S. equi ssp. zooepidemicus was often

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 111 caused by more than one bacterial clone (64%), whereas this was a less pronounced in infections coused by E. coli (36%). Finally, we observed no difference in the genetic diversity among S. equi ssp. zooepidemicus or E. coli isolated from clitoris of mares from the closed herd when compared to isolates from mares kept as on an individual basis. In conclusion, it appears that no specific strain of S. equi ssp. zooepidemicus or E. coli cause infectious endometritis in the mare. Furthermore, positive cytology is a not a reliable tool to evaluate the infectious status as presence of PMN’s was absent in 33% or 67% of infections caused by S. equi ssp. zooepidemicus or E. coli, respectively. P251 Luteal function and ovulation in mares treated with pgf2α during early and mid-diestrus Holland, BE; Pinto, CRF* North Carolina State University, College of Veterinary Medicine, Raleigh, North Carolina 27606,USA PGF2α is commonly administered as single injection to mares with a mature corpus luteum (days 5 to 7 post-ovulation. In the present study, it was hypothesized that complete luteolysis (plasma progesterone < 1.0 ng/mL) will be achieved in mares receiving PGF2α for 3 consecutive days beginning as early as 2 days after ovulation (early diestrus). The specific objectives of the present study were to document ovarian dynamics (follicular growth, ovulation, CL formation) using transrectal ultrasonography, and luteal function determined by concentrations of plasma progesterone (P4). The effect of intramuscular administration of 2.5 mg PGF2α on luteal function (dinoprost tromethamine) given on day 10 after ovulation (Group 1) and on days 2, 3, and 4 (Group 2) was examined in a switch back design utilizing horse mares (n = 10). Transrectal ultrasonography was performed three times per week or once daily on mares in estrus with follicle diameters ≥ 30mm. Blood samples were taken daily and plasma samples were stored at -20 ˚C until RIA analyses for P4. Statistical analyses were done by ANOVA, with significance level set at P < 0.05; data are presented as mean ± SEM. All mares in Group 1 (control) underwent complete luteolysis 2 to 3 days after PGF2α treatment with a mean of 2.4 ± 0.16 days; all mares in Group 1 ovulated 8.2 ± 0.75 days following PGF2α treatment. In Group 2 (early diestrus), 6 out of 10 mares underwent complete luteolysis 3.3 ± 0.2 days after beginning of treatment on day 2 post-ovulation; these mares ovulated 9.4 ± 1.36 days after treatment. The remaining 4 mares in Group 2 underwent partial luteolysis followed by resurgence in circulating concentrations of plasma P4; 3 out of these 4 mares ovulated with relatively high circulating concentrations of plasma P4 at day 9 (P4 = 3.3 ng/ml), 15 (P4 = 2.99 ng/ml) and 16 (P4 = 3.29 ng/ml) following treatment, respectively; whereas the remaining mare underwent natural luteolysis 16 days after treatment with its ovulation occurring on day 19 following treatment. Complete luteolysis followed by ovulation was observed in 60% (5/10) of mares treated during early diestrus. We concluded that the equine corpus luteum could be responsive to exogenous PGF2α as early as 2 days post ovulation. Increasing the dose or frequency of PGF2α treatment during early diestrus may provide novel protocols for use in broodmare management. P252 Pregnancy diagnosis in the mare by semi quantitative relaxin quick assay kit Ponthier, J1*; Van de Weerdt, M-L2; Deleuze, S1 1Equine Reproduction, Equine Veterinary Teaching Clinic, Faculty of Veterinary Medicine, ULg, University of Liege, B41, 20, Boulevard de Colonster, B-4000 Liege, Belgium; 2Lab For Vet, 31 Rue Laoureux, B-4800 Verviers, Belgium Few hormonal assays for pregnancy diagnosis are available in the mare. Progesterone assay is not sensitive, not predictive of foetal viability and is useless after day 120 of pregnancy. PMSG or eCG diagnosis is short-windowed (from day 45 to 100) and can give false-positive results (in case of embryo mortality). Urinary estrogens assay

is only reliable in late pregnancy (after day 150) and requires bladder catheterism. Estrone sulfate measurement predicts foetal viability but is inadequate before day 100. Relaxin, a polypeptid produced by the placenta in the mare, the bitch and the queen, is a candidate for the pregnancy diagnosis and the foetal viability prognosis. Rapid immunological tests have been developed to detect relaxin after day 28 of pregnancy in the bitch and 31 in the queen. In the bitch, circulating relaxin measured by immunological procedure is at 1ng/ml at 4 weeks and peaks at 4ng/ml at 6 weeks. In the queen, relaxin is at 5ng/ml at day 31 and reaches 9ng/ml at day 40. In pregnant mares, relaxin detected by chromatography is basal until day 80 and then reaches 80ng/ml for the mare and 10ng/ml for the pony mare. From there on, concentration will increase in the pony and decrease in the horse. In both cases, concentration falls dramatically at parturition. The aim is to study the validity of a commercially available semi-quantitative quick immunological relaxin detecting test for dogs and cats in the mare. Serums of ten mares (pony, saddle or draft) are used for Witness Relaxin® Test (Synbiotics Corporation, France): an ELISA sandwich test. The sample is mixed with specific primary antibodies, then this complex migrates on a membrane and is captured by secondary antibodies. Positive reaction reveals a coloured band. Proper migration on the membrane is confirmed by a second coloured band (witness). Diagnosis and stage of pregnancy are assessed by transrectal or abdominal ultrasonography. Sensibility and specificity are determined and statistical significance is obtained by Fischer’s exact test. Out of the 10 mares, 4 were non-pregnant and 6 were pregnant over 100 days. No Witness Relaxin® Test did show a positive result, neither for pregnant nor for non-pregnant mares. Sensitivity is 0% and specificity is 100%. Samples of the 6 pregnant mares were sent to the Synbiotics laboratory for a classical ELISA, but none showed a response for the antibodies used. Antibodies of the Witness Relaxin® Test have been used successfully in various species (dog, cat, mice). Although equine relaxin has a similar structure with two sub-units (A and B) and a comparable molecular weight, these antibodies fail to recognize its sub-unit B. Further studies are required to develop specific equine antibodies. P253 Clinical Causes for Infertility in Jennets on “Planalto Mirandês” Quaresma, M1*, Payan-Carreira, RM2 1Veterinary Teaching Hospital,; 2CECAV; Univ. Trás-os-Montes and Alto Douro, Vila Real, Portugal A group of 24 jennets were reported by the local breeder’s association to our Veterinary Teaching Hospital with complains of infertility. Twenty-two animals belong to the breed “Asinina de Miranda” (84,6%), a small portuguese breed of no more than 200 females registered in the Book, and 4 were Miranda’s crossbreed (15,4%). The group showed a wide ages distribution, ranging from 3 to more than 15 years old. The gynaecological evaluation of the jennets included the reproductive anamnesis and examination of the external genitalia, vaginoscopic and digital evaluation of the vagina and the evaluation of the uterus and ovaries by transrectal palpation and ultrasonography. The gynaecological examination detected six jennets having structural anomalies: one with an imperforate hymen, two other animals with severe hymenal constriction and two with cervical hypoplasia. Another one evidenced a polyp in entrance of the uterine body. Ultrasonographic examination evidenced bilateral granulosa cell tumours in four of the jennets. It was also found a female with multicystic uterus resembling “suisse cheese”, and isolated uterine cysts in two of the females. In sixteen animals ultrasonographic evaluation demonstrated an apparent normal ovarian activity, despite that most of them being referred by owners as in anoestrus. It seems that in many of those cases the owners were unable to detect oestrus. Although the data presented here was collected in a relatively small number of animals, it may reflect the high consanguinity that we tend to observe in this breed due to the low number of animals available for reproduction.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 112 P o s t e r A b s t r a c t s P254 Effect of impaired uterine drainage via cervix in normal mares after insemination Reine, E1*; Reilas, T2; Rivera Del Alamo, M3; Katila, T4 1Faculty of Veterinary Medicine, Latvian University of Agriculture, Latvia; 2Equine Research, MTT Agrifood Research Finland, Finland; 3Faculty of Veterinary Medicine, Autonomous University of Barcelona, Spain; 4Faculty of Veterinary Medicine, University of Helsinki, Finland Introduction In normal mares, the acute endometrial inflammation caused by artificial insemination (AI) peaks around 8 h and subsides appreciably within 24 h after AI. In mares susceptible to endometritis, inflammation and infection may persist because of reduced myometrial contractions. The necessity of a patent cervix has been recognized, and manual dilatation of the cervix has been used to aid evacuation of fluid collections. The roles of lymhatic drainage and drainage through an open cervix warrant further investigations. Objective To examine the role of the cervix in uterine drainage, a balloon-tipped catheter was used to impaire uterine drainage via cervix. Numbers of polymorphonuclear neutrophils (PMNs) were evaluated after AI in 3 treatments: A) AI, catheter closed for 25 h, B) AI, catheter closed for 6 + 19 h, and C) AI, no intracervical catheter. Methods Twenty-nine clinically normal mares were assigned to 4 groups and followed through 5 oestrus cycles. During the first, third and fifth oestrus, the uterus was swabbed. In the second and fourth oestrus, the mares were treated in the following order: group1) CA, group 2) AC, group 3) CB, and group 4) BC. AI dose was 500 x 106 progressively motile sperm extended with skim milk (20 ml, pooled semen from 2 stallions). In treatments A and B, clamped catheters were inserted immediately after AI. Uterine fluids were collected either using a tampon 25 h after AI in C (tampon fluid TF) or by draining fluid from the catheter at 25 h in A, and at 6 and 25 h in B (catheter fluid CF). Oxytocin was injected i.v. to aid fluid drainage. At 25 h, the uterus was lavaged using 500 ml of Ringer’s solution (lavage fluid LF). PMNs were counted using a Bürker chamber. Results In the second oestrus, at 25 h after AI, PMN concentrations (106/ml) were similar in treatments A and B (CF-A: 73.2 ± 8.4, CF-B: 66.3 ± 19.9, LF-A: 2.4 ± 0.4, LF-B: 2.4 ± 0.8), and lower in treatment C (TF-group 1: 3.8 ± 0.5, TF-group 3: 2.9 ± 0.4). In the fourth oestrus, PMN numbers in treatment C were 10 times higher than during the second oestrus (TF-group 2: 27.7 ± 4.2, TF-group 4: 31.1 ± 12.5). In treatments A and B, PMNs were only slightly elevated compared to values in the second oestrus (CF-A: 143.3 ± 17.3, CF-B: 97.9 ± 16.7). PMNs in LF between treatments did not differ. Draining the uterus at 6 h had no effect on PMN numbers in CF 19 h later. Swabs were negative for bacterial endometritis. Conclusion Impaired cervical drainage seemed to have a profound effect on uterine inflammation showing the important role of the cervix. P255 Serum aldosterone concentrations in Spanish Purebred mares during pregnancy Satué, K*; Domingo, R

Faculty of Veterinary Medicine, Cardenal Herrera-CEU University, Valencia, Spain Introduction The need to supply oxygen and nutrients to the fetoplacental unit and to counterbalance the effects induced by the release of new gonadotropic hormones during pregnancy requires important adjustments of all hormones involved in the regulation of blood volume, hydration and electrolytic state, and therefore of blood pressure. Objectives The main purposes of this research were: 1) to establish reference ranges for serum aldosterone (ALD) concentrations in Spanish Purebred mares; 2) to analyze pregnancy-related changes related to pregnancy in serum ALD concentrations and 3) to assess the effect of the age of the mare in serum ALD. Material and Methods Thirty-three Spanish Purebred broodmares, aged between 4 and 17 years were selected for this study. Jugular venous blood samples were taken every month during pregnancy in

the morning. After withdrawal, blood was centrifuged and serum was harvested. Serum ALD concentrations were measured by competitive immunoassay. Results Mean serum ALD concentrations were 562.21 pg/ml, with maximum and minimum values of 1936.77 and 101.50 pg/ml respectively. Mean values in the 1st month of pregnancy were 628.79 pg/dl, they diminished in the 2nd month, when the minimum mean values were achieved (346.09 pg/ml). In the 3rd and 4th months, serum ALD progressively increased to reach maximum mean values in the 5th month (795.19 pg/ml). From this moment on, the mean values fluctuated without significant differences up to the partum, with means comprised between 458.59 and 658.17 pg/ml. No significant differences were detected in relation to the age of the mares. Discussion The Spanish Purebred broodmares showed serum ALD concentrations higher than those described for foals and adult horses of different breeds. Most of the studies have been carried out in sport horses and it is well known that the loss of Na in sweat leads to a compensatory release of ALD. Serum ALD concentrations increased two to three-fold in pregnant women, bitches and laboratory animals. The main mechanisms involved in the increased serum ALD concentrations during pregnancy could be: release of renin and angiotensin II, and changes in ACTH concentrations. Conclusions In conclusion, pregnancy in Spanish Purebred broodmares induces a progressive increase in serum ALD concentrations. This finding might imply a better conservation of Na and water in the kidneys in order to favor the expansion of the fetoplacental barrier. In this way, a suitable supply of nutrients and oxygen to the fetus as well as a correct blood pressure would be guaranteed, contributing to the internal homeostasis of the fetus and the mare. In addition, this result could be a consequence of the interaction of several neuroendocrine factors during pregnancy. P256 The duration of the effects of active immunization against GnRH to suppress ovarian activity in mares in South Africa Schulman, ML*; Botha, AE; Bertschinger, HJ; Guthrie, AJ Faculty of Veterinary Science, University of Pretoria, South Africa Introduction A GnRH-vaccine to suppress reproductive function was administered to a large group of horse mares. The effects of vaccination on ovarian activity were monitored over a period of one year using serum progesterone concentration (SPC). Methods Sixty five cyclic mares (age range: 3 to 24 years) were assigned randomly in the middle of the summer season to either a control (Group C, n = 10) or an experimental (Group E, n = 55) group, respectively. Both groups were subdivided into three age categories: Category 1 (3 to 5 years), Category 2 (6 to 14 years), and Category 3 (> 15 years). On Day 0, all mares were examined by trans-rectal palpation and ultrasound to establish their reproductive status. Group E mares were injected intramuscularly with 2 mL of GnRH-vaccine (Improvac®, Pfizer Laboratories, Sandton, SA). Group C mares similarly received an equal volume of sterile normal saline solution. The injections were repeated on Day 35, and the clinical examinations on Days 35, 70 and 260. The last examination corresponded approximately with the onset of the following summer season. Blood samples were collected at weekly intervals from Day 0 until Day 360 from all mares for SPC using a radioimmunoassay kit (Progesterone 125 Coat-a-Count, Diagnostic Products Corp, Los Angeles, CA, USA). As the SPC results correlated significantly with the clinical findings, SPC alone was used to monitor ovarian activity from Day 260 until 360. All data was analyzed using NCSS software (Number Cruncher Statistical Systems, Kaysville, UT, USA) and a multivariate analysis of variance (ANOVA) assessed the effects of treatment and age on clinical parameters and SPC. Values were considered to be statistically significant at P < 0.05. Results On Day 0, all Group C and E mares showed clinical evidence of ovarian activity. On Day 35, all Group C and 8 (14.5 %) Group E mares showed ovarian activity. The SPC results showed all Group E mares were non-cyclic by Day 56. On Day 70, examination and SPC indicated all Group C, and none of Group E mares showed ovarian

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 113 activity. All Group E mares remained in anoestrus until Day 175 with SPC < 1 nmol/L. No effect of age category on suppression of cyclicity within Group E was observed. On Day 260, only two (4 %) of the 48 Group E mares remaining in the trial were cyclic. On Days 280, 300, 320, 340 and 360, the number of cyclic mares was: 4 (8 %), 11 (23 %), 18 (38 %), 23 (48%) and 27 (56 %), respectively. A significant age effect on the resumption of cyclicity was observed between Category 3 and the other two age categories. Conclusions All mares responded rapidly after immunization against GnRH with complete suppression of cyclic activity for a minimum of 175 days, with 56 % resuming cyclic activity within one year of vaccination. P257 Effect of seminal plasma on the fertilizing capacity of stallion epididymal sperm Stout, TAE*, Sostaric, E; Kraan, H Department of Equine Sciences, Utrecht University, Netherlands The epididymis plays important roles in sperm maturation and storage and, in the event of death or castration, represents a potentially useful source of male germ plasm. However, while pregnancies have been obtained in mares inseminated with frozen-thawed epididymal sperm, success rates have been disappointing. This study aimed to determine: at what point during epididymal transit stallion sperm acquire the ability to acrosome react; whether cauda epididymal sperm are as capable of capacitating and acrosome reacting as ejaculated sperm and, if not, whether this can be rectified by exposure to seminal plasma. In Experiment 1, spermatozoa recovered from the caput, corpus and cauda epididymides were incubated under capacitating conditions; aliquots were then exposed to progesterone or calcium ionophore (A23187) to induce the acrosome reaction (AR). AR and viability were examined by staining with fluorescein-conjugated peanut agglutinin (PNA-FITC) and propidium iodode. Only cauda epididymal sperm were able to undergo the AR in appreciable quantities in response to progesterone (7 %) or calcium ionophore (17 %). In Experiment 2 an ejaculate was recovered from nine stallions at daily sperm output; the sperm and seminal plasma were separated by centrifugation. The stallions were then castrated and the sperm flushed from the cauda epididymides and divided into two portions, one of which was pre-incubated for 30 mins with homologous seminal plasma. Three experimental groups were thus created; i) ejaculated sperm (Ej); ii) epididymal sperm (E) and iii) epididymal sperm exposed to seminal plasma (Es). After washing, sperm from all 3 groups were incubated under capacitating conditions. At intervals during incubation, aliquots were examined for evidence of capacitation (tyrosine phosphorylation and progesterone receptor exposure) and the AR. After incubation for 2 or 4 hours, significantly higher percentages of ejaculated than epididymal sperm showed evidence of tyrosine phosphorylation, the AR (p<0.01) and progesterone receptor exposure (p<0.05); the only exception was that the percentage of ejaculated and Es sperm with exposed progesterone receptors was similar. Interestingly, pre-incubation of epididymal sperm with homologous seminal plasma (Es) resulted in significantly higher percentages of sperm exhibiting all 3 signs of activation (p<0.05). It is concluded that although the apparent ‘fertilizing capacity’ of stallion epididymal sperm is lower than that of ejaculated sperm, the deficiency can be largely compensated by exposure to seminal plasma. P258 Incidence of Retained Endometrial Cups in Pregnant Mares after 120 days of Gestation Wolfsdorf, K1*, Tai, C2, VanDyke, R3, Roser, J4, Zent, W1 1Field Veternarian, Hagyard Equine Medical Institute, United States; 2Lab, Hagyard Equine Medical Institute, United States; 3Department of Agriculture, University of kentucky, United States; 4College of Veterinary Medicine, University of California, United States Recently, clinical evidence has revealed endometrial cups can remain functional past parturition, affecting the normal reproductive cycle of

the mare. This study was undertaken to try and ascertain the incidence in which endometrial cups exist past 120 days at which time production of Equine Chorionic Gonadotropin(ECG) should cease. Three hundred and eighty five pregnant thoroughbred mares had serum levels of ECG measured once monthly starting at 120 days of gestation. Collection of serum samples continued monthly until the mare’s serum was negative for ECG. Samples were processed within twenty-four hours of collection using a standardized Elisa test determining positive, weak positive, very weak positive and negative levels. Positive results were then quantified using a Radioimmunoassay with levels greater than 30ng considered positive for levels of ECG and not false positives of cross reacting Luteniezing Hormone. Frequency procedures were used to determine the percentage of mares that were serum positive for ECG at 120, 150, 180 200, 240 and 270 days of gestation. Results revealed 21.04% (81/385) at 120 days, 19.74% (76/385) at 150 days, 9.87% (38/385) at 180 days, 7.01% (27/385) at 200 days, 3.12%(12/285) at 240 days and 1.3%(5/385) of mares at 270 days had positive serum ECG levels. In addition out of 81 serum positive mares 56 (67.47%) were positive at less than 200 days of gestation and 27(32.53%) were positive for serum ECG at > 200 days of gestation. This data suggests that endometrial cups may not recede or cease to produce ECG strictly at 120 days of gestation as previously thought and that retained functional endometrial cups may be present late into pregnancy. Further studies utilizing excessively large numbers of mares would be needed to actually determine the incidence of retained endometrial cups in mares that have foaled. P259 Biochemical composition of stallion seminal plasma: is this correlated to semen freezability? Zahn, FS*; Papa, FO; Melo, CM Department of Animal Reproduction and Veterinary Radiology, FMVZ, UNESP, Botucatu, Brazil Seminal plasma levels of Ca, Na, K, P, Cl, Mg, Cu, Fe and Zn were reported, but there were no reports of selenium in equine seminal plasma or the correlation between these elements and semen freezability. The present study aimed to verify the correlation between semen freezability of normospermic stallions and seminal plasma levels of Ca, Cl, P, Mg, K, Na, Zn, Se, total proteins, albumin, glucose and cholesterol. Semen was obtained from 22 adult normospermic stallions. Seminal plasma was obtained by 3 steps of centrifugation at 1000xg for 15 minutes. Cl, Ca, Na, K, P, Mg, albumin, total protein, glucose and cholesterol were detemined by dry chemistry (Vitros-Johnson). Zn levels were determined by atomic absorption spectrophotometry (Shimadzu AA-6800) and Se by atomic absorption spectrophotometry with a graphite furnace (Varian AA-800). Semen samples from the same ejaculates were frozen in MP50 extender and analyzed by CASA (IVOS 10). Thawed semen evaluation allowed us to separate stallions into 3 groups: poor freezers (G1, n=7), regular freezers (G2, n=8) and good freezers (G3, n=7). ANOVA was used to verify variation among groups and statistical differences were verified by Tukey test. Correlation between thawed semen motility and seminal plasma components was verified by Pearson test. Statistical significance was considered when p<0,05. Statistical analysis demonstrated difference between groups only on phosphorus levels, that were higher in poor freezers (5.58 ± 1.42 mg/dL) than in good (3.31 ± 1.08 mg/dL) or regular (3.64 ± 0.94mg/dL) freezers (p=0.0030). Negative correlation was verified between values of thawed semen total motility and phosphorus levels on seminal plasma (r= -70714, p=0.0002). Other biochemical components also did not correlate to semen freezability. The present study revealed that, although many reports demonstrate that Zn and Se play important roles in seminal quality and male fertility, when we study only normospermic and fertile stallions, there is no correlation between their levels in seminal plasma and semen freezability. Possibly, animals with abnormal levels of these elements may have been previously rejected because of their low quality fresh semen. These results suggest that all the biochemical components of seminal plasma evaluated, excepting P, may not interfere specifically with events involved in semen cryopreservation. This knowledge contributes to a

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 114 P o s t e r A b s t r a c t s better understanding of equine semen physiology, but other studies are necessary to achieve better results for those stallions that are still considered poor freezers. Poster 06 - Porcine Reproduction P260 Azoospermic boars in the Finnish Yorkshire and Landrace breeds Andersson, M1*, Kopp, C1, Ijäs, R2 and Taponen, J1 1Department of Production Animal Medicine, University of Helsinki, Saarentaus, Finland; 2FABA Breeding Service, Pieksämäki, Finland

In the period (1996-2005) ejaculates of 2048 boars were collected. All boars were intended for use in artificial insemination or natural breeding and had two descended testes. Azoospermia was found in 16 of 1097 Yorkshire boars (1.5%) and in 2 of 951 Landrace boars (0.2%). The distribution of azoospermic boars into different groups were (Y/L): pre-testicular azoospermia 0Y/1L, testicular azoospermia: 9Y/1L and post-testicular (obstructive) azoospermia in 7Y/0L. The following diagnosis groups and number of affected boars were found: in Yorkshire breed: arrest of spermatogenesis at the pachytene spermatocyte stage in 8 boars and segmental aplasia of the Wolffian ducts resembling the congenital unilateral absence of the vas deferens and idiopathic epididymal obstruction in humans (CUAVD ) in 7 boars and Klinefelter syndrome in one boar. In Landrace breed the azoospermic boars were less frequent and had a different diagnosis and different aetiology compared with the Yorkshire boars: one boar had a probable hypogonadotropic hypogonadism and another boar had an arrest of spermatogenesis at the round spermatid stage with degenerating round spermatids present in multinucleated cell bodies. Morphometry of testicular tissue and distribution of different cells in the seminiferous tubules were examined in thirteen boars; 4 normal control boars, 3 boars with segmental aplasia of the Wolffian ducts, 3 boars with arrest of spermatogenesis at the pachytene spermatocyte stage, one boar with hypogonadotropic hypogonadism, one boar with an arrest of spermatogenesis at the round spermatid stage and one boar with Klinefelter syndrome. These findings indicate that the reason for azoospermia is mainly genetic and in populations of different breeds different reasons for and frequency of azoospermia was observed. P261 Effect of different estrus synchronization systems on embryo quality in multiparous sows and prepuberal gilts Antosik, P1*, Kempisty, B2, Bukowska, D1, Lianeri, M2, Bieżyński, J3, Jaśkowski, JM1

1Department of Agricultural Veterinary, University of Agriculture, Poznań, Poland; 2Department of Biochemistry and Molecular Biology, University of Medical Sciences, Poznań, Poland; 3Department and Clinic of Veterinary Surgery, Wrocław University of Environmental and Life Sciences, Wrocław, Poland In this experiment, multiparous sows (n=63) and prepuberal gilts (n=42) were used. The subgroups of these animals were treated with PMSG (1500 U.I.) + hCG (500 U.I.) or PG-600 synchronization systems. These animals were inseminated twice, 24 and 36 h after hCG injection. The control gilts (n=20) were from the third subgroup and were inseminated two times at 12 h intervals during their natural estrus cycles. We observed a statistically significant increased number of corpora lutea (CL) and embryos between natural estrus and both synchronization systems in multiparous sows (P<0.001). We did not find differences in the number of degenerative embryos isolated from both ovaries between PMSG+hCG, PG-600, and natural estrus groups in multiparous sows, (P=0.484), (P=0.279), (P=0.213), (P=0.138), respectively. However, we observed an increased number of unfertilized oocytes in multiparous sows after treatment with PMSG+hCG as compared to control animals (P=0.041). We also

observed a statistically higher number of embryos after treatment with PMSG+hCG in the separated groups of multiparous sows and prepuberal gilts as compared to PG-600 treated animals. We did not, however, find differences in the number of degenerative embryos between those two separated groups of animals after treatment with PMSG+hCG and PG-600 of both ovaries; (P=0.175), (P=0.344), (P=0.122), and (P=0.055), respectively. We suggest that differences in the number of embryos isolated from both ovaries after these two systems of treatments in prepuberal gilts may be a result of age-dependent different response to gonadotropins and reproductive competence of these females. Keywords: estrus, embryos, gonadotropins. P262 Differences in motility pattern of boar spermatozoa incubated with or without bovine oviductal explants Bergqvist, A-S1,2*, Ramio, L2, Ballester, J2, Flores, E2, Morato, R2, Mogas, T2 & Rodriguez-Gil, JE2 1Division of Reproduction, Department of Clinical Sciences, Faculty of Veterinary Medicine and Animal Science, Swedish University of Agricultural Sciences, SLU; 2Unit of Reproduction, Department of Animal Medicine & Surgery, Veterinary Faculty, Autonomous University of Barcelona Before fertilisation spermatozoa reside in the oviduct for hours-days. The oviductal environment seems to influence the motility and fertilizing ability of the spermatozoa. Material and methods: Bovine oviducts were obtained at a local slaughter house and the epithelial cells milked from them within 1 hour after slaughter. The resulting oviductal explants were incubated over night in TALP media in humified atmosphere, 39°C, 5% CO2. The following morning, the explants were checked for viability, and if viable, co-incubated in STL media, with chilled, diluted centrifuged boar spermatozoa Sperm motility parameters were evaluated with CASA and live-dead with Eosin-Nigrosin staining after incubation 0, 5, 15, 30 and 60 min for both co-incubation with oviductal explants and control samples with only spermatozoa and STL-media. Results: When comparing the motility parameters at 0-15 min there were no significant difference comparing sperm motility parameters between controls and combined sperm and oviduct explants samples. From 30 min incubation there was a significant higher (p<0.05) sperm velocity; VCL (curvilinear velocity), VSL (straight-line velocity), and VAP (average velocity), ALH (lateral head displacement) when comparing the sperm samples co-incubated with oviductal explants to the control samples. Conclusion: A heterologous system with bovine oviductal explants significantly increased the velocity of boar spermatozoa after 30 min of co-incubation. P263 Sow-specific risk factors associated with late pregnancy loss during seasonal infertility in pigs Bertoldo, M*, Grupen, C; Thomson, PC, Evans, G; Holyoake, PK Faculty of Veterinary Science, The University of Sydney Reduced farrowing rate due to late pregnancy loss is a manifestation of seasonal infertility in pigs. This study was undertaken to determine sow-specific risk factors leading to late pregnancy loss during the seasonal infertility period. Age at first mating was considered to be a major gilt-specific risk-factor, whilst older parity sow-specific factors included; parity, wean-to-service interval, lactation length and number of piglets weaned per litter. Logistic regression analysis of these factors was undertaken on 14,835 animals from 3 genetically distinct herds located in 3 different Australian states. These farms exhibited a greater than 5% reduction in farrowing rate during the seasonal infertility period when compared to the rest of the year. Results of the analysis of pooled data revealed that age at first mating for gilts had a significant effect on late pregnancy loss (P < 0.001), with the optimal age for maintaining a pregnancy being 30 to 34 weeks. Parity was a significant factor in one herd (P < 0.001), with the proportion of sows with late pregnancy loss increasing with increasing parity. Sows with a wean-to-service interval of less than 10 days had less than a 20%

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 115 chance of losing their pregnancy after 5 weeks gestation. There was a significant herd × wean-to-service interval interaction suggesting a different effect of wean-to-service interval in each herd. Sows with longer lactation periods had a lower chance of late pregnancy loss (P < 0.05). Sows with a lactation period of 11 days had over a 20% chance of late pregnancy loss compared to those with a lactation length of 21 days. There were no significant effects of the number of piglets weaned per farrowing on the outcome of the subsequent pregnancy. The results of this analysis suggest that higher parity sows with shorter lactations and longer wean-to-service intervals have the greatest chance of late pregnancy loss during the seasonal infertility period. M. Bertoldo is supported by a postgraduate scholarship from the Australian Pork CRC. P264 Morphological evaluation of preantral follicles from Large White sow ovaries Cardoso, RC1*, Oliveira, TM1, Monteiro, C1, Cagnini, DQ2, Amorim, RL2, Oba, E1 1Department of Animal Reproduction and Radiology, São Paulo State University, Brazil; 2Department of Veterinary Pathology, São Paulo State University, Brazil The study of porcine preantral follicles characteristics may contribute for a better comprehension of the mechanisms that are involved in the folliculogenesis during preantral stage. Moreover, preantral follicles are a major source of oocytes, and their utilization as an important tool to store large number of gametes for future use in reproductive programs has already been investigated. In this study 46 ovaries were evaluated, from 23 Large White sows aging around 6 months. After the ovary collection, the ovaries were washed in saline and fixed in 10% formol saline for 24 hours. After that, the ovaries have been embedded in paraffin wax, and the material was sectioned into 3μm thick sections, preparing one slide at each 120 sections. The slides were stained with hematoxilin and eosin. The preantral follicles were morphologically classified as primordial, primary or secondary follicles. Were defined as primordial follicles those containing, around the oocyte, one flattened granulosa cells layer. The follicles that presented one cuboidal granulosa cells layer were classified as primary, and follicles that presented 2 or more cuboidal granulosa cells layers were defined as secondary. The preantral follicles were classified also according to their viability, as viable, moderately atretic or severely atretic follicles. Viable follicles were defined as those with well-ordered and intact basal layers, oocytes with less than 3 cytoplasmic vacuoles and intact germinal vesicles. The follicles that presented oocytes with more than 3 cytoplasmic vacuoles and, initial chromatin decondensation were classified as moderately atretic follicles. And severely atretic follicles were defined as those with seriously damaged oocytes and severe chromatin decondensation. The average values and standard deviations found on the morphological analysis of the follicles were: 61,1 ± 6,8% of primordial, 25,3 ± 5,6% of primary and 13,6 ± 3,3% of secondary follicles. Among all the follicles observed, 11,5 ± 5,5% were considered viable, 26,9 ± 5,1% were considered moderately atretic and 61,6 ± 7,6% were classified as severely atretic follicles. Therefore, the Large White sows that were evaluated in this study presented preantral follicles at similar developmental stages when compared to the results reported previously for other breeds, however, with a higher incidence of atretic follicles. So future studies are necessary to determine if this high rate of atretic preantral follicles is directly related to the Large White breed or to other factors that could have affected these results.

P265 Regulation of porcine sperm function by prostasomes Fischman, ML1, Piehl, LL2, Molejón, MI3, Zampini, MC3, Cisale, HO1*, Miranda, PV3 1Area Física Biológica, Facultad de Ciencias Veterinarias, Universidad de Buenos Aires, Argentina; 2Cátedra de Física , Facultad de Farmacia y Bioquímica UBA , Argentina; 3Instituto de Biología y Medicina Experimental , CONICET , Argentina The mammalian male reproductive tract has the ability to secrete membrane vesicles usually called prostasomes. These vesicles can interact with sperm but the function and relevance of this interaction is controversial. In this report, the effect of vesicles isolated from pig seminal plasma in sperm function was analyzed. Samples were obtained by the gloved hand method. Prostasome-like vesicles were isolated by ultracentrifugation of seminal plasma at 100000 g and molecular filtration on a Sephadex G-200 column. Sperm were diluted in Tyrode medium supplemented with 3 mg/ml BSA and incubated for 3 hs at C under 5% CO2. After incubation, sperm were treated with°39 g/ml) for 30 min to induce acrosomeμLysophosphatidylcholine (LPC, 100 reaction (AR). To analyze the effect of prostasomes on different sperm functions, vesicles (3-fold seminal plasma concentration) were included during the whole capacitation period. Tyrosine phosphorylation (TyrP) was analyzed by Western blot. Apical plasma membranes were obtained by nitrogen cavitation (600 psi) and sequential centrifugation. Cholesterol (Cho) content was determined with the Colestat® kit (Wiener Lab) and membrane fluidity by the order parameter (S) using electron spin resonance (a decrease in S represents an increase in membrane fluidity). Sperm incubation under capacitating conditions increased 6±TyrP in a subset of proteins and made sperm sensitive to LPC (AR= 28 2, p±vs 9<0.05). Prostasomes did not affect the LPC-induced AR. However, the increase in TyrP was partially inhibited. Capacitating 4 ng/106 sperm, p±6 vs. 42±conditions reduced Cho content (27<0.05) 0.009, p±0.007 vs. 0.680±and decreased the S value (0.639<0.01) in apical plasma membranes. The presence of prostasomes during 3 ng /106 sperm±capacitation abolished these changes: Cho content = 47 0.005 (p±and S=0.662>0.05 vs non-incubated cells). In conclusion, prostasomes had the ability to affect some capacitation-associated parameters, such as the increase in TyrP, Cho loss and the increase in plasma membrane fluidity. These results suggest a possible protective role for these vesicles on boar sperm. P266 Viability of boar spermatozoa stored in short and long-term extenders assessed by fluorescent multiple staining (FMS) and computer assisted semen analyzer (CASA) Cremonesi, F*, Maggio, V; Lange Consiglio, A Veterinary Clinical Sci, Large Anim. Reprod. Unit, University of Milano, Faculty of Veterinary Med, Italy The aim of this study was to test a simple and consistent method for the simultaneous evaluation of the integrity of the plasma and the acrosome membranes and the mitochondrial sheath of boar spermatozoa extended in six short-term (A-F) and three long-term (G-I) commercial extenders. Sperm samples coming from healthy and sexually mature boars were incubated with three fluorochromes: propidium iodide specific for nonviable cells; JC-1 specific for functional mitochondria and fluorescein isothiocyanate-conjugated peanut agglutinin (PNA) specific for acrosome status. To validate this technique the results obtained from this fluorescent multiple staining (FMS) were compared with sperm motility assessed by a computer assisted semen analyzer (CASA) and with the standard evaluation of sperm viability by using the eosin esclusion test (EE) and sperm morphology. Sperm evaluations along with bacteriological contaminationc (CFU) were investigated during a 6-12-days period. In our study, differences in sperm viability did not exist between the FMS and the EE tests. Moreover, it was found that the frequency of viable spermatozoa with non-reacted acrosome and intact mitochondria was positively correlated with the rate of motile

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 116 P o s t e r A b s t r a c t s spermatozoa (r2>0.9) regardless of the extender used. In all extender the frequency of motile spermatozoa significantly decreased with the preservation period (p<0.05). At the last day of the experiment, short-extender E and long-extender I, characterized by slightly higher osmolarity and lower pH as determined in our laboratory, showed the highest total motility (55,95±1,89% at the sixth day and 36,56±3.46% at the twelfth day respectively). The rate of progressively motile spermatozoa was very low in all the assayed extenders (14,95%±0,89 since day 0) but this motility can be influenced by the diluition effect, so, sperm motility alone is not an adequate parameter for predicting boar fertility upon extension. In this regard, the FMS test is a potent indicator of sperm motility because it analyses the mitochondrial integrity independently from observable alteration of motility and our results indicated that the low progressive motility was only apparent since the mitochondrial sheath of most spermatozoa was intact. CFU number remained stable during the study period for all extenders and there was no significant correlation between CFU, percentage of motility and dead spermatozoa. In conclusion, the integration of the data obtainable from FMS test and CASA analysis are required for a correct evaluation of boar sperm viability during preservation. P267 Semen characteristics of Hungarian Mangalica boars Egerszegi, I1*; Sarlós, P1; Nagy, Sz 1; Tóth, P2; Rátky, J1

1Department of Reproductive and Cell Biology, Research Institute for Animal Breeding and Nutrition, Hungary; 2Olmos and Tóth Ltd., Hungary Fortunately Hungarian native Mangalica is not an endangered pig breed anymore. The number of breeding stock is increasing continously. In spite of knowledge on female reproductive characteristics of this breed (Arch Tierz. 44: 413-419, 2001; Arch Tierz. 47: 585-594, 2004; J Reprod Dev. 51: 427-432, 2005) we have no data about boars, which could have infact facilitated more effective use of breeding animals in propagation. The objective of this study was to determine quantitative and qualitative semen parameters of fresh ejaculate from native Hungarian Mangalica boars. Altogether 221 ejaculates were collected by gloved hand method from 12 boars (13-24 months of age). Immediately after collection the semen volume, motility %, sperm concentration (Bürker-chamber) and total number of spermatozoa per ejaculate were determined. Samples were prepared for subsequent morpholgical assesment. The percentage of abnormal spermatozoa was evaluated under phase contrast microscope at 400x magnification after staining as described by Cerovsky (Zivocisna Vyroba 21: 361-666, 1976). The mean semen volume was 177.8±18.92 ml with concentration of 490±160 x 106 spermatozoa/ml. Mean number of sperm cells per ejaculate was 894±308.1 x108. A high sperm motility was observed in all samples (75.52±6.78 %). Percent of abnormal spermatozoa excluding sperm cells with distal cytoplasmic droplets (19.6±7.97%) was 5.76±2.20%. No genetically inheritable morphological defect was found during the investigation period. It can be concluded that volume of semen is less, whilst concentration and total number of sperm cells are much more in Mangalica ejaculate than in other commercial breeds. (Founded by OMFB-00507/2007) P268 Immunolocalization of Caveolin-1 and hexose transporters on three steps of the freezing/thawing process of boar spermatozoa Flores, E1*; Ramírez, A2; Angulo, MC2; Castro, MA2; Rauch, MC2; Concha, II2; Rodriguez-Gil, JE1. 1Dept. Animal Medicine & Surgery, Autonomous University of Barcelona, Spain; 2Instituto de Bioquímica, Facultad de Ciencias, Universidad Austral de Chile, Valdivia, Chile The presence of Caveolin-1 and the hexose transporters Glut-1, Glut-2 and Glut-3 was studied by immunolocalization on three stages of the cryopreservation process of boar spermatozoa. The three stages studied are the fresh, cooled to 5ºC and frozen/thawed semen. When we studied the localization of Caveolin-1 no changes were seen in the

three stages studied. Caveolin-1 was located mainly in the midpiece of boar spermatozoa and in some cases a weaker mark appeared at the head. The location of Glut-1 in fresh spermatozoa was mainly at the principal piece of the tail and at the postacrosomal region of the head. When boar spermatozoa were cooled to 5 ºC, the location of Glut-1 changed to a diffuse mark at the head and the end piece of the tail. Furthermore, after the freezing/thawing process, this location further changed to a diffuse mark around the principal and the end pieces of the tail. The location of Glut-2 in fresh spermatozoa was at the principal and the end pieces of the tail, and this location changed to the head membrane when the spermatozoa were cooled to 5ºC. After the freezing/thawing process, this location changed to the principal and end pieces of the tail as seen on the fresh spermatozoa but with a weaker mark. Finally, the location of Glut-3 in fresh spermatozoa was mainly the principal and end pieces of the tail, and in some cases the midpiece and the head. In the cooled spermatozoa, the location did not change but the mark was weaker. After the freezing/thawing process, Glut-3 was located mainly in a diffuse manner at the postacrosomal region of the head and in some cases a weak mark in the principal and end pieces of the tail. All of these results indicate that freezing/thawing induces structural changes in the location of the different hexose transporters. These changes are not related to significant alterations in the distribution of caveolin-marked membrane domains. In this way, freezing/thawing would induce alterations in the ability of boar sperm to modulate its energy requirements without alterations in the distribution of the caveolin-linked membrane regions. Finally, the observed alterations are initiated at the cooling phase of the freezing/thawing process. This stresses the utmost importance of this cooling phase in explaining sperm survival during freezing/thawing. P269 Evaluation of lipid content in porcine embryos cultured in modified conditions Gajda, B1*, Romek, M2, Krzysztofowicz, E2, Smorag, Z1 1Biotechnology of Animal Reproduction, National Research Institute of Animal Production, Poland; 2 Cytology and Histology, Institute of Zoology, Jagiellonian University, Poland It has recently been demonstrated that supplementation of NCSU-23 medium with one of the metabolic regulators – phenazine ethosulfate (PES) has a positive effect on culture efficiency of porcine blastocysts of good quality (Gajda et al., Folia Biol, 2008 in press). These blastocysts had also an increased ability to survive cryopreservation (Gajda et al., Reprod. Fertil. Dev., 2008, in press). It is known that porcine embryos have a considerably higher contents of lipids than other mammalian embryos and the success rates of their cryopreservation appear to be highly correlated with cytoplasmic lipid contents. The PES treatment clearly reduced accumulation of lipids in cultured bovine embryos (De La Torre-Sanchez et al., Reprod Fertil. Dev., 18, 597-607, 2006). In present study, the lipid contents in porcine embryos cultured in medium supplemented with or without PES was determined. Porcine zygotes obtained from superovulated gilts were cultured in NCSU-23 medium supplemented with 0 (control), 0.025 (exp. 1) and 0.05 (exp. 2) µM PES. The culture were performed at 39oC, with 5% CO2 in air, for 96-120 hours up to the blastocyst stage. For each group, ten of the blastocysts were examined for lipid content. We developed a new method for evaluation of total lipid contents in pig embryos based on visualization of lipid droplets using specific fluorescent dye Nile Red and applying confocal scanning microscopy. Blastocysts were fixed with 2% glutaraldehyde and 2% formaldehyde, stained with 10μ/ml Nile Red and analyzed in confocal microscope LSM 510 Meta (Zeiss, Germany). Serial optical sections of each individual embryos were measured by point counting method. Scion Image software, version B 4.02 with Integrated Density parameter (ID) for estimation of lipid droplets was used to measure the intensity of fluorescence (originating from Nile Red). Total intensity (TI) of fluorescence per blastocyst was evaluated as total of ID of each optical section whole embryo. Data were analyzed by test t. Embryos cultured in presence of 0.025 and 0.05 µM PES contained significantly lower contents of lipids in lipid droplets (57,4%;TI=0.574 and 80,3%; TI=0.803, respectively) compared with

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 117 embryos cultured without PES (control, 100%; TI=1.0). In conclusion, our results showed a significant decrease of lipid content in lipid droplets of porcine embryos after in vitro culture in PES-containing medium. The findings also suggest that PES reduced accumulation of lipids in cultured pig embryos. P270 The using of the DSI telemetry implants in the reproductive tract EMG recording in the sows in relation to LH, P4,E2 Gajewski, Z1*, Pawliński, B1, Ziecik, AJ2, Zabielski, R3 1Animal Reproduction, Warsaw University of Life Sciences, Faculty of Veterinary Medicine, Poland; 2Institute of Animal Reprod. and Food Res., Poland; 3Physiology, Warsaw University of Life Sciences, Faculty of Veterinary Medicine, Poland Introduction The method of radiotelemetry system allows transformation of biological signals from animal body into the radio waves. Knowledge on oviduct electrical and motor activity is limited though crucial for understanding the physiology and pathophysiology of the reproductive system. The objective of the present studies was to adapt implantable telemetry technique for uterus and oviducts EMG studies and examine relationship between LH, E2, P4 level and EMG activity of oviduct and uterine horn in sows with induced estrus (PMSG/HCG). Materials and Methods For examinations we used commercial implants (DSI, USA) and silver bipolar electrodes. 11 nonpregnant sows were surgically fitted with TL10M3-D70-EEE (DSI, USA) implants positioned between the abdominal muscles, and 3 silicone electrodes sutured on the left or right oviduct (bulb and mid part) and the corresponding uterus horn. Three signal channels was filtered (high cut-off 50 Hz, low-cut 10 Hz) and amplified (BioAmp, ADInstruments, Australia). A four-channel PowerLab/4e unit and PC computer with Chart v.4.1 (ADInstruments) software were used to record, display and analyze the data. Blood samples were taken from the jugular vein, stored at -20oC, until LH, P4 and E2 RIA analyses. Results Registration was performed on the end of follicular phase of estrous cycle i.e. before beginning of LH surge. A rise of progesterone secretion (1-4 ng/ml) was found 36-40 hrs after preovulatory LH surge. The E2 decrease after the LH surge from 150-180 pg/ml to 75-85 pg/ml. Mean burst duration of ampulla contractions was 30.5 ± 2.4 s and the total duration of electrical activity tested 736.4 s. The same parameters recorded from the uterine horn were 27.0±0.9 and 520.0 s, respectively during 30 min of observation. The frequency of burst was 27 in the ampulla of oviduct and 21 in the uterine horn for 30 min period of recording. The mean amplitude (mV) of spikes inside burst was significantly higher in uterine horn than in ampulla of oviduct (0.86±0.04 vs 0.32±0.01, respectively; p <0.0001) but the maximal amplitude of some single spikes in uterus was 4-8 times higher than in oviduct. The increase of P4 suppressed the EMG activity in the uterus and oviduct and LH relaxed the oviduct contractility. Conclusion This method has a great advantage upon the traditional wire method and older telemetry methods as well since it can be applicable in freely moving and not stressed animals These results indicate that preovulatory LH surge may play a role in relaxation of oviduct contractility. P271 Effect of group-housing during the follicular phase on reproductive performance of gilts Hazeleger, W*; Gerrits, FA; Bouwman, EG; Laurenssen, BFA; Soede, N Department of Animal Sciences, Wageningen University, Wageningen, The Netherlands Group-housing in pig production is common practice during pregnancy nowadays. However, during the phase of follicular development and insemination, usually animals are housed individually, since group housing is expected to cause disturbances in follicular development, estrus expression, timing of ovulation and/or the chance of fertilization due to stressful interactions, especially

during oestrus (Brandt et al. (2007) Dom. Anim. Reprod. 32:122-137). Therefore this study aims to quantify the effects of dissimilar timing of estrus in group housed gilts on reproductive performance. The estrous cycle of gilts (n=48) was synchronized by Regumate® treatment during 18 – 20 days. Eight groups of 4 gilts were created with 2 gilts ending their Regumate treatment 2 days earlier (Early Gilts) then the other 2 gilts (Late Gilts). For comparison 16 gilts were housed individually, also with a 2 day difference in end of Regumate treatment. Follicular development (average diameter of 5 largest follicles) at 48, 96 and 120 h after Regumate was measured by trans-rectal ultrasound. Onset and duration of estrus were assessed and ovulation time was determined by trans-rectal ultrasound at 8h intervals during the estrus period. Gilts were inseminated daily during estrus and slaughtered at Day 5 after ovulation to determine ovulation rate, fertilization rate and average number of accessory sperm cells in the ZP of the embryos. Data were analyzed by Proc GLM (SAS). In the group housed gilts, follicular development differed only at 96 h after end of Regumate (Early Gilts 6.0±.1 mm; Late Gilts 6.4±.2 mm; p<.05). Further, Early Gilts ovulated at 135±3 h and Late Gilts at 123±4 h after end of Regumate (p<.05) and estrus ended 148±4 and 137±4 h after end of Regumate respectively (p<.05). No differences in fertilization rate or accessory sperm numbers were detected. In individually housed gilts, no differences between Early Gilts and Late Gilts were detected in any of the measured parameters (p>.05). On average, individually housed gilts compared to group housed gilts showed earlier onset of estrus (91±3 vs. 100±3 h after Regumate) and longer estrus duration (53±3 vs. 43±2 h; p<.05), but were similar in timing of ovulation (127±3 vs. 129±2 h) and end of estrus (143±3 vs. 143±2 h after Regumate respectively; p>.05). It is concluded that possible stressful events due to group-housing of gilts during the (pro-) estrus period do not have the expected negative effect on reproductive performance, although small changes in timing of ovulation and estrus expression are induced. P272 Influence of seminal plasma on IL-1β and IL-6 mRNA expression in the pig endometrium Jiwakanon, J1*; Berg, M2; Fossum, C2; Persson, EM3; Dalin, AM1 1Dept. of Clinical Sciences, 2Dept. of Biomedical Science and Veterinary Public Health, 3Dept. of Anatomy, Physiology and Biochemistry, SLU, Uppsala, Sweden It has been shown that semen induces uterine immune response and that seminal plasma may regulate uterine cytokine expression. The aim of the present study was to evaluate if seminal plasma per se affects the expression of the pro-inflammatory cytokine, interleukin-1β (IL-1β) and IL-6 in the porcine endometrium. Sixteen gilts were inseminated once, 15-20 h after standing reflex, with fresh semen diluted in BTS (extender) (n=4), seminal plasma (n=4), sperms isolated by colloidal centrifugation and diluted in BTS (n=4) or BTS alone (n=4). The gilts were slaughtered 5–6 h after insemination and uterine samples were taken immediately either plunged into liquid nitrogen and stored at -80 °C until analyzed for mRNA quantification or immersion fixed in 2% paraformaldehyde for immunohistochemical staining. IL-1β and IL-6 mRNA expression level in endometrium, was quantified by real time PCR using TaqMan-probe normalized to the geometric mean of two housekeeping genes, hypoxanthine-guanine-phosphoribosyl-transferase (HPRT) and cyclophilin. Moderated expression of IL-6 and low expression of IL-1β mRNA was observed in all gilts, however, no significant differences among treatment groups could be detected for the amount of IL-1β and IL-6 mRNA expression in endometrium. Immunoreactive IL-6 protein was presented primarily in the surface and glandular epithelial cells of the endometrium as well as in smooth muscle cell of uterus (IL-1β was not analyzed with immunohistochemistry). Thus, the results suggest that seminal plasma per se has no early effect on the level of IL-1β and IL-6 mRNA in the endometrium. Keywords: gilt, IL-1β, IL-6, endometrium, and seminal plasma

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 118 P o s t e r A b s t r a c t s P273 Modifications of prostaglandin synthesis enzymes gene expression in the porcine oviduct after intrauterine infusion of seminal plasma Kaczmarek, MM*; Krawczynski, K; Kiewisz, J; Ziecik, AJ Department of Hormonal Action Mechanisms, Division of Reproductive Endocrinology and Pathophysiology, Institute of Animal Reproduction and Food Research, Polish Academy of Sciences, Olsztyn, Poland Introduction Recent studies have indicated that introduction of semen/seminal plasma (SP) into the female reproductive tract orchestrates striking molecular and cellular changes that facilitate embryo development, conception and pregnancy. These changes were also observed in the expression of enzymes of prostaglandin (PG) synthesis pathway, however until now only seminal-induced expression of PGHS-2 (prostaglandin-endoperoxide synthase 2) mRNA in the porcine endometrium has been showed. Since the oviduct plays a decisive role in reproduction providing a beneficial environment for gamete maturation, fertilization and the early embryonic development we have investigated whether intrauterine infusion of SP can modulate PG synthesis in the porcine oviduct through regulation of prostaglandin synthesis enzymes gene expression. Methods Fifty six synchronized crossbred gilts received 100 ml intrauterine infusion of either SP or phosphate buffered saline (PBS; control). Oviducts were collected 1, 3, 5 and 10 Day(s) after SP or PBS-treatment. Expression of PGHS-2, PGF synthase (PGFS), PGE synthase (mPGES-1), PG 9-ketoreductase (9-KR) and PGI synthase (PGIS) mRNA in oviducts was assessed by the real time PCR. Results Among tested enzymes only PGFS and 9-KR mRNA were significantly lower (4.6- and 2.1-fold, respectively) in oviducts 24 h after SP infusion into the uterine horns, when compared to PBS-treated animals (P<0.01 and P< 0.05, respectively). This decrease was transient and by Day 5 mRNA levels of PGFS and 9-KR were comparable in SP- and PBS-treated animals. In contrast, gene expression of PGHS-2, mPGES-1 and PGIS was not significantly affected by the SP treatment in all testes periods. Conclusions We showed, for the first time, that intrauterine infusion of SP can alter PGFS and 9-KR expression in the porcine oviduct. Thus, it is possible that SP-induced lower expression of PGFS and 9-KR, which converse PGE2 to PGF2α, in the porcine oviduct may act in favor of PGE2 action as a mediator of early embryonic development. This work was supported by the Polish Ministry of Science and Higher Education (grant No. 2 P06D 002 30). J. Kiewisz is supported by a fellowship of the President of the Polish Academy of Science (Nr 4/S/2007). P274 Quantitative expression of lysophosphatidic acid receptor 3 gene in porcine endometrium during the periimplantation period and estrous cycle Kaminska, K1*; Wasielak, M1; Bogacka, I2; Blitek, M1; Bogacki, M1

1Institute of Animal Reproduction and Food Research of Polish Academy of Sciences, Poland; 2Department of Animal Physiology, Faculty of Biology, University of Warmia and Mazury, Poland Lysophosphatidic acid (LPA) is glycerophospholipid that stimulates oocyte maturation, preimplantation development of two- or four-cell embryos to the blastocyst, and embryo transport in the oviduct. This multifunctional lipid messenger acts via family of lysophosphatidic acid receptors coupled to G-proteins. One of its receptor, LPA3/EDG7, is responsible for proper embryo implantation as well as embryonic and placental development in mice. In the present study we investigated whether LPA3 also plays role in early pregnancy in the pig as other multiparous species. Therefore, the research evaluated the gene expression of LPA3 by a real time RT-PCR in the endometrium during different stages of pregnancy (6-7, 8-9, 10-12, 13-14, 15-17, 18-20, 22-30) and corresponding days of the estrous cycle (up to day 20). Gene expression of LPA3 was also measured in periimplantation period (day 12-14) in porcine endometrium of animals subjected to

the surgical procedure, in which one of the uterine horns of the gilts was cut transversely and endings were closed by suture. In this way the uterus consisted of one intact uterine horn connected to the uterine corpus. The second horn was detached from the uterine corpus and connected with the contiguous ovary. Using human and rodent LPA3 primers a 619 bp (GenBank: EF137953) of porcine LPA3 transcript was amplified. Sequencing of this fragment let to design the pair of primers to determine quantitative LPA3 gene expression in porcine endometrium. The results revealed that highest transcript level on days 10-12 of gestation in comparison to the remaining periods and during pregnancy on days: 6-7, 8-9, 10-12 and 13-14 in comparison with the corresponding days of the estrous cycle. Higher mRNA level was noted in the horn with developing embryos compared to the contralateral horn, where embryos were not present. Relating facts from this research led to the conclusion that receptor LPA3 seems to be essential during early pregnancy. This higher LPA3 gene expression coincidences of the time of initial implantation and occurs with abundance in the uterine horn which interacts with embryos. Therefore we assume that embryonic LPA acting through LPA3 receptor participate in preparing porcine uterus for implantation. However further investigations are needed to confirm this findings. Thus, western blot analysis is caring out to investigate whether LPA3 protein level reflects gene expression. We are also assessing relation between level of LPA3 and prostaglandins and estrogens synthesis in uterus. P275 The relationship between testosterone level and protein content in boar semen plasma Kauerova, Z.1*; Veznik, Z.1; Kunetkova, M.1; Zajicova, A.1; Svecova, D.1; Liberda, J.2 1Veterinary Research Institute, Brno, Czech Republic; 2Department of Biochemistry, Charles University in Prague, Czech Republic The ejaculate quality is above all evaluated owing to functional analysis of spermatozoa, including their motility, amount, membrane integrity and morfological characteristics. However, the main prediction of spermatozoa to reach the oocyte means to pass through reproduction system of female. This process is accompanied with modification of structure on sperm surface which is mainly carried out by spermadhesins contained in semen plasma. The functional facility of semen plasma (and thus spermadhesin proportion) depends on a state of accessory glands which are directly influenced by testosterone level. In this case, evaluation of protein content in semen plasma related to testosterone level can serve as an important factor for examination of accessory gland function. In the experiment, the testosterone level was measured by competitive radioimmunoanalysis before and after stimulation with GnRH (TPA method – Testosterone Production Assay). Boar semen plasma was obtained in Insemination stations Velké Meziříčí and Grygov. For the analysis of heparin binding and non-binding proteins in semen plasma we used chromatography on hydroxylapatit column. It was proved that the increasing testosterone level leads to general higher protein concentration in boar semen plasma. The level of glycosylated proteins and heparin binding protein concentration correlated with released testosterone after GnRH stimulation. Daily average of testosterone level is generally supposed to be a good marker of reproductive function. As testosterone measurement is afflicted by a daily periodicity, testosterone itself cannot be considered as a good marker, and additional stimulation by GnRH must by done. In contrast to previous facts, glycosylation and protein content of heparin non-binding fraction was not affected by testosterone level. To summarize it, good fertility markers could be found among seminal plasma proteins indeed.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 119 P276 Expression of integrins, transmembrane protein CD9, leukocyte adhesion molecule CD18, and zona- glycoproteins in porcine oocytes isolated from multiparous sows and prepuberal gilts Kempisty, B1*, Antosik, P2, Bukowska, D2, Jackowska, M1, Lianeri, M1, Jaśkowski, JM2, Jagodziński, PP1

1Department of Biochemistry and Molecular Biology, University of Medical Sciences, Poznań, Poland; 2Department of Agricultural Veterinary, University of Agriculture, Poznań, Poland The developmental and meiotic competence of oocytes isolated from age different female donors is well described. However, little is yet known about the fertilization potential of these oocytes. Therefore, the aim of this study was to determine the differences in the expression pattern of sperm-oocyte interaction molecules in oocytes produced by multiparous sows and prepuberal gilts. Using reverse transcription (RT-PCR) and real-time quantitative PCR (QR-PCR) analysis we compared the expression levels of integrins (αL, αM, β1, β6), leukocyte adhesion molecule CD18, transmembrane protein CD9, and porcine zona pellucida proteins pZPs (pZP1, pZP2, pZP3 and pZP3α) in oocytes isolated from multiparous sows and prepuberal gilts. We found statistically significant increased expression of all integrins, CD9, pZP2, and pZP3 mRNA in oocytes collected from prepuberal gilts as compared to multiparous sows (P<0.05). However, we did not observe any differences in the expression of pZP3α, pZP1, and CD18 mRNA between those two groups of females, with values of P=0.518, P=0.376, and P=0.293, respectively. These results indicate a different expression level of sperm-oocyte interaction genes during the investigated lifetime periods. The oocytes isolated from prepuberal gilts demonstrate an increased fusibility and fertilization ability. Decreased expression of investigated genes in oocytes isolated from multiparous sows suggests a lower reproductive potential of these females, which should be considered when the question arises of whether or not they should be used in IVF and breeding programs. Key words: sperm-oocyte interaction molecules, fertilization, pig. P277 Effect of hydrostatic pressure pulse on the life-time of fresh extended boar semen at 15ºC storage and following insemination on pregnancy rate and litter characteristics Kútvölgyi, G1*, Horváth, A2, Molnár, M2, Horváth, G2, Pribenszky, Cs2 1Cryo-Innovation Ltd., Hungary; 2SZIE Faculty of Veterinary Science, Hungary Sublethal stress treatment, namely high hydrostatic pressure (HHP), applied in the magnitude of 300 times the physiological value to fresh boar semen prior to cryopreservation was reported to improve post-thaw motility and fertility as measured by significantly increased litter size. Proteomic studies revealed treatment related elevation of different proteins that may contribute to increased fertility. In the present study preliminary data are shown about how the same pressure treatment protocol influences the life-time of fresh boar semen stored at 15 ºC. We also examined the in vivo effect of pressure treatment of fresh semen to pregnancy rate, litter size, weight, sex ratio and stillbirth. Semen was collected from Seghers boars (n=7), extended individually, cooled to room temperature, then split into two groups. Treatment group was filled into sterile transfusion bags and treated with 300 bar for 90 min at 25 ºC in computer controlled pressure device (Cryo-Innovation Ltd., Hungary). After treatment semen of both groups was placed into a cooling thermostat set to 15ºC. Total and progressive motility was assessed daily for 12 days by CASA system. In Experiment II. semen was prepared, split and treated as above, then Hungarian Large White x Hungarian Landrace sows (n=52) were inseminated with treated or not treated semen. Exp.I.: At day 5 the number of live (TM) and progressive motile (PM) cells was higher in the HHP treated groups (TM: 55.4 +/-27% vs. 64.6+/-23%; PM: 36.6+/-20% vs. 46.4+/-20%: control vs. HHP

treated; p<0.05, n=7). At day 11 in the 5 remaining samples containing survivor sperm, TM and PM was still higher in the HHP treated groups (TM: 43+/-19% vs. 53 +/-14%; PM: 27+/-15% vs. 31.4+/-9%: control vs. HHP treated). Exp.II.: Pregnancy rate, average number of males or females born, stillborn and litter weight were not different between the two groups ( 68% vs. 70%; 5.7+/-0.8 vs. 5.7+/-1.8 – female; 5.6+/-0.6 vs. 5.2+/-1.1 – male; 0.6+/-0.5 vs. 0.4+/-0.6; 15.7+/-2 kg. vs. 16+/-3 kg: HHP treated vs. non treated, respectively). Total litter size and number of live piglets born per sow was higher in the treated group (11.9+/-0.9 vs. 11.3+/-1.4; 11.4+/-0.8 vs. 10.9+/-1.7, HHP treated vs. non-treated, respectively). This preliminary report shows that HHP treatment may provide protective effect in chilled semen storage, as well as it can produce healthy piglets, litters not being different from control in weight, sex ratio, stillbirth. Further field trials are needed to support the effect seen in larger litter sizes. Supported by OMFB-00364/2007 P278 Gross and histopathological evaluation of reproductive system in sows vaccinated against Porcine Reproductive and Respiratory Syndrome (PRRS) Papatsiros, VG.1, Alexopoulos, C.1, Papaioannou, N.1, Kyriakis, SC.2* 1Faculty of Veterinary Medicine, Aristotle University of Thessaloniki, Greece, 2Foundation of Biomedical Research of the Academy of Athens, Greece Introduction PRRS virus (PRRSV) induce reproductive failure in sows, adversely affective their fertility and longevity. There are only a limited number of studies investigating gross and histopathological lessions in PRRSV infected sows. Microscopic examination of the uterus of uncomplicated PRRSV-induced abortion may reveal mild-to-moderate lymphoplasmacytic endometritis and myometritis. Objective The aim of this field study was to evaluate the possible beneficial effects of vaccination of sows with a PRRS ianctivated vaccine (PROGRESSIS®/Merial SAS, France) on their endometrium / myometrium and ovaries. Materials & Methods The study was carried out in a 1100-sow farrow-to-finish pig farm suffering from the endemic form of PRRS, accompanying with a reduction of fertility after t weaning. All gilts/sows of the herd were vaccinated with PROGRESSIS® twice 3–4 weeks apart, except those being 1 week prior to 2 weeks post-service, which were vaccinated with a 3 week delay. A booster vaccination followed, between 55 and 60 days of each gestation in all gilts/sows, for a period of 18 months. At slaughterhouse, the reproductive system of 33 nonvaccinated sows and 47 vaccinated sows, equally distributed among groups as regards their age and partly number, were collected. Gross (thickness and diameter of uterine horn, diameter of ovaries) and microscopic examinations (histopathological examination of ovarian cysts or other cystic formations) were performed in all collected samples. Results No significant differences were noticed from the results of gross examinations between vaccinated and nonvaccinated sows, as the measurements of uterine horn’s thickness / diameter and ovaries’ diameter were within normal levels in both vaccinated and nonvaccinated sows. The presence of cystic formations >2cm was observed, but their frequency did not significantly differ between vaccinated and nonvaccinated sows. The histopathological examination of those cystic formations indicated that they were luteinizing cysts. The results of histopathological examinations did not show lesions of endometritis or myometritis. Conclusion Vaccination of sows with a PRRSV inactivated vaccine had no effect on the reproductive system of vaccinated sows. However, it would be very interesting for future field trials to perform investigations in a greater number of samples. The outcome of such a follow up would give valuable information, since according to our field experience PRRSV infection outbreaks result in a higher percentage of sows with follicular cysts, as evidenced by slaughterhouse checks.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 120 P o s t e r A b s t r a c t s P279 The study on the temperature curve of boar straw frozen semen Hu, JH1, Li, QW1,2*, Jiang, ZL1, Yang, H1, Zhao, HW2 1College of Animal Science and Technology, Northwest A & F University, Yangling, Shaanxi 712100, P.R. China; 2College of Environment and Chemistry Engineering, YanShan University, Qinhuangdao, HeBei 066004, P.R. China The sperm-rich fraction was collected from 10 adult boars by the gloved hand technique. Effects of seven kinds of extender on boar sperm viability, acrosome integrity and membrane integrity were studied in this experiment. The extenders were composed as follow (for 100 ml sterile non-pyrogenic water): Ⅰ2.9g glucose, 1.0g sodium-citrate, 0.2g sodium bicarbonate, 0.03g potassium chloride, 0.06g penicillin, 0.1g streptomycin and 20ml egg yolk. Ⅱ 5.0g glucose, 0.3g sodium-citrate, 0.1g EDTA, 0.25g BSA, 0.06g penicillin, 0.1g streptomycin and 20ml egg yolk. Ⅲ 1.1g glucose, 1.48g sodium-citrate, 2.42g Tris, 0.5g BSA, 0.06g penicillin, 0.1g streptomycin and 25ml egg yolk. Ⅳ 1.5g glucose, 3.0g lactose, 0.8g L-Glycin, 0.06g penicillin, 0.1g streptomycin and 24ml egg yolk. Ⅴ 4.0g glucose, 1.2g sucrose, 0.1g BSA, 0.06g penicillin, 0.1g streptomycin and 24ml egg yolk. Ⅵ 5.1g glucose, 0.18g sodium-citrate, 0.05g sodium bicarbonate, 0.16g EDTA, 0.06g penicillin, 0.1g streptomycin and 20ml egg yolk. Ⅶ 1.48g sodium citrate, 2.42g Tris, 1.1g fructose, 0.06g penicillin, 0.1g streptomycin and 20ml egg yolk. The results showed that the number Ⅲ extender was the best among the seven extenders. After thawing, sperm viability, acrosome and membrane integrity were 51.36%, 75.27% and 51.29% respectively, all parameters were significantly higher than that of other extender (P<0.05). The key step of the freezing procedure was the establishment of temperature curve consisted of the freezing temperature and the cooling rate. The initial freezing temperature was –124～–112℃ and it required 172sec. The thermal balance temperature was –135℃, and it required 46sec. The temperature that the straws were immersed into liquid nitrogen was –187℃. The straws must be throw into liquid nitrogen instantaneously, the pre-freezing temperature above liquid nitrogen was –112～–135℃, and it required 254sec. Key words: Extender, Sperm viability, Temperature curve in frozen semen, Boar P280 Effect of boar seminal plasma on production of oxytocin and prostaglandins from the porcine cervical stromal cells Madej, M1*; Madsen, MT2; Ekstedt, E1; Norrby, M1; Madej, A1 1Department of Anatomy, Physiology and Biochemistry, Swedish University of Agricultural Sciences, P.O Box 7011, SE-750 07 Uppsala, Sweden; 2Danish Pig Production, Axeltorv 3, DK-1609 Copenhagen, Denmark Madsen et al. (2002) reported that mating and the high human stimulation before and during AI of sows elevated oxytocin, while the low and high human stimulation increased PGF2α metabolite (PGFM), which was not seen in the mated group. The elevation of PGFM has been seen not only in conventionally inseminated (AI) sows but even in sows intrauterine inseminated (IUI) (Borg Alexandersen et al., 2005). Again, sows mated by a boar did not display any significant changes in concentrations of PGFM (Borg Alexandersen et al., 2005). Thus, the objective of this study was to investigate effect of seminal plasma on production of oxytocin, PGF2α and its metabolite PGFM, from the porcine cervical cells. Two crossbred gilts were inseminated (AI) either during second or third oestrus. One gilt was slaughtered 4 h after AI and three other 3 days after AI. The genital tract was separated into cervix and uterus with horns and washed with sterile, ice-cold phosphate buffered saline (PBS). The cervix was washed with sterile PBS and placed in ice-cold PBS supplemented with antibiotics for transport to the laboratory. After isolation of cervical stromal cells the viability and cell yield were tested. The separated

cells were cultured on 24-wells plates until the confluence was reached. The incubation of the cervical stromal cells with different volumes of seminal plasma, pooled from two boars with proven fertility, included to the Medium 199 was done for 3 and 24 hours always in triplicate with control to each volume. Collected media were analysed for the content of protein, oxytocin, PGF2α and PGFM. The basal concentration of oxytocin in the collected media from the cervical stromal cells after 3 h incubation was 3.2 ± 0.5 pg/µg protein. Three hours incubation of cervical stromal cells with 1.0 ml of seminal plasma resulted in the highest production of oxytocin (up to 40 pg/µg protein). The basal concentrations of PGF2α and PGFM in the collected media from the cervical stromal cells after 24 h incubation were 8.43 ± 0.50 and 2.94 ± 0.54 pg/µg protein, respectively. Adding of 0.1 ml seminal plasma decreased production of PGF2α and PGFM to 1.62 ± 0.03 and 0.95 ± 0.18 pg/µg protein, respectively. In conclusion, boar seminal plasma has a stimulatory effect on production of oxytocin as well as an inhibitory effect on production of PGF2α and its metabolite PGFM from porcine cervical stromal cells after 3 and 24 h of incubation. This study was supported by Danish Pig Production. P281 Level of lactogenic hormones in blood of gilts and first litter sows during gravidity and post partum Nitovski, A1*, Hera, A2, Milenkovic, M1, Radovic, B1, Grcak, D1, Milanovic, V1, Horea, S3, Gvozdic, D3, Zivkovic, B4 1Agriculture Faculty, University of Pristina; 2Veterinary Faculty, Brno, 3Veterinary Faculty, Belgrade, 4Agriculture Institute, Zemun Polje It is necessary to involve a certain number of guilts into the breeding stock with the aim of maintaining and increasing herd breeding on big farms. First litter sows make the breeding herd younger but they also give rise to the appearance of frequent post-partum complication, such as MMA syndrome, hypo and agalactia, etc. In order to raise pigs first litter sows must have both well developed mammary complex and normal lactation. In addition to genetic and paragenetic factors Neuro-humoral and hormonal regulation also have influence on the development and function of lactic gland. Most of the authors think that primary hormones: Prolactin, Cortisol and Insulin are necessary for lactogenesis. Our research included the monitoring of the concentration of the following hormones in blood of 6 gilts: Prolactin, Cortison and Insulin. We monitored the concentration 1 day after insemination, 30 days after insemination, 10 days before parturition, 1 day after parturition and 7 days after parturition. The determination of hormonal concentrations in serum was performed by application of a set for radioimmunoassay (RAI) of certain hormones. Concentrations of Prolactin were within limits of normal values for breeding pigs, meaning that during gravidity they were lower (60,42 nmol/l) but with the increased level of Prolactin (70,34 nmol/l) after parturition compared with the beginning of lactation. Concentration of serum Cortisol was on some higher level during gravidity (265,30-286,64 nmol/l), in comparison to the period prior to fertilization (253,00 nmol/l). The highest level was on the day of parturition (292,44 nmol/l), most probably due to stressful action of the parturition itself. Later, 7 days after parturition, concentration Cortisol decreases (222,10 nmol/l), probably due to its growing consumption in the processes of gluconeogenesis and lactogenesis. Those values comply with normal values of Cortisol for this category of pigs and Concentration of serum Insulin was statistically and significantly higher one day after parturition (13,04 mIU) and 7 days after parturition (11,33 mIU), in comparison to the period - a day after fertilization (7,33 mIU) and the period during gravidity (5,10 - 6,63 ,IU). Higher concentration of Insulin after farrowing contributes to the increase of glucose concentration in blood, which is the essential substrate of lactose, and that is, in addition to the others, the most important lactogenic role of Insulin.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 121 P282 Changes in oxytocin secretion during intrauterine insemination and mating in sows Norrby, M1*; Madsen, MT2; Borg Alexandersen, C3; Madej, A1 1Department of Anatomy, Physiology and Biochemistry, Swedish University of Agricultural Sciences, P.O Box 7011, SE-750 07 Uppsala, Sweden; 2Danish Pig Production, Axeltorv 3, DK-1609 Copenhagen, Denmark; 365 Rigtrupvej, 8370 Hadsten, Denmark Mating stimuli are known to activate the release of oxytocin in the peripheral blood in sows (Claus & Schams, 1990). It is also known that both exogenous oxytocin and endogenously released oxytocin stimulate uterine activity in oestrous sows (Langendijk et al., 2003). Plasma levels of cortisol were increased in gilts following oxytocin administration (Kotwica et al., 2002). In our previous study we have demonstrated that prostaglandin F2α metabolite (PGFM) dramatically increase in intrauterine inseminated sows at the time when in mated sows there was no production of PGFM and concentrations of cortisol reached maximum (Norrby et al., 2007). The aim of the present work was to monitor and compare the effects of intrauterine insemination and mating on circulating concentrations of oxytocin. Two groups of multiparous sows (Danish Landrace x Danish Large White) were randomly formed and were served during their first oestrus after weaning. Nine sows (IUI-group) were inseminated intrauterinally with 80 ml of extended semen in EDTA using insemination catheter “Deep goldenpig”. The other 8 sows (Boar-group) were mated by Danish Duroc boars. The sows were checked for standing oestrus by means of backpressure test and riding test. Before insemination sows were stimulated after the 5-point stimulation principle and a boar was activated in front of the sow. Blood samples were taken frequently before, during and after service. The blood was collected in heparin tubes containing Trasylol, immediately centrifuged and the plasma was stored at –70°C until analyzed. The quantitative determination of oxytocin in the collected plasma samples was performed by a competitive immunoassay kit from The Assay Designs' Oxytocin Enzyme Immunoassay (EIA) according to the manufacturer’s recommendations with some modifications. Before oxytocin was analysed, the plasma was extracted with acetone and petroleum benzene. Repeated measurement analysis of variance was performed using the MIXED procedure on the generated averages according to the Statistical Analysis System program package. No significant changes in the plasma concentration of oxytocin were seen before and during stimulation of sows from IUI-group. After intrauterine insemination commenced a significant decrease in oxytocin concentrations was seen. In mated sows concentrations of oxytocin significantly increased during premating behaviour and mounting. In conclusion, human stimulation before intrauterine insemination does not activate the release of oxytocin as it is seen in mated sows. * Supported by Danish Pig Production. P283 Effect of an essential omega-3 fatty acids premix on boar’s semen characteristics and fertility parameters Papaioannou, DS.*, Papatsiros, VG., Kyriakis, SC. Hellenic Ministry of Rural Development and Food, Athens, Greece Introduction Little attention has been paid to the possible beneficial effects of diets enriched in n-3 polyunsaturated fatty acids (PUFA) in domestic animal production. Research data underline the beneficial effect of n-3 PUFA’s maternal dietary intake on the reproductive performance of sows. Objective The aim of the present study was to determine the effects of a premix of essential omega-3 fatty acid on boar’s semen characteristics and fertility parameters. Materials and Methods Twelve semen donor healthy crossbred boars of the same genetic background of a commercial farrow-to-finish farm were paired by age and allocated to one of two diets (6 boars per diet). The six boars of the experimental group (EG) were fed daily the experimental diet (2.5 kg/day), consisted of a typical lactation diet supplemented with a premix of essential omega-3 fatty acids at the rate of 2% («Optomega 50»). The six boars of control

group (CG) were fed 2.5 kg of lactation diet daily. The typical analysis of premix was 50% oil, 4% protein, 3% fibre, 27% ash and 23.5 MJ /kg premix DE and its fatty acid profile was C18:2 4%, C18:3 2%, C18:4 2%, C20:4 2%, C20:5 6-8%, C22:5 3%, C20:6 9-11%. Ejaculates were collected at commencement, 6 weeks after and 12 weeks after the start of the experiment. The semen characteristics (semen volume and density, sperm viability and motility, spermatozoa with normal acrosome and abnormal morphologies) were evaluated. A total of 105 multiparous sows (which exhibited weaning to oestrus interval >5 days) were inseminated twice with semen from ejaculates collected as mentioned above. A 2x3 factorial design was set according to the experimental group of donors and the time of semen collection. Return to oestrus rate, farrowing rate, pregnancy duration and litter size at birth, were recorded. Results Feeding essential omega-3 fatty acids for a period longer than 6 weeks increased the proportion of spermatozoa with progressive motility and with a normal acrosome score and reduced the proportion of spermatozoa with abnormal morphologies. The above findings are in contrast with other studies, reporting no improvement in sperm motility or acrosome integrity after fish oil supplementation. Accordingly, there was no significant effect on performance parameters of EG and CG inseminated sows, independently on the time of semen collection, nor any group x time interaction was recorded. Conclusion The long-term dietary use of a premix of essential omega-3 fatty acids in boars promotes their semen quality since it results in a beneficial effect on semen motility and percentage of normal spermatozoa. P284 Effect of a PRRSV inactivated vaccine on health status and semen characteristics of boars Papatsiros, VG.1*, Alexopoulos, C.1, Boscos, C.1, Joisel, F.2, Kyriakis, SC.3 1Faculty of Veterinary Medicine, Aristotle University of Thessaloniki, Greece, 2Merial SAS, Lyon, France, 3Foundation of Biomedical Research of the Academy of Athens, Greece Introduction Porcine reproductive and respiratory syndrome (PRRS) causes clinical signs in boars (anorexia, lethargy, fever, respiratory problems, lack of libido) and adversely affects their semen characteristics. During last decade, the control of PRRS is based on the use of vaccines, but the published data regarding to PRRS virus (PRRSV) vaccination of boars are limited. The majority of studies which include trials with modified live vaccines (MLV), have demonstrated that the use of MLV in boars is under discussion with regard to safety. Objective The aim of the present field study was the evaluation of the effect of boar’s vaccination with a commercial European PRRSV-inactivated vaccine on their health status and the semen characteristics. Materials and Methods Seven healthy crossbred adult boars (1.1-2.2 years old) of the same genetic background were initially vaccinated twice with PROGRESSIS® (Merial SAS/France) 4 weeks apart. Each vaccination was separated by at least 3 weeks from vaccinations against other pathogens and all boars were boostered twice per year, for a period of 18 months. The boars were monitored daily for side effects until 15 days after each PRRSV vaccination. Ejaculates collected 24 h prior, 24 h, and 15 days after each vaccination were involved in the analysis. Semen characteristics (semen volume and density, sperm viability and motility, spermatozoa with normal acrosome and abnormal morphologies), were analyzed with regard to time of semen collection / examination and booster vaccinations. Results No systemic clinical signs and no local reaction on the area of the injection were observed in all boars. Furthermore, they performed normal appetite, behaviour and libido after each vaccination. No changes in semen characteristics were noticed after each vaccination, apart from an increase of sperm viability as vaccination repetitives increased, which is more likely due to the increase of boars’ age than the vaccination itself. Vaccinations resulted in a slight decrease of semen characteristics 24 h after each injection, but their values remained within normal levels and did not influence the semen quality, because the sperm viability and motility remained above 70%,

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 122 P o s t e r A b s t r a c t s as in practice, ejaculates with viability/motility above 70% are required to ensure semen of good quality. Conclusion The results of the present study demonstrate the safety of long-term vaccination of boars with PROGRESSIS®. The above conclusion has huge financial significance, as the production and use of high quality semen is very important for the global swine industry. P285 Ovariohysterectomy by means of endovideolaparoscopy in Large White gilts Parmigiani, E*; Bresciani, C; Di Ianni, F; Bigliardi, E; Morini, G; Vecchi, I; Di Ciommo F; Bertaccini, G Faculty of Veterinary Medicine, Parma University, Italy To the Authors knowledge this technique has not been previously reported. The aim of this study was to develop a laparoscopic technique for ovariohysterectomy (OHE) in pig for reproductive practical reasons and as a model for human and veterinary clinical use. Five gilts 4 months old weighing 25-35 kg were considered. All procedures were performed under general anaesthesia in dorsal recumbency and a neuromuscular block was induced. Traction was placed in order to lift the body wall about 4 cm away from the viscera, a Veress insufflation needle was inserted over the umbilicus and pneumoperitoneum was induced by CO2 insufflation to a pressure of 15 mmHg. In the same place a 10 mm trocar was positioned and a 10 mm laparoscope (angle 0°) connected to a 3 CCD video camera with light source was passed through (Karl Storz Endoscope® equipment). The patient was placed in Trendelenburg position. The laparoscope was used to guide the entrance of 2 trocars away from viscera, one (10 mm) paramedian to the midline on the left and one on the right (5 mm), to provide two operating channels. A grasping forceps, passed through the right cannula, was then used to lift the uterine horn and visualized ovarian vasculature. Ovarian vascular pedicle with broad uterine ligament was cauterized with a bipolar electrocautery (BEC) and transected using a hook shaped monopolar electrocautery (MEC) away from abdominal organs to prevent collateral thermal injuries. The procedure was repeated for the same left structures. The uterine body was grasped, coagulated and transected using BEC and MEC 1 cm proximal to the cervix. The “reproductive system” was then withdrawn through the left cannula. The laparoscope and the cannulas were also withdrawn and CO2 was allowed to escape. The stab incisions were sutured with Vicryl® EP 3.5. All the patients were awake and standing in half an hour. There was no need to convert to the open surgical approach in any case. The mean surgical time was 56±4 minutes. The BEC effectively sealed all vessels and tissues. No postoperative complications were observed. Three trocars allowed all procedures. This paper shows that laparoscopic OHE in the pig is feasible, safe and advisable because does not require an enlarged skin incision or extracorporeal ligation. P286 Immunohistochemical studies on oestrogen receptor alpha (ERα) and progesterone receptors (PR) in the sow oviduct at oestrus and early pregnancy Persson, EM1*, Srisuwatanasagul, K2, Srisuwatanasagul, S2, Dalin, AM3 1Dept of Anatomy, Physiology and Biochemistry, Fac of Vet Med and Animal Science, SLU, Sweden; 2Dept of Anatomy, Fac of Vet Science, Chulalongkorn Univ, Bangkok, Thailand; 3Div of Reproduction, Dept of Clinical Science, Fac of Vet Med and Animal Science, SLU, Sweden Introduction: We have earlier shown in sows, a uterine presence of oestrogen-alpha (ERα) and progesterone (PR) receptor proteins that varied between oestrus and different stages of early pregnancy. However, the presence of ERα and PR in the oviduct of these sows was not investigated and is therefore the aim of the present study. Methods: Eighteen sows were inseminated before ovulation (range 15 – 23 h) and slaughtered as follows: 5-6 h after insemination (group 1), 20-25 h (group 2) and about 70 h after ovulation (group 3), day 11 (day 1 = 1st day of standing, group 4) and day 19 (group 5). Prior to slaughter, blood samples were collected for analyses of plasma

oestradiol-17β (E2) and progesterone (P4). Oviductal samples of three different segments (isthmus, ampulla and infundibulum) were fixed, embedded in paraffin and analysed by immunohistochemistry by use of mouse monoclonal antibodies to ERα and PR. Semiquantitative evaluation of staining intensity respectively proportion of positive cells, was performed under the light microscope. Results: Hormone levels and post-mortem observations: The highest level of E2 was found at oestrus (groups 1) while the P4-levels were high at days 11 and 19 (groups 4 and 5). All sows slaughtered after ovulation were pregnant (groups 2-5). Immunohistochemistry: Varying levels of positive staining could be found in all tissue compartments (surface epithelium, stroma and muscular layer). ERα: The most prominent immunostaining was found in group 1 (at oestrus) in all tissue compartments while both intensity and proportion of positive cells was lower in the other groups, especially in the stroma and smooth muscle at day 19 (group 5). PR: Apparent levels of positive staining were found in all tissues and segments of groups 1-3 (oestrus, 20-25 h and 70 h after ovulation) while a majority of the oviductal cells were negative at d 11 and 19 (groups 4- 5). Conclusions: As for the uterus, ERα- and PR-immunolabelling in the different segments and tissues of the sow oviduct, showed highest levels at oestrus and lower at later stages, especially low for PR at days 11 and 19, although not as early as in the uterus (20-25 h after ovulation), indicating common regulatory mechanisms related to the change from oestrogen to progesterone dominance for both receptors, but not any apparent influence by semen/insemination or pregnancy. P287 Seasonal changes in reproductive function of Mangalica boars Rátky, J 1*; Egerszegi, I 1; Nagy, Sz 1; Fébel, H 2; Tóth, P 3; Sarlós, P 1

1Department of Reproductive and Cell Biology and 2Department of Physiology, Research Institute for Animal Breeding and Nutrition, Hungary; 3Olmos and Tóth Ltd., Hungary Introduction Seasonal effect could be observed in pig semen quality. These seasonal changes can be monitored in the alteration of testes volume too, which is related with hormone and semen production, quantitative and qualitative parameters of the ejaculate. Parallel investigation of these characteristics could give more profound result about the degree of seasonality. Objective Aim of the study was to determine seasonal changes in testicular and endocrine function of Mangalica boars. Methods Nine mature boars were involved in the experiment. Semen was collected weekly for qualitative and quantitative analysis. Volume of the testes was measured as described by Toelle and Robison (J. Anim. Breed. Genet. 102 : 125-132, 1985) in each season. At the same time GnRH treatment was performed to evaluate testosterone productivity of the testes. Basic testosterone level and hormone response to GnRH were determined by RIA. Data were analysed by Statistica 6.0 Software (Friedman ANOVA + Wilcoxon Matched Pairs Test, Spearman correlation). Results Basic testosterone concentrations were distinct in seasons, however significant difference was observed only between summer and autumn samples (p=0.028). The highest median value was measured in autumn (23.41 nmol/ml), and the lowest in summer (11.0 nmol/ml). The testosterone levels after GnRH injection were also diverse with smaller deviations. Effect of seasonal changes was recorded on the volume of the testes. The biggest value was registered in autumn (758 cm3), whilst the testes were smallest in winter (486 cm3). Significant difference in volume was found between autumn-winter (p=0.012) and autumn-spring (p=0.015) relation. The basic and induced testosterone levels were significantly correlated with testes volume in spring (r=0.75 and r=0.77; p<0.05). No signifcant difference was obtained in ejaculate volume and motility % of spermatozoa. The same results were found about sperm concentration and total number of spermatozoa. The incidence of different morphological defects remained under 10% during the investigation period. Conclusion Seasonal changes and relationship could be observed in volume and endocrine function of the testes, which had weak influence on quantitative and qualitative semen parameters in

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 123 Mangalica boars. However, further investigation is necessary to confirm these results. Founded by OMFB 0601-0602/2004. P288 Cystic ovaries in Intermittently Suckled sows: follicle growth and endocrine profiles Soede, N Department of Animal Sciences, Wageningen University, Netherlands Studies have shown that 2-6% of culled sows have cystic ovaries (e.g. Heinonen et al. (1998) Anim Reprod Sci 52: 235-244). Little is known about the aetiology of cystic ovaries. Furthermore, most studies examining hormone profiles of sows with cystic ovaries have used ACTH to induce the cysts. The endocrine profile preceding and during the formation of spontaneously developing cysts is not known. In a number of experiments we attempted to induce lactation ovulation by separating sows from their piglets for a number of hours daily during established lactation (IS; Intermittent Suckling). In these studies, sows repeatedly developed cystic ovaries. The aim of this study is to describe the follicle development, hormone levels and oestrus expression of these sows and of their normally ovulating counterparts. Data came from 3 experiments in which IS-sows were separated from their litters for 12h daily from day 14 of lactation onwards. Control sows were fully lactating until weaning at day 21 of lactation. The total number of IS sows included in the studies was 89, of which 52 (58%) ovulated within 8 days after start of IS and 10 (11%) developed cystic ovaries. Of the 36 control sows, 34 (94%) ovulated within 8 days after weaning and 2 (6%) developed cystic ovaries. Differences were evaluated between cystic sows and their normal ovulating counterparts, using SAS-GLM and taking into account Experiment as a fixed effect. At days 1 to 4 after start of IS or weaning, follicle diameter of sows that developed cystic ovaries was similar to the follicle diameter of the sows that ovulated (P>0.10), but follicle diameter was greater for sows developing cysts from day 5 onwards (P<0.05). Peak levels of E2 were similar (27±2.4pg/ml vs. 26±0.9pg/ml; P>0.10), but in sows that developed cysts, E2 levels did not return to basal levels within 48 h after peak E2. LH basal levels were not significantly different, but the increase in LH after peak E2 was significantly lower in sows that developed cystic ovaries (0.4±0.1ng/ml vs. 3.6±0.3ng/ml; P<0.01). Timing of onset of oestrus was similar, but duration of oestrus was longer for sows that developed cysts (73±11h vs. 52±3h; P<0.05). In cystic sows, no rise in P4 was observed. In conclusion, sows that developed cystic ovaries initially had normal follicle development (based on follicle size and E2 production) and basal LH production, but failed to elicit a pre-ovulatory LH surge. This suboptimal LH response may be related to the relatively early timing after parturition (approximately 20 days) in most of these sows. P289 Effect of organic and inorganic mineral supplementation on seminal quality and adrenocortical activity of boars exposed to heat stress Spessatto, DD1*; Oliveira, CA2; Tol, EV2; Heinemann, R3; Moreira, N1 1Veterinary Sciences Post Graduation Course (CPGCV), Federal University of Parana – Campus Palotina, Brazil; 2Department of Animal Reproduction (VRA) – LDH, University of Sao Paulo, Brazil; 3Veterinary Medicine, Federal University of Parana – Campus Palotina, Brazil Seasonal high temperatures or inadequate nutrition can decrease reproductive efficiency in boars, especially through a reduction in ejaculate spermatozoal number and normal morphology. The aim of this study was to evaluate the effect of organic and inorganic trace mineral supplementation on seminal quality and adrenocortical activity in boars exposed to high environmental temperatures. Organic minerals contain a complex of minerals and amino acids. The experiment was conducted in Southern Brazil. Boars (2 years of age) were divided into three groups to receive inorganic (GIn, n=4) and organic (GOr, n=4) mineral supplementation and a lactation control

diet (GCo, n=5). Inorganic and organic diets contained a premix of inorganic and organic trace minerals, respectively, with the same quantity of each trace mineral, based on NRC nutritional requirements for boars. The lactation diet was based on NRC requirements for lactating sows and contained a higher level of inorganic trace minerals, protein and metabolic energy. Maximum mean environmental temperatures were higher than the normal thermal comfort temperature for boars (26oC) during the experimental period, and were associated with a reduction in semen quality. Results are expressed as mean ± SEM. The semen volume of Inorganic and Organic diet groups were higher than Lactation group animals (345.7 ± 92.6 ml and 338.4 ± 67.8 ml versus 302.5 ± 81.4 ml, respectively; P=0.02). Boars in the Organic diet group had higher sperm concentration when compared to the Inorganic diet group (233.5 ± 76.7 X 106 sptz/ml versus 181.2 ± 77.3 X 106 sptz/ml, respectively; P=0.006). Percentage of normal spermatozoa, evaluated by humid preparation technique (KRAUSE, 1966), averaged higher in the Organic group than both Inorganic and Lactation groups (93.31 ± 5.20% versus 78.48 ± 12.15% and 82.59 ± 17.27%, respectively; P=0.00021). High temperatures (>34.5oC) reduced normal spermatozoa number in all groups, but with significant differences only in the Inorganic and Lactation groups (P<0.05). Mean fecal corticoid concentrations, assessed by RIA in wet samples, were similar among groups (GIn 10,932.77 ± 12,332.00 ng/g; GOr 9,088.60 ± 8,748.61 ng/g and GCo 9,988.20 ± 10,072.27 ng/g). However, negative correlations were found between fecal corticoids and normal spermatozoa percentage (P<0.05). Organic mineral supplementation did not influence adrenocortical response to the stressor agent (heat stress) in this experiment, but was beneficial to seminal quality, reducing some of the heat stress effects in exposed boars. Keywords: stress, heat, semen, swine, organic minerals, cortisol, reproduction. P290 Spermatozoa inhibit breeding-induced cytokine induction in porcine endometrial cells in vivo Taylor, U1*; Zerbe, H2; Seyfert, HM3; Rath, D1; Schuberth, HJ4 1Department of Biotechnology, Institute for Animal Breeding, Mariensee (FAL), Germany; 2Clinic for Ruminants, LMU Munich, Germany; 3Research Institute for the Biology of Farm Animals, Dummerstorf, Germany; 4Immunological Unit, University of Veterinary Medicine, Hanover, Germany The post-mating inflammatory response of the porcine uterus is a well described but poorly understood event with potentially far reaching consequences. The present study was designed to elucidate early endometrial cytokine responses after challenge with various inseminate components. After the establishment of baseline values for the expression of GM-CSF, IL-10, CXCL8, TNF-α and TGF-β in periovulatory uterine endometrial tissue using quantitative RT-PCR, synchronized gilts were inseminated with the semen extender Androhep™ or seminal plasma, both with or without spermatozoa. Endometrial samples were taken 3 hours after insemination and the expression of the aforementioned cytokines was quantified. Simultaneously the recruitment of neutrophilic granulocytes (PMN) into the uterine lumen was quantified, thus enabling a correlation of cytokine induction and PMN-influx. In the absence of spermatozoa the contact with seminal plasma (SP) as well as Androhep™ (AH) caused judged on baseline expression a significant up-regulation (p<0.05) of IL-10 (SP: 1.5-fold; AH: 1.3-fold), TGFβ (SP: 1.5-fold; AH: 1.5-fold), CXCL8 (SP: 2.8-fold ; AH: 7.1-fold) and TNFα (SP: 2.5-fold ; AH: 1.9-fold) in the endometrial cells. In the presence of spermatozoa only CXCL8-mRNA expression was still significantly higher compared to baseline values (SP: 2.8-fold; AH: 4.6-fold; p<0.05). Interestingly, of all tested endometrial cytokines only the expression of CXCL8 after insemination with Androhep™ correlated significantly with the number of immigrated, intra luminal neutrophilic granulocytes (r2=0,51, p<0.05). Most surprising was, however, that the presence of spermatozoa in Androhep™ or seminal plasma resulted in an inhibition or down-regulation of IL-10 mRNA (SP: 0.9-fold; AH: 0.9-fold), TGFβ (SP: 0.9-fold; AH: 0.9-fold) and TNF-α (SP: 1.0-fold; AH: 0.8-fold) expression with expression levels

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 124 P o s t e r A b s t r a c t s similar to or even below baseline values. The collected data suggest a significant and so far not recognized influence of spermatozoa on the regulation of the uterine immune responses after insemination. P291 Effect of dietary supplementation with salmon oil on cryopreservation of boar semen Amorim, LS1, Torres, CAA2*, Amorim, EAM2, Graham, J2 1Department of Biomedical Sciences, Colorado State University, Fort Collins, CO, United States; 2Animal Science Department, Federal University of Viçosa, Minas Gerais, Brazil Cryopreservation of boar semen is not common, as the damage caused to the cells is extensive. The fatty acid composition of boar spermatozoa contain some docosapentaenoic acid (DPA) and docosahexaenoic acid (DHA). The increase in the freezability of boar spermatozoa by enhancing the DHA content of the plasma membranes via changes in the lipid content of the feed is considered. The objective was to find out whether DHA, given as salmon oil supplementation, may have a beneficial effect on cryopreservation of boar semen. Twenty-four boars Dalboard 85, 1–2 years old, were distributed in a completely randomized factorial design (2×3) with two oil sources (soybean and salmon) and three levels of antioxidant (150, 300, and 450 mg of vitamin E/kg). The diets consisted of a basal diet that was supplemented with 35g soybean or salmon oil (SO) per kg diet. During a period of 10 weeks of feeding the diets, one ejaculate from each boar was collected per week. An aliquot of the sperm rich fraction was diluted 1:1 (v:v) in BTS and used for assessment of fresh semen quality and sperm lipid analysis. Semen was diluted with BTS at 30 oC and after kepted at 24 oC for 1 h, and then, centrifuged with centrifugation diluent (CD) and rediluted with a freezing extender (50 ml of 11% lactose in distilled water + 20 ml of egg yolk, + 25 ml of CD, 1.5 ml Equex, 6 ml of 85% glycerol) to a final concentration of 500x106 cells/ml and filled French straws (0.5 ml; Minitub, Brazil) and stored for 1 h at 5 oC. After, samples were frozen 5 cm above liquid nitrogen. Thawing was in a noncirculating water-bath 37 oC for 20s. For determining the fatty acid composition of the spermatozoa, a sample of approximately 15 ml was taken from each ejaculate shortly after collection and centrifuged for 20 min at 1000 x g. The remaining semen was frozen until analysed. Sperm motility, morphology and lipid composition were assessed in fresh and frozen–thawed samples. The DHA increased in the SO-group from 23.3 to 46.7% and the DPA decreased from 11.5 to 5.2% (P<0.01). The concentration of these fatty acids was unchanged in the control group. Eicosapentaenoic acid was not found in any sample. The total number of sperm per ejaculate, motility and quality parameters was increased in the SO-group (P<0.05). Salmon oil supplementation increased the content of DHA in the spermatozoa membranes and improves the freezability. Suported by FAPEMIG, CNPq, Lagoa da Serra, Minitub. P292 Seasonal variation on age at first observed oestrus in Landrace x Yorkshire crossbred gilts in Thailand Tummaruk, P*; Tantasuparuk, W; Techakumphu, M; Kunavongkrit, A Faculty of Veterinary Science, Chulalongkorn University, Bangkok, Thailand Introduction The age at first observed estrus in gilts is associated with their subsequent reproductive performance, longevity and the reasons for culling. Delayed age at first mating in gilts not only increases the non-productive days from entry to conception but also influences reproductive performance. The present study investigated the influence of season on age at first observed oestrus in 5 commercial swine herds in Thailand. Methods The study was carried out on 5 commercial swine herds in Thailand (herds 1-5) and included 10,392 Landrace x Yorkshire (LY) gilts that entered into the herds between Jan 2004 and Mar 2007. The gilts entered into the gilt pools at 80-100 kg BW. The outdoor maximum temperature and average humidity in this area in winter (Nov-Feb), summer (Mar-Jun) and rainy (Jul-Oct) was 32.8°C/64.5%, 35.1°C/70.5% and 33.1°C/75.5%, resp. Boar contact and oestrous

detection was applied to the gilts between 24 and 35 wks of age once or twice a day. The oestrus detection was carried out using the observation of vulva symptoms and a back pressure test. The age at first observed oestrus was analyzed using multiple ANOVA. The statistical model included herd, year, season and interaction between herd and season. Least-square means were obtained and were compared. Results The gilts entered into the gilt pools at 170 d of age and exited from the gilt pools at 230 d of age. Of these gilts, 61% showed first oestrus before sending to the breeding house. The average age at first observed oestrus was 203±29 d. The proportion of gilts that could be detected for the first observed oestrus was 50, 52, 82, 60 and 62% in herds 1-5, resp. The ages at first observed oestrus were 220, 190, 196, 188 and 241 d in herds 1-5, resp. (P<0.001). Gilts showed first oestrus during summer were younger than gilts showed first observed oestrus during winter (P<0.001) and rainy (P<0.001) (202 vs 205 and 207 d, resp). However, the effect of season on age at first observed oestrus differed among the herds. The gilts that showed first oestrus in summer were youngest in 3 herds, oldest in 1 herd and intermediate in 1 herd. Conclusions The present study demonstrated that crossbred LY gilts in Thailand showed first observed oestrus at 203 d of age. Of these gilts, only 61% could be detected for oestrus before sending to the breeding house. A large variation on age at first observed oestrus was observed among the herds. These data indicated that oestrus detection in the gilt pools should be improved. P293 Prostaglandin E2 and F2α synthesis in corpus luteum and uterus during periimplantation period in the pig Wasielak, M*; Kaminska, K; Glowacz, M; Bogacki, M Institute of Animal Reproduction and Food Research of Polish Academy of Sciences, Poland The main luteolytic factor in the pig is prostaglandin (PG) F2α, while PGE2 acts in a luteotrophic manner. The terminal enzymes in PGE2 and PGF2α synthesis are prostaglandin E2 synthase (mPGES-1) and prostaglandin F2α synthase (PGFS), respectively. One of the potential mechanisms of corpus luteum (CL) protection against luteolysis is a retrograde transfer of PGF2α from the venous and lymphatic vessels to the uterine lumen. Additionally, embryonic estrogens on day 11 of pregnancy may initiate PGF2α release into the uterine lumen and increase endometrial PGE2 secretion. Besides uterine also luteal PGs are involved in the autoregulation of CL function. The aim of the study was to determine 1) the expression of mPGS-1 and PGFS genes in porcine CLs and uterine tissues using real-time RT PCR and 2) PGs content in CL uterine tissues and uterine flushings from gilts on days 12-14 of pregnancy and 12-14 of the estrous cycle. For this study a surgically-generated model of porcine uterus was used in which part of the uterine horn was surgically disconnected. All gilts were treated hormonally and then one group was inseminated (n=6). In these gilts embryos developed only in a one of the uterine horns. The control group (n=6) consisted of gilts subjected to the surgical procedure and hormonal treatment but not inseminated. CLs from both ovaries, ipsi (CL1)- and contralateral (CL2) to the uterine horn with the developing embryos, uterine tissues from both parts of the uterus and uterine flushings were collected. The expression of mPGES-1, PGFS genes and mPGES-1/PGFS ratio were significantly higher in CLs of the pregnant gilts compared to CLs from ovaries of the cyclic gilts. There was no difference in mPGES-1, PGFS genes expression and mPGES-1/PGFS ratio between corpora lutea ipsi- (CL1) and contralateral (CL2) to the uterine horn with the developing embryos. The highest content of PGE2 was found in CL1 of the pregnant gilts. The PGE2/PGF2α ratio was significantly higher in CL1 of the pregnant gilts compared to CL from parallel ovary of the cyclic gilts. Both PGE2 and PGF2α concentration in uterine flushings was the highest in horn with developing embryos. There were no differences in PGs content in endometrium between pregnant and cyclic gilts. These results suggest that embryo presence increase the release of PGE2 and PGF2α to the uterine lumen. The activity of the investigated genes in CL is induced by embryonic compounds which are not distributed

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 125 only to the ipsilateral ovary but are transported within the mesometrium to both ovaries in a more systemic manner. Poster 07 - Reproduction of Pet Carnivores P294 IVF of in vitro matured dog oocytes using homologous fresh or frozen-thawed spermatozoa Alhaider, AK1*; Satake, N1, 2; Watson, PF1

1Veterinary Basic Sciences, Royal Veterinary College, UK; 2Institute of Zoology, Zoological Society of London, UK Fertilization is the crucial test of both successful oocyte maturation and sperm cryopreservation. The aims of this study were to investigate the effect of sperm freezing and the influence of sperm donor on the outcome of IVF of oocytes cultured under conditions developed in our laboratory and to investigate the effect of Percoll-wash frozen-thawed spermatozoa on IVF outcome. Cumulus oocyte complexes (COCs) were collected from spay ovaries and cultured in TCM 199 medium supplemented with 0.3 % BSA, 7 μg/ml progesterone, 100 nM each of growth hormone, IGF-I, FGF and TGF-α for 48 h at 39 °C in 5 % CO2 in air in a humidified incubator. COCs were then co-incubated with 1 x 106/ml capacitated-fresh or frozen-thawed spermatozoa from the same dog for 12 h. COCs were cultured for further 48 h before being denuded and fixed. Oocytes were stained with propidium iodide and then evaluated under a laser scanning confocal microscope. Fertilization rate was significantly higher in oocytes inseminated with fresh semen (55.8 vs 37.2 %, P = 0.001). There were no significant differences between oocytes fertilized with fresh and frozen-thawed semen in cleavage rate (26.7 vs 18.5 % respectively) and polyspermic fertilization (41.9 vs 50.0 % respectively). However, significantly more embryos at the 2-cell stage were recorded when fresh spermatozoa were used for fertilization (P < 0.01). Individual analysis of each dog ejaculate revealed differences in their sperm fertilizing ability after freezing. Freeze-thawing significantly decreased fertilization rate in Dogs 2 and 4 but had no effect on spermatozoa from Dogs 1 and 3. When the same analysis was employed for cleavage rate, freeze-thawing significantly decreased the number of cleaved embryos derived from COCs fertilized with semen from Dog 1 only (fresh: 33.3, frozen-thawed: 8.0 %, P = 0.025). Percoll-wash had no effect on fertilization and cleavage rates. In conclusion, freezing-thawing significantly reduced fertilization rate in vitro, but not cleavage rate. Sperm donors influenced fertilization and cleavage rates in both fresh and frozen-thawed semen. Moreover, oocytes matured in vitro under the conditions developed in our laboratory were found to be competent to achieve fertilization and sustain early embryonic development up to 48 h of IVC. P295 Centrifugation and dilution effects on sperm quality and freezability from dog Nicolas, M1, Mata-Campuzano, M1, Gomes-Alves, S2, Garcia-Macias, V1, Alvarez, M1, Tamayo, J1, De Paz, P2, Anel, L1* 1Animal Reproduction and Obstetrics, University of Leon, Spain; 2Cell Biology, University of Leon, Spain Semen processing before cryopreservation in wild animals (electroejaculated) involves centrifugation. Dog ejaculates could be an appropriate animal model to study semen manipulation in endangered wild carnivores, in our case cantabric brown bear (Ursus arctos). The aim of this study was to assess the effects of semen dilution before centrifugation at 4 different dilution rates in dog spermatozoa. Sperm rich fractions of ejaculates from 8 healthy dogs (means concentration 505.72x106 spermatozoa/ml), collected by digital manipulation, were divided into 5 aliquots. 4 were diluted (Tris, glucose, citric acid, antibiotics) at: 1:1 (a), 1:4 (b), 1:8 (c) and 1:16 (d) dilution rates, and the other was not diluted (control) (e). All the aliquots were centrifuged at 600 g for 6 minutes (Centrifuge 2-15, Sigma), then

supernatant was immediately removed. Each pellet was suspended using a freezing extender (centrifugation extender with 7% glycerol and 20% egg yolk) to a final concentration of 100x106 spermatozoa/ml, cooled at -0.25ºC/min and equilibrated at 5ºC for 1 hour. Diluted semen was placed into 0.25 ml straws, sealed (Ultraseal 21, Minitub) and frozen from 5ºC to -100ºC (-20ºC/min) in a programmable cell freezer (Kryo 10, Planer). Straws were plunged into liquid nitrogen until analysis and thawed in a water bath (65ºC 6 s). Semen quality was assessed at 3 different stages: immediately after the collection, postcentrifugation and after thawing. Motility (total motility TM, %; progressive motility PM, %) was assessed with computer assisted sperm analyzer (SCA, Microptic, Barcelona). Viability (%) was assessed by flow citometry using SYBR-14 and propidium iodide staining. Motility parameters decreased according to the increase of the dilution rate. Total and progressive motility had lower values in postcentrifugate (TM: a 72.92; b 74.04; c 71.33; d 61.72; e 72.19; PM: a 29.16; b 24.82; c 17.07; d 16.18; e 29.83) and after thawing samples (TM: a 32.98; b 41.51; c 44.52; d 48.86; e 40.70; PM: a 17.71; b 22.41; c 25.53; d 22.53; e 21.79) than in fresh semen (TM:86.77; MP:50.23). Thus, total motility was lower in postcentrifugate 1:16 diluted samples than in fresh semen showing statistical differences (p<0.05). Centrifugation significantly decreased progressive motility (p<0.05). Viability was not significantly statistical different between fresh (83.47) and postcentrifugate semen (a 79.95; b 80.68; c 82.97; d 74.38; e 78.16). Post thaw samples were not significantly different between dilution rates. This work was supported in part by CICYT (CGL2007-63788/BOS). P296 Intrauterine Insemination with Cat Semen Frozen with Various Extenders Baran, A.1*, Tek, Ç.2, Demir, K1, Sabuncu, A.2, Ozdas, OB.1 1Department of Reproduction and Artificial Insemination, Faculty of Veterinary Medicine, Istanbul University,34320, Avcilar-Istanbul/TURKEY; 2Department of Obstetrics and Gynaecology, Faculty of Veterinary Medicine, Istanbul University, 34320, Avcilar-Istanbul/Turkey The aim of this study was to investigate the post thaw motility and morphological defect rates of cat semen frozen with various extenders and pregnancy rates after intrauterine artificial insemination. Two toms and 14 queens of 2-3 ages under the same managemental conditions were used. Semen was collected by means of an electro-ejaculator under general anesthesia. Semen samples presumed convenient to be frozen relating spermatological traits, were extended with 20% egg yolk bearing Tris-fructose-citric acid (EY-TFC) and 10% egg yolk skimmed milk-glucose-taurine (EY-SMGT) extender and frozen in 250 μl straws. Post thaw motility and morphological defect rates of semen samples extended with EY-TFC extender were 42.85±2.64% and 36.42±2.25% respectively. These values for samples extended with EY-SMGT extender were 45.71±2.97% and 30.71±2.63% respectively. For both extenders, post thaw motility and morphological defect rate values have been efficient for intrauterine insemination and no statistical significance have been observed between the values of both extender groups (p>0.05). To achieve ovulation, queens showing behavioral estrus have received 250 IU hCG (Chorulon®, Intervet, Turkey) via i.m. route 30 hours prior to intrauterine insemination. Under general anesthesia, queens were laparatomised on the medial line and left and right cornua uteri were taken out. Two straws including 25x106 spermatozoa each, have been thawed in 37ºC for 30 seconds and equally injected into both cornua uteri (two different points) by a 20G needle. Pregnancy diagnose was done by a Real Time B-Mode ultrasonography device on the 19th day after intrauterine artificial insemination by detecting the embryonic sacs. One of three EY-TFC group (n=7) queens detected pregnant has aborted and other two had early embryonic death (EED) and pregnancy rate was 42.9% (3/7). In a queen in the EY-SMGT group (n=7) no ovulation took place after the hCG injection. In two of the queens detected pregnant in this group EED occurred and pregnancy rate was 33.3% (2/6) (p>0.05). In conclusion, cat semen extended and frozen with EY-TFC and EY-SMGT extenders, have been successful in post thaw motility and morphological defect rates. However, EED and aborts was thought to

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 126 P o s t e r A b s t r a c t s be due to intrauterine inseminations at two different points. In the future studies, it is suggested that, non-surgical intrauterine insemination techniques are needed to be tried in queens. P297 Assessment of reproductive histology and sex steroid receptor expression in the domestic cat (Felis catus) following chronic exposure to phytoestrogens Bell, K1*, Ugarte, CE1, Tucker, LA2, Roe, WD3, Thomas, DG1 1Institute of Food Nutrition and Human Health, Massey University, New Zealand; 2Waiti Hill, New Zealand; 3Institute of Veterinary Animal Biomedical Sciences, Massey University, New Zealand Phytoestrogens are secondary plant compounds, incorporated into commercially prepared felid diets through the use of soy-derived ingredients. The phytoestrogens genistein and daidzein, have been shown to elicit changes in reproductive tract histology and sex steroid receptor expression in a variety of mammalian species. These phytoestrogens are considered to be potential aetiological agents in the infertility suffered by a large percentage of the captive cheetah (Acinonyx jubatus) population. To investigate this hypothetical role in felid reproduction, domestic cats (n = 6; 4 female, 2 male) were exposed to dietary genistein and daidzein (300µg/g DM total isoflavones) from weaning (8 weeks of age) until approximately 15 months of age. A control group of related cats (n = 10, 8 female, 2 male) were reared under identical conditions and fed the same diet without the addition of phytoestrogens. Reproductive tracts were collected from all animals during routine gonadectomy and processed for histological and immunohistochemical analysis (IHC). Tissues were collected from female animals (mean age 485 days) during inter-oestrous as assessed by vaginal cytology, and from male animals at 350 days of age. Reproductive tracts were assessed for histopathological changes, and other parameters including uterine luminal epithelial cell height and follicular development in females. The expression and distribution of Estrogen Receptor (ER)-α, ERβ and Progesterone Receptor (PR) was assessed in ovarian and uterine tissue using IHC techniques. Wet weight of the reproductive tracts did not differ between groups and all but one tract (treatment group) were within normal expected range of inflammatory cell infiltration. Luminal epithelial cell height was greater in treatment animals (5.39µm vs. 4.36µm; p < 0.05) but no differences were detectable in ovarian histology. Expression of ERα and ERβ was up-regulated in the tracts of treatment animals, whilst PR expression was generally down-regulated, compared to controls (p < 0.05). Tissue- and receptor-specific variation was apparent. Although isoflavones were not found to be uterotrophic, the observed histological changes were suggestive of oestrogenic activity. Furthermore, the ability of isoflavones to modulate the proportional expression of sex steroid receptors may have implications for fertility and fecundity in later life. Future investigations in domestic cats utilising larger sample sizes, regimes including in utero and/or lactational exposure and controlled fertility and fecundity testing are warranted. P298 The effect of GnRH on fertility of alpacas inseminated with frozen-thawed semen Bravo, W1*, Ramos, A2, Alarcon, V3, Ordoñez, C2 1Camelid Veterinary Services, United States; 2Centro Experimental La Raya, Universidad Nacional San Antonio Abad, Cusco, Peru; 3Facultad de Agronomia y Zootecnia, Universidad Nacional San Antonio Abad, Cusco, Peru Gonadotropin releasing factor (GnRH) was used immediately after artificial insemination with frozen-thawed semen in alpacas. GnRH diluted in Tris buffer was deposited in the uterine horn ipsilateral to the ovary containing an ovulatory-sized follicle. Ovulation was induced with hCG (Chorulon, Intervet) 24 hours before artificial insemination in 157 adult female alpacas that were divided into three groups: 58 control, 43 with 0.1 μg GnRH, and 56 with 1 μg of GnRH (Fertagyl, Intervet). There was no difference in ovulation percentage

between the three groups, with 72.6% of females ovulating. There was no significant difference in pregnancy at 21 days between the two dosages of GnRH, with 75%, and 76.2% of females being pregnant for 0.1 μg and 1.0 μg GnRH, respectively; however, 65% of females of the control group were pronounced pregnant, which is significantly different than the females that received GnRH (P<0.05). The ovulation percentage was in agreement with previous reports for alpacas. This study suggests a paracrine effect of GnRH, when used at the time of insemination of female alpacas with frozen-thawed semen, that might be used in programs of artificial insemination in this species. P299 Distribution of oestrogen receptor alpha and progesterone receptor and leukocyte infiltration in canine cervical tissue Chatdarong, K*; Kunkitti, P; Srisuwatanasagul, S Faculty of Veterinary Science, Chulalongkorn University, Bangkok 10330, Thailand Introduction Cervix serves as a physical barrier of female reproductive tract to prevent ascending infection by mucus secretion and constriction. Changes of the cervical patency are cycle-dependent. In woman, cervical dilatation at labouring is correlated with the extent of neutrophils infiltration. However, mechanisms of cervical dilatation in the bitches are not well understood. This study aimed to investigate the distribution of oestrogen receptor α (ERα) and progesterone receptor (PR) and leukocyte infiltration in cervical tissue of normal bitches during various stages of the oestrus cycle and bitches undergone open- and closed-cervix pyometra. Methods Cervical tissues were collected from bitches subjected to ovariohysterectomy and divided into six groups: inactive (9); follicular (6); early luteal (7); luteal (13); open-cervix pyometra (22) and closed-cervix pyometra (19). The samples were fixed in 4% paraformaldehyde, embedded in paraffin blocks, longitudinally sectioned and placed on two slides. One slide was stained with haematoxyline-eosin and evaluated for leukocyte infiltration. The other was processed for immunohistochemical evaluation of ERα and PR. The cervical tissue was divided into two parts: the uterine part was characterised by a simple columnar epithelium and the vaginal part was characterised by a stratified squamous epithelium. Three tissue layers were evaluated: the surface epithelium; the propria submucosa and the tunica muscularis. An immunohistochemical total score consisted of the addition of intensity and proportional score. Leukocytes were quantified in five microscopic fields of 0.0845 mm2. The statistical models included the effects of groups, tissue layers and cervical parts. The immunohistochemical scores were compared using Kruskall-Wallis test. Differences of the number of leukocytes were analysed and compared using ANOVA and Tukey test. Results The ERα and PR scores were different between groups and between layers (P < 0.05) but not between parts (P > 0.05). Lower ERα and PR scores (P < 0.05) and higher numbers of leukocytes (P < 0.05) were observed in the pyometra groups than the normal bitches. Differences of the ERα and PR scores were not seen between the open- and closed-cervix pyometra (P > 0.05) whereas higher number of neutrophils was found in the open-cervix than closed-cervix pyometra (P < 0.05). Conclusions The ERα and PR expressions in the cervix of dogs are influenced by stages of the oestrus cycle. Neutrophils infiltration in the cervical tissue appears to involve in cervical dilatation in pyometra bitches.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 127 P300 Acrosin activity evaluation in chilled/rewarmed dog sperm during different capacitation times De Los Reyes, M*, Godoy, N; Palomino, J Animal Production, Animal Reproduction Unit, Faculty of Veterinary Sciences, University of Chile, Chile Introduction The acrosome reaction causes release of acrosin, a proteolytic enzyme that facilitates sperm penetration through the zona pellucida. The release of acrosin on in vitro capacitated chilled/rewarmed canine spermatozoa is a time depending process. Thus, the aim of the present work was to study the proteolytic acrosin activity in chilled/rewarmed canine spermatozoa during in vitro capacitation and acrosome reaction. Methods Six ejaculates were collected from four adult dogs. Each ejaculate was liquated into 2 fractions and centrifuged in tris buffer medium. The pellet of one fraction was diluted in fert-talp medium (fresh control sample), and the pellet of the other fraction was diluted in a tris-fructose-citric acid and egg-yolk extender and then cooled at 4º C for 24 h. Sperm samples (fresh and chilled/rewarmed) were centrifuged and the pellet rediluted in fert-talp medium and then aliquoted into four tubes which were incubated separately for 0, 1, 2 and 3 h at 20º. At each time of cultured, acrosin activity was measured by the gelatin-substrate film technique, where enzyme activity is detected by the presence of halos around single sperm resulting from a localized proteolytic digestion of gelatin. Gelatin suspension was placed on pre-cooled slides and fixed in 0.05% glutaraldeyde, washed and kept overnight. Sperm suspensions were placed on the slices and incubated at 38°C in CO2 for 24 h. Slices were stained with Comassie Blue and examined with light microscopy for evidence of digestion. Results Fresh and chilled dog spermatozoa incubated for up to 3 h in fert-talp medium, displayed digestion halos on gelatin films. Those digestion halos were of three different mean sizes: small, medium and large. Acrosin activity as measured by halo diameter on slides coated with gelatin, showed a significant difference between fresh and chilled sperm. A low proportion of large halos was observed in fresh samples at the beginning of culture (time 0 and 1), while chilled sperm showed a high rate of large halos at these times. During the following hours (2 and 3) of culture, fresh sperm showed higher rates of large halos than fresh sperm. Conclusion These results indicate that acrosomal proteolytic activity of chilled/ warmed dog sperm is different throughout the time from that of the control fresh sperm Supported by Grant FONDECYT 1060602. P301 Terminating pregnancy in bitches: compartive study of side effects between four treatments Fila Varela, D1*, Berglavaz, A2, de Leon, J3, Navarro, G3, Morgades, D2, Pereira, O3, Elhordoy, D1, Cavestany, D1 1Animal Reproduction Department, Veterinary Faculty, Uruguay; 2Private Practitioner, Don Quijote Veterinary, Uruguay; 3Private Practitioner, Zoolymar Vet, Uruguay To compare incidence of side effects in four medical treatments to terminate unwanted pregnancies. 166 bitches were assigned to different treatments: Group A: (n=38) aglepristone (Alizine, Virbac, France) (10 mg/kg), two s.c. injections, 24 hours apart, around 25 to 30 days of gestation; Group D: (n=44) dexamethasone orally (0,2 mg/kg two times per day, by 5 days and then 0,1 mg/kg two times per day, during 5 more days) around 28 to 30 days of gestation; Group E: (n=45) estradiol (0,01mg/kg) intramuscularly within 48 hours of mated; and Group L: (n=39) lotrifen (Privaprol, FATRO, Italy) (2,5 mg/kg) intramuscularly within 15 days of mated. In group A, there were no side effects. In group D, the side effects were mild polydipsia and polyuria that disappeared when treatment was discontinued. Moreover, 7 of 44 bitches (15,91%) presented bloody vaginal discharge during 7 days after treatment ended, without general symptoms. In group E, 12 of 45 bitches (26,67%) developed cystic endometrial hyperplasia-pyometra that forced ovary-hysterectomy. In group L, 18 of 39 bitches (46,15%) developed cystic endometrial

hyperplasia-pyometra that forced ovary-hysterectomy. Data were analyzed using X2 test and differences within treatments were considered significant when p<0,01. Agrepistone administration did not present side effects, but had higher cost. Orally administration of dexamethasone appears like a potentially good treatment, considering the low percentage of side effects, low general complications and low cost. Treatments with estradiol or lotrifen for mismating in dogs should not longer be recommended due to had a high percentage (26,67% and 46.15%, respectly) of side effects (cystic endometrial hyperplasia-pyometra). P302 A combination of a GnRH agonist and an antagonist at two different time points in anestrous bitches Valiente, C; Hermo, G; Zugak, K; García, P; Corrada, Y; Gobello, C*

Faculty of Veterinary Medicine, National University of La Plata, Argentina Introduction The slow release GnRH agonists have shown to reversibly prevent canine estrous cycles for periods exceeding one year. However, when agonists are administered to anestrous bitches an initial stimulation of the gonadal axis, manifested as an estrous response, appears before the axis is suppressed [1]. This response constitutes the main undesirable effect of GnRH agonists for contraceptive purposes. The objective of this study was to assess the efficacy of a single injection of the GnRH antagonist, acyline administered at two different time points, to prevent the post agonist (deslorelin) estrous response in anestrous bitches. Material and Methods Fourteen anestrous bitches were randomly assigned to one of the following treatment groups: deslorelin acetate (Suprelorin, Peptech, Australia), 10 mg sc (DA; n = 6), the same deslorelin treatment combined simultaneously (DA&ACY; n = 3), or 48 hours apart (DA&ACY+2; n = 6) with acyline (NICHHD, NIH, USA) 330μg/kg sc. The animals were examined daily for detection of post treatment estrous response. Three weeks after its onset ovulation was tested by progesterone serum determination. Data were statistically analyzed. Results The appearance of estrous response and ovulation did not vary among treatment groups (P > 0.05). They occurred in 6/6, 3/3, 5/6 and 5/6, 2/3, 4/5 of the animals of the DA, DA&ACY and DA&ACY+2 groups, respectively. Estrous response appeared 5.0 ± 1.2, 10 ± 1.0 and 24.2 ± 11.7 days after treatment in the same groups (P = 0.1). Conclusions The GnRH antagonist, acyline, administered at two different time points after a GnRH agonist failed to prevent estrous response in most of these anestrous bitches. Although, in the antagonist treated groups, estrous response had a tendency to appear later. These findings suggest a postponement of the stimulation period during the peak antagonistic effect. Further studies with repeated or higher doses of antagonists are necessary. Acknowledgements This study was funded by the National Agency for Scientific and Technological Promotion, Argentina (Grant PICT 38376/05). The authors thank to NICHHD, NIH, USA and Peptech, Australia for drug provision. References Wright PJ, et al. 2001. The Suppression by Progestin of Oestrus Responses of the Bitch to the GnRH Analogue Deslorelin. J Reprod Fertil. 57: 283-8. P303 Distribution of active mitochondria in canine oocytes is related to reproductive cycle stage but can be damaged during IVM culture Iorga, AI*; Valentini, L; De Santis, T; Ambruosi, B; Guaricci, AC; Caira, M; Dell’Aquila, ME Department of Animal Production, University of Bari, Italy Introduction We investigated the effect of the reproductive cycle stage on the distribution of active mitochondria in canine oocytes examined 1) at collection and 2) after in vitro maturation (IVM). Methods Cumulus-oocyte complexes (ooplasmic size >120 µm in diameter) were recovered from 20 bitches divided into five groups

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 128 P o s t e r A b s t r a c t s based on their reproductive status: anestrous (A, n=4), follicular phase (F, n=4), ovulation (O, n=2), early luteal phase (until 15 days after ovulation, EL, n=7) and mid/late luteal phase (MLL, n=3). IVM culture was performed in TCM199 with 10% estrous canine serum (72h, 5% CO2). Oocyte mitochondrial (mt) distribution pattern was revealed after 30’ incubation in 280 nM MitoTracker Orange CMTM Ros and confocal laser scanning microscopy. Data were analyzed by Chi-square Test. Results In oocytes examined at collection, three mt patterns were found: I) small granules diffused throughout the cytoplasm; II) diffused tubular networks; III) pericortical tubular networks. Significantly higher rates of oocytes showing heterogeneous mt patterns (II and III) were obtained from bitches in F (21/28, 75%) and in O (23/24, 96%) compared with bitches in A (4/13, 31%; F vs A: P<0.05; O vs A: P<0.001), in EL (27/44, 61%; O vs EL: P<0.01), or in MLL (0/9, 0%; F vs MLL: P<0.05; O vs MLL: P<0.001). In cultured oocytes, the maturation rates (MII+PB) did not differ statistically among reproductive stages (1%, 1/72 vs 6%, 12/189 vs 2% 1/58 vs 4% 2/47 vs 9%, 5/53, for oocytes from bitches in A, F, O, EL and MLL, respectively). The only oocyte from an A bitch had reticular mt pattern. The 12 oocytes from bitches in F showed tubular networks (3/12, 25%) or granular mt distribution (9/12, 75%). The only oocyte from an O bitch and all oocytes from bitches in EL (n=2 oocytes) and from bitches in MLL (n=5 oocytes) showed granular mt distribution. Conclusions Our data demonstrate that the distribution of active mt in canine immature oocytes is related to cycle stage. However, the used IVM culture system did not yield high MII rates as well as mt distribution patterns, such as pericortical or perinuclear, expressive of full cytoplasmic maturation. This compromised oocyte energy status may be one of the factors responsible for overall reported low MII rates in this species. P304 Semen Quality of Dogs Naturally Infected by Leishmania Sp. Previous Note Koivisto, M*; Martins, M; Carreira, J; Labat, E; Lima, V; Perri, S

São Paulo State University, Araçatuba, Brazil Introduction The American Visceral Leishmaniasis (LVA) affects three times as many men as women. Degenerative lesions may occur in the testis which are associated with the presence of lymphocytes and macrophages infiltration containing amastigotes forms with the consequent degeneration of spermatogonia. The dog is recognized as the most important reservoir for LVA. The goal of the present study was to evaluate spermatozoon changes associated with the natural infection in dogs by Leishmania spp. Methods Thirteen dogs were divided into two groups: group of G1, three dogs serologically negative and group of G2, 10 dogs serologically positive by the ELISA method, were submitted to orchiectomy. The semen was transferred manually through massage of the epididymis and ductus epididymis to a Petri dish containing 200 μL of saline solution heated at 37°C. Motility, sperm morphology, chromatin, membrane and acrossome integrity and mitochondrial function were evaluated. Sperm alterations were classified as major and minor defects (Blom, 1973). For statistical analysis, data were converted into arcsin√% and the t test was used to compare the two groups independently. Results The mean values of motility were 66.7% and 47.5% for the group of G1 and G2, respectively. The total morphological sperm abnormalities were 46.7% (G1) and 63.2% (G2). The values for major defects were 27.3% (G1) and 46.9% (G2), showing higher proportions for proximal cytoplasmatic droplets (PCD) of 19.3% (G1) and 34.8 % (G2). Minor defects showed values of 19.3% (G1) and 16.3% (G2). The injured DNA average was 5.7% (G1) and 24.6% (G2). The fluorescent stains showed an average of 35.3% and 32.8% for membrane integrity, 24.7% and 18.0% for acrossome integrity and 25.3% and 3.2% for mitochondrial function for the groups of G1 and G2, respectively. There was no significant difference between the groups, with the exception of the total morphological defects (P<0.05).

Conclusion The degree of testicular degeneration is proportional to the severity of clinical signs and lesions suggestive of visceral leishmaniasis. In the group of G2, symptomatic and asymptomatic animals were observed; therefore this may explain the great variation in individual results. In both groups, the PCD showed increased levels due to the collection method, but were higher in the serologically positive group providing evidence that the percentage may be linked to the disease. This preliminary study showed that the serologically positive group has to be classified according to the severity of the clinical symptoms. P305 In vitro evaluation of canine sperm cells frozen with different concentrations of low-density lipoprotein of hen egg yolk Neves, MM.1*, Henry, M.1; Heneine, LGD.2 1Clinics and Surgery Department, Veterinary School, Federal University of Minas Gerais, Brazil; 2Immunology and Bioproducts Laboratory, Ezequiel Dias Foundation – FUNED, Belo Horizonte, MG, Brazil Introduction Many researches have reported that low-density lipoprotein (LDL) of hen egg yolk acts positively on protecting spermatozoa submitted to low temperatures1,2. Studies using LDL for freezing canine semen are rare. The objective of this work was to evaluate the effect of different concentrations of LDL on the survival of frozen canine spermatozoa. Methods LDL extraction followed methodology described by Moussa et al. (2002) modified by Neves et al. (2007), using 50% of ammonium sulphate. Hen egg yolk and purified LDL were evaluated by Lowry´s procedure and SDS-PAGE. Four ejaculates per dog (n=4) were collected by digital manipulation. Sperm morphology and motility were evaluated and semen was centrifuged at 755x g for 7 minutes. Sperm pellets were diluted in the following extenders: T1 – Tris-citric with 5% glycerol and 20% egg yolk (120mg of protein), Tris-citric with 9.64mg (TII), 19.28mg (TIII) and 24.1mg (TIV) of LDL. Diluted semen was frozen in 0.5mL straws using a programmable system (TK 3000-TETAKON – Brazil). Cooling rates were as follows: from room temperature to 5ºC, -0,5ºC/min and –20ºC/min from 5 to –120ºC. Samples were allowed to equilibrate for one hour at 5ºC. Parameters evaluated post-thawing were: progressive motility (PM), functional integrity of tail membrane (hiposmotic test-HT) and structural integrity of sperm membranes using CFDA-PI fluorescent dyes. Statistical analysis was performed using the Latin square, the Kruskall Wallis test and ANOVA using the Instat program. Results and conclusion The results showed no differences of sperm PM between treatments (TI: 54.4±5.8; TII: 60±11; TIII: 52.5±9.5; TIV: 61.2±7.5%). There was no difference in the reactivity of sperm cells to the HT after thawing (TI: 19.1±13%; TII: 14±11; TIII: 22.5±12; TIV: 25.7±2.7) (p≥0,05). The same trend was observed for the structural integrity of the sperm membranes. As described by Moussa1 and Juliani3, LDL is efficient in protecting sperm cells during the freezing and thawing processes. In these studies, the LDL used was based on v/v but not on LDL concentrations. In the present work the lowest quantity of LDL used showed to be as efficient as the control extender to protect canine sperm during the freezing process. References (1) Moussa et al. (2002). Theriogenology, 57, 1695-1706.; (2) Neves et al. (2007). In XVII BCAR, Proceedings, www.cbra.org.br; (3) Juliani et al. (2004) In: XV ICAR, Proceedings; Financial support: FAPEMIG. P306 Effects of gonadectomy on the proportion of collagen and muscle in the lower urinary tract of intact and gonadectomised male and female dogs Ponglowhapan, S*, Church, DB and Khalid, M The Royal Veterinary College, University of London, UK Introduction Urinary incontinence is a well-known side effect of neutering in the dog and occurs with greater prevalence in females.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 129 Gonadectomy not only affects hormonal homeostasis but also alters the turnover of different components of the extracellular matrix in urogenital tissues. Collagen is an important component of the bladder and urethral walls and thus crucial for the mechanical properties of normal lower urinary tract (LUT) functions. Collagen synthesis appears to be modified by the hormonal environment, specifically oestrogen and gonadotrophin levels, and receptors for these hormones are expressed in the LUT. Interestingly, the expression of these receptors varies between intact and gonadectomised dogs. The objective of the present study was to determine whether there is any difference in proportions of collagen and muscle tissues in the LUT of intact and gonadectomised male and female dogs. Materials and Methods All the animals used in this study were clinically healthy and included 10 intact dogs (5 males, 5 females) and 10 gonadectomised dogs (4 males and 6 females). Four regions of LUT including body and neck of the bladder as well as proximal and distal urethra were collected. The proportion of collagen and muscle were determined by staining the tissue sections with Masson’s trichrome, which highlights collagen as blue and muscle as red. Colour image analysis was performed on digitized computer data using the Leica Q Win Version 3 Quips Programming Software. The proportion of blue and red staining within each image was calculated to determine relative proportions of collagen and muscle in each sample. Data were statistically analyzed using Mixed Model ANOVA. Results The proportion of collagen and muscle tissue differed with the reproductive status (intact and gonadectomised) and gender. Gonadectomised dogs had a higher (P<0.001) proportion of collagen and consequently a lower (P<0.001) proportion of muscle in the LUT than intact dogs. These differences between the two reproductive statuses were observed in all of the four regions of the LUT. Of both reproductive statuses, female dogs had a higher (P<0.05) proportion of collagen and a lower (P<0.05) proportion of muscle tissues in LUT compared to male dogs. Conclusions Increased collagen and decreased muscle density observed in the LUT of gonadectomised dogs suggests a structural change associated with different hormonal statuses between intact and gonadectomised animals. Excessive collagen deposits in the bladder and urethral walls may adversely affect their function by reducing the elastic capacity and interfering with tissue contractility. The results obtained in this study suggest a pathophysiological mechanism for the development of incontinence observed in gonadectomised dogs. P307 Use of GnRH antagonists in ovarian remnant syndrome experimentally induced in rats Risvanli, A1*; Kumru, S2; Akpolat, N3; Yildiz, S4

1Faculty of Veterinary Medicine, University of Firat, Elazig, Turkey; 2Faculty of Medicine, University of Firat, Elazig, Turkey; 3Faculty of Medicine, University of Firat, Elazig, Turkey; 4Faculty of Veterinary Medicine, University of Kafkas, Kars, Turkey Introduction The objective of this study was demonstrated the efficacy of Cetrorelix, a GnRH antagonist, in rats with experimentally induced ovarian remnant syndrome. Methods 25 Wistar female rats of 7-8 weeks of age and of 200-250 g were used. The rats were randomly divided into 5 groups: the first group was used as control group; the second and third groups underwent sham operation; and the fourth and fifth groups underwent bilateral hemiovariectomy. At the first proestrus detected by vaginal cytology from post-operative day 2, the animals in groups 1, 2 and 5 received placebo and animals in the group 3 and 4 received Cetrorelix subcutaneously. In the study, the Kruskal-Wallis Variance Analysis was used for the comparison of the results of vaginal irrigation, histopathological examination, and of blood FSH and LH values, and the Mann Whitney U test was used for determination of the differences between the groups. Results It was determined that according to vaginal cytology results, estrus-like cytological changes disappeared in a shorter time and according to histopathology results, the number of follicle were fewer in the ovarian remnant syndrome-induced and Cetrorelix-injected 4th

group (P<0.05), but there was no difference between the groups for FSH and LH concentrations. Conclusions Ovarian remnant syndrome is a complication of bilateral ovariohysterectomy. In cases with this syndrome, certain treatment is possible with re-operation. However, it may not always be possible to perform an operation, or even if operated, it is difficult to determine the place of the residual ovarian tissue. In this study, it has been determined that the use of Cetrorelix as a GnRH antagonist in rats with ovarian remnant syndrome, reduced the duration of estrogenic affect. P308 Brucella canis in Colombia, a disease without control Giraldo-Echeverri, CA.1, Taborda, N1, Palacio, LG.2, Ruiz, ZT.1*, Olivera-Angel, M1 1Grupo de Reproducción - Fisiología y Biotecnología, Facultad de Ciencias Agrarias, Universidad de Antioquia, Colombia; 2Facultad de Ciencias Agrarias, Universidad de Antioquia, Colombia Brucella canis was first isolated by Carmichael (1966), who identified it as a small, intracellular gram-negative cocobacillus, which forms rough colonies in culture. Dogs can be seen infected by several types of brucela, including Brucella abortus, Brucella suis and Brucella melitensis, but Brucella canis is the one that is widely distributed and has the most relevant epidemiology. The main symptom in females is abortion in the last third of gestation and in males the most frequent clinical symptoms are acute epididymitis, prostatitis and infertility. Some nonspecific signs in both males and females are lethargy, loss of lybido, premature aging, lymphadenitis, discoespondilitis and anterior uveitis. Infections in humans present a world-wide distribution and are endemic in Latin America, having an impact on Public Health, but because the symptoms are nonspecific and few specific tests exist, the incidence of brucellosis in humans is poorly known. In kennels, Brucella canis has been a cause of economic losses by abortions and infertility; many studies were carried out in Latin American countries, but the disease has not been thorougly investigated in Colombia, as a reproductive problem between dogs but also as a Public health problem. We carried out an epizoological survey on 1467 sera from domestic and kennel dogs, with 2M-RSAT. The percentage of positiveness was 11%. We didn’t found significative statistic associations between breed, age, sex with diagnostic results. Although bacteriological studies are the only methods that have been considered specific, intermittent periods of abacteraemia may occur, and a negative blood culture cannot be used as a criterion for excluding canine brucellosis. Thus, the 2ME-RSAT can be a quick and practical screening test on our region. Close contact between people and infected dogs increases the risk of transmission; however, its impact on public health is probably underestimated due to lack of reporting and inadequate diagnostic services. P309 Effect of different glycerol concentrations on the viability of domestic cat frozen-thawed semen Villaverde, AISB1*; Fioratti, EG1; Melo, CM1; Martin, I1; Papa, FO1; Trinca, LA2; Lopes, MD1 1Department of Animal Reproduction and Veterinary Radiology - Faculty of Veterinary Medicine and Animal Science, UNESP, Botucatu, Brazil; 2Department of Biostatistics; Institute of Biosciences, UNESP, Botucatu, Brazil Research involving cryopreservation of male and female gametes in domestic cats has been growing over the last years aiming to develop techniques that guarantee better success when applied to conservation programs for wild felines. The aim of this study was to compare three different glycerol concentrations of 3, 5 and 7% for freezing domestic cat sperm. Semen samples were collected by artificial vagina from five tom cats aged 2-6 years. Three males were collected three times and two males twice, given a total of 13 ejaculates. After collection, samples were diluted in a Tris-OEP-Glucose-20% egg yolk (TOG) extender and assessed for motility (CASA), plasma membrane

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 130 P o s t e r A b s t r a c t s integrity (PMI) (propidium iodide and carboxyfluorescein diacetate) and sperm concentration. Samples were divided into three equal aliquots, which were first diluted with TOG and, afterwards, with TOG supplement with 10% of glycerol in proportions that permitted final concentrations of 3, 5 or 7% of glycerol. Sperm samples from the same ejaculate contained equal final volume (100 or 150 µL) and sperm concentration (40 to 60 x 106/ mL). After load into 0.25 mL straws, samples were placed in a programmed refrigerator at 5oC for 60 minutes, then in liquid nitrogen vapour during 15 minutes and immersed. Sperm samples were thawed at 46oC for 12 seconds and analyzed immediately (CASA and IMP), 30 (CASA) and 60 (CASA) minutes post-thawing. Data were submitted to statistical analysis by ANOVA and Tukey test, with p < 0.05 taken as significant. Among all post-thaw moments, VAP (average path velocity), VSL (straight line velocity), BCF (beat cross frequency) and STR (straightness) were not different between 3, 5 and 7% of glycerol groups. Higher values for TM (total motility), PM (progressive motility), R (percentage of rapid spermatozoa) and PMI (plasma membrane integrity) were obtained in all evaluated moments after thawing for groups 5 and 7% of glycerol, with no statistical difference between them. Values for ALH (amplitude of lateral head displacement) increased after thawing only in group 3% of glycerol. Group 7% of glycerol exhibited lower VCL (curvilinear velocity) values compared to groups 3 and 5%. Since frozen-thawed sperm samples containing 5 or 7% of glycerol showed better results compared to 3% of glycerol and considering that glycerol is known to be toxic for spermatozoa, we can conclude that a concentration of 5% of glycerol is suitable for freezing domestic cat spermatozoa. P310 Preliminary studies on isolation and culture of the epithelial, stromal and endothelial cells from the uterus of domestic cat-technical report Siemieniuch, M., Skarzynski, DJ.* Institute of Animal Reproduction and Food Research, Olsztyn, Poland The most of the previous experiments concerning feline female reproductive regulations, were based on the hormones plasma levels, morphological examination of ovaries and CL during laparoscopy and behavioral changes in the animals. The local, immuno-endocrine events within the feline ovary and/or uterus, and such interaction between different cells of the endometrium have been largely ignored. Thus, we decided to establish methodology for the isolation and culture of different types of endometrial cells (epithelial, stromal and endothelial cells) from uteri of domestic cat. The main goal of the study is to establish the model for further examinations of local, immuno-endocrine regulations in cat uterus and mechanisms of early embryo development. Uteri of queen were obtained by ovariohysterctomy. A polyvinyl catheter was inserted into the uteri horn, and the end of the horn near the corpus uteri was tied shut in order to retain an enzyme solution for solubilizing the epithelial cells. 1-2 ml of enzyme solution (sterile HBSS containing (dispase I, collagenase I, DN-ase IV and 0.1% BSA) was then infused into the uterine lumen through the catheter. Epithelial cells were isolated by incubation twice at 37,5˚C for 45 min and 20 min with gentle shaking. The cell suspension obtained from the first and second digestions was pooled and washed 3 times by centrifugation in the gradient and finally resuspended in culture medium (DMEM/Ham's F-12; supplemented with 10% calf serum). After isolation of epithelial cells, the horns were longitudinally slit and the surface was scratched. The rest of endometrial tissue were digested in 10-20 ml of the above-described enzyme solution. After 20, 40 and 60 minutes stirring, dissociated cells were collected. For isolation of endothelial cells, horns from intact uterus were cut and minced into small pieces (1 mm3). The mix cells were isolated as described for stromal cells isolation. The pure population of endothelial cells was isolated using Dynabeads® M-450 magnetic beads coated by the lectin BS-1. The cells of each cell type were separately seeded at a density of 1 x 105 viable cells/ml in 24-well plates. The culture medium was changed every 2 days until confluency was reached. When the cells

were confluent the homogenity of cells was estimated using immunofluorescent staining for specific markers of epithelial (cytokeratin), stromal (vimentin) or endothelia cells (von Willebrand VIII factor). The test revealed 95%, 90% and 95 % of purity of the epithelial, stromal and endothelail cells in the culture, respectively. P311 Retroflexion of the urinary bladder in a rottweiler bitch during pregnancy Sontas, BH*; Apaydin, SO; Toydemir, TSF; Kasikci, G; Ekici, H Department of Obstetrics and Gynecology, Faculty of Veterinary Medicine, Istanbul University, Turkey Clinical case A 2.5-year-old, pregnant rottweiler bitch, weighing 29 kg, was presented with a 24-hour’ history of a large mass of tissue visible through the vulvar cleft and difficulty in parturition. Accompanying complaints were loss of appetite and increased licking of the mass. No previous trauma was reported, but the bitch had been continuously barking through the night because of a snake in the garden. The bitch had mated several times with a mixed-breed dog of the same size two months before presentation and one year before the bitch had whelped five live puppies without requiring any veterinary assistance. On clinical examination a large, firm, non-painful round ball-shaped mass of tissue, approximately 10 cm in diameter, was identified blocking the entrance of the vulva. The tissue was clean with no haemorrhage or ulceration. Abdominal ultrasonography demonstrated several fetuses without heart beats and the absence of the urinary bladder in its anatomical position in the abdominal cavity. Ultrasonography of the mass revealed anechoic appearance with no fetal vesicles inside. Vaginal cytology showed the presence of neutrophils and parabasal cells, typical of a bitch in the luteal phase. Haematology, serum biochemical analysis and radiographic evaluation of the mass or the caudal abdomen were not performed because of the cost. Diagnosis of pregnancy, fetal death and retroflexion of the urinary bladder confined to the vagina were made according to the clinical and ultrasonographic findings. Removal of the gravid uterus by ovariohysterectomy was performed and the bladder was manually repositioned. The bitch recovered well and was sent home after the surgical procedure. One week later, the bitch was healthy with no complaints of dysuria, stranguria or urinary incontinence. Two months after the surgery, the owner reported that the bitch was clinically normal with no recurrence of the retroflexion. To our knowledge, this is the first case of a vaginal mass occurring after the retroflexion of the urinary bladder in a pregnant bitch. Discussion A mass of tissue that is visible from the vulva is the most common sign of vaginal hyperplasia, neoplasia or prolapse (Manothaiudom and Johnston 1991). However, in the present case, the mass was associated with the urinary bladder which was retroflexed into the space between the vagina and pelvic wall because of a perineal hernia. Perineal hernias occur most commonly in the male when degenerative changes develop in the muscles of the pelvic diaphragm as a result of hormonal influences or pelvic fractures (Hayes et al. 1978, White and Herrtage 1986, Risselada et al. 2003, Angeli et al. 2005). References 1) Angeli G, Bellezza E, Arcelli R, Padua S. XII Congresso Nazionale Società Italiana di Chirurgia Veterinaria, Pisa, Italy, june 16-18, 2005. www.vet.unipi.it/clınıca/2005sicv/lavoridef/angeli.pdf. accessed in 02 july, 2007. 2) Hayes H M, Wilson GP, Tarone RE J Am Anim Hosp Assoc 1978, 14: 703-707. 3) Manothaiudom K and Johnston SD. Vet Clin North Am, Small Anim Pract 1991, 21(3): 509-521. 4) Risselada M, Kramer M, Van de Velde B, Polis I, Görtz K. J Small Anim Pract 2003, 44: 508-510. 5) White RAS, Herrtage ME. J Small Anim Pract 1986, 27: 735-746.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 131 P312 Estrus induction in bitches by using HUMAN MENOPAUSAL GONADOTROPIN & HUMAN CHORIONIC GONADOTROPIN combination Zahedi Abdi, A No 25,Neshat Ave,Bargh St,Urumieh,West Azarbayjan,Iran-Post Code:5715694884 tel:0098-441-3441977 Fax:0098-21-22707955 In this trial,5 leash of bitches were chosen for inducing of estrus by using the combination of Human Menopausal Gonadotropin (H.M.G) & Human Chorionic Gonadotropin(h.C.G).Such bitches were controlled for nutrition and estrus signs in their new home(place) since 2 months before the beginning of trial. To start the trial,H.M.G(H.M.G,75 IU FSH,75 IU LH approx N.V Organon oss Holland)was injected to all of the bitches (5 leash of dogs)during the first 9 days and by the day of 10th,H.C.G(intervet Holland)was injected I.M to each bitch. Since 1 month before the beginning of treatment and also during the period of treatment and 1 month after the end of treatment, blood progesterone concentration was detected in such bitches and vaginal smears was obtained to recognize the changes in vaginal cytology. The results showed that,all of the bitches show the signs of proestrus and serosangunis discharge from their vulva,8±0.7 days after the beginning of treatment.These signs were continued upto 9.8±1.6 days.In 2 leash of such bitches breeding was seen 2 days after the end of vaginal bleeding and in other 3 bitches the signs of estrus was appeared in the state of split heat.In 2 leash of bitches,that have matted ,the progesterone concentration increased by the beginning of estrus and rised above a critical plateau(>1ng/ml)and reached upto >20 ng/ml, one month later .But in 3 other bitches the progestrone concentration didn't rise above the 1.5 ng/ml A cytology of vagina was interpretated as superficial intermediate cells after the end of treatment. These results show that the combination of H.M.G & H.C.G can facilitate induction of proestrus in the bitches which have no previous history of parturition. Key words : HMG , HCG , dog, , estrus , proestrus Poster 08 - Reproduction of Zoo and Wild Mammals P313 Sperm sex sorting in Asian elephant Behr, B1*, Rath, D2, Hildebrandt, TB1, Blottner, S3, Goeritz, F1, Sieg, B2, Knieriem, A4, Hermes, R1 1Reproduction Management, Leibniz Institute for Zoo and Wildlife Research, Germany; 2Institute for Animal Breeding Mariensee, Federal Agricultural Research Centre, Germany; 3Reproduction Biology, Leibniz Institute for Zoo and Wildlife Research, Germany; 4Zoo Hannover, Germany Introduction The captive population of the Asian elephant (Elephas maximus) suffers from an insufficient reproductive rate to maintain a self sustaining population. This negative trend leads to an increasing demand for assisted reproduction tools with the artificial insemination as new and promising supplement. As mainly females are affected from premature aging processes and husbandry of several elephant bulls involves challenging management situations, there is a strong need for female elephant offspring in captivity. Application of flow cytometric sex sorted spermatozoa in artificial insemination offers the possibility to predetermine the sex of offspring. Objectives The aims of this study were to determine a suitable semen extender and basic parameters for flow cytometric sex sorting of spermatozoa in the Asian elephant. Methods 18 sperm samples were collected by manual transrectal stimulation from one bull. Sperm quality parameters and sex sortability of spermatozoa were evaluated after dilution in three semen extenders and DNA labelling. Following sex sorting process, samples were stored at 4oC for 12h, imitating the long transportation time to the female designated for insemination. Results Only skim milk containing semen extender was determined as suitable semen extender for sex sorting spermatozoa from Asian elephant, providing repeatable, high resolution between X and Y

chromosome bearing sperm populations compared to other extenders. 12 of 18 collected ejaculates could be sex sorted successfully at an average sort rate of 1945.5 ± 187.5 spermatozoa/ sec resulting in a population purity of 94.5 ± 0.7%. Best sortability of spermatozoa was reached after DNA staining for 1.5 - 2h at 37°C. Sperm integrity, progressive and total motility was ≥ 65% after collection, 42.6 ± 3.9%, 48.1 ± 3.3%, 59.4 ± 3.8% after DNA labelling, and 64.8 ± 3.2%, 57.9 ± 5.0%, 70.8 ± 4.4% after sorting process, respectively. After liquid storage of sorted spermatozoa for 12 hours at 4°C, sperm integrity, progressive and total motility was 46.4 ± 5.2%, 33.6 ± 4.9% and 64.8 ± 2.4%, respectively. Discussion This study describes flow cytometric sex sorting of Asian elephant spermatozoa. Quality and purity of sex sorted spermatozoa and a reasonable ability for liquid storage after sorting process provide a promising base for the application of sex sorted spermatozoa in artificial insemination of the Asian elephant. P314 A comparison of three culture media for the incubation of thawed red deer (Cervus elaphus hispanicus) epididymal spermatozoa Domínguez-Rebolledo, AE*, del Olmo, E; Martínez-Pastor, F; Fernandez-Santos, MR, Espinosa, M; Esteso, MC; Soler, AJ and Garde, JJ National Wildlife Research Institute (IREC) (UCLM-CSIC-JCCM) and Institute of Regional Development (IDR), University of Castilla-La Mancha, Spain The suitability of incubation media is of capital importance when conducting IVF or other artificial reproduction techniques (ART) in vitro. In this study we tested the effect of three different culture media on frozen/thawed epididymal spermatozoa from red deer (Cervus elaphus hispanicus). Epididymal spermatozoa are available from hunted males, and use of ART on this species is increasing, thus it is important to assess existing techniques for this kind of samples. Frozen epidididymal samples from nine males were thawed, and diluted to 107 mL-1 in three common media for IVF and embryo culture (SOF, TALP, BGM) and control (freezing extender without glycerol: Tris-citrate-fructose, 20% egg yolk) at 37 ºC 5% CO2 and analyzed at 0, 3, 6 and 9 h. Sperm motility index (SMI) and normal acrosome ridges (NAR) were assessed subjectively (phase contrast microscopy); sperm viability according to YO-PRO-1 staining (necrotic and apoptotic sperm detection: VIAB), and mitochondrial status by Mitotracker deep red (spermatozoa with active mitochondria within VIAB: MT) were assessed by flow cytometry. The effects of storage time and incubation media were analyzed by linear mixed-effects models. All parameters decreased with incubation time (P<0.05) in the four media. SMI (59% at 0 h) was better preserved in any of the incubation media than in control at 6 h (8% vs. 31%; P<0.01), but at 9 h BGM and TALP (33 and 27%) preserved it significantly better than SOF 21% (control: 1%). NAR was lower in BGM at 0 h (65% vs. 75% control; P<0.05), but at 9 h differences vanished (overall 36%). Non-necrotic/non-apoptotic spermatozoa (VIAB) were only 28% at 0 h. Only at 9 h results were higher than control, being the three tested media similar (19% vs. 5% control; P<0.05). Few VIAB spermatozoa had mitochondrial activity at 0 h in control (13%), and dropped to ~1% afterwards. It was well preserved in the tested media, although BGM and SOF rendered higher results at 0 h (87%) than TALP (82%). However, after 3 h BGM and SOF decreased faster and differences disappeared at 9 h, being results still much higher than control (52%). In conclusion, the three media could be used for incubating red deer spermatozoa. Considering motility results, TALP and BGM may be more suitable for red deer epididymal spermatozoa than SOF. Further research must test the suitability of these media regarding IVF success and embryo production. Supported by grants AGL2004-05904/GAN (MEC) and PAC06-0047 (JCCM). Felipe Martínez-Pastor was supported by the Juan de la Cierva program (MEC).

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 132 P o s t e r A b s t r a c t s P315 Supression of ovarian cyclic function and estrous behaviour in captive African lionesses (Panthera leo) induced by the use of subcutaneous implants of the GnRH agonist, deslorelin Guimaraes, MABV1*, Pizzutto, CS1, Braga, DPAF2, Correa, SHR3, Oliveira, CA1, Trigg, TE4 1Animal Reproduction, University of Sao Paulo, Brazil; 2Fertility Dept, Assisted Fertilization Center, Brazil,; 3Veterinary Division, Sao Paulo Zoo, Brazil; 4Managing Director, Peptech Animal Health Limited, Australia Captive maintenance of large carnivores can produce overpopulation, especially with highly prolific species such African lions.This condition tends to promote the inbreeding of captive individuals leading to a reduction of the genetic diversity. The increasing of the captive population also brings the problem of space availability and the consequent increase of fights between captive animals.The aim of this work was to achieve suppression of the ovarian cyclic function and the estrous behaviour in captive African lionesses (Panthera leo) using subcutaneous implants of the GnRH agonist deslorelin. Four captive adult lionesses, with successful breeding history, were treated with subcutaneous implants containing 9.4mg deslorelin acetate (Suprelorin 12®, Peptech Animal Health Pty Limited, Australia). They were followed using serial collection, extraction and dosage of fecal metabolites of estradiol and progesterone during 36 months. The occurrence of estrous behaviour along the same period of time was recorded, as well. During the whole period of the study, an adult vasectomised male African lion was kept within the group in order to detect heat. It was demonstrated that the effect of suppression of ovarian cyclicity and estrous behaviour were achieved in all lionesses and it lasted for 22 and 31 months for two of the animals and more than 36 months for the remaining two. During the time of this study it was observed marked reduction of aggression and improvement of the general body condition. These results strongly suggest that the deslorelin implants can be used for reversible contraception and reduction of aggression in captive lionesses. P316 Effect of a natural diet on the health and reproductive success of captive giant pandas (Ailuropoda melanolueca) Hou, R* Research Center, Chengdu Research Base of Giant Panda Breeding, China The natural diet of giant pandas consists nearly entirely of bamboo. In the 52 years of maintaining giant pandas in captivity in China, however, the diet of these animals has contained a significant amount of concentrated food items such as bovine milk, eggs, beef, corn, rice and wheat. On this diet, captive giant pandas suffer from chronic diarrhea and frequent bouts of intestinal pain and mucous faeces. In September 2005, the Chengdu Research Base of Giant Panda Breeding (Chengdu Panda Base) changed the diet of all its adult and subadult giant pandas from the traditional captive diet to one comprised almost entirely of bamboo and bamboo shoots. In the two years since this nutritional adjustment, the health and reproductive success of the pandas at the Chengdu Panda Base has improved dramatically. The animals no longer have diarrhea, the occurrence of mucous faeces is rare, faecal quality and quantity have improved, the duration of post-weaning diarrhea in cubs has decreased significantly, with no new cases of chronic diarrhea, and the body weights of adult pandas have increased. Preliminary data comparing male reproductive function on the traditional diet with that on the bamboo diet suggests that testicular volume increased from 337.6 cm3 to 446.3 cm3 and abnormal sperm decreased from 54.6% to 28.7%. The number of live births has also improved greatly. In the seven years from 1999 to 2005, live births averaged 63.3% per breeding female (19/30). In 2006 and 2007, these figures increased to 92.9% (13/14). In conclusion, a natural diet that allows ad libitum consumption of bamboo and bamboo shoots and minimal supplementation with concentrates is important to the health and reproductive success of captive giant pandas.

P317 Successful production of Koala pouch young following AI using electroejaculated and extended-chilled semen Johnston, SD1*; Allen, C1; Burridge, M2; Mulhall, S3; Holt, W4; Carrick, F1; Lundie-Jenkins, G5; Curlewis, J1 1The University of Queensland, Australia; 2Dreamworld, Australia; 3Currumbin Wildlife Sanctuary, Australia; 4Institute of Zoology, England; 5Environmental Protection Agency (Queensland), Australia Artificial insemination in the koala using chilled electroejaculated semen provides for a marked improvement in the reproductive and genetic management of captive colonies of koalas in Australia and overseas, as well as making available the option of using semen collected from wild populations to expand restricted gene pools. Dilution of koala semen for artificial insemination is complicated by this species being an induced ovulator and it is thought that ovulation-inducing factors are present in the semen, so that semen extension for preservation purposes might be anticipated to result in a failure to induce ovulation. This study was designed to determine whether artificial insemination using undiluted, extended and extended-chilled semen collected by electroejaculation was capable of inducing a luteal phase and/or the production of pouch young. In Experiment 1, 1 mL of undiluted electroejaculated semen, 2 mL of 1:1 diluted semen and 1 mL of 1:1 diluted semen resulted in 7/9, 6/9 and 6/9 koalas showing a luteal phase respectively; in each treatment 4 pouch young were produced. A second artificial insemination experiment was conducted in which 2 mL of diluted (1:1) semen was deposited in 3 groups of 9 koalas. The first group received semen that had been collected and diluted immediately without chilling, the second group received semen stored chilled for 24 h, while the final group was inseminated with extended ejaculates that had been chilled for 72 h. In the first group, 5 females had a luteal phase but none gave birth. In the second group, 2 of the 5 females that had a luteal phase gave birth, while in the third group, 4 of the 6 females that had a luteal phase produced pouch young. These experiments have shown that it is possible to use undiluted, extended or extended-chilled semen to produce koala offspring at conception rates similar to those achieved following natural mating. These findings represent a significant advance in the use of reproductive technology in marsupials and provide the basis for the shipment of koala semen over long distances. The pouch young produced in this study represent the first marsupials born following artificial insemination using extended-chilled semen and bring the total number of koalas produced by artificial insemination to 31. P318 Hierarchical structure effect over reproductive function in captive collared peccaries (Tayassu tajacu) Mayor, P1, Couron, E2, Jori, F3, Manteca, FX4, Lopez-Bejar, M1* 1Animal Health and Anatomy, Universitat Autonoma de Barcelona, Spain;2Station Expérimentale de Soucoumou,, Chambre d’Agriculture de Guyane, French Guiana;3Tropical Veterinary Medicine and Production, CIRAD, France;4Animal and Food Science, Universitat Autonoma de Barcelona, Spain Introduction The social organization may influence physiological functions, especially the reproductive one. Thus, the study of the effect of hierarchical structure of the herd on reproductive function is essential to improve the efficacy of animal captive breeding systems. A great variation in the reproductive performance of different captive collared peccary females, and the presence in general of two kinds of females has been reported: females with a good reproductive success and continuous reproductive function, and females with no reproductive event. The aim of this study was to determine the relationship between the dominance index status and the estrous cyclicity of collared peccary females maintained in captivity. Material and methods Twelve collared peccary females were kept in captivity on an experimental farm of Chambre d’Agriculture de Guyane at Soucoumou, Kourou (French Guyana). Four experimental groups, composed by 3 females and 1 male, were established in paddocks with an area of 6.09 m2, which resulted in an average occupied space of 1.52 m2 per animal. During an experimental period

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 133 of 90 days, both behavioral and reproductive data were simultaneously collected. Agonistic encounters were recorded and a social dominance index was assigned to each female per group. Sexual cyclicity of females was determined through the study of fecal progesterone and vaginal cytology features every 3 days. Weight and age of all females were also recorded. Results and discussion Cycling females presented heavier body weight than non-cycling females and showed an average estrous cycle length of 28.63 ± 3.55 days (range: 22 to 33 days). Dominant females were more likely to show regular cyclicity, compared with subordinate females. All experimental groups presented at least a cycling, and a non-cycling female. All dominant females were cycling, and all but one subordinate female were non-cycling. This study suggests that there exist a strong hierarchical structure in groups of collared peccary females that largely affects their reproductive function. In captive breeding systems, stress is an important cause of impaired reproductive and maternal performance, throughout mechanisms acting on the hypothalamic, pituitary, ovarian and uterine function. This study pretends to provide information useful to develop new management strategies that minimize any detrimental behavioral and physiological consequences of breeding collared peccaries in groups. The dominance index could act as a limiting factor over the reproductive functionality of the collared peccary. P319 Genome resource bank in Moscow Zoo Maksudov, G1*, Shishova, NV2 1Scientific department, Moscow Zoo, Russian Federation, 2Genom Conservation Laboratory, Institution on Cell Biophysic, Russian Acad. Sci. Introduction In Russia, where natural resources are used intensively, creation of cryobanks is the chance to save many species from extinction. Considering that rare species generally have low number and collection of germ plasm in situ is questionable, zoos are the important source of germ plasm for banking. A practical implementation of this idea is often troublesome. Reproductive data exist only for a few species. They differ from their domestic counterparts, which makes the direct transfer of cryopreservation techniques a real challenge. Moscow "Frozen zoo" program includes three main directions: vital semen collection; post mortal testes; investigation of rare species semen parameters. Materials and methods Semen was collected by electroejaculation (Pulsator-IV, Lane Mfg) with self made probes (mammals), or by massage techniques (birds). The post-mortem testes were excised from dead males and stored at 4°С. Then spermatozoa were recovered from the cauda epididymis, accessed and frozen. Semen assessment was both standard and with sperm analyzer (SFA-500 Biola Ltd). Pellet and straw methods, different extenders were used for freezing. Glycerol for mammals, DMSO and DMF for cranes spermatozoa were used as cryoprotectants Results List of cryopreserved specimens now includes: 47 samples from six males of Siberian crane Grus leucogeranus; 3 samples from two white-naped cranes Grus vipio; one semen sample of Japanese crane G. japonensis and one from sandhill crane G. canadiensis. 8 samples from four Amur leopard males Panthera pardus orientalis; one sample from Amur tiger Panthera tigris altaica; 3 samples from three males of Spectacled bear Tremarctos ornatus, two electroejaculated and one post mortal sample; postmortal sample from one markhor Capra falconeri male 2 post mortal samples from two males of white-tailed gnu Connochaetes gnou; post mortal sample from one East Caucasian tur Capra cylindricornis; 2 samples from European mink Mustela lutreola and 4 samples from American mink M. vison. Also we store goat and donkey semen samples. Some samples from different species were thawed and investigated. Conclusions Genome resource bank is important tool to save genetic material of rare species in zoos, but further applications of cryopreservation techniques are urgently needed. We collaborate with EEP, IZW, Oka Crane Center and supported RFBR, grant N. 06-04-49268.

P320 Deslorelin affects reproduction and behaviour of female western grey kangaroos (Macropus fuliginosus ocydromus) Mayberry, C School of Animal Biology, University of Western Australia, Australia The control of wild animal populations by shooting is becoming less socially acceptable, creating a requirement for more imaginative means of limiting population growth. A promising approach uses depot formulations of Gonadotropin Releasing Hormone (GnRH) agonists. We are investigating the use of Suprelorin®, a depot formulation of the GnRH super-agonist deslorelin, to suppress reproduction as part of an Australia-wide project, the Koala and Kangaroo Contraception Program. Two types of GnRH are found in most mammals. GnRH-I drives the production and release of pituitary gonadotrophins. GnRH-II affects sexual, feeding and possibly other, behaviours. In mice and musk shrew exogenous GnRH-II causes females to eat less when feed is abundant and to restore sexual behaviour that has been suppressed by feed restriction. In November/December 2006 on a reserve in the southwest of Western Australia, we treated 24 free-ranging female western grey kangaroos with 4.7 (n = 8) or 9.4 (n = 7) mg of deslorelin, or a placebo (n = 9). Eleven of the kangaroos were either already pregnant or conceived to give birth between November 2006 and February 2007. None of the kangaroos treated with deslorelin conceived more than 15 days after treatment. Four kangaroos, one each from the placebo and 4.7 mg groups, and two from the 9.4 mg group, disappeared or died from unrelated causes. We monitored the morning attendance of the remaining kangaroos at a feeding station from March to October 2007. All 12 deslorelin-treated kangaroos attended regularly at the feeding station. Six of the 8 placebo kangaroos attended at the feeding station only intermittently after July. Attendance at the feeding station was independent of pouch young. Eight of the 12 deslorelin-treated animals had no pouch young and two more lost their pouch young by May. Three of the eight placebo animals had no pouch young and another lost her pouch young by May. The six kangaroos that had pouch young all year and the three kangaroos that lost their pouch young between February and May 2007 did not use the feeding station regularly after July. Although favourable weather conditions in 2007 resulted in abundant natural feed supplies on this reserve and placebo treated kangaroos decreased their use of the feeding station, the deslorelin-treated kangaroos maintained their use of the station. These results suggest that long acting formulations of deslorelin may affect feeding behaviour in female western grey kangaroos. P321 Development of regular individual faecal sample collections from group housed African wild dogs (Lycaon Pictus) in a European Zoo setting: evidence of oestrus without male presence Paris, M1,2*; Schwarzenberger, F3; Thomas, R4; Jabbour, H1,5; Farstad, W6, Millar, R1,5

1Institute for Breeding Rare and Endangered African Mammals (IBREAM), Edinburgh, UK; 2Dept. of Equine Sciences, Faculty of Veterinary Medicine, University of Utrecht, The Netherlands; 3Dept. of Natural Sciences – Biochemistry, Vet. Med., Austria; 4Royal Zoological Society of Scotland, Edinburgh Zoo, Edinburgh, United Kingdom; 5MRC Human Reproductive Sciences Unit, United Kingdom; 6Dept. of Reproduction and Forensic Medicine, Norwegian School of Veterinary Science, Norway The African wild dog (Lycaon Pictus) is a group-living carnivore, and they hunt and reproduce in a cooperative manner. European Zoos generally attempt to imitate the natural situation as closely as possible by group housing and carcass feeding. This makes collection of regular individual faecal sampling for endocrine monitoring a challenge. This study describes the development of a reliable food marking technique to enable frequent individually identifiable faecal collections. Three UK based zoological institutions participated in this

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 134 P o s t e r A b s t r a c t s study with a total of 8 female African wild dogs. Faecal samples were collected from August until November 2006 (attempted 3 times/week). In Edinburgh Zoo, 5 adult females were group housed and no males were present. In Colchester Zoo, 2 females were group housed with 4 males. In West Midland Safari Park, a further 3 females participated in the study. Two of these females were housed together adjacent to the main pack which consisted of both males and females. The third female was hand-reared and housed with 2 males. Initially, dye was added to the food but this did not result in consistent colouring of faeces; hence this approach was abandoned. Alternative approaches included: a) the addition of beads (1-3mm), b) addition of sweet corn, and c) the addition of a teaspoon of coloured glitter to a small amount of minced meat given daily. The addition of beads was successful but labour intensive. Both sweet corn and glitter successfully marked the faeces in a reliable and consistent manner. Samples were stored at -20 �C, and transported frozen to the laboratory. The hormone analysis used a group specific EIA with antibodies against 20-oxo-Pregnane (20-oxo-P), total estrogens, testosterone, epi-androsterone, and cortisol. In Edinburgh Zoo (no male present), the dominant and second dominant female showed elevated faecal 20-oxo-P levels, indicating a pseudopregnant cycle. No elevations of 20-oxo-P were seen in the other females. Sample collection at Colchester Zoo has been unsuccessful, due to the combination of a newly formed group with several dominance coups. At West Midland Safari Park, individual samples were collected successfully, and data show elevated 20-oxo-P levels in 2 out of 3 females (1 in both sample groups). This study shows that 1) faecal marking can be achieved consistently, 2) obtaining regular samples is challenging, and 3) signs of oestrus in females kept without the presence of a male are observed, which has been unknown so far, and will further the general physiological understanding of this species. Acknowledgements: We would like to acknowledge the zoological institutions and their staff for the enthusiasm and efforts. In addition, we are grateful to Dr Mervyn Jacobson, and the RZSS for financial support. P322 Experimental investigations on the phenomenon of superfetation in European brown hares (Lepus europaeus) Roellig, K*, Goeritz, F; Hermes, R; Hildebrandt, TB Reproduction Management, Leibniz Institute for Zoo and Wildlife Research, Germany Introduction Superfetation (SF) is conception in an already pregnant female. This is assumed to be a reproductive mechanism in European brown hares (EBH). Its functional mechanisms are still not very clear due to difficulties in studying pregnancy in live EBH. Objective We aimed to reveal the phenomenon of SF using a new experimental design in live EBH. It was tested when SF occurs, and if semen is stored from a previous mating. Methods The study was performed on captive EBH. Frequent examinations were conducted on pregnant females using high resolution ultrasound (10-22 MHz linear transducer; Diasus, Dynamic Imaging Ltd, UK). The study consisted of five parts: (I) Detailed ultrasonographic characterisation of pregnancy (embryonic development, ovarian activity; pregnancy length): males only present for mating, n=35 (II) Detection of shortened interbirth intervals: males permanently with females, n=27 (III) Natural induction of SF: males present for first mating and prior birth (day 36 to 41), n=33 (IV) Testing the hypothesis of sperm storage: vasectomised males mated with females prior birth (day 36 to 41), n=6 (V) Experimental induction of SF with Artificial insemination (AI) and ovulation induction (GnRH-analogon): day 34 to 36, n=12; day 38, n=9 Results (I) Mean pregnancy length was 41.9±0.8 days. Prenatal growth curves were calculated. Ultrasonographic milestones in embryonic and CL development were defined. CL of pregnancy and embryonic vesicles were first detectable on day three and six, respectively. (II) In 85% (n=23) a new pregnancy was detected shortly after birth. In 67% (n=18) a second litter was delivered. Mean interbirth interval was significantly shorter (38.1±1.1 days, p<0.001)

than mean pregnancy length. (III) In 33% (n=11) a pregnancy developed. In (II) und (III) new sets of CL of pregnancy were seen prior birth. Embryonic vesicles occurred two days after birth. (IV) The mating of females with vasectomised males led to ovulation (ultrasound control) but no pregnancy developed. (V) AI in pregnant females on day 34 to 36 (n=12) did not lead to new pregnancies whereas AI on day 38 (n=9) resulted in new pregnancies in six cases. Embryonic resorption and developmental retardation was diagnosed in 29% of all pregnancies in the breeding colony. Conclusion SF occurred in 49% of the possible cases and most likely with insemination on day 38. At the time of birth the new embryos were still located in the oviduct. There was no evidence of semen storage. Fetuses of different size found in one uterus are most likely not due to SF. P323 Skewed birth sex ratio and premature mortality in elephants Saragusty, J1*; Hermes, R1; Göritz, F1; Schmitt, DL.2,3; Hildebrandt, TB.1

1Department of Reproduction Management, Leibniz Institute for Zoo and Wildlife Research, Germany; 2Department of Agriculture, Southwest Missouri State University, Springfield, MO, USA; 3Ringling Bros. Center for Elephant Conservation, Polk City, FL, USA Introduction Left undisturbed, elephants reproduce well in the wild. It is therefore an irony that most captive elephant populations are not self-sustained and face possible “extinction”. The aim of this study was to expand our knowledge on captive populations and search for brewing processes in them. Methods We studied studbooks data on captive births (CB, n=487) and premature deaths (<5 yrs; PD, n=164) in Asian and African elephant populations in Europe and North America and compared to data on timber elephants in Myanmar (CB, n=3,070, PD, n=736). Results Both European populations showed exponential growth in CB and North American Asian population showed linear growth. In the North American African elephants, two birth peaks were found with no births between 1986-1993. In the European Asian elephants excess of male births was found for births since 1996 (ratio: 0.61, P=0.044). A similar skew in North American African population (0.6), however, was insignificant due to small sample number. Male excess was also found in births following artificial insemination (n = 23, 0.83, P=0.003). All Asian elephant births in this group were males (n = 6, P = 0.031). Premature death rate in the European African elephants and in Myanmar was 21-23% while in the other three populations it ranged between 40-45%. Perinatal mortality constituted 47% to 68% of all PD in the zoo populations, with stillbirth and infanticide being major death causes. In Myanmar 62% of the juvenile deaths were at age older than 6 months and were due to maternal insufficient milk production, natural hazards (snake bites) and accidents. The European Asian and Myanmar elephants PD was biased towards males (ratio: 0.71, P=0.024 and 0.55, P=0.005, respectively). Conclusions The skewed sex ratio trend the captive elephant population is taking and the differences in PD proportions and causes should turn on a red light and stimulate the investment of efforts with the hope that the mechanism behind these trends will be elucidated and solutions can be found. P324 Vaginal cytology of maned sloth (Bradypus torquatus) Snoeck, PPN1*; Cruz, ACB1; Catenacci, LS1,2; Cassano, CR2,3 1Universidade Estadual de Santa Cruz (UESC), Ilhéus, Bahia, Brazil; 2Instituto de Estudos Sócioambientais do Sul da Bahia (IESB), Ilhéus, Bahia, Brazil; 3Universidade de São Paulo (USP), São Paulo, SP, Brazil Introduction Maned sloths (Bradypus torquatus) are arboreal mammals of the family of Bradypodidae. They can be found in the Atlantic coastal forest of Brazil and its largest populations occur in forests of southern Bahia. The observation of these animals in the wild is very difficult as they spend most of their lifetime hidden in the dense forest canopy; data about their reproductive aspects are scarce, and there is little information about their estrous cycle. This research

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 135 aimed at identifying the vaginal epithelial cells of maned sloths (Bradypus torquatus) as a possible way to study the phases of the estrous cycle of this animal. Material and methods The samples for vaginal cytology were obtained from four free ranging maned sloths living in a protected area of coastal forest in the South of Bahia. The sterile gynecological brush was inserted up to the necessary distance to reach the pelvic channel. Two smears were immediately immersed in absolute alcohol for ten seconds to produce cell fixation. Staining was performed using rapid Panotic Kit (Laborclin®). The methodology for differential evaluation of the cells was based on Schutte’s work (1967). Results and discussion Maned sloths BT033, BT065, and BT042 presented, respectively, 32%, 33%, and 7% of parabasal epithelial cells (PB); 58%, 22%, and 10% of small intermediate cells (SI); 9%, 18%, and 6% of large intermediate cells (LI); 4%, 13%, and 24% of superficial epithelial cell with a nucleus (NS); 8%, 14%, and 53% of anucleated superficial epithelial cell (AS). Two cell samples were collected for maned sloth BT464 with a 15 months interval. Cytological differences were observed between the two samples (1ª and 2 ª): 7.5% and 17.5% of PB cells, 6.5% and 25% of SI cells, 12% and 15.5 of LI cells, 9.5% and 19.5% of NS cells and 70% and 22.5% of AS cells, respectively. It’s interesting to remark that the percentage of vaginal epithelial cells varied among sloths and also for the same animal. This result suggests that vaginal cytology of maned sloth can be used as a tool to evaluate of estrous cycle. References SCHUTTE AP. Canine vaginal cytology. I – Technique and cytological morphology. J. Small Anim. Pract., v.8, p 301-306, 1967. Keywords: cells, vaginal epithelia, estrous cycle. P325 Effects of culture medium McCoy 5A Modified® (Sigma-Aldrich M-9309) in semen motility post-thawing of bottlenose dolphin (Tursiops truncatus, Tursiops aduncus, Tursiops gilli) Ugaz, C Veterinary and research, Dolphinaris, Mexico Due to the grate interest in captive marine mammals, in recent decades works on reproduction biotechnology in these species increased. One of the most charismatic species in captivity is the bottlenose dolphin, in witch many different researches have been done to improve procedures for their semen freezing (Robeck T. 2004; Robeck T. 2001, Ugaz C. et al. 2006). Many researches in different species have used the amino acids additions in freezing extender, generally glutamine (50mM), proving good results on the motility percentage after thawing (Khlifaoui M et al, 2005; Yahui L, et al, 2003; Trimeche A et al, 1999; Vidament M et al, 2001). In present job semen of the three male of the three different species was use (Tursiops truncatus, Tursiops aduncus, and Tursiops gilli); kept in captivity under the same life conditions. At least 3 ejaculate each was extracted (table 1). It was frozen using a refrigeration rate -0.18° C/min. and freezing rate -8.5° C/min. The Triladyl® (Minitube) extender was use, according to the manufacturer's instructions, with a concentration of 800 million sperm/ml. Thawing was made at 36°C for 60 seconds, McCoy 5A Modified ® (Sigma-Aldrich M-9309) at 36°C was added, in 1:1 (v/v) dilution. The main characteristics of this culture medium are that it has a lot off amino acids, and it is enriched with L-Glutamine (219.15 mg/L) and NaHCO3. All results indicated a significant increase in motility post-thawing (P= 0.0004; R squared: 0.6889; T paired test) with McCoy 5A Modified ®, 49.57 % is higher versus semen post-thawing without culture medium.

Poster 09 - Reproduction of Rabbit and Laboratory Rodents P326 Effect of reproductive rhythm on the oocyte quality and fertility rate in primiparous does Arias-Álvarez, M1*; García-García, RM1; Revuelta, L1; Rebollar, PG2; Lorenzo, PL1

1Dpto. de Fisiología (Fisiología Animal). Facultad de Veterinaria-UCM. Madrid. Spain; 2Dpto. de Producción Animal. ETSIA-UPM. Madrid. Spain. The fertility and prolificacy of the primiparous rabbit does are low when they are inseminated (AI) in the short period after kindling. Strong nutritional needs and a lactation status may have consequences on the quality of their gametes. Oocyte maturation is the first step that affects the successful fertilization and preimplantation embryo development and finally influencing the economic profits. The aim of this study was to compare the effect of different reproductive rhythms (semi-extensive and extensive) on meiotic and cytoplasmatic maturation measured as cortical granules migration (CG) of rabbit oocytes matured in vitro. A total of 90 primiparous New Zealand x California white rabbits, under semi-intensive (Group A: AI at 11 postpartum day (ppd), n=45) or extensive rhythm (Group B: AI at 32 ppd, post weaning, n=45), were synchronized by biostimulation 24 hours. Fifteen animals by group were euthanasized according to the bioethics committee of the University. Cumulus oocyte complexes (COC) were aspirated from ovarian follicles ≥ 1 mm in size of one ovary and were matured in TCM-199 medium supplemented with 10% FCS, 10ng/ml EGF and 100ng/ml IGF. Afterwards, a total of 301 COC (n=188, group A and n=113, group B) were treated progressively with 2mM hyaluronidase, 0.5% pronase, 4% paraformaldehyde, 0.02% Triton X-100 and 7.5% BSA. Oocytes were incubated with 100 μg/ml FITC-LCA for GC staining and with 10μg/ml Propidium Iodide for nuclear staining, and observed under a confocal laser-scanning microscope. Chi-square test was performed to analyse fertility, nuclear maturation and CG migration index. Fertility rate was significantly higher in group B than group A (53.6% vs 100%, p<0.01, respectively). Also, primiparous does of group B showed a significantly increase in the rate of oocytes reaching MII compared to does of group A (84.3% vs 48.6%, p<0.001). The percentage of oocytes presented CG migration to the cortex beneath to the plasma membrane, was significantly higher in group B than group A does (75.3% vs 21.3%, p<0.001). Besides, the semi-intensive group showed more abnormal, no homogeneous CG distribution compared to oocytes from does inseminated in the post weaning period (30.9% vs 0.9%, p<0.001). The rest of the oocytes had either incomplete CG migration or homogeneous CG distribution, as they were not cytoplasmic matured. In conclusion, the lower reproductive performance in 11ppd inseminated primiparous does seems to be a direct consequence of the poor oocyte quality in response to a sub-optimum ovarian condition in the does. CM and FSE granted MAA. “Juan de la Cierva” MEC Program supported RMGG. Research was supported by AGL05-196, PR1/07-14906 and UCM-CM research program (920249-2007). P327 Effect of different concentrations of oestrus cow serum fluid and bovine preovulatory follicular on the development of two-cell mouse embryos in vitro Beheshti Govij, R1*, Tajik, P2, Soleimani rad, J3 , Mohamadi roshandeh, A3 1Department of Veterinary Medicine, Islamic Azad University, Shabestar Branch, Shabestar, Iran; 2Department of Clinical Sciences, Faculty of Veterinary Medicine, University of Tehran, Iran; 3Department of Anatomy and Embryology, Faculty of Medicine, Tabriz university of Medical Sciences, Tabriz, Iran Objective To measure fetal developmental potential of mouse two-cell cleaved in Ham's F-10 medium (Sigma Chemical Co., St. Louis, MO) and Ham's F-10 medium containing the estrus cow serum (ECS), bovine preovulatory follicular fluid (BFF) and bovine serum albumin

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 136 P o s t e r A b s t r a c t s (BSA) as a model for establishing criteria for human IVF and GIFT procedures. Design Optimum concentrations of ECS and BFF in Ham's F-10 were established by measuring blastocyst development of in vivo fertilized zygotes from a mouse strain. Animals eight-week-old, superovulated mice. Result(s) In vivo-derived embryos were cultured in Ham's F-10, to which one of the following groups: [1] BSA (4 mg/ml), [2] different concentrations (10 and 20%) of ECS [3] different concentrations (10 and 20%) of FF, added two-cell stage. The proportion of embryos developing was affected by the type of protein and concentration. Reduced cleaved rates of embryo development were observed in Ham's F-10 supplemented with 10% BFF and 10% ECS. The rates of development of balstocystes in vitro were suppressed when the embryos were cultured with 10% BFF or 10% ECS as compared with BSA. Ham's F-10 supplemented with 20% ECS, 20% BFF and BSA also supported the development of in vitro-derive embryos (P<0.05). Conclusion(s) These results suggest that the higher concentrations of protein supplements are more effective for embryo culture. Key Words: Embryos-In vitro culture-Mouse -Protein. P328 Effect of crioprotectant concentration on the post vitrification morphological viability of murine embryos Cabrera, P.1*; Martínez, M.2; González, Y.2; Fernandez, A.1; Perozo, E.1; Vivas, I.1; Reyes, Y.1 and Diaz, T.1 1Facultad de Ciencias Veterinarias, Universidad Central de Venezuela, Venezuela; 2Facultad de Ciencias de la Salud, Universidad de Carabobo, Venezuela The vitrification technique for embryo cryopreservation has developed a considerable importance around the world, because it reduces the time for the process of freezing which improves the viability of embryos. One of the most important steps of the vitrification process is the equilibration, period in which the embryos are exposed to crioprotectants for an adequate dehydration prior to cryopreservation. There is a great variability for the ideal type and concentration of crioprotectants. In order to determine the best vitrification solution (VS) using ethylene glycol (EG), glycerol (GLY) and sucrose (SUC), the post vitrification morphology in murine embryos was evaluated. Eight different mixtures of crioprotectants, with the following concentrations: VS1: 0% crioprotectants; VS2: 50% EG; VS3: 50% GLY; VS4: 50% SUC; VS5: 25% EG + 25% GLY; VS6: 50% EG + 0.3M SUC; VS7: 50% GLY + 0.3M SUC and SV8: 25% EG + 25% GLY + 0.3M SUC, were used. To achieve this objective 160 murine blastocysts collected from superstimulated female mice were used and evaluated based on the following criteria: morphologically intact blastomeres, intact zona pellucida and re-expansion of the blastocoele, after the cryopreservation by vitrification through the modified open pulled straw (mOPS) procedure. VS5 was the solution with the highest percentage (94.7%) of embryos with normal morphological. There were no significant differences between the VS8 (88.9%) and VS5. However, embryos cryopreserved with the other solutions had a lower morphological viability (p<0.05). Four types of morphological abnormalities were observed: partial degeneration of the cellular mass, total degeneration of blastomeres, partial absence of the zona pellucida and fracture of the zona pellucida. These results suggest that VS5 provides embryos with better tolerance to the vitrification process, because a higher viability and lower frequency of morphological abnormalities were present. These findings provide details of great importance to the selection of crioprotectants for vitrification.

P329 Effect of donor weight on recovery rate of murine embryos Cabrera, P.1; Fernandez, A.1*; Molina, M. 2; Perozo, E.1; Bethencourt, A. 1; Vivas, I. 1; Reyes, Y. 1 and Diaz, T. 1

1Facultad de Ciencias Veterinarias, Universidad Central de Venezuela, Venezuela; 2Instituto Nacional de Investigaciones Agrícolas, Sanidad Animal, Venezuela The in vivo production of murine embryos is a biotechnology widely influenced by a series of variables such as dose and type of hormone for superovulation, strain and level of nutrition of the donor. These factors can affect the efficiency of the system. Therefore, knowing and controlling most of these factors allow to obtain a higher number of excellent quality embryos at a very low cost in a shorter period of time. With the aim to evaluate the effect of the donor weight at the beginning of the superovulation protocol on the recovery rate, 54 female mice were divided according to their weight in five categories: 12.2 - 14.9g; 15.0 - 17.6g; 17.7 - 20.3g; 20.4 - 23.0g; 23.1 - 25.8g. A total of 940 embryos were collected, showing a weight effect (p<0.05) of the donor on the number of embryos recovered, demonstrating that female mice with weight between 17.7 to 20.3g had the highest recovery rate, being those embryos of excellent quality obtaining 10.4+2.8 and 6.0+1.1 morulae and blastocysts/donor, respectively; which indicates the importance of considering the weight of the murine donor female before superovulation hormonal protocol in an in vivo production system of embryos. P330 The Motility and Fertilizing Capacity of Sperm from Six Strains of Mice after Cryopreservation Graham, J*, Marley, W; Dewit, M Biomedical Sciences, Colorado State University, United States Introduction The fertilizing efficiency of cryopreserved sperm from different mouse strains vary considerably, and cryopreservation procedures have not been optimized for sperm from many strains mice commonly used for transgenic research. Recently, we developed a diluent containing 20% whole egg (WE) that improved the cryosurvival of sperm from ICR mice. In these experiments we determined if the WE diluent could benefit the cryosurvival of mouse sperm from other strains. Methods Epididymal mouse sperm were collected from adult males of the ICR, B6SJLF/J, B6D2F1, B6C3F1, B6CBAF1/J and C57BL6 strains into the WE diluent. The percentage of motile sperm and the in vitro fertilizing ability of sperm from the six strains of mice were evaluated prior to and after freezing. Mouse sperm were cryopreserved at -10C/min using a Planar programmable freezer. The cells were stored in liquid nitrogen and thawed in 37C air for 4 min. Samples were assessed for the percentage of motile sperm using CASA and for their ability to fertilize oocytes in vitro, utilizing oocytes from B6C3F1 females. Results The percentages of motile sperm from all strains were similar prior to (63-83%) and after cryopreservation (52-62%; P>0.05), although percentages of motile sperm from the B6SJLF/J strain tended to be lower (23%) than those of the other strains investigated. Fertilization rates prior to freezing were higher for ICR sperm (98%) than for sperm from the other strains (52-67%; P<0.05). After cryopreservation, fertility rates were again highest for sperm from ICR mice (67%), which were similar to those for sperm from the B6D2F1 strain (51%). The B6C3F1 and B6CBAF1/J strains exhibited lower fertility rates (33 and 27%, respectively; P<0.05)), and the C57BL6 and B6SJLF/J strains exhibited relatively poor fertility rates (13 and 14%, respectively; P<0.05), although fertility was achieved for sperm from all strains tested. Conclusion In summary, a cryopreservation medium containing 20% whole egg maintains relatively high fertilizing potential of sperm for a majority of the mouse strains examined, and maintains at least some fertilizing potential for all strains examined.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 137 P331 Sexual behaviour and semen quality of rabbits fed with diets containing Myristica fragrans (Houtt) (Nutmeg) Herbert, U.*, Ukar, IA. College of Animal Science and Animal Production, Michael Okpara University of Agriculture, Umudike, Umuahia, Nigeria Introduction Rabbits, in Nigeria, have been exhibiting low reproductive performance in terms of litter size, copulatory behaviour, etc which could be attributed to several factors including genetic, physiological and environmental factors (Herbert, et al., 2005). Studies have been carried out to find out the aphrodisiac effect of 50% Ethanolic extract of Myristica fragrans on male rats (Tajuddin, 2003) with positive results. This study was designed to determine the sexual behaviour and semen quality of rabbits fed diets containing whole seeds Myristica fragrans. Materials and Methods Eighteen mature crossbred rabbits divided into 3 groups were used in the study. The whole nutmeg seeds were dried and milled prior to incorporation into the diets at 0% (T1), 2.5% (T2) and 5.0% (T3) of dietary dry matter. The diets were fed the animals ad libitum for 12 weeks. Semen was collected fortnightly using an artificial vagina as described by Herbert and Adejumo (1995) and analysed using standard methods. Data obtained were analysed using the analysis of variance technique. Results and Discussion There were no significant differences (P>0.05) between the treatment groups in all the parameters measured. Reaction time was however shorter in the T3 group being 10.30 seconds as against 12.13 seconds in the T1, implying an improvement in this parameter. Semen volume decreased with increasing level of nutmeg in the diet with T1, T2 and T3 having values of 0.95ml, 0.84ml and 0.76ml respectively. All the semen volumes obtained in this study were higher than the 0.71ml reported by Herbert and Adejumo (1995). The sperm concentration values obtained ranged from 22.00x106/ml for T1 to 25.75x106/ml for T3. These values are lower than those reported by Herbert and Adejumo (1995). However, the non-significant variations in the sperm concentration indicating increase with increasing level of nutmeg suggests that further increase in the level of nutmeg in the diet may lead to a significant variation in the treatments. The values obtained for motility, live sperm proportion and abnormal sperm fall within normal ranges in the literature. It is concluded from this study that even though there were no significant differences between the treatments, Myristica fragrans tended to improve the reproductive performance of the rabbit bucks. References Herbert, U, Ozoje, M O, Adejumo, D O (2005). Animal Research 54(3):173-174.; Herbert, U. and Adejumo, D.O. (1995). Delta Agric. 4: 99 – 108.; Tajuddin, Ahmad, S, Latif, A, Qasmi, I.A. (2003). BMC Complement. Altern. Med. 3:6. P332 Characterization of rabbit uterine electric and mechanical activities associated to the presence of capacitated and non capacitated spermatozoa Lazcano-Reyes, JF1*; Montiel, JL2; Medrano, A2. 1Programa de Maestria y Doctorado en Ciencias de la Producción y la Salud Animal. 2Departamento de Ciencias Pecuarias. Facultad de Estudios Superiores – Cuautitlán. Universidad Nacional Autónoma de México. Uterine motility is very important during gestation, parturition and mating since it may play an important role for sperm transport and capacitation, for instance, an increase in myometrial motility could be displayed when a sperm subpopulation shows hyperactivation. The objective was to characterize the electric and mechanical activity of rabbit uterus after mating and other treatments. In the first stage, contractibility was measured in 3 segments: uterus (UTE), uterotubal junction (UTJ) and oviduct (OVI) from 20 adult does, before and after the application of 200, 100 and 50 microlitres, respectively, of each treatment: 1) Mating, 2) Seminal Plasma and 3) PBS. In the second stage, either capacitated or non capacitated spermatozoa were introduced into each uterine segment from 20 adult does, and contractibility (g) and electric activity (mV) were recorded for 3 minutes before and after treatment. Data was analyzed by ANOVA to

determine possible differences between treatments and segments; a correlation test between mechanic and electric activities was carried out. Basal values for mechanical and electric activity were: 9.4, 9.1 and 9.4 g; 0.14, 0.09 and 0.13 mV for UTE, UTB and OVI respectively. Regarding the effect of treatments, values of mechanic and electric activity were: 8.8, 7.6 and 10.9 g; 0.08, 0.10 and 0.14 mV for UTE, UTB and OVI respectively, with PBS. Values with Seminal plasma were: 12.0, 8.8 and 8.5 g; 0.07, 0.06 and 0.11 mV for UTE, UTB and OVI respectively. Values after mating were: 6.1, 6.7 and 8.7 g; 0.13, 0.08 and 0.10 mV for UTE, UTB and OVI respectively. In the first stage, contractibility between uterine segments was not different for PBS and Mating, but it was for Seminal Plasma (P<0.03). Electric activity of UTE showed a border line difference with respect to UTB and OVI (P<0.056) for Seminal Plasma, but for Mating and PBS there were not differences. There was no difference between treatments (PBS, Seminal Plasma and Mating) in any of the uterine segments. There was a negative correlation between the electric and mechanical activity regarding the basal values (r= -0.34, P<0.04) and the difference basal minus experimental values (r= -0.44, P<0.005). In the second stage, the presence of either capacitated or non capacitated spermatozoa produced no significant differences in the electric and mechanical activity in any of the uterine segments and there was no difference between treatments. Seminal plasma induced an increase in the electric and mechanical activity of the 3 uterine segments, but Mating and PBS did not; this may indicate the influence of any substance present in seminal plasma and their relative concentration. The negative correlation between electric and mechanical activity was unexpected since mechanical is usually followed by an electric activity; this, suggests a possible independence of the two events. This experimental model used to characterize the electric and mechanic activities has produced interesting information but at the same time has revealed a number of possible sources of variation around data collection. P333 New approaches to Artificial Insemination technique in Laboratory Mice Martin-Caballero, J*, Garcia, T

Animal Facility, Par de Recerca Biomedica de Barcelona, Spain Low level of fertility, short time of average life span and some clinical abnormalities showed by several genetically engineered male mice make natural reproduction very difficult, so many times is necessary to use assisted reproduction. To solve this problem and standardise artificial insemination (AI) in mice, we have performed preliminary experiments in accordance with the Masahiro Sato technique, (2001). We have induced superovulation in 20 females mice, fourteen C57BL/6J y six non consanguine ICR.CD-1, through intraperitoneal inoculation of PMSG and HCG hormones, and mated them with vasectomiced males, 7 hours after the vaginal plug we introduced the selected spermatozoids collected from the deferent ducts of C57BL/6J males, into the ovary bursa (TIBE, Masahiro Sato 2001) or uterus corn. We have obtained poor results since only 9 females were pregnant, from then on we analysed our materials and methods, as well as the critical points of this technique to argue the aspects that need to be improved and to modify our protocol to get more pregnant females using artificial insemination in mice. (1) Sato M, Kimura M. (2001). Theriogenology 55, 1881-1890. (2) Sato M, et al, (2002). J Assist Reprod Genet.11, 523-530. P334 Effect of alcoholic extract of Phoenix dactylifera spathe on concentration of LH, FSH and testosterone in adult male rats Mokhtari, M*; Sharifi, S; Moghadamnia, D. Faculty of Sciences, Department of Biology, Islamic Azad University, Kazeroun Branch In the present research the effect of phoenix dactylifera spathe on concentration of LH, FSH and testosterone were studied.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 138 P o s t e r A b s t r a c t s In this study, 50 male Wister rats, each weighing 282±110g were used. These animals were divided into five groups of tens: the control group receiving normal food, the sham group receiving solvent (distilled water), and three experimental groups receiving 0.05, 0.1, and 0.2 g/kg extract of spathe respectively. The dosages of distilled water and extracts were injected intra peritoneally for 14 days. Eight hours after receiving last doses blood samples were taken and serum concentration of lutein hormone (LH) follico stimulation hormone (FSH) and testosterone were measured by RIA method.The results were evaluated by SPSS and Tukey test. Statistical analysis of the results indicates that concentration of testosterone decreases significantly in experimental groups receiving 0.05 and 0.1 g/Kg extract, while serum concentration of LH and FSH did not show any significant difference (π≤0.05) among various groups. According to the results alcoholic extract of phoenix dactylifera spathe reduces serum testosterone and protein synthesis. In addition, the presence of phytosterols in the extract which inhibit 5-a-reductase and aromatase enzymes activities may diminish tissues sensitivity to androgens. Finally, the reduction of sperms in somniferous tubules may due to the estrogenic activities of phytosterols and coumarin. P335 Synchronization of oestrus and ovulation in mice by administration of progesterone and prostaglandin analogues Pallares, P1* and Gonzalez-Bulnes, A2

1Fundacion CNIC. Madrid, Spain; 2Dpto. Reproduccion Animal. INIA. Madrid, Spain Introduction Management of the oestrous cycle in the mouse is scarce. Usual methods for induction of behavioural oestrus and ovulation are “male effect”, by the introduction of a male, fertile or vasectomized and “Whitten effect”, by the exposition to male pheromones; however, the degree of oestrus synchronization reached with these methods is very limited. Thus, we aimed to design and establish a protocol for induction and synchronization of oestrus and ovulation in mice, based in exogenous hormones. Material and methods In four consecutive experiments, a total of 72 adult mice in breeding age were used to evaluate effectiveness of the use, alone and combined, of exogenous progesterone and prostaglandin analogues. Different strains (37 BALB/c, 10 C57BL/6 and 25 CD1) were treated for testing breed effects. All the animals were maintained at the facilities of the CNIC Animal Laboratory Unit in Madrid, Spain. Results The higher synchronization degree and the higher fertility rates were obtained by the use of a protocol consisting of two i.p. doses of 0.5μg of cloprostenol, three days apart, plus a single s.c. dose of 3μg of progesterone coincidentally with the first injection of cloprostenol. Within main advantages of the new method, we have to highlight the short time elapsed for appearance, and the high degree of synchronization, of oestrus and ovulations (almost 100% of the animals responding to the treatment in 48h; 78.4% with fertile mates at 24h), plus the high fertility rate obtained after a programmed mating (100%). The response was very repeatable between replicates, which may be related to a high synchronization of the ovarian stage at induction of luteolysis and introduction of the male. There were not found significant differences between strains, except the expected effect on prolificacy (P<0.01). These yields are superior to those obtained by classical methods based on the introduction of males. Eighty per cent of the control females, exposed to the male without prior hormonal treatment, showed vaginal plugs during the first 96h after male introduction; however, in the responding females, the oestrus were expanded at 24 (12.5% of the mice), 48 (25%), 72 (50%) and 96 h (12.5%). Pregnancy rate in control females was 80%. Conclusion The proposed protocol arises as an adequate alternative for reproductive management in mice.

P336 Effect of Adriamycin on Morphological Changes and Epididymal Sperms in Adult Male Rat Shariati, M*, Ghavami, M; Salehi, S; Tayyebi, D Biology, Islamic Azad University, Kazeroun Branch, Islamic Republic Of Iran Background Adriamycin is an organic cytotoxis drug, which is currently used as a chemotherapeutic agent, which has different side effects on body organs. In this work, the effects of adriamycin were studied on sperm parameters and microstructure of adult male rat testis. Methods Fifty adult male rats were divided in five groups. First group was considered as untreated control. Saline was injected to second group and the remaining three groups received intraperitoneal injection of 5, 10 and 20 mg/kg of Adriamycin. The testes were removed after 4, 6 and 8 weeks, weighed and processed for light microscopic examination. Transverse and cross section diameters of testes, seminiferous tubules diameters, percentage of different types of tubules, epithelium thickness, spermatogenic cell numbers and capsule thickness as well as the sperm parameters in epididymis were measured. Results There was a significant decrease in sperm numbers and marked changes in testes structures. Accordingly, the changes in percent of normal tubules without sperm, abnormal tubules and capsule thickness were increased after drug administration. Conclusion Totally, adriamycin decreased all analyzed parameters, except capsule thickness, normal tubules without sperm and abnormal tubules, probably due to the arrest of spermatogenesis. P337 Laser-assisted zona-drilling increased in vitro fertilization with frozen semen in rabbit Varga, E1*; Polgar, Z3; Bodo, S 2; Dinnyes, A2

1Szent Istvan University, Faculty of Agricultural and Environment, Hungary; 2Genetic Reprogramming Group, Agricultural Biotechnology Center, Hungary; 3Constantine the Philosopher University, Faculty of Natural Sciences, Slovakia Introduction In vitro fertilization allows oocytes to be fertilized in laboratory conditions with valuable sperm, and can resolve fertility problems. The sperm of valuable males can be cryo-banked. The aim of our study was to increase the fertilization ability of frozen rabbit semen. Material and Methods All procedures for handling and treatment of the animals were conducted according to the Guidelines for Animal Care and Use of the ABC. Mature Hycole hybrid female rabbits were superovulated and the oocytes were flushed from the oviduct. The semen was collected using artificial vagina and the freezing was performed in two steps using 9% DMSO and 4% glycerol extenders. The fresh and the frozen-thawed semen was capacitated for 12 hrs in BO medium at 38,5°C under 5% CO2 in air, and the oocytes were incubated with them for 6 hrs. The zygotes were transferred to EBSS complete medium and development to 2-cell (at 24 hr) and to blastocyst (at 96 hr) stages were recorded. To achieve a higher fertilization rate a small hole was made on the zona pellucida using a laser impulse (XY Clone®, Hamilton Thorne Biosciences, USA). Data were analyzed by SPSS software. Results There were significant differences in fertilization and blastocyst development rates between the fresh and the frozen-thawed sperm groups (97.8% vs 8.9% and 77.8% vs. 4.7%, p<0.05). In the zona drilled oocyte group the fertilization and the embryo development rate with frozen-thawed semen were significantly higher than in the untreated oocyte group (52.7% vs. 8.9% and 39.0% vs. 4.7%, p<0.05). Finally, there were no significant difference in the cleavage and the blastocyst rates between the fresh and the frozen-thawed semen groups when the zona drilled oocytes were used (84.1% vs. 52.7% and 39.4% vs. 39.0%, p>0.05). Conclusion We determined that the frozen-thawed rabbit semen can fertilize, but penetrates the zona pellucida with lower rates. We report for the first time that application of laser zona drilling in rabbits can

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 139 increase significantly in vitro fertilization with frozen-thawed rabbit semen. Our work were supported by Wellcome Trust (070246/Z/03/Z) and the EU FP6 (MEXT-CT-2003-509582, MRTN-CT-2006-035468). Poster 10 - Avian Reproduction P338 Comparison of various freezing protocols of native roosters semen Barna, J*, Végi, B Avian Reproduction Group, Research Institute for Animal Breeding and Nutrition, Hungary Efficiency of semen freezing of Hungarian speckled roosters was evaluated in vitro. The aim of the study is the support of the ex situ gene conservation efforts on indigenous Hungarian chicken breeds. Semen of 10 individually placed males were collected twice weekly for 6 weeks. The pooled samples were divided into 5 equal parts for the various freezing protocols. The composition of the semen diluent was the same in all cases, the protocols differed in the type of cryoprotectants (glycerol, MA, DMA), the rates of cooling (slow, fast) and the type of cryo-conteners (straw, ampoule). The slow cooling with glycerol in ampoule using programmable freezer (Lake and Stewart, 1978) served as an etalon for comparison the various fast protocols in nitrogen vapour, as simple, quick and inexpensive way for maintaining of spermatozoa. For assessment of the effectiveness of protocols in vitro determination of the survived, morphologically intact sperm ratio was the main goal. Testing the damaging effect of cryopreservation procedures 4 qualifications/sample were performed at each steps of the protocols: 1. fresh undiluted semen; 2. diluted semen during equilibration without cryoprotectants; 3. diluted semen at finishing of equilibration with cryoprotectants; 4. semen after freeze-thaw cycle. In fresh samples the concentrations spectrophotometrically and the motility by subjective scoring were measured. On the basis of membrane permeability the live/dead cell ratios and the sperm anomalies were determined using aniline-eosin stained smears by counting 200 spermatozoa/samples. Only those samples were frozen which had a concentration characteristic of breed, motility with maximum score and a live, morphologically normal cell ratio above 80%. On the effect of simple dilution sperm decay was as double as in fresh semen (13%), at the end of equilibration with cryoprotectants there was a further increase in sperm death (7%), after freeze-thaw cycle 50 and 80% of spermatozoa died in slow and fast protocol, respectively. Around 50% of recovered cells had abnormal morphology in all cases, therefore the ratios of live, morphologically intact cells which are presumably able to take part in the fertilization were only 23.7, 12.5, 14.1, 4.3 and 9 % in slow, fast with DMA in straw and ampoule and MA in straw and ampoule protocols, respectively. Although, the slow freezing could produce significantly higher survival rate the further perfection of the simple method in nitrogen vapour using DMA and ampoule seems to be promising. P339 Effect of diets with different lipid sources in the ability of rooster sperm to hydrolyze the inner perivitelline layer of the egg Bongalhardo, DC1*, Nunes, PM2, Oliveira, EB2, Anciuti, MA3, Rutz, F4, Ledur, MC5, Deschamps, JC2 1Departamento de Fisiologia e Farmacologia, Universidade Federal de Pelotas, Brazil; 2Faculdade de Veterinária, Universidade Federal de Pelotas, Brazil; 3Conjunto Agrotécnico Visconde da Graça, Universidade Federal de Pelotas, Brazil; 4Departamento de Zootecnia, Universidade Federal de Pelotas, Brazil; 5EMBRAPA Suínos e Aves, Brazil Dietary lipids alter sperm membranes by the modification of specific fatty acids and may have an impact on sperm fertilizing ability. Previous work showed that sperm modifyed by dietary means

maintained its membrane integrity and motility when compared with a control. Compared with these in vitro evaluations of sperm quality, the sperm:egg interaction assay predicts, with more accuracy, the ability of sperm to fertilize the egg. This work aimed to verify if the ability of rooster sperm to hydrolyze holes in the inner periviteline layer (IPVL) of fresh chicken eggs would be affected by diets with different lipid sources. Twenty roosters with 37 weeks of age were divided in 4 groups and fed with one of the following diets: 1) control (standard diet, without addicional lipid source), 2) corn (standard diet + 4% corn oil), 3) fish (standard diet + 4% fish oil), and flax (standard diet + 4% flax oil). Gas chromatography analyses of these diets showed the following amounts of n3 and n6 fatty acids: 2.6 and 48.3% for control, 1.1 and 50.7% for corn, 9.3 and 26.7% for fish, and 36.6 and 24.2% for flax. After 6 weeks on the treatments, semen was collected and pooled by diet. This pool was then evaluated by its ability to hydrolyze holes in the IPVL. After three repetitions, results were analyzed by Kruskall-Wallis test, for non-parametric data. Means and standard errors for each treatment were 123 ± 51, 92 ± 47, 73 ± 22 and 71 ± 42 holes/mm2 of IPVL for control, corn, fish, and flax, respectively. There was no significant difference (P>0.05) among treatments. It can be concluded that sperm modified by dietary lipids maintain its ability to hydrolize holes in the membrane, and suggests that its ability to fertilize the egg would also remain unchanged. P340 Sex determination in juvenile Emus (Dromaius novaehollandiae) from feathers by PCR Costantini, V1*; Guaricci, AC1; Rausa, F2; Bucci, FA1; Lacalandra, GM1 1Department of Animal Production, Faculty of Veterinary Medicine, University of Bari, Italy; 2Zoosafari Fasano, Italy Introduction The molecular sexing methods DNA-based on the amplification of the chromo-helicase-DNA-binding 1 (CHD1) gene of the sex chromosomes were successfully established for many avian species, but none of these tests is widely applicable to ratite birds. Recently, the sequences of ESEXZ and ESEXW have been used for the development of a two-primer CAPS (cleaved amplified polymorphic sequence) assay for sex identification of the Emu (Dromaius novaehollandiae) (de Kloet 2001). In the current study, during a captive breeding program, we assessed the effectiveness of a molecular based assay with amplification of a sex-specific locus (kW1), W chromosome-linked in the North Island Brown Kiwi (Apteryx australis mantelli) and all ratite species, for sexing young Emus, using genomic DNA from feather samples. Methods Genomic DNA was isolated from the calamus of small double feathers, collected from the back of 4 months old Emus, using GenEluteTM Mammalian Genomic DNA mini prep kit (Sigma, Milano, Italy). The samples were derived from birds of known sex, determined by cloacal examination (seven males and three females). The kW1 locus was PCR-amplified (forward primer: CCTTTAAACAAGCTGTTAAAGCA; reverse primer: TCTCTTTTGTTCTAGACACCCT). Amplification products were separated on 2% agarose gel and stained with ethidium bromide. Results Amplification of Emu DNA using the primers w1 and k7 resulted, after run, in the production of a single sex-specific band (~150 bp) only in female subjects (female-specific band). Conclusions In this report we describe a PCR approach from feather DNA in Emu (Dromaius novaehollandiae), with amplification of a sex-specific locus W chromosome-linked (kW1), that appears to be a rapid, reliable and no risks technique for sex determination of this species, especially young, in breeding programs. References de Kloet SR, 2001: Development of a CAPS (cleaved amplified polymorphic sequence) assay for sex identification of the emu (Dromaius novaehollandiae). Molecular Ecology Notes 1 (4), 273–275.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 140 P o s t e r A b s t r a c t s P341 The effect of various diluents on pigeon semen stored 24h at 5oC Klimowicz, M1*, Batkowski, F2

1Krakow Agricultural University, Faculty of Animal Breeding and Biology, Department of Animal Reproduction and Anatomy, Al. Mickiewicza24/28, 30-059 Krakow, Poland; 2Wroclaw University of Environmental and Live Science, Faculty of Veterinary Medicine, Student Scientific Association, ul. Norwida 31, 50-375 Wroclaw, Poland The aim of the study was to identify a suitable extender for pigeon semen preserved for 24h at 5oC. Experiment was conducted 10 weeks. Semen was collected twice a week, from 40 fancy pigeons. After macroscopic analysis semen was pooled, diluted in Lake’s solution and BPSE extender, and divided in two equal parts. One part of semen was evaluated immediately and second one was stored at 5oC and evaluated after 24h. Every sample of semen was stained using 2 different methods - conventional eosin-nigrosin stain to estimate morphology of spermatozoa and SYBR-14/PI to evaluate sperm viability by flow cytometry. Sperm motility and velocity parameters were estimated using computer-assisted semen analyser HTM IVOS 12.2 (CASA). CASA analysis revealed that sperm motility (MOT), percentage of spermatozoa with a progressive motility (PMOT) were significantly higher in BPSE than in Lake’s solution after 24h storage (p≤0.05). Velocity parameters such as VAP, VSL, VCL, LIN, STR and the percentage of viable spermatozoa were not different between extenders. The percentage of morphologically normal spermatozoa was significantly higher at 0h in semen diluted in BPSE than in Lake’s solution (85.48±4.83 and 75.12±3.45; p≤0.01), as well as after 24h in vitro storage - 65.4±10.71 and 52.5±10.44 respectively (p≤0.05). The deformation and damage of spermatozoal acrosome was extremely higher in semen extended in Lake’s solution after in vitro storage (p≤0.001). BPSE is a suitable semen extender for storage of pigeon ejaculates at 5oC. This diluent has been capable of protection pigeon semen during in vitro storage and could potentially improve methods of cryopreservation. P342 The effect of short-term semen storage temperature and period on South African indigenous cock breeds Mphaphathi, ML*; Raito, MB; Mapeka, MH; Mantiziba, CW; Munyai, PH1; Boshoff, MP; Suzette, F and Nedambale, TL Agricultural Research Council-Livestock Business Division, Germplasm and Reproductive Biotechnologies, Private Bag X2, Irene, 0062, RSA The development of short and long term storage of South African indigenous cock’s semen is needed to ensure a viable reserve of germplasm for artificial reproduction. The aim of this study was to examine the longevity of freshly collected semen of two different indigenous cock breeds at room temperature (25 oC) and low temperature (4 oC) for 4 h, 8 h, and 24 h. Abdominal massaging technique was used to collect cock’s semen of Naked neck (NN) and Venda (V) breed. Following semen collection, spermatozoa was divided equally per treatment group; then microscopic characteristics (motility and survival rate) were evaluated under polarizing BHTU microscope and the sperm concentration was measured by spermacue. Modified Brackett and Oliphant’s (BO) medium was used to dilute (1:2) individual ejaculates per treatment group. The ejaculates volume, concentration, and pH of NN and Venda breed were recorded and evaluated for different time intervals. Data was analyzed by ANOVA. Preliminary results demonstrated a higher concentration of sperm in NN (8.14 x 108/ml) than in Venda (4.46 x 108/ml) breed. In contrast, higher pH was recorded in semen collected from Venda cock breed. However, there were no statistical differences in sperm motility and survival rate of semen stored at 25°C and 4°C between NN and Venda breed for all periods (Table 1). Regardless of time intervals and cock breed, there was an increase in dead sperm percentage and pH over time for semen stored at 4 and 25 oC. In summary, semen collected from NN cock resulted in higher concentration of sperm. This study also indicated changes induced by storage temperature,

breed and length of semen storage. Study on cryopreservation of NN and Venda cock semen is on progress. P343 Changes in sperm quality of broiler breeder males supplemented with organic selenium Végi, B*; Váradi, É; Ferencziné Szőke, Zs; Barna, J Avian Reproduction Group, Research Institute for Animal Breeding and Nutrition, Hungary The fertility decline in the second half of reproduction cycle has been a permanent problem in broiler breeders’ production. The aim of the study was to find differences in the effect of inorganic and organic selenium and the higher level of vitamin E on sperm parameters, mainly in the second half of the reproduction cycle in two types of broiler breeders. Selenium and the vitamin E play important role in the antioxidant system of live organism and additionally, of the membrane of avian spermatozoa. Due to the membrane damages the sperm functions failure, which results in reduced fertility. Sperm parameters of 20-20 males from ROSS 308 and Hubbard broiler breeders were compared during the whole reproduction cycle by weekly semen evaluations. The food of experimental groups was supplemented with 0.3 ppm Sel-Plex (Alltech) and 200 ppm vitamin E, while the food of control groups contained sodium selenite in traces and 100 ppm vitamin E. Males of 26 weeks of age were placed in individual cages feeding and keeping according to the management manual, until 61 weeks of age. Sperm collections were made twice a week by dorso-abdominal massage according to Burrows and Quinn (1937). Concentrations were determined by spectrophotometer (Accucell, IMV Technologies), motility by subjective scoring from 0 to 5, morphology of spermatozoa and live/dead cell ratio in stained smears by aniline eosin. As a result, the 0.3 ppm organic selenium and 200 ppm vitamin E affected differently in the two types of males. While in ROSS males they improved significantly the sperm motility, concentration and the ratio of live, morphologically normal spermatozoa in the second half of the production cycle, in the case of Hubbard males there were no any significant improvements in sperm traits. However, significant differences were found between the sperm qualities of the two types regarding to the sperm volumes (.18 - .25 ml/ejaculate), the concentrations (4.9 – 1.9 million/µL), and the dead cells’ ratios (15 – 17.8 %) in ROSS vs. Hubbard control males, respectively. Thus, Hubbard males produced higher semen volume with significantly less sperm concentration, less abnormal sperm cells but significantly more dead cells, than ROSS males. As a consequence, Sel-Plex with vitamin E could maintain the initial good sperm quality of ROSS males until the end of the cycle. However, in the case of Hubbard males the spermatological performance seemed to be more stable during the reproduction cycle and less accessible by exogenous factors. Poster 11 - Reproduction of Other Vertebrates (Fishes, Amphibians, Reptiles) P344 Endogenous opioid system and sharpsnout seabream (Diplodus Puntazzo) milt: detection of mu, delta and kappa opiod receptors on sperm cells Aiudi, G*; De Sandro Salvati, A; Bucci, FA; Micera, E; Albrizio, M Department of Animal Production, University of Bari, Italy Sharpsnout seabream, (Diplodus puntazzo) is the third most farmed marine teleost species in Italy (Taddei et al., Cryobiology 42:244, 2001). Fish reproduction in aquaculture facilities is mainly obtained through environmental/pharmacological conditioning. These techniques may stress fish and decrease reproductive performances (Cleary et al., Aquac. Res. 33:829, 2002). Endogenous opioid peptides (EOPs) system is involved in stress response (Arends et al., J. Endocrinol., 163:149, 1999), and affects several physiological

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 141 functions, both in central nervous system and in peripheral tissues. EOPs act through their specific cell membrane receptors (EOPr), which are classified into three major categories: mu, delta and kappa (Zadina et al., Nature, 386:499, 1997). The EOPs-EOPr binding blocks the cellular calcium channels, giving rise to considerable effects on all calcium-dependent metabolic pathways. Osmolality is one of the most important factors in the regulation of marine Teleosts sperm motility (Morisawa, Zool. Sci., 2:605, 1985). In fish spermatozoa hyperosmolality increases the intracellular calcium levels which allow the activation of flagellar beating (Oda and Morisawa, Cell Motil. Cytoskeleton, 25:171, 1993). Because of the recognized importance of calcium ions in marine Teleost sperm initiation, the high levels of stressors in aquaculture, and effects of EOPs on intracellular calcium balance, we evaluate the expression and localization of mu, delta and κappa opioid receptors in sharpsnout seabream milt by means of indirect immunofluorescence. Briefly, milt was collected by gentle abdominal massage into a depressurized syringe positioned at the genital pore and smeared onto poly-L-lysine coated glass slides. Cells were fixed, washed and incubated in blocking solution. A 1:1250 dilution of primary rabbit specific polyclonal antibodies against each receptor were applied except for the controls and let to react over night. After washing, slides were incubating with an anti rabbit FITC-conjugated IgG secondary antibody diluted 1:200 in Evans blue/PBS to counterstain negative cells. Slides were observed under a fluorescence microscope equipped with a specific filter. Our results show that mu opioid receptor is predominant localized on the tail, while delta and kappa seem to be located on the head. Opioid receptors detection on sharpsnout seabream milt let us suppose that the opioidergic system could modulate sperm motility, so that the use of opioid antagonists in fish farm could be useful to decrease stress effects on reproductive performances. P345 Short-term storage of Abant Trout (Salmo trutta abanticus Tontonese, 1954) semen and fertility trials Hatipoğlu, T1; Akçay, E2* 1Ministry of Environment and Forestry, General Directorate of national parks and nature protection, Ankara, Turkey; 2Department of Animal Reproduction and AI, Faculty of Veterinary Medicine, University of Ankara, Turkey Introduction In developing successful techniques for the preservation of fish sperm, some specific considerations related to the fish species must be taken into account such as biochemical structure and short life span of sperm after their release into water and preservation procedures. Most of the experiments in this field have focussed on finding appropriate extenders and additive agents for salmonids. Generally seminal plasma mimicking media and simple carbohydrate-based solutions have been used as extenders. Objective The objective of this experiment was to evaluate spermatological parameters and fertilizing ability of short term stored semen in different extenders from endemic Abant trout (Salmo trutta abanticus T,1954). Materials and methods Semen was collected from 15 adult males by the hand stripping method without anesthesia. Having determined the main spermatological properties (volume, motility, movement duration, concentration and pH), the pooled samples were diluted at a 1:2 ratio with two extenders (0,3 M Glucose and Ringer solution). The diluted semen were stored for 48 hours at 4 °C. Following the cooled storage, spermatological parameters of the semen were evaluated after 24 and 48 hours as regards to the post-cooled period. For the fertilization, dry fertilization technique was used. Eggs were pooled from 10 females. Fertilization took place in dry plastic dishes and 600 eggs were used in each fertilization trial. The sperm-egg ratio was approximately 0,25x106 sp/egg. After insemination, 25 ml fertilization solution (0.3% NaCl) were added on sperm-egg mixture. After swelling, eggs were rinsed with hatchery water (7 oC) and batches were placed into vertical incubation trays. Results The experimental success was assessed from sperm motility and the percent of eyed-egg 25 days after fertilization. Fresh semen motility was 81,46±6,39 %. According to the results of the experiment, the highest post-thaw motility (67 % after 24 h, 53 %

after 48 h) and movement duration (60 s after 24 h, 42 s after 48 h) were determined by using glucose extender after 24 and 48 hours storage. Fertility rate of fresh semen was 86,3 %. The highest eyed-egg rate (80.3%) obtained from semen stored with glucose based extender after 24 h storage. After 48 hour storage fertilization yield for the one diluted with 0,3 M Glucose decreased to 61,92 % and to 43,87 % for the one diluted with Ringer solution. Conclusion Our results indicate that glucose based extender is a better preservative than Ringer solution for short term preservation of Abant trout semen. P346 Comparative study about the use of Oxytocin chlorohydrate administered intravenous or intramuscular for induction of eggs deposition in non obstructive eggs retention in captive breed turtles (Trachemys scripta elegans ) Di Ianni, F*; Parmigiani, E; Bresciani, C; Bigliardi, E; Bertaccini, G

Faculty of Veterinary Medicine, Parma University, Italy Introduction Non obstructive eggs retention in turtle may be the result of some different factors including poor husbandry, not appropriate nesting site, improper temperatures, inadequate diet, dehydration, and poor physical condition of the female. Oxytocin, from 1 to 20 IU/kg of body weight stimulates oviductal contraction and induces eggs deposition. The aim of this study is to make a comparison between intravenous (IV) and intramuscular (IM) oxytocin chlorohydrate administration for the induction of eggs deposition in Trachemys scripta elegans turtles. Methods We considered 23 chelonia (Trachemys scripta elegans) recovered in the Teaching Hospital from 2005 to 2007 with signs of anorexia and restlessness. The turtles were radiographed and non obstructive eggs retention was diagnosed. The eggs were counted and the animals were divided in two groups with the same eggs number: group A (10 animals) and group B (13 animals). Oxytocin (2 IU/Kg) was administered IM in all the animals of group A and in the dorsal caudal vein in group B. If the animals did not laide all the eggs, we administered a second dose (2 IU/Kg) 60 minutes later and every 120 minutes up to the end of the deposition for both groups. Results The animals of group A started laiding in a mean of 100.5 ± 54.08 minutes and laided the last egg in a mean of 246± 85.4 minutes. For all animals (100%) was necessary to administer a second bole, for 7 of them (70%) a third for 3 of them (30 %) a fourth one. The animals of group B started laiding in a mean of 51.38 ± 19.80 minutes and laided the last egg in a mean of 141.92± 60.33 minutes. For 10 animals (77.92 %) was necessary a second bole and for 5 (38.46 %) a third one. All the eggs were laided. The statistical comparison ( χ2 ) was highly significant for the initial laiding time (P < 0.01) and significant for the mean total time from beginning to the end all the depositions (P < 0.05). Conclusions In this study the Authors showed that oxytocin (2 IU/Kg) administered IV induces more quickly the deposition and that this finishes in shorter time. The treatment technique results to be easy to perform with no undesired collateral effects. P347 Induced spermiation in Green Poison Frogs, Dendrobates auratus (Amphibia, Anura, Dendrobatidae), and ultrastructure of the spermatozoa Lipke, C1, Meinecke-Tillmann, S1*, Meyer, W2 and Meinecke, B1 1Department of Reproductive Biology, University of Veterinary Medicine Hannover Foundation, Hannover, Germany; 2Institute of Anatomy, University of Veterinary Medicine Hannover Foundation, Hannover, Germany The sperm ultrastructure of the Green Poison Frog, Dendrobates auratus, from Panama is described following induced spermiation in living animals. For this purpose a new method for processing of low concentration sperm samples (< 3.8*104 sperm/ml) had to be developed. So far only data on testicular spermatozoa were reported in

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 142 P o s t e r A b s t r a c t s other dendrobatid frogs. But sacrificing endangered animals should be avoided. Sperm samples are obtained after gentle hormonal stimulation with human chorionic gonadotropin (hCG) cloaca lavage and light microscopic evaluation. Sperm cells are filiform with an arcuated and 21.1 µm long head and a single tail (35.0 µm length). Their acrosomal complex is located at the anterior portion of the head and consists of the acrosomal vesicle with low electron density, and the subjacent electron-dense subacrosomal cone. The nucleus is circular in transverse section (1.9 µm diameter), and conical in longitudinal section. It is surrounded by several groups of mitochondria. The highly condensed chromatin is electron-dense but shows numerous electron-lucent inclusions. A short midpiece has a mitochondrial collar with a proximal and a distal centriole. The latter gives rise to the axoneme which alone forms the flagellum. The sperm ultrastructure of D. auratus differs from that of other Dendrobatidae because of the absence of a nuclear space and the missing undulating membrane associated with an axial fibre. In conclusion, it can be stated that the spermatozoa of D. auratus are the first within the Dendrobatidae without accessory tail structures. This tail conformation is analogue to these of Ranoidea and not Bufonoidea. This observation is in contrary to Garda et al. (2002) and Aguir-Jr. et al. (2004) who grouped the Dendrobatidae within the Bufonoidea. Our findings indicate that the whole dendrobatid family cannot be grouped within the Bufonoidea by means of the sperm tail conformation. Poster 12 - Neuroendocrine Control of Reproduction P348 The preovulatory LH surge in the ewe appears to be essentially timed by the hypothalamus Ben Saïd, S1*; Clarke, IJ2; Lomet, D1; Caraty, A1 1UMR Physiologie de la Reproduction et des Comportements, INRA-CNRS-Université Tours/Haras Nationaux, 37380 Nouzilly, France ; 2Department of Physiology, Monash University 3800, Australia The interval between the luteal regression and the preovulatory LH surge is longer in high fecundity breeds like the Romanov (ROM), than in breeds with lower fecundity, like the Ile de France (IF). This difference in the surge onset persists when ovariectomized (OVX) ewes of the two genotypes are challenged with an exogenous estradiol (E) signal (Ben saïd et al, 2007). It has been suggested (Clarke, 1995) that the preovulatory LH surge is the result of a coordinated positive effect of E on the brain and pituitary and we hypothesized that a time difference in the increase of pituitary sensitivity to E may exist between the two breeds. To test this hypothesis, we utilised the model of OVX Hypothalamo-Pituitary-Disconnected (HPD) ewes receiving regular GnRH pulses and monitored the effect of a preovulatory E signal on the LH pituitary response in both genotypes during 2 successive artificial cycles. Pituitary responsiveness was maintained with hourly i.v injections of 250 ng GnRH (cycle 1) or 500 ng GnRH (cycle2), throughout the experiment. After 12 days treatment with vaginal progesterone implants, and 24 h after removal, a preovulatory E signal was given (s.c. insertion of 2 x 3cm E implants) to the two genotypes (4 ROM, 5 IF). LH secretion was monitored by sampling jugular blood every 10 min for 30 h starting 4-5 h before E administration. Before the E signal, and for the two GnRH doses, the amplitude of the LH pulses was higher in ROM ewes compared to IF ewes (1.3 ± 0.2 ng/ml vs 0.5 ± 0.1 ng/ml for 250 ng/pulse (P< 0.05) and 2.1 ± 0.1 ng/ml vs 1.0 ± 0.0 ng/ml (P< 0.01) for 500 ng/pulse respectively, values are mean ± SEM). Interestingly, around 10 h after E insertion and for the two breeds, an increase in LH concentration occurs resulting of both an increase of the basal level and of the GnRH-induced pulses amplitude. Therefore, this E induced “LH discharge” occurred earlier in the OVX-HPD-ROM ewes than in OVX-ROM ewes treated by the same E signal. In summary our results show that in the absence of hypothalamic input, but with stable GnRH input, the increase in pituitary sensitivity

occurs earlier than in Hypothalamo-Pituitary-Intact animals and this difference of timing is more pronounced in ROM ewes. The likely explanation is that the latency to the onset of the LH surge is timed by a negative feedback effect of E at the hypothalamic level which is longer operative in ROM ewes. A possible role of other inhibitory factors of hypothalamic or pituitary origin cannot be totally excluded. P349 Transgenic domestic cloned kittens produced by lentivector-mediated transgenesis Gómez, MC1*, Pope, CE1, Kutner, R2, Ricks, DM2, Lyons, LA3, Truhe, M3, Dresser, BL1, Reiser, J2 1Audubon Center for Research of Endangered Species, Audubon Nature Institute, United States; 2Department of Medicine, Gene Therapy Program, Louisiana State University, United States; 3School of Veterinary Medicine, University of California Davis, United States Introduction The domestic cat exhibits 90% homology to putative genes of humans. Domestic cats carrying mutant human genes associated with hereditary diseases would provide a powerful tool for studying human disorders and developing gene therapy strategies. In the present study, we evaluated 1) whether domestic cat cloned blastocysts reconstructed with donor cells transduced with eGFP-encoding LV-vector carrying the human ubiquitin (hUbC) promoter expressed the incorporated transgene and, 2) the in vivo viability of transgenic cloned embryos after transfer into recipients. Materials and methods High titer stocks of eGFP-encoding LV-vectors bearing hUbC promoter were generated for transduction of donor cells. Domestic cat fetal fibroblasts (CFF) were infected overnight with 82.000.000 IU/ml of a LV-UbC-eGFP vector stock. Mature oocytes collected from cat donors were enucleated and a single eGFP-positive CFF was introduced into the perivitelline space of each oocyte. Fusion was induced by applying two electrical pulses and fused couplets were activated 2 h later and placed in culture. Transgene expression in cloned embryos was evaluated by observing green fluorescence of blastomeres (Days 2, 5, and 8). To analyze LV-vector copies, qPCR quantification was performed on genomic DNA derived from single blastocysts. A total of 186 transgenic cloned embryos were transferred by laparoscopy to the oviduct of five synchronous domestic cat recipients. The recipients were examined by ultrasonography on day 22 to determine pregnancy status. Results Cleavage rate (D2; 44/52=85%) and blastocyst development (D8; 5/44=11%) of reconstructed embryos with hUbC promoter-containing LV vectors was similar to those obtained previously with hCMV-IE and hEF1 alpha promoter-containing LV vectors. On day 2, 32% of the cloned embryos expressed green fluorescence, and by day 5, the percentage of embryos expressing the eGFP transgene increased to 41%. By day 8, all embryos displayed sustained transgene expression and blastocysts (n=5) exhibited green fluorescence. In blastocysts, each blastomere carried from 0.7 to 4 copies of the provirus. Two (40%) recipient cats were pregnant when examined on day 22. Five embryos (2.7%) had implant in two recipients. Three fetuses were reabsorbed by day 39 and two near-term died in utero on day 55 of gestation. The clonal status of the transgenic cloned kittens was assessed by a standardize DNA identification panel for cats. eGFP transgene expression was detectable by fluorescence imaging of cloned kittens. P350 Ontogeny of the daily rhythm in plasma melatonin concentrations during postnatal development in wild and domestic ewes Gómez-Brunet, A1*; Santiago-Moreno, J1; Chemineau, P2 ; Malpaux, B2 ; Lopez-Sebastian, A1

1Departamento de Reproducción Animal, SGIT-INIA, Madrid, Spain; 2Physiologie de la Reproduction et des Comportements, UMR INRA-CNRS-Université de Tours-Haras Nationaux, Nouzilly, France In seasonal reproductive species, melatonin, hormone synthesized and released into the general circulation with a marked day-night rhythm,

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 143 transduces photoperiodic information to regulate reproduction. In ewes, melatonin secretion is under genetic control and an early pineal function is important for the induction and timing of puberty. The European mouflon (Ovis orientalis mussimom), is a wild sheep which has a close phylogenetic relationship with the current domestic sheep breeds (Ovis aries). This wild sheep, reaches puberty 2-3 months later than most domestic ewes originating from and living at similar Mediterranean latitudes, suggesting the possibility of differences in the ontogeny of melatonin secretory rhythm between wild and domestic types of ewes. This study examines the patterns of melatonin secretion from birth to 32 weeks of age in Mouflon (n=7) and Merino (n= 6) female lambs born in March. Lambs were kept under natural day-length conditions (latitude 40º 25`N). They were bled (3ml) once a day after birth, once a week from 1 to 6 weeks of age and then at 8, 10, 12, 16, 20, 24, 28 and 32 weeks of age. From one day to 4 weeks of age, four blood samples were taken at hourly intervals, during the night (from 23:00 to 02:00 h) and then during the following day (from 10:00 to 13:00h). Thereafter, from 5 to 32 weeks of age, only the night-time blood samples were collected. A mean (± S.E.M) day/night (D/N) difference in plasma melatonin concentrations with higher values at night was evident as early as the day following birth in Merino ewe lambs (D: 5,9 ± 1,0 vs N: 22,0 ± 3,3 pg/ml, P<0.05), but not in Mouflon lambs (D: 34,4 ± 14,8 vs N: 60,2 ± 19,4 pg/ml, P>0.05). In Mouflon lambs, day/night differences were detected by 1 week of age (4,9 ± 0,3 vs 56,9 ± 15,3). ANOVA revealed a significant effect of the breed (P< 0.05) and of age (P< 0.01) on the mean night-time plasma melatonin concentrations. In both types of lambs, nocturnal plasma melatonin concentration increased between 1 and 32 weeks of age; however, the concentrations were lower in Merino than in Mouflon lambs. This difference was detected as early as the first week of age (Merino lambs: 22, 0 ± 5, 8 vs Mouflon lambs: 56, 9 ± 15, 3 pg/ml) and was maintained until 32 weeks of age (Merino lambs: 230,4 ± 42,9 vs Mouflon lambs: 287,6 ± 36, 3 pg/ml). These results demonstrate the existence of differences in the ontogeny of melatonin secretory rhythm and in the amplitude of nocturnal plasma melatonin concentrations between wild and domestic ewes. P351 Characteristics of prolactin secretion by salsolinol in ruminants Hashizume, T1*, Shida, R1, Onodera, Y1, Isobe, E1, Sawai, E1, Kasuya,l E2, Oláh, M3 and Nagy, GM3

1Faculty of Agriculture, Iwate University, Morioka, Japan; 2Laboratory of Animal Neurophysiology, National Institute of Agrobiological Science, Tsukuba, Japan; 3Neuromorphological and Neuroedocrine Laboratory, Department of Human Morphology, Hungarian Academy of Science and Semmelweis University, Budapest, Hungary Prolactin (PRL) secretion is under a dominant and tonic inhibitory control of dopamine (DA); however, recently, it has been reported that salsolinol (SAL), a DA-derived compound, is a putative endogenous PRL-releasing factor in rats. More recently, our group has also demonstrated that SAL is able to stimulate the release of PRL both in vivo and in vitro in ruminants. On the other hand side, it is well known that the secretion of PRL is stimulated by thyrotropin-releasing hormone (TRH). The aim of the present study was to clarify the some characteristics of PRL secretion induced by SAL in ruminants. A series of intravenous (i.v.) injections of SAL or TRH were given to goats with 2-hrs intervals for 6 hrs period, and secretory responses to each secretagogue were compared. Interactions between SAL, TRH and DA on PRL secretion were also examined in goats. PRL-releasing responses to three consecutive i.v. injection of SAL (5 mg/kg body weight (b.w.)) or TRH (1 μg/kg b.w.) at 2-hrs intervals increased plasma PRL levels after each injection (P<0.05); however, the responses induced by SAL were different from TRH. Although there were no significant differences at each peak value between these groups, the rate of decreases in PRL levels following the peak values were higher in SAL than in TRH treated animals (P<0.05). A single injection (i.v.) of SAL and TRH alone or in combination significantly stimulated the release of PRL in goats (P<0.05). The cumulative response curve (area under the curve: AUC) during 120 min was greater after the injection of SAL plus TRH than either SAL or TRH

alone (P<0.05). A single i.v. injection of sulpiride (a DA receptor antagonist, 0.1 mg/kg b.w.), sulpiride plus SAL, and sulpiride plus TRH also significantly stimulated the release of PRL (P<0.05). The AUC of PRL during 120 min was greater after the injection of sulpiride plus TRH compared to either sulpiride alone or sulpiride plus SAL (P<0.05). These results provide further evidences that SAL can stimulate the release of PRL in ruminants. Moreover, they also demonstrate that the mechanism (s) of SAL inducing PRL release are different from the mechanism of action of TRH. Supported by a Grant-in aid for Scientific Research (No.19580321 to T.H.) from the Japan Society for Promotion of Science (JSPS) and the Hungarian National Fund (OTKA K-68170 and ETT T-177/2006 to N.G.M.). P352 The relationship between mammary secretion of oestradiol-17beta and udder oedema in dairy cows Janowski, T*, Zdunczyk, S, Baranski, W Department of Animal Reproduction, University of Warmia and Mazury, Poland Janowski, T., Zduńczyk, S., Barański, W. Department of Animal Reproduction, Faculty of Veterinary Medicine, University of Warmia and Mazury in Olsztyn, Poland Oedematic swelling of the udder around the parturition is a physiological process, but in some cases it is associated with pain and milking difficulties. The high level of peripheral plasma oestrogens seems to increase the occurrence of udder oedema. It has been shown, that mammary gland itself is the source of oestradiol-17b near term. The aim of this study was to compare mammary secretion of oestradiol-17b in cows with and without pathological udder oedema. The study was carried out on 40 late pregnant dairy cows. Blood samples were collected from milk and tail veins every fourth day during a period from day 20 prior to parturition to day 4 post-partum. Concentration of oestradiol-17b was determined by radioimmunoassay. The concentration of this hormone was significantly higher (p Ł 0.01) in mammary than in peripheral circulation. It increased from day 12 pre-partum, reaching maximum at parturition and decreasing thereafter. The pathological udder oedema occurred in 6 cows ante-partum. In these animals the concentration of oestradiol-17b in milk vein was significantly higher (p Ł 0.05) than in cows without udder oedema. Maximal values were 2166.5 ± 315.1 pmol/l and 1413.7 ± 247.5 pmol/l, respectively. Our results showed that there is relationship between the mammary secretion of oestradiol-17b and incidence of pathological udder oedema. P353 Neuroendocrine pathways in the ‘female effect’ in sheep Jorre De St Jorre, T*, Hawken, P, Esmaili, T; Machado, T; Scanlan, V; Martin, G The School of Animal Biology, The University of Western Australia, Australia Exposure of rams to oestrous ewes stimulates a number of behavioural and endocrine changes in the ram, a phenomenon known as the ‘female effect’. Specifically, there is an increase in the secretion of luteinising hormone (LH) and testosterone, and in the sexual behaviour of rams (Review; 2). However, the neural pathways that mediate these responses are yet to be identified. The aim of this experiment was to use the immediate early gene c-fos to identify brain cells activated by the female effect. During the breeding season (Southern Hemisphere), 8 adult Merino rams were allocated to one of two groups; Ewe-exposed (n = 4) and Control (n = 4). Exposed rams received fence-line contact with oestrous ewes midway through a frequent blood-sampling regime. Control rams remained isolated from ewes for the duration of the experiment. Blood was sampled from all rams every 15 min for 4 h before and 2 h after the time of ewe exposure in Ewe-exposed rams. Approximately, 2 h after ewe exposure, rams were killed, their brains removed and blocks of hypothalamic tissue were dissected out. For each ram, three representative sections of the anterior, medial and posterior ventromedial hypothalamus were processed for Fos

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 144 P o s t e r A b s t r a c t s immunohistochemistry. Exposure to ewes stimulated an increase in LH pulse frequency (0.19 ± 0.12 vs. 0.75 ± 0.14 pulses/h; P < 0.01), mean concentration of LH (0.16 ± 0.06 vs. 0.53 ± 0.21 ng/mL; P < 0.05) and basal concentration of LH (0.08 ± 0.01 vs. 0.13 ± 0.01 ng/mL; P < 0.05). Exposure did not affect LH pulse amplitude (0.55 ± 0.15 vs. 0.55 ± 0.15 ng/mL; P > 0.1). In Control rams, there was no change (P > 0.1) in LH pulse frequency (0.25 ± 0.10 vs. 0.25 ± 0.10 pulses/h), mean concentration of LH (0.15 ± 0.03 vs. 0.11± 0.01 ng/mL), basal concentration of LH (0.08 ± 0.02 vs. 0.12 ± 0.02 ng/mL) or LH pulse amplitude (0.62 ± 0.09 vs. 0.70 ± 0.09 ng/mL). Preliminary analysis of the histology indicates that Ewe-exposed rams have a greater number of Fos-immunoreactive cells in the ventromedial hypothalamus, and probably other regions, than Control rams. This result corresponds with studies in the ewe that have identified neural activation in the ventromedial hypothalamus of ewes following stimulation by rams (1). 1. Gelez H, Fabre-Nys C. Neural pathways involved in the endocrine response of anestrous ewes to the male or its odor. Neuroscience 2006;140: 791-800. 2. Rosa HJD, Bryant MJ. The 'ram effect' as a way of modifying the reproductive activity in the ewe. Small Ruminant Research 2002;45: 1-16. P354 Plasmatic thyroxine and triiodothyronine concentrations in non-pregnant, pregnant and lactating Saanen breed goats Greco, G1*; Baldini, L1; De Paula, M1; Bittencourt, RF1; Maia, L2; Oba, E1

1Department of Animal Radiology and Reproduction, São Paulo State University -UNESP - Botucatu, Brazil; 2Department of Veterinary Clinics and Pathology, Fluminense Federal University -UFF, Brazil Thyroid hormone receptors are expressed in most of the animal tissues, being responsible for activating biochemical reactions and organic responses. In pregnant goats, these hormones are essential for normal fetal development and organogenesis and, during the lactational period, they stimulate galactopoiesis. As in sheep, thyroid hormones seem to be involved regulating reproductive sazonality in the caprine species. In comparison to other ruminants, few studies have been published regarding the variations in the concentrations of thyroxine (T4) and triiodothyronine (T3) in goats, according to their reproductive state. The present work had as objective to determine the plasmatic concentrations of T3 and T4 in non-pregnant, pregnant and lactating Saanen breed goats. Forty-three female Saanen goats, aging 24 to 32 months, were assigned into three different groups. Group 1 was composed of 15 non-pregnant goats. Thirteen goats experiencing their last month of pregnancy were assigned to group 2. As for group 3, it was composed of 15 lactating goats, whose kids were at most one month old. Blood was collected from animals through jugular venipuncture into tubes containing heparin, which were centrifugated at 3000 x g for 15 minutes. Plasma obtained was stored at – 20 degrees Celsius. T3 and T4 concentrations were estimated through radioimmunoassay, using Diagnostic Products Corporation® (DPC) kits. The obtained data was statistically analyzed through the Statistical Analysis System®, version 6.1, 1996. Concentrations of T3 and T4 were compared between the groups using the Student-Newman-Keuls test. The correlation between T3 and T4 measured concentrations was established using the PROC CORR procedure. Significance levels were set as P < 0.05. A highly significant (P < 0.01) positive correlation was found between T3 and T4 overall concentrations. Mean T3 concentrations were 150.08 ng/dL +/- 46.7, 108.48 ng/dL +/- 41.1 and 171.55 ng/dL +/- 38.3 in groups 1, 2 and 3, respectively. Pregnant goats had lower (P < 0.05) T3 concentrations than lactating and non-pregnant animals. As for T4, mean concentrations were, respectively, 5.40 μg/dL +/- 1.38, 3.76 μg/dL +/- 1.05 and 6.51 μg/dL +/- 1.43 in groups 1, 2 and 3. Lactating goats had higher (P < 0.05) T4 concentrations than non-pregnant animals. T4 concentrations obtained from pregnant goats were significantly lower (P < 0.05) than those in the remaining groups. In conclusion, T3 and T4 concentrations are lower in pregnant Saanen goats, being the concentration of T4 higher during the lactational period.

P355 Salsolinol as a hypothalamic neurotransmitter stimulating prolactin release during suckling in ewes Misztal, T1*; Gorski, K1; Tomaszewska-Zaremba, D2; Molik, E3; Romanowicz, K1 1Department of Endocrinology, 2Department of Neuroendocrinology, The Kielanowski Institute of Animal Physiology and Nutrition in Jablonna, Poland; 3Department of Sheep and Goat Breeding, Agricultural University in Cracow, Poland Introduction Salsolinol is a dopamine-derived, endogenously synthesized compound associated mainly with dysfunction of dopaminergic neurons. Recent data suggest, however, that salsolinol may also be involved in the dopaminergic regulation of prolactin secretion. It has been shown that in rats, the brain salsolinol concentration is elevated during situations when pituitary prolactin secretion is increased. In the present study, we hypothesized that salsolinol was present in the infundibular nucleus-median eminence (IN/ME) of lactating ewes and that its extracellular concentration in the IN/ME increased in response to suckling, similarly to the plasma prolactin concentration. The second hypothesis was that exogenous salsolinol, infused into the third ventricle (IIIv) of the brain, could stimulate prolactin secretion in lactating ewes. Material and Methods Stainless steel guide canullae were implanted under stereotaxic control into the IN/ME (n=6) or into the IIIv (n=10) through a drill hole in the skull in the second moth of pregnancy and two experiments were performed during the fifth week of lactation. 1) Perfusions of the IN/ME with Ringer-Locke solution were performed in ewes bilaterally, from 10:00 h to 15:00 h, by the push-pull method and were divided to the non-suckling and suckling periods, both for 2.5 h. At least 9 or 10 perfusates were collected during perfusion. 2) Pulsatile infusions of salsolinol (5 x 1 μg/20 μl, n=5) or vehicle (n=5) into the IIIv were performed from 12:30 h to 15:00 h, corresponding to the suckling period in perfused ewes. The preinfusion period was from 10:00 h to 12:30 h. In both experiments, plasma samples were collected every 10 minutes, through a catheter inserted into the jugular vein. The perfusate concentration of salsolinol and plasma concentration of prolactin were assayed by HPLC and RIA, respectively. Results The presence of salsolinol, but not dopamine, was detected in the perfusates collected from the IN/ME of lactating ewes. Perfusate salsolinol concentrations during the non-suckling period vs. suckling period were 56.82 ± 13.78 vs. 150.08 ± 16.85 pg/50 μl (mean ± SEM, P<0.001), respectively. Plasma prolactin concentrations noted during these perfusion periods were 98.60 ± 2.87 vs. 155.66 ± 5.96 ng/ml (P<0.001), respectively. Salsolinol infused into the IIIv evoked a significant increase in plasma prolactin concentration, 137.97 ± 11.47 ng/ml, as compared with the concentration noted during the preinfusion period, 104.04 ± 4.98 ng/ml (P<0.01) and that during control infusion, 77.06 ± 5.76 ng/ml (P<0.001). Conclusion These studies show the presence of salsolinol in the hypothalamus of lactating ewes and suggest that this compound may be a potent prolactoliberin during lactation. P356 Effect of Saffron Extract on Reproductive System in Male Mice Modaresi, M1*, Messripour, M2, Asadi arghmaleki, M3 1Department of Physiology, Islamic Azad University (Khorasgan Branch), Isfahan, Iran; 2Department of Clinical Biochemistry, Islamic Azad University (Khorasgan Branch), Isfahan, Iran; 3Department of Physiology, Payame Noor University of, Isfahan,Iran Background Due to widespread use of saffron (Crocus sativus L) as food colorant and flavor , and it reputation in folk medicine as a drug, recent studies revealed that main components of saffron are the carotenoids: crocin, crocetin, picrocrocin and safranal have a large number of physiological effects on different biological systems. Our objective was to assess the efficacy of Crocus sativus in the hormone changes in reproductive system and pituitary-testis axis of male mice.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 145 Materials and methods Four group including eight adult male Balb/C mice weighing 30 5g were used in this study. Normal saline administered as placebo to control group and saffron extract in doses of 25 , 50 and 100 were injected intraperitoneally for 20 days to experimental groups. FSH, LH and testosterone in serum samples, were measured by ELISA. Results In comparison with plasebo the level of FSH, LH and testosterone significantly increased in 100 saffron treated group, but no significant differences were observed between other treatments and placebo. The results of this study indicate the efficacy of saffron extract in the male reproductive endocrine function, and showed that it can modify the reproduction activities. Discussion The results of this research show that the extract of saffron in the mass of 100mg/kg has an important effect on level of FSH and LH and testosterone hormone. Saffron can have a key role in increasing the generative power in male mice. Poster 13 - Molecular Biology of Reproduction P357 Goat as model for studying ovarian differentiation in mammals Auguste, A*; Montazer-Torbati, F; Kocer, A; Pannetier, M; Renault, L; Mandon-Pepin, B; Cotinot, C; Pailhoux, E INRA – UMR Biologie du Développement et Reproduction – 78350 Jouy en Josas - France In mammals, once the chromosomal sex XY or XX is set up at fertilization, the presence of SRY gene (Sex-determining Region of Y) will determine the fate of the gonad by initiating testis differentiation. Following SRY expression, SOX9 the key testis differentiating factor is up-regulated in the embryonic XY gonad thus triggering testis differentiation. In the female counterpart, key genes for ovarian differentiation have been isolated from genetics studies of female-to-male XX sex-reversal. Three loci fit in the class of early ovarian differentiating factors, the PIS locus (Polled Intersex Syndrome) discovered in goat, RSPO1 in human and Wnt4 in mouse. In goat, the pleiotropic PIS mutation leads to a phenotype without horn in both sexes (dominant) and to a female-to-male sex-reversal in all XX individuals homozygous for the mutation (recessive). This mutation is a 11.7 kb deletion encompassing any genes, but acting on the transcriptional regulation of at least 3 genes, PISRT1, PFOXic and FOXL2, lying at 25 kb (PISRT1) and 300 kb (PFOXic/FOXL2) apart the deletion. When the PIS region is present (PIS+/+ and PIS+/- individuals), the 3 genes are highly expressed in the developing ovary, from the onset of their differentiation. This expression is abolished in the ovaries of XX fetuses homozygous for the deletion (PIS-/-). Concomitantly, the expression of SOX9 increased in these mutant gonads and the first histological sign of sex-reversal appeared. So, it seems that one of the PIS-regulated genes have an “anti-testis” effect. Among the three genes, only FOXL2 encodes a conserved protein belonging to the fork-head box family of transcription factors. In order to better understand the role of these 3 genes, we have restored PISRT1 expression in XX PIS-/- gonad of transgenic goats. As no effect on the sex-reversal phenotype was observed, our current working hypothesis is that FOXL2 is the only gene of the PIS locus responsible for both pathological phenotypes. However, Foxl2 invalidation in mouse leads to an early block of follicle formation but not to sex-reversal. Consequently, we hypothesize that FOXL2/Foxl2 could have additional roles in goat during the early stages of ovarian differentiation, a period that is clearly different between goat and mouse. By contrast to mouse, goat fetal ovaries show an early spatial organization and produce estrogens under the control of FOXL2 before germ cell meiosis. In order to definitely precise the role of FOXL2 in ovarian differentiation of non-rodent mammals, FOXL2 invalidation is currently under process in goat.

P358 Identification of genes expressed during sheep ovarian development Baillet, A*; Mandon-Pepin, B; Cabau, C; Poumerol, E; Pailhoux, E; Cotinot, C INRA, UMR 1198; ENVA; CNRS, FRE 2857 Biologie du Développement et Reproduction, Jouy-en-Josas, F 78350, France In mammals, several genes involved in ovarian development have been identified but the molecular cascade leading to a functional female gonad remains poorly documented. Although, in the last decade, progress has been made towards the identification of genes controlling ovarian differentiation using transcriptomic approaches and gene inactivation, most of theses studies have been achieved in mouse. The aim of this work is to identify genes involved in the two main steps of ovarian development in sheep, germ cells meiosis and follicle formation. In contrast to rodents both steps occur during fetal period in several mammals (human, sheep, pig) promoting sheep as a good model to study human ovogenesis and early folliculogenesis. For this study, we used suppressive subtractive hybridization allowing isolation of genes differentially expressed between two developmental stages. This technique was used in order to compare two ovarian developmental stages in sheep: 55dpc (onset of prophase I) and 82dpc (first follicle formation). Two subtractive libraries (55/82; 82/55) were constructed and 7296 clones were recovered. Among them, 6080 clones were sequenced. Using SIGENAE bioinformatics facilities, clones sharing sequence homology were grouped into 2090 unique contigs. Then all contigs were blasted against databases of different mammalian species (human, bovine and ovine) and annotad. In both libraries, 99% of contigs have an Unigene annotation and 1% were unknown. The comparison of the meiosis library contigs with another study of SSH concerning mouse male germ cells revealed 30 genes in common with our library. We have investigated the possible involvement of these 30 transcripts in female meiosis by RT-PCR. Two of them were never described in female and presented a differentially expression pattern. Their expression profile was performed by RT q-PCR in female and male gonads during fetal life in sheep. Both genes showed a high expression level during female meiosis I while their expression remained low in male and during the other stages of ovarian development. Further investigations such as chromosomal localisation in sheep, expression pattern in mouse gonads, cell type origin are currently in progress for these two genes. Moreover, investigations of the folliculogenesis library are in under progress. In parallel, these 2090 genes will be spotted on a nylon membrane to constitute a macroarray dedicated to the ovine ovarian differentiation, in order to evaluate sheep ovarian expression profiles in different physiological or physiopathological conditions. P359 Changes in gene expression of mouse blastocysts treated with high hydrostatic pressure pulse Bock, I1*; Mamo, S2; Polgar, Zs3; Pribenszky, Cs4 1BioTalentum Ltd., Hungary; 2Genetic Reprogramming Group, Agricultural Biotechnology Center, Hungary; 3Faculty of Natural Sciences, Constantine the Philosopher University, Slovakia; 4Faculty of Veterinary Science, St. István University, Hungary High hydrostatic pressure (HHP) treatment of mouse blastocysts before vitrification was reported to increase their post-warming in vitro developmental competence. Similarly, HHP treatment of gametes or embryos has proved to increase substantially the efficacy of the subsequent processes such as vitrification of porcine oocytes, in vitro produced bovine or cloned pig embryos, somatic cell nuclear transfer in pig, bull and boar semen cryopreservation. Proteomic studies have revealed changes in the protein profiles of boar spermatozoa that may relate to increased post-thaw survival and fertility. Here we report the first results of HHP induced alterations in the gene expression of mouse blastocysts.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 146 P o s t e r A b s t r a c t s F1 (B6D2) female mice were superovulated and mated with DBA males. Early blastocysts were collected from pregnant females and cultured in KSOM till the expanded blastocyst stage, that were loaded into 0.25 ml ministraws with CZB-Hepes. Embryos were treated with 600 bar pressure for 30 min at 23 ºC in a computer controlled pressurizing device (Cryo-Innovation Inc., Budapest, Hungary). Embryos were collected immediately and 120 min after the treatment. Then, mRNA was isolated and cDNA prepared for real-time PCR analyses. To assess the change in gene expression profiles, nine stress related genes and two reference genes (H2afz, and Ppia) were selected. Primers were designed, optimized and standards prepared for real time PCR analyses. Based on the analyses, the genes Azin1, Gas5, Gadd45g and Sod2 were up-regulated (mean±SD) 1.88±0.25, 1.55±0.36, 1.47±0.59 and 1.41±0.25 fold, respectively after hydrostatic pressure treatment, compared to the levels of the same genes in the untreated control. All studied genes, but Gadd45g, have returned to the control expression levels after 120 minutes culture. The up-regulation of Gadd45g (1.92±0.60 fold) shows that hydrostatic pressure has a prolonged effect on the transcription of this gene. H2afz and Ppia genes were not significantly affected (P>0,05) by the treatment, and this supports our previous results on the stable expression of these genes during mouse preimplantation development. This study demonstrates, for the first time, that HHP activates certain stress related genes in the mouse embryo. The effects don’t compromise developmental competence of the blastocysts, moreover it may contribute to increased survival rates at the subsequent cryopreservation. Supported by OMFB-00364/2007 and NKTH/KPI Kozma F. TUDAS-1-2006-0005 P360 Sexing in vitro produced bovine embryos with semen selected by percoll or swim-up Wolf, C1, Brass, KE2* 1Equine Reproduction, Federal University of Rio Grande do Sul, Brazil; 2Large Animal Clinics, Federal University of Santa Maria, Brazil Preimplantation genetic diagnosis (PGD) is becoming a current issue in animal reproduction biotechnology due to economical reasons. Predetermining the sex of offspring is one example of PGD. This study aimed to determine the percentage of male and female bovine embryos in vitro produced after oocyte fertilization with Percoll density gradient centrifugation or with self-migration (swim-up) selected semen. In experiment 1, sperm selection was performed by 90%-45% discontinuous Percoll density gradient centrifugation (T1) and swim-up (T2). In experiment 2, along side the discontinuous gradient, a 67.5% continuous density gradient, and centrifugation time of 5 and 10 minutes were used. A total of 4 treatment groups was defined (TI = continuous, 5 minutes, TII = discontinuous, 5 minutes, TIII = continuous, 10 minutes and TIV = discontinuous, 10 minutes). Polymerase chain reaction (PCR) was used to determine the sex of the embryos. T1 (n=185) resulted in 48.65% (n=90) male embryos and 51.35% (n=95) female embryos and T2 (n=142) in 58.45% (n=83) male and 41.55% (n=59) female embryos. In experiment 2, the percentages of male and female embryos obtained in TI (n=93), TII (n=70), TIII (n=82) and TIV (n=82) were 49.46% (n=46) and 50.54% (n=47), 57.14% (n=40) and 42.86% (n=30), 36.59% (n=30) and 63.41% (n=52) and 48.78% (n=40) and 51.22% (n=42), respectively. There was no difference on the percentage of males and females in all treatment groups from experiments 1 and 2 when these were individually compared to the expected percentage of 50% of each sex. There was also no difference in male and female embryo percentage between treatment groups in experiments 1 and 2.

P361 Granulocyte-macrophage colony-stimulating factor (GM-CSF) enhances glucose uptake in bovine granulosa cells Bücher, DD1*, Castro, MA1, Beltrán, F1, Correa, JE2, Concha, II1 1Instituto de Bioquímica, Universidad Austral de Chile, Chile; 2Instituto de Reproducción Animal, Universidad Austral de Chile, Chile The granulocyte-macrophage colony stimulating factor (GM-CSF) is a pleiotropic cytokine capable of stimulating proliferation, maturation and function of hematopoietic cells. Receptors for this cytokine are composed of two subunits alpha and beta and are expressed on myeloid progenitors and mature mononuclear phagocytes, monocytes, eosinophils and neutrophils, as well as in other nonhematopietic cells. We have previously demonstrated that bull spermatozoa express functional GM-CSF receptors that signal for increased glucose and vitamin C uptake and enhance several parameters of sperm motility in the presence of glucose or fructose substrates. The ovarian follicular development involves a complex exchange of endocrine signals between the hypothalamic-pituitary-ovarian system and within each ovarian follicle in a cell to cell interaction that precisely coordinates the process in a paracrine or autocrine manner. It is possible to assume that GM-CSF plays a fundamental role during folliculogenesis. The aim of the present work was to analyze the expression of GM-CSF receptors in bovine granulosa cells of follicles at different developmental stages and study the effect of GM-CSF on glucose uptake by these cells. Immunolocalization and immunoblotting analysis demonstrated that both subunits of GM-CSF receptors are expressed in granulosa cells at an early stage of development up to preovulatory stage of folliculogenesis. Using functional analysis with 2-D-3H-deoxyglucose we demonstrated that this cytokine enhances glucose uptake via facilitative hexose transporters (GLUTs) in granulosa cells isolated from follicles up to 6 mm in diameter cultivated under serum free conditions for 24 hours. The results suggest that GM-CSF interacts with factors present in the ovarian environment such as IGF-I and FSH, modulating the process of folliculogenesis. (MECESUP; DID D-2006-24; Escuela de Graduados, Facultad de Ciencias Veterinarias; FONDECYT 1060135). P362 Effect of undernutrition and pregnancy on hepatic and adipose tissue gene expression Carriquiry, M1*, Sosa, C2, Abecia, JA2, Forcada, F2, Meikle, A1 1Facultad de Agronomia-UDELAR, Uruguay; 2Facultad de Veterinaria, Zaragoza, Spain Undernutrition decreases embryo survival and pregnancy rates in ewes. The effect of plane of nutrition and physiological status (cyclic or pregnant) on hepatic and adipose tissue mRNA expression of genes involved in the somatotropic axis and leptin was investigated. Twenty-four ewes were fed either 1 or 0.5 times their maintenance requirements, estrus-synchronized, and mated with intact (n=12) or vasectomized (n=12) rams, to establish four treatment groups in a 2 x 2 factorial combination of plane of nutrition and physiological status. Ewes were slaughtered at day 14 of estrous cycle or pregnancy (Day 0=estrus) The abundance of mRNA for growth hormone receptor (GHR), GHR1A, insulin-like growth factor-I (IGF-I), leptin (LEP), and an endogenous control (ribosomal protein L19; RPL19) was measured by quantitative real time RT-PCR using SYBR Green. Abundance of mRNA of target genes was normalized to RPL19 and expressed in relative amounts to an external control (delta-deltaCT -method). Data were analyzed using PROC MIXED (SAS Institute) and considered to differ when P<0.05. The expression of RPL19 mRNA in liver and adipose tissue did not differ due to plane of nutrition, physiological status or their interaction. Hepatic amounts of GHR, GHR1A, and IGF-I mRNAs did not differ among groups which was in agreement with similar plasma IGF-I concentrations observed on day 13 of the estrous cycle among ewes. Independently of plane of nutrition and physiological status, expression of IGF-I and GHR1A mRNA were highly correlated (r=0.78; P<0.001). Abundance of GHR mRNA in adipose tissue was not affected by physiological status but

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 147 decreased by 30% with undernutrition. This diminished sensitivity to GH in adipose tissue could result in reduced adipogenesis and increased lipolysis. Leptin mRNA was highly correlated (r=0.68; P<0.001) with plasma leptin concentrations. There was an interaction between plane of nutrition and physiological status as pregnancy increased leptin mRNA expression only 1X-fed ewes. Results would agree with changes in nutrient partitioning towards mobilization of body energy reserves in underfed ewes and would suggest that increased leptin synthesis occur very early in pregnancy and this increase would depend on nutritional status. Funding from A26-DGA and AGL2004-00432-CICYT P363 Expression pattern of Zygote Arrest 1 (ZAR1), Maternal Antigen That Embryo Requires (MATER), Growth Differentiation Factor 9 (GDF9) and Bone Morphogenetic Protein 15 (BMP15) genes in ovine oocytes and pre-implantation embryos Bebbere, D1, Bogliolo, L2, Fois, S2*, Ariu, F2, Leoni, G3, Succu, S3, Berlinguer, F1, Ledda, S2 1Department of Animal Biology, University of Sassari, Italy; 2Department of Veterinary Clinics and Pathology , University of Sassari, Italy; 3Department of Physiological, Biochemical and Cellular Sciences, University of Sassari, Italy Introduction During the very first phases of development the embryo relies on maternal origin mRNAs and proteins stored in the oocyte during its growth and maturation, until embryonic genome activation. Amongst the stored mRNAs are the maternal effect genes (MEG), which are expressed predominantly in the oocyte and are involved in the early cleavage regulation. Because of the fundamental roles played during the first phases of development in several species, we have analysed the quantitative temporal mRNA expression of four MEGs (Zar1, Mater, GDF9 and BMP15) in oocytes and throughout early embryo development in sheep. The existence of Zar1 and Mater in the ovine species was never assessed before. Methods Reverse transcription-polymerase chain reaction (RT-PCR) was performed in germinal vesicle (GV) and in vitro matured (IVM) metaphase II (MII) oocytes, and, following in vitro fertilization and culture (IVFC), in 2- (2C), 4- (4C), 8- (8C), and 12–16- (16C) cell embryos, morulae, and blastocysts. Real-time PCR was performed with primers designed on the basis of ovine or bovine and swine conserved sequences. The PCR products were sequenced and aligned with BLAST (www.ncbi.nlm.nih.gov/BLAST/), confirming the gene identity (BMP15 and GDF9) or the homology with the orthologous genes present in public databases (Zar1 and MATER). Results The relative quantification of the transcripts shows that they are all most abundant in the immature oocyte and present to different extents during the following stages of pre-implantation development. Their expression is not resumed after the activation of the genome. All but BMP15 mRNA show a significant reduction during oocyte maturation. Zar1 transcript level has two more significant decreases (from 4C to 8C and 8C to 16C stage). MATER expression stays stable from MII until the 8C stage and becomes undetectable from the 16C stage onward. GDF9 transcript shows a gradual reduction during all pre-implantation development. It is the only analysed mRNA that persists in the morula. Differently from the other observed transcripts, BMP15 mRNA maintains its initial level from GV until the 8C stage, when significantly drops and becomes barely detectable during the following stages of development. Conclusions Our data demonstrate the existence of Zar1 and Mater orthologs in the ovine species. The expression patterns of all analysed MEGs support the hypothesis of an involvement in the transition from oocyte to embryonic life. Results are in accordance with the expression patterns characterized in other mammalian species.

P364 Identification of some integrin subunits on catlle (Bos indicus) oocytes Gonçalves, RF.1*; Bertolla, RP.2; Mortara, RA.3; Barnabe, VH.1

1Department of Animal Reproduction, College of Veterinary Medicine and Animal Science, São Paulo University, Brazil; 2Department of Surgery, Division of Urology, Human Reproduction Section, São Paulo Federal University, Brazil; 3Department of Microbiology, Immunology, and Parasitology, São Paulo Federal University, Brazil Introduction Fertilization in mammals is initiated by the direct interaction of sperm and egg membranes, a process mediated primarily by gamete surface proteins. Therefore, an important task in the study of sperm–egg interaction is to evaluate the role in fertilization of gamete specific surface proteins and other surface proteins more widely expressed. On gametes, these proteins act in a sequential pattern to orchestrate the initial contact and ultimate fusion of the two cells. Integrins receptors, which are adhesion molecules, are expressed on mouse, hamster, pig, and human unfertilized oocytes. Objective To investigate the potential role of integrins in fertilization, we determined the presence of integrin subunits on catlle (Bos indicus) oocytes by confocal microscopy. Methods Cumulus-oocyte complexes (COCs) recovered from slaughterhouse derived ovaries were matured for 24 h in maturation medium (Nutricell®, Campinas, SP, Brazil) at 39 °C under 5% CO2 in air. The matured oocytes were vortexed in 1 mL of maturation medium to completely remove cumulus cells. The zonae pellucidae (ZP) was removed using a 1 % solution of pronase, the oocytes were washed extensively in MIV-t (Nutricell®), and placed in maturation medium for 10 h (39 °C under 5% CO2 in air). After recovery, oocytes were washed in PBS with 3 mg/mL BSA and incubated with each of the primary antibodies (αV, α6, α4, α2, β1, β3; Chemicon International®, Temecula, CA, USA) for 8 h, washed in PBS again, and incubated with Alexa Fluor 488 secondary antibody (Invitrogen®, Eugene, OR, USA) for 2 h. Oocytes were washed for a final time in PBS and imaged using a confocal microscope to detect specific fluorescence of any integrin subunits present on the bovine oocytes. Results and Conclusion The integrin subunits αV, α6, α4, α2, β1, β3 were identified on the oocyte plasma membrane by confocal microscopy. These data provided evidence that some integrin subunits may be involved in sperm-oocyte adhesion and/or fusion in the cattle, and have an important role in fertilization as an adhesion molecule. Acknowledgements This study was supported by FAPESP grants (2007/00363-5 and 2006/06008-0, Brazil). P365 Testis development protein NYD-SP26 is a novel calcium-binding protein specifically expressed in elongate spermatids of mouse Kawashima, A1*; Osman, B2; Takashima, M2; Kikuchi, A2; Satoh, E2; Matsuda, M2 and Okamura, N1,2

1Graduate School of Science, The University of Tokyo; 2Graduate School of Comprehensive Human Sciences, University of Tsukuba Introduction Mammalian spermatogenesis can be divided into three parts: self-renewal and multiplication of spermatogonia, miosis and spermiogenesis. To accomplish such highly complicated germ cell differentiation process, strict stage- and cell-specific gene expressions must occur in the adult testis. Many attempts have been done to identify the genes expressed in germ cells as well as somatic cells at the specific stages of spermatogenesis. In the present study, we analyzed the effects of busulfan, which is known as an immunosuppressive agent, on mouse spermatogenesis and identified genes specifically expressed during spermiogenesis. Methods The spermatogenesis was temporarily ceased by a single intraperitoneal injection of busulfan(20mg/kg) to mature male mice. Proteins were extracted from testis at apprppriate time and analyzed by 2-D-gel electrophoresis and mass spectrometry. Results Thirty-two days after the injection of busulfan, no spermatogenic cells except the undifferentiated type A spermatogonia

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 148 P o s t e r A b s t r a c t s were observed in the seminiferous tubules. The proliferation of germ cells resumed and the differentiated spermatogonia appeared again at 6 weeks. The spermatogenesis was found to restore completely by 11 weeks after the injection. Among the proteins that reappeared concomitantly with the spermatids, we focused on a protein migrated to pI 4.0 and 66kDa on 2-D-gel. It was identified as a hypothetical protein, NYD-SP26, by TOF-MS analysis. NYD-SP26 mRNA was found to be specifically expressed in elongate spermatids at steps 10-16 and its translates were first detected at step 13 and mainly localized to the flagellar principal piece of the sperm. Furthermore it was found that NYD-SP26 had calcium-binding properties. Conclusions NYD-SP26 is a new member of the calcium-binding proteins expressed in the elongate spermatids, which is subsequently localized into the principal piece of flagella of matured sperm. These data indicate that this protein plays a part of [Ca2+]i signalling in sperm. P366 Identification of a novel ovine acrosome protein: implications for sex-sorted spermatozoa Leahy, T1*; Marti, JI2; Evans, G1; Maxwell, WMC1

1REPROGEN, Faculty of Veterinary Science, The University of Sydney, Australia; 2CITA, Aragon, Spain Sex-sorting subjects spermatozoa to numerous stressors. Sorted spermatozoa are highly diluted and exposed to mechanical forces, including propulsion into a collection tube at 90km/hr. This may destabilise the sperm membrane by stripping proteins from its surface. However, sorted ram spermatozoa have superior fertility to non-sorted spermatozoa1 as the sorting process gates out non-viable spermatozoa, leaving a homogenous and possibly membrane-intact population. The aim of this experiment was to detect differences in the membrane protein profiles of a) viable sorted spermatozoa b) non-viable sorted spermatozoa and c) non-sorted spermatozoa (control) and relate these to variations in sperm function. Semen was collected by artificial vagina (n= 3 rams), diluted in a Tris-citrate-fructose buffer supplemented with 1% PVA and incubated (1hr, 34°C) with 311uM Hoechst 33342. The incubated sample was sorted to obtain a viable, non-viable and non-sorted (control) population. The sperm samples were centrifuged (7500g, 5 min) to obtain a pellet that was resuspended in membrane protein extraction medium (2% SDS, 28% sucrose, 12.4mM TEMED, 185mM Tris chloride) and incubated (100°C, 5 min). The incubated sample was centrifuged (7500g, 5 min) and the proteins in the supernatant analysed using one- and two-dimensional gel electrophoresis and mass spectrometry. A protein of 15kDa and isoelectric point of 4.99 was found in abundance on the non-viable and non-sorted sperm membranes but was not present on the membranes of viable spermatozoa. This protein was identified as an intra-acrosomal, non-bacteriolytic, C lysozyme-like protein, termed SLLP1. This protein is exposed during the acrosome reaction, and retained on the equatorial segment of the sperm membrane. The absence of this protein in the viable, sorted sperm population suggests that sex-sorting actively selects sperm that are acrosome-intact. These results provide evidence that the sorting process selects a superior, homogenous population of membrane-intact spermatozoa. This may explain why sorted spermatozoa survive longer in the female tract than non-sorted spermatozoa and can provide acceptable fertility rates with low-dose inseminations1. This work was supported by XY Inc and the Major National Research Facilities Program (Biomedical Node of the Australian Proteome Analysis Facility). 1 de Graaf, S, et al. (2007) Reprod Dom Anim 42: 648-653

P367 The effect of VEGF on the change of P44/p42 MAP kinases, Protein Kinase C and Protein tyrosine kinases of ovine oocytes matured in vitro Hailing, LUO1*, Xin, CAO1，2, Ping, ZHOU3, Youzhang, ZHAO2, Guoqing, SHI3 1College of Animal Science and Technology, China Agriculture University, Beijing 100094，P.R China; 2College of Animal Science and Technology, Gansu Agricultural University, Lanzhou 730070, P.R China; 3Xinjiang Academic of Agriculture and Reclamation Science, Shihezi, Xinjiang, 832000, P.R China P44/p42 MAP kinases (Erk1 and Erk2) and Protein Kinase C (PKC) are mediate essential cellular signals required for activation, proliferation, differentiation and survival. Protein Tyrosine Kinases (PTKs) perform a critical role in signal transduction pathways that control cell proliferation, differentiation, metabolism and apoptosis. Our previous results proved that Vascular Endothelial Growth Factor (VEGF) is a powerful mediator for vessel permeability and could improve the quality of ovine oocyte maturation in vitro. In this study, to investigate the effect of VEGF on the change of phosphorylation ERKs, PKC and PTKs activity in ovine oocyte, 5 ng/ml VEGF was supplied in media during maturation in vitro and the method of ELISA was used to determine the ERKs, PKC and PTKs activities. The results shown that the levels of phosphorylation ERKs, PKC and PTKs activity in VEGF groups were higher than the without-VEGF groups. Moreover VEGF was strongly enhanced the level of phosphorylation ERKs and PKC activity but reduced PTKs activity during the period of ovine oocyte maturation in vitro. The phosphorylation levels of ERKs and PKC were slowly reduced from 0 hour to germinal vesicle breakdown (GVBD), subsequently phosphorylation ERKs level rapidly rose when GVBD was commencing and kept this higher level to MII phase, specially arrived at top at 18 hours and 21 hours. Phosphorylation PKC level took on fluctuant change but rose little by little and maintained high level at MII phase, reached peak at 21 hours. The ERKs and PKC activity reached the highest at 21 hour in vitro culture and descended again from 21 hours to 24 hours but interestingly that the levels were mount up again in the VEGF group at 24 hours compared to the control. The level of PTKs activity rapidly lessened from 0 hour to GVBD, fluctuant changed and kept low level during the residual period of oocyte maturation, but reached high level at 21 hours. Protein tyrosine kinase activity is often associated with membrane receptor protein tyrosine kinases such as VEGFR. Phosphorylation of ERKs and PKC by PTKs is essential for the regulation of oocyte maturation biological mechanisms. It could hypothesis that activation of VEGFR-mediated pathways occurs by supplying VEGF in ovine oocyte maturation medium, which cross-link the VEGFR on the plasma membrane and initiate receptor-mediated signaling pathways, leading to ERKs and PKC activation by PTKs activity change. In conclusion, VEGF induce the activation of ERK and PKC functions dependently of the activation of PTKs, strongly supporting the view that VEGF could enhance the ability of oocyte maturation. Keywords VEGF, p44/p42 MAP kinases, Protein Kinase C, Protein Tyrosine kinases, ovine oocyte The present study was supported by National Natural Science Foundation of China (No. 30371035) P368 Mucin Gene Expression in the Equine Reproductive Tract Maischberger, E1*, Irwin, J1, Cummins, C1, Duggan, V1, Carrington, S1, Corfield, A2, Reid, C1 1Veterinary Sciences Centre, University College Dublin- School of Agriculture, Food Science and Veterinary Medicine, Ireland; 2Mucin research group, University of Bristol, United Kingdom Mucins, which are the principal gel-forming components of the mucus gel, play an important role in lubricating, hydrating and protecting mucosal surfaces. In particular, they contribute to a barrier against microbial infection, toxins and other potentially harmful elements in the supramucosal environment. We hypothesize that there are changes

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 149 in the composition of the mucous layer of the endometrium/cervix of mares with Persistent Post-Breeding Endometritis (PPBEM)/Ascending Placentitis (AP), which affect normal barrier function at these sites. Both of these conditions cause considerable economic losses to the Irish equine bloodstock industry. PPBEM manifests as a failure to clear semen, exogenous contaminants and bacteria from the endometrium after breeding, leading to an embryo-toxic environment and failure to conceive. In AP, the cervical mucus plug is breached by invading microorganisms late in pregnancy, inducing abortion or premature birth. In an attempt to address this hypothesis, our initial objective has been to determine the expression of mucin genes within the reproductive tract of the mare. The expression of the mucin proteins is encoded by approximately 20 genes and is under the influence of steroid hormones during the oestrus cycle. We surveyed 16 mucin genes of the normal equine vagina, cervix, endometrium and uterine tube during oestrus (n=6) and dioestrus (n=12). Orthologues of human mucin genes were identified in the horse genome and their expression determined by PCR and agarose gel-electrophoresis. MUC1, a membrane-bound mucin, and MUC2, a secreted mucin, are expressed in the human and equine reproductive tract. MUC3 appears to be expressed in the equine endometrium only during dioestrus, while MUC5B is expressed only during oestrus. MUC5AC is one of the secreted mucins that are expressed in very low concentrations in the human reproductive tract and it is expressed in the equine lung. However, it is not expressed in the equine reproductive tract. MUC7, which is not expressed in the human reproductive tract, is expressed in the mare. This study provides baseline data for normal mares and for future comparison with mares affected by PPBEM or AP. Future work will include real time PCR and in- situ hybridisation to determine gene expression levels and tissue distribution within the reproductive tract throughout the oestrus cycle in healthy and diseased mares. P369 Endometrial expression of IGF-I, IGF-II and IGF-1R throughout the cow oestrous cycle Meikle, A1*, Carriquiry, M2, Chalar, C3, Sanguinetti, C3, Abreu, C3, Crespi, D1, Cavestany, D1 1Laboratory of Nuclear Techniques, Veterinary Faculty of Uruguay, Uruguay; 2Agronomy Faculty, Uruguay; 3Sciences Faculty, Uruguay The insulin-like growth factor (IGF) system is expressed in bovine uterus during the estrous cycle and early pregnancy and plays an important role in regulating the development of the embryo and uterus. IGF-I and -II mediate their effects through the type 1 IGF receptor (IGF-1R). In this study, the expression of the IGFs and IGF-1R was determined on endometrial transcervical biopsies collected on days 0 (oestrus), 5, 12 and 19 of the cow oestrous cycle (n = 8). The abundance of mRNA of IGF-I, IGF-II, IGF-1R, and an endogenous control (ribosomal protein L19; RPL19) was measured by quantitative realtime RT-PCR using SYBR Green. Abundance of mRNA of target genes was normalized to RPL19 and expressed in relative amounts to an external control (ΔΔCT -method). Results were analyzed with a repeated measures analysis (PROC MIXED of SAS) and considered to differ when P < 0.05. The expression of RPL19 mRNA did not throughout the oestrus cycle. Endometrial expression of IGF-I mRNA was the greatest at oestrus and day 5 (100%), and decreased to 47% and 35% of the initial values on days 12 and 17, respectively. Abundance of IGF-II mRNA peaked at day 12 and decreased sharply thereafter (to one third of day 12 values). Interestingly, IGF-1R mRNA expression showed the same pattern during the oestrous cycle that IGF-II mRNA. IGF-1R mRNA showed reduced expression at oestrus and day 5, increased by 1-fold on day 12, and decreased on day 17 to values similar to the oestrus ones. These results show that these IGF system components are distinctively regulated during the oestrous cycle suggesting that modulation of IGF system may influence uterine activity during this period. The earlier and later increases found on IGF-I and IGF-II respectively, suggest a differential role of these hormones on the early/late blastocyst and/or on the regulation of uterine function. The increase in the uterine sensitivity to IGFs during the late luteal phase – by IGF-1R

expression- may reinforce the role of IGF-II during the early pregnancy. P370 Regulation of Lefty2 in the oviduct of cyclic, pregnant, and pseudopregnant rats. Argañaraz, ME1, Valdecantos, PA2, Miceli, DC1* 1Instituto Superior de Investigaciones Biológicas, CONICET, Argentina; 2Facultad de Bioquímica,Cátedra de Biología Celular, Universidad Nacional de Tucumán, Argentina Transforming growth factor beta superfamily members are closely associated with tissue remodeling events and reproductive processes, being involved in the embryo development and in the maternal-embryo cross-talk. Moreover, transforming growth factor beta and their receptors were found in the preimplantation embryo and the reproductive tract (oviduct and uterus). Lefty2 an unusual member of this family has been implicated in the regulation of other transforming growth factor beta members such as nodal, activin, bone morphogenic proteins and transforming growth factor beta 1 via cryto co-receptors and by an antagonic mechanism. To date, the presence and regulation of Lefty2 in the rat oviduct have not been described yet. The aim of the present study was to investigate the expression of Lefty2 and its co-receptor (crypto) in the oviduct. RNA; oviductal proteins and tissues were collected from cyclic non-pregnant, pregnant, and hormonally-induced pseudopregnant rats. Lefty is a pre-proprotein of 42 kDa that is proteolytic activated to a mature form of 26 kDa. Lefty2 proteins were detected by western blots in the oviduct of cyclic, pregnant, and pseudopregnant rats but were not influenced by the estrous cycle. During early pregnancy, Lefty2 mature form was significantly higher at day 4 (when the embryo is still in the oviduct) and then it was gradually decreased while the pre-proprotein had not significant modifications. During pseudopregnancy, both form of Lefty2 protein were found at very low levels, without variations. Crypto transcripts, analyzed by semi-quantitative RT-PCR, were detected in the oviduct in the three studied conditions. Crypto expression levels were increased at day 4 of pregnancy, as we have reported for the lefty2 protein. Neither the estrous cycle nor the pseudopregnancy showed variation in the crypto gene expression pattern. These results suggest that Lefty2 and crypto are present in the rat oviduct during pregnancy; that Lefty2 could act along a paracrine pathway by binding to specific receptors on oviductal cells and that their expression could be independent of steroid regulation. The secretion of Lefty2 could be important for the embryo maintenance during its pass through the oviduct. P371 Oog1 is a maternal effect gene required for the development of mouse preimplantation embryo Minami, N1*, Imaichi, H1, Tsukamoto, S2, Ohta, Y3, Kito, S3, Kimura, K4, Imai, H 1Lab. Reproductive Biology, Kyoto University, Japan; 2Physiology and Cell Biology, Tokyo Medical and Dental University, Japan; 3Research Center for Radiation Safety, National Institute of Radiological Sciences, Japan; 4Animal Breeding and Reproduction Research Team, National Institute of Livestock and Grassland Sci, Japan Previously we identified an oocyte-specific gene, Oog1 (Minami et al., 2001). The expression of Oog1 starts at E15.5 in embryonic ovary and continues until the 2-cell stage. The expression is dramatically degraded thereafter. The most interesting characteristic of Oog1 protein is nuclear accumulation during the late 1-cell to early 2-cell stage (Minami et al., 2003). The period coincides with the time of zygotic gene activation and the time of first mitosis. The molecular biological feature of Oog1 is the association with small GTP binding proteins, such as Ras and Ran (Tsukamoto et al., 2006). However, the precise mechanism of Oog1 in embryonic development remains unknown. In addition, since Oog1 is multicopy gene, knockout approach can not be used. In the present study, we examined the role of Oog1 in the development of mouse embryos using transgenic RNAi approach. Two constructs differing in the sequence of Oog1 inverted repeats (IR1 and IR2) were employed in this study. To make

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 150 P o s t e r A b s t r a c t s transgenic constructs containing IR1 or IR2, each inverted repeat was transferred to pRNAi-ZP3 cassette (Stein et al., 2003), to produce pZP3-oog1IR1 or pZP3-oog1IR2. In these transgenic constructs, the expression of Oog1 dsRNA hairpins is controlled by ZP3 promoter which directs oocyte-specific expression. To analyze the phenotype of the transgenic females, each founder females (C57BL/6J) was mated with the same four wild type males (C57BL/6J) in a random sequence. Successful mating was verified by detecting vaginal plug. Mated females were then housed separately for observation and recording the number of pups delivered per litter, which was averaged to assess fertility. To test the suppressive effect of dsRNAs, fertilized embryos were collected from transgenic F1 females mated with wild-type males 24 h after eCG injection. Fertilized embryos were cultured in KSOM medium and their development was recorded at 24 h interval until 96 h after eCG. At the time of embryo collection, GV stage oocytes were collected from the same female ovaries to examine the amount of Oog1 mRNA by real-time RT-PCR. We obtained nine transgenic founders and four female transgenic lines out of 5 were sub-fertile. Embryos recovered from some transgenic F1 females mated with wild-type males exhibit developmental block in culture. These results suggest that Oog1 functions in early embryo development in mouse. This approach provides a powerful method to study the function of the genes transcribed during oogenesis and early embryogenesis. P372 Cloning and sequence analysis of Sheep fertilin β and its tissue expression Narenhua, N1*, Fu, L1, Li, N1, Bao, XRG2 1College of Animal Science and Medicine, Inner Mongolia Agriculture University, China; 2Life Science of College, China Fertilin β is member of the ADAMs (metalloproteinase-like, disintegrin-like, cysteine-rich) protein family and is expressed on the sperm surface where it has been proposed to play a role in mammalian fertilization. Inhibition of the sperm-egg binding and sperm-egg fusion make fertilin an attractive target for development of an immunocontraceptive vaccine. This study examined fertilin β gene activity in relation to fertilization in the ram testis. Mixed primers for the polymerase chain reaction (PCR) were designed based on the high sequence homology of selected regions of known bovine fertilin β gene. PCR-amplified cDNA fragments generated by 3\' and 5\' rapid amplification of cDNA ends (RACE) were combined to generate full-length cDNA sequence here for the first time. The 2217 bp cDNA has an open reading frame encoding 738 amino acids, with a molecular mass of ~82 KDa. The deduced amino acid sequence showed identity at equivalent regions of bovine (87.1 %), porcine (73.2 %), mouse (37.6%), human (58.1%), and macaque (58.0%). Bovine fertilin β contains a domain with homology to disintegrins, snake venom proteins that bind to integrins via an integrin-binding domain containing the tripeptide RGD. This partial inhibition of fusion with RGD peptides prompted the cloning of the sheep homologue of bovine fertilin β to determine if it possessed the tripeptide RGD or different amino acid sequence in its disintegrin domain. The disintegrin domain of sheep has the tripeptide TDE (instead of RGD) in its cell recognition region. In the present investigation we also report RT-PCR and in situ hybridization studies that show that the sheep fertilin β is transcripted only in adult ram testis and not in the all 3 epididymal regions. In situ transcript hybridization shows the transcript to be localized in round and enlongating spermatids in the seminiferous epithelium. The work confirms that fertilin β is expressed tissue specifically. Key word: fertilin β/disintegrin/RGD peptide/binding and fusion

P373 Changes in serine/threonine phosphorylation associated to the achievement of “in vitro” capacitation in boar spermatozoa Ramió-Lluch, L* and Rodriguez-Gil, JE Unit of animal Reproduction, Dept. Animal Medicine and Surgery, School of Veterinary Medicine, Autonomous University of Barcelona, Bellaterra, Spain Several studies in different species have shown that tyrosine phosphorylation of sperm proteins is a suitable marker of the capacitation. Furthermore, capacitation has been linked to changes in the spatial location of tyrosine-phosphorylation. However, there is little information about changes on both serine- and threonine-phosphorylation status during sperm capacitation. Thus, the main aim of this study has was the observation of putative changes in both expression and location of serine- and threonine phosphorylation during "in vitro" capacitation (IVC) of boar sperm. For this purpose, boar sperm from fresh ejaculates were incubated in specific capacitation medium durin 4 hours at 39ºC in a 5%CO2 atmosphere . Sperm aliquots were taken at 0, 1, 2 , 3 and 4 hours after incubation and both the general presence and spatial location of serine- and threonine-phosphorylation were evaluated. Our results showed that boar sperm had an specific pattern of phosphorylation in both serine and threonine residues. Weight of the main bands were around 25-30 KDa, 30-35 KDa and 50 KDa in serine-phosphorylation, and around 30 KDa, 50 KDa and 75 KDa in threonine-phosphorylation. IVC induced an observable rise in the expression of serine phosphorilation during capacitation, specially in the band around 30-35 KDa in both cases. These results were accompanied with specific changes in the spatial location of both serine- and threonine-phosphorylation in spermatozoa. All these results indicate that IVC is associated with specific changes in protein phosphorylation, in tyrosine residues and in both serine- and threonine residues as well. Finally, the observed spatial changes in protein phosphorylation indicates that they could be involved in the achievement of a feasible IVC. P374 Sperm DNA fragmentation and presence of varying levels of protamine 1 mRNA in Ram and Goat Roy, R1*, Gosalbez, A1, Lopez-Fernandez, C1, Arroyo, F1, García-Hurtado, J1, Casado, S2, De La Torre, J1, Gosalvez, J1 1Biology, Universidad Autonoma de Madrid, Spain; 2Research And Development, Halotech Sl, Spain Sperm DNA fragmentation has been the subject of numerous studies because the incidence of a high rate of nuclei containing damaged DNA is highly correlated with a loss of fertility. However, the origin of DNA fragmentation is mostly unknown, although apoptosis, oxidative stress, or persistence of DNA breaks produced during chromatin protamination in spermiogenesis, could be direct causes of chromatin damage. The aim of the present investigation was to analyze the correlation between different levels of protamine 1 mRNA in sperm cells from ejaculated semen samples in ram and goat with the dynamics of DNA fragmentation after ejaculation and sperm extension. For this purpose, 10 rams from Castellana breed and 10 goats all showing Sperm DNA Fragmentation (SDF) index below 6% were assessed for SDF by using the Sperm Chromatin Dispersion test (SCD; Halomax). The dynamics of SDF was assessed at T0,T1,T4 and T24 (numbers indicates hours after ejaculation in sperm samples extended and incubated at 37ºC). SDF Values were plotted against increasing incubation times. Results showed that differences in the dynamic range of SDF do exist among different animals; each animal reached a SDF index 50% of DNA fragmentation at different times (ranging from 4 to 24 h). Simultaneously, the amount of protamine 1 mRNA from mature spermatozoa was analyzed using real-time PCR. Interestingly, when levels of protamine 1 mRNA was compared with the dynamic range of SDF present in the same samples, those individuals showing a rapid increase in sperm DNA fragmentation, exhibited the lower levels of protamine 1 mRNA. These results suggest that sperm chromatin failing to achieve a proper

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 151 protamination in condensing chromatin, facilitates DNA breakage. It is suggested that a reduction in the level of deoxyribonucleic acid protection, render the DNA molecule more sensitive to external damaging agents. P375 GnRH-a induced steroid hormone receptor regulation in bovine endometrium Singh, R*; Pretheeben, T; Perera, R; Rajamahendran, R Animal Science, University of British Columbia, Canada Introduction Ovarian steroids consistently influence the endometrium and maintain its cyclicity by acting through their corresponding receptors. Estrogen receptors(ER α and ER β) and progesterone receptors (PR) are present in bovine endometrium in follicular and luteal phases of the estrous cycle, bovine ovaries and placentomes. We, most recently demonstrated the presence of GnRH receptors (GnRH-R) in bovine endometrium at both mRNA and protein level and localized these receptors to endometrial epithelial cells in both the phases of the estrous cycle. Additionally GnRH-R mRNA is also present in normal and carcinogenic human endometrium and endometriosis, where GnRH acts in an apoptotic and antiproliferative manner. GnRH is widely used in the bovine reproductive management including estrous and ovulation synchronization, induction of ovulation, post partum cyclicity, treatment of cystic ovarian disease, to overcome early embryonic mortality, and increase pregnancy rates; but there is clear lack of information on its local modulatory role in the endometrium. We find the co-existence of GnRH-R and steroid hormone receptors as interesting and there are prior reports about ligand independent activation of steroid hormone receptors. Whether GnRH through its receptors could regulate these receptors in normal endometrium is still not known and this study, for the first time examined the GnRH induced regulation of ER α and ER β and PR in bovine endometrium. Materials and Methods Uteri belonging to follicular and luteal phases of the estrous cycle were collected from the local abattoir, transported to lab within one hour. One hundred mg of endometrial explants were cultured at 370C, 5% CO2 in humidified atmosphere. After 20 h incubation, explants were treated with different doses of GnRH agonist – buserelin (0, 200, 500, 1000 ng/mL respectively), GnRH antagonist – antide (500 ng/mL) and a combination of antide (500ng/mL) and buserelin (200ng/mL) for 6 h. Two µg of total RNA extracted from each treatment was reverse transcribed using commercially available kit and the mRNA levels of ER α, ER β and PR were assessed by semi-quantitative RT-PCR and using the gene specific primers G3PDH was used as an internal control in the experiments. Optical intensity of individual bands was analyzed by Scion imaging beta and statistically analyzed by comparing to control and using student t test. Results This study revealed that GnRH (200ng/mL) upregulated ER α mRNA in both follicular and luteal phases of the estrous cycle and it this effect was more pronounced (P≤ 0.05) in the luteal phase; whereas mRNA levels of ER β and PR were not altered. Conclusions GnRH induced upregulation of ER α could have potential implications on reproductive process such as gamete transport, fertilization, cellular proliferation, uterine receptivity, implantation and maintenance of normal physiological status of the uterus and increases our understandings of the molecular basis of the reproduction at the endometrial level.

P376 Effect of pre-incubation of male and female gametes with fibronectin prior to fertilization in vitro in cattle Thys, M1*; Nauwynck, H2; Maes, D1; Van Soom, A1 1Department of Reproduction, Obstetrics and Herd Health, Faculty of Veterinary Medicine, Ghent University, Belgium; 2Department of Virology, Parasitology and Immunology, Faculty of Veterinary Medicine, Ghent University, Belgium

Carbohydrates and glycoproteins modulate various adhesion and binding events in reproductive processes, including sperm-oviduct adhesion, sperm-egg interaction and embryo implantation. When fibronectin (Fn) – an extracellular matrix glycoprotein – is supplemented to the fertilization medium, a substantial inhibition of sperm penetration during bovine in vitro fertilization (IVF) was observed. To identify whether Fn interacts with either male or female gametes, 2 experiments were conducted incubating either sperm cells or cumulus oocyte complexes (COCs) with Fn prior to IVF. To evaluate the effect of Fn on sperm, 2 groups of in vitro matured bovine COCs were fertilized in standard medium. One group was inseminated with spermatozoa (1x106 sp/ml) previously incubated with 500 nM Fn for 30 min. The second group was fertilized with spermatozoa (same ejaculate) incubated with standard medium. Two extra experiments – where the sperm cells were incubated for 2 h resp 4 h – were performed to evaluate effect of time of sperm pre-incubation on inhibition of sperm penetration. To assess the effect of Fn on the female gamete, in vitro matured COCs were divided into 2 groups. The first group was fertilized under standard conditions, the second one was treated with 500 nM Fn for 30 min prior to IVF. Subsequently, a similar setup was applied on zona-free oocytes. Twenty hours after insemination, all presumed zygotes were fixed, stained with Hoechst 33342 and evaluated by fluorescence microscopy for sperm penetration and fertilization. Differences in fertilization and penetration percentage were analyzed by binary logistic regression (SPSS 15.0). Pre-incubation of sperm cells with Fn significantly decreased the sperm penetration compared to that of the control (75.2% vs 87.0%) resulting in an inhibition of penetration of 13.6%. The same tendency was observed for fertilization with or without Fn pre-incubated sperm (68.6 % vs 78.2 %). Prolonging the duration of sperm pre-incubation caused more prominent inhibition of penetration (22.2% after 2 h; 42.8% after 4 h). When pre-incubating COCs with Fn, penetration was not significantly reduced (76.2% vs 83.0 %) compared to that of the control, nor was the fertilization rate (67.3% vs 75.4%). Furthermore, Fn pre-incubation of zona-free oocytes did not affect sperm penetration (42.0% vs 46.9%) nor fertilization (37.1% vs 37.0%). In conclusion, Fn inhibits sperm penetration in bovine COCs through interaction with the sperm cell. To elucidate the underlying mechanism, identification of receptors for Fn on bovine sperm is required. P377 Effect of replacer of fetal calf serum in the development and gene expression in bovine embryos in vitro cultured Serapião, RV1*; Boité, MC1,2; Camargo, LSA1; Polisseni, J1; Viana, JHM1; Folhadella, I1; Sá, WF1; Fonseca, FA4

1Laboratório de Reprodução Animal, Embrapa Gado de Leite, Brazil; 2Faculdade de Medicina Veterinária, Universidade Federal Fluminense, Brazil; 3Laboratório de Genética Molecular, Embrapa Gado de Leite, Brazil; 4Laboratório de Reprodução Animal, Universidade Estadual do Norte Fluminense, Brazil Introduction The period of post fertilization embryo culture is the most critical affecting blastocyst quality. Knockout SR (Gibco Labs., Grand Island, NY) is a serum replacer optimized to support embryonic stem cells in culture and can also be used to replace serum during culture of bovine embryos. The expression of genes associated to stress response, such as heat shock proteins (Hsp), can be affected by in vitro culture conditions, including culture medium components. The aim of this study was to evaluate the effect of KnockoutTM SR on

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 152 P o s t e r A b s t r a c t s the development, total number cells and relative abundance of Hsp70.1 of in vitro fertilized bovine embryos. Materials and methods COCs collected in slaughterhouse were matured and in vitro fertilized. The presumptive zygotes were randomly distributed in three groups of medium culture CR2aa supplemented with 10% of fetal calf serum (FCS); 10% knockout serum replacer (KSR) and 3 mg/ml of polyvinyl alcohol (PVA). Cleavage rate and blastocyst rate were determined respectively 72 and 168 hours post-fertilization (hpf). The total number of cells were determined at 192 hpf. Pools of ten embryos obtained at 192 hpf were frozen for RNA extraction and real time RT-PCR methodology was used to obtain quantitative data of Hsp 70.1 transcripts. Expression of GAPDH gene was used as endogenous reference. Calculations of relative quantification were performed by Comparative Ct method, using the value found in PVA group as calibrator. Data of cleavage and blastocyst rate were analyzed by the Kruskal Wallis test and the total number of cell by variance analyses. Means were compared by Student Newman Keuls test. Results and Discussion No significant difference (P>0.05) was found among FCS (57,8±4,6), KSR (62,2±4,5) and PVA (60,4±4,4) on cleavage rate. However, blastocyst rate (12,2±2,1 and 18,6±3,0) and total number of cells (105,9±5,9 and 109,4±6,1) were similar (P>0.05) for KSR and FCS, and higher (P<0.01) when these supplements were compared to PVA (4,2±1,0 and 79,6±8,4). Expression levels for FCS and KSR group were 1.2±0.06 and 1.4±0.08 fold different relative to PVA group without differences (P>0.05) between FCS and KSR groups. These data show that bovine embryos cultured in medium supplemented with KSR has similar patterns of development, quality and Hsp70.1 expression than those cultured in presence of the serum. In conclusion, KSR is able to support development of in vitro fertilized bovine embryos and it can be an alternative when serum-free culture medium is recommended. Thanks to Agrogenetica, FAPEMIG, CNPq P378 Melatonin treatment and undernutrition affect expression of uterine estrogen and progesterone receptors in ewes during the reproductive and the anestrous seasons Vázquez, MI1*; Sartore, I2; Abecia, JA1; Forcada, F1; Sosa, C1; Palacín, I1; Casao, A1; Meikle, A3

1Animal Production and Food Science, Veterinary Faculty, University of Zaragoza, Spain; 2Biochemistry, Faculty of Veterinary Medicine, University of Montevideo, Uruguay; 3Laboratory of Nuclear Techniques, Faculty of Veterinary Medicine, University of Montevideo, Uruguay Melatonin treatment in ewes increases prolificacy and fertility. A reduction in PGF2α in vitro secretion by endometrial cells after melatonin addition has been reported, suggesting that melatonin could act directly on sheep endometrium. In previous studies we have shown that undernutrition affects endometrial sensitivity to estradiol and progesterone by decreasing their receptor concentration (ERα and PR, respectively) which could explain the lower pregnancy rates found in undernourished ewes. In this study we tested the hypothesis that melatonin treatment could counteract subnutrition effects, and thus ERα and PR content in different endometrial cell types were studied in undernourished ewes. Adult Rasa Aragonesa ewes were assigned to a 2 x 2 factorial design performed both in the reproductive (RS, n=25) and anestrous seasons (AS, n=24). They were treated (+MEL) or not (-MEL) with a subcutaneous implant of melatonin for 42 days (Melovine®, CEVA) and fed to provide 1.5 (Control, C) or 0.5 (Low, L) times daily maintenance requirements from synchronization day with intravaginal pessaries. Ewes were mated at oestrus (Day=0) and slaughtered on Day 5, when pieces of uterus were collected to determine PR and ERα by immunohistochemistry. There was an effect of season on the staining intensity of PR (P<0.0001), and a tendency for ERα (P=0.10); the expression was higher during the anestrous season, being more evident in the deep stroma. No effect of undernutrition or melatonin was observed during the AS in any cell type. However, differences were found during RS: C ewes had greater ERα staining than L ewes (luminal epithelium, P<0.05); PR staining was greater in C+MEL than in L+MEL

(superficial stroma, P<0.05). Treatment with melatonin in undernourished ewes decreased PR expression in both superficial and deep glandular epithelia and in superficial stroma (P<0.05). This study shows that neither melatonin nor nutrition treatment had an effect on ERα and PR expression during anoestrous. Melatonin treatment could not counteract the detrimental effects of undernutrition on sex steroid receptors; moreover, it even provoked a higher decrease in PR content in undernourished ewes which was associated with lower embryo viability during reproductive season. This study was supported by grants AGL2004-00432 from CICYT and A-26 from DGA P379 Effects of E and F prostaglandin receptor agonists on luteal function in vivo in ewes Weems, C1*; Weems, Y1; Nett, T2; Davis, T2; Uchima, T1; Raney, A1; Johnson, D1; Randel, R3 1Dept. of HNFAS, University of Hawaii, USA; 2College of Veterinary Medicine and Biomedical Sciences, Colorado State University, USA; 3Agricultural Research and Extension Center, Texas A&M University at Overton, USA Introduction PGF2α is delivered locally from the uterus to the adjacent corpus luteum (CL)-containing ovary in ewes. However, PGF2α during early pregnancy is not decreased in uterine endometrium or venous blood, ovarian venous blood, or CL, nor binding to CL membranes. Ewes become resistant to PGF2α1 (C. Weems et al. 2006). PGE1 and PGE2 increased two fold in endometrium of day 13 pregnant ewes2 (Wilson et al. 1972). PGE1 or PGE2 prevented luteolysis only when infused chronically into the uterine horn lumen adjacent to the CL-containing ovary, increase luteal progesterone (P4) secretion in vitro and in vivo, and PGE1 in vivo increased P4 secretion longer than PGE2

1 (C. Weems et al. 2006). Four PGE receptor subtypes (EP1, EP2, EP3, and EP4) and one PGF2α (FP) receptor have been identified (Narumiya 1995). Objective The objective of this experiment was to elucidate the effects of EP1, EP2, EP3, and FP receptor agonists on CL function Methods On day-9, ewes received a single treatment into the vascular interstitium adjacent to the CL-containing ovary of Vehicle, PGF2α (100 μg) an FP receptor agonist, or 500 μg of the EP receptor agonists 17-Phenyl-Tri-Nor-PGE2 (EP1 and EP3). Butaprost (EP2), 19-(R)-OH-PGE2 (EP2), or Sulprostone (EP3). Jugular venous blood was collected at 0 and every 6 hours up to 48 hours for analysis for P4 by RIA. CL were collected at 48 hours, bissected, weighed, and stored in liquid nitrogen until analysis for the mRNA:actin ratio for LH receptors and unbound and bound LH receptors. P4 in jugular venous plasma was analyzed by a Split-Plot ANOVA for repeated measures. CL weight, CL mRNA:actin ratio for LH receptors, and CL unbound and bound LH receptors were analyzed by a One Way ANOVA. Results and conclusion PGF2α or Sulprostone reduced (P<0.05) CL weight, circulating P4, CL mRNA:actin ratio for LH receptors, and CL unbound and bound LH receptors. 17-Phenyl-Tri-Nor-PGE2 did not affect (P>0.05) any parameter analyzed. Butaprost and 19-(R)-OH-PGE2 increased (P<0.05) circulating P4, CL mRNA:actin ratio for LH receptors, and CL unbound and bound LH receptors. Luteal mRNA for LH receptors and unbound and bound receptors for LH may be increased via the EP2 receptor, while the EP3 receptor may decrease CL mRNA for LH receptors and unbound and bound receptors for LH to contribute to luteolysis. 1Weems et al., The Vet. J., 171:206-228, 2006; 2Wilson et al., Prostaglandins. 1:479-487, 1972; 3Narumiya, Prostaglandins, Thrombox., and Leukotriene Res. 23:17-22, 1995

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 153 P380 HaeⅡ polymorphism at caprine inhibin-alpha gene and its relationship to litter size Hua, GH1; Chen, SL1; Shen, Z2; Wen, QY3*; Zhang, ZR3; Yang, LG1 1China Education Ministry’s Key Lab of Agricultural Animal Genetics, Breeding and Reproduction of , Huazhong Agricultural University, Wuhan, PR China; 2Animal Husbandry Bureau of Hubei Province, Wuhan, China; 3Animal Husbandry Bureau of Shiyan of Hubei, Shiyan, China Introduction Goats contribute largely to the livestock industry and livelihoods of people in the world. Goats are animals with moderate prolificacy. It is important to improve the fertility of the goat. Reproductive traits such as litter size and conception rate are crucial economic traits with low heritability. Marker association selection (MAS) is a useful method to improve animal fertility via genetic selection. Inhibin is a kind of glycoprotein hormone which plays an important role in animal reproduction for its regulation of pituitary FSH secretion. The decline in inhibin secretion is responsible for an increase in FSH which coincides with an increased rate of follicular depletion. The objective of this research is to detect the polymorphism of INHA in goat and to investigate the relationship between the genotypes and litter size. Materials and Methods A total of 387 adult females individuals from 3 breeds of goats were examined, including Boer (n=208), Matou (n=125), Haimen (n=54) goats. Approximately 10 ml of blood was collected aseptically from the jugular vein in EDTA. The genomic DNA was extracted from white blood cells using standard phenol-chloroform extraction procedure. The DNA samples were dissolved in TE buffer (PH=8.0) and stored at -20℃ for use. The primers were designed according the INHA sequence of sheep (Accession number: L28815) as follows: forward-5’CCACACAGGACTGGACAGACA3’ and reverse-5’ GCAGGAACAGAGAGGACAACG-3’. PCR-SSCP, sequencing and PCR-RFLP were applied to detect the mutation and genotypes. The effect of INHA genotypes on the litter size of goat were analyzed by GLM procedure of SAS. Results 217bp fragments were obtained from PCR. A G284A mutation was tested by sequencing different genotypes of individuals separated by PCR-SSCP. A Hae�restriction site was changed by the mutation. Genotyping was performed successfully for a total of 387 individuals. Of these, 286 were homozygous (GG) for the presence of the functional Hae� restriction site, 27 were absence (AA), and 74 were heterozygous (AG). An association between the genotypes with litter size was examined. The GG individuals were positively associated with better litter size, followed by AA and AG. The mean litter sizes were 2.273, 2.231, 2.002 respectively. Conclusions The INHA gene can be used as a candidate gene for selection of litter size in the goat. The individuals with GG genotype is the favorable one for the goat breeding. Besides, it is necessary to search other loci in INHA gene in more samples. P381 Construction and expressed conditions optimization of an inhibin gene fragament prokaryotic expression plasmid Han, L1; Cao, SX2; Liang, AX1; Zhen, YH1; Wang, QL1; S, L1; Yang, LG1* 1China Education Ministry’s Key Lab of Agricultural Animal Genetics, Breeding and Reproduction of , Huazhong Agricultural University, Wuhan, PR China; 2College of Animal Science and Technology, Nanjing Agricultural University, Nanjing, China Introduction Improving reproductive efficiency in females is one of the major concerns in the monotocous animal, such as cattle. Inhibin plays an essential role in the regulating FSH secretion in various mammals. Previous studies have proved that active immunization and passive immunization against inhibin increase FSH secretions and ovulation rate in females. And they also proved that the peptide of subunit α(1-32) that can induce the special antibody was better than others. However, a synthetic peptide of a subunit of swine inhibin was an effective antigen when conjugated to a carrier protein. The

synthetic peptide and complete inhibin molecule apparently contain similar epitopes to which antibody binding blocks inhibin's bioactivity. Hepatitis B surface antigen gene (HBsAg) has been used as a particulate carrier for various foreign gene products. So, the preparation of inhibin α(1-32) fragment is very important to improve the fertility in animals. Methods The single strands of porcine inhibin α (1~32) (INH) gene (NM_214189) was synthesized chemically by Sangon. The gene of an inhibin α fragment was annealed and fused to the downstream of 225 amino acids of the encoding region of HBsAg gene and the site of amino acid sequence 112-113, and the recombinant fragment was subcloned into the vector pET-28a to obtain an inhibin expression vector pETISI with high immunogenicity. The recombinant plasmid pETISI was then verified by restriction endonuclease analysis and the integrity of coding sequences was checked by sequence analysis (Sangon). Finally, the plasmid pETISI was transfected into the host of E.coli BL.21 which can express ISI recombinant protein. The recombinant protein (41.2KDa) was detected by SDS-PAGE, which induced through the different concentration of IPTG and different induced time. The bioactivity of the recombinant protein was detected by western blot with mouse inhibin antibody (Thermo). Results The results of SDS-PAGE gel indicated that the recombinant protein was expressed in E.coli BL.21. And the highest expression of this protein was induced with 1mmol/L IPTG and 6 hour induced, at 37 centigrade. And the results of western blot indicated that the recombinant protein had high immunological activity of inhibin. Conclusion In a word, the inhibin gene could be expressed highly in the host E.coli BL.21 and the recombinant protein combined with HBsAg had high immunological activity. The large-scale preparation of this protein would settle the substance ground improving the fertility in animals, especially in monotocous animal. Poster 14 - Ovary and Uterus P382 Detection of apoptosis in bovine endometrium during early period of involution Domokos, M.1*, Ígyártó, B2, Pécsi, A.3, Földi, J.4, Kulcsár, M. 1, Huszenicza, G. 1, Neogrády, Zs.1, Gálfi, P.1 1Faculty of Veterinary Sciences Szent István University Budapest; 2Department of Human Morphology and Developmental Biology Semmelweis University Budapest; 2Centre for Agricultural Sciences and Engineering University of Debrecen; 4Intervet International BV, Angers, France In the postpartum uterine involution programmed cell death, apoptosis is needed for returning to the pre-pregnancy state. Apoptosis in contrast to necrosis makes possible dying cells without membrane disruption and consequent inducing of inflammation. Dairy cows undergo a period of negative energy balance in puerperium because energy output for milk production and uterine involution exceeds feed energy intake. In negative energy status involution may become moderate because involution process and apoptosis are energy-dependent as well. In this study cows were investigated in early period of involution to determine the apoptosis index with immunohistochemistry in their endometrium biopsia samples and to find out its connection with the beta-hydroxybutyrate (BHB) blood concentration labeling their energy status. Paraffin-embedded tissue samples were immunofluorescence stained for apoptosis detection with two methods. We used terminal deoxynucleotidyl-transferase mediated dUTP nick-end labeling (TUNEL) and PARP (monoclonal antibody against caspase-cleaved fragment of poly-ADP-ribose-polimerase) assays. At first we tested the methods on thymus samples from calf and they worked after some methodical changes acceptable. On the uterus samples only few cells were stained by the PARP assay and many of them were fals staining so we did not use it to determine the apoptosis index of the endometrium. While a lot of tissue samples were extremely infiltrated by inflammatory cells, antibody against CD45 (human leukocyte antigene) was used to exclude these tissue samples. After this procedure TUNEL staining was used for detection of apoptotic cells in uterus biopsies. In the hyperketonaemical group

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 154 P o s t e r A b s t r a c t s (BHB>1 mmol/l) the average apoptosis index was 23,83±6,44%, it is significantly less than the result of the normoketonaemic (BHB<1 mmol/l) groups (50,82±4,76%). So we found that in case of hyperketonaemia, correlating to normoketonaemic controls, less endometritic cells die by apoptosis. In conclusion the negative energy balance of dairy cows in early puerperium decreases the occurrence of apoptosis in involutionary endometrium tissue samples. It can result in some involutional complications (such as puerperal metritis) because it increases the risk of necrosis in the case of negative energy balance. P383 Luteal estrogen receptor, interleukin-1, and apoptosis-associated genes during prostaglandin F2α-induced luteolysis in rabbits at different stages of pseudopregnancy Maranesi, M1*; Lilli, L1; Brecchia, G1; Dall’Aglio, C2; Guelfi, G1; Zerani , M3; Gobbetti, A3; Boiti, C1

1Dip. Scienze biopatologiche veterinarie, Sezione di Fisiologia; 2Sezione di Anatomia, Università di Perugia, Italy; 3Dip. Biologia Molecolare, Cellulare e Animale, Università di Camerino, Italy In rabbits, several intraluteal pathways have emerged as potential mediators of the luteolytic action of prostaglandin F2αPGF2α , but the mechanisms that protect the developing corpora lutea (CL) from functional luteolysis to occur up to day 5 of pseudopregnancy are still unclear. Thus, the aim of this study was to elucidate PGF2α-induced temporal expression changes for estrogen receptor (ERα), interleukin-1 (IL-1β), p53, and Bcl-x genes in day 4 vs. day 9 CL, in order to further characterize their role in the acquisition of luteal capacity to PGF2α. CL were collected from rabbits 0, 1.5, 3, 6, 12, and 24 h after 200 μg i.m. PGF2α (alfaprostol) injection given at either day 4 or 9 of pseudopregnancy induced by 0.8 μg i.m. GnRH administration. mRNA was extracted at different time points and multiplex RT-PCR technique was used to obtain semi-quantitative abundances of target genes. Before treatment, ERα mRNA steady state levels were lower (P<0.01) in day 4 than in day 9 CL. At day 4, luteal ERα mRNA levels remained fairly constant after treatment, whereas at day 9 gradually declined to low values (P<0.01) within 6 h after PGF2α injection. At day 4, IL-1β mRNA transcript peaked (P≤0.01) two-fold 3 h after PGF2α challenge and thereafter gradually fell to pre-treatment values, whereas at day 9 the peak level was reached 6 h after PGF2α. Before treatment, Bcl-x transcripts were higher (P<0.01) in day 4 than in day 9 CL. At day 4, the Bcl-x mRNA levels gradually dropped within the first 3 h after PGF2α and then remained unchanged thereafter. At day 9, Bcl-x mRNA relative abundance decreased (P<0.01) 6 h after PGF2α administration to reach the lowest values (P<0.01) 24 h later. Pretreatment p53 mRNA values did not differ between luteal stages. At day 4, p53 mRNA progressively declined within the following 24 h after treatment. At day 9, p53 mRNA increased up to 3 h after PGF2α and then diminished. In conclusion, these findings suggest that PGF2α regulates luteolysis by ERα mRNA downregulation and by modulation of pro- and anti-apoptotic pathways in CL that have acquired luteolytic capacity. P384 Comparison of cervical and intrauterine cytology in cows with or without cervicitis Schult, J1*, Merbach, S3, Heilkenbrinker, T2, Klindworth, HP2, Schoon, HA3, Hoedemaker, M1 1University of Veterinary Medicine Hannover, Clinic for Cattle, Germany; 2Chamber of Agriculture Lower Saxony, Animal Health Department, Oldenburg, Germany; 3Faculty of Veterinary Medicine, Institute of Veterinary Pathology, University of Leipzig, Germany

Introduction This study compares cervical and endometrial cytology in clinically normal postpartum dairy cows and in dairy cows with cervicitis.

Material and methods Dairy cows (n=514) from 33 dairy farms were clinically examined by rectal palpation and vaginoscopy at 42 to 50 d postpartum. Inclusion criteria were absence of abnormal vaginal discharge and abnormalities of the uterus (fluctuation) at rectal palpation. From these cows, cytological samples were obtained from the cervix and the uterus by a modified cytobrush method. Cytological assessment was performed by counting a minimum of 200 cells to determine the percentage of neutrophils from the cervix (% PMNC) and the uterus (% PMNU). 302 slides prepared for cervical endometrial cytological examination were readable and assessed. In addition, progesterone (P4) concentration in blood plasma samples was determined. According to the status of the cervix, cows were distributed among three groups: no cervicitis (C0: n=119); cervicitis degree 1 (C1: n=92), i.e. cervix swollen, prolapsed mucosa pale; cervicitis degree 2 (C2: n=91), i.e. cervix swollen, prolapsed mucosa reddened. Results % PMNU (6.87+14.91) was higher than % PMNZ (3.04+8.64) (P<0.0001) independent of P4 concentrations. However, % PMNZ tended to be higher, when P4 concentrations were higher than 3.18 nmol/l as compared to lower than 3.18 nmol/l (2.21+6.79 vs. 3.60+9.66; P=0.086). A slight positive correlation between % PMNU and % PMNZ was found (r=0.22, P<0.0001). The clinical status of the cervix was not related to % PMNZ or % PMNU independent of the stage of the oestrus cycle based on P4 concentrations. Conclusions: Uterine and cervical % PMN were positively correlated with % PMNU being higher than % PMNZ. No relationships between intrauterine or cervical cytology and cervicits were found. P385 Dominant follicle size and first post-partum ovulation are influenced by the administration of amino acids and low molecular weight peptides in lactating dairy cows Silva, TF.*; Neto, GSR.; Barreto Filho, JB.; Repolês, SLC.; Moreira, MB.; Ferraz Júnior, MVC.; Rossi, RODS. Lavras Federal University, Veterinary Medicine Department, Brazil

High production dairy cows demand greater feed intake in the post-partum and often have problems arising from the period of negative energy balance (NEB). Apparently the NEB inhibits fertility through mechanisms that affect serum glucose levels, decrease insulin concentration and increase the non-esterified fatty acids (NEFA) and ketones. These changes diminish the frequency of luteinizing hormone (LH) pulses necessary for ovarian follicle development and ovulation. The goal of this work was to evaluate the influence of amino acids (AA; tryptophan, glutamic acid, lysine, histidine, methionine) and low molecular weight peptides (LMWP) supplementation in follicular development and the first post-partum ovulation in high production dairy cows. Forty Holstein cows (25 milk kg / cow / day; body score ≥ 3.0) were used in the experiment. The treated group (n = 20) was supplemented with AA and LMWP solution intramuscularly 15 days before calving, in the day of parturition, and fortnightly until the 120 days post-partum. The control group received saline solution. Measurements of the ovaries and ovarian structures of all cows were made by ultra-sonography (Falco 100, Pie Medical, 8.0 Mhz) and computer data analysis were done using the software EView® (Pie Medical Inc.). The incidence of first ovulation was evaluated in order to investigate the influence of the supplementation in the post-partum ovarian dynamics. In the study of the follicles size was used variance analysis, while for occurrence of first ovulation was used survival analysis, with nominal significance level of 5%.Ultra-sound images revealed that the size of dominant follicles of the treated animals was higher (P <0.05) than the same follicles in the control group. In survival analysis, it was observed that the supplemented cows presented the first post-partum ovulation early in relation to the control group (P <0.05), that shows the influence of the supplement in the post-partum metabolism.The addition of amino acids and low molecular weight peptides was able to increase the size of follicles in the supplemented animals, and anticipates the first ovulation. Data of this work indicate that amino

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 155 acid supplementation can stimulate follicular dynamics and minimize post-partum anestrous. P386 Role of Adiponectin in Regulating Ovarian Theca and Granulosa Cell Function in Cattle Spicer, LJ*; Lagaly, DV; Aad, PY; Grado-Ahuir, JA; Hulsey, LB Animal Science, Oklahoma State University, United States Adiponectin is an adipokine that has been implicated in insulin resistance, a condition associated with polycystic ovarian syndrome in humans, and alters steroid production by rat and pig granulosa cells. Furthermore, adiponectin receptor mRNA has recently been localized within ovarian tissue of rats and chickens, but whether adiponectin can directly affect ovarian theca or granulosa cell function in cattle is unknown. Therefore, experiments were conducted to determine the effects of adiponectin on proliferation, steroidogenesis and gene expression of large-follicle theca and granulosa cells as well as compare adiponectin receptor 2 (ADIPOR2) mRNA abundance in theca and granulosa cells of small and large follicles. Fluorescent real-time quantitative RT-PCR was used to elucidate the effects of adiponectin on gene expression of side-chain cleavage enzyme (CYP11A1) and LH receptor (LHR) in large-follicle theca and granulosa cells, as well as expression of 17-hydroxylase (CYP17A1) in theca cells and aromatase (CYP19A1) in granulosa cells. Adiponectin (3 μg/ml) attenuated insulin-like growth factor-I (IGF-I)-induced LHR, CYP11A1, and CYP17A1 gene expression in theca cells as well as decreased (P < 0.05) LH plus insulin-induced progesterone and androstenedione production by theca cells. In contrast, adiponectin (3 μg/ml) decreased (P < 0.05) LHR mRNA abundance in granulosa cells but did not affect steroidogenic enzyme gene expression in granulosa cells. Theca cells from large (8-22 mm) follicles had fourfold greater (P < 0.05) abundance of ADIPOR2 mRNA than theca cells from small (2-6 mm) follicles. In contrast, granulosa cells from small and large follicles had similar (P > 0.10) ADIPOR2 mRNA abundance and these levels did not significantly differ from those of small-follicle theca cells. To evaluate if hormones regulate ADIPOR2, theca cells from large follicles were incubated in the presence of 0 or 30 ng/ml of IGF-I without or with 30 ng/ml of LH for 24 h. IGF-I decreased (P < 0.05) abundance of ADIPOR2 mRNA by 14% in untreated theca cells but had no effect (P > 0.10) on ADIPOR2 mRNA abundance in LH-treated large-follicle theca cells. In contrast, LH increased (P < 0.05) theca cell ADIPOR2 mRNA abundance by 17% and 27% in the absence and presence of IGF-I, respectively. These results indicate that the inhibitory effects of adiponectin on steroidogenesis are primarily localized to theca cells and that the response system of theca cells to adiponectin (i.e., ADIPOR2) may be regulated during follicle growth by LH and IGF-I. P387 Renal abscesses as a complication of ovaryhisterectomy in a bitch Vicente, WRR1*, Medeiros, MG1, Pereira, ML2, Bürger, C2, Voorwald, FA1, Motheo, TF1, Carvalho, MB2, Toniollo, GH1 1Animal Reproduction, Faculty of Agriculture and Veterinary Sciences, São Paulo State University, Brazil; 2Veterinary Clinics and Surgery, Faculty of Agriculture and Veterinary Sciences, São Paulo State University, Brazil Rarely, renal abscesses are seen in dogs and can occur due to pyelonephritis, nephrolithiasis, and kidney biopsy. The ovaryhisterectomy (OHE) can show numerous complications such as hemorrhage, uterine stump pyometra, pyometra, fistules, urether ligature, hydronephrosis or pyonephrosis, urinary incontinence, partial colon obstruction and granulomas. To date, there are no reports of OHE complications resulting in kidney abscesses in this specie. A ten year-old Rottweiler female was referred to the Veterinary Teaching Hospital featuring anorexia, oligodipsia and vomiting for three days. The bitch underwent OHE due to pyometra history three weeks ago. Physical examination revealed prostration, moderated dehydration and intense abdominal and lumbar pain. Laboratory findings revealed

normocytic, normochromic anemia, leukocytosis, mild azotemia, and high levels of alkaline phosphatase. Results of the urinalysis showed isostenuria, hematuria, leukocyturia and bacteriuria. A large round mass appeared on abdominal radiograph as a soft tissue-density, caudal to the right side of the liver. Abdominal ultrasound revealed a round structure with multiple fluid-filled areas in the same region. Laparotomy was performed for definitive diagnosis. During the procedure, the right kidney was large, round, grey to yellowish, irregular and adhered to the abdominal aorta. Immediately, the animal underwent nephrectomy. There were cortical abscesses and pelvic recesses thickening at the sagital section through the kidney. Medical therapy included fluidtherapy for ten days, in addition to metronidazole (15 mg/kg PO, bid), tramadol (2 mg/kg PO, tid) and ranitidine (2.2 mg/kg PO, bid) for five days, and enrofloxacin (5 mg/kg PO, bid) for sixty days. Despite chronic renal failure, the patient was discharged after sixty days from the surgery, and recovered uneventfully. In summary, we hypostatized that the abscesses formation was due to a lesion in the capsule of the kidney that was promoted by a complication during the OHE procedure itself. P388 Effects of endothelin-1 (ET-1) a vasoconstrictor and bradykinin (BK) a vasodilator on luteal function in vitro in ewes Weems, Y1*; Johnson, D 1; Uchima, T1; Raney, A1; Lennon, E1; Bowers, G1; Randel, R2; Weems, C,1 1Dept. of HNFAS, University of Hawaii, USA; 2Agricultural Research and Extension Center, Texas A&M University at Overton, USA PGF2α is the uterine luteolysin delivered locally from the uterus to the adjacent corpus luteum (CL)-containining ovary. However, cow CL secretes PGF2α before the onset of luteolysis, but it also secretes the PGE at a PGE:PGF2α ratio of 1:1 and PGE1 and PGE2 prevents luteolysis (Weems et al. 2006; The Vet J:171:206-228 for review). ET-1 has been reported to mediate PGF2α-induced luteolysis (Milvae, Rev. Reprod. 5:1, 2000). Amounts of mRNA encoding ET-1 converting enzyme-1 (ECE-1), pre-pro ET-1, and the ET receptors (ETA, ETB) increased in bovine luteal tissue from days 1 through day 10 postestrus, amounts on day 17 were similar to day 10, and were not increased by PGF2α on day 10 when CL are responsive to the luteolytic actions of PGF2α, but were increased by exogenous PGF2α on day 17 only when luteolysis was already underway (Choudhary et al., Domest. Anim. Endocrinol. 27:63, 2004). In addition, Nitric oxide (NO) has been reported to be luteolytic by some in cows (Weems et al. 2006; The Vet J:171:206-228 for review). Furthermore, ET-1 and NO donors increased PGE secretion by bovine CL slices in vitro when estrus was not synchronized or when estrus was synchronized with PGF2α and did not affect CL PGF2α or progesterone secretion a. In addition, ET-1 or NO donors infused chronically intrauterine or into the interstitial tissue of the CL-containing ovine ovary delayed luteolysis. Therefore, the objective of this experiment was to determine whether ET-1 affected progesterone, PGE, or PGF2α secretion by ovine CL. Days-12 or 16 ovine CL were collected, weighed, and slices were incubated in vitro with Vehicle, ET-1, Bradykinin (BK-vasodilator), Bradyzide (BZ-BK2 receptor antagonist) or HOE-140 (BK1 receptor antagonist) at 39 C for 1 hour without treatments and for 4 and 8 hours with treatments. Media collected at 4 and 8 hours were analyzed for progesterone, PGE, and PGF2α by RIA. CL weights were analyzed by a One Way ANOVA. Hormone data were analyzed by a 2X5 Factorial Design for ANOVA. CL weights differed (P<0.05) by day. Progesterone in media was lower (P<0.05) on Day-16 than Day-12 and PGF2α did not differ (P>0.05) by day or treatment. PGE in media differed (P<0.05) by treatment, day or time. ET-1 and BK, but not BZ or HOE 140, increased (P<0.05) PGE secretion by day 12 and 16 CL tissue. Therefore, it is concluded that ET-1 is not luteolytic in vitro in ewes, but instead may be luteotropic or antiluteolytic by altering the PGE: PGF2α ratio. In addition, BK may also play a role in preventing luteolysis by increasing CL PGE secretion in vitro.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 156 P o s t e r A b s t r a c t s P389 Lysophosphatidic acid influence prostaglandin synthesis in the bovine endometrial cells: enzymatic mechanism and early pregnancy dependence Woclawek-Potocka, I*; Brzezicka, E; Korzekwa, A; Siemieniuch, M; Skarzynski, DJ Department of Reproductive Immunology, Institute of Animal Reproduction and Food Research, PAS, Olsztyn, Poland Lysophosphatidic acid (LPA) via receptor type 3 (LPA3) modulates prostaglandin (PG) synthesis in the murine endometrium. The lack of functional LPA3 may lead to implantation failures and embryo mortality in mice. However, we proved recently that there is LPA1, instead of LPA3 and LPA2, gene expression in the bovine endometrium. Moreover, we showed that LPA via LPA1 modulate PG secretion in vivo and in vitro from the bovine uterus at the end of luteal phase. In the present study, we examined whether LPA regulates PG synthesis in the bovine endometrial cells isolated from the uteri at the estrous cycle and early pregnancy and what is the enzymatic mechanism for this influence. Endometrial epithelial and stromal cells were isolated from the uteri on 8/9 day of the estrous cycle and 8/9 day of early pregnancy. The cells were treated with LPA agonist (LPA; 10-5 M, 10-6 M) and an embryonic signal – interferon-τ (IFNτ; 30 ng/ml) for 24 hours The concentrations of PGF2� and PGE2 were measured in the culture medium by EIA method. Moreover, gene expression for LPA1 and prostaglandin synthases (PGFS and PGES) were measured in the cells by Real Time PCR. In stromal cells both doses of LPA and IFNτ stimulated PGE2 synthesis (190, 180, 170% of control, respectively, for cells isolated from the uteri on 8/9 day of the estrous cycle and 195, 186, 175% of control, respectively, for cells isolated from the uteri on 8/9 day of pregnancy; P<0.05). In epithelial cells both doses of LPA and IFNτ decreased PGF2� synthesis (45, 50, 55% of control, respectively, for cells isolated from the uteri on 8/9 day of pregnancy; P<0.05). We also showed that in stromal cells both doses of LPA stimulated LPA1 gene expression (150, 145% of control, respectively, for cells isolated from the uteri on 8/9 day of pregnancy; P<0.05). Moreover, we proved that in stromal cells both doses of LPA and IFNτ stimulated PGES gene expression (210, 220, 225% of control, respectively, for cells isolated from the uteri on 8/9 day of the estrous cycle and 175, 180, 185% of control, respectively, for cells isolated from the uteri on 8/9 day of pregnancy; P<0.05). On the other hand, we showed that in epithelial cells both doses of LPA and IFNτ decreased PGFS gene expression (55, 50, 60% of control, respectively, for cells isolated from the uteri on 8/9 day of pregnancy; P<0.05).Concluding, in our study we proved that both LPA and IFNτ stimulate luteotropic PGE2 synthesis via gene expression for PGES in stromal cells of the bovine endometrium at estrous cycle and early pregnancy. Moreover, LPA and IFNτ decrease luteolytic PGF2� synthesis via PGFS gene expression in epithelial cells. Therefore, the stimulatory effect of LPA on the PGE2 production in stromal cells and concomitantly, inhibitory effect on luteolytic PGF2� production by epithelial cells, may serve as an additional antiluteolytic mechanism during the early stages of pregnancy in cattle. P390 Follicular growth and development of the neonatal mouse ovaries grafted in male kidney capsul Xue, L*; Yuan, A; Peng, N; Wang, N; Xu, D College of Veterinary Medicine, Hunan Agricultural University, Changsha 410128, Hunan, P.R. China Studies on ovarian transplantation have shown that the hormonal environment of male mice can support the development of follicles in ovarian allografts. However, it is not known whether neonatal mouse ovaries grafted in male recipients are developmentally competent. The objective of our study was to evaluate the follicular developmental competence of the neonatal mouse ovaries grafted in male recipient mice. Kunming strain mice were used in the study. Ovaries from 1-day-old mice were transplanted underneath the kidney capsule of male recipient mice aged 7~12 weeks old and were collected at 18 and 36

days after the transplantation for observation of histology and morphology. The retrieved grafts grew with significant increase in size (P<0.01) compared with 1-day-old ovaries and contained many growing follicles. The average diameter of the 18-day and 36-day grafts was 1881.1±204.7 µm and 2575.3±466.4 µm respectively with significant difference (P<0.01). The follicles in the 18-day and 36-day grafts developed to antral and mature follicles respectively, without formation of corpus luteum. Oocytes at the germinal vesicle stage were isolated from the grafted ovaries. In conclusion, this work has shown that the physiological environment of male mice can support the development of follicles in allografts of neonatal mouse ovaries. Poster 15 - Pregnancy, Parturition, New-Born Offspring P391 Aquaporins and water handling during canine and feline pregnancy Aralla, M1*; Groppetti, D2; Arrighi, S1

1Department of Veterinary Science and Technologies for Food Safety, Faculty of Veterinary Medicine, University of Milan, Italy; 2Department of Clinical Sciences, Faculty of Veterinary Medicine, University of Milan, Italy

Balancement of water concentration within the uterine environment is important in every reproductive moment of a female mammal life. Rapid transcellular water movements are facilitated by a family of water-selective channels known as Aquaporins (AQPs) that increase plasma membrane permeability. Previous results from our laboratory showed that AQP-mediated water movement between the intraluminal, interstitial, and capillary compartments is crucial in the uterine imbibition mechanism in the bitch, including periodic stromal oedema in preparation for embryo implantation, with evidence that the expression of different AQPs can be regulated by steroid sex hormones. Also, the importance of the AQP-mediated fluid regulation in uterine environment in the peri-implantation period is known in the woman and laboratory mammals, to assure the successful implantation of blastocyst and its survival. The establishment of pregnancy and its maintenance is dependent on strict synchronization of uterine receptivity with embryonic maturation. Water homeostasis during foetal development is of crucial physiologic importance. Amniotic fluid provides the fluid-filled compartment that is essential for normal foetal growth, movement and development. To examine the cellular distribution of AQP1, AQP2 and AQP5, uterine samples were collected on early, middle and late-gestation, during bitch and queen ovariohysterectomies performed with owners’ acceptance. Uterine fragments at the sites of implantation were processed for immunohistochemistry. Our results show distinct uterine expression pattern in response to pregnancy period. AQP1 was localized in uterine and placental venous vessels and capillary endothelia; additionally, the strongest signal of AQP1 was detected in the epithelium of the chorionic plate amnion, principally located at the foetal side. AQP2 was mainly present in the peri-implantation period, in the glandular epithelium and in some vessels. AQP5 showed preferential localization in the apical membrane of glandular cells, especially in the basal region of endometrial glands and with a greater pattern of immunoreactivity away from the site of implantation. Immunoreactivity was displayed at a lesser extent in late-gestation. In addition, AQP5 staining was found at the endometrial side of the amnion epithelium, especially basally located. These observations confirm that the AQP water channels are involved in peri-implantation fluid homeostasis and are important in the regulation of amniotic fluid volume to facilitate water transport on the maternal-foetal interface.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 157 P392 A clinical case of bleeding vaginal varicose veins causing severe anaemia in a late-term pregnant mare Bresciani, C*; Parmigiani, E; Di Ianni, F; Morini, G; Bigliardi, E; Vecchi, I Faculty of Veterinary Medicine, Parma University, Italy Vaginal varicosities have been described in the mare as uncommon, generally non-life threatening findings with a multifactorial aetiology. In pregnant mare varicosities usually shrink after foaling. The authors report a case in which vaginal haemorrhage from vaginal varicosities led to a severe anaemia. Treatment became necessary to save both mare and foal. A 18 years old pluriparous Standardbred mare 322 days pregnant at first examination showed poor body condition and normal haematological values. Two days later a swelling due to oedema mainly in the left perineum in standing position and episodes of vulvar bleeding during recumbency were reported. Haematological exams revealed a mild anaemia. Traction was made on vaginal mucosa to arrest haemorrhage, which appeared to arise from a single 8 cm bursted varicosity on the left dorsolateral vaginal wall. Vaginoscopic examination revealed also the presence of other varicosities on the right side and excluded bleeding from urinary tract. The combined thickness of the uterus and placenta (CTUP), the fetus, fetal fluids and membranes, evaluated by use of transrectal and transabdominal ultrasonography, were within normal ranges. Since vaginal bleeding persisted, the large ulcerated varicosity vein was resected and sutured. The status of placenta, fetus and the small varicose veins were monitored and phenylephrine hydrochloride cream was locally applied. The day after the mare became weak showing pale mucous membrane, tachycardia and tachypnea. The clinical and haematological values (PCV 12%; Hb 7 g/dl) induced us to deliver 10 L of whole blood collected from 2 donors. In two days PCV and Hb values became 30 % and 11 g/dl respectively. The authors were concerned that the other varicosities could bleed again and the clinical condition could worsen dangerously. The opening cervix stage was checked and oxytocin (12 IU i.v.) was administrated to induce parturition. Labour started ten minutes later and the mare gave birth to a healthy foal. Within 3 hours the entire fetal membranes were expelled and placenta showed no abnormalities. In the same time the foal was standing up and suckled. Two weeks later mare and foal were discharged. This study shows that in some cases bleeding from vaginal varicose veins could be fatal and lifesaving medical intervention is essential. P393 Transrectal and transabdominal ultrasonographic study of Amiata donkey pregnancy from day 150 to term Crisci, A1*, Rota, A; Panzani, D; Sgorbini, M; Camillo, F Dipartimento di Clinica Veterinaria, Università di Pisa, Italy Introduction The Amiata donkey breed takes its roots from southern Tuscany and is faced with the risk of extinction. To our knowledge, ultrasound assessment of donkey pregnancy has never been reported after day 60. Aim of this study was to describe ultrasonographic characteristics of Amiata donkey pregnancy from day 150 to term. Methods During 3 years, seven pregnancies of 4 Amiata jennies (3 of them were studied on 2 consecutive pregnancies), were monitored weekly from day 150 to foaling by transrectal (TRU) or transabdominal (TAU) ultrasounds. The following parameters were studied: diameter of foetal orbit (OØ), aorta (AØ) and chest (CØ), foetal heart rate (HR), presentation (PRE) and position (POS). Combined thickness of the utero-placental unit at the cervical pole (CTUP), was also evaluated. The OØ and CTUP were evaluated by TRU while AØ, CØ and HR by TAU. Results Six/7 pregnancies gave birth to a living foal, 1/7 ended with the death of both jenny and foal due to an intestinal torsion in the mother at day 326 of pregnancy. In the remaining 6 jennies the average pregnancy length was 343.5±9.5 days (range 333-361). Foetal PRE and POS changed frequently until the days 233±54 (196-310) and 315±31 (261-341) of pregnancy respectively; thereafter foetuses were always found in anterior presentation and in dorsopubic position. Between the 6th and the 12th month of pregnancy, the evaluated

parameters gradually increased except for HR which decreased. In the first and the last month of evaluation mean values were respectively: OØ (mm): 19.2 and 29.9; AØ (mm): 8.1 and 21.2; CØ (mm): 93.5 and 192.2; CTUP (mm): 6.0 and 10.9; HR (bpm): 138.1 and 82.1. In one donkey, at 11 months of gestation, CTUP (18.3 mm) and placental aspects were indicative of placentitis, and treatment resulted in regression of symptoms, CTUP reduction (11.3 mm) and birth of a living foal. Conclusions This is, to our knowledge, the first study describing foetal and placental parameters in jennies from mid-gestation to term. Data from a larger number of subjects needs to be collected before the normal ultrasonographic profile of donkey pregnancy can be described. This could be useful to early diagnose and treat donkey pregnancies at risk. P394 Evaluation of cortisol and free thyroid hormones in goat during the peripartal period De Sandro Salvati, A* , Nicassio, M; Lacalandra, GM; Leoci, R; Aiudi, G Department of Animal Production, Faculty of Veterinary Medicine, University of Bari, Italy In many animal species the prepartum plasmatic cortisol surge and antenatal glucocorticoid administration cause functional and structural changes in fetal tissues, so that the fetus is able to tough out both labour and extrauterine life. These effects are in part mediated by thyroid hormones. Forhead et coll. (Endocrinology, 2007) reported that in fetus and pregnant ewe the surge of glucocorticoids influences the variations of thyroid hormones in an opposite manner. In fetus it increases circulating level of T3 through tissue specific modifications of deiodinase D1 and D3 enzyme activity, while in pregnant ewe causes a remarkable decrease in T3 and T4 plasmatic levels without changing the deiodinase activity. The aim of this study was to investigate, through goats peripartum, the correlation among cortisol and free thyroid hormones, which are the metabolic active fractions of thyroid. This trial was carried out in South of Italy on 13 healthy goats aged 2-4 years, 45-50 kg/b.w. Blood sampling was done 24 hours before parturition (T0), the day of parturition (T1), 24h and one week after parturition (T2-T3). Plasma cortisol, fT3 and fT4 were evaluated with immunoenzimatic assay (EIA, RADIM, Italy). Obtained data were analyzed with ANOVA test and considered significant for P<0.05. Cortisol increased from 18.9±7.8 to 58.2±29.9 ng/ml (T0vsT1, P<0.001) and returned to initial levels (15,1±6.3 ng/ml) one week after parturition (T2vsT3, P<0.001). The free thyroid hormones, instead, had an opposite pattern compared with cortisol: fT4 significantly decreased from 10.6±2.5 to 8.3±2.6 pg/ml (T0vsT1, P<0.05), while fT3 had a significant decrease from 5.8±3.4 to 3.2±1.4 pg/ml (T0vsT2, P<0.05). In the week after delivery, free thyroid hormones show an increasing trend and reach values of 3.36±1.5 pg/ml and 9.6±4.3 pg/ml for fT3 and fT4 respectively. High cortisol levels induce a decrease of free thyroid hormones at parturition in goats, whereas, after delivery, the reduction of cortisol is associated with an increase of fT3 and fT4. A double mechanism may explain this kind of response: a suppression of hypothalamic-pituitary-thyroid activity and/or a reduction in pituitary sensitivity to TRH in order to adapt metabolism to stressful stimuli (Forhead et al., Endocrinology, 2006). It could be interesting to investigate the variations of deiodinase enzymes, with the aim of confirming that in goat, as observed in sheep, the fT3 and fT4 decrease is due to a suppression of hypothalamic-pituitary-thyroid axis rather than to deiodinase enzyme activation.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 158 P o s t e r A b s t r a c t s P395 The effect of intra-mammary infection on 205-day adjusted weight of calves in a Brahman herd Gonzalez-Castro, F1*, Scaramelli, A2, Cordero, F2, Tirado, MA3, Diaz, T4, Clerc, K3 1Departamento Medico Quirurgico, Facultad de Ciencias Veterinarias, UCV, Venezuela; 2Patologia, Facultad de Ciencias Veterinarias, UCV, Venezuela; 3Medico Quirurgico, Facultad de Ciencias Veterinarias, UCV, Venezuela; 4Instituto De Reproduccion Animal, acultad de Ciencias Veterinarias, UCV, Venezuela In order to evaluate the effect of intra-mammary infection (IMI) on 205-day adjusted weight of calves (P205d) in a Brahman herd, 104 Brahman cows with >1 calving were used. Calving season spreads from February 15th to June 15th. Restricted suckling, from day 30 postpartum, allowed 2 hours calf-cow contact in the morning and was maintained until cow was diagnosed pregnant. Bacteriological analyses were performed to individual quarter samples during early lactation (EL; 30±7 d post-partum; n=104) and at weaning (W; 210 d post-partum; n=66). Milk samples and their duplicates were collected aseptically in sterile vials, and stored on ice for transportation to the laboratory for bacteriological analysis, 6-8 h after sampling. Staphylococcus sp. were identified using growth in blood agar (GBA) and salt manitol agar, Gram staining (GS), catalase test (CT), OF glucose test, coagulase test (CT). Streptococcus sp. were identified using GBA, GS, CT, hypurate hydrolysis, aesculin hydrolysis, growth in the presence of bile, tolerance to 6.5% NaCl and CAMP test. Gram + bacilli were identified by GBA, GC, growth in Tween 80 and in the presence of 9.5% NaCl. Frequency distribution was used to determine the IMI prevalence in cows and quarters. ANOVA was used to study the effect of IMI on P205d, and only EL data was considered. The prevalence of IMI in cows during EL and W were: Coagulase negative Staphylococcus sp. different from S. epidermidis (CNS)= 19,2% (20/104) and 15,4% (10/65); Corynebacterium sp.= 7,7% (8/104) and 4,6% (3/65); C. bovis= 3,8% (4/104) and 3,1% (2/65); S. uberis= 3,8% (4/104) and 4,6% (3/65); S. agalactiae= 1% (1/104) and 1,5% (1/65); S. hyicus= 1% (1/104) and 1,5% (1/65); S. intermedius= 1% (1/104) and 0,0% (0/65); mixed infections= 4% (4/104) and 3% (2/65), respectively. The prevalence of IMI in quarters during EL and at W were: CNS= 10,2% (40/392) and 7,2% (18/249); Corynebacterium sp.= 4,8% (19/392) and 3,6% (9/249); C. bovis= 2,6% (10/392) and 4,4% (11/249); S. uberis= 2,0% (8/392) and 1,2% (3/249); S. agalactiae= 0,3% (1/392) and 1,6% (4/249); S. intermedius= 0,5% (2/392) and 0,0% (0/249); S. hyicus= 0,0% (0/392) and 0,4% (1/249); mixed infections= 1,1% (4/392) and 0,8% (2/249), respectively. IMI had no significant effect on P205d. P205d of calves from non-infected cows was 167.23±3 kg (n=52) and from infected cows 163.05±3 kg (n=37). In conclusion, even though a significant effect of IMI on P205d was not found, numeric differences were observed, and non infected cows weaned slightly heavier calves than infected cows. P396 The effect of umbilical cord clamping on acid-base balance of piglets at term Jonker, FH1*, Van Dijk, J2, Van Loon, TPAM3, Taverne, MAM1 1Farm animal Health, Faculty of Veterinary Medicine, Utrecht University, the Netherlands, Netherlands; 2Pharmacology, Pharmacy and Toxicology, Faculty of Veterinary Medicine, Utrecht University, Netherlands; 3Equine Sciences, Faculty of Veterinary Medicine, Utrecht University, Netherlands Umbilical cord clamping (UCC) was used to mimic the evolvement of birth asphyxia, like observed in natural farrowings. A laparatomy was conducted in 4 sows (on day 112 or 113) under general anaesthesia. Successive fetal compartments were exteriorised and each fetus was placed, with an intact umbilical cord and its head covered by a plastic bag, under a heating lamp. Piglets were alternately subjected either to 5-8 min of UCC (n=23) or served as controls (n=24) during a similar waiting period (WP). After cutting of the cord, 21 control and 21 clamped piglets had to be supported by manual ventilation with room air to establish independent respiration (IR). In 4 control and 7 clamped piglets no IR occurred and these piglets were classified as

non-surviving (NSV). Mean birth weight and duration of UCC or WP of NSV piglets did not differ significantly from surviving (SV) piglets. Before UCC / WP, acid-base balance values and heart rates (HR) of piglets did not differ within and between litters throughout the 5 h of surgery (mean 291± 44 min). UCC resulted in an initial fetal bradycardia, with a consecutive gradual increase in HR, followed by a second decrease in HR at which moment UCC was stopped. HR in control piglets remained constant during the WP. Mean body weight (BW) and duration of UCC / WP did not differ between SV control piglets (n=20; BW: 1336± 417 g; WP: 7.0± 1.9 min) and SV clamped piglets (n=16; BW: 1392± 403 g; UCC: 7.0± 1.1 min). Only a mild, mixed respiratory-metabolic acidosis in umbilical artery blood was measured at 10 min after cutting of the cord in SV UCC piglets, with lower pH (7.22; range 7.10-7.32) and BE (2 mmol/L; -3 to 7) and higher pCO2 (9.8 kPa; 7.0 – 12.2) and lactate values (6.5 mmol/L; 5.4 – 8.9) compared to SV control piglets (pH: 7.31, range 7.17 – 7.38; BE: 5 mmol/L, range -6 to 10; pCO2: 8.5 kPa, range 6.8 – 12.2; lactate: 4.0 mmol/L, range 3.0 – 5.6), independently of spontaneous breathing, manual ventilation and BW. This study demonstrates that loss of umbilical cord function alone is not responsible for severe asphyxia during birth. The response to UCC was rather variable with respect to onset of the second HR decrease and the degree of acidosis. The latter was not as severe as reported by Herpin et al. in 1996 (pH < 7.00; pCO2 >11.8 kPa; lactate >7.2 mmol/L ) for highly asphyxiated, vaginally delivered piglets. P397 Biochemical profile of the amniotic fluid at the delivery moment of the Nelore calves conceived by in vitro production and embryo transfer Moya, CF1*; Piagentini, M1; Prestes, NC1; Lucidi, CA2; Takahira, RK2 1Department of Animal Reproduction and Veterinary Radiology, São Paulo State University - FMVZ/UNESP, Brazil; 2Department of Veterinary Clinics, São Paulo State University - FMVZ/UNESP, Brazil

The purpose of the present study was to quantify biochemical constituents of the amniotic fluid of the Nelore calves conceived by in vitro production and embryo transfer at the delivery moment. Forty cows divided in 2 groups were used in this experiment: 01- Twenty cows pregnant with Nelore calves obtained by in vitro production after follicular aspiration; 02 - Twenty cows pregnant with Nelore calves obtained by superovulation of embryo donors. The animals were fed on pasture with mineral salt, supplement of corn silage and ration in the rural area in Avaré, São Paulo, Brazil. Near to the labor, the cows were transferred to a maternal paddock, permitting delivery observation. During the expulsion phase the amnion was punctured and 15mL of fluid were collected, kept in a plastic tube and stored in a freezer. The evaluation of the biochemical parameters were made through commercial kits. Total protein, glucose, chloride and urea were determined by colorimetric spectrophotometry. Creatinine and gama glutamyltransferase (GGT) were determined by kinetic spectrophotometry. Potassium and sodium were determined by flame photometry. Statistics included analysis of variance and Tukey test considering 5% as the level of significance. The mean values and their standard error for the biochemical parameters obtained from the amniotic fluid in the Group 01 were: 0.45±0.46 g/dL for total protein, 4.4±6.1 mg/dL for glucose, 8.0±5.3 mg/dL for creatinin, 40.3±16.5 mg/dL for urea, 17.2±14.6 UI/L for GGT, 63.7±31.5b mmol/L for chloride, 94.8±33.6 mmol/L for sodium and 8.3±7.1a mmol/L for potassium. The mean values and their standard error for the biochemical parameters obtained from the amniotic fluid in the Group 02 were: 0.36±0.57 g/dL for total protein, 6.7±7.7 mg/dL for glucose, 5.9±4.9 mg/dL for creatinina, 38.3±20.5 mg/dL for urea, 22.6±13.0 UI/L for GGT, 88.8±23.8a mmol/L for chloride, 77.7±33.4 mmol/L for sodium and 3.9±1.8b mmol/L for potassium (p<0.05). Statistically significant difference was only observed between the concentrations of chloride and potassium. Potassium concentration in Group 01 was higher while chloride concentration was lower than in Group 02, represented by a and b letters after the mean values. Financial Support: FAPESP.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 159 P398 Study of pituitary-adrenal axis in the trotter newborn foal Sgorbini, M1; Paci, V2*; Maccheroni, M3; Luchetti, E1; Rota, A1; Marmorini, P4; Corazza, M1 1Dipartimento Clinica Veterinaria, via Livornese lato monte, 56010 San Piero a Grado (PI), Italy; 2DVM, Florence, Italy; 3Laboratorio Dosaggi Endocrinologici, Azienda Ospedaliera Pisana, via Bonanno Pisano, 56100 Pisa, Italy; 4DVM, Pisa, Italy Introduction A rise in foetal plasma cortisol concentration has been detected in many species at a time when the maturational changes are occurring. A distinction between post natal cortisol levels in mature and immature foals is present. The aim of the present work is to study the trend of the plasmatic concentration of ACTH and cortisol in trotter foals during the first 48h of life. Materials and methods Fifty trotter foals different in sex and born in the same farm during breeding seasons 2006 were included in this study. Inclusion criteria: 1) 320-340 gestation days; 2) assisted deliveries; 3) mares vaccination for influenza and EHV-1 and treatment for GI parasites; 4) Apgar ≥7; 5) IgG concentration at 24h ≥800 mg/dl (SNAP® Foal IgG, IDEXX, USA); 6) immediate suction reflex and standing the head, sternal recumbency within 3 min, quadrupedal position within 160 min, first suckling within 180 min; 7) normal physical examination during the first week of life. Blood samples were collected within 6h from birth (T1), at 24 (T2) and 48h (T3) of life in EDTA and heparinised tubes. Samples were immediately centrifuged and plasma was stored at -20°C. Both ACTH and cortisol were analysed by chemoluminescence (Immunolite 2005 Analyzer, DPC, USA). X±SD were calculated both for ACTH and cortisol. Correlation has been calculated for both the hormones in relation with sampling times. Anova test has been applied both for ACTH and cortisol vs different sampling times and the differences were considered statistically significant for p<0,05. Results ACTH was 368±149 pg/dl at T1, 28,5±20,6 pg/dl at T2 and 28,1±14,9 pg/dl at T3. Cortisol concentration was 113,2±24,7 ng/ml at T1, 31,2±10,5 ng/ml at T2 and 27,3±11,5 ng/ml at T3. Coefficient r calculated by correlation test was -0,76 for ACTH and 0,81 for cortisol. The highest mean value at T1 both for ACTH and cortisol was statistically significant, while differences were not detected for T2 and T3. Conclusions Our results confirm an over-stimulation of the adrenal gland at birth in mature healthy foals. In this study hormones concentrations at birth resulted higher than the normal values reported in adult horses. After 24h both ACTH and cortisol concentrations were similar to the adult and remain constant after 48h, confirming that these hormones are already stable at 1 day of age. The negative correlation both for ACTH and cortisol vs sampling times confirm what reported previous by others. P399 Placental vascular endothelial growth factor and endothelial nitric oxide synthase are increased in sheep pregnancy at high altitude Parraguez, VH1-2*; Atlagich, M1; Urquieta, B1; Galleguillos, M1; De Los Reyes, M1; Kooyman, DL3; Araneda, S4; Raggi, LA1-2

1Facultad de Ciencias Veterinarias, Universidad de Chile, Chile; 2Centro Internacional de Estudios Andinos (INCAS), Universidad de Chile, Chile; 3Department of Physiology and Developmental Biology, College of Biology and Agriculture, Brigham Young University, USA; 4Laboratoire de Phisiologie Intégrative, Cellulaire et Moléculaire, UMR 5123 CNRS, Université Claude Bernard Lyon1, France High altitude (HA) hypoxia has deleterious effects on ovine reproduction. In addition to decreased fertility and low birth weight, the placenta show significant changes, including increased weight, decreased number of placentomes and increased area surface occupied by vasculature. Changes in placenta are more accentuated in sheep with long-time than in those with short-time adaptation to HA. Due to endothelial growth factor (VEGF) and endothelial nitric oxide synthase (eNOS) play crucial roles in the development of ovine placenta, we examined placental expression of VEGF and eNOS in

pregnant sheep after long or short adaptation to HA, and compared to those at sea level. Two groups of ewes were maintained at HA (3589 m) during pregnancy including ewes native to HA (group HH) and ewes raised at sea level and taken to HA 20 days after mating (group LH). A third group (LL) corresponded to ewes raised and maintained at sea level during pregnancy. At 140 days of pregnancy, placentas and fetuses were removed and weighed. Placentomes were counted, processed for immunohistochemistry, examined for VEGF and eNOS protein expression and vasculature area measured. Placental weight and vascular area were higher in HA ewes, while the number of placentomes and fetal weight were higher in LL ewes. VEGF and eNOS expression were higher in both HH and LH groups, when compared to LL group. VEGF was higher in LH than HH placentomes. No differences were observed in eNOS expression between HA animals. These results demonstrate that chronic hypoxia up-regulates the expression of placental VEGF and eNOS. Over-expression of VEGF in the placental tissue may indicate inadequate adaptation to HA. Supported by Grants ENL 06/2 From DI, Universidad de Chile and FONDECYT 1070405. P400 Congenital Malformation Cases in Cattle Ecco, R1, Leite, R1, Lobato, Z1, Rajão, D1*, Ribeiro, A2 1Veterinary School, Federal University of Minas Gerais, Brazil; 2Embrapa Dairy Cows, Brazil Introduction Congenital malformations of the central nervous system (CNS) are among the most common anomalies and its etiology includes genetic factors, maternal infections during pregnancy, toxicity, metabolic factors and irradiation in uterus. The abnormalities are the result of deviation from normal developmental pathways, which are primarily determined by the chromosomal material of the zygote, but the genetic material and its products are highly influenced by surrounding factors. Neural tube defects are the most common congenital abnormalities of the CNS and can have cranial involvement, such as anencephaly and meningoceles. Methods Two calves with teratogeny, alive for up to 72 hrs and a third, alive for over 60 days, were examined, euthanized and then submitted to necropsy. Results Both calves that lived only 72 hrs were born with a fluid round structure of approximately 30 cm in diameter, located on the dorsal area of the cranium, which did not contain encephalic mass, characterized as anencephaly, caused by a defect in the closure of the neural tube during fetal development. The third calf was born with a fluid filled sack of meninges of 40 cm in diameter and an opening of 8 cm in diameter, located on the rostral cranium region, characterized as cranium bifidum, which resulted in meningoceles and agenesis of the left cerebral hemisphere. The anomalies could be a result of a congenital bone defect during cranial formation, leading to hemiation of the brain or dura through this opening. Conclusions The malformation cases observed in this study are consistent with congenital malformations of the neural tube and encephalus. The etiopathogeny of Blue Tongue is being examined. P401 Vitality and viability of newborn goat kids from malnourished mothers are improved by maternal high energetic supplementation two weeks before parturition Terrazas, A1-2*, Santiago, R2, Soto, R2, Sánchez, H2, Serafin, N3, Ramírez, S4, Hernández, H4 1Secretaría de Posgrado, Universidad Nacional Autonoma de México, Mexico; 2Secretaria de Posgrado, FES-CUAUTITLAN, UNAM, Mexico; 3Instituto de Neurobiología, UNAM , Mexico; 4CIRCA, UAAAN, Mexico Malnutrition during pregnancy negatively affects kid’s viability and goat milk production; also, malnutrition during pregnancy impairs mother and young mutual recognition. Therefore, we investigated whether vitality and viability of newborn kids from malnourished goats may be improved by a maternal high-energetic supplementation two weeks before parturition. Multiparous mixed-breed dairy goats were allocated in the next groups: 1) Control (C, n=11); 2)

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 160 P o s t e r A b s t r a c t s Malnourished during second half of pregnancy, receiving 70% of their energy and protein requirements (MN n=12); 3) Malnourished but supplemented, two weeks before parturition, with 0.6 kg of ground maize/animal (S, n=14). The following variables were recorded: 1) dystocia, 2) motor activity and head reflex response in the first hour after birth, 3) birth weight and 4) percentage of mortality during the fist 45 days after birth. Proportion of dystocia was significantly higher in MN compared to S and C groups (MN: 16/29, S: 7/32 and C: 3/23 kids, P<0.01); non significant differences were found between C and S groups (P>0.05). After birth, kids from malnourished goats spent longer time trying to stand up than kids from Control mothers (1380.2 ± 291.2 vs 464 ± 75.9 sec., P=0.009), while non significant differences were found between kids from S and MN, and those from S and C goats. Similar results were found in the kid´s latency to be completely stood up (2457.4 ± 243 vs 1461.2 ± 199.4 sec., P=0.01). Proportion of kids showing positive response to the head reflex test (head rising after a touch on their nose) was smaller in MN than in C and S (MN: 7/16, C: 14/20 and S 20/27, P=0.04).While proportion of kids shaking their head in response to tickling inside their ear tended to be smaller in kids from MN than those from S and C mothers (P=0.08). Kids from Control were heavier at birth than those from Supplemented and Malnourished mothers (Control: 3.54 ± 0.1, Supplemented: 3.04 ± 0.9 and Malnourished: 3.02 ± 0.1 kg, P=0.01). Mortality from birth until the first 45 days of life was significantly higher in kids from MN than those from Control and Supplemented mothers (MN: 40%, C: 12% and S: 18%, P=0.05); non significant differences were found between Control and Supplemented. It is concluded that a high-energetic food supplementation few days before parturition improves some aspects of vitality and consequently the viability of kids from underfed mothers. Supported by PAPIIT IN217205, FIS B/3872-1 and CATEDRA IN2-07. P402 Neonatal clinical evaluation of Holstein calves born under distinct obstetric conditions Rodrigues, JA; Niemeyer, C; Silva, LCG; Lúcio, CF; Veiga, GAL; Vannucchi, CI* School of Veterinary Medicine and Animal Sciences, University of São Paulo, Brazil During normal bovine parturition, uterine contractions compress umbilical cord and uterine arteries, causing a reduction of fetal blood flow and acidemia. However, during dystocia, uterine contractions are more intensive, which even worsened these conditions. Administration of oxytocin during maternal dystocia may compromise fetal well-being due to maternal hypotension and increased fetal stress. The aims of this study were to evaluate neonatal blood gases, acid base and clinical parameters and to compare the initial period of metabolic compensation under distinct obstetrical conditions. Animals were allocated into 3 groups: Group 1–eutocia (n=10); Group 2–fetal dystocia with obstetric assistance (n=10); Group 3–maternal dystocia treated with oxytocin and calcium gluconate infusion (n=4). Neonates were examined using the APGAR scoring and rectal temperature measurement at birth, 5 and 60 minutes after calving. Arterial blood samples were collected at delivery and after 60 minutes, in order to evaluate blood gases, acid base parameters, hematocrit, hemoglobin, Na, K, BUN and glucose. Calves of Group 2 showed reduced vitality as compared to the other groups. Moreover, pH (7.15±0.15) and BE (-9.1mmol/L±10.3) at birth were significantly lower than in the other groups, while HCO3 (19.1mEq/L±8.1) was only lower than the reference values. Therefore, these results showed that dystocia can cause fetal distress as demonstrated by metabolic acidosis due to reduced blood supply to vital organs. Calves of Group 3 also showed metabolic acidosis at birth (pH 7.23±0.03 and BE -4.5mmol/L±2.1) and low pO2 at both measurements (44.5mmHg±10.6 and 42.2mmHg±11.2). However, there was no difference among groups. Oxytocin infusion can cause distinct uterine contraction pattern diminishing maternal-fetal circulation and increasing neonatal stress. Group 3 exhibited significantly higher HCO3 (26.3mEq/L±2.3) after 1 hour than the other calves, demonstrating the requirement to compensate hypoxia after delivery. During asphyxia, blood flow redistributes, resulting in lower renal perfusion and ischemic renal injury. As a result, electrolytic disturbances such as hyponatremia,

hypopotassemia and uremia were observed. All newborns showed lower hematocrit and hemoglobin results than reference values due to umbilical hemorrhage or immature erytropoiesis. All calves born normally or by assistance showed evident thermoregulation and glucose maintenance1 hour after birth. The obstetric condition was crucial to neonatal clinical development mainly affecting maternal-fetal circulation in dystocias and compromising the newborn vitality. FAPESP 06/50485-7. Poster 16 - Andrology, Male Genitals P403 Seric testosterone concentration (STC) in young Guzerat bulls (Bos taurus indicus) and its association with reproductive traits Andrade, VJ.*; Dias, JC.; Martins, JAM; Emerick, LL.; Ivo, JC.,Vale Filho, VR; Silva, MA, Souza, FA. Universidade Federal de Minas Gerais - Belo Horizonte, MG, Brasil Introduction Positive associations have been found (Gwasdauskas et al., 1980) among seric testosterone concentrations and reproductive characteristics, indicative of bull fertility. This study aimed to evaluate seric testosterone levels and their associations with andrologic characteristics in young Guzerat bulls. Material and Methods Blood samples collected at two hours intervals from 7 AM to 7 PM and reproductive characteristics from 24 young Guzerat bulls, aging from 24 to 34 months, raised under pasture conditions were evaluated. STC was determined by radioimmunoassay. Andrologic evaluations were performed according to Brazilian College of Animal Reproduction (1998) and the animals submitted to the BSE for zebu (BSE-Z), according to Vale Filho (1989). Pearson & Spearman correlations were used to estimate the associations among reproductive traits and STC. Results and discussion Means for age, weight, STC and andrologic characteristics (Scrotal circumference – SC; Sperm motility – SM; Vigor – Vig; Semen Volume – SVOL; Sperm Concentration – SCONC; Major Sperm Defects – MD; Total Sperm Defects – TD and BSE-Z. Means for age, weight, STC and reproductive characteristics of Guzerat bulls aging from 24 to 34 months, raised on pasture STC varied from 0.18 to 4.10ng/mL. It was also registered variation in STC according to blood collection time, with highest concentration (4.42 ng/mL) at 7 AM and lowest (0.36 ng/mL) at 7PM. It was also recorded correlations (P<0.05) among STC and age (0.56), weight (0.68), SC (0.50, SVOL (0.48), SCONC (0.66) and BSE-Z (0.38), similar to the results reported by Wildeus et al. (1984). It was not observed correlations (P>0.05) among physical and morphological semen characteristics as reported by Gwasdauskas et al. (1980). Conclusion It was registered great variability in STC in young Guzerat bulls, suggesting that it can be used as an auxiliary parameter in identifying bulls with greater reproductive potential, based on its favorable associations with reproductive characteristics. P404 Absorptive activities in the efferent ducts of adult cat studied by Aquaporin immunohistochemistry and lectin histochemistry Arrighi, S1*; Ventriglia, G2; Aralla, M 1; Zizza, S2; De Metrio, G2; Desantis, S2

1Department of Veterinary Science and Technologies for Food Safety, Faculty of Veterinary Medicine, University of Milan, Italy; 2Department of Animal Health and Well-being, Faculty of Veterinary Medicine, University of Bari, Italy Ultrastrucural features of the epithelium lining the efferent ducts (ED) in the cat, as in other mammalian species, are strongly indicative of an absorptive activity taking place towards the intraluminal fluids. It is well-known that more than 95% of the fluid leaving the testis is reabsorbed by the ED, but the cell structures involved in the reabsorption processes are still a matter of debate. The purpose of the present work was to study the absorptive pathways in the ED of adult

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 161 cats by means of 1) the immunohistochemical localization of different isoformes of the aquaporine family (AQPs), integral membrane water channels that facilitate rapid passive movement of water, and 2) the localization and the carbohydrate characterization of the endocytotic apparatus by means of the lectin histochemistry. The results will be interpreted in the light of ongoing electron microscopy studies. The study was carried on fragments of cat epididymides obtained at orchiectomy, fixed in neutral formalin and paraffin embedded. Immunohistochemistry examined the localization of AQPs 1, 2 and 5, whereas lectin histochemistry analyzed the glycoconjugates by a panel of 12 lectins in association with sialidase (s) treatment. AQP1-immunoreactivity was strongly evidenced at the apical surface of the ED non-ciliated cells, whereas the ciliated ones were unstained. The vasal endothelium was immunoreactive, too. No other AQP1-immunoreactivity was observed throughout the epididymal duct. Otherwise, AQP2 appeared absent in the ductuli efferentes but it was well localized in the cauda epidydimidis. AQP5-immunoreactivity was undectectable. Lectin histochemistry showed that the luminal surface and the apical region of ED non-ciliated cells contain glycans with terminal Neu5Acα2,3Galβ1,3GalNAc, Neu5acα2,3Galβ1,4GlcNAc, Galβ1,4GlcNAc, GalNAc (s-PNA, MAL II, RCA120, SBA reactivity) and with internal/terminal αMan (Con A affinity). In addition, terminal GalNAc and Neu5Acα2,6Gal/GalNAc (SNA reactivity) were present in glycans of the luminal surface and the apical zone, respectively. Ciliated cells expressed glycoconjugates only on cilia which showed terminal Neu5Acα2,3Galβ1,4GlcNAc (s-RCA120 staining), GalNAc, and internal/terminal αMan, GlcNAc (s-WGA, GSA II staining). Our data provide evidence for the involvement of different pathways in the bulk reabsorption of water and low molecular weight solutes by the non-ciliated cell of the cat ED. A combination of pathways is possible, too: AQP-mediated trans-cellular route together with fluid phase glycocalix-mediated endocytosis. Part of this work was granted by University of Bari, Funds 2007. P405 High and low motility ejaculates: a choice using laser light Carvalho, PHA1; Barreto Filho, JB.1*; Rossi, RODS.1; Braga, RA.2; Andrade, FSRM.1; Rabelo, GF.2 1Veterinary Medicine, Lavras Federal University, Brazil; 2Engeneering , Lavras Federal University, Brazil In semen analysis it has been widely accepted that spermatozoa percent motility (M) and velocity (V) are highly related to the sperm fertility. Assisted reproduction practices, like in vitro fertilization (IVF) and sperm sexing involve semen manipulations that decrease the cell mobility and thus objective techniques that allow rapid selection or discard of ejaculates are of great benefit to the artificial insemination (AI) industry. Laser light incidence (biospeckle) has been previously described as a evaluating method of sperm cell motility. The correlation between the intensity of the particle movements, responsible to the scattered light, and the rate of pattern change is the aim of the works to use that phenomenon as a source of information. The goal of this work was to verify whether this optical approach is capable of discriminate fast and slow motility cell patterns in different ejaculates. Frozen semen of six bulls, evaluated by light microscopy (LM), were divided in two groups according to their motility patterns (group I, M > 50%; Group II, M < 50%;), each group containing three animals. Sixty straws, 10 per bull, exhibiting sperm cell concentration adjusted to 30 to 35 x 106, in 0.5 ml volume were thawed at 37ºC / 60 seconds. Ten µl aliquots were illuminated by a coherent He-Ne laser beam light of 632 nm and 10 mW for 40 seconds, and the biospeckle index (inertial moment – IM) was obtained. An index (IND) to grade motility and velocity [IND = (V x 20 + M) / 2] was proposed to express LM data and compare to IM. The statistical analysis was based on correlation coefficients (CC) among M, V, IND and IM using the Spearman correlation test with 5% nominal significance level. CC between IM and V, IM and M, and IM and IND were, respectively, 42% (p<0.05), 59% (p<0.01) and 56% (p<0.01) for group I. To the second group, CC, to the same variables, were, respectively, 54% (p<0.01), 56% (p<0.01) and 59%

(p<0.01). The IM means (µi = 194.13; µII = 142.03) between the two groups were statistically different (p<0.01). These data show that biospeckle can be used in the selection of high motility ejaculates to be used in artificial reproduction procedures. P406 Sperm oxidative status and seminal quality in Bos taurus taurus and Bos taurus indicus bulls under tropical conditions Rodrigues, MP; Nichi, M; Perez, EGA; Cardoso, PBS; Viana, CHC; Barros, PMH; Barnabe, RC*; Barnabe, VH

Department of Animal Reproduction (VRA), Faculty of Veterinary Medicine and Zootechny (FMVZ), University of São Paulo (USP), Brazil Introduction European breeds are much more sensible to the tropical environmental conditions. Non-adapted animals present a fast decrease in sperm quality. This may occur due to oxidative stress, which is caused by the reactive oxygen species (ROS). Another deleterious event that, in human, is known to be caused by oxidative stress, is the damage caused by the cryopreservation. The aim of the present experiment was to evaluate the effects of breed on cryopreserved sperm quality and on sperm susceptibility to oxidative stress, and correlate those results with pre-freeze variables. Methods Semen samples of five Nelore and five Simmental bulls were collected during the summer months by electroejaculation and subsequently cryopreserved. Sperm conventional analysis and functional tests were performed before and after freezing. Pre-freeze values of antioxidant enzymes activity (SOD, catalase and GPx) and seminal spontaneous thiobarbituric acid reactive substances (TBARS), an index of oxidative stress, were evaluated. After thawing samples were submitted to a protocol of oxidative stress induction, followed by the measurement of the TBARS, which indicates the susceptibility of sperm to the oxidative stress. Data were analysed using the SAS System for Windows. Results Nelore bulls showed higher post-thaw. No catalase activity was detected on samples of both breeds. No differences were found on SOD and GPx content. Seminal TBARS were higher for the Simmental than for Nelore bulls (845 vs 497 ng/mL, respectively; p<0.05). Unexpectedly, post thaw spermatic susceptibility to oxidative stress were higher for the Nelore bulls (548 vs 118 ng/106 spermatozoa, respectively, p<0.05). Also, a positive correlation was found between pre-freeze TBARS and post-thaw motility (r=0.94, p<0.05), indicating the the higher the pre-freeze oxidative stress, the higher post-thaw motility. Conclusions Our results indicate that despite the pre–freeze higher susceptibility to oxidative stress, the European bulls showed a better antioxidant protection post thaw. This may indicate that probably, the spontaneous peroxidation that European bulls suffered due to the heat stress may have selected sperm more resistant to the cryopreservation when compared to the Nelore bulls. P407 Rats underfed during fetal to prepubertal life have lighter testes and epididymides, fewer sertoli cells, but moderate histological changes in the epididymis Genovese, P; Núñez, ME; Picabea, N; Pombo, C; Bielli, A* Departamento de Morfología y Desarrollo, Facultad de Veterinaria, Lasplaces 1550, Montevideo, Uruguay To study the influence of fetal to prepubertal undernutrition on rat’s adult testis and epididymis structure, 8 Sprague-Dawley female rats were fed ad libitum: (group C: control, n=4) or with 33.5% of gestational feed requirements (group U: underfed, n=4). From parturition to weaning (25 days of age), mothers were fed ad libitum but pups did not have access to chow (group C litters, n=8; group U litters, n=14). Both mothers and pups were weighed daily. Male pups (both groups) were fed ad libitum from weaning until weighed and slaughtered (100 days of age). Testes and epididymides were weighed, sampled and processed for histology. The following histological quantitative variables were studied: diameter of

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 162 P o s t e r A b s t r a c t s seminiferous tubules (ST), percentual and absolute (AVST) volumes of seminiferous epithelium and testicular interstitium, and number of Sertoli cells/ST cross-section and /testis, diameter of epididymal duct, of epididymal duct lumen, epithelium height of epididymal duct (EHED). Epididymal variables were studied for caput, corpus and cauda epididymal regions. Results (mean±sd) were compared with t tests (p≤0,05). Selected Pearson correlations were studied. Mother body weight (BW) at weaning (g, U vs C: 258.0±25.3***, 361.9±33.1), pup’s BW at slaughter (254.0±27.0***, 342.4±10.2), paired testicular weight (2.7±0.3*; 3.0±0.2), paired epididymal weight (g, 1.1±0.0**, 1.2±0.1), number of Sertoli cells/ST cross-section (18.2±1.2**, 20.2±1.3) and /testis (30.5±4.2x106*, 36.0±5.4x106) were smaller in group U. Mother BW at weaning was correlated with pup’s BW at slaughter (0.86***), testicular weight (0.72***), AVST (0.73***) and number of Sertoli cells/testis (0.69**). Pup’s BW at slaughter was correlated with testicular weight (0.65**), AVST (0.99***) and number of Sertoli cells/testis (0.64**). Testicular weight was correlated with number of Sertoli cells/testis (0.61**). Only EHED (corpus region) was different between groups (µm, U vs. C: 31.3± 4.4** vs 17.05± 7.8). Epididymal duct diameter from caput and corpus regions (0.039*), and from caput and cauda regions (0.035*) were correlated. The EHED (corpus region) was correlated with maternal BW at weaning (0.059*), pup’s BW at slaughter (0.059*), testicular weight (0.041*) and EHED (caput region, 0.014*). In conclusion, testicular structure, in particular the number of Sertoli cells/testis (and consequently, maximal sperm production) in adult rats is affected by undernutrition during fetal to prepubertal life. Epididymides from such animals are lighter but show minor changes in histological structure. P408 Cryopreservation of ovine semen with different techniques and cryoprotectors Carneiro, GF1,2*; Maia, VN2; Silva, SV1,3; Gomes Neto, OC1,2; Procópio, OCS1; Medeiros, LRD1,2 1Caroatá Genética, Gravatá, PE, Brazil; 2Clinica de Eqüinos Pedro Zaluski LTDA, Recife, PE, Brazil; 3Universidade Federal Rural de Pernambuco, Recife, PE, Brazil Introduction The use of Artificial Insemination (AI) associated with semen cryopreservation enable a rapid multiplication in the number of superior animals per sire and gives the possibility of storage and manipulation of genetic material. Objective: To compare the efficiency of three cryoprotectors: 7% glycerol (G), 7% ethilene glycol (EG) and 3% dimethil formamide (DF) on cryopreservation of ovine semen using two frozen techniques, conventional (with liquid nitrogen vapor in the styrofoam box) and automated (with a programmed frozen machine – TK 3000). Methods The study was performed at Caroatá Genética, Gravatá - PE, Brazil from August to November, 2006. Semen was obtained from five Santa Inês breed mature rams with 3-5 years old, with proved seminal quality. Semen collection was performed using artificial vagina with a total of six ejaculates per animal, giving a total of thirty ejaculates. Spermatozoa concentration was performed by spectrophotometry (Spermacue). After evaluation of semen sample, total volume was divided in three equal aliquotes, and diluents with each cryoprotector to be tested was added. Semen was processed in 0,25 mL straws and divided in equal numbers for each frozen technique. Straws were thawed for evaluation at least 5 days after frozen. Progressive individual motility/vigor was assessed subjectively under cover slip on a warm stage by phase contrast microscopy. Data from the variables frozen technique and motility/vigor was performed by chi-square (χ2). Results No difference were seen between the frozen techniques (p<0,2), however there was a significant difference among cryoprotectors (p<0,001). Motility results was 47,40 ± 6,8a for G; 30,82 ± 22,8a for DF; and 0,66 ± 1,84b for EG. The automated technique has the advantage of correcting the frozen curve according to ram individuality and this could be added to the sire frozen semen observations, including curve and cryoprotector that gave better results. The results obtained in this study enable us to conclude that despite G being the most used cryoprotector in ovine semen

cryopreservation, DF also showed efficacy in the sperm cells cryopreservation of this specie giving to the technicians an alternative in case of individual bad freezers. We are starting an AI program using these straws in order to complete the manuscript of this research checking fertility numbers. Conclusion There was no differences on frozen technique on this experiment. Among cryoprotectors, G and DF shows better efficacy in post-thaw motility of ram sperm cells compared with EG. P409 Primary epididymal dysfunction in zebu bulls: Changes in sperm motility andmorphology according to ejaculation frequency Chacón, J* Section of Andrology, Department of Animal Reproduction, School of Veterinary Medicine, Universidad Nacional (UNA), Heredia-Costa Rica Introduction Primary epididymal dysfunction is a disorder so far reported in bulls and boars related with an abnormal chemical composition of epididymal plasma. The typical semen picture from affected bulls is characterized by motility ranging 0-40%, and the presence of spermatozoa showing the bent tail with cytoplasmic droplet entrapped and distal cytoplasmic droplet as predominant abnormalities (1). The storage time of the spermatozoa in the epididymis cauda is critical on the development of this disorder. This report attempts to provide information on the effect of successive ejaculations on % sperm motility and morphology in 2 Brahman bulls presumably affected by primary epididymal dysfunction. Materials and Methods Two pure breed Brahman bulls (ID 23/01 and 360/1) whose spermiogrammes were characterized by 20% and 25% sperm motility and 56% and 43% bent tails with cytoplasmic droplet entrapped during their first andrological examination at 16 and 40 months of age respectively, were submitted to an exhaustive test aiming to determine the effect of successive ejaculations on % motility and sperm abnormalities. Semen samples (n=10/bull) were collected at an age of 22 (bull 23/01) and 52 months (bull 360/1) by electro ejaculation at 20 minutes interval and immediately after motility was estimated (400x). Sperm morphology was determined under phase contrast microscopy by fixing a semen aliquot in buffered formol saline and in slides stained with William’s solution (1000x/400 cells). After ending the exhaustive test, the bulls were allowed to sexual rest for 14 days and then, a single ejaculate (# 11) was taken from both animals. Results and Discussion An increase in % sperm motility was observed as the bull was progressively ejaculated at 20 minutes intervals. On the contrary, the levels of bent tails with cytoplasmic droplet entrapped decreased gradually in relation to ejaculate number (figure 1). This trend was p<0.05 starting from third ejaculation compared with the first. However, the sample collected after 14 days of sexual rest (# 11) showed almost the same picture seen in ejaculate # 1 of the exhaustive test. No significant differences were observed between ejaculations for other sperm abnormalities (p>0.05). The %±SD and range during the test for those defects was: Abnormal acrosomes 0.72±0.45 (0.25-2.25), damaged acrosomes and tailless heads 6.55±4.61 (0.75-17.75), head and nucleus 4.58±1.97 (1.75-7.0), middle piece 0.16±0.20 (0-0.5), proximal cytoplasmic droplets 2.27±1.62 (0.5-4.75), distal cytoplasmic droplets 11.11±5.04 (0.5-18.75), tails coiled under the head 2.96±1.74 (1.0-6.75), distal coiled tails 0.35± 0.28 (0-0.75) and right angle tails 2.6±1.66 (0.5-5.25). The % motility and levels of ejaculated spermatozoa showing the bent tail with cytoplasmic droplet entrapped defect, are significantly affected by the ejaculation frequency in those bulls affected by primary epididymal dysfunction.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 163 P410 Effect of Theriogon on fertility of native bulls and buffalo-bulls El-Amrawi, G.A.* Faculty of Veterinary Medicine, Alexandria University Four native bulls and four buffalo-bulls (7-8 years of age) were used for investigating the effect of Theriogon on libido and fertilizing capacity. Serum and semen samples were collected for three weeks (twice per week) before treatment to serve as controls. A single oral dose of Theriogon (100 mg/ kg. body weight) was given to each animal and serum and semen samples were collected twice per week form all animals for three weeks post treatment. On collection, libido index and reaction time (in seconds) were measured and the collected semen samples were evaluated for: Ejaculate volume, pH, individual sperm motility, percentage of live sperm, sperm cell concentration (in millions/ml), total sperm number per ejaculate and sperm abnormalities (primary and secondary). Testosterone concentration was assessed in serum samples using RIA technique. The fertility of each bull was assessed before and after treatment. The results revealed that, a single oral dose of Theriogon leads to improvement in testosterone level, libido, semen quality and sperm fertilizing capacity in both bulls and buffalo-bulls. P411 Seminal plasma heparin binding protein (HBP) in Gyr bulls and its association with andrological characteristics Folhadella, I.1*; Camargo, LSA.2; Castro TS.1; Salvador, DF 3; Sá, WF.2; Ferreira, AM.2; Andrade, VJ.1; Vale Filho, VR.1

1Veterinary School of Federal University of Minas Gerais, Brazil; 2Embrapa Dairy Cattle, Juiz de Fora, Minas Gerais, Brazil; 3CEDERJ, Rio de Janeiro, Brazil Introduction Bulls subfertility represents a negative impact in beef and milk cattle industry. Bulls with normal breeding soundness evaluation (BSE) have different fertility profiles that may be associated with differences in seminal chemical compounds, what leads to a need to look for biochemical markers to these differences. The aim of this study was to identify heparin binding proteins (HBP) of seminal plasma and their association with andrological characteristics such as scrotal circumference, motility, vigor, major and total sperm defects, and Andrological Classification by Points. Material and Methods welve Gyr bulls were evaluated by Breeding Soundness Evaluation for Zebu (BSE-Z), according to Vale Filho (1989). A sample of 1mL of fresh semen was frozen in liquid nitrogen for purification, isolation, quantification and identification of HBP by gel filtration chromatography and chromatography affinity. The concentration was evaluated according to Lowry (1951) and HBP identification by 1-D electrophoresis, with the reader in Totallab 100 program. Statistical analyses of possible associations between BSE-Z and HBP were made by Pearson Correlation, using the SAS (2002). Results and discussion Chromatography profile of HBP showed five heparin affinity peaks. HBP concentrations varied from 0.02096 to 0.19025mg/ml. Within the five HPB peaks were found eighteen HPB with different molecular weights. From these eighteen HBP band found in electrophoresis gel, the most concentrated HPBs were those with 13, 14, 16, 18, 20, 28, 29 and 30 KDa molecular weights. No association was found among proteins and andrological parameters. Conclusions HBP evaluations were not a feasible method for predicting field andrological parameters. Its use alone does not allow consistent results for selecting high reproductive performance bulls.

P412 Casa measurements of concentration, motility and viability, compared to established procedures for bull semen analysis: accuracy, reliability and its predictive value for fertility Frijters, A* R&D, CRV Holding BV, Netherlands Introduction The bull AI industry likes to use the most objective and standard semen analysis methods, that are also useful to predict fertility. The CASA instrument IVOS (Hamilton Thorne) was compared to our current tests, of which some are subjective visual microscopic assessments. Materials and methods Ejaculates (n=262) of 39 HF test bulls (12-15 months old) were collected, processed and frozen (15 million total cells/dose) over a period of 3 months. Concentration and motility were determined of fresh and thawed semen. IVOS was compared to Coulter counting (CC) for concentration measurements, using Heamo cytometry (HC) as the golden reference. IVOS was also compared to our standard tests for motility and viability (both visual microscopic assessments). Viability was only determined for thawed semen, using IDENT/VIADENT stains for IVOS analysis, and Hoechst staining for our standard test. For IVOS analysis 4-chamber slides were used (LEJA). To evaluate reliability, Coefficients of Variation (CV) were determined by processing and measuring samples in duplicate. The predictive value of many sperm characteristics for fertility (NRR) was analysed with GENSTAT (v 8.1). Results Concentrations of fresh semen correlated highly between the used methods (R≥0.89). Values obtained by IVOS and CC respectively were 1.0 ± 16.5 (n=46) and 0.2 ± 8.2% (n=49) lower than by HC (n=49). CV ± SD were 12.0 ± 10.0 (n=252) and 2.0 ± 1.8% (n=254). Using thawed semen, IVOS and CC respectively counted 2.6 ± 10.0 (n=256) more, and 2.1 ± 8.7% (n=256) less cells, compared to the expected dose. CV ± SD were 5.9 ± 5.6 (n=256) and 4.2 ± 4.2% (n=256). Motility measured by IVOS and our standard test did not correlate when fresh or thawed semen was used. The range was higher for thawed semen using IVOS: 18-69 vs 25-55% (n=256). Viability measured by IVOS and our standard test correlated moderately (R=0.76) for thawed semen, and resulted in CV ± SD of 5.6 ± 5.8 (n=255) and 2.3 ± 1.6% (n=256) respectively. The range was higher using IVOS: 19-81 vs 41-78% (n=255). A better prediction of NRR is possible using IVOS, but we were unable to quantify this, due to an insufficient number of inseminations. Conclusions When using IVOS, CC and HC correctly, concentrations are the same. However, high reliability is easier and faster obtained by CC. IVOS and our current tests do not measure motility and viability similarly, while differences are easier detected by IVOS. More inseminations are needed to study if IVOS predicts fertility better in addition to, or instead of our current tests. P413 Recrudescence of spermatogenesis following downregulation with a GnRH-implant in the dog: first morphological and hormone-analytical results Goericke-Pesch, S1*; Spang, A1; Bergmann, M2; Hoffmann, B1 1Clinic for Obstetrics, Gynecology and Andrology of Large and Small Animals, Justus-Liebig-University Giessen, Germany; 2Institute of Veterinary Anatomy, Histology and Embryology, Justus-Liebig-University Giessen, Germany Aberrations in semen quality causing infertility in males must still often be classified as idiopathic as no other deviations from normal, also in respect to peripheral hormone levels, have been found. Hence not an absolute deficit but rather aberrations in the local availability of hormonal control factors may be responsible for disruption of spermatogenesis. Consequently recrudescence of spermatogenesis was monitored after having achieved downregulation of testicular function with a GnRH-implant (Gonazon®, Intervet 18.5 mg Azagly-Nafarelin) in 30 Beagles. Implant removal was after 5 months (week 0) and 3-4 dogs were castrated at weeks 0, 3, 6, 9, 12, 15, 18, 21 and 24, the testes were conserved for further examination. To assess

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 164 P o s t e r A b s t r a c t s morphological changes approximately 200 tubule-cross-sections were evaluated and grouped (A-D) according to the most developed germ cell observed. Testosterone (T) and estradiol-17ß (E) were estimated in blood collected during downregulation and at castration. Timing of recrudescence showed distinct individual differences yielding different numbers of dogs per group: Gr. A, spermatocytes (n=4); Gr. B, round spermatids (n=3); Gr. C, elongating spermatids (n=6) and Gr. D, elongated spermatids (n=17). T and E concentrations increased from Gr. A to B (T: 0.14 ± 0.10 to 2.54 ±1.57ng/ml; E: 6.40 ± 2.19 to 9.73 ± 4.16pg/ml) and were constant thereafter. These first results imply that onset of spermatogenesis occurs at low steroid hormone levels, accompanied by expression of the androgen receptor, and is rapidly stimulated by a further increase. To our knowledge, this is the first study giving detailed information about recrudescence of spermatogenesis of the dog following downregulation. P414 Early Detection of Membrane Asymmetry in Frozen-thawed Buffalo Spermatozoa Govindasamy, K1*; Kumar, S2 and Sharma, B3

1PhD Scholar, 2Principle Scientist, Division of Animal Reproduction; 2Indian Veterinary Research Institute, Izantnagar, Bareilly (UP), India; 3Principle Scientist, Division of Animal Biochemistry, Indian Veterinary Research Institute, Izantnagar, Bareilly (UP), India Introduction Mammalian spermatozoa undergo tremendous chemical and physical stresses during cryopreservation. The sperm plasma membrane is one of the key structures affected by cryopreservation. When the cell membrane is disturbed, phospholipid phosphatidylserine (PS) is translocated from the inner to the outer leaflet of the plasma membrane, which is one of the earliest signs of membrane disruption. Annexin V conjugated to Fluorescein isothiocyanate (FITC) fluorochrome retains its high affinity for PS and therefore, serves as a sensitive probe that can be used for flow cytometric detection characterized by the loss of membrane asymmetry. Methods Fifty six semen ejaculates, eight ejaculates from seven healthy Murrah buffalo bulls (4-6 years age) maintained at standard management conditions were used for the study. The standard conventional cryopreservation protocol was adopted. Combination of two fluorescent dyes, Annexin V and propidium iodide (PI) was used to evaluate the membrane asymmetry in fresh and frozen thawed spermatozoa in conjugation fluorescent microscope and flow cytometry. Results Four groups of spermatozoa were identified: (i) viable spermatozoa (Annexin V-negative and PI-negative); (ii) viable spermatozoa with early membrane disruption but integer plasma membrane (Annexin V-positive and PI-negative); and two categories of PI positive, dead spermatozoa (iii) early necrotic (Annexin V-positive and PI-positive); and (iv) Late necrotic cells (Annexin V-negative and PI-positive). The four sperm population varied significantly between fresh and frozen thawed spermatozoa. In fresh semen, the early sperm membrane change was observed only in 17% of the total number of sperm. However, after freezing and thawing, these sperm accounted for more than 31%. After freezing-thawing, there was significant increase in the percentage of live cells with phosphatidylserine externalization (early membrane changes) and early necrotic cells, while reducing the percentage of live normal cells. Conclusions The Annexin V-binding assay is an effective tool to provide early detection of membrane asymmetry in the viable spermatozoa. Further, cryopreservation of buffalo spermatozoa induces translocation of phosphatidylserine as in the early apoptosis of somatic cells.

P415 Identification, Isolation and in vitro long term culture of Male Germline Stem Cell in Porcine Su Young, H*; Gupta, MK; Uhm, SJ; Lee, HT Dept of Bioscience & Biotechnology, ARRC, Konkuk University, Seoul 143-701, Korea Male germline stem cells are the basis of spermatogenesis and reside on basement membrane of seminiferous tubule in testis. Due to the lack of specific markers, identification of male germline stem cells is difficult to study in pig. In this study, we investigated to determine isolation and long-term culture system of male germline stem cell in neonatal pig testis. We used farm piglets 5~10days old, testis were digested by sequential enzymatic system, including 1mg/ml collagenase, 1mg/ml hyaluronidase and 0.25% trypsin/EDTA. Cells were separated by discontinuous density gradient and differential plating to increase of purity. Isolated cells were cultured in DMEM medium supplemented with 15% FBS, and specific growth factors as 1000 IU/ml leukemia inhibitory factor (LIF) and 10ng/ml glial cell line-derived neurotrophic factor (GDNF) at 37℃ incubator with 5% CO2. We have used STO cell line for feeder layer treated by mitomycin C for mitotically inactivation. After 7-8 days culture, three dimensional colonies appeared as original generation. Alkaline phosphatase (AP) staining expressed positively. Also these germ cells expressed stem cell markers OCT-4, SSEA-1, and spermatogonial stem cell markers PGP9.5, Dolichos Biflourus Agglutinin (DBA) in immunocytochemistry. These cells have been investigated by RT-PCR using specific primers, pgp 9.5 and pigvasa, which is expressed specifically in the porcine undifferentiated spermatogonia. We established porcine male germline stem cell lines from neonatal testis and in vitro long-term culture system. These results could be used for identifying the mechanism of spermatogenesis and applying for transgenesis. P416 In vitro effect of sodium nitroprusside (SNP) on sheep sperm motility Hassanpour, H* Department of Basic Sciences, College of Veterinary Medicine, Sharekord University, Iran Nitric oxide (NO) has been recently shown to regulate many functions of sperm such as Acrosome reaction, sperm chemotaxis and motility. The aim of this study is to investigate the effects of sodium nitroprusside (SNP) as nitric oxide donor on sperm motility of sheep. After collecting of normozoospermic samples by artificial vagina from twenty Bakhtiari rams, motile spermatozoa were harvested by the swim-up technique using SOF-HEPES medium then incubated for 120 minutes in the presence of SNP (0.1, 0.5, 0.7 μM). sperm motility assessed in four grades (rapid progressive motility, grade A; slow or sluggish progressive motility, grade B; non-progressive motility, grade C; or immotility, grade D.).In this study, SNP in the concentration of 0.1µM non-significantly increased sperm motility at grades A & C, and decreased at grades B & D. Concentration of 0.5 µM increased grade B & D, and decreased grade C. SNP at the concentration of 0.7 µM significantly decreased sperm motility at grade A (15.1%) and increased at grade D (16.7%), in comparison with their control groups (p<0.05). Decreasing of sperm motility at grades B & C at concentration of 0.7 µM weren’t significant. It is concluded that exogenous NO is beneficial at low concentration for ram sperm motility and is harmful at high concentration.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 165 P417 The effect of centrifugation and dilution on concentrations of reactive oxygen species in canine semen Heaton, L*, Pinto, CRF Population Health & Pathobiology, North Carolina State University College of Veterinary Medicine, United States Reactive oxygen species (ROS) are produced by sperm in small quantities as part of cell signaling cascades that enable the capacitation and acrosome reaction required for fertilization; however, excess ROS production has deleterious effects on DNA and fertility. Semen handling techniques should therefore minimize elevated ROS levels to maintain optimal fertility, but there is limited information regarding what circumstances inadvertently increase ROS. In the present study, it was hypothesized that both centrifuged and undiluted semen samples would have increased ROS concentration and that the addition of semen diluents (extenders) would reduce the concentrations of semen ROS. Canine ejaculates (n = 14) were collected manually and divided into four aliquots, two of which were extended 1:1 using EZ-BF with ticarcillin. Initial ROS concentrations were obtained using chemiluminescence (Lumat LB 9507, Berthold Technology, Oak Ridge, TN). Immediately thereafter, raw semen was analyzed for concentration, motility, viability, morphology, membrane integrity, acrosome integrity, and for the presence of leukocytes in the ejaculate. Following the initial analysis, one extended and one non-extended fraction were centrifuged for 10 minutes at 900 g. After centrifugation, the fractions were evaluated for ROS concentration, motility, viability, morphology, membrane integrity, and acrosome integrity. The ROS concentration, assessed by eleven relative light unit (RLU) readings, was averaged and standardized as RLU/106 spermatozoa. Data was analyzed using two way ANOVA with the significance level set at P = 0.05. The Tukey Test was used for all pairwise multiple comparison procedures of the mean responses to the different treatment levels. There was a significant effect of dilution (P < 0.05); undiluted (raw) semen samples had greater RLU means ROS concentrations than those diluted with semen extenders (320.1 and 87.9, respectively). The effect of dilution within the factor centrifugation was also significant (P < 0.05); there was a consistent trend for greater means of ROS concentrations in centrifuged samples than in non-centrifuged samples. This elevation of ROS did not appear to affect motility or other seminal parameters analyzed, suggesting that evaluating motility or even membrane integrity alone is not sufficient to identify oxidative stress and potential fertility problems. These results emphasize the benefits of using semen extenders prior to laboratory processing to reduce potential ROS-induced detrimental effects on semen quality. P418 Testicular Growth curve of Guzerat (Bos taurus indicus) raised in the savannah region at pasture and supplemented with silage during the dry period Henry, M1*, Osorio, JP1, Bergman, JAAG2, Carmo, AS1 1Clinics and Surgery Department, Federal University of Minas Gerais, Brazil; 2Animal Science Department, Federal University of Minas Gerais, Brazil Introduction The early detection of superior reproductive traits is desired in any selection program. Unanian and co-workers (2000) stated that scrotal circumference (SC) and testicular volume (VL) need to be evaluated when selecting young males due to the fact that the association of both characteristics improve the confidence in the selection process. The aims of the present study were to characterize some reproductive traits of young males in order to subsidize evaluation and selection of sires of the Guzerat breed as well as to evaluate the correlation between SC and VL. Material and methods Three hundred and thirty Guzerat males were evaluated at three months interval from five to 70 months of age. Data included a total of 1,757 observations. SC, length and width of both testicles were measured and VL was estimated according to Bailey et

al. (1996). Electro-stimulation seminal collection was attempted when males had SC above 19cm. Onset of puberty was considered when at least one motile sperm cell was detected in the ejaculate. Descriptive statistics were performed, Pearson correlation between both traits was calculated and SC and VL growth were modeled using Logistic function and General Linear Model Procedures (SAS, 1997). Results and discussion Growth curves for SC and VL reached inflection points, respectively, at 12.8 (18.1cm) and 23.3 months of age (389.4 cm3). Average age at puberty was 20.2 month with mean SC of 22.79cm and a VL of 298.28cm3. Estimated SC and VL for 75 months of age were, respectively, 36.2cm and 778.8cm3. The average growth rates of SC and VL, for the period before and after the inflection point were .58cm/mo, 16,3cm3/mo, .29cm/mo, 7,7cm3/month of age, respectively. Direction and strength of correlation between SC and VL (.91; P<0.001) indicated that SC per se is an efficient indicator of testicular growth and may be used as an indicator trait for selection to reduce age at puberty of Guzerat bulls. Acknowledgements To Fazendas Reunidas Antônio Balbino and CAPES/CNPq - IEL Nacional for the financial support. P419 Evaluation of scrotal circumference in bulls of blond Galician breed with presence of the myostatin gen Iglesias, A1*, Carri, JA2, Ferreiro, JM1, Cantalapiedra, J1, Sánchez, L1 1Dept. of Anatomy and Animal Production, University of Santiago de Compostela, Spain; 2Breeders Association of the Blond Galician Breed (ACRUGA), Lugo, Spain Introduction Muscle hypertrophy present in some bovine breeds originates animals with an evident external muscular development, which has an effect on the final production of meat. Nevertheless it can harm the fertility showing underdevelopment in the puberty, genital infantilism and less spermatic production. The average of the measures of scrotal circumference are calculated for different ages in bulls of the Blond Galician Breed, determined in a later stage the differences for two groups of animals depending on the presence or absence of the gene mutant of the myostatin. Methods The information was obtained of bulls proceeding from Perfomances Control Nucleus in the Program of Improvement of the Breed and farms controlled by the Breeders Association of the Blond Galician Breed (ACRUGA). The bulls with factor of Differentiation and Growth - 8 (GDF-8) were identified by means of the genetic test to detect the main mutations that give rise to an inactive myostatin. For the calculation we made use the statistical program jmp SAS 5.1., through a model in which effects of station and year of birth, age, genotype and farm are included. Results Values of scrotal circumference were computed (mean value ± standard error). for the ages of 7, 15, 18 and 24 months (31.98±0.63; 35.37±0.94; 37.90±0.59; 39.20±0.73). Regular effects were significant (P <0,001) for the variables of age, genotype and farm. The evaluation of the measures of the scrotal circumference to different ages in three different genotypes: mutant homozygous, heterozygous and normal homozygous, have given as a result that the bulls with double musculature presented less scrotal circumference than normal homozigous bulls in the studied ages. At the ages of 15 months both homozigous bulls of double musculature and heterozygous bulls presented less scrotal perimeter in relation to the normal homozigous. The above mentioned difference increased in animals of the 18 to 24 months. The obtained results coincided with ones reported by other authors: Michaux & Hanset 1981); Z. Tierz. Zuech. Biol. 98, 29-37; Quirino et al., (2004). V Simposium SBMA. Conclusion These considerations will have to be born in mind by the producers association in the future programs of crossing and improvement of the breed.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 166 P o s t e r A b s t r a c t s P420 Seasonal variations in the sperm parameters in dairy bulls regularly used for artificial insemination in Algeria Iguer-Ouada, M1,2*, Ayad, H2, Abbas, G2, Azzeradj, M2 1Department of Organisms and Populations, Faculty of Nature and Life Sciences, University of Bejaia Algeria, Algeria; 2Department of Organisms and Populations, University Abderahmane Mira, 06000, Bejaia, Algeria, Algeria The present work is the first report describing bull semen quality variations during the different annual seasons in this part of the word (North Africa). Data from 503 ejaculates collected during 14 months from 06 mature Holstein bulls were analyzed and different semen parameters were evaluated. Semen volume was measured using calibrated plastic vial, and gametes concentration was determined using a haemocytometer. Mass motility of semen was graded from a 0–5 scale, based on the appearance of waves and swirls created by sperm movement when visualized by keeping one drop of semen on a glass slide, without cover slip, under low power microscopic magnification (10×). The individual motility of freshly diluted semen was assessed after covering a semen drop on a glass slide with a thin cover slip under high power magnification (40×). The individual motility was recorded as the percentage of progressive motile sperm. Semen concentration and motility percentage showed a parallel evolution with a regular decrease form the spring season were the highest values were observed to reach the lowest values in the summer season. For motility percentage the values were 55.96 ± 1.94, 54.07 ± 1.9, 50.82 ± 2.46 and 37.33 ± 7.12 respectively for spring, winter, autumn, and summer seasons (Mean ± SE). The semen volume showed an inverse evolution increasing from winter (6.29 + 0.19 ml) to reach maximum values in summer (7.1 + 0.69 ml). It was concluded in the present work that season affected significantly different bull semen parameters. However, in one hand the confounding effects of ambient temperature and photoperiod on the semen quality variation in North Africa region needs further examinations as well as the impact of these variations in term of fertility. P421 Hyperthermia is more important than hypoxia as a cause of disrupted spermatogenesis Kastelic, J1*; Wilde, R1; Bielli, A2; Genovese, P2; Bilodeau-Goeseels, S1; Thundathil, J3 1Agriculture and Agri-Food Canada, Lethbridge Research Centre, Canada; 2Facultad de Veterinaria, Universidad de la República, Montevideo, Uruguay; 3Faculty of Veterinary Medicine, University of Calgary, Canada Mammalian testes operate on the brink of hypoxia; furthermore, it is believed that hyperthermia-induced disruptions in sperm quality and production are primarily due to hypoxia. The objective of this study was to determine the relative effects of hypoxia versus hyperthermia on sperm quality and production. We tested the hypothesis that hypoxia would disrupt sperm quality and production, whereas hyperoxia would prevent hyperthermia-induced reductions in sperm quality and production. Forty-eight CD-1 mice (approximately 50 days of age), were randomly allocated into six groups and exposed to environmental conditions of 20 vs 36 °C and oxygen (O2) concentrations of 13, 21, or 95% (2 x 3 factorial experiment) for 12 hours on two occasions (separated by 12 hours at 20 °C and 21% O2), and euthanized (CO2) 14 or 20 days later. One cauda epididymis was minced and placed in PBS for 30 minutes; sperm motility was assessed subjectively, and smears were prepared and stained with Eosin Y. One testis was fixed in Bouins (24 hours), transferred to 70% alcohol, and sections prepared and stained with hematoxylin and eosin. Morphological assessments were done ‘in the blind’ on semen smears (200 sperm/mouse) and testicular sections (30 videocamera fields/mouse). Data are mean±SD (combined for both days). There were primarily main effects of temperature; mice exposed to 20 vs 36 °C had differences in testis weight (110.4±14.3 vs 101.3±17.6 mg, P<0.06), daily sperm production (19.6±3.7 vs 16.5±6.1 x 106 sperm/g, P<0.03), motile sperm (44.8±15.1 vs 29.6±15.7%, P<0.01),

progressively motile sperm (26.5±12.1 vs 13.8±9.8%, P<0.001), morphologically normal sperm (77.6±7.9 vs 61.3±15.8%, P<0.0001), and defective heads (5.2±3.2 vs 17.1±11.8%, P<0.0001), and on histology, total altered germ cells (78.4±49.2 vs 125.7±103.4, P<0.05), total altered spermatids (56.3±38.2 vs 106.7±95.3, P<0.05), altered round spermatids (55.6±38.0 vs 98.8±84.5, P<0.05), and altered elongated spermatids (0.7±1.4 vs 8.0±19.3, P<0.1). However, there was an effect of O2 concentration on seminiferous tubule diameter (172±12, 189±11, and 183±10 μm; (P<0.0001) and epididymal sperm reserves (6.9±4.1, 12.3±4.8, and 10.7±7.0 x 106, P<0.05) in mice exposed to 13, 21, and 95% O2, respectively). Our hypothesis was not supported; sperm quality and production were not consistently disrupted by hypoxia, nor were hyperthermia-induced disruptions prevented by hyperoxia. These preliminary data did not support the long-standing dogma that hyperthermia-induced disruptions in sperm quality and production are due to hypoxia. P422 Pursuit of scrotal circumference, evaluation of semen quality and testicular ultrasonography in Brahman bulls within 18 to 21 and 21 to 24 months of age Lozano, H*, Jimenez, C Department of Animal Health, Theriogenology, Faculty of Veterinary Medicine, Universidad Nacional de Colombia (UN), Bogotá, Colombia A study was conducted to evaluate scrotal circumference (SC), semen quality and testicular ultrasonography characteristics of 460 Brahman (Bos Indicus) bulls between 18 to 24 months of age in 3 different regions of Colombia (South America). Bulls were evaluated twice with a 3-month interval. Both evaluations included SC measurement, seminal vesicle (SV) size, and semen analysis including color, concentration, sperm morphology and sperm motility; testicles, epididymis and spermatic chord were also subjected to ultrasonographic examination. Body weight was determined in both evaluations. Characteristics in bulls’ behavior during electroejaculation and detection of reproductive anatomic alterations were also considered. There was a high correlation between age and body weight of evaluated animals and between SC and body weight. For each region, age affected significantly SC, sperm motility, sperm morphology and size of seminal vesicles. The monthly increase in SC was estimated to be 0.928, 0.874, 0.801 cm for zones 1, 2 and 3 respectively. SC values for each age evaluated was 31.36±2.1 and 25.96±1.34, 28.07±2.23, 29.3±2.73, 30.08±2.51, 30.87±1.91, 31.4±2.3 and 33.2±1.9 cm for 18, 19, 20, 21, 22, 23, 24 months of age respectively. Of the 460 bulls, 49.7% of the bulls were considered satisfactory potential breeders during the first evaluation and 63.1% during the second evaluation. Of all bulls of this study, satisfactory potential breeders according to the zone of the study showed these results, 40, 57 and 69% for the regions 1, 2 and 3 respectively. Scrotal circumference was the main reason to discard bulls indicating that Brahman bulls raised under pasture have lower SC and that bulls should be evaluated at an older age or the standards should be adjusted for this pasture raised bulls. In conclusion, a high percentage of bulls of this study do not have a required sexual maturity to start a breeding program. P423 Conception rate in extensively managed beef cattle herds bred by bulls with different andrological status in the south area of tropical Costa Rica Navarro, L1*, Alpízar, E2, Chacón, J1 1Research Program on Applied Animal Andrology (PIAAA), Section of Andrology, Dept of Animal Reproduction, School of Veterinary Medicine, Universidad Nacional (UNA), Heredia-Costa Rica; 2Cattle Breeders Association from the South area of Costa Rica Introduction Fertility in beef cattle herds is influenced by management, environmental, nutritional and infectious factors being sub fertility more frequent than infertility. In tropical areas, those stocks, where a 50% calving rate has been reported, are managed

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 167 under extensive rearing with natural mating and are characterized by lack of selection, poor record keeping and infrequent veterinary assistance. Besides, breeding bulls are selected based mainly on phenotype, neglecting the importance of the breeding soundness evaluation (BSE) (1). Materials and Methods A single BSE was performed in 38 sires placed in 26 beef cattle farms managed under extensive rearing and continuous mating from the south area of Costa Rica. Bulls belonged to Brahman (n=8), Simmental x Brahman crosses (n=17), Simmental (n=6), Brown Swiss x Brahman (n=3) and other crosses (n=4). These bulls were under single sired mating breeding with 24.0±13.6 (5-73) adult cows. After the BSE, bulls were classified as Sound: Bulls that fitted the physical exam, with a scrotal circumference (SC) according to breed and age standards (2), healthy reproductive organs and without deviations in the spermiogramme. Deferred: Sires who did not meet the above requirements but with a favorable prognosis for recovering. Unsound: Serious clinical and spermiogramme abnormalities compromising gravely their potential breeding efficiency. Simultaneously, the conception rate (CR) was evaluated in the herds by rectal palpation and ultrasound. Thereafter, the cows were ranked as pregnant or not, being the cycling activity determined by the presence of a corpus luteum. Results and Discussion Mean SC (cm) and age (yrs) for sound (n=23), deferred (n=5) and unsound (n=10) sires were 37.4±3.3 and 4.5±2.4, 39.0±4.4 and 4.7±2, 37.6±5.2 and 4.2±2 respectively. In the unsound group, one bull had low SC and the remnant had clinical and spermiogramme deviations typical of testicular degeneration. The CR calculated solely upon the cycling cows was 82.5%±12.1 (64-100) for sound, 77.4%±27.2 (36-100) for deferred and 28.4%±30.5 (0-79) for the unsound sires. The CR was p<0.05 when comparing the unsound vs. either the sound or deferred bulls, but it was p>0.05 when comparing the sound vs. the deferred group. Given the conditions of cattle rearing prevailing in the tropics, the BSE is an efficient tool in order to identify those bulls with an unsound andrological status. The presence of those sires in the herd, contributes to impair seriously the productive proficiency of the beef cattle system. P424 Effect of epididymis storage temperature and cryopreservation on mitochondrial potential, membrane integrity and motility of bovine epididymal sperm Nichi, M1,2*, Rijsselaere, T3, Goovaerts, IGF2, Van Soom, A3, Barnabe, VH1, De Clercq, JPB2, Bols, PEJ2

1Department of Animal Reproduction (VRA), Faculty of Veterinary Medicine and Zootechny (FMVZ), University of São Paulo (USP), Brazil; 2Laboratory of Veterinary Physiology, Faculty of Pharmaceutical, Biomedical and Veterinary Sciences, University of Antwerp, Belgium; 3Department of Reproduction, Obstetrics and Herd Health, Faculty of Veterinary Medicine, Ghent University, Belgium Introduction Cryopreservation of sperm recovered from epididymides is potentially a useful tool in case of unexpected death of animals with high genetic value, species endangered of extinction, or when the collection of sperm by other means is not possible. Studies indicate that maintaining the epididymis at a lower temperature during storage and transport improves the quality of the retrieved sperm. The objective of this experiment was to study whether the storage temperature of the epididymis following slaughter influences sperm membrane resistance against lipid peroxidation, resistance to cryopreservation, and fertilizing capacity, and if the percentage of cytoplasmic droplets would play a role in this event. Methods Thirty two epididymides (16 bulls) were collected after slaughter and divided into two groups, stored at 4 and 34ºC for 2-3 hours, after which semen was collected from the caudae epididymides. The epididymal sperm was then evaluated using CASA, and an aliquot was stained with SYBR14/PI/JC1 to evaluate membrane integrity and mitochondrial membrane potential. Sperm was then frozen using an automatic device. Post thaw sperm was also analyzed using CASA and SYBR14/PI/JC1. Results A marked negative effect of cryopreservation on sperm motility was observed in the samples collected from epididymides

stored at 4ºC. Significant effects of temperature of epididymal storage and of cryopreservation were observed on motility parameters as well as on cell viability and mitochondrial activity. Pre-cryopreservation sperm motility, progressive motility, and velocity were higher in samples from epididymides stored at 4oC, while post-thaw sperm motility, progressive motility, and velocity did not differ between samples from epididymides stored at 4 or at 34oC. Although the drop on motility was not evident on sperm samples collected from epididymides stored at 34ºC, the effect of temperature before cryopreservation may have influenced those results. Strong correlations (r>0.6) were found for samples collected from epididymides stored at 34ºC between pre-freeze sperm motility indexes and mitochondrial potential and between post-thaw sperm motility and membrane integrity. Conclusions Results indicate that the conditions in which epididymides are handled after cryopreservation may influence post-thaw sperm quality, especially due to an impaired mitochondrial potential in sperm samples collected from epididymides stored at higher temperatures. This effect may have caused a higher susceptibility to membrane damages due to cryopreservation. P425 Assessment of spermatozoal characteristics in extended boar semen incubated at 18oC using flow cytometry Niżański, W1*; Partyka, A2; Dubiel, A1; Łukaszewicz, E2 1Department of Reproduction, University of Environmental and Life Sciences in Wrocław, Poland; 2Department of Poultry Breeding, University of Environmental and Life Sciences in Wrocław, Poland Extended liquid boar semen is commonly used for insemination for up to 5 days after collection. A litter size and farrowing rates are reduced when using semen stored > 3 days. The aim of our study was to estimate changes of spermatozoal characteristics in extended boar semen incubated at 18oC for 240 hrs using fluorescent staining and flow cytometry. The study was carried out on 35 ejaculates collected from 7 boars. Semen samples were extended in Safe Cell+ diluent (IMV Technologies). Spermatozoal characteristics were evaluated at 24, 48, 96, 168 and 240 hrs after collection. Spermatozoal viability was determined by SYBR-14/PI fluorescent staining. The DNA status of spermatozoa was assessed using the metachromatic properties of acridine orange (AO) in the sperm chromatin structure assay (SCSA). DNA fragmentation index (DFI) and high DNA stainability (HDS) were evaluated. Acrosomal integrity was measured by Pisum sativum (PSA) agglutinin labeled by a fluorescent probe that stains acrosome-reacted- or damaged spermatozoa only. The mitochondrial function of spermatozoa was evaluated with Rhodamine 123 (R123). Samples were analysed in a FACSCalibur flow cytometer (Becton Dickinson, San Jose, CA). The percentage of live spermatozoa did not change significantly during the 168 hrs of storage. A significant increase of the dead spermatozoa percentage (p<0.001) was observed at 96 hr of incubation. A significant decrease of the acrosome intact spermatozoa percentage (p<0.001) was observed at 168 hr post-collection. DFI increased significantly (p<0.001) beginning from hour 48 of incubation. Semen samples incubated for 24 hrs and 240 hrs showed no significant differences in HDS. The percentage of spermatozoa with functional mitochondria decreased significantly (p<0.001) at 240 hr of incubation. These results indicate that storage of extended boar semen at 18oC for two days results in a decreased integrity of sperm DNA. The viability of spermatozoa and the status of mitochondrial function are relatively stable during 168 hrs of incubation of boar semen. The acrosome structure of spermatozoa deteriorates from day 7 of incubation of extended boar semen at 18oC.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 168 P o s t e r A b s t r a c t s P426 Phenotypic correlations among andrologic markers of Nelore bulls from two to six years old, raised under pasture condition at Minas Gerais state, Brazil Nogueira, LAG.1*; Fragua, JD2; Salamanca, E2; Andrade, VJ.1; Martins, JAM1; Emerick, LL.1; Souza, FA.1 Vale Filho, VR.1 ¹Veterinary Medicine School, Federal University of Minas Gerais, Brazil; ²University of Applied and Environmental Sciences, UDCA, Bogota, Colombia Introduction Scrotal Circumference (SC), physical and morphological semen characteristics, expressed by Breeding Soundness Evaluation for Zebu (BSE-Z) index, can be taken as reference for evaluation of bulls, since sexual maturity phase. The aim of this study was to estimate phenotypic correlations among andrological markers of Nelore bulls from 2 to 6 years old. Material and Methods A total of 163 Nelore bulls from 2 to 6 years old were evaluated according to CBRA (1998) and classified by BSE-Z according to Vale Filho et al. (1988). Pearson’s and Spearman’s correlations were estimated by CORR procedure using SAS (2002) with 5% of significance. Results High correlations of BSE-Z, motility and total sperm defects (TD) were, respectively, 0.65 and -0.67 (P<0.05), suggesting the influence of these characteristics on BSE-Z. It was also observed high correlation between SC and weight (P<0.05), suggesting the importance of selecting larger aiming productive traits. Conclusion Correlations between BSE-Z, motility and total sperm defects, should be considered when selecting Nelore bulls from 2 to 6 years to reproductive efficiency. Once SC is an element of the BSE-Z, and showed high correlation with weight, BSE-Z should also be considered when selecting for productive efficiency. P427 Relationship between testosterone response to hCG stimulation and location of the testes in bilateral and unilateral cryptorchid bulls Osawa, T1*, Yamagishi, N1, Sugawara, M2, Ishikawa, H2, Sasaki, J1, Goryo, M1, Sato, S1, Izaike, Y1 1Department of Veterinary Medicine, Iwate University; 2NOSAI Iwai Veterinary Hospital, Japan Introduction Cryptorchidism is characterized by failure of one or both testes to descend into the scrotum. Although prevalence of this condition in bulls has been reported to be low, castration procedure becomes difficult if the animal has intra-abdominal testes. Castration of bulls is a preferable practice in fattening industry to enhance marbling score. Non-castrated cryptorchid bulls might result in a carcass with reduced value because they have an ability to produce a certain level of testosterone. However, it remains unknown to what extent the location of the testes affects the testosterone production in cryptorchid bulls. The aim of this study was to clarify the relationship between testosterone response to human chorionic gonadotropin (hCG) stimulation and location of the testes in cryptorchid bulls. Materials and methods A total of eight bulls, comprising of one Holstein-Friesian and seven Japanese Black (263 ± 77 kg of BW, 7.8 ± 2.3 mo of age; mean ± SD), admitted for cryptorchidism were used. Out of the eight bulls, five were bilateral and another three were unilateral (left side) cryptorchid animals. All of the three unilateral animals had the right testis removed. The eight animals, together with one castrated and two intact bulls were intramuscularly injected with 3,000 U of hCG. Blood was taken from the jugular vein of each animal 5 minutes before (day 0) and 1, 3, 5 and 7 days after hCG injection, and plasma samples were stored at – 30 ℃ until testosterone assay. Plasma concentrations of testosterone were measured by chemiluminescence immunoassay. Location of the testes was confirmed during surgery (n = 7) or necropsy (n = 1). Results Five (three bilateral and two unilateral) animals had abdominal testis (testes), one unilateral animal had intra-inguinal testis, and the other two bilateral animals had subcutaneous testes. Testosterone concentrations in the castrated animal were low (9.7 - 21.1 ng/dl) throughout the sampling period. The two intact bulls

showed a peak testosterone level on day 5 (1586.2 ng/dl) or day 7 (1028.8 ng/dl). The two animals with subcutaneous testes showed a peak testosterone level (953.4 ng/dl and 722.1 ng/dl, respectively) on day 3. On the other hand, the six animals with abdominal or intra-inguinal testes showed an average (± SD) of peak testosterone level (104.4 ± 83 ng/dl), which was intermediate between the castrated and intact animals, on either day 1, 3, 5 or 7 after hCG injection. Conclusions These results indicate that testosterone response to hCG stimulation may be related to the location of the cryptorchid testes and may be used to estimate meat quality in case of not castrating cryptorchid bulls. P428 Effect of glutathione on ovine cryopreserved sperm function and oxidative status Perez, EGA*; Nichi, M; Rodrigues, MP; Cardoso, PBS; Viana, CHC; Barros, PMH; Barnabe, VH; Barnabe, RC Department of Animal Reproduction (VRA), Faculty of Veterinary Medicine and Zootechny (FMVZ), University of São Paulo (USP), Brazil Introduction It is well known that sperm is extremely susceptible to the oxidative stress. This occurs especially due to the high content of poly-unsaturated fatty acids (PUFFAs) in its plasma membrane. The PUFFAs provide the necessary fluidity to the plasma membrane, which allows the sperm to move. However the double bonds present in those fatty acids are more susceptible to the oxidative stress. Therefore, sperm is highly dependent of the extra-cellular environment antioxidant protection. Studies in human indicate that cryopreservation may lead to damages to the sperm due to the oxidative stress. The objective of this experiment was to study if the antioxidant glutathione (GSH) may protect ovine cryopreserved sperm against the damages caused by the oxidative stress. Methods Semen samples of four rams were collected using an artificial vagina. Samples were then cryopreserved using a commercial extender (Ovimix™, Nutricell, Brazil) supplemented with different concentrations of reduced glutathione (control, 1, 5 and 10 mM). After thawing, samples were evaluated using conventional (motility and vigor) and functional tests (membrane integrity and mitochondrial activity). An aliquot of each thawed sample was submitted to the protocol of induced lipid peroxidation using ascorbate (20 mM) and ferrous sulphate (4 mM), with the further measurement of the tiobarbituric acid reactive substances (TBARS), as an index of oxidative stress. This technique aims to evaluate sperm oxidative status by its susceptibility to the lipid peroxidation. Statistical analysis was performed using SAS system for Windows. Results Samples treated with 5 mM of GSH showed significantly higher percentage of sperm with full mitochondrial potential and lower TBARS concentration (e. g. lower susceptibility to the oxidative stress). No effect of GSH was observed on motility, vigor and membrane integrity. The percentage of sperm showing full mitochondrial activity were correlated to motility (r= 0.64) and vigor (r=0.53). Correlation was found between TBARS and motility (r=0.86), indicating that samples with high motility showed an increased susceptibility to the oxidative stress. Conclusions In conclusion, our results indicate that the treatment of the extender with the antioxidant GSH (5 mM) may show a positive effect on post-thaw sperm quality of rams. Furthermore, motility may not be a good indicator of the fertility of a given sperm sample, since those samples showing high percentage of motile cells would be more susceptible to the oxidative stress. P429 Comparison of different density gradient centrifugation media in the ability to separate red blood cells and dead spermatozoa from viable, motile sperm Phillips, T*; Dhaliwal, G; Verstegen, JP College of Veterinary Medicine, LACS Small Animal Reproduction, University of Florida Gainesville, FL, USA Introduction For artificial insemination or prior to any reproductive techniques to semen, it is essential that the ejaculates are devoid of

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 169 factors such as: blood, urine, bacteria, or debris that possibly lead to reduced fertility. In dogs, blood is known to negatively affect semen preservation. Improving the quality of contaminated semen by purification prior to preservation or fertilization may increase the overall success rate in terms of pregnancy. The density gradient centrifugation method has been demonstrated as simple, inexpensive, and results in favorable sperm cell recovery. Our aim was to compare different commercial media [Isolate®, Percoll®, PureCeption®, PureSperm®] in their ability to optimally separate viable, motile sperm from non-motile sperm and red blood cells (RBC). Methods The sperm-rich 2nd fractions of 4 dogs were pooled. The pooled semen was analyzed with Spermvision for concentration, motility, morphology, and diluted to 300 x106/ml with CaniPro® chilled extender. Canine whole blood (10% v/v) was added to semen to mimic contamination. One ml of the blood/sperm admixture was pipetted over 4 ml of a double layered-column of the following gradients: Isolate®, Percoll®, PureCeption®, and PureSperm®. After centrifugation at 400 x g for 20 min at 23°C, the gradients were divided into 1 ml fractions (Top, B, C, D, E, Pellet). The 1 ml fractions were analyzed with Spermvision. Morphology of the Dif Quik stained smears of the fractions were examined under light microscopy (1000X). For the RBC/sperm ratio, 100 cells were counted in three fields in each slide, and an average was obtained. Results The fraction with the highest concentration of motile sperm and the lowest ratio of RBC for each media is a follows: PureCeption® pellet; PureSperm® E; Percoll® D, pellet; and Isolate® D, pellet. The percent recovery of sperm cells from the fraction with the highest concentration in each media was as follows: PureCeption® (93.0±2.25%) concentration, (72.0±12.97%) motility; PureSperm® (44.8±25.9%) concentration, (53.5±17.11%) motility; Percoll® (31.0±22.48%) concentration, (70.39±32.10%) motility; Isolate® (49.67±41.37%) concentration, (59.7±21.38%) motility. PureCeption® had a significantly higher percent recovery of motile sperm cells compared to the other sperm separation media (P<0.05; one-way ANOVA). Conclusion In this preliminary study, PureCeption® was superior to the other density gradient centrifugation media in allowing an optimal separation of viable, motile sperm cells from non-motile sperm cells and red blood cells. P430 Andrologic characteristics of 2 to 6 year old Nelore bulls raised under pasture condition in Minas Gerais State, Brazil Pinho, T1*, Fragua, JD2, Salamanca, E2, Rincón, OM2, Emerick, LL3, Dias, JC4, Andrade, VJ4, Vale Filho, VR5 1Animal Reproduction, Fluminense Federal University, Niteroi, Rio de Janeiro, Brazil, Brazil; 2Zootechny, University of Applied and Environmental Sciences, Colombia; 3Animal Reproduction, Federal University of Minas Gerais, Brazil; 4Zootechny, Federal University of Minas Gerais, Brazil; 5Animal Reproduction, Federal University of Minas Gerais, Brazil Introduction The use of high reproductive and genetic potential bulls can reduce the number of bulls in service in the herd and increase genetic gains. However, special attention should be given to bull age, once its reproductive potential can be decreased as it ages. The objective of this study was to compare the body weight (BW), scrotal circumference (SC) and seminal characteristics (sperm motility-Mot, major sperm-MD and total sperm-TD defects) for bulls of five different ages. Material and Methods Semen samples, collected by electro-ejaculator, from 163 contemporary Nelore bulls aging from two to six years, previously selected by clinical aspects with culling of those with andrologic disturbs, using the Brazilian College of Animal Reproduction (1998) standards and classified by Breeding Soundness Evaluation for Zebu (BSE-Z) according to Vale Filho (1989) were divided in 2 groups: (A) BSE-Z above and (B) below 60 points (scale 1-100 points)). Statistics analyses were performed using the SAS (2002) procedures at 5% levels. Means for BW, SC, MD and TD were compared using t student test, and Mot and BSE-Z using the Mann Whitney test.

Results For two, three, four, five and six year-old bulls, the means were, respectively: BW (kg), A=411.6±25.3 and B=370.0±34.9, P<0.05; A=456.4±22.9 and B=420.9±41.6, P<0.05; A=703.4±92.5 and B=701.4±59.7; A=645.1±47.1 and B=643.4±48.1; A=744.3±36.5 and B=744.0±51.9. SC (cm), A = 32.4±1.8 and B = 29.1±2.0, P<0.05; A =33.9±1.8 and B =32.8±2.3; A=35.4±2.5 and B=35.8±2.4; A=35.7±2.5 and B=34.4±2.2 and A=36.2±2.3 and B=36.4±2.5 (p>0.05), suggesting previously high selection pressure for this characteristic. Mot (%), A=61.6±6.9 and B=48.6±12.9; A=62.7±7.9 and B=51.8±7.7; A=60.3±10.6 and B=48.0±7.9; A=60.6±7.5 and B=50.3±5.5; A=61.0±9.1 and B=34.4±21.4 (P<0.05). MD (%), A=10.7±4.2 and B=17.1±12.7%); A=10.2±3.4 and B=14.6±5.6; A=8.0±3.8 and B=15.2±14.2; A=9.2±5.5 and B=15.6±10.9; A=7.9±4.3 and B=13.7±9.1 (P<0.05). TD (%), A=20.1±18.9 and B=28.1±15.2; A=18.5±9.8 and B=44.6±122.9; A=15.1±5.2 and B=35.1±23.7; A=17.6±9.9 and B=34.9±15.5; A=13.3±5.2 and B=26.4±14.3 (p<0.05). Conclusion BSE-Z did not change from two to six years of age, for Nelore bulls classified with more than 60 points, as technically recommended, meaning they can safely be used from two years of age, as far as reproductive efficiency is concerned. P431 Cryopreservation of ram semen: Effect of lipid peroxidation Salla Cardoso, PB*; Perez, EGA; Nichi, M; Rodrigues, MP; Viana, CHC; Barros, PMH; Barnabe, VH; Barnabe, RC

Department of Animal Reproduction (VRA), Faculty of Veterinary Medicine and Zootechny (FMVZ), University of São Paulo (USP), Brazil Introduction Semen cryopreservation is an important biotechnique that brings several advantages to the animal production system. However, this biotechnique, together with several others, are known to induce significant damages to the sperm. A hypothesis to explain this deleterious effect is the oxidative stress, which is cause by the reactive oxygen species (ROS). Spermatozoa is extremely susceptible to the attack of ROS due to the relatively small cytoplasm and especially due to the high content of poly-unsaturated fatty acids, more susceptible to the oxidative stress due to the double bonds. Ovines are known to show a higher content of PUFFAs when compared to species that are more resistant to the cold shock (e. g. human and rabbits). The aim of this study was to verify the effect of cryopreservation on sperm function and on sperm susceptibility to oxidative damages. Methods Semen of four rams was collected using an artificial vagina. Samples were then cryopreserved using a commercial extender (Ovimix™, Nutricell, Brazil). Before cryopreservation and after thawing, samples were evaluated for motility, vigor and membrane integrity. An aliquot of each semen sample (before and after cryopreservation) was submitted to the protocol of induced lipid peroxidation using ascorbate (20 mM) and ferrous sulphate (4 mM), with the further measurement of the tiobarbituric acid reactive substances (TBARS), as an index of susceptibility to the lipid peroxidation. Statistical analysis was performed using SAS system for Windows. Results Differences were found on motility, membrane integrity, and TBARS when comparing samples before and after cryopreservation (66.2%, 54.1% and 609.4 ng/106sptz; 21.75%, 35% and 1104.5%, respectively; p<0.05). No effect of cryopreservation was found on vigor. A negative correlation was found between TBARS and percentage of sperm showing intact membrane (r=0.66; p<0.05), indicating that whether sperm with damaged membrane would be more susceptible to the attack of ROS or sperm with membranes showing a higher susceptibility to the oxidative stress would indeed suffer more damages in its plasma membrane. Conclusions In conclusion, our results indicated that lipid peroxidation may be an important factor on the decreased quality of sperm after cryopreservation, especially due to damages to the plasma membrane.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 170 P o s t e r A b s t r a c t s P432 The effect of the addition of seminal plasma and antioxidants to frozen thawed ram semen Sicherle, CC1*, Maia, MS2, Bicudo, SD1, Green, RE1, Azevedo, HC2 1Department of Animal Reproduction and Veterinary Radiology, UNESP, Botucatu, São Paulo, Brazil; 2Embrapa Semi Árido, Petrolina, Pernambuco, Brazil, dEmbrapa Tabuleiros Costeiros, Sergipe, Alagoas, Brazil Intoduction The structural changes in ram spermatozoa after cryopreservation are a fact assumed by several authors (1). This fact can be explained by a combination of factors that include a low level of membrane phospholipids and also by the oxidation process that generate the reactive oxygen species (ROS) which, when in high levels, are toxic to spermatic cells (2). The seminal plasma (SP) is a complex mixture of components as proteins, sugars and antioxidants. Evidence of high levels of pregnancy after cervical insemination in ewes with frozen thawed semen after a swim-up procedure supplemented with SP indicates a way to improve fertility using this method for artificial insemination in sheep (3). The aim of this study was to evaluate the effect of the addition of SP and the antioxidants catalase (CAT) and Trolox (TRO) on the structural and kinetics parameters on frozen thawed ram semen, independent of individual characteristics of cryopreservation resistance. Materials and Methods With this purpose four groups were established, CO (semen sample + 200µL PBS), CAT (12,5mg/mL+ PBS = 200µL), TRO (100µMol/100 x 106 sptz + PBS = 200µL) and SP (60% of seminal plasma diluted in PBS) added to semen samples in the proportion of 1:1. The SP was obtained from tree different rams, after semen collection all ejaculates were pooled, centrifuged and filtered as described by Mortimer & Maxwell (4). Semen samples were obtained from 13 rams and after dilution for a final concentration of 100 x 106 sptz/0,25mL were frozen. One sample from with ram per group were thawed and immediately mixed on the solutions groups for posterior analyses after 5 minutes of incubation. The kinematics parameters, as total motility, progressive motility, average path velocity, curvilinear velocity and straight-line velocity were analyzed using the computer assisted sperm analyzer (CASA). The membrane integrity (MI) were determined by by the combination of fluorescent probes Propidium Iodide and Carboxyflorescein, and on the capacitation status analyzed by the assay using Chortetracycline (CTC) (4). Results and Discution There were no statistic differences (P>0,05) between groups on the kinematics parameters, on the membrane integrity, and on the capacitation status analyzed by the assay using Chortetracycline (CTC). Probably in our experimental conditions the oxidative stress generated wasn’t high enough to permit the effectiveness of the antioxidants. P433 Semen quality (SQ) and scrotal circumference (SC), in Nelore bulls, from 2 to 6 years old Silva, PAR.1*, Emerick, LL.1, Martins, JAM.1, Andrade, VJ.1, Quintao Lana, AM.1, Leite, TG.1,Vale Filho, VR.1, Salamanca, E.2 1Medicine Veterinary School, Federal University of Minas Gerais, Brazil; 1Universidad de Ciencias Aplicadas Y ambientales, UDCA, Bogota, Colombia Introduction SC and SQ are important parameters for selecting bulls with adequated reproductive efficiency during the first 21 days of breeding season. However, there are still some doubts related to bull age in relation to semen quality, as far as reproductive efficiency is concerned (Feliciano Silva et al., 1993). The aim of this study was to evaluate the evolution curve of SC and total semen defects (TD) from 2 to 6 year-old Nelore bulls, elucidating doubts concerning SQ as the animal ages. Material and Methods Semen samples from 163 Nelore bulls, aging from 2 to 6 years, were collected by electro ejaculation and evaluated according to Brazilian College of Animal Reproduction (1998). Models of linear and quadratic regression were estimated (Sampaio, 2002), verifying the evolution of TD and SC according to age. Results A linear model (Y=0.59-0.53X; R²=0.92, p<0.01) was estimated for TD from 2 to 6 years, showing that TD decreased

linearly in animals from 2 to 6 year olds, indicating that Nelore bulls did not reach their full semen maturity by six years of age. A quadratic model (Y=0.29+0.27X-0.22X²; R²=0.97, p<0.05) showed that in Nelore bulls, SC growth stabilized around 4 years of age. Conclusion Nelore bulls raised on pasture from 2 to 6 years of age did not reach their reproductive plenitude, based on SQ, eventhough reaching full SC development by 4 years of age, showing the importance of evaluating SQ besides SC, when selecting for reproductive efficiency. P434 Older breeding bulls are exposed to oxidative stress and decreased welfare condition Stradaioli, G1*, Zamparini, M1, Tassielli, V1, Stradaioli, G1, Salvador, D2 1Dipartimento di Scienze Animali, University of Udine, Italy; 2Official Vetrinary of the AI center, Intermizoo S.p.a., Padua, Italy Often breeding bulls are affected by pathologies caused by ageing and suboptimal feeding and housing conditions. In human, oxidative stress induced by reactive oxygen species is known to be involved in the process of ageing and in many age related pathologies. Moreover, that condition could also compromise the reproductive function. The aim of this research is to evaluate the pattern of semen production, some oxidative stress markers and cortisol blood levels in bulls of different age used as sires. Animals (n = 81) come all from the same artificial insemination centre and were of the same breed (Holstein Friesian). The age of bulls range from 1 to 9 years and the animals were maintained in individual pens, and subjected to the same breeding and feeding management. Semen were collected twice per week and blood samples were withdrawals once a month for four months. Semen were evaluated for motility by computer assisted semen analysis system and number of seminal doses produced were also recorded. Welfare and oxidative stress conditions were evaluated from blood’s analysis of glutathione (GSH) and cortisol levels, and glutathione peroxidases (GPx) and superoxide dismustase (SOD) activity. Statistical analysis of the data were performed subdividing the subjects for age into 3 groups (group 1 = <2 years, group 2 = fro 2 to 6 years, and group 3 = >6 years old). The GSH levels were significantly higher (P<0.001) in groups 2 and 3 compared to group 1 (537.4 ± 17.4, 863.1 ± 25.1 and M for groups 1, 2 and 3, respectively). The bloodμ937.5 ± 28.0 cortisol concentrations were also higher (P< 0.001) for older animals (1.4 ± 0.4, 5.1 ± 0.5 and 4.6 ± 0.4 ng/mL for groups 1, 2 and 3, respectively). The GPx activity decreases (P<0.01) with age (203.8 ± 5.6, 177.1 ± 8.3 and 174.1 ± 9.2 U/mg Hemoglobin, for groups 1, 2 and 3, respectively). The SOD activity also decreased with age but the differences were not significant (1515.9 ± 85.5, 1343.4 ± 126.9 and 1152.6 ± 140.1 U/mg Hemoglobin, for groups 1, 2 and 3, respectively). Semen doses production for each collection day were also significantly influenced by age with higher production for bull of group 2 (740.7 ± 35.6) compared to groups 1 (252.9 ± 37.6) and 3 (572.3 ± 53.6), while no differences emerged from spermatozoal motility analysis. In conclusion, the oldest animals have been more sensible to oxidative stress as they have lower GPx and SOD activity and higher GSH levels. Older bulls seem also more stressed than the younger based on higher blood cortisol concentrations and strategies to improve welfare are needed.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 171 P435 Potential fertility estimation in bulls using polyacrylamide gel instead of cervical mucus in the sperm penetration test Taş, M1*, Bacinoglu, S2, Cirit, Ü2, Özgümüş, S3, Kaşgöz, H3, Pabuccuoglu, S2 1Department of Reproduction and Artificial Insemination, Faculty of Veterinary Medicine, Dicle University, 21280 Diyarbakir, Turkey; 2Department of Reproduction and Artificial Insemination, Faculty of Veterinary Medicine, Istanbul University, 34320 Avcilar, Istanbul, Turkey; 3Sub Department of Chemical Technologies, Department of Chemical Engineering, Faculty of Engineering, Istanbul University, 34320 Istanbul, Turkey The aim of the study was to develop a polyacrylamide gel that could be used instead of bovine cervical mucus in the cervical mucus penetration test (CMPT) to obtain coherent and replicable results in bulls. The frozen semen samples of six Holstein bulls, which were divided into two fertility groups as high and low according to their non-return rate (NRR), were used. The modified CMPT (mCMPT) was carried out within 0.25 ml transparent plastic straws with an inner diameter 1.7 mm in this study. The penetration ability of spermatozoa to bovine cervical mucus and to polyacrylamide gels swollen with two different solutions [NaCl (G1) and PBS (G2)] was compared. For the penetration test, the straws filled with cervical mucus and both gels were dipped into thawed semen samples and incubated at 37 °C for 15 min. After the incubation, straws were frozen in liquid nitrogen vapour and stored at -20 °C. On the evaluation day, the frozen straws were cut at 1.5–1.75 cm (penetration distance range = PDR1), 3.25–3.5 cm (PDR2) and 5.0–5.25 cm (PDR3), beginning from open-end of the straws. The separated frozen parts were then immediately transferred onto special counting slides by pushing with a mandrel and left to thaw. Thawed samples were covered with cover glass and penetrated spermatozoa in these parts were counted. The relation between the results and fertility of bulls was determined. When compared with the low fertility group, the number of penetrating spermatozoa was found to be significantly higher in the high fertility group in mucus at PDR3 (p<0.0001), and in G1 at PDR1 and PDR3 (p<0.0001). In G2 medium, however, no significant difference was observed between either of the fertility groups with respect to spermatozoa number determined at all distance ranges. In the correlation analysis, no difference was found between fertility and the number of spermatozoa penetrating the mucus and gel swollen by PBS, while a significant positive correlation was found between fertility and the number of spermatozoa penetrating PDR3 of the gel swollen with NaCl (r = 0.408; p<0.001). We have determined that the gel swollen with NaCl produces better results and this gel can be used instead of bovine cervical mucus for the CMPT. Therefore, we have concluded that the penetration test performed by polyacrylamide gel swollen with NaCl can be a suitable technique for estimation of the potential fertility of bull spermatozoa. P436 Post-thawing evaluation of bull semen frozen by various antioxidants Uysal, O 1*; Bucak, MN2; Yavaş, İ1; Varışlı, Ö1 1Ankara University Faculty of Veterinary Medicine, Department of Reproduction and Artificial Insemination, 06110, Dışkapı, Ankara, Turkey; 2Lalahan Livestock Research Institute, Ministry of Agriculture, Ankara, Turkey Cryopreservation induces a series of alterations in sperm structure and function that ultimately interfere with the fertilizing potential of these cells. The freezing process produces physical and chemical stress on the sperm membrane which in turn that reduces sperm viability and fertilizing ability. A total number of 20 ejaculates from 2 bulls were evaluated and included in the trial if the following criteria were met: volume varying between 4.5–6.0 ml, sperm concentration more than 1x109 sperm/ml, the motile sperms percentage higher than 70 % and less than 10 % abnormal sperm in total. Each ejaculate was split into 9 equal aliquots and diluted with a Tris-based extender [Tris 36.3 g/L, fructose 10 g/L, citric acid 5 g/L, egg yolk 10 ml/100 ml, glycerol 7 %, penicillin 100.000 IU/100 ml, streptomycin 100 mg/100 ml

(Penovil-S/Vilsan)- pH 6.8, 300 mOsm] with GSH (5 mM) GSSG (5 mM), cysteine (5 mM), taurine (50 Mm), hypotaurine (25 mM) and BSA (5 mg/ml), trehalose (50 mM), hyaluronan ( 1000µg/ml) or no additives (control). Diluted semen samples were frozen and stored in liquid nitrogen. Post-thawing sperm motility, total abnormality, acrosome damage, membrane integrity by hypoosmotic-swelling test and viability by fluorescent staining were determined. In this study, significant differences were found among groups for post-thaw spermatological parameters (P<0.001). In conclusions, this study has showed to be many aspects of sperm protection e.g. sperm motility, viability and membrane stabilisation of sperm cells during the cryopreservation. In this study, the antioxidants GSH at 5 mM, taurine at 50 mM , hyaluronan at 1000µg/ml and cysteine at 5 mM have primer importance to protect bull spermatozoa during the freezing-thawing process. P437 GM-CSF Receptor density on Brahman and Holstein bull spermatozoa Vilanova, LT1*; Ballarales, PP2

1Universidad Centroccidental Lisandro Alvarado, Decanato de Ciencias Veterinarias; 2Nucleo Universitario Tarabana, Cabudare, Lara, Venezuela Introduction The granulocyte-macrophage colony stimulating factor (GM-CSF) is a pleiotropic cytokine capable of stimulating proliferation, maturation and function of hematopoietic cells. Receptors for this cytokine are composed of two subunits -alpha and beta- and are expressed on myeloid progenitors and mature mononuclear phagocytes, monocytes, eosinophils and neutrophils, as well as in other non hematopoietic cells. GM-CSF receptors have been found on bovine ejaculated as well as epidiymal spermatozoa, showing different receptor densities among different bulls (Vilanova et al., 2003b). A variety of reproductive differences between Bos taurus y Bos indicus animals have been demonstrated. The aim of the present work is to determine possible differences in GM-CSF receptor density between Bos indicus and Bos taurus bulls sperm cells. Materials and Methods Frozen semen from 9 Brahman (Bos indicus) and 7 Holstein (Bos taurus) bulls was studied through immunocytochemistry in order to localize GM-CSF receptor subunits. Semen straws (10 from each bull) were used to, individually, determine the localization of both receptor subunits. Images from immunostained spermatozoa were captured and analyzed by the computer software UN-SCAN-IT™ (Silk Scientific Inc., USA), being calculated the density of brown areas stained with peroxidase and the results being expressed in pixel units. Data were statisticaly analyzed using the “t” student test for two independent variables. Results and Discussion In Brahman bull spermatozoa, mean density for the alpha subunit was 21543.1 pixels (minimal and maximal values being respectively 19212 and 23872); mean density for the beta subunit was 16133.1 (min 14195 and max 17895). In Holstein bull spermatozoa, mean density for the alpha subunit was 22658.4 pixels (minimal and maximal values being respectively 19631 and 24987); mean density for the beta subunit was 17749.2 (min 15653 and max 19721). There were no significant (p<0.05) differences between these Bos indicus and Bos taurus bulls spermatozoa regarding the density of alpha and beta subunits of the GM-CSF receptor, thus indicating no variations in expression for this receptor related to breed.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 172 P o s t e r A b s t r a c t s P438 Correlaction between bovine sperm membrane integrity and mitochondrial cytochemical activity in Bos taurus bulls Zuge, RM1,2; Bertolla, RP3; Nichi, M1,4; Soler, TBS1,3; Cortada, CNM2*; Bols, PEJ4; Barnabe, VH1

1Department of Animal Reproduction (VRA), Faculty of Veterinary Medicine and Zootechny (FMVZ), University of São Paulo (USP), Brazil; 2Paraná Technology Institute (Tecpar), Brazil; 3Department of Human Reproduction, Federal University of São Paulo (UNIFESP), Brazil; 4Laboratory of Veterinary Physiology, Faculty of Pharmaceutical, Biomedical and Veterinary Sciences, University of Antwerp, Belgium Introduction Previous studies with varicocele in men and European bulls in tropical region, indicated that heat stress would induce deleterious effects to all structures of the spermatozoa, with special regard to the mitochondria. The disruption of the spermatic mitochondria could have a potential damaging effect not only to an individual cell but to the surrounding cells, specially regarding to the sperm membrane. This could be due to the release of a high amount of reactive oxygen species (ROS) produced in this environment, rich in electrons and oxygen that would lead to an event known as lipid peroxidation. Methods To study whether sperm cells with disrupted mitochondria, would show higher amount of membrane damages probably due to higher levels of ROS attack, semen samples of eleven heat stressed Simmental bulls were collected by electroejaculation, the method of choice when working under field conditions in Brazil. The staining 3-3’ diamino benzidine (DAB), as an index of mitochondrial activity, the hypo-osmotic swelling test (HOST), as an index of membrane integrity, and the measurement of tiobarbituric acid reactive substances (TBARS), an index of spontaneous lipid peroxidation were used. Data was analysed using the SAS system for Windows. Results Results showed a positive correlation between sperm cells with full mitochondrial activity (DAB class A), and percentage of cells with intact membrane by the HOST (r=0.93, p<0.05), and a negative correlation between the later and the percentage of inactive mitochondria (r=-0.91; p<0.05). There was also a positive correlation between TBARS and the percentage of cells with inactive mitochondria (r=0.84; p<0.05). Conclusions These results could be explained by the disruption of the mitochondria caused by the lead to release of ROS to the cytoplasm. This would cause damages to the sperm membrane, possibly due to lipid peroxidation. In conclusion, our results indicate that heat stress would induce damages to the mitochondria. This, in turn, would have the potential to cause damages to the plasma membrane and other structures and even to other cells of the ejaculate. Poster 17 - Artificial Insemination and Related Techniques P439 Use of glutamine and low density lipoproteins isolated from egg yolk to improve buck semen freezing Ali Al Ahmad, M1*; Amirat-Briand, L1 ; Moussa, M1 ; Tainturier, D1, Anton, M2; Fieni, F1 1UPSP DGER, Sanitary Risks and Biotechnology of Reproduction, National Veterinary School of Nantes; 2Groupe Physio-chimie des Emulsions, Laboratoire d’Etude des Interactions des Molécules Alimentaires, INRA, Nantes, France Introduction The goals of this study were firstly to assess the addition of glutamine and, secondly the use of low-density lipoproteins (LDL) as a substitute for egg yolk in the extender used for freezing caprine sperm. This development should eventually make it possible to obtain a chemically defined extender of constant physical quality and with a controlled health risk. Methods In experiment 1, to improve the results obtained with a reference cryopreservation extender (control extender: Triladyl® +

20% (v/v) egg yolk + 6.4% (v/v) glycerol) for freezing caprine semen, glutamine was added to 18 split ejaculates at concentrations of 0, 20, 40, 80 and 120 mM. In experiment 2, glutamine was added to 18 split ejaculates at concentrations of 20, 25, 30, 35 and 40 mM. In rxperiment 3, the egg yolk was replaced with the low-density lipoprotein (LDL) fraction of egg yolk. The quality of frozen then thawed spermatozoa in each extender was compared using computer-assisted semen analysis. In experiment 4, the quality of freezing extender defined by the previous experiment was tested by comparing acrosome, tail membrane, plasma membrane and DNA integrity in 18 split ejaculates of frozen then thawed spermatozoa with spermatozoa that had been frozen then thawed in the control extender, and with spermatozoa from fresh, unfrozen sperm. Results In experiment 1, glutamine at concentrations of 20 mM and 40 mM significantly improved sperm motility compared with the control extender. However, at 120 mM, a significant decrease in motility and velocity was observed. In experiment 2, motility, curvilinear velocity and amplitude of lateral head displacement (ALH) were improved in glutamine at 25 mM compared with the control. In experiment 3, 8% LDL and 25 mM glutamine significantly improved sperm motility, straight line velocity and ALH. In experiment 4, the percentage of spermatozoa with intact acrosomes and tail membranes was significantly higher with the newly defined extender ((Triladyl® + 8% (v/v) LDL + 25 mM glutamine + 6.4% (v/v) glycerol) than that observed with the control extender. Conclusion This experiment demonstrate that Triladyl®

supplemented with 8 % LDL, 25 mM of glutamine, and 6.4 % glycerol has cryopreservation qualities that are at least as good as those of a widely used reference extender. This extender has the advantage of a simple chemical composition, making it easier to industrialize, whilst avoiding the sanitary risks related to the use of a biological product such as egg yolk. P440 Follicular dynamic in postpartum anoestrous and cycling cows treated with medroxiprogesterone acetate (mpa) and estradiol benzoate (eb) Manes, J; Alberio, R*; Callejas, S; Hozbor, F; Aller, J Biotechnology of Reproduction Laboratory, National Institute Agricultural Research (INTA), EEA Balcarce, National University of Mar del Plata and National University of the Center The objective of this study was to determine if the length of a progestagen treatment and the injection time of estrogen at the end, affect follicular dynamic, follicular diameters and ovulation time in cows in different physiological status. The study was performed with 35 anoestrus suckling (AS) (48±10pp days) and 38 cycling no suckling (CNS) Aberdeen Angus multiparous cows weighting 424±48 and 422±48kg respectively. An intravaginal device with 250mg of MPA was introduced at day 0 (d0) together with an injection of 10mg of MPA and 3mg of EB. At device removal, all cows were injected with 150mg of d-cloprostenol and randomly distributed into 6 treatments: 1) d7 device removal+0.7mg EB; 2) similar to 1 but EB d8; 3) d8 device removal+ 0,7mg EB; 4) similar to 3 but EB d9; 5) d9 device removal+ 0,7mg EB; 6) similar to 5 but EB d10. To determine the follicular diameter (FD) at device removal, daily echographies were started d0. After device removal, echographies were done every 12h to determine ovulation time (OT) and diameter of ovulatory follicle (DOF). Analyses were run with the PROC GLM (SAS, confidence level 95%). Ovulation rate was analyzed by exact Fisher Test. No comparisons between AS and CNS cows were made. Ovulation rate was 56 and 77% for AS and CNS cows without differences between treatments. FD was different in AS cows (8.4±16a, 10,5±1.6b and 10.6±1.2bmm for 7, 8 and 9 days) but not in CNS cows. OT after device removal was longer (P<0.05) when EB was injected 24h than 0h after device removal in AS cows (51±6 and 70.5±5.7h) and in CNS cows (50±21 and 73±20h) independently of the length of treatments. DOF was bigger only in AS cows with 9 days long and EB injected at 24h treatment (11.5±1.1a, 11±1a, 12.7±1.2a, 11.3±2.1a, 11±1a and 14.2±0.3bmm for treatments 1 to 6 respectively) but were similar between treatments in CNS cows. We

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 173 can conclude that treatments of 8 or 9 days of duration would be of election and from practical point of view; the insemination time would be earlier when EB is injected at device removal than 24 h later. Granted by NUMdPlata. P441 Evaluation of different lipid sources in frozen-thawed ram semen Alvarez, M1*, Bernardo, J1, Boixo, JC1, Gomes-Alves, S1, Mata-Campuzano, M2, Anel, E1, De Paz, P2, Anel, L1 1Animal Reproduction and Obstetrics, University of Leon, Spain; 2Cell Biology, University of Leon, Spain The use of substances free of animal proteins in semen extenders is an important tool to improve the healthy conditions of ovine reproduction programmes. Hygienic control and chemical composition of extenders are important factors that affect the spermatozoa lifespan. Egg yolk provides protection against cold shock and particularly the low density lipoprotein fraction is the responsible of this effect. Other lipoproteins have been demonstrated to be good cryoprotectants (soy bean) but their use is limited. The aim of this study is to test the fertility of frozen-thawed semen from Churra breed rams, cryopreserved with four extenders (different source of lipids). Extenders were made with different sources and concentrations of lipids: egg yolk (UL), low density lipoproteins (LDL), soy lecithin 1% and soy lecithin 2% (granulated commercial soy bean). Semen from ten rams (two consecutive semen collections per session, two sessions) was evaluated (volume, mass motility and spermatozoa concentration). For each ram, the two ejaculates of a session were pooled if both had good quality. Thus, the final ejaculate was divided in 4 aliquots and diluted (1:1) with the 4 freezing extenders: UL (TesT-fructose-10% egg yolk -4% glycerol- antibiotics), LDL8 (TesT-fructose-8% LDL-4% glycerol- antibiotics), SOY1 (TesT-fructose-1% soy -4% glycerol- antibiotics) and SOY2 (TesT–fructose-2% soy-4% glycerol- antibiotics). The samples were cooled at 5ºC (-0.25ºC/min) and extended to a final concentration of 100x106 spermatozoa/ml. Diluted semen was placed into 0.25 ml straws, sealed and frozen from 5ºC to -100ºC (-20ºC/min) in a programmable cell freezer (Kryo 10, Planer). The straws were plunged into liquid nitrogen until analysis and thawed in a water bath (65ºC, 6 s). The fertilizing capacity was evaluated by laparoscopic intrauterine insemination. The oestrous of the ewes were synchronized using intravaginal sponges with 40 mg fluorogestone acetate (14 days) and 500 UI of eCG (im) at withdrawal. Laparoscopic inseminations were performed at 64 h after the removal of the sponges. The number of inseminated ewes (total 576 from four farms) with each extender was: UL (144), LDL8 (146), SOY1% (146) SOY2% (140). Fertility was not significantly affected by freezing extender, although UL and LDL seemed to show better results (UL: 43.06%; LDL: 49.32%; SOY1: 41.78% and SOY2: 40.71%). The lipid sources assayed are suitable for freezing the ram semen applied by intrauterine insemination. This work was supported in part by CYCYT (AGL2005-07601/GAN), Ovigen, Diputación de León and ASSAF.E. P442 Effect of different thawing rates on post-thaw sperm viability, kinematic parameters and motile sperm subpopulations structure of bull semen Peña, AI1*; Muiño, R1; Rivera, MM2; Rigau, T2; Rodriguez-Gil, JE2

1Faculty of Veterinary Medicine, University of Santiago de Compostela, Spain; 2Faculty of Veterinary Medicine, Autonomous University of Barcelona, Spain The aim of the present study was to evaluate three thawing rates for bull semen frozen in 0.25 ml-straws: placing the straws in a water bath at 37ºC for 40 s, at 50ºC for 15 s or at 70ºC for 5 s. In a first experiment, the 3 thawing rates were compared in relation to post-thaw sperm motility, determined subjectively, and sperm plasma and acrosomal membrane integrity, examined by flow cytometry, after 0 and 5 h of incubation at 37ºC. In a second experiment, the three

thawing rates were evaluated based on post-thaw sperm motility, determined using a CASA system, after 0 and 2 h of incubation at 37ºC. In addition, for the motile spermatozoa, the individual motility descriptors were analysed using a multivariate clustering procedure to test the presence of separate sperm subpopulations with specific motility characteristics in the thawed bull semen samples. Finally, it was investigated if the thawing rate had any influence on the relative frequency distribution of spermatozoa within the different subpopulations. In terms of overall post-thaw motility or plasma and acrosomal sperm membrane integrity there were no significant differences between the 3 thawing methods evaluated. The statistical analysis clustered all the motile spermatozoa into 4 separate subpopulations with defined patterns of movement: 1) moderately slow and progressive sperm (27%); 2) “hyperactivated-like” sperm (15.4%); 3) poorly motile non progressive sperm (34.3%) and 4) fast and progressive sperm (23.3%). The thawing rate had no significant influence on the frequency distribution of spermatozoa within the 4 subpopulations, but there was a significant effect (P<0.05) of the interaction between thawing rate and incubation time. Higher proportions of spermatozoa with fast and progressive movement were observed after 2 h of post-thaw incubation when the thawing was at the faster rates (35ºC/40 s: 8.3%; 50ºC/15 s: 18.1% and 70ºC/5 s: 16.5%). Whether this subtle difference might affect to the in vivo fertility of the thawed bovine semen is not known. P443 Effect of oxidative status on cryopreserved sperm quality and fertility Barnabe, VH*; Nichi, M; Rodrigues, MP; Perez, EGA; Cardoso, PBS; Crepaldi, GA; Sales, JNS; Baruselli, PS

Department of Animal Reproduction (VRA), Faculty of Veterinary Medicine and Zootechny (FMVZ), University of São Paulo (USP), Brazil Introduction Oxidative stress is caused by reactive oxygen species (ROS) that may cause structural damage to biomolecules, DNA, lipids, carbohydrates and proteins, as well as other cellular components. In humans, ROS were identified as a cause of infertility and decreased fertility of cryopreserved semen. In addition, mitochondria appears to play an important role on sperm oxidative status. It is well known that, in bulls, cryopreservation leads to a significant decrease on sperm quality. However, limited research is available on the effect of oxidative stress on fertility in bulls, especially Bos taurus indicus. The objective of the present experiment was to study the effect on cryopreservation on sperm function and in vivo fertility of Nelore bulls. Methods Six different batches of two Nelore bulls were cryopreserved and used in an artificial insemination program. A straw of each batch was thawed and evaluated for motility, vigor, membrane integrity (eosin/nigrosin) and mitochondrial activity (diaminobenzidine). An aliquot of each straw was submitted to a protocol of induced lipid peroxidation using ascorbate (20 mM) and ferrous sulphate (4 mM), with the further measurement of the tiobarbituric acid reactive substances (TBARS), as an index of oxidative stress. This technique aims to evaluate sperm oxidative status by its susceptibility to the lipid peroxidation. Statistical analysis was performed using SAS system for Windows. Results A strong correlation was found between TBARS and pregnancy rates (r=0.8, p<0.05). No correlation was found between pregnancy rates and the other variables. Membrane integrity negatively was correlated with the percentage of sperm showing no mitochondrial activity (r=0.88, p<0.05). Conclusions Ours results indicate that the possible mechanism of injury caused by cryopreservation may be related to the disruption of the mitochondria that would probably lead to the release of ROS in the cytoplasm, causing damages to the plasma membrane. Furthermore, results indicate that an alternative to overcome the decreased quality of sperm after cryopreservation would be the treatment of extenders with antioxidants that would improve the protection of sperm against the attack of ROS.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 174 P o s t e r A b s t r a c t s P444 Effective low dose insemination with sex-sorted ram spermatozoa Beilby, K*; Grupen, C; Maxwell, WMC; Evans, G The Faculty of Veterinary Science, The University of Sydney, Sydney, Australia Sex-sorted ram sperm is an attractive breeding management tool in commercial production systems. However, the time required and cost associated with sorting large commercial sperm doses limits the use of this technology. Previous research has shown that insemination with sex-sorted ram sperm resulted in equal, if not superior, fertility compared to non-sorted controls at dose rates of 1, 5 and 15 million motile sperm1. Pregnancy rates were similar for sex-sorted sperm at these dose rates. Therefore, the current study aimed to determine the minimum dose that could be inseminated before fertility was significantly reduced. Semen was collected from 3 merino rams. Half of each ejaculate was frozen immediately (non-sorted, control sperm) and the remaining half was sex-sorted via modified flow cytometry and then frozen (sorted sperm). Oestrus was synchronised in ewes (N=138) using progestagen pessaries (12 days) and PMSG at pessary removal (PR). Ovulation was further controlled using GnRH given 36h after PR. All animals were inseminated by laparoscopy 58h after PR with either 5 x 105 (n = 60), 1 x 106 (n = 39) or 15 x 106 (n = 39) sorted or non-sorted, frozen-thawed motile spermatozoa. Pregnancy rates were assessed at day 60 after insemination using cutaneous real-time ultrasound. There was no difference in pregnancy rate for groups inseminated with sorted or non-sorted spermatozoa across all dose rates. Furthermore, there was no difference between doses of 1 and 15 million spermatozoa. However, the pregnancy rates were lower (P < 0.05) for the 5 x 105 sperm dose (15 and 13%, for non-sorted and sorted, respectively) compared with doses of 1 (49 and 41%) and 15 x 106 spermatozoa (44 and 49%). More than 90% of lambs born were of the predicted sex. This study confirmed that a dose of 1 x 106 sex-sorted frozen-thawed motile sperm is the minimum that can be used for laparoscopic insemination of ewes before fertility is reduced. This is much lower than the current industry standard of 20-40 x 106 frozen-thawed sperm/inseminate. These results provide the sheep industry with a promising assisted reproductive management strategy that is not only effective, but practically applicable. P445 Advantages of the association of glutamine and LDL (Low Density Lipoprotein) for freezing canine sperm Bencharif, D1*, Tainturier, D1, Pascal, O1, Larrat, M1, Langlois, ML2, Barrière, JP2, Amirat-Briand, L1 1Department of Biotechnologies and Reproductive Pathology, Nantes Veterinary College, Nantes, France; 2Department of Reproductive Pathology, Mother and Child, CHU Hôtel Dieux, Nantes, France Introduction Various studies have demonstrated the cryoprotective action of glutamine (Glut). The latter improves spermatozoa motility and provides superior protection for the cytoplasmic membrane. This preliminary study aims to determine the ideal concentration of glutamine when combined with 6% LDL to improve the cryopreservation of canine semen. Materials and method Exp n°1: 20 ejaculates were collected from 6 dogs (Beagle, Golden Retriever) aged from 3 to 6 years. Semen with a motility of between 2 and 5 were frozen in different media: Basic Medium (BM)+20% egg yolk (e.y), BM+6% LDL, and BM+6% LDL+60, 70, 80, 90, or 100 mmol of Glut. Following collection, the spermatic and prostatic fractions were mixed and diluted in the different freezing media at +37°C to obtain a final concentration of 100x106 spermatozoa/ml. Exp n°2: In the same way as for Exp n°1, the ejaculates were frozen in different media: BM+20% e.y, BM+6% LDL, and BM+6% LDL+10, 20, 30, 40, or 50 mmol of Glut. Exp n°3: 10 ejaculates were collected from these same 5 dogs, and frozen in: BM+20% e.y, 6% LDL milieu (e.y extract), and 6 % LDL medium+20 mmol Glut. The semen was cooled to +4°C for 1 hour then aspirated into 0.25 ml straws and stored for 30 min at +4°C. The straws were placed in the liquid nitrogen vapours at -110°C for 10

minutes, before being plunged into the liquid nitrogen. The straws were thawed in a water bath at +37°C for 30 seconds. The semen was assessed 10 minutes after thawing with a HAMILTON THORN CERROS 12 image analyser. For Exp 3, spermatozoa integrity was analysed using Acridine orange, HOS, PSA-FITC, and Spermac® tests. Results Exp n°1: the motility results were superior in the 6% LDL media than the other media (BM+20% (e.y), BM+6% LDL+60, 70, 80, 90, 100 mmol of Glut) (43,13% vs 27,3, 28,7, 30,9, 24,1, 31,1, 27,8% respectively) (p<5%). Exp n°2: the 6% LDL+20 mmol Glut media gave the best results (BM+20% e.y, BM+6% LDL, BM+6% LDL+10, 30, 40, or 50 mmol of Glut) (62,1% vs 48,9, 57,6, 60,9, 60,9, 56,3, 52% respectively) (p<5%, except in the media with 10 and 30 mmol Glut). Exp n°3: Following the various staining methods, the results of all of the tests except that of acridine orange, were superior in the 6% LDL+20 mmol Glut milieu. Conclusion A media containing 20 mmol of glutamine combined with 6% LDL provides superior preservation of spermatozoa during the freeze-thaw process and a marked improvement in the characteristics of spermatozoa trajectories in the dog. Glutamine has cryoprotective properties and also provides a source of energy for the spermatozoa. P446 Effect of time of prostaglandin administration and progesterone content in a vaginal insert on pregnancy rates in Bos indicus-influenced beef heifers inseminated at a fixed time Bo, GA* Instituto de Reproduccion Animal Cordoba, Argentina We have previously shown that giving prostaglandin F2alpha (PGF) at the time of insertion of a 1 g progesterone-releasing device hastened follicular wave emergence and increased the size of the ovulatory follicle in cycling beef cows, and resulted in higher pregnancy rates in Bos indicus heifers. An experiment was designed to test the hypothesis that lowering circulating levels of progesterone during follicular wave emergence and growth would increase pregnancy rates to fixed-time AI (FTAI) in Bos indicus x Bos taurus beef heifers. Crossbred Bos indicus (1/2 to 3/4 Bonsmara) heifers, 22 to 26 months of age, body condition scores (BCS) of 3 to 3.5 (1 to 5 scale), 300 to 350 kg of body weight and with a CL detected by ultrasonography were randomly allocated in one of four treatment groups in a 2 x 2 factorial design. On Day 0, all heifers received 2 mg of estradiol benzoate (EB, Bioestradiol, Biotay, Argentina) i.m. and either a Cue-Mate device (Bioniche Animal Health, Canada) with two pods impregnated with progesterone (Two-pod Cue-Mate; total progesterone = 1.56 g) or a Cue-Mate device with one progesterone-releasing pod and a blank pod (One-pod Cue-Mate, total progesterone = 0.78 g). Heifers in each group were further subdivided to receive PGF (75 µg of D(+) cloprostenol, Bioprost, Biotay) i.m. on Day 0 and again at Cue-Mate removal (Day 8) or a single treatment of 150 µg D(+) cloprostenol on Day 8. All heifers received 1 mg EB on Day 9 and were FTAI 28 to 32 hours later with frozen/thawed semen from bulls of proven fertility. Pregnancy was determined by ultrasonography 30 days after FTAI. Data were analyzed by logistic regression to evaluate the effects of the day of PGF treatment, progesterone content in the Cue-Mate device, BCS, semen and inseminator. There was no effect of BCS, semen or inseminator on pregnancy rates (P>0.3). However, there was a day of PGF by progesterone content interaction (P<0.05) due to a lower (P<0.05) pregnancy rate in heifers with One-Pod Cue-Mate (29/74, 39.2%) as compared to Two-Pods Cue-Mate (40/71, 56.3%) and treated with PGF on Days 0 and 8. Pregnancy rates in heifers treated with PGF on Day 8 were not different from the other treatment groups (One-Pod Cue-Mate 34/68, 50%; Two-Pods Cue-Mate, 36/71, 50.7%). Results, suggest that decreasing circulating progesterone in heifers by using only one progesterone-releasing pod results in comparable pregnancy rates to the conventional Two-pod Cue-Mate when PGF is given at the time of Cue-Mate removal, but not at insertion.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 175 P447 The effect of plant lipid extender component on quality of frozen ram semen Palasz, A1, Bochenek, M2*, Gogol, P2, Kareta, W2, Smorag, Z2 1INIA, Dpto Reproduccion Animal, Crta. Coruña, km 5, 9-28040 Madrid, Spain; 2Dept. Biotechnology of Animal Reproduction, NRIAP, 32-083 Balice, Poland Experiment was designed to test different concentrations and different homogenization protocols of soybean lipids liposomes for the use as a milk replacement in ram semen freezing extender. Lipids were homogenized by high pressure homogenization (800 bars) and then 5% (Y1 extender) or 10% (Y2 extender) liposomes were mixed with 8% glycerol. As additional group, lipids and glycerol were homogenized together (LIPO extender). All 3 extenders (Y1, Y2, LIPO) were prepared in Tris buffer containing citric acid and fructose. As control group milk/egg yolk (MY) extender was used. The semen was collected from 3 rams with artificial vagina. Post thaw motility and survival time (total of 11 ejaculates), lipid peroxidation (total of 7 ejaculates) and sperm membrane integrity (total of 3 ejaculates) were examined in 4 extenders tested. Immediately after collection each ejaculate was divided into 4 parts, diluted with Y1, Y2, LIPO and MY extenders and processed according schedule. Post thaw motility and survival time: Mean sperm motility examined immediately after thawing for Y1, Y2, LIPO and MY extenders was 51.4%, 46, 8%, 50.6% and 44.4% respectively. Mean survival time of spermatozoa kept at 42°C was 200, 220, 255 and 135 minutes for Y1, Y2, LIPO and MY extenders respectively. Lipid peroxidation was monitored by chemiluminescence method. Iron induced luminescence of frozen/thawed sperm cells was assessed using a luminometer. It was shown that Y1, Y2 and LIPO semen extenders had significantly lower peroxidation level than MY extender. The values of Integral parameter for Y1, Y2, LIPO, MY extenders was 4,57; 5,49; 4,31; 28,70 respectively. Sperm membrane integrity: After thawing semen sample was diluted with PBS to 20mln/ml concentration and kept for 1h at room temperature. Sperm membrane examination (“live/dead”) was performed by double staining with SYBR-14/propidium iodide fluorochromes and analysis by flow cytometry. Data of 20 000 spermatozoa were collected for each sample. The percentage of membrane intact (“live”) spermatozoa was taken for statistical analysis. The mean percentage of live spermatozoa for Y1, Y2, lipo and milk extenders were 10.79%, 10.61%, 10.82% and 4.71% respectively. Statistically significant differences was found between milk and Y1, Y2, LIPO (test t, P<0.05). P448 Effect of treatment for estrous cycle control on fertility of inseminated ewes Cervera, D1*, Poo, T1, Navarrete, L1, Baeza, J2, Quintal, J2, Ortiz, F3, Ramón, J1 1Center of Ovine Selection and Reproduction, Technical Institute of Conkal, Mexico; 2CA-MOCOCHA, INIFAP, Mexico; 3SVI, Mexico To evaluate the fertility of inseminated ewes with estrus synchronized through different progestins and duration treatments. Based on live weight and body score, 136 adult Pelibuey hair ewes, were assessed into 6 treatments: Long cycle (14 days) with sponges containing either 60 mg of Medroxiprogesterone (LCMAP, n=24); 40 mg of Fluorogestone Acetate (LCFGA, n=31), or a 0.3g Progesterone CIDR (LCP, n=20) and Short cycle (7 days) combined with all intravaginal pessaries mentioned; SCMAP (n=21); SCFGA (n=20); SCP (n=20). Ewes were fed in Star Grass pastures + 250 g/hd/d of a 14% CP supplement. On day of intravaginal devices withdrawal (D0), 200 IU of eCG were administered I.M. (Foligon: INTERVET; eCG OVEJERO). From 24h of D0, estrus was detected aided by vasectomized rams. Ewes were A.I. cervically with refrigerated semen (150x106 sperms) 36 h after detected in estrus. Ewes were observed for return to estrus 16 days after insemination. At day 50 post A.I., gestation was diagnosed by ultrasonography (Toshiba Sonolayer SALT 32; 5 MHz probe). Gestation rates were analyzed by Chi squared test. Observation of estrous behavior ranged 24-40 h (LC: 28-40; SC: 28-32). Only 73% of ewes were detected in estrus (LC 89; SC

54; P< 0.05). Overall fertility (F) rate was 64%. Fertility differences (P<0.05) were observed among SC treatments, 55% for SCFGA and 57 % for SCMAP vs. 85% for SCP. No differences were found within LC treatments. Fertility of SC versus LC treatments, showed significance (P<0.05) between SCP and LCP (85 vs. 60 % respectively). Also, a favourable tendency (P<0.1) of SCP above LCMAP (85 vs. 69 % respectively) and SCP vs. LCFGA (85 vs. 71 % respectively) was observed. Total prolificacy average was of 1,43, being greater (p<0.05) in LC treatments compared to SC (1,58 vs. 1,25 respectively). Prolificacy in SCFGA treatment was greater (P<0.05) compared to SCMAP y SCP (1.45 vs 1.25 y 1.11). No differences were observed among LC treatments. Duration of progestin treatments to synchronize estrus, affect presentation of estrous without influencing fertility. CIDR devices for 7 days, allow obtaining a greater fertility as compared with intravaginal sponges. Progestin treatments for 14 days yield a greater prolificacy than 7 days treatments. Projects:DGEST 509.07-P and CONACYT-SAG. P449 Rate and timing of ovulation and pregnancy rate in Nelore cows treated with estradiol Cypionate or Benzoate to induce ovulation on FTAI protocols Crepaldi, GA1*; Sales, JNS1; Marques, MO2; Ribeiro Junior, M2; Silva, RCP2; Pinho, JPD3; Faria Junior, SP4; Baruselli, PS1 1Animal Reproduction Department, FMVZ/USP, Brazil; 2Geraembryo, Cornélio Procópio, Brazil; 3Field Veterinarian, Londrina, Brazil; 4Schering-Plough Saúde Animal, Brazil In order to minimize the number of handling during protocols that allow fixed-time artificial insemination (FTAI), two studies were performed to evaluate the follicular dynamics (Experiment 1) and pregnancy rate (Experiment 2) in Nelore cows (Bos indicus) treated with estradiol Cypionate (EC) or Benzoate (EB) as ovulation inductor. At Experiment 1, it was used 37 Nelore cows with body condition score (BCS) of 2.62±0.13 (1 to 5 scale). At day 0 (AM), all animals received 2mg of EB (Gonadiol®,Syntex, Argentina) and an intravaginal progesterone device (DIB®, Syntex, Argentina). On Day 8, the cows were allocated in one of three groups, considering the BCS and cyclicity status. At this day, the device withdrawal was performed, 500μg of Cloprostenol (Ciosin®, Schering-Plough, Brazil) and 300UI of eCG (Novormon®, Syntex, Argentina) were administered in all animals (AM for CE8 and BE9 groups and PM for BE8,5 group). The cows of group CE8 (n=10) received 1.0mg of EC (ECP®, Pfizer Saúde Animal, Brazil) and the cows of BE8,5 (n=15) received 1.0 mg of EB on device withdrawal. The cows of Group BE9 (n=12) were treated with 1.0mg of EB 24 hours after the device removal (D9). Ultrasound (Chison 600VET) examinations to monitor follicular dynamics occurred every 12h from device withdrawal until ovulation. Data was analyzed for normality and equal variance, and transformations were used if needed. The statistical analysis was accomplished by GLM procedure of the Statistical Analyses System (SAS). The results for groups CE8, BE8,5 and BE9 were, respectively: diameter of the ovulatory follicle (14.3±0.4a, 12.3±0.4b and 13.3±0.6ab mm; p=0.01), ovulation rate [9/10 (90.0%), 15/15 (100%) and 11/12 (91.7%); p=0.99] and interval from device removal to ovulation (72.0±2.0a, 57.6±1.3b and 72.0±0.0a h; p<0.001). On Experiment 2, 584 Nelore cows were allocated in 3x2 factorial [treatments (CE8, BE8,5 and BE9) and FTAI period on D10 (AM or PM)] considering the BCS and post-partum period. The statistical analysis was accomplished by GLIMMIX procedure of SAS. There were no interactions between the treatments and the FTAI period. There was no statistical difference on pregnancy rate between group CE8 (57.5%; 118/193), BE9 (59.9%; 118/197) and BE8,5 (49.5%; 96/194; P=0.09) and between the FTAI performed at AM (56.6%;164/290) or PM (54.8%;161/294; P=0.66). These results show that EB on BE8,5 protocol and EC can be used for inducing ovulation, allowing a reduction in the number of animal handling and the FTAI during all day. Acknowledgements: Schering-Plough and USProducts Brasil Eletromedicina Ltda.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 176 P o s t e r A b s t r a c t s P450 Factors affecting pregnancy rates following fixed-time AI in beef cattle in Argentina Cutaia, L1*, Lopez, P2, Videla Dorna, I2, Leblic, D2, Castagneto, N2, Diaz, T2, Bo, GA1 1Instituto de Reproduccion Animal Cordoba (IRAC), Argentina; 2Syntex SA, Argentina Field data on 54,457 inseminations in 396 herds were analyzed to determine the factors that affected pregnancy rates following fixed-time AI (FTAI) of beef cattle in Argentina between 2004 and 2006. Cattle were treated by 39 different veterinarians with a new or once-used progesterone releasing device (1.0 g progesterone; DIB, Syntex, Argentina) for 7 or 8 days, combined with 2 mg estradiol benzoate (EB, Syntex) at DIB insertion, 150 µg D(+) cloprostenol (Ciclase, Syntex) at DIB removal and 1 mg EB 24 h later. Cattle were FTAI 52 to 56 hours after DIB removal. Lactating beef cows in poor body condition also received 400 IU eCG (Novormon, Syntex) at DIB removal. Pregnancy rates were determined 30 to 60 days following FTAI by ultrasonography or rectal palpation. Data were analyzed by logistic regression. The overall pregnancy rate was 49.5%. Body condition score was not included in the model because of inconsistencies in methodology and scoring among veterinarians. Breed significantly influenced pregnancy rates (P<0.01), with the highest values in Angus (51.0%; 11,482/22,534) and Polled Hereford (50.8%; 7,380/14,543) and the lowest in Braford (44.9%; 3,369/7,503). Pregnancy rates in Brangus (47.9; 4,731/9,877) were intermediate and differed (P<0.01) from the others. Region also influenced pregnancy rates (P<0.01) and was higher in the south and central part of Argentina than in the north (subtropical). Region and breed were closely related; more than 90% in the south and central part of Argentina were Angus and Polled Hereford while more than 80% in the north were Bos indicus-influenced. Class of cattle also affected pregnancy rates (P<0.01); lactating cows (50.0%; 13,603/27,229) and heifers (49.7%, 9,461/19,060) had a higher pregnancy rate than dry cows (47.7%; 3,898/8,168). Pregnancy rates were also affected by treatment (P<0.05), with higher pregnancy rates in cattle treated with new devices (50.0%; 14,867/29,765) than in those treated with once-used devices (48.9%; 12,095/24,692). Finally, duration of treatment also affected pregnancy rates (P<0.01) with higher pregnancy rates when devices were in place for 8 days (50.0%; 17,256/34,543) compared to 7 days (48.8%; 9,706/19,914). In summary, an average pregnancy rate of 50% was achieved using FTAI in beef cattle. However, other factors such as climate, breed, class of cattle and treatment protocol were shown to affect results. P451 Effect of sephadex filtration of ram semsn on its freezability and fertility El-Shamaa, IS1*, Metwally, AASM1, Ibrahim, MAER1, Abd El-Razek, IM1, EL-Saidy, BE2 1Animal Production, Faculty of Agriculture, Kafr Elsheikh University, Egypt; 2Animal Production, Research Institute, Agricultural Research Center, Dokki , Egypt Semen of 10 healthy mature crossbred (1/2 FR) ram was frozen in Tris-egg yolk glycerol extender befor and after filtration through sephadex column G25-150 to investigate the effect of filtration on freezability and fertility outcomes during different seasons of year. Filtration of semen through sephadex column resulted in significantly (P<0.05) better maintenance of sperm progressive motility, live sperm count and sperm morphology compared to unfiltered semen. There was significant (P<0.05) decrease in sperm cell concentration x 109/ ml after filtration (2.05±0.05) over the unfiltered semen (2.68±0.08). Progressive motility of filtered frozen-thawed spermatozoa was significantly (P<0.05) improved compared to progressive motility of unfiltered frozen semen (60.10 vs 43.88%). Conception rate was higher for ewes inseminated cervically with filtered frozen semen (63.4%) than those inseminated with unfiltered frozen semen (52.2%) at synchronized estrus with GnRH- PG- GnRH protocol. However, conception rate at observed estrus for ewes inseminated cervically

with filtered frozen semen was significantly (P<0.05) better in comparison with those inseminated with unfiltered frozen semen (95 vs 75%). These results concluded that removal of dead and abnormal spermatozoa by filtration of ram semen through sephadex column resulted in a highest fertility after cervical insemination. P452 Motility and fertility of bull sperm frozen in extender containing dry soya-lecithin Erokhin, A Reproductive Biology, Reseach Instiitute of Animal Breeding, Russian Federation The attempts to freeze semen of animals without animal compounds (egg yolk, milk) have been reported. The goal of this study was to evaluate protective effect of dry soya-lecithin (“Centrolex P”,Germany) under deep-freezing of bull spermatozoa. In experiment 1 the ejaculates of Hol-stein bull after assessment of semen quality were diluted 1:8 in Tris-fructose-glycerol extender with addition of different concentration of dry soya-lecithin (1-10%) or 20 C was performed and°% egg-yolk (con-trol). A one-step dilution at 30 C over 1,5 h. After equilibration of°semen was subsequently cooled to 4 C, semen were pipetted into indentations on a°semen during 3 h at 4. Pellets were thawed in2block of dry ice and then plunged into LN C. Spermatozoa motility, survival time and°electrithawing at 37 acrosome morphology were evaluated after cryocon-servation. In experiment 2 the effect of dry soya-lecithin at optimum concentration (8%) on the results of insemination of cows frozen-thawed semen with 10 mln motile spermatozoa/dose was studied. Cows of experimental (180) and control (160) groups were inseminated twice in the spontaneous estrous..The spermatozoa motility immediately after thawed in groups frozed with 1, 2, 3, 4, 5, 6, 7, 8, 9 and 10 % of dry soya- lecithin were 25; 30; 36; 40; 40; 42; 44; 47; 47 and 44 %, respectively , vs. 45 % in control . The survival time of thawed spermatozoa at 37ºC were higher in groups with 8-9% of soya-lecithin in compare with another experimental groups (P<0,01). The motility of frozen-thawed C were 28,5 and°spermatozoa in these groups after 3h incubation at 37 28,3 % ,respectively, in compare with 30,5 % in control. Percentage of spermato-zoa with acrosomal abnormalities immediately after thawed in groups with 8 and 9% soya-lecithin were same as control (32 and 33% vs. 30%). There was no statistical significance dif-ferences occured in conception rate to first insemination of cows under used of 8 % dry soya-lecithin (46,4%) vs. 20% egg-yolk in control ( 49,6%). These results indicated that dry soya-lecithin “Centrolex P” at optimal concentration has high cryoprotective action on the bull sper-matozoa. P453 Effects of two extenders (with and without egg-yolk) on the semen post-thaw viability in two-years-old Gyr bulls (Bos taurus indicus), selected by CAP (Zebu-BSE) Felipe-Silva, AS.1*; Ferreira, MBD.2; Correa, GSS.1; Correa, AB.1; Emerick, LL.1; Silva, MA.1; Andrade, VJ.1; Vale Filho, VR.1 1Veterinary School - Federal University of Minas Gerais, UFMG - Belo Horizonte, Brazil; 2 Livestock Research Center of Minas Gerais State, EPAMIG, Uberaba, Brazil Introduction The best use of donors depends on the freezability and distribution of semen among different herds to the evaluation of progeny, always looking forward to minimize sanitary risks and contaminations. Right choice of semen extenders to be used, methodology in cooling and freezing processes and selection of bulls are fundamental aspects for the successfull cryopreservation. Objective Once many studies have shown concern with the use of egg-yolk as a bacteriological risk in AI, the objective of this paper was to compare the effects of an egg-yolk-lactose (EYL) and a lecithin based extenders (Bioxcell®) on the semen post-thaw motility, vigor and hyposmotic swelling test (Host) results in two-years-old dairy Gyr bulls (Bos taurus indicus), pre-selected for high scores in CAP (Zebu-BSE).

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 177 Methods A total of eight clinically normal, sexually mature two-years-old dairy-Gyr bulls (25.7 ± 0.8 months old) with average score 84.4 ± 15.6 points in the CAP evaluation (zero to 100 scale), scrotal circumference 34.4 ± 2.5, body weight 354.7 ± 26.3 Kg and scanned for andrological features from 18,2 ± 0.8 months old had their semen collected by eletroejaculation. The bulls were raised, from weaning to 21.2 ± 0.8 months old, under tropical pastures of Brachiaria brizhanta receiving mineral salt supplementation and from there they were kept individually in a feeding-lot under full diet management based in corn silage and 27% crude protein / 83% total digestible nutrients ration. Sperm Motility (MOT) and vigor (VIG) were immediately analyzed. The semen was diluted in both EYL and Bioxcell® diluters until 60.0 x 106 sptz/mL and loaded in 0.5 mL straws at room temperature being stored at 5ºC for a cooling stabilization period from four to six hours. The negative curve was performed by the Brazilian machine CRYOGEN® until -135ºC, when the straws were immersed in liquid nitrogen. A total of 160 straws were evaluated (10 from each bull per extender used) for MOT and VIG post-thawing and also for the Host and compared by the SNK test (p<0,05). Results It was observed significant difference between both diluters for all the features analyzed. Conclusion In this study insufficient sperm Motility, Vigor and Host reagent spermatozoa were obtained in the semen frost using Bioxcell® as a dilutor, the opposite occurring when utilizing the egg-yolk-lactose based extender. As this is the first international relate about this kind of study in the Brazilian dairy-Gyr, it indicates that further researches are required in order to validate these results. P454 Morphometry of porcine spermatozoa and its relation to motility parameters in fresh semen Gil, MC1*, Garcia-Herreros, M1, Barón, FJ2, Aparicio, IM3, Santos, AJ4, Garcia-Marin, LJ3 1Animal Medicine, Faculty of Veterinary, University of Extremadura, Cáceres, Spain; 2Biostatistic, Faculty of Medicine, Málaga, Spain; 3Physiology, Faculty of Veterinary, Cáceres, Spain; 4Veterinary, ACOREX, Spain In this study we have evaluated the relationship between the morphometry of sperm head and midipiece as well as the relationship between morphometry of these two spermatic components and sperm motion characteristics in the boar. Analysis of regression (lineal and multiple) and principal components analysis were used for the study of these relationships. Semen samples from five Iberian boars was taken for analysis. Analysis of morphometry was assessed by CASMA system and motility by CASA system. Sperm midpiece showed a significant relationship (positive or negative, depending on the morphometric parameter evaluated) with sperm head. VSL, LIN, STR, BCF and VAP showed a significant relationship with several head and midpiece morphometric parameters. Finally, we obtained several statistical models that predict STR, LIN, VCL, ALH, BCF, PC1 and PC2 (the last two variables have been obtained from an analysis of principal components) as a function of one, two or three morphometric parameters. Our results suggest a co-evolution of sperm head and midpiece and that motion characteristics of porcine spermatozoa are influenced by morphometry of head and midpiece. P455 Optimisation of IVF conditions used for sex-sorted, frozen-thawed boar sperm Grupen, C Faculty of Veterinary Science, University of Sydney, Australia Introduction Due to the large numbers of sperm needed to effectively inseminate sows, the inefficiencies associated with the sex-sorting procedure limit the use of this technology in pigs. In vitro fertilisation (IVF) using sex-sorted sperm, followed by embryo transfer, may be a more effective way to produce piglets of the desired sex. Previous studies have demonstrated the feasibility of this approach, but the efficiencies of in vitro embryo production were low. The aim of this study was to determine the effects of medium components, sperm

concentration and gamete co-incubation period on the efficiency of IVF using sex-sorted, frozen-thawed sperm. Methods The sperm rich fraction of boar semen was diluted with Androhep, flow cytometrically sex-sorted and cryopreserved as previously described (Bathgate et al., 2007, Anim. Reprod. Sci., 99:82-92). Sperm were thawed and subjected to a modified swim-up procedure immediately prior to IVF. In experiment 1, in vitro matured oocytes were randomly allocated to fertilisation medium that contained 4.7 or 7.7 mM calcium, with or without 2 mM caffeine, and co-incubated with 50 sperm/oocyte for 6 h. In experiment 2, oocytes were transferred to the optimum medium determined in experiment 1 and co-incubated with 50 or 250 sperm/oocyte for 5 min, 30 min or 6 h. After IVF, oocytes were washed and incubated in Porcine Zygote Medium-3 for 14 h, fixed and then stained with orcein to assess fertilisation. Results In experiment 1, the concentration of calcium in the medium did not affect the rates of fertilisation and polyspermy. The addition of caffeine increased the rates of fertilisation (58% vs 26%) and polyspermy (54% vs 16%) compared with the control (P<0.05). The medium containing 4.7 mM calcium and 2 mM caffeine was found to be optimal. In experiment 2, insemination with 250 sperm/oocyte resulted in higher rates of fertilisation compared with 50 sperm/oocyte. Restricting the co-incubation period to 5 min and 30 min did not affect fertilisation rates, but reduced the incidence of polyspermy (11% and 18%, respectively) compared with 6 h (41%; P<0.05). Conclusions The results show that the fertilising capacity of sex-sorted sperm was increased by the addition of 2 mM caffeine to the medium. Also, the incidence of polyspermic penetration by sex-sorted sperm was reduced by using a brief gamete co-incubation period. Together, the optimised IVF conditions increase the efficiency with which normally fertilised oocytes, and potentially viable embryos, can be produced using sex-sorted, frozen-thawed boar sperm. P456 Effect of low dose oxytocin treatment during the AI period, on the conception rates of the dairy cows Hamali, H1*, Mosafery, S2, Zargarzadeh, M2 1Dept. Theriogenology, Faculty of Veterinary Medicine, University of Tabriz, Iran; 2Dept. Theriogenology, Faculty of Veterinary Medicine, University of Azad-Tabriz, Iran It is well known that during the natural mating, stimulation of the female genital system by the bull causes oxytocin release from the posterior part pituitary gland of the female and this hormone enhances the sperm transport in the genital tract. However, due to the lack of physiological stimulation during the artificial insemination, this hormone release is not perfect. In order to determine the oxytocin effect on the conception rates of the cows, a total number of 100 cows, minimum 45 days after parturition, were chosen in a dairy herd at around of Tabriz (North-West of Iran). These cows were randomly divided into Group A (treatment) and Group B (control). In Group A, during the AI period, the cows were injected with 30 IU oxytocin (3 ml Vetocin, manufactured by Aburehan Company) intramuscularly. Cows in Group B were injected with 3 ml saline intramuscularly at the time of AI, as placebo. On Day 45 after AI, all cows were examined for detection of pregnancy by rectal palpation and conception rate of each group was calculated. The pregnancy rate in Group A was 58% whereas in Group B 54% was calculated. No any statistical difference was observed between the two groups. These results indicate that oxytocin administration during the AI period has no significant effect on the cow's conception rates.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 178 P o s t e r A b s t r a c t s P457 Microfluidic sorting of boar spermatozoa Holt, W1*, Satake, N1, Smith, GD2, Alhaider, A3, Takayama, S4, Watson, PF3 1Institute of Zoology, Zoological Society of London, United Kingdom; 2Department of Obstetrics and Gynecology, University of Michigan, United States; 3Veterinary Basic Sciences, Royal Veterinary College, United Kingdom; 4Department of Biomedical Engineering, University of Michigan, United States Microfluidic sperm sorter devices, developed at the University of Michigan, are able to sort a highly motile subpopulation of human spermatozoa, where motile spermatozoa traverse the boundary between two laminar flowing streams (one containing spermatozoa and the other comprising culture media alone) and are collected at an outlet reservoir (1). The aim of the present study was to investigate the application of this technology to the physical separation of putative boar sperm subpopulations. We have previously shown statistically that bicarbonate exposure significantly stimulates the motility of a (boar-dependent) sperm subpopulation (2), while others remain unaffected; physical separation of these populations has never been achieved. Percoll washed spermatozoa from 3 boars were incubated (10 min at 38ºC) in Tyrode’s based medium without bicarbonate, then 15mM bicarbonate/CO2 was added to the medium before loading into sperm-sorters (provided by Strex Inc., Japan); the sorters were then left for 30 minutes at 38°C. Two outlet populations were collected and 60μl samples of each were subsequently analysed using a CASA system (Hobson Sperm Tracker, Hobson Tracking Systems, Sheffield, UK). In a preliminary study, spermatozoa were stained with SYBR14 and Propidium Iodide before loading into sperm sorters; videomicrography of the sorting channel showed that >95% of spermatozoa in the ‘sorted’ channel were live (PI−ve), although they were highly diluted. The proportion of immotile spermatozoa was reduced from 45% in the unsorted channel to 26% in the sorted channel. The proportion of progressively motile spermatozoa also decreased upon sorting (from 45% to 22%), but there was a surprising increase in the proportion of hyperactivated spermatozoa (from 10% to 52%). These results demonstrate the feasibility of using the sperm sorters for the isolation of a boar sperm subpopulation. Given that progressive motility is required for the sorting process to occur, the prevalence of hyperactivated spermatozoa after sorting suggests that the sorting may induce the final stages of capacitation. P458 Time oriented A.I. in cattle with reduced number of sperm cells Kanitz, W.1*, Becker, F.1, Bhojwani, S.1, Alm, H.1, Nehring, H.2, Nürnberg, G.1

1Research Institute for the Biology of Farm Animals, Dummerstorf, Germany, 2Institute for Reproduction of Farm Animals, Schönow, Germany Among others number of spermatozoa per A.I. and time of insemination with regard to oestrus symptoms or ovulation are important determinants for pregnancy rate in cattle. In addition, the necessary number of spermatozoa per A.I. is under investigation with an aim of better utilisation of A.I. sires and the insemination of sorted spermatozoa. Because, data on fertilisation rate after A.I. with reduced sperm number are unavailable, we performed the following experiment. Altogether 116 heifers (German Holstein) received PGF2� (0.5 mg Cloprostenol®, Jenapharm, Germany; i.m.) between day 8 to 14 of oestrous cycle. 60 hours later 50 µg GnRH agonist (Depherelin®; Veyx, Germany, i.m.) was injected. Subsequently, 13 hours later the animals were inseminated once with frozen/thawed semen of 4 proven sires. The number of spermatozoa was 15x106, 5x106 or 1x106 per A.I. (G1/G2/G3). After surgical recovery of the oviduct and the tip of the uterine horn ipsilateral to the C.l. embryos and oocytes were flushed from the oviduct on day 4 after insemination. The recovered oocytes and embryos were classified according their morphology and fixed using BFS medium (buffered formol solution, Merck, Germany). All oocytes and embryos were stained with HOECHST 33258 (Sigma, Germany) to identify accessory sperm cells. For statistical analyses fertilisation rates and portions of intact embryos were compared by means of Chi-square-

test. The influence of the factors sire, and sperm number on fertilisation rate was tested by GLM-procedure of SAS® (Release 8.2, SAS Institute, Inc., Cary, NC 1999). Of the 116 heifers treated 106 animals ovulated (ovulation rate 91.5 %). The mean recovery rate for oocytes and embryos was 80.2 %. Mean fertilisation rates and the portions of intact embryos were 92.3/84.6 % (G1), 96.2/80.7% (G2) and 78.8/75.8 % (G3). Mean number of accessory sperm cells per embryo was significantly higher in G1 and G2 than in G3 (G1: 26.6±8.4, G2: 45.3±8.6, G3: 6.5±7.2). From the data obtained it can be concluded that time oriented A.I. can result in high fertilisation rate. Moreover, the portion of intact embryos does not depend on sperm number per insemination after time oriented A.I. Finally, the number of accessory sperm cells is not correlated with the portion of intact embryos after time oriented A.I. P459 A simple technique for minimal dose DIUI in PMSG multiple-ovulating dairy heifers Kornmatitsuk, B1*; Charoenyongyoo, P1; Pattharanukulkit, K1; Akkhawattanangkul, Y1; Chaiprasat, S2; Kornmatitsuk, S1 1Faculty of Veterinary Science, Mahidol University, Phutthamonthon, Nakhon Pathom, 73170; 2Livestock Semen Production Center-Inthanont Royal Project, Department of Livestock Development, Ministry of Agriculture and Cooperatives, Maung, Chiang Mai, 50300 The aim of the present study was to investigate an accomplishment of minimal dose deep intra-uterine insemination (DIUI) using a simple embryo transfer (ET) pistolet, in connection to relative fertilisation rates and early embryo qualities on day 7 post-service, studying in pregnant mare serum gonadotropin (PMSG) multiple-ovulating dairy heifers. Ten heifers of crossbred Holstein Frisian (≥75%) were included. They were characterised for their oestrous cycles, afterwards subjected to the superovulatory programme using PMSG/ Prostaglandin F2alpha (PGF2alpha) protocol, and fixed-time artificial insemination: Group 1, 3 heifers inseminated with 20×106 sperm cells at body of uterus; Group 2, 4 heifers inseminated with 10×106 sperm cells at tip of the uterine horns and Group 3, 3 heifers inseminated with 10×106 sperm cells at body of the uterus.. Embryos were non-surgically recovered and categorised on 7 days subsequent to the insemination. On the day of each treatment, the ovaries of the heifers were ultrasonographically examined. Prior to the treatment, majorities of the follicles observed in all heifers were of small sizes (<0.4 mm) and then, the numbers of medium size follicles increased after the PMSG treatment (P<0.05 in Group 2; P=0.09 and 0.23 in Groups 1 and 3, respectively) and after PGF2alpha (P=0.34, 0.07 and 0.08 in Groups 1, 2 and 3, respectively). Large follicles (≥10 mm) increased subsequent to the day of PGF2alpha administration or at 12 hours prior to time of AI (P<0.05 in Group 2 and P=0.07 in both Groups 1 and 3). The mean numbers of corpus luteum documented on a day of embryo flushing were 7.0±4.6, 9.3±3.0 and 6.3±5.9 in Groups 1, 2 and 3, respectively and the mean number of recovered embryos/ovas was numerically highest in Group 2 (4.3±5.3), compared to the others (2.7±2.3 in Group 1 and 2.0±2.8 in Group 3). However, the numbers of fertilised and transferable embryos were not statistically different among groups (P>0.05). In conclusion, it is feasible to perform DIUI –placing a reduced number of spermatozoa closely to the isthmus area, using a simplest ET pistolet, with at least equivalent end results to an ordinary artificial insemination (AI). However, a study with a larger number of animals, both in heifers and cows, under standard field conditions (i.e., spontaneous oestrous heifers; well-trained district inseminator), are required to further study.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 179 P460 Improved sperm tail viability differentiation by coloured mounting medium Kovács, A1-2*, Sarlós, P1, Egerszegi, I1, Oláh, J2, Révay, T1, Vass, N 2 and Jávor, A2

1Research Institute for Animal Breeding and Nutrition; 2Debrecen University, Centre for Agricultural Sciences, Institute for Animal Breeding Sciences Introduction Head membrane permeability and acrosome status of spermatozoa of different domestic mammals can be well differenciated by the combined trypan blue – Giemsa staining (Kovács A., Foote R.H.: Viability and acrosome staining of bull, boar and rabbit spermatozoa. Biotechnic & Histochemistry 67: 119-124, 1992; Nagy Sz. et al.: Evaluation of sperm tail membrane integrity by light microscopy. Theriogenology 52: 1153-1159, 1999), as well as by the similar Chicago sky blue - Giemsa (Kútvölgyi et al.: Viability and acrosome staining of stallion spermatozoa by Chicago sky blue and Giemsa. Biotechnic & Histochemistry 81: 109-117, 2006) staining. The evaluation of the tail membrane permeability may be often uncertain due to its narrowness and different backgrounds caused by seminal plasma and extender components. Materials and methods Both combined stainings are routinely applied in our laboratories using a yellow filter helping the better differentiation of the acrosome status. Preparations from fresh ram and boar, and frozen-thawed bull and ram semen samples were mounted with immersion oil (Merck 4699) control evaluated with a yellow filter, or with the same immersion oil saturated with Sudan I. (Peking Chemical Works, Peking, China) or with dimethyl yellow (Sigma D6760). The saturated solutions were the supernatants of the centrifugated oversaturated ones. Results and discussion Sudan I. or Dimethyl yellow solved in immersion oil resulted in not only a good differentiation of the acrosome status similarly to the control, but also a better distinguishing of membrane permeable „dead” and impermeable „live” tail domains of spermatozoa even in the case of background caused by the extender. The effect can be explained by the relief-like nature of the smears - the yellow mounting medium is more thick around the cells than above them. The yellow surroundings of the cells are lighter than the coloured „dead”, but darker than the unstained „live” sperm tails ensuring their easy and clear differentiation. The tail membrane of spermatozoa is more sensitive to the harmful effects of the freezing-thawing procedure than their head membrane, therefore its correct evaluation is extremely important for the quality control. P461 First foal born in Italy using flow cytometrically sorted spermatozoa Mari, G1*; Rizzato, G1; Iacono, E1; Merlo, B1; Seren, E2; Tamanini, C2; Galeati, G2; Spinaci, M2 1 Veterinary Clinical Department, University of Bologna, Italy; 2Dep. of Veterinary Morphophysiology and Animal Production, University of Bologna, Italy Introduction Sex-preselection of stallion spermatozoa is possible using a modified flow cytometer to separate spermatozoa into X and Y-chromosome bearing cells on the basis of DNA content. The objectives of this study were to evaluate vitality, motility characteristics and fertilizing ability of equine sexed semen. Methods Semen from 4 thoroughbred stallions of proven fertility (65% pregnancy rate per cycle) was diluted 1:1 with KMT and analysed by Computer Aided Sperm Analysis (CASA). Total motility (TM), progressive motility (PM), velocity average path (VAP) and rapid spermatozoa (RAP) were recorded. For sorting, samples were diluted to 200 x106 spermatozoa/ml and stained with Hoechst 33342 for 1.30 h at 35° C in the dark. Just prior to sorting a final concentration of 100 x106 spermatozoa/ml was reached and red food dye was added. A MoFlo SX® sperm sorter was used. Sorted spermatozoa were evaluated for motility parameters by CASA and for viability by SYBR-PI staining. The fertility of sexed spermatozoa was assessed by inseminating 4 mares (7 estrous cycles). Mares were

histeroscopically inseminated at the utero-tubal junction, ipsilateral to the preovulatory follicle, with 5 x106 spermatozoa in 250 μl, 30-32 h after 2500 IU hCG administration for induction of ovulation. Pregnancy diagnosis was carried out 15 days after ovulation. Results Sperm motility characteristics were negatively affected by sorting (pre vs. post-sorting: TM 79.6±5.5 vs. 38.6±14.5; PM 32.3±9.4 vs. 10.6±5.4; VAP 116.4±12.4 vs. 99.9±13.3; RAP 67.0±12.0 vs. 30.2±12.0; p<0.05, T student test) while viability was similar pre- and post-sorting (84.3±7.1 vs. 74.3±11.6 ; p>0.05, T student test). Pregnancy rate was 28.6% (2/7), and a pregnancy was loss at 30 days while the other was carried to term with the birth of a healthy filly. Conclusions Sperm motility parameters are negatively affected by the sorting process. On the other hand, viability is only slightly and non-significantly affected. Usually, mares are inseminated with 500 x 106 motile spermatozoa; being that the number of sexed spermatozoa/h is about 15 x 106, and it would take too time to obtain the optimal dose, the histeroscopic insemination allows to use low numbers of sexed spermatozoa. Pregnancy rate obtained is lower than that reported in literature (Lindsey et al., 2002: 38% with 5 x106 motile spermatozoa), likely due to the lower number of motile spermatozoa in the inseminating dose used in the present study. The Authors wish to thank “Società Italiana Produttori Sementi”. P462 Viability of equine spermatozoa recovered from the epididymis cauda submitted to refrigeration Martins, MIM*; Nagao, JF; Gomes, RG Department of Veterinary Clinics, University of Londrina State (UEL), Brazil The recovery of spermatozoa from the epididymis cauda may be an important tool in equine reproduction because it makes possible the recovery of viable cells after the death of valuable stallions. The purpose of this study was to compare the viability of the spermatozoa recovered from the epididymis cauda submitted to refrigeration. Epididymals were obtained from five horses (English Thoroughbreds and two mixed –breed) from a slaughterhouse. During the transportation to the lab, the specimens were maintained in a 0,9% saline solution in an ice box. The recovery of the spermatozoa was accomplished by compressing the epididymis cauda and part of the deferent duct with help of an anatomic nipper on a Petri dish containing the extender Botu-Sêmen® (Biotech Ltda, Botucatu, Brazil). The sperm samples were evaluated for motility, vigor, sperm concentration, percentage of viable cells and morphology. The semen was diluted (final concentration of 100x106/mL) and stored in 1,5 mL plastic tubes and packed in a transportation system Botu-Tainer® (Biotech Ltda, Botucatu, Brazil) for 18 hours. After this period, the tubes were transferred to a container with 400mL of water and kept in the refrigerator (4ºC) for 24 hours. The semen samples were analysed in three different moments: collection (M1), removal from the transportation boxes (M2) and after 24 hours of refrigeration at 4ºC (M3). The average motility (%), vigor (0-5), alive (%) and normal spermatic cells (%) were 64.0, 3.7, 90.6 e 60.0 (M1); 56.0, 2.9, 91.8 and 57.8 (M2); 56.0, 3.1, 88.4 and 56.0 (M3). The most frequent spermatic alterations were: abaxial tail insertion (6.3%), proximal cytoplasmic droplet (7.3%), distal cytoplasmic droplet (3.0%) and strongly bended tail (13.4%); probably because the spermatozoas were from the epididymis cauda. Transportation was considered efficient for the maintenance of spermatic quality after 24 hours at 4 ºC and no significant difference was observed among the evaluations. The process of spermatozoa recovery and refrigeration obtained from the epididymis cauda is promising, however, new experiments must be carried out aiming the analyses of in vivo and/or in vitro fertility of these cells.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 180 P o s t e r A b s t r a c t s P463 Pregnancy rates following fixed-time embryo transfer in Bos indicus recipients synchronized with progestin devices and estradiol or GnRH and treated with eCG Mayor, JC1*, Tribulo, HE2, Bo, GA2 1Escuela para Graduados, Facultad de Ciencias Agrop, Instituto de Reproduccion Animal Cordoba, Universidad Nacional de Cordoba, Argentina; 2Instituto de Reproduccion Animal Cordoba, Argentina An experiment was designed determine the effect of the addition of eCG to a GnRH-based treatment protocol in recipients that received embryos at a fixed-time. The experiment was performed in the Cauca Valley region of Colombia. Bos indicus x Bos taurus heifers, 380 to 420 kg of weight and a body condition score between 2.5 to 3.5 (1 to 5 scale) were randomly allocated into one of three treatment groups. On Day 0, heifers in the control group received an intravaginal progesterone releasing device (DIB, 1 g progesterone, Syntex SA, Argentina) and 2 mg of estradiol benzoate (EB, Syntex SA) plus 100 mg progesterone (Gestavec, Vecol, Colombia) i.m. On Day 5, heifers received PGF (500 μg cloprostenol, Estrumate, Schering Plough, USA) and 400 IU eCG (Novormon 5000, Syntex SA) i.m. DIB were removed on Day 8 and 1 mg of EB was administered i.m. 24 hours later. Heifers in the GnRH treatment group received a DIB device and 100 μg of GnRH (Cystorelin, Merial, USA) i.m. on Day 0, PGF at DIB removal on Day 7 and a second GnRH on Day 9. Heifers in the GnRH+eCG group were treated similarly to those in the GnRH group except that they also received 400 IU eCG i.m. on Day 3. All heifers were examined by ultrasonography 8 days after EB treatment or 7 days after GnRH and those with a CL >16 mm in diameter received a frozen-thawed embryo by Direct Transfer. Pregnancy was determined by ultrasonography 30 days after embryo transfer. Conception rates and pregnancy rates were compared by Chi-square test. The number of recipients selected/treated was higher (P<0.05) in the control group (70.0%, 28/40) and those treated with GnRH+eCG (72.5%, 29/40) than in those treated with GnRH but not eCG (47.5%, 19/40). It was not possible to pass the cervix in three heifers in the GnRH+eCG group and they were removed from the dataset for calculation of pregnancy rates. Finally, conception rates and pregnancy rates were significantly higher in recipients treated GnRH+eCG 16/26, 61.5% and 16/40, 40%) and those in the control group (16/28, 57.1% and 16/40, 40%) than those treated with GnRH without eCG (9/19, 47% and 9/40, 22.5%). In summary, the addition of eCG to estradiol- and GnRH-based protocols which included the use of progesterone releasing devices resulted in increased pregnancy rates following fixed-time embryo transfer in Bos indicus recipients. P464 Semen thawing methods and its influence in pregnancy rates of Nelore cows with synchronized ovulations Murta, JEJ1*; Andrade, VJ2; Vale Filho, VR2, Nogueira, LAG.2; Felipe-Silva, AS.2, Azevedo, NA.3, Reis, SR2, Pereira, JCC.2 1State University of Montes Claros, Brazil; 2Veterinary School, Federal University of Minas Gerais, Brazil; 3Livestock Research Center of Minas Gerais State, EPAMIG, Belo Horizonte, MG, Brazil Introduction Artificial insemination (AI) is an important tool to promote the genetic improvement of the herd and increase economic return to the producers. With the nowadays methods of semen cryopreservation, about 30 to 50% of the spermatozoids are destroyed or damaged in the freezing and/or thawing processes. The aim of this study was to evaluate the results of pregnancy rates after AI with semen from three different thawing methods. Material and Methods A total of 113 multiparous Nelore (Bos taurus indicus) females with body condition score ranging from 4 to 5 (scale1-9), and with presence of a functional corpus luteum detected by rectal palpation (cycling), and synchronized with the Crestar® protocol (IM association of 3mg of Norgestomet and 5mg of Estradiol Valerate, followed by auricular silicone implant of 3mg of Norgestomet) were divided in three different groups: G1 = semen thawing straight in the animal; G2 = semen thawing in hot water (35-37ºC) for a period of 30 seconds, and G3 = semen thawing in an

electronic device (35ºC), also for a period of 30 seconds. In order to rationalize the AI procedures, 50% of the animals were worked in the morning and 50% in the afternoon, to keep the same interval from synchronization time. All the females were raised under the same pasture conditions. It was utilized cryopreserved commercial semen from a single bull and from the same aliquot, evaluated in relation to physical and morphological aspects. A single well trained inseminator realized all the AI in a randomized design, 56h after implant removal (9 days after its implantation), according to the morning-afternoon groups, with no heat observation. Results It was registered 36.2; 34.4 and 29.3 % of pregnancy rates, respectively, for G1, G2 and G3 (P>0.05). Conclusion Semen thawing methods did not affect the pregnancy rates of Nelore cows, raised under pasture conditions, suggesting the use of T1 based on costs benefits. P465 Quality of frozen/thawed bovine semen tested with common AI lab tests or flow cytometric analysis Padrik, P1*, Hallap, T1, Januskauskas, A2, Jaakma, Ü1 1Department of Reproductive Biology, Estonian University of Life Sciences, Estonia; 2Department of Non-Infectious Diseases, Lithuanian Veterinary Academy, Lithuania Introduction Evaluation of frozen/thawed (FT) bull semen with routine AI laboratory methods gives good preliminary results for estimation of semen quality but the number of evaluated sperm is too low to guarantee objectivity of the measurements. Precise evaluation of sperm motility in combination with other semen traits is needed to improve breeding efficiency. Our aim was to study the correlations between the results of routine AI lab tests, flow cytometric analysis of sperm membrane status, mitochondrial membrane potential and field fertility. Another aim was to study whether these characteristics are influenced by bulls` age. Materials and methods Forty five FT semen batches from fifteen Estonian Holstein dairy AI-bulls (7 young bulls < 16 months and 8 mature bulls 30…72 months) were examined for motility (subjectively, using microscope and objectively, using a computer assisted motility analyzer (CMA)), hypo-osmotic swelling (HOS), membrane lipid disorder (Merocyanine 540 staining) and mitochondrial membrane potential (Mitotracker Deep Red 633 staining). Fluorescence of the stained sperm samples was assessed by flow cytometer. Results Significant positive correlations were found between sperm subjective motility (SubMot), general motility (GMot), progressive motility (PMot) and the proportion of live sperm with stable membrane (LSM) and also, the proportion of sperm cells with high mitochondrial activity (MTDR-H ) on batch (P<0.001) and bull levels (P<0.01). General motility, SubMot (P<0.05), curve line velocity (VCL), amplitude of lateral head displacement (ALH) (P<0.001) and MTDR-H (P<0.05) improved in mature bulls. Significant positive correlation was found between bulls’ fertility (estimated as 60-days non-return rate) and HOS, SubMot, GMot and VCL (P<0.01 on bull level). The best statistical model for predictive non-return rates was obtained by combining the results of routine laboratory tests and flow cytometric analysis. It included seven parameters: HOS, SubMot, GMot, PMot, ALH, LSM and MTDR-H (R2=0.91). Conclusion Age of a bull has influence on sperm motility characteristics and mitochondrial status. Combinations of common AI laboratory tests (motility analysis, HOS) and flow cytometric assays could be used for the prediction of the potential fertility of bull semen. As flow cytometry is capable of measuring multiple fluorochromes, additional functional tests could be useful for assessment of sperm parameters in AI industry.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 181 P466 Identification of sperm subpopulations with defined motility characteristics in ejaculates from Holstein bulls: effects of cryopreservation and between-bull variation Muiño, R1*; Tamargo, C2; Hidalgo, CO2; Peña, AI1 1Faculty of Veterinary Medicine, University of Santiago de Compostela, Spain; 2Servicio Regional de Investigación y Desarrollo Agroalimentario (SERIDA), Spain The aims of the present study were: 1) to determine the existence of sperm subpopulations with specific motility characteristics in fresh ejaculates from Holstein bulls, 2) to investigate the effects of semen cryopreservation and post-thaw incubation on the distribution of spermatozoa within the different subpopulations, and 3) to evaluate the existence of between-bull variation in the sperm subpopulations structure of fresh and frozen-thawed semen. Six ejaculates were collected from each of 9 Holstein bulls and cryopreserved following a standard protocol. Overall sperm motility and the individual kinematic parameters of motile spermatozoa, determined using a CASA system, were evaluated before freezing and after 0, 2 and 4 h of post-thaw incubation at 37ºC. Data from 16,740 motile spermatozoa, defined by VCL, VSL, VAP, LIN, STR, WOB, ALH and BCF, were analysed using a multivariate clustering procedure to identify and quantify specific subpopulations within the semen samples. The statistical analysis clustered all the motile spermatozoa into four separate subpopulations with defined patters of movement: Subpopulation (Subp.) 1) moderately slow but progressive spermatozoa (23.2%), Subp. 2) highly active but non-progressive spermatozoa (16.0%), Subp. 3) poorly motile non-progressive sperm (35.5%), and Subp. 4) highly active and progressive sperm (25.3%). Subpopulations 2 and 4 significantly (P<0.01) decreased during cryopreservation and post-thaw incubation (Subp. 2: 21.1%, 18.1%, 8.7% and 5.9%; and Subp. 4: 34.1%, 20.6%, 15.2% and 7.3%, respectively, for fresh, 0, 2 and 4 h post-thaw) whereas Subp. 3 significantly (P<0.01) increased (10.7%, 27.2%, 27.2% and 30.7%, respectively, for fresh, 0, 2 and 4 h post-thaw). The frequency distribution of spermatozoa within subpopulations was quite similar for the 9 bulls, either in fresh or frozen-thawed semen, and differences among bulls were mainly due to differences in the Subp. 4. Significant correlations (P<0.01) were found between the proportions of spermatozoa assigned to Subp. 4 in the fresh ejaculates and those in frozen-thawed semen after 0 (r=0.473), 2 (r=0.513) and 4 h post-thaw (r=0.450). This indicated that the ejaculates with the highest subpopulations of rapid and progressive sperm were also the most resistant to cryopreservation and showed the best post-thaw sperm longevity. P467 Rate and timing of ovulation in Nelore cows treated with estradiol Cypionate or Benzoate to induce ovulation on FTAI protocols Sales, JNS1*; Carvalho, JBP2; Crepaldi, GA1; Maio, JRG3; Carvalho, CAB2; Baruselli, PS1 1Animal Reproduction Department, FMVZ/USP, Brazil; 2Vale do Paraíba Regional Station-APTA, Brazil; 3Ouro Fino Saúde Animal, Brazil In order to minimize the number of handling during protocols that synchronize ovulation and allow fixed-time artificial insemination (FTAI), this study was perfomed to evaluate the follicular dynamics in Nelore cows (Bos indicus) treated with estradiol Cypionate on device withdrawal or estradiol Benzoate 24h after device withdrawal (control group). At the Experiment, it was used 30 Nelore cows with body condition score of 2.8±0.4 (1 to 5 scale). At day 0, all animals received 2mg of estradiol Benzoate i.m. (Sincrodiol®, Ouro Fino, Ribeirão Preto, Brazil) and an intravaginal progesterone device (DIB®, Syntex, Buenos Aires, Argentina). On Day 8, the device withdrawal was performed, 500μg of Cloprostenol (Sincrocio®, Ouro Fino, Ribeirão Preto, Brazil) and 300UI of eCG (Novormon®, Syntex, Buenos Aires, Argentina) were administered in all animals. At this day, the cows were allocated in one of two groups [Group SincroCP (n=16) and Group Sincrodiol (n=14)], considering the body condition

score and cyclicity status. The cows of SincroCP group received 1.0mg of estradiol Cypionate (SincroCP®, Ouro Fino, Ribeirão Preto, Brazil) on D8 and the cows of Group Sincrodiol were treated with 1.0mg of estradiol Benzoate (Sincrodiol®, Ouro Fino, Ribeirão Preto, Brazil) on D9. Ultrasound (Chison 500VET, Chison Medical Imaging Co., Ltd., China) examinations to monitor follicular dynamics occurred every 24h from device withdrawal until FTAI and then every 12h until ovulation or 96 hours after device removal. Data was analyzed for normality and equal variance, and transformations were used if needed. The statistical analysis was accomplished by GLM procedure of the Statistical Analyses System (SAS). The results for Group SincroCP and Group Sincrodiol were, respectively: maximum diameter of the dominant follicle (13.4±0.5 and 12.9±0.5 mm), diameter of the ovulatory follicle (13.6±0.5 and 12.8±0.5 mm), ovulation rate [12/16 (75%) and 9/14 (64.3%)] and timing of ovulation after progesterone device removal (67.0±3.4 and 70.4±2.0 h). There was no statistical difference among the treatments (p>0.05). These results show that estradiol Cypionate in a dose of 1mg can be used for inducing ovulation in TAI programs, allowing a reduction in the number of animal handling. Acknowledgements: Ouro Fino Saúde Animal and USProducts Brasil Eletromedicina Ltda. P468 The seminal plasma from different portions of the ejaculate affects the kinematics of boar sperm cryopreserved in MiniFlatPacks Saravia, F1*; Wallgren, M1,2; Rodríguez-Martinez, H1 1Division of Reproduction, Dept of Clinical Sciences, SLU, Uppsala; 2 Quality Genetics, Kävlinge, Sweden In boars, owing to the presence of a fractionated ejaculate, sperm are differently exposed to portions of seminal plasma (SP) whose composition varies quali- and quantitatively. Based on previous results where sperm resilience to handling, including cryopreservation, differed between ejaculated portions (P1: the first 10 mL of the sperm-rich fraction, P2: the rest of the ejaculate), we hereby studied the influence of the SP of these portions on sperm freezability. Spermatozoa of 4 mature stud boars (5 ejaculates/boar) were primarily- or secondarily (following cleansing and re-exposure) exposed to P1-SP and P2-SP, frozen in MiniFlatPacks (MFPs), and their kinetics examined post-thaw by CASA. Immediately post-collection, P1 was extended 1:3 in BTS+® and kept for 60 min in the dark (RT). An aliquot from P1 was centrifuged (800 x g/10 m) to separate the P1-sperm from the extended SP, the sperm pellet being thereafter mixed (1:9) with thawed, pooled SP from P2 (SP2) and hold in the dark (60 min, RT; P1CENSP2). Procedures were repeated with P2 (extended 1:1 in BTS+®), from where spun P2-sperm were re-exposed to thawed, pooled SP from the P1-portion (P2CENSP1). Both the percentage of total motile sperm (TotMS), of subpopulations with different motility patterns, their degree of lateral sperm head displacement (LHD, µm); and their speed (µm/sec, VSL: straight linear velocity, VAP: average path velocity, VCL: curvilinear velocity) were recorded post-thaw. The original P1-sperm and those of P2CENSP1, increased significantly the percentage of TotMS (65.8±2.3 and 62.1±2.7 respectively) in comparison with P2-sperm and those of P1CENSP2 (56.2±2.8 and 49.8±4.2 respectively). Also sperm velocities in P1 and P2CENSP1 were significantly higher than those of P2 and P1CENSP2 (VCL: 114.6±5.1 and 106.6±4.2 vs 91.8±3.6 and 89.2±4.0; VSL: 74.3±3.2 and 72.5±3.0 vs 59.6±2.6 and 57.5±2.4; VAP: 77.7±3.3 and 75.7±3.1 vs 62.2±2.7 and 60.1±2.5). Since incubation of “cleansed” P2-sperm in P1-SP increases their total motility post-thaw to levels similar to “controls” (P1), while the opposite is seen with P2-SP; it is concluded that the SP aliquot of P1 allows boar sperm to better sustain handling and cryopreservation, compared to the rest of the ejaculate. Supported by FORMAS and SLF, Stockholm.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 182 P o s t e r A b s t r a c t s P469 A modified Cosynch protocol for timed artificial insemination in beef cattle Schmitz, W1*, Driancourt, MA2, Hoppe, S1, Friedrich, M1, Erhardt, G3, Gauly, M1, Holtz, W1, Schmitz, W1 1Institute for Animal Husbandry and Genetics, Goettingen University, Germany; 2Intervet Pharma R&D, France; 3Department of Animal Breeding and Genetics, Giessen University, Germany The Ovsynch protocol for timed artificial insemination (TAI) is widely used. In beef cattle the Cosynch protocol is often preferred, as TAI and the second GnRH injection may be conducted simultaneously, thus reducing the number of handlings. Pregnancy rates achieved with either protocol are not fully satisfactory. Critical points influencing the success rates are the proportion of animals ovulating after the first GnRH injection, the progesterone producing capacity of the corpus luteum and the incidence of short cycles after TAI. Possibly, an insufficient LH peak following induction with exogenous GnRH may be the reason why these problems occur. Human chorionic gonadotrophin (hCG) may serve as an alternative to GnRH, due to its longer half-life. The aim of this study was to determine the effectiveness of the Cosynch program using GnRH (Buserelin), hCG (Chorulon) or a combination of GnRH and hCG in beef cows. The trial was conducted on 240 beef cows (120 Simmental (SIM), 120 German Angus (DA)) at the experimental farm Rudlos of Giessen University. At the onset of the breeding season about 70 days after the previous calving all animals were subjected to the Cosynch program, involving a single TAI. Four variations of the Cosynch program were randomly applied taking breed, age and days post partum into account: hCG-PG-hCG (Group 1), GnRH-PG-GnRH (Group2 = standard Cosynch), hCG-PG-GnRH (Group3), GnRH-PG-hCG (Group4). All inseminations were carried out by the same experienced person. Semen of the different sires (5 Charolais, 5 Limousin) was distributed systematically among treatments. Blood samples taken on days -9, 0, 7 (day of PG treatment) and 9 were analysed for progesterone to determine the stage of the estrous cycle prior to treatment and to evaluate the response to the respective hormone treatment. Breeding sires were introduced into the herds to impregnate return cows. In cows treated with hCG on day 0, progesterone concentrations prior to PG treatment (day 7) were higher than in GnRH-treated cows (P<0.05). On the basis of parturition date the calving rates for Groups 1 to 4 were: 37, 54, 48 and 66%, respectively, with fertility of Group 1 being significantly lower than that observed in Groups 2, 3 and 4 (P<0.05). Calving rates for cows cycling prior to treatment as compared to those non-cycling were 53 and 41%, respectively (P>0.05). It can be concluded from this study that, whereas inclusion of hCG at the beginning of the Ovsynch protocol failed to improve fertility, replacement of GnRH by hCG at the end might be beneficial. P470 Effects of Epigallocatechin-3-gallate (EGCG) on boar sperm Spinaci, M*; Tamanini, C; Seren, E; Galeati, G Dip. di Morfofisiologia Veterinaria e Produzioni Animali (DIMORFIPA), Università di Bologna, Italia Studies in animals and humans have suggested that green tea extracts, and particularly its main polyphenol, epigallocatechin-3-gallate (EGCG), exert positive effects on human and animal health and exhibit antioxidant activities. Although high concentrations of reactive oxygen species (ROS) may cause sperm damages, an accumulating body of evidence indicates that a mild and controlled generation of ROS plays a physiological role in the acquisition of sperm fertilizing ability. Basing on these information, two experiments were conducted to study the effects of EGCG on boar sperm. In a first experiment, spermatozoa were incubated for 1 h in Brackett & Oliphant's medium supplemented with 12 % FCS and 0.7 mg/ml caffeine, in order to induce sperm capacitation, in presence of 0, 5, 10, 25 µg/ml EGCG. The degree of sperm capacitation was assessed on the basis of Hsp70 immunolocalization, that has been

demonstrated to be strictly related to the functional status of sperm. Hydrogen peroxide production was measured by an Amplex Red Hydrogen Peroxide Assay Kit (Molecular Probes). When sperm capacitation was induced in presence of 25 μg/ml EGCG, the percent of spermatozoa displaying the Hsp70 capacitated pattern was significantly lower as compared to controls (62.8±5.6 vs. 79.8±3.6, P<0.05) and sperm H2O2 was significantly reduced (1.7±0.1 μM vs. 2.6±0.2, P<0.05). In a second experiment spermatozoa were coincubated for 1 h with IVM oocytes in presence of 0, 5, 10, 25 µg/ml EGCG in order: 1) to evaluate the occurrence of spontaneous acrosome reaction (AR) in fertilization medium by using FITC-PSA; 2) to examine the effect of EGCG on both sperm-ZP binding and ZP-induced AR by staining sperm-oocyte complexes with FITC-PNA and Hoechst 33342. EGCG 10 μg/ml significantly (P<0.05) inhibited the onset of spontaneous AR in sperm suspension (6.6 ± 0.5 vs.16.3 ± 1.4). Treatment with 25 µg/ml of EGCG significantly (P<0.05) increased the number of sperm bound to ZP after 1 h of coculture compared with the control (38.5± 16.9 vs. 7.1± 2.5, P<0.05) without influencing the incidence of AR in ZP-bound spermatozoa. These results demonstrate that EGCG inhibits sperm capacitation (probably by reducing sperm H2O2) and spontaneous AR while enhancing ZP binding as only acrosome intact sperm are able to initiate binding to ZP; the subsequent true AR, induced by ZP glycoproteins, does not seem to be influenced by this catechin. Work supported by “Fondazione del Monte di Bologna e Ravenna”. P471 Relationships between fertility and seminal traits after artificial insemination under restrictive conditions in rabbits Tusell, L Unitat de Cunicultura, IRTA, Spain Objective The aim of this study was to evaluate relationships between fertility and seminal traits in rabbits under restrictive insemination conditions in order to increase the observed variability in fertility and therefore enhance the power of the test. Material and Methods A total of 6800 homospermic inseminations involving 263 males of Caldes Line were performed in a commercial farm. Overall fertility was 49% (kindling rate). Ejaculates of three groups of males with different fertility rate were selected: 21 high-fertility (>75%), 19 medium-fertility, and 19 low-fertility (<30%) males. The following seminal variables were evaluated: ph of the ejaculate, individual motility (IM) (subjectively evaluated; range: 0-5, discarding for AI values lower than 2), % viable spermatozoa (Vi), % spermatozoa with normal apical ridge (NAR), % morphologically normal spermatozoa (NSP), % spermatozoa with morphological abnormalities of head (HAP), neck-midpiece (NAP) and tail (TAP), and % spermatozoa with cytoplasmic droplet (CD). An ANOVA was performed to test whether there were any significant differences amongst the means. If there, a multiple rang test was performed to establish which means were significantly different from which others. Then, a multiple linear regression model was fitted to describe the relationship between fertility and the independent variables. Results In the ANOVA analysis, differences in LS means were found for CD and pH. CD had significant differences between low-fertility group (24.7%) and medium and high fertility group (14.5% and 11.0%, respectively). There were significant differences in pH between low-fertility (7.67) and medium-fertility (7.20) groups, being intermediate the value for the high-fertility group (7.47). The model of multivariate regression analysis for fertility and quality semen traits that gives the largest adjusted R2, included the following variables: pH, IM, NAR and NSP. pH and CD had significant effect on fertility at level of 5% (0.27±0.08 and -0.011±0.004 respectively) and NAR had a significant effect at level of 10% (0.006±0.003). Conclusion We have increased the power of the test for obtaining more observed variability in fertility among males. It seems that pH of the ejaculate could affect sperm cell fate, being an important factor to take into account as a fertility trait. However, it is still necessary to perform the analysis with the total set of data in order to obtain more accurate estimations of the variables that are involved in the relationship between fertility and seminal traits in rabbits.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 183 P472 Effect of extender and equilibration time on post-thaw motility of cryopreserved dairy Gyr bull semen, using computer-assisted semen analysis (CASA) Vale Filho, VR.1*; Leite, TG.1; Arruda, RP.2; Andrade, AFC.2; Emerick, LL.1; Martins, JAM.1; Andrade, VJ.1; Ferreira, MBD.3

1School of Veterinary Medicine, Federal University of Minas Gerais, Brazil; 2Faculty of Veterinary Medicine and Zootechny, University of São Paulo, Brazil; 3EPAMIG - Uberaba, Brazil Introduction There is still some doubts remaining related to semen equilibration time (Coulter, 1992; Gao et al, 1997). The aim of this study was to evaluate the effect of equilibration time and extender on post-thaw motility of cryopreserved bovine semen using computer-assisted semen analysis (CASA). Material and methods Semen samples from 12 andrologicaly normal adult dairy Gyr bulls (24 to 50 months) were collected by eletroejaculation and evaluated according to Brazilian College of Animal Reproduction (1998). Every semen samples were divided in two aliquots and each of them diluted with different extender (Bioxcell® or Tris) at 34ºC, to a concentration of 50 x 106 sperms/mL. The extended semen was cooled to ambient temperature (25ºC) and packaged in 0.50-mL straws and transferred to automatized freezing machines (model TK-3000®). The same cooling (0.25°C/min.) and freezing (20°C/min) rates were used for all six treatments (two extenders – Bio and Tris, and three equilibration times at 5ºC: 0h (T0), 2h (T2), and 4h (T4). Later, semen samples were thawed (37ºC/30 sec.) and post-thaw motility evaluated by CASA. Data were analyzed using SAS (2002) procedures. Results There were interactions among equilibration times and extenders. The treatments without equilibration time showed the lowest results (p<0.05) for percentages of motile (Mot) and motile sperm with progressive motility (Prog) (TrisT0: Mot = 14.50±12.73; Prog = 10.75±9.29); (BioT0: Mot = 16.75 ± 15.53; Prog = 13.83 ±11.95), compared with 2 and 4h, within each extender. There was no difference (p>0,05) between 2 and 4h, within each extender. The extender Tris showed the highest results (p<0,05) within 2 and 4h (TrisT2: Mot = 36.67±13.88; Prog = 26.58±11.11) (TrisT4: Mot = 41.00±11.82; Prog = 30.75±10.37). No difference between extenders within 0h (P>0.05), for both parameters evaluated was found. Conclusion The results indicated that equilibration time is necessary for higher post-thaw motility parameters, and that Tris (with egg yolk) is recommended when using equilibration time, assuring high post-thaw motility. P473 Estrus Synchronization in beef heifers using a progesterone device comparing the application of Estradiol Cipionate or GnRH in TAI programs Vater, A.1*; Rodríguez Aguilar, S.1; Nazarena, T2 y Callejas, S.3 1Private Activity Ia Total Group, B. Juarez, Buenos Aires, Argentine; 2Veterinary student, Veterinary School, UNCPBA, Tandil, Buenos Aires, Argentine; 3Animal Reproduction Area, Veterinary School, UNCPBA, Tandil, Buenos Aires, Argentine The use of estradiol at the time the progesterone device is removed has been studied in several papers. As well the use of GnRH al the moment of insemination has been demonstrated the effect synchronizing the ovulation in cattle. An experiment was designed to evaluate the effect in the pregnancy rate using estradiol cipionate (ECP) at the day of remotion of a progesterone device compared with the application of GnRH at the moment of time insemination 48 hs after progesterone device was removed in beef heifers. 39 Red Aberdeen Angus (RedA) and 42 Polled Hereford (PH) heifers were used in this trial. All heifers were maintain on pasture, with similar age (18-20 months) and body condition (BCS=4-6, scale from 1-9). On day 0 they received a progesterone device (DIB®, 1g of Progeterone, Syntex S.A. Argentine) with an injection im. of 2 mg Estradiol Benzoate (BE, Syntex S.A. Argentine). At day 7 DIB was removed and heifers receive 150 ug of D(+) Clorprostenol

(CPTENOL®, Lab. Prof. E. Capaul, Argentine), and for both breeds they were randomly allocated in two groups. One group receive 0.5 mg of Estradiol Cipionate (ECP, König, Argentine) (Group ECP0h) at the same time DIB was removed and inseminated (TAI) 48 hours afterwards (Group ECP0h; RedA=19; PH=21). The other group receive 10 ug of Busereline (CPRH®, Lab. Prof. E. Capaul, Argentine) 48 hours after the DIB was removed at the same time of the insemination (TAI) (Group GnRH48; RedA=20; PH=21). The insemination was using frozen/thawed semen for one bull for each breed (RedA: Rosendo; PH: Farolero). Ultrasonography was used for pregnancy diagnostic 30 days after TAI using a 5 MHz transductor (CHISON VET500). CATMOD Proceeding with SAS was used to evaluate effect in pregnancy rate of each treatment (ECP0h vs. GnRH48h); breed effect (RedA vs. PH) and bull effect. No statistical difference were found for treatment (ECP0h: 40,0% vs. GnRH48h: 50,0%; P>0,05); breed and bull (RedA/Rosendo: 38,5% and PH/Farolero: 51,2%; P>0,05). The use of ECP at the moment of the remotion of the progesterone device has the same effect in the pregnancy rate as using GnRH at TAI 48 hours after the Progesterone dev ice is removed in beef heifers. P474 Progesterone release patterns in lactating dairy cows treated with vaginal devices impregnated with different amounts of progesterone Videla Dorna, I1*, Cutaia, L2, Feresin, F3, Bo, GA4 1Veterinary Division, Syntex SA, Argentina; 2Syntex SA , Argentina; 3Private Practitioner, Argentina; 4nstituto de Reproduccion Animal Cordoba (IRAC), Argentina Various intravaginal progesterone releasing devices are commercially available and each is impregnated with different amounts of progesterone. An experiment was designed to characterize plasma progesterone profiles following intravaginal insertion of devices containing different amounts of progesterone. Cycling Holstein cows (n=14) with body condition scores of 2.0 to 3.0 out of 5, 79±27 days in milk and producing 25.2±5 kg of milk per day were used. On Day -1, all cows with a ultrasonically detected CL received two injections of 150 µg cloprostenol (PGF; Ciclase, Syntex SA, Argentina) 12 h apart and were randomly assigned to one of three groups to receive a new DIB (1 g progesterone; Syntex SA), a previously used DIB, or a new DIB 0.5 (0.5 g progesterone, Syntex SA) the following day (Day 0) for 7 days. Blood samples were taken daily for progesterone analysis with a modified human double-antibody RIA kit (DPC Coat-a-Count; Diagnostic Products Corporation, Los Angeles, CA, USA). Time-series hormone data were analyzed using ANOVA for repeated measures. The highest mean concentrations of progesterone were calculated and compared by ANOVA. There was a significant effect of day (P<0.01), treatment (P<0.01) and a day by treatment interaction (P<0.002) in the progesterone profiles, due to higher plasma progesterone concentrations in cows treated with the new DIB and DIB 0.5 than in those treated with a previously used DIB. Profiles did not differ between cows treated with DIB and DIB 0.5. Progesterone profiles in the cows treated with the new devices were characterized by a significant increase reaching peak concentrations on Day 1 (mean ± SEM: DIB 3.0±0.33 ng/ml and DIB 0.5 (2.6±0.25 ng/ml) and decreasing gradually over the following 6 days to 2.3±0.78 ng/ml and 1.4±0.52 ng/ml, respectively at device removal. Plasma progesterone concentrations in cows treated with the previously used DIB were characterized by an increase to 0.7±0.06 ng/ml on Day 1 which was lower (P<0.01) than those with the new devices. Mean progesterone concentrations remained lower than 1 ng/ml for the next 4 days and then gradually increased from Days 5 to 7, presumably due to cows ovulating with the previously used device in place. It was concluded that new devices containing 1 or 0.5 g of progesterone result in similar plasma progesterone release patterns. However, previously used DIB did not result in blood levels above 1 ng/ml and would appear to be inadequate for use in lactating dairy cows.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 184 P o s t e r A b s t r a c t s P475 Effect of density gradient and single layer centrifugation on motility and survival of boar spermatozoa Wallgren, M*, Saravia, F; Rodriguez-Martinez, H; Morrell, JM Dept. of Clinical Science, Div. of Reproduction, SLU, Uppsala, Sweden Density gradient centrifugation was compared with centrifugation on a single layer of colloid for preparing boar spermatozoa, using species-specific colloid formulations developed at SLU. Ejaculates (12) from four boars were extended 1:1 with Beltsville thawing solution (BTS) within 15 minutes of collection. The sperm concentration was adjusted to 100 million per mL, again with BTS; the sperm suspensions were used either immediately or after overnight storage at room temperature. Aliquots (1.5 mL) of the extended semen were layered on a density gradient of silane-coated silica colloid formulations (2 mL of a high density and 2 mL low density colloid formulations) or a single layer (4 ml) of the high density colloid formulation, before centrifugation at 300 g for 20 minutes. The sperm pellet was subsequently washed in BTS by centrifugation at 500 g for 10 minutes and resuspended in 1.0 mL BTS. Sperm motility of incubated aliquots (37°C for 30 min) of the sperm suspensions was assessed subjectively every day. Sperm motility was significantly better (P<.0.001) in the centrifuged sperm preparations (means ± SD: 79.6 ± 8.1% and 74.2 ± 12.0 % for single layer and density gradient respectively) than in the uncentrifuged controls (62.9 ± 12.7%). The mean yield of motile spermatozoa for the single layer was 67.5 ± 25.6 %, and for the density gradient was 59.6% ± 22.3 % (ns). Sperm survival was significantly increased by colloidal centrifugation (control: 3.1 ± 0.3 days, SL 5.5 ± 0.79 days, DG 5.75 ± 0.62 days; P < 0.001 for control versus centrifugation treatments; NS for SL vs DG). Boar spermatozoa could be stored for 24 hours before centrifugation (SL) without having a detrimental effect on sperm motility and duration of motility in the centrifuged preparations (control: 50.4 ± 16.11%, centrifuged stored 68.8 ± 14.2%, centrifuged fresh 67.5 ± 25.6 %, duration of motility as above). In conclusion, the single layer method is as effective as density gradient centrifugation through the same colloid formulations in selecting good quality spermatozoa. Acknowledgment: We thank the animal husbandry staff of the Department for their excellent care of the boars. Supported by the Swedish Farmers´ Foundation for Research in Agriculture (SLF) and FORMAS, Stockholm, Sweden. P476 Effect of three diluents on ram semen preservation at 15ºC assessed by computer-assisted sperm analysis Yániz, JL1*, Santolaria, P1, Bech-Sàbat, G2, López-Gatius, F2 1Dept. Animal Production, University of Zaragoza, Huesca, Spain; 2Dept. Animal Production, University of Lleida, Lleida, Spain Inadequate semen preservation remains as an obstacle for the extensive use of cooled semen in sheep artificial insemination (AI) programs. The literature contains contradictory results concerning the effectiveness of different diluents for ram semen preservation, being citrate-, TRIS-, and milk-based media the more frequently used extenders for liquid storage of ram semen. The objective of the present work was to study the effect of milk-, citrate-, and TRIS- based extenders on sperm motility parameters assessed with CASA during ram semen storage at 15ºC. Second ejaculates from six rams were collected by artificial vagina, pooled and diluted to 800x106 spermatozoa ml-1 in milk liquid standard (0.7% fat); citrate-based extender (80.6 mM sodium citrate titrated to pH 7.0 using a 1M citric acid solution, 55.6 mM glucose, and 1% BSA); or TRIS-based extender (300 mM TRIS titrated to pH 7.0 using a 1M citric acid solution, 55.6 mM glucose, and 1% BSA). Semen samples were stored at 15º C and sperm motility variables assessed at 0, 24 and 48 h of storage using a CASA system (ISAS®). Differences in motility variables between groups were examined through analysis of variance (ANOVA) using generalized linear models. The level of statistical significance was set at P < 0.05. Significantly higher motile sperm were obtained at 0 hours of storage, and higher motile and progressive

sperm at 24 h when milk-based extender was used rather than citrate and TRIS-based extenders. Dilution in TRIS extender caused marked modifications of kinematic parameters during storage, with an increase of the amplitude of the lateral head displacement (ALH) and of circular trajectories (lower linearity, LIN, and straightness, STR) at 24 and 48 hours, and of the of curvilinear velocity (VCL) at 48 h of storage. Poster 18 - Oocyte and Embryo (Including Nuclear Transfer) P477 Superovulatory response of Nelore cows treated with pFSH in a single subcutaneous injection followed by an additional intramuscular sub-dose 48 hours later Alvarez, RH1,2*, Martinez, AC3, Pires, RML2 1Center of Genetic and Animal Reproduction, Instituto de Zootecnia, Brazil; 2Center of Genetic and Animal Reproduction, Animal Production Institute/APTA, Brazil; 3Animal Reproduction, Faculty of Veterinary Medicine- UEM, Brazil A single injection of FSH applied by sc route induces a less predictable ovarian stimulation than conventional twice-a-day im sub doses injected during 4 days. Considering that plasmatic levels of exogenous FSH return to basal levels in a 36-hour period after the sc injection, it may be speculated that the lack of FSH after this period could affect the final stage of follicular growth and ovulation. The aim of this study was to evaluate whether an additional im injection of FSH would increase the embryo production of zebu cows superovulated with a single sc FSH injection. Twenty-one Nelore cows were treated with a progestagen vaginal implant (CIDR-B) and injected im with 2.5 mg estradiol benzoate. Four days later, cows were assigned randomly in 7 groups of 3 animals each and superovulated with pFSH in sequenced ABC, BCA and CAB treatments. Treatments A and B were single injection of 400 and 320 IU by sc route, respectively; Treatment C was multiple im injections of 400 IU in decreasing doses in 12-hour intervals. In the morning of day 3 after starting superovulation cows received im 150 mcg cloprostenol and Treatment B was additionally injected im with 80 IU of pFSH. CIDR-B was withdrawn in the afternoon. Cows were inseminated 48 and 62 hours after the cloprostenol injection. Embryo collection and corpora lutea (CL) estimation were done seven days after insemination. Alternation of treatments (cross over design) occurred in a 60-day interval. There was no significant difference (P>0.05) of CL counts among Treatments A (8.9 ± 1.3), B (11.4 ± 1.3) and C (12.0 ± 1.1), respectively. The total number of recovered structures from Treatment A (6.9 ± 1.5) was no different from Treatments B (5.7 ± 1.5) and C (9.8 ± 1.2). Transferable embryos from Treatments A (2.4 ± 0.7) and B (1.7 ± 0.6) were lower (P<0.05) than Treatment C (4.6 ± 1.2). Lesser embryo production from Treatment B was related to lower recovery rate (46.4%) compared to Treatment A (65.1%) and C (81.7%). It was concluded that an additional im injection of pFSH does not improve the embryo production of Nelore cows superovulated with a single dose of pFSH injected by sc route. P478 Cytoplasmic lipid droplets aggregation in equine oocyte correlates with perinuclear mitochondrial distribution but not with fertilization after ICSI Ambruosi, B1*; Iorga, AI1; De Santis, T1; Mugnier, S2; Matarrese, R1; Goudet, G 2; Dell’Aquila, ME1 1Department of Animal Production, University of Bari, Italy; 2INRA, UMR85 Physiology of Reproduction and Behaviours, Nouzilly, France Introduction Lipid granules and mitochondria in the ooplasm are essential for energy production required for fertilization and embryo development. We studied the correlations between cytoplasmic lipid

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 185 droplets aggregation and: 1) perinuclear mitochondrial (mt) distribution; 2) fertilization after intracytoplasmic sperm injection (ICSI) in equine oocytes matured in vitro. Methods Equine oocytes from slaughtered mares were cultured for in vitro maturation (IVM). After culture, oocytes classified as morphologically normal, according to zona pellucida thickness and integrity, perivitelline space wideness, ooplasmic size and oolemmal integrity, were categorized as having aggregation (A) or uniform distribution (U) of lipid droplets within the cytoplasm. Those oocytes showing the 1st polar body extruded underwent either to mt distribution analysis (Experiment 1) or to ICSI (Experiment 2). The mt distribution was revealed after 30’ incubation in 280 nM MitoTracker Orange CMTM Ros and confocal microscopy. IVM and ICSI were performed as previously reported (Dell’Aquila et al., Biol Reprod 2003;68:2065-72). Results In Exp. 1, 54 oocytes, 29 A (54%) and 25 U (46%) were analyzed. The nuclear maturation rate (metaphase II + polar body) was significantly higher in A oocytes compared with U (83%, 24/29 vs 0%, 0/25; P<0.001). The highest rate of A oocytes showed perinuclear mt distribution in the area corresponding to meiotic spindle (63%,15/24). None of U oocytes was analyzed for mt distribution due to 0% maturation rate. In Exp. 2, 110 oocytes, 76 A (69%) and 34 U (31%) were analyzed. The maturation rate was, again, significantly higher in A oocytes compared with U (91%, 69/76 vs 65%, 22/34; P<0.01). However, the rate of normally fertilized oocytes was not different between groups (57%, 37/65 vs 65%, 11/17, for A and U respectively; NS). Conclusions In morphologically normal equine oocytes, the two examined energy status parameters are correlated between them and associated with nuclear maturation. However, cytoplasmic lipid droplets aggregation cannot be considered as a predictive indicator for normal fertilization. P479 Efforts to optimize embryo production from somatic cell nuclear transfer in bovine Bhojwani, S*; Torner, H; Alm, H; Kanitz, W; Poehland, R Research Unit Reproductive Biology, Research Institute for the Biology of Farm Animals, Germany Introduction Several factors contribute to the variability and inconsistence of SCNT results. Efforts must be made to optimize at least some of these factors so as to have consistency in NT embryo production. Objective The aim of the present investigation was to study the influence of modifications to the method of oocyte enucleation, electrofusion and the gas-phase during embryo culture on the ultimate efficiency of bovine NT process in terms of generating transferable blastocysts. Methods Compact cumulus-oocyte-complexes were recovered from slaughterhouse-collected bovine ovaries by aspirating follicles greater than or equal to 5mm at the surface of the ovary. After IVM for 19 to 21h, oocytes were subjected to Handmade Cloning (HMCTM) procedure using ear fibroblasts from at least four different cell lines (L1 to L4) as nuclear donors. Following modifications were tested: (a) 20% oxygen tension in the gas phase vs. 5% oxygen during embryo culture; (b) Chemically-assisted enucleation using demecolcine vs. Hoechst staining & UV exposure; (c) Single-step electrofusion (cytoplast-somatic cell-cytoplast) with a double DC pulse of 65V for 20 µsec each & 0.1 sec apart vs. the double-step fusion (cytoplast-somatic cell + first fusion product-cytoplast after 1h interval) with the same parameters but at 45V DC for the second fusion. Embryos were cultured in synthetic oviductal fluid medium with 10% oestrous cow serum. The data were evaluated by one-way analysis of variance and all results with P < 0.05 were considered statistically significant. Results (a) The cell lines (n=600 embryos per group, approx.) exhibited significant differences in terms of blastocyst rates which were maintained irrespective of the gas phase, though a low oxygen tension tended to significantly favour blastocyst development rate in all the cell lines. (b) In comparison to Hoechst selection (n=484 embryos), demecolcine-assisted enucleation (n=466 embryos) yielded significantly higher blastocyst rate in the cell line which had earlier

provided the best results (L4; 27.6% vs. 38.3%). (c) When the same line (L4) was further tested for single-step (n=728 embryos) vs. double-step electrofusion (n=672 embryos), a significantly higher blastocyst rate (44.7% vs. 32.1%) was achieved showing positive effects of reduced exposure to electric field. Conclusion From our results we can conclude that low oxygen tension, demecolcine-assisted enucleation and single-step electrofusion help increase the output of bovine embryo production after NT and could be used for optimization of NT process by HMCTM method. P480 Effect of adding serum or follicular fluid to the maturation medium on the in vitro cytoplasmic maturation of porcine oocytes Bijttebier, J1*, Van Soom, A1, Meyer E2, Mateusen, B1, Maes, D1 1Department of Obstetrics, Reproduction and Herd Health, Faculty of Veterinary Medicine, Ghent University, Belgium; 2Department of Pharmacology, Pharmacy and Toxicology, Faculty of Veterinary Medicine, Ghent University, Belgium Follicular fluid (pFF) is usually added to the maturation medium to improve in vitro production of porcine embryos. In this study, the maturation medium was supplemented with either pFF or autologous serum. The main purpose was to investigate whether supplementation of pFF, as a transsudate of serum, has additional positive effects on the glutathione content of the oocytes and the in vitro embryo development. Both parameters can be considered as good characteristics for the in vitro cytoplasmic maturation of porcine oocytes. A sow was slaughtered in the preovulatory stage of the estrus cycle after hormonal treatment. Both the pFF and serum were collected and kept at -80°C until use. Subsequently, oocytes of prepubertal gilts were matured in ‘North Carolina State University’ medium supplemented with 10% serum or 10% pFF. Afterwards, a part of the oocytes (3 replicates, n=219) was denuded and the intracellular glutathione content was determined using the 5,5’-dithio-bis-(2-nitro-benzoic acid)-glutathione disulfide reductase assay. The other part of the oocytes was fertilized and cultured for 7 days. Cleavage and blastocyst rates were determined (4 replicates, n=896) as well as the embryonic cell number after staining the obtained blastocysts (3 replicates, n=51) with Hoechst 33342. Cleavage and blastocyst rates were analyzed using logistic regression analysis while ANOVA was used to analyze data concerning embryonic cell number and oocyte glutathione content. Statistical analysis was performed using SPSS 15.00. The glutathione content of the oocytes matured in the medium with serum (s-group) (5.1 pmol/oocyte) was lower compared to that of the oocytes matured in the medium with pFF (pFF-group) (6.7 pmol/oocyte) (p< 0.05). After 7 days of in vitro culture, cleavage of the embryos in the pFF-group (72%) was numerically (p=0.057) higher than that of the embryos in the s-group (65%). The percentage of oocytes that further developed into the blastocyst stage was 11% and 8% in the pFF-group and s-group, respectively (p>0.05). There was a tendency towards higher average cell number of the blastocysts in the pFF-group (20.2) compared to the s-group (17.4) (p = 0.08). This study demonstrated a higher glutathione content in pig oocytes matured in pFF compared to those matured in serum. No significant difference could be observed in embryo development between the 2 groups, although there was a tendency towards an improved quality of embryos generated after oocyte maturation in pFF. The factors and mechanisms responsible for our results remain to be elucidated.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 186 P o s t e r A b s t r a c t s P481 Ovine oocytes fertilization followingICSI: effect of interspecific sperm injection, oocyte activation and sperm treatment Bogliolo, L*, Fois, S; Ariu, F; Rosati, I; Zedda, MT; Pau, S; Ledda, S Department of Veterinary Pathology and Clinic, University of Veterinary Medicine, Italy Ovine oocytes fertilization following ICSI: effect of interspecific sperm injection, oocyte activation and sperm treatment Bogliolo, L; Fois, S; Ariu, F; Rosati, I; Zedda, MT; Pau, S; Ledda , S Department of Veterinary Pathology and Clinic, University of Sassari Introduction Intracytoplasmic sperm injection (ICSI) is a very powerful technique in domestic livestock species. In ovine species, although the birth of normal lambs has been reported, the efficiency of blastocyst production after ICSI is very low probably owing to defective activation of the oocyte. In the present study, we investigate the effect of interspecies sperm injection, oocyte artificial activation and sperm treatment on sheep oocyte fertilization following ICSI. Materials and methods Exp 1-Cumulus-oocyte complexes collected from sheep ovaries were matured in vitro for 24 h before being injected with: a) frozen-thawed ram semen (RS); b) frozen-thawed stallion semen (SS). Motile ram and stallion spermatozoa were selected by swim-up technique. Injected oocytes were thereafter cultured 18-20 h, fixed and stained with aceto: lacmoid to assess the presence of male and female pronuclei. Exp 2- On the basis of the results of Exp1, we tried to optimize sheep oocyte fertilization with the aid of activation of oocytes with ionomycin (5 μM, 5 min) and 6-DMAP (3h)and/ or ram sperm pre-treatment with 0.1% Triton X-100 (5 min). Fertilisation rate was evaluated by oocyte staining as previously described. Statistical analysis was done using the Chi-square test. Results Exp 1- A significantly (P<0.01) higher proportion of normal fertilization was obtained after injection of SS (84/116, 72.4%) compared to RS (48/104, 46.2%). Exp 2 –The treatment of injected oocytes with ionomycin and 6-DMAP resulted in increased pronuclei formation (69/ 98, 70.4%) compared to non-activated group (46. 2%). Fertilization rate after sperm pre-treatment was significantly lower in absence of oocyte activation (20/83, 24.1%, P<0.01) compared to activated group (38/79, 48.1 %) Conclusions Taken together these findings proves that stallion spermatozoa have a higher ability to activate sheep oocytes compared to ram semen and that oocyte artificial activation, but not sperm pre-treatment, enhances fertilization of sheep oocytes after ICSI. P482 Analysis of gene expression of in vitro produced bovine blastocyst cultured for 72 hours post-vitrification Boité, MC1, Camargo, LSA2*, Guimarães, MFM3, Serapião, RV2, Wohlres-Viana, S2, Viana, JHM2, Sá, WF2, Nogueira, LAG1 1Faculty of Veterinary Medicine, Fluminense Federal University, Brazil; 2Laboratory of Animal Reproduction, Embrapa Dairy Cattle, Brazil; 3Laboratory of Molecular Genetics, Embrapa Dairy Cattle, Brazil Introduction In vitro produced (IVP) embryos frequently show low survival rates after cryopreservation. Among the available methods, vitrification has generally shown better results with IVP embryos. However, little is known about vitrification effects on genes expression. The aim of this study was to evaluate the expression of aquaporins encoding genes for (AQP) 3, AQP11 and ATPase α1 in vitrified/warming embryos cultured in vitro for 72h. AQPs are channels that facilitate water transportation across membranes, whereas ATPase α1 is a Na/K pump subunit. Both AQPs and Na/K pump may be involved in blastocoel expansion after cryopreservation. Materials and methods In vitro produced bovine blastocyts (n=57) were vitrified using an open pulled straw (OPS) in a two steps protocol (10% DMSO + 10% ethylene glycol (EG) for 1 minute followed by 20% DMSO + 20% EG for 20 seconds). Warming was performed through OPS immersion on holding media with 0.26M of sucrose at 39ºC for 1 minute, followed by 0.26M and 0.16M for 5 minute each step. Warmed embryos were cultured in CR2aa with granulosa cells monolayer at 38,5°C under 5% CO2 in air for 72

hours. Non-vitrified embryos (control group; n=52) were cultured simultaneously. After 72 hours, viable embryos (expanded and hatched blastocysts) were frozen and stored in -80°C until mRNA extraction. RNA extraction was performed from pools of five expanded/hatched blastocysts equally distributed in each pool. RNA obtained from pool extraction was amplified and real time RT-PCR was performed in order to obtain quantitative data. Beta-actin gene expression was used as an internal control. Primers efficiency was assayed by LinRegPCR software. Calculations and statistical analysis of relative quantification were performed by REST® software. Data of embryos’ hatching and survival rate were analyzed by Chi-square. Results Control group presented higher (P<0.05) hatching and survival rates (78.8%; 84.6%, respectively) than vitrified group (17.5%; 57.9%). In contrast, relative expression of APQ3, AQP11 and ATPase α1 transcripts was not different between control group and vitrified embryos after co-culture for 72 hours (0.8, 0.3, and 0.9 fold difference relative to control group). These results suggest that, despite lower survival rates, vitrified IVP embryos that survived in vitro culture for 72h presented similarities to fresh IVP blastocysts. In conclusion, vitrification may result in expanded/hatched IVP blastocyts with no alterations on expression of genes associated with blastocoel expansion. P483 Effect of melatonin on in vitro maturation of bovine cumulus-oocyte complexes and DNA damage of cumulus cells Coelho, LA1*; Takada, L1; Martins Jr, A2; Mingoti, G2

1Faculty of Animal Science and Food Engineering, USP, Pirassununga-SP, Brazil; 2Faculty of Veterinary Medicine, UNESP, Araçatuba-SP, Brazil Introduction Melatonin, a major hormone of pineal gland, is known to be associated with the modulation of circadian rhythms and the regulation of seasonal reproductive function. In addition, its antioxidant properties as a scavenger have been also reported. Objective The aim of this study was to examine the effect of melatonin on in vitro maturation (IVM) of bovine cumulus-germinal vesicle-stage oocyte complexes and DNA damage of cumulus cells. Materials and Methods The bovine cumulus-oocyte complexes (COCs) aspirated from abattoir ovaries were cultured in Tissue Culture Medium 199 supplemented with 0.3 mM sodium pyruvate, and 10 µg/ml gentamicin sulfate (B199 medium) at 39°C in an atmosphere of 5% CO2 in air. After 24 hours of culture in B199 medium with 0.5 μg/ml FSH and 5.0 μg/ml LH (control), in B199 medium with 1 µ/ml melatonin (MEL) or in B199 medium with 1 µ/ml melatonin, 0.5 μg/ml FSH and 5.0 μg/ml LH (MEL-FSH-LH) the oocytes were stained with Hoechst 33342 to evaluate the maturation rate. After in vitro maturation the DNA damage of the cumulus cells of each group was also measured by Comet assay. Results Maturation rates were similar (P > 0.05) among groups (Control = 59.92±4.99; MEL = 60.96±4.99; MEL-FSH-LH = 55.08±4.99). The percentage of cumulus cells with no DNA damage was significantly superior in MEL group (37.77±1.59) than in Control (24.76±1.59) and MEL-FSH-LH groups (31.87±1.59). Additionally, the percentage of cumulus cells that exhibited a large migrating DNA fragment was lower (P < 0.01) in MEL group (16.78±1.62) than Control group (24.99±1.62) but not significantly different from MEL-FSH-LH (18.97±1.62). Conclusion The results suggest that the addition of melatonin to the IVM medium protects the cumulus cells from DNA damage. However, additional studies are necessary to verify the role of melatonin on the regulation of oocyte maturation. Research supported by FAPESP.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 187 P484 Morphological and ultra structural evaluation of the interaction of Porcine Parvovirus with porcine oocytes during in vitro maturation period Athayde, CS.1; Pavão, DL.1; Piccolomini, MM.1; Palazzi, EG.1; Bersano, JG.2; Catroxo, MHB.3; D’Angelo,M.1* 1Cell Biology Lab, Instituto Biológico de São Paulo, Brazil; 2Porcine Lab, Instituto Biológico de São Paulo, Brazil; 3Electron Microscopy Lab, Instituto Biológico de São Paulo, Brazil The biotechnological advances in animal reproduction aim to optimize the reproductive efficiency on distributing valuable genetic material. By using commercially these biotechnologies, the improvement of better techniques for infectious diseases prevention is needed. Therefore, studies must be performed to evaluate the potential risk of pathogens transmission by in vitro fertilization technique. The aim of this study was to elucidate porcine parvovirus (PPV) and porcine oocytes interaction during in vitro maturation period, evaluating the morphological changes by optical microscopy and the possible oocyte infection by electron microscopy. Cumulus-oocyte complexes (COCs) with intact zona pellucida were retrieved from slaughtered pre pubertal gilts ovaries and separated into control (n=593) and exposed (n=600) groups. The exposed group was inoculated with 60�l of PPV virus suspension and both groups were in vitro maturated in NCSU23 medium for 44h at 39ºC. Oocytes were then fixed, included in paraffin, cut with ultra microtome and incubated with PPV specific antibody with colloidal gold for ultra structure analysis. At morphological evaluation, the exposed group showed irregular cumulus cells expansion, with some cellular individualization; ooplasm presented brownish with dark points and granules. The control oocytes showed regular cumulus cell expansion and uniform brownish ooplasm. The ultra structural analysis showed exposed oocytes with chromatin marginalization of the cumulus cells nucleus as well as viral inclusions immunologically marked by the colloidal gold. These viral inclusions were spread through cumullus cells, zona pellucida and inside the oocytes. These changes were not seen at the control group. The morphological changes observed on optical microscopy were not severe and considering that COCs are selected according to their morphology on procedures for embryo in vitro production, it seems that this criterion do not guarantee that these embryos are pathogens free. Electron microscopy showed the presence of viral inclusions with the PPV immunologically marked inside the oocytes, which suggest viral replication and an interaction with the oocyte. Further studies must be performed to verify these oocytes viability until the embryo transfer stage. A criterion should be established to enable porcine oocytes and embryos evaluation for in vitro procedures. It would assist the prevention of infectious diseases transmission besides avoiding losses of the biotechnique viability. P485 Improvement of embryo recovery rates by modified flushing techniques in Holstein cattle at a commercial embryo transfer station Detterer, J1*; Wolgast, T1; Reuss, W1; Meinecke-Tillmann, S2; Schmidt, T3 1AI- and ET-Center Georgsheil, Südbrookmerland, Germany; 2Department of Reproductive Biology, University of Veterinary Medicine, Hannover, Germany; 3Intergen GmbH; Höchstädt, Germany During the last 30 years an embryo recovery rate (RR) of about 65% to 75% was reported after flushing of superovulated cattle. This indicates that the collection techniques might be suboptimal and that embryos might be left in the reproductive tract. The aim of our study was to find a way to improve the recovery rate in commercial embryo transfer (ET) with the support of uterotonic drugs, which should promote the release of embryos by myometrial contractions. After estrus synchronisation with prostaglandin analogues and superovulation with 630 IU FSH (Folltropin-V®), 169 Holstein cows (1-12 lactations) were divided at random into five experimental groups. Four of these were treated with different drugs and/or placebo and embryo collection (EC) was performed with a double flushing

procedure, while the fifth served as a standard control without any additional treatment and with a single uterine flushing. Group A (n=36) got a luteolytic dose of Dinoprost (25 mg/5 ml i.m., Dinolytic®) 12 to 16 hours before flushing and 10 IU Oxytocin (10 IU/1 ml i.v., Oxytocin Albrecht®) at the beginning of the flush. Group B (n=34) was treated with Dinoprost and placebo (1 ml i.v., 0.9% NaCl). Group C (n=37) received placebo (5 ml i.m., 0.9% NaCl) and Oxytocin; group D (n=30) got a placebo twice (timing as in Group A, respectively). Group E (standard control) included 32 animals. EC was done by a single technician. Each uterine horn was flushed separately with 400 ml DPBS on D7 of pregnancy. 30 min after the first flush the catheter was reintroduced and EC was repeated with the same amount of medium (group A-D) to control the effect of the drugs. The embryos in the different flushings were counted and classified according to the standards of the IETS. Corpora lutea were counted ultrasonically (7.5 MHZ, Sonovet 2000) after EC, and RR was determined. RR in Group A-D averages 72.5%, 78.4%, 66.1%, 69.1% and 69.6%, respectively (Group A: 10.7±8.9 oocytes/embryos (O/E) with 6.3±5.3 transferable embryos (tE); Group B: 10.6±6.1 O/E with 6.6±5.2 tE; Group C: 9.2±7.9 O/E with 4.9±5.2 tE; Group D: 11.0±8.1 O/E with 5.6±5.6 tE; Group E: 9.5±7.7 O/E with 5.2±6.5 tE). This indicates that an uterotonic treatment as well as a double flushing procedure improves embryo recovery rates. An enhancement of RR via double flushing is more noticeable in the placebo group D (increase comparing 1st flush to 2nd flush: Group A: 3.9%, B: 2.7%, C: 4.4%, D: 5,8%) It can be concluded that an uterotonic support especially with Dinoprost could enhance embryo recovery rates in commercial ET. P486 Determination of oocyte membrane permeability coefficients and their application to cryopreservation in a rabbit model Liu, J1; Mullen, S2; Meng, QG1; Critser, J2; Dinnyes, A1* 1Genetic Reprogramming Group, Agricultural Biotechnology Center, H-2100 Gödöllő, Hungary; 2Comparative Medicine Center and Department of Veterinary Pathobiology, University of Missouri at Columbia, Columbia, Missouri, USA Introduction It is essential to establish good animal models for human oocyte cryopreservation and the rabbit is among the candidates. Having an effective means to cryopreserve human oocytes would offer more flexibility in healthcare services for infertility patients, and obviate cryopreservation of preimplantation embryos. Attempts to improve oocyte cryopreservation are often empirical, with results often irreproducible. Cryopreservation protocol may be optimized by modeling the changes in oocyte volume and the associated damages incurred during the addition and dilution of cryoprotective agent (CPA). Unlike rabbit oocytes, the permeability to water and several cryoprotective agents (CPAs) has been determined for human oocytes. The objectives of the current study are to determine cryobiological properties of rabbit oocytes, including the isotonic volume (Viso), osmotically inactive cell fraction (Vbp), permeability to water (Lp), dimethylsulfoxide (PDMSO), ethylene glycol (PEG), and glycerol (PGLY). Using these new data, we modeled both rabbit oocyte and human oocyte responses to CPA addition and dilution. Materials and method Mature rabbit oocytes were held by two injectors that were mounted on Narishige micromanipulators to an Olympus microscope. The oocytes were perfused with 15% (V/V) CPA medium (dissolved in 1X PBS). The osmotic responses of the oocytes were videotaped. A two-parameter model was fit the experimental data to determine the values of Lp, and PCPA. Equilibrium oocyte volumes exposed to 285, 600, 900, and 1200 mOsm/kg solutions were normalized to their respective isotonic values and then plotted versus the reciprocal of normalized osmolality in Boyle van’t Hoff plot. T-tests were used in statistical analyses. Result The average radius of rabbit oocytes in an isotonic solution was determined to be 55.7 ± 1.2 μm (n=16). The rabbit oocyte exhibited an “ideal” osmotic response in the range from iso-osmolity to 1200 mOsm. The Vbp was determined to be 20% of isotonic value

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 188 P o s t e r A b s t r a c t s with r2 = 0.97. The values of LP were determined to be 0.79 ± 0.26, 0.82 ± 0.22, and 0.64 ± 0.16 μm⋅min-1⋅atm-1 and the PCPA values were determined to be 2.9 ± 1.3, 2.7 ± 1.3, and 0.27 ± 0.18 x10-3cm⋅min-1

for DMSO, EG and GLY respectively. There were no significant differences (p>0.05) between values for LP and PCPA in presence of the DMSO and EG. However, these values were significantly different from the values in presence of GLY. Conclusions Similar to human oocytes, rabbit oocytes behave as ideal osmometers in the range osmolalities tested with values for Vbp nearly identical to human oocytes. However, rabbit oocyte isotonic volume is smaller than human oocytes. Previously published mean values for Lp in human oocytes falls within the 95% confidence limits for rabbit oocytes; the same is true for the permeability to DMSO. Rabbit oocytes are more permeable to EG in comparison to human oocytes, however. Higher PCPA values for rabbit oocytes result in less volume excursions than those for human oocyte during CPA addition and dilution. Supported by Wellcome Trust (Grant No.070246), EU FP6 (MEXT-CT-2003-509582, MRTN-CT-2006-035468) and Chinese-Hungarian Bilateral projects (TET CHN-28/04, CHN-41/05). P487 Different response of Bos indicus Vs Bos taurus oocyte on maturation, cleavage and embryo development under in vitro system Escalona, F*; Mercado, J; Rodríguez, A; Rodríguez-Sallaberry, C; Kowalski, AA Laboratorio de Embriología y Endocrinología Molecular, Decanato de Agronomía, Universidad Centroccidental Lisandro Alvarado (UCLA), Lara, Venezuela The in vitro of production embryos represents an alternative to the cattle industry for generating large numbers of F1 embryos. The objective of this study was determine the differences of in vitro maturation, fertilization and culture (IVM, IVF, IVC) of two oocytes groups; Brahman (Br) and Holstein (Ho) oocytes. Ovaries from slaughterhouse were transported in saline 0.9% at 30 ±1.1°C; complex oocytes-cumulus (COCs) were collected from Br (52) and Ho (51) ovaries and used for IVM, IVF and IVC. The number of oocytes from each ovary were: Br (13.65±1.3) Ho (7.30±3) respectively. COCs were cultured on TCM-199 supplemented with BSA, piruvate, L-glutamine, FSH, LH y EGF during 22 hrs, and incubated at 38°C on 5% CO2 in a humidified environment. The COCs were transferred to IVF-TALP supplemented with heparin, penicillamine, hypotaurin and epynephrine. The fertilization was made with sperm from Ho bulls. The semen was separated by percoll gradient and washed in sperm-talp. In both groups the semen concentration was 1 x 106sperm/mL and incubated for 18 hrs. The zygotes were incubated for 7 days in KSOM supplemented with BSA, L-glutamine, EAA and NEAA. The cleavage rate was Br (92.36±0.8%) and Ho (69.4±18.7%) (P<0.05). The rate of IVM was 60.3±17.5% for Br and 34.7±9.7% Ho (P<0.05). The percentage of blastocysts obtained from the Br oocytes were significantly higher than the oocytes from Ho (29.5±9.37% Vs 17.5±3.3%). These results showed a better performance of Br oocytes than Ho according to maturation rate, cleavage rate and percentage of embryos. This suggests a better quality of Br oocyte than Ho, and it could be related to the capacity of Br cows to tolerate heat stress under tropical conditions which relates to higher heat tolerance characteristic of Br cow. P488 Undernutrition and exogenous melatonin affect ovine embryo viability on a seasonal basis Vázquez, MI; Forcada, F*; Casao, A1; Sosa, C; Palacín, I; Abecia, JA

Animal Production and Food Science Department, Veterinary Faculty, University of Zaragoza, Spain Seasonality and nutrition are major factors affecting the reproductive performance in sheep. Melatonin treatment is effective inducing cyclicity and increasing ovulation and lambing rates during anoestrus. On the other hand, undernutrition increases embryo mortality and decreases pregnancy rates in ewes. The aim of the current study was

to investigate the effect of melatonin and undernutrition on ovulation rate, recovered ova and embryo viability during both the anoestrous and the reproductive season. The experimental design was similar for reproductive (RS) and anoestrous seasons (AS). In December (RS, n=35) and in March (AS, n=30) adult Rasa Aragonesa ewes were assigned into two groups: treated (MEL) or not with a subcutaneous implant of melatonin (Melovine®, CEVA). After 42 days, both groups were synchronized with intravaginal pessaries and fed to provide 1.5 (Control, C) or 0.5 (Low, L) times daily maintenance requirements. Therefore, ewes were divided into four groups: C, C+MEL, L and L+MEL. At oestrus (Day=0) ewes were mated and on Day 5 embryos were recovered by mid-ventral laparotomy and classified according to their developmental stage and morphology. No effect of diet or melatonin treatment was observed on ovulation rate and number of recovered ova per ewe during both the RS and AS. During the RS, number of viable embryo per ewe from L+MEL (0.22±0.15) was significantly lower than L (0.89±0.3), C+MEL (1.22±0.3) and C (1.00±0.4) (P<0.05). Overall, undernutrition decreased the number of viable embryos/ewe (C: 1.11±0.2; L: 0.56±0.2; P<0.05). Embryo viability rate (% viable embryos/total recovered embryos) was not affected by melatonin in the RS. During the AS, no significant effects were observed either on the number of viable embryos/ewe or on embryo viability rate, although both parameters were slightly improved by melatonin. In fact, there was a clear effect of season on the number of viable embryos only for L+MEL ewes (RS: 0.17±0.15; AS: 0.58±0.16; P<0.05). In conclusion, this study shows that undernutrition impaired ovine embryo viability during the breeding season, particularly in ewes treated with melatonin. However, melatonin seemed to improve embryo quality during anoestrus. These results indicate that the mechanisms involved in the interaction of melatonin and nutrition on embryo development are seasonally regulated. This study was supported by grants AGL2004-00432 from CICYT and A-26 from DGA. P489 Sources of dietary fatty acids affect the developmental potential of oocytes and quality of embryos in lactating dairy cows Fouladi-Nashta, A1,2*, Gutierrez, CG3, Sinclair, KD2, Garnsworthy, PC2, Webb, R2 1Veterinary Basic Sciences, The Royal Veterinary College, United Kingdom; 2Animal Production, The University of Nottingham, United Kingdom; 3Departamento de Reproducción , Facultad de Medicina Veterinaria, UNAM , Mexico; We have previously demonstrated the beneficial effects of fatty acids on bovine oocyte quality (Fouladi-Nashta et al. 2007). To investigate this further, the effects of short-term feeding of three dietary sources of fatty acids (supplying predominantly either palmitic and oleic, linoleic or linolenic acids) on developmental potential of oocytes were compared in lactating high yielding dairy cows. Twelve Holstein dairy cows were allocated to 3 groups. Each group received 3 diets containing rumen inert fat (RIF), soyabean or linseed as the main fatty acid source for three periods of 25 days in a Latin-square design. Within each period, after two weeks of feeding, oocytes were collected from each cow by ovum pick up (OPU), which was repeated a further 3 times with 3 - 4 day intervals between OPUs. Significant differences were observed in profiles of fatty acids in plasma and milk reflecting differences in the dietary sources of fatty acids. Cleavage rate of oocytes was higher when cows were fed RIF (P<0.05) than when they were fed either soya or linseed. Blastocysts produced when cows were fed RIF tended to have a higher ratio of inner cell mass to trophectoderm cells and a lower proportion of apoptotic cells in the trophectoderm. It is concluded that saturated and monounsaturated fatty acids, supplied from RIF, improve both the developmental potential of oocytes, as measured by the increase in the cleavage rate, and the quality of embryos as compared with polyunsaturated fatty acid sources. Fouladi-Nashta et al. (2007) Biol. Reprod. 77:9-17.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 189 P490 Use of immunomodulation in susceptible mares to clear an experimentally induced endometritis effect on pro-inflammatory cytokines: IL-1β, IL-6 and IL-8 mRNA expression Fumuso, E*1; Giguère, S2; Rogan, D4, Rivulgo, V1; Wade, J3; Rodriguez, E1; and Sánchez Bruni S1 1Faculty of Veterinary Medicine, UNCPBA, Tandil, Argentina 7000, Argentina; 2Coll.Vet. Med. Gainesville, FL, USA; 3Ireland; 4Bioniche Life Sciences Inc, Belleville, Ontario, Canada The effect of an immunomodulator, Mycobacterial Cell Wall Extract (MCWE), on IL-1β; IL-6 and IL-8 mRNA expression was studied in mares susceptible to endometritis after experimental uterine infection with Streptococcus zooepidemicus. Thirty endometritis susceptible mares, based on the presence of uterine fluid during both diestrus and estrus, were inoculated with 5 × 106 CFU of S. zooepidemicus on day 1 of estrus. Twenty-four hours later, the progression of infection was evaluated by ultrasonography, bacteriology, exfoliative cytology, and uterine biopsy. Forty eight hours after inoculation and confirmation of uterine infection, mares were randomly assigned to one of four unbalanced experimental groups in order to receive: Group A: 1500 μg total dose of MCWE (Settle™) by intrauterine route (IU) (n = 10), Group B: the same treatment as Group A, but using the intravenous (IV) route (n = 10), Group C: Distilled water as placebo (PL) IU (n = 5) and the Group D: was treated as Group C using the IV route (n = 5). Endometrial biopsies were taken when infection was confirmed (day 0), at ovulation (day 3) and 7 days post-ovulation (day 10) for measurement IL-1β; IL-6 and IL-8 mRNA expression. Total RNA was isolated, treated with DNAse-I and cDNA was synthesized. Relative quantitation of mRNA expression (RmRNA) was determined by real-time PCR. The effect of treatment (MCWE vs PL), administration route (IU vs IV), and day of sampling (0, 3, 10) on RmRNA mixed model analysis of a split-unit experiment with repeated observations. There was no effect of route of administration on RmRNA. As a result Groups A & B (treated) and groups C & D (PL), were combined in the final analysis. There were no significant differences in RmRNA between PL and treated groups on day 0. On days 3 and 10, MCWE treated mares had significantly lower IL-1β, IL-6 and IL-8 mRNA expression than mares in the PL group. We previously demonstrated the effect of immunomodulation after AI in susceptible mares to post breeding endometritis (Fumuso et al. 2003, 2007); this effect was confirmed in the present study through experimentally induced endometritis. Results indicate that MCWE exerts an anti-inflammatory effect on cytokine RmRNA that may contribute to resolution of endometritis caused by S. zooepidemicus in mares. P491 The addition of malondialdehyde during in vitro maturation of bovine oocytes improves subsequent cleavage rate after in vitro fertilization Garcia-Ispierto, I1*, Leroy, JLMR2; Lopez-Béjar, M1; López-Gatius, F3; De Clercq, JPB2; Andries, S2; Goovaerts, IGF2 ; Bols, PEJ2 1Department of Animal Health and Anatomy, Autonomous University of Barcelona, Spain; 2Laboratory of Veterinary Physiology, Department of Veterinary Sciences, University of Antwerp, Belgium; 3Department of Animal Production, University of Lleida, Spain Introduction Oxidative stress has been related to heat shock on embryos and has been considered to play a critical role in the success of in vitro fertilization protocols. Malondialdehyde (MDA) is the major endogenous product of lipid peroxidation due to oxidative stress. It has been demonstrated that MDA can have toxic effects on bacterial and mammalian cells. Oxidative stress is high during the postpartum period and this can be exacerbated by heat stress during the hot seasons. Objective The aim of the current study was to apply MDA combined with high temperature conditions during in vitro maturation of oocytes to evaluate possible effects on oocyte developmental competence.

Methods Bovine ovaries were obtained from the slaughterhouse. A total of 1209 immature Grade I cumulus–oocyte complexes (COCs) were aspirated from follicles 2–6mm of diameter. COCs were cultured in groups of 50 for 24 h in 500µl serum-free maturation medium (20 ng/ml mEGF) with or without MDA (8µM) under normal (38.5ºC) or high temperature (41ºC) conditions in a humidified 5% CO2 incubator. Four treatment groups were used during maturation: control (C), MDA (M), high temperature (T) and MDA plus high temperature (TM). After IVM, all oocytes were routinely fertilized by co-incubation per 100 with spermatozoa (frozen bull semen selected by percoll gradient) at a final concentration of 106 sperm cells/ml for 20 h at 38.5ºC in fertilization medium, in a humidified 5% CO2 incubator. Presumptive zygotes were cultured per 25 in 500µl droplets of modified SOF medium with 5% FCS, under mineral oil for 8 days. Results Binary logistic regression procedures were performed using cleavage and blastocysts rate (blastocysts per oocytes matured) as dependent variable, and treatment and replicate as independent variables (SPSS 16.0). Cleavage and blastocyst rate were 70.5+7.5 and 29.4+3.1 in C, 80.6+8.5 and 35.5+11.3 in M, 40.8+12.9 and 4.9+3.4 in T, and 39.3+3.4 and 7.6+7.8 in TM groups, respectively. Based on the odds ratio the cleavage rate decreases in the high temperature group (by a factor of 0.27, P<0.001) and in the MDA plus temperature group (0.34, P<0.001), and increases in MDA group (1.78, P=0.01) (using control group as reference). No significant difference was found for the blastocyst rates. Conclusion This preliminary report confirms that maturation at high temperature conditions is harmful for the oocyte’s developmental capacity. Furthermore addition of MDA to the IVM medium can increase cleavage rate, although this stimulatory effect could not be observed in heat shocked oocytes. P492 Effect of oocyte caffeine and sperm Triton X-100 treatments on male pronucleus formation of ICSI porcine oocytes Silvestre, MA1,2, Garcia-Rosello, E3*, Salvador, I2, Garcia-Mengual, E2, Alfonso, J4, Cebrian-Serrano, A2 1Centro de Tecnologia Animal, Instituto Valenciano de Investigaciones Agrarias, Spain; 2CITA, Instituto Valenciano de Investigaciones Agrarias, Spain; 3Universidad CEU, Cardenal Herrera, Facultad de Ciencias Experimentales y de la Salud (Veterinaria) Medicina y Cirugía Animal, Spain; 4IMER Valencia, Spain In pigs, rate of blastocyst obtained following intracytoplasmic sperm injection (ICSI) remains low. One of the problems is the failure or delay of decondensation of sperm nucleus into functional male pronucleus (Lee et al., 2003; Biol Reprod 68:1341-7). An adequate exposure of sperm nucleus to oocyte cytoplasmic compounds is needed to correct male pronucleus formation. In this work, we analyze the effect of Triton X-100 (TX) sperm pretreatment combined or not with a caffeine treatment of oocytes and zygotes on pronuclear formation following ICSI. The addition of caffeine into the culture medium suppresses Myt1/Wee1 activity, increasing the MPF activity (Kikuchi et al., 2002; Cloning Stem Cells 4:211-222). Oocytes were in vitro matured for 45h in M199 supplemented with 0.1% PVA, 0.57 mM cysteine, 10 ng/mL EGF, antibiotics and hormones for the first 22h maturation period (0.1 IU/ml recombinant human-FSH and -LH). TX Sperm pretreatment was performed as follows; upper fraction of control semen (with higher motile sperm rate) was put aside and added 0.1% TX. Semen with TX was vortexed and washed. Then, semen was centrifuged for 5 min and pellet was resuspended in manipulating medium. We study the effect of the presence of 5 mM caffeine (Sigma, C8960) on the manipulating and culture medium 2h after sperm injection on pronuclear formation. Caffeine effect was studied in combination with a TX sperm pretreatment on a complete 2x2 experimental design. To study pronuclear formation, at 18h after ICSI, presumptive zygotes were fixed and stained in absolute ethanol with bisbenzimide, and pronuclei were scored under an epifluorescence microscope. Injected oocytes were classified into 5 groups as follows: Activated indicates oocytes resuming meiosis, with no metaphase plate visible and at least with one pronucleus; oocytes

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 190 P o s t e r A b s t r a c t s with 2 pronuclei and no visible sperm; oocytes with 2 pronuclei and one sperm; oocytes with 1 pronucleus and one sperm; others, oocytes with other nuclear structures, such as more than 2 pronuclei or no analyzable oocytes. Oocytes injected with TX sperm pretreated and caffeine during and after micromanipulation had a lower oocyte activation rate than the other experimental groups (25.4% vs. 54.4-69.1%; P<0.05). Also, oocytes injected with sperm pretreated with TX and caffeine had difficulties in decondensing sperm nuclei on male pronucleus, showing a higher rate of female pronucleus plus intact sperm than TX group (62.7% vs. 29.7% from activated oocytes, respectively; P<0.05). This work was supported by INIA (RTA2007-0110). P493 Eeffect of three different cumulus cell coculture conditions on the developmental competence during single bovine embryo culture in vitro Goovaerts, IGF1*; Leroy, JLMR 1; Van Soom, A 2; Andries, S 1; De Clercq, JPB1; Bols, PEJ1

1Laboratory of Veterinary Physiology, University of Antwerp, Belgium; 2Department of Reproduction, Obstetrics and, Herd Health, Faculty of Veterinary Medicine, Ghent University, Belgium Introduction An in vitro production system, in which a single oocyte can be followed from the moment of retrieval up to the blastocyst stage, would be a valuable tool for studies linking developmental competence and embryo metabolism to immature oocyte quality and follicular environment. Earlier studies revealed that adding cumulus cells (CC) during IVC enhanced individual development (Goovaerts et al. 2007 Reprod. Dom. Anim., 42 suppl. 2, 73-74). The present study aimed to test the effect of three different CC coculture conditions on the developmental competence of individually cultured zygotes. Methods A total of 1033 cumulus oocytes complexes from slaughterhouse ovaries (6 replicates) were routinely matured and fertilized in groups and then assigned to 4 culture treatments (SOF + 5% FCS under oil). In treatment 1, one zygote was cultured in 20 µL of medium in which a monolayer of matured CC was grown for 5 days. In treatment 2, each zygote was cultured in 20 µL of medium to which CC from the fertilization medium were added. In treatment 3, one zygote was cultured in 20 µL of CC conditioned medium, obtained after contact with a CC monolayer for 5 days. In treatment 4, regular group culture (25 zygotes in 50 µL) was performed as a control. Cleavage, blastocyst and hatching rates were assessed 2, 8 and 10 days p.i. respectively and analysed with binary logistic regression (SPSS 13.0). To assess cell number, part of day 8 blastocysts was stained with Hoechst 33342. Because of the low blastocyst rate, cell numbers of treatment 3 blastocysts were not included in the statistical analysis (mixed model ANOVA, SPSS 13.0). Results No significant differences in cleavage and blastocyst rates between treatment 1 (74.1% and 38.2% respectively) or treatment 2 (69.9% and 31.9%), and the group culture (73.2% and 36.4%) could be found. Only the cleavage and blastocyst rates of treatment 3 (59.0% and 6.3%) were significantly lower than those of the control (p<0.05). Hatching rates did not show a significant difference between the different culture treatments. Moreover, no significant difference in cell numbers (± SEM) could be found between treatment 1 (133.4 ± 9.16), treatment 2 (137.3 ± 8.00) and the control (155.1 ± 7.26). Conclusion Adding autologuous CC from the fertilization medium or culturing on a CC monolayer, can be used as a valuable alternative to provide a satisfying number of good quality blastocysts following individual embryo culture in vitro. Cumulus cell conditioned medium does not enhance single embryo development sufficiently.

P494 In vitro production of minipig cloned embryos by interbreed somatic cell nuclear transfer Gupta, MK*; Uhm, SJ; Lee, HT Department of Animal Biotechnology, Konkuk University, Seoul 143 701, South Korea Somatic cell nuclear transfer (SCNT) is a potential tool for production of transgenically modified minipigs for xenotransplantation of solid organs into human. However, limited availability and high cost of minipig oocytes imposes a major barrier to minipig SCNT. This study evaluated the option of producing cloned minipig embryos by interbreed SCNT of minipig somatic cell karyoplast into commercial Landrace pig cytoplast. Commercial Landrace pig oocytes, retrieved from abattoir derived ovaries, were matured in vitro (in TCM 199 medium supplemented with 10% porcine follicular fluid, 22 µg/ml sodium pyruvate, 0.56 mM Cysteine, 0.5 µg/ml FSH and 1 µg/ml Estradiol 17β) and nuclear transferred with commercial Landrace pig (n= 196) or minipig (n= 192) donor cells or were subjected to IVF (n=443) or parthenogenesis (n= 354) by electric activation (by single DC pulse of 1.36 kV/cm for 30 µsec) as controls. Embryos were cultured in NCSU 23 medium supplemented with 0.4% BSA. Results showed that the blastocysts rate of reconstructed embryos did not differ between minipig (12.6 ±2.9%) and commercial Landrace pig donor cells (15.5±2.2%). However, fusion efficiency of minipig donor cells with commercial Landrace pig recipient cytoplast was significantly lower (P<0.05) than those achieved with commercial Landrace pig donor cells (29.6±0.8 vs. 65.0±4.9%). Changes in pulse (1 to 3), duration (30 to 80 µsec), and amplitude of electric strength (1.0 to 2.0 kV/cm) and calcium concentration (0.0 to 1.0 mM) in fusion medium (0.3 M Mannitol supplemented with 0.1 mM MgSO4 and 0.1% PVA) used for electro-fusion of minipig donor cells with enucleated cytoplast (n= 1689) showed that changing the fusion parameters (a single DC pulse of 1.8 kV/cm for 30 µsec) could improve the fusion efficiency without compromising their developmental ability (P>0.05). Analysis of chromatin configuration of cloned embryos (n= 144) by fluorescent nuclear staining revealed that commercial Landrace pig recipient cytoplast could efficiently remodel the minipig donor nucleus similar to those of Landrace pig nucleus. Immunostaining of cloned embryos (n= 180) for nuclear histone protein acetylation at H3K9 residue (Ac-H3K9) further showed that the pattern of changes in Ac-H3K9 were similar in cloned embryos produced by nuclear transfer of minipig donor cells or commercial Landrace pig donor cells. These data suggest that commercial Landrace pig cytoplast could efficiently reprogram the minipig donor nucleus. P495 Influence of L-Carnitine on the apoptosis of granulose cells and the meiotic competence of porcine growing oocytes Hashimoto, S*, Miyata, Y; Yamanaka, M; Morimoto, Y IVF Namba Clinic, IVF Osaka Clinic The mammalian ovary contains a large number of oocytes in various growth stages. Nevertheless, most of these oocytes undergo atresia, and only a few oocytes obtain meiotic competence. Recently, we have established in vitro culture system of growing porcine oocytes (Hashimoto et al., 2007). However, all oocytes cannot necessarily grow in vitro. L-Carnitine (L-Car) plays an important role for ATP production from fatty acids by beta-oxidation as a transportation carrier of long chain fatty acids into mitochondrial inner membrane. In this study, we assessed effects of L-Car on the meiotic maturation of in vitro grown oocytes and on the apoptosis of granulose cells surrounding growing oocytes. Porcine oocyte granulose cell complexes (OGCs) were recovered from follicles with diameter of 300-700 μm (early antral follicles) using scalpels, and intact oocytes with intact granulosa cells were selected and randomly assigned to each treatment. OGCs were cultured for 14 days in the medium (containing 2% polyvynilpyrrolidone, estradiol-17β, ascorbic acid, Insulin, sodium selenite, transferring and BSA, Hashimoto et al.,

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 191 2007) supplemented with 0, 0.002, 0.02, and 0.2% (w/v) L-Car. In vitro maturation of in vitro grown oocytes was carried out for 44 hours following the culture. Apoptosis indexes of granulose cells cultured in 0 or 0.02 % (w/v) L-Car were assessed using In situ Cell Detection Kit (Roche Diagnostics, Tokyo). To assess the cytchrome c oxidase activity on electron microscopy, the ultrathin sections of the in vitro grown and in vivo grown OGCs were observed by TEM. The proportions of oocytes survived, GVBD and matured were calculated based on the number of OGCs cultured. Data were analyzed by Fisher’s PLSD test following ANOVA. Proportions of apoptotic cells were compared by t test. When OGCs were cultured in 0.02% L-Car, proportions of oocytes survived after 14-days culture, GVBD and matured after IVM were 43%, 32%, and 25%, respectively. These values were significantly higher (P<0.05) than those cultured in 0% (33%, 23%, and 16%, respectively) and 0.002% L-Car (29%, 16%, and 15%, respectively). The proportion of apoptotic cells cultured in 0.02% L-Car (8.6%) was lower (P<0.05) than that cultured in 0% (16.1%). The cytchrome c oxidase activities in mitochondria were observed in in vitro grown oocytes similarly in in vivo oocytes. Results of the present study suggested L-Car improves the meiotic competence of porcine growing oocytes by holdback of apoptosis of granulose cells. P496 Effect of the air temperature on the ET efficiency at dairy cattle Hegedűšová, Z1*, Holasek, R1, Slezakova, M1, Dufek, A1, Kubica, J2 1Dep. of Breeding and Reproduction, Research Institute for Cattle Breeding, Ltd., Rapotín, Czech Republic; 2Dep. of Breeding and Reproduction, Agrovyzkum, Ltd. Rapotín, Czech Republic The aim of this work was to evaluate the climatic factors, especially the air temperature at the time of the flushing and transfer on the duality of the embryo and conception after transfer of fresh and frozen embryo during monitored years. Purebred dams of dairy breeds (high production milk cow of Holstein, Czech spotted cattle) dams were used as donors during years 2005 to 2007. The superovulatory treatment included synchronization of the estrus cycle with one application of the PGF2alfa in a group of animals with known estrus cycle. The following day of estrus was marked as 0. Donors had been treated on the 9 – 11 day of estrus cycle with p-FSH every morning and evening for 4 days. Other application of analog of the PGF2alfa was curried out on the third day of stimulation. Insemination with three insemination doses of particular bulls was on the 5th and the 6th day of super stimulation treatment. Embryo recovery was curried out on the 7th day after insemination. The recipients were synchronized with application of the PGF2alfa and on the 7th day after estrus embryo transfer was carried out. Effect of temperature at 174 embryo flushing and 1073 transfers was analyzed using the GLM assuming quasipoisson and quasibinomial error distribution by R software. We evaluated the profit, embryo quality and pregnancy after transfer of fresh and frozen embryos at the air temperatures shown below. The intervals were divided subsequently: A) from -5 to +5°C B) from +6 to +15°C C) from 16 to 20 °C D) over 20°C In the temperature interval -5 to +5°C the lowest number of suitable embryos 4,15±3,88 was obtained. The highest number of suitable embryos and embryos in total was found in the interval C (6,16±6,76 suitable embryos and 9,89 ± 9,35 in total)). The effect of temperature was not significant p=0.2719. The lowest percentage of conception was detected in the interval A (34,7%) and the highest percentage of conception was detected in the interval C (65,31%). The temperature effect was significant p<0.001. From the results is evident the significant influence of the external temperature on the efficiency of the carrying out the embryo transfer. These results can be useful for commercial organizations to optimize embryo recoveries when realizing breeding programs. Supported by MEYS CZ: 2678846201, NAZV QF3024, NAZV 1B44034.

P497 Effects of trichostatin A on gene expression and in-vitro development of bovine embryos cloned from transfected fibroblasts carrying a luciferase gene Iwamoto, D1*; Kishigami, S1; Taniguchi, S1; Matsumoto, K1; Hosoi, Y1; Iritani, A1; Wakayama, T2; Saeki, K1 1Department of Genetic Engineering, Kinki University, Japan; 2Laboratory for Genomic Reprogramming, RIKEN-Center for Developmental Biology, Japan Introduction Recently, the efficiency of full-term development of somatic cloned mouse embryos was significantly increased by treatment with trichostatin A (TSA), an inhibitor of histone deacetylase. The TSA treatment has also improved blastocyst development of cloned bovine and porcine embryos. In this study, we examined the effects of TSA on gene expression at the 4- to 8-cell stage of cloned bovine embryos and their subsequent the blastocyst development. Methods An expression vector, pbeta-act/luc+/IRES/EGFP (neor), was transfected into bovine fibroblasts using a transfection reagent, GeneJammer. We obtained stably transfected bovine cells carrying a luciferase gene. The transfected cells were cultured under serum deprivation and used as donor cells. The cells were electrofused with bovine enucleated matured oocytes, and activated with a calcium ionophore and cycloheximide. The cloned embryos were exposed to 0 (control) and 50 nM TSA from the start of activation to 48 hours post-activation (hpa) and then cultured in mSOFM. At 60 hpa, the luciferase activity (luminescence) in each blastomere of 4- to 8-cell embryos was detected with an imaging photon counter. The embryos were then classified as being whole-LUC, mosaic-LUC, or negative depending on whether all, some or no blastomeres were luminescent, respectively. The embryos were individually cultured until 168 hpa to assess the blastocyst development. Results At 60 hpa, 59% (62/105) of embryos in the TSA treatment group, and 53% (57/109) of embryos in the control group developed to the 4- to 8-cell stage. In the TSA treatment group, the rates of whole-LUC, mosaic-LUC, and negative embryos were 52%, 33%, and 15%, and the blastocyst rates were 40%, 5%, and 0%, respectively. In the control group, the rates of whole-LUC, mosaic-LUC, and negative embryos were 42%, 46%, and 12%, and the blastocyst rates were 21%, 8%, and 0%, respectively. Within the TSA treatment group, the rate of whole-LUC embryos was higher than that of mosaic-LUC embryos (52% vs 33%, P<0.05). However, within the control group, the rate of whole-LUC embryos was the same as that of mosaic-LUC embryos (42% vs 46%, P>0.05). For TSA treatment group, the blastocyst rates of whole-LUC embryos were much higher than that of negative embryos (40% vs 0%, P<0.01). Similar results were obtained for the control group (21% vs 0%, P<0.01). Conclusion These data suggest that TSA treatment increased the rate of whole-LUC embryos at the 4- to 8-cell stage, resulting in improvement of the blastocyst development. Supported by Wakayama CREATE, JST. P498 Viability and DNA fragmentation of mouse frozen bone marrow cells without cryoprotectant and its availability for nuclear donor in somatic cell nuclear transfer Kato, H*1, Nakao, A2, Nishiwaki, M2, Anzai, M1, Mitani, T1, Iritani, A1 1Institute of Advanced Technology, Kinki University, Kainan, Wakayama, 642-0017, Japan; 2Department of Biology-Oriented Science and Technology, Kinki University, Kinokawa, Wakayama, 649-6493, Japan Frozen Animal cells without cryoprotectant would have serious damage in membrane and DNA strand. If the cell from animal sample frozen without cryoprotectant could be useful for the nuclear donor cell in somatic cell nuclear transfer (SCNT), there are potentially many candidates to reproduce individual animals by SCNT. In this study, we examined the possible use of frozen mouse bone marrow cell without cryoprotectant for the nuclear donor cell in SCNT. Collected thighbones from B6C3F1 mice were frozen in either a –25oC or –80oC freezer for more than one month and thawed at 37oC.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 192 P o s t e r A b s t r a c t s Bone marrow cells were collected by washing the bone cavity with saline. The cell viability was examined by trypan blue vital staining and the DNA fragmentation was examined by comet assay. The procedure of SCNT was performed as previously reported (Wakayama et al. 1998 Nature 394, 369-374) with a piezo-actuated micromanipulator system. In SCNT experiment, 4 groups of mouse cells (fresh bone marrow cells, bone marrow cells frozen either at –25oC or at –80oC and fresh cumulus cells) were used as the nuclear donors. After nuclear injection, the nuclear dynamics of SCNT embryos in each donor cell group was observed using DAPI staining and a fluorescent microscope at 0, 1, 7 and 24 h after nuclear injection. Data were analyzed by Student′s t-test. The cell viability after thawing were 85.4%, 6.4% and 13.4% in fresh, frozen at –25oC and frozen at –80oC bone marrow cells, respectively. There was severe DNA fragmentation in both frozen-thawed bone marrow cells. At 7 h after nuclear injection, SCNT embryos injected with frozen bone marrow cells, regardless of freezing temperature, had more single pro-nuclei (67%; 54/81, P<0.05) than SCNT embryos injected with either fresh bone marrow cells (36%; 26/73) or cumulus cells (28%; 67/236). At 24 h after nuclear injection, fewer SCNT embryos injected with bone marrow cells, either frozen or fresh, developed to the 2-cell stage (fresh: 11%; 6/56, frozen at -25°C: 21%; 5/24, frozen at -80°C: 20%; 10/49, respectively) than SCNT embryos injected with cumulus cells (58%; 185/319, P<0.05). There was no difference in the embryonic development to 2-cell stage among SCNT embryos injected fresh and frozen bone marrow cells. Because still some SCNT embryos injected frozen bone marrow cell without cryoprotectant developed to 2-cell stage, there is a little possibility to use such cell for the nuclear donor cell in SCNT. This work was supported by a Grant-in-Aid for the 21st Century Center of Excellence Program of the MEXT, Japan. P499 Role of Mitochondrial Genome during In Vitro Maturation of Oocytes Lee, HT*; Das, ZC; Uhm, SJ; Gupta, MK Department of Animal Biotechnology, Konkuk University, Seoul 143 701, South Korea Mitochondrial DNA (mtDNA) undergoes massive replication at the time of entry and arrest at meiotic stage of oocytes. The mtDNA number thereafter, remains remarkably stable throughout preimplantation development to blastocyst stage until mtDNA replication is initiated post-implantation. However, role of transcriptional and translational activity of mitochondrial genome during maturation of oocytes is not known. This study therefore, evaluated the role of mtDNA genome during in vitro maturation (IVM) of porcine oocytes using specific inhibitors of mtDNA replication (2’ 3’ dideoxycytidine; ddc), transcription (ethidium bromide; EtBr) and translation (D-Chloramphenicol; ChlD) added to IVM medium. Results showed that specific inhibition of mtDNA replication did not influence the nuclear maturation of porcine oocytes in terms of cumulus expansion, polar body extrusion, and second metaphase plate formation. However, post-fertilization development of such oocytes were lower (P<0.05) than those of controls (15.1±0.2 vs. 25.2±0.5%). On the contrary, inhibition of mtDNA transcription significantly (P<0.05) reduced the nuclear maturation of oocytes (44.5±1.6 vs. 80.2±1.6%). Co-treatment with pyruvic acid and uridine rescued the EtBr-treated oocytes suggesting that EtBr-treated oocytes were pyrimidine auxotroph due to deficiency of the respiratory chain-dependent enzymes. The inhibitory effects of EtBr were also reversible as they could cleave and develop to blastocyst at a rate similar to those of control oocytes following in vitro fertilization. Treatment of oocytes with ChlD inhibited both nuclear maturation and subsequent post-fertilization development of oocytes (P<0.05). In conclusion, these data suggests that mtDNA replication during IVM may not be required for nuclear maturation of oocytes but is important for post-fertilization development. On the other hand, mtDNA transcription and translation could be dispensed for nuclear maturation of oocytes provided an alternate source of energy production is available.

P500 Effect of different combinations of cryoprotectants on in vitro maturation of immature buffalo (Bubalus bubalis) oocytes vitrified by straw and open pulled straw methods Mahmoud, K* Animal Reproduction & A.I, National Research Center, Egypt This study was designed to evaluate the effects of different combinations of cryoprotectants on the ability of vitrified immature buffalo oocytes to undergo in vitro maturation. Straw and open pulled straw methods for vitrification of oocytes at the germinal vesicle stage also were compared. Cumulus oocyte complexes were harvested from ovaries obtained from a local slaughterhouse by aspirating the visible follicles. The immature oocytes were divided into three groups according to whether they were: (1) left untreated (control); (2) exposed to cryoprotectant agents (CPAs); or (3) cryopreserved by straw and open-pulled straw (OPS) vitrification methods. The vitrification solution (VS) consisted of 6 M ethylene glycol (EG) as the standard, control vitrification treatment, and this was compared with 3 M EG + 3 M dimethyl sulfoxide (DMSO), 3 M EG + 3 M glycerol, and 3 M DMSO + 3 M glycerol. The cryoprotectant was added in 2 steps, using half the final concentration for the first step. After warming, oocyte samples were matured by standard methods and then fixed and stained for nuclear evaluation. Rates of MII oocytes were lower (54.3% in EG, 47.5% in EG + DMSO, 36.8% in EG + glycerol and 29.9% in DMSO + glycerol; P < 0.05- 0.01) than control group (79.8 %). The survival rate decreased significantly (P < 0.01) in treatments containing glycerol with both straw and OPS methods. The percentages of oocytes reaching telophase I or metaphase-II stages were lower in oocytes cryopreserved in all the treatments of cryoprotectant compared with control. However, among the vitrified oocytes, the highest maturation rate was seen in oocytes vitrified in EG + DMSO (42.1 % for the straw and 40.8% for the OPS method). Oocytes cryopreserved in all groups with glycerol had an overall low maturation rate. However, the differences were not significant between oocytes vitrified by the straw method in EG + glycerol (18.8 %) and DMSO + glycerol (18.7 %) and the OPS method in EG + glycerol (19.8 %) and DMSO + glycerol (17.0 %). There were no significant differences in recovery rate of morphologically normal oocytes or maturation rate among any treatments between straw and OPS methods. It can be concluded that the function of oocytes was severely affected by both vitrification and exposure to cryoprotectant; the best combination of cryoprotectants was EG+DMSO for vitrification of immature buffalo oocytes using either straw or OPS methods. P501 The effect of albendazole administration on the concentration of ovarian steroids in the follicular fluid and the maturation of oocytes in the ewe Mamali, P1,2*; Samartzi, F2; Batzias, GC3; Theodosiadou, E4; Vainas, E2; Goulas, P5; Belibasaki, S2; Saratsis, F1 1Clinic of Productive Animal Medicine, Faculty of Veterinary Medicine, Aristotle University of Thessaloniki, Greece; 2Veterinary Research Institute, National Agricultural Research Foundation, Thessaloniki, Greece; 3Laboratory of Veterinary Pharmacology, Faculty of Veterinary Medicine, Aristotle University of Thessaloniki, Greece; 4Laboratory of Physiology, Faculty of Veterinary Medicine, University of Thessaly, Karditsa, Greece; 5Department of Animal Production, Technological Educational Institution, Larissa, Greece Introduction Benzimidazole anthelminthics are widely used in veterinary and human medicine. Recent studies indicated that some of them are potentially endocrine disruptors. Their action disturbs endocrine and reproductive function as they interfere with steroid hormone activity. Purpose of this study was to investigate the possible effect of albendazole, which belongs to benzimidazoles, on the concentration of ovarian steroids in the follicular fluid and the maturation of oocytes in the ewe. Materials and Methods The oestrus cycles of 16 Chios ewes were synchronized using subcutaneous implants of progesterone (375mg)

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 193 and eCG (500IU). Albendazole was administered orally to eight ewes, at the beginning of oestrus, in a single dose of 11.5 mg/kg b.w., (group A), while the other eight ewes were used as controls (group C). At the end of oestrus all non-atretic 2-8 mm diameter follicles were aspirated. Grade A cumulus oocyte complexes were identified under stereoscope and cultured for 24 hours in Modified Parker’s Medium at 38.5 ºC, 5% CO2 in humidified air. Nuclear maturation was assessed microscopically, after orcein (2%) staining. Albendazole was detected in follicular fluid using HPLC. Progesterone and 17-β estradiol concentrations in follicular fluid were assessed using RIA. Data were analyzed using independent T-test and Chi square test. Results Albendazole metabolites were detected in all follicular fluid samples. Mean progesterone concentration in the follicular fluid did not differ significantly (p>0.05) between groups (group A: 0.028±0.021 ng/μl and group C: 0.073±0.060 ng/μl). Mean 17-β estradiol concentration in the follicular fluid of group A (26.97±24.42 pg/μl) was significantly lower (p<0,05) than that of group C (104.11±97.20 pg/μl). Nuclear maturation rate (mature oocytes / incubated oocytes) of the oocytes in group A (58.82%) did not differ significantly (p>0.05) compared to the rate of maturation in group C (65.71%). Conclusions Oral administration of albendazole affects steroid hormone balance in follicular fluid of ewes but does not seem to affect significantly in vitro nuclear maturation of ovine oocytes. Further research is necessary to elucidate whether the detected steroid hormone imbalance could affect cytoplasmic maturation of oocytes and, consequently, their fertilization ability and developmental competence. P502 Ultrastructural characteristics of non-matured and in vitro matured oocytes collected from follicular, luteal and inactive ovaries of domestic cat during non-breeding season Martins, LR1*, Fernandes, CB1, Minto, BW2, Landim-Alvarenga, FC1, Lopes, MD1 1Animal Reproduction, University of State of Sao Paulo, Brazil; 2Small Animal Surgery, University of State of Sao Paulo, Brazil Objective The aim of this experiment is to describe the ultrastructural characteristics of non-matured (NMo) and in vitro matured oocytes (IVMo) recovered from queen during the non-breeding season (January, February and March) in southeast of Brazil. Methods Transmission electronic microscopy (TEM) was performed in NMo immediately after harvest and IVMo were matured for 36 hrs before TEM. Specimens were divided into oocytes from inactive ovaries (NMI/IVMI); follicular ovaries (NMF/IVMF) and luteal ovaries (NML/IVML). Results NMI and NMF presented a narrow perivitelline space covered with microvilli. On the other hand, microvilli were less evident in NML. Cumulus cell projections penetrate the ZP forming junctional complexes with the oolemma in all NMo. In the cytoplasm of NMI lipid droplets and vesicles were evenly distributed in the ooplasm except for the cortical zone, were clusters of mitochondria were observed. NML was also characterized by peripheral mitochondrial clusters, but greater clusters could also be seen centrally in the cytoplasm. Differently, NMF were characterized by evenly distributed mitochondria within the ooplasma. In NMI and NML cortical granules were seen only in the peripheral area of the cytoplasm, but the electron density of these organelles appeared to be lower and Golgi complex were often seen in association with these granules. The density of cortical granules in NMF was higher but they were also present in central regions of the ooplasm. In all NMo a well developed Golgi complex was observed. In IVMo mitochondria clusters are no longer observed and these organelles presented an even distribution towards the ooplasm. Cortical granules were present in the peripheral region of IVMI, IVMF and IVML oocytes, although a small number could still be observed in central region of the ooplasm of IVMF. The perivitelinic space was more proeminent in IVMo. However the amount of microvilly was similar with the one observed in NMI. Granulosa cell projections were no longer seen.

Conclusion These results indicate that in vitro maturation was efficient in inducing the morphological changes necessary for cytoplasmic maturation of cat oocytes, independently of the ovarian status. P503 Superovulation fsh-p protocol in sarda ewes without progestagen synchronization treatment Mayorga, I.1,2*, Masia, F.2, Mara, L.2, Chessa, F.2, Casu, S.2, Juyena, N.1,2, Dattena, M.2 1Department of Veterinary Clinical Sciences, University of Padova, 35100 Padova, Italy; 2DIRPA-AGRIS Sardinia, 07040 Olmedo, Italy The aim of this study was to evaluate the effect of superovulation response to FSH-p treatment without the use of intravaginal progestagen sponges. Twenty animals were divided into 2 groups such as single sponge (SS) 40 mg FGA for 12 days (n=10) and natural oestrus (NT) (n=10). Superovulatory treatment per sheep consisted of 350 I.U. of porcine FSH (Folltropin®, Bioniche Animal Health, Ireland) administered in eight (i.m.) decreasing doses at every 12 h (2 ml x 2, 1.5 ml x 2, 1.0 ml x 2 and 0.5 ml x 2) starting 48 h before sponge removal in the SS group and on day 4 after onset of oestrus (day 0) in the NT group. A single dose of 125 µg (i.m) cloprostenol was injected on day 6 after oestrus detection in the NT group to induce ovulation. Ewes were naturally mated 24 h after sponge removal in SS group and after cloprostenol injection in the NT group. Seven days after mating, inguinal laparotomy was performed and the number of corpora lutea (CL) was recorded. Embryos were recovered by flushing each uterine horn according to the technique of Tervit and Havik (1976) with some modifications. The recovered embryos were evaluated according to their stage of development and their quality was scored on a scale of 1 to 3 (Niemann et al., 1981). Embryos with a score of 1 were considered of high quality. Data on number of corpora lutea (CL), embryos recovered (ER), embryos fertilized (EF), and high quality embryos (EQ1) per ewe were analysed by ANOVA (GLM SAS procedure). Length of treatment for each group was also assessed. Data on recovery (RR), fertility (FR) and embryo quality (Q1R) rates per treatment were analysed by a Chi Square analysis. Statistical differences were founded between SS and NT groups only in the number of CL/ewe (7 ±3.2 vs 10.7± 3.4) (p<0.05), while ER/ewe (5.6 ± 3.2 vs 7.2 ± 3.9), EF/ewe ( 4.5 ± 3.5 vs 7.2 ± 3.9 ), EQ1/ewe (4 ± 3.0 vs 6.2 ±3.8 ) did not show statistical differences. Moreover, statistical differences were found between groups only in FR ( 80% vs 100% ) (p<0.05), while RR ( 80% vs 67%) and Q1R (88% vs 86%) did not show statistical differences. In conclusion it is possible to superovulate ewes avoiding the use of intravaginal sponge during the FSH-p treatment and some variables (CL/ewe; FR%) seem to be improved as well as the length of the treatment is reduced (20 days vs 14 days). P504 Minimum number of motile frozen-thawed spermatozoa required for successful in vitro fertilization of cat oocytes Merlo, B*; Iacono, E; Tirocchi, F; Zambelli, D Faculty of Veterinary Medicine, University of Bologna, Italy Introduction The optimal number of spermatozoa required for fertilization is fundamental for the outcome of the IVF in an embryo production programme. In the cat, the sperm concentration used for IVF is very variable in different laboratories (from 0.2 to 2 x106 motile spermatozoa (msp)/ml) regardless of the source of spermatozoa (epididymal vs ejaculated or fresh vs frozen). The objective of this study was to determine the minimum number of spermatozoa required for a successfull IVF using cat frozen-thawed ejaculated spermatozoa. Methods Semen from 4 tomcats was collected by electroejaculation and frozen in Tris-egg yolk extender plus 0.5% Equex STM paste and 4% glycerol. 349 grade I and II cat oocytes were matured in SOFaa plus BSA 5 mg/ml, pFSH-LH 0.1 IU/ml, EGF 25 ng/ml, ITS 25 μl/ml and L-cysteine 1.2 mM in a 5% CO2 incubator at 38.5°C for 24 h. For IVF, semen was thawed at 37°C for 30 sec and washed in SOFaa plus BSA 6 mg/ml, by centrifuging at 300 g for 5 min. Semen pellet was

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 194 P o s t e r A b s t r a c t s re-suspended in fresh medium, motility was evaluated and sperm concentration was determined. The suspension volume was adjusted in order to obtain 4 samples with a final concentrations of 0.025, 0.1, 0.5, 1 x106 msp/ml, and supplemented with PHE 20 μl/ml and heparine 10 μg/ml. Matured oocytes were co-cultured in 100 μl droplets of the different IVF suspensions under mineral oil for 18 h at 38.5°C in 5% CO2. After fertilization, cumulus cells were removed and presumptive zygotes were cultured in SOFaa plus BSA 16 mg/ml at 38.5 °C in 5% CO2. Cleavage was determined after 12 h of IVC and embryos were cultured in the same medium supplemented with 10% FBS until day 9. Results Cleavage rate, morulae-blastocyst rate on day 6 and blastocyst rate on day 9 were lower (p<0.05, Chi square test) in the 0.025 x106 msp/ml group (37.6%, 20.2%, 8.6% respectively) than the others (0.1 x106 msp/ml: 55.0%, 45.0%, 30.0%; 0.5 x106 msp/ml: 50.7%, 45.4%, 31.2%; 1 x106 msp/ml: 54.2%, 44.6%, 27.7%). Conclusions No differences in cleavage and blastocyst yield were found using sperm concentrations 10 times higher (0.1 vs 1 x106 msp/ml), showing that in the cat the block to polispermy is very efficient. Only the very low concentration of 0.025 x106 msp/ml did not achieved satisfactory results. Among the tested concentrations, the minimum number of cat frozen-thawed spermatozoa required for an optimal IVF was 0.1 x106 msp/ml, using semen with a progressive motility value of 3.5-5 after thawing. The low concentration found in this study might allow for a more efficient use of cat frozen-thawed semen. P505 Expression of the genes implicated in the development of the trophoblast lineage in mouse somatic cell nuclear transfer embryos Mitani, T1*, Nishiwaki, M2, Morita, M2, Moriki, K2, Nishiyama, Y2, Kato, H1, Anzai, M1, Iritani, A1 1Institute of Advanced Technology, Kinki University, Japan; 2Department of Genetic Engineering, Kinki University, Japan Somatic cell nuclear transfer (SCNT) embryos can develop at relatively high rates during the preimplantation period; however, most of these fail after implantation. Development of extraembryonic tissue is indispensable for normal embryonic development. Hence, an abnormality of trophoblast development might be a significant factor in post-implantation lethality of SCNT embryos. A transcription factor, caudal-related homeobox 2 (Cdx2), appears to be involved in the segregation of ICM and trophectoderm (TE) in preimplantation embryos. Both Cdx2 and Oct3/4 are expressed in all cells at the morula stage, and then Cdx2 expression becomes restricted to the TE and Oct3/4 to the ICM as the blastocyst develops. Mouse embryos deficient in Cdx2 are able to develop to normal blastocysts but die soon after implantation, probably because of defects in the TE lineage. Moreover, dysplasia of the spongiotrophoblast layer might attribute to an abnormality of Tpbpa expression in mouse SCNT embryos. Regarding this, we have demonstrated that the expression of Cdx2 in SCNT embryos delayed and its expression level was significantly lower than that in intracytoplasmic sperm injection (ICSI) embryos. Moreover, the ectopic expression of Oct3/4 was observed in the TE cells of SCNT, but not in ICSI blastocysts. However, there was no significant difference in expression level of Oct3/4 between ICSI and SCNT embryos. In this study, we examined the expression profiles of the genes implicated in the trophoblast development in mouse SCNT embryos and ICSI embryos by immunohistochemistry and real-time PCR analysis. Eomesodermin (Eomes) is implicated in the trophoblast development and its expression depends on Cdx2, BMP4 and FGF4. Real-time PCR analysis revealed that in SCNT embryos the expression level of Eomes was also only half that in ICSI embryos. Anomalous expression patterns of FGF4 and FGFR2 were also observed in the preimplantation SCNT embryos. These results indicate that anomalous expression of these genes in preimplantation SCNT embryos may cause the delayed expression of Cdx2 which leads to the ectopic expression of Oct3/4 in blastocysts and, along with the limited expression of Cdx2 and Eomes, may contribute to disorders in the

function of the trophoblast lineage for normal placental development. This work was supported by a Grant-in-Aid for the 21st Century Center of Excellence Program of the MEXT, Japan, and by a Grant-in-Aid for Scientific Research from the Japan Society for the Promotion of Science. P506 Mammalian oocyte extracts induce chromatin remodeling and dedifferentiation of somatic cells, but do not global demethylation Miyamoto, K*; Tsukiyama, T; Minami, N: Yamada, M; Imai, H Laboratory of Reproductive Biology, Kyoto University, Kyoto, Japan An egg cell-free system is a powerful tool to analyze molecular mechanisms underlying early embryonic development or nuclear remodeling of sperm and somatic nuclei. The system has been developed mainly in Xenopus laevis. However, the cell-free system from mammalian oocytes has not been well characterized. We previously produced functional cell-free extracts from porcine germinal vesicle (GV) and metaphase II (MII) oocytes, and found that permeabilized-porcine-fibroblast cells were reprogrammed in part by the extracts. In general, global demethylation in embryonic genome occurs during early embryonic development. However, somatic cells after nuclear transfer sustain hypermethylation. Differences in methylation status in both embryos may explain in part the failure of development in cloned embryos. Here, we utilized this system to examine the modification of DNA methylation in somatic genome by mammalian oocyte extracts. About a thousand of GV oocytes were recovered from porcine ovaries and were matured in vitro. The GV oocytes and MII oocytes were resuspended in an extraction buffer and were crushed by centrifugation at 90, 000 rpm. Each suspension was used as GV extracts and MII extracts. Porcine fibroblasts were previously treated with Streptolysin O to reversibly permeabilize cell membrane. The permeabilized cells were treated with the extracts for 1 hour at 37oC, and then the change of global methylation was examined by immunofluorescence analysis using 5-methylcytosine antibody. For examining methylation status of a centromeric satellite sequence, purified DNAs of the extract-treated cells (ETCs) were subjected to the bisulfite-genomic-sequencing analysis. After treatment with MII extracts, TATA binding protein (TBP) was released from nuclei and histone H3K9 and H4K12 were deacetylated, suggesting that cell memories of somatic cells are erased in the MII extracts. In contrast, cells treated with GV extracts did not show such chromatin remodeling. Instead, they expressed the NANOG gene and downregulation of somatic-cell genes after cell culture, suggesting partial dedifferentiation occurred. These results indicate that both GV and MII extracts are functional on reprogramming of somatic cells. However, DNA methylation in global genomic region and repetitive sequences of heterochromatin was not changed in ETCs. These results suggest that both GV and MII oocyte components can induce a part of nuclear reprogramming in ETCs such as the chromatin remodeling and the activation of pluripotent genes, but not global DNA demethylation of somatic genome. P507 Effect of the theca cells during in vitro growth porcine oocytes on the viablity of oocytes granulose cell complexes after in vitro growth Miyata, Y*, Hashimoto, S; Fukuda, A; Morimoto, Y IVF Namba Clinic, IVF Osaka Clinic Paracrine factors secreted by oocytes and somatic cells regulate many important aspects of early ovarian follicle development in mammals. Thus, it is believed that granulosa cells surrounding growing oocytes play an important role including secretion of oocyte development supporting factors, nutrient supply via gap junction and so on. Recently, we have established in vitro culture system of growing porcine oocytes (Hashimoto et al., 2007). However, it is not well-understood the effect of the morphology of growing oocyte granulose

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 195 cell complexes (OGCs) on the viability and the meiotic competence of in vitro grown oocytes. In this study, we assessed the morphology of OGCs on the antrum formation of OGCs, the viability and the meiotic competence of in vitro grown oocytes. Porcine OGCs were recovered from early antral follicles with diameter of 300-700 μm and intact oocytes with intact granulosa cells were selected. OGCs categorized into 3 categories according to the quantity of granulose cells attached with oocytes (Category A: 1-3 layers of granulose cells (GCs); B: 3 or more layers of GCs attached with a small amount of theca cells; C: 3 or more layers of GCs surrounded with theca cells). OGCs were cultured for 14 days in the medium (containing 2% polyvynilpyrrolidone, estradiol-17β, ascorbic acid, Insulin, sodium selenite, transferring and BSA, Hashimoto et al., 2007) supplemented with 0.02% (w/v) L-Carnitine under 5% oxygen tension. In vitro maturation (IVM) of in vitro grown oocytes was carried out for 44 hours following the culture. The antrum formation rate of OGCs in category A (18%) was significantly lower (P<0.05) than that of OGCs in catgery B (49%). The survival rate of OGCs in category C (37%) was significantly lower (P<0.05) than that of OGCs in category B (57%). The proportion of germinal vesicle breakdown of oocytes in category C after IVM (27%) was also significantly lower than that of oocytes in category B (48%). However, there were no significant differences in the maturation rates (14-31%). Results of the present study suggested a small amount of theca cells gives a favorable condition for the antrum formation of OGCs in vitro. However, an excessive amount of theca cells may decrease the viability of OGCs due to the depletion of oxygen around oocytes under 5% oxygen condition. P508 Comparison of meiotic competence of filly and mare oocytes Mlodawska, W*, Okolski, A Agriculture University, Department of Animal Reproduction and Anatomy, Al. Mickiewicza 24/28; 30-059 Krakow The aim of this study was to investigate the effect of age on morphology of cumulus-oocytes complexes (COCs) and the ability of oocytes to in vitro maturation (IVM) in fillies, in comparison with oocytes of mares. The study was performed on oocytes collected from the ovaries of slaughtered fillies (n=123) and mares (n=33; control group) from September 2006 till March 2007. The age of the fillies was estimated by examining their teeth. The ovaries were classified to one of 3 groups, according to fillies age: I) ≤ 9 months old; II) about 12 months old and III) about 18 months old. COCs were collected by scraping ovarian follicles and only oocytes having compact (Cm) or expanded (Ex) cumulus cells were classified to IVM. COCs were cultured in 50 µl of TCM 199 supplemented with 0.1g/L L-glutamine, 20% FBS, 1µg/ml Estradiol, 5 µg/ml FSH, 1 mM sodium pyruvate and 25 i.u/ml gentamycin, under paraffin oil for 24 - 26 h (Ex oocytes) or 29 - 31 h (Cm oocytes). After culture, the nuclear maturation of oocytes was evaluated by orcein staining. From the ovaries of fillies and mares, a total of 774 and 290 oocytes, respectively, were collected. In all filly groups, more Ex than Cm oocytes were obtained (48% vs. 37%, respectively; P<0.05). This relationship was not observed in the oocytes of mares, from which 41% and 47% of Ex and Cm oocytes, respectively, were collected. The percentage of oocytes with only corona radiata or degenerated was similar in all filly and mare groups. No effect of filly’s age on morphology of collected oocytes was found. A total of 296 filly oocytes and 65 mare oocytes were evaluated after IVM. In the filly groups, no effect of age on meiotic competence of their oocytes was found. However in the Cm groups, lower percentage of filly (28-36 %) than mare oocytes (50%) attained telophase I/metaphase II stage. The lowest percentage of mature oocytes was obtained in the youngest filly group. In the Ex groups, similar proportion of oocytes of fillies (42 - 51 %) and mares (48 %) attained the metaphase II stage. In all filly groups, more Ex than Cm oocytes reached the maturity stage in vitro. These results indicate, that in applied culture conditions filly Cm oocytes were able to mature in vitro, but they showed lower meiotic competence than the oocytes of mares. Both filly and mare oocytes with expanded cumulus cells display the same

ability to in vitro maturation. This study was financially supported by Polish Ministry of Education and Science in the years 2006-2008, as a research project (No 2 P06D 042 30). P509 Higher rates of abnormal spindles after vitrification using flexipet denuding pipette Morato, R1*; Izquierdo, D2; Paramio, MT2; Mogas, T1

1Departament de Medicina i Cirurgia Animals; 2Departament de Ciència Animal i dels Aliments, Facultat de Veterinària, Universitat Autònoma de Barcelona, 08193, Bellaterra, Spain

The cryopreserved/warmed oocytes normally show several ultrastructural and structural alterations, such as alteration in chromosomes, microtubules and microfilaments distribution. Structural injuries have been largely evidenced but there are few works which compare oocyte vitrification using different carrier systems. The aim of this study was to determine the effectiveness of two different vitrification supports for oocyte vitrification. We evaluated the effect of open pulled straws (OPS) and flexipet denuding pipette (FDP) on cytoskeletal components of in vitro matured (IVM) cow and calf oocytes. IVM cow and calf oocytes were divided into three experimental groups: (1) vitrified in OPS (OPS); (2) vitrified in FDP (FDP); (3) without further treatment as a control (CTR). At 22 h after onset of maturation, groups of 2-4 oocytes were pre-equilibrated in HEPES-buffered TCM199 medium supplemented with 20% fetal calf serum containing 1 mM Taxol for 15 min (HM). After equilibration oocytes were incubated in HM with 10% DMSO and 10% Ethylene Glycol (EG) for 30 sec. Then oocytes were moved through 20-µl drop of HM with 20% DMSO, 20% EG and 0.5 M of sucrose, loaded into OPS or FDP and immersed in liquid nitrogen. Oocytes were warmed by plunging the OPS or FDP into 0.25 M sucrose in HM, then placed in 0.15 M sucrose in HM, and HM alone, for 5 min each. After warming, spindle configuration and chromosome distribution was assessed. Double fluorescent staining evidenced higher rates of spindle and chromosome abnormalities in FDP group compared to OPS group (P<0.05). After vitrification and warming, percentages of oocytes with normal meiotic spindle morphology and chromosome alignment (OPS: 45.8% and 56.4%; FDP: 29.9% and 33%; cow and calf, respectively) were significantly lower than those from untreated matured oocytes (68.9% and 70.7%, cow and calf respectively). Among the spindle abnormalities, we observed that the FDP group showed higher percentages of complete spindle depolymerisation (29.9% and 29.2%, for cow and calf, respectively) when compared to the OPS group (10.4% and 10.3%, for cow and calf, respectively). Flexipet denuding pipette didn’t improve the results as we expected and high rates of clustered chromatin and abnormal spindle appeared in calf and cow oocytes vitrified by FDP. P510 Effect of the ejaculate and bull on in vitro embryo production using sexed semen of Nelore (Bos indicus) bulls Oliveira Filho, BD1*, Sanches, B3, Santos, F2, José Pontes, H3, Gambarini, ML3, Ereno, A3, Basso, A3, Ferreira, CR3 1Animal Production, Federal University of Goiás, Brazil; 2Brazil; 3InVitro, Brazil Flow cytometry sperm technology is currently the only one which presents satisfactory results for sexing semen in commercial scale. However, variations in the fertility occurs, probably as a consequence of injuries during the procedure of cell sorting in X and Y chromosomes. The objective of this study was to evaluate the effect of frozen sexed semen obtained from four different ejaculates of four Nelore bulls (Bos taurus indicus) on in vitro embryo production. Oocytes (8,485) were recovered from Nelore cows by follicular aspiration, matured during 24 hours in TCM 199 medium added of bicarbonate, piruvate/LH/FSH +10% of Fetal Calf Serum at 38,5ºC and 5% CO2. After that oocytes were placed in droplets containing Tyrodes medium plus BSA, piruvate, gentamicin and heparin and

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 196 P o s t e r A b s t r a c t s were inseminated with thawed sexed semen. Motile spermatozoa were obtained by centrifugation on a Percoll gradient (45-90%) diluted to 1x106/mL (IVF) of four different ejaculates of each bull, previously evaluated. The presumptive denuded zygotes, without the cumulus oophorus cells, were transferred to culture droplets of synthetic oviductal fluid medium added of BSA. On Day 7 after IVF, embryos classified as Grade 1 were counted. The rate of viable embryos was calculated by the number of Grade 1 obtained embryos divided by viable oocytes. The total rate of viable embryos differed (p <0, 05) between bulls, as well as the rate of viable embryos of each ejaculate of the same bull (p <0,01): A - 10,3%a (86/835), 21,6% (86/399), 19,7% (120/609) and 32,9% (254/771); B - 38,0% (101/266), 24,6%

(78/317), 9,7% (78/802) and 28,2% (220/779); C - 23,7% (146/615), 23,0% (278/1210), 25,8% (132/511) and 34,6% (36/104); D - 32,8% (41/125), 28,1% (86/399), 66,7% (42/63) and 13,3% (36/271). These results permitted to conclude that there is not only an effect of the bull, but also of the ejaculate on in vitro embryo production. P511 Effect of Duration in the Vitrification Medium on the Post Thaw Development of In Vitro Derived Bovine Embryos Ozdas, OB.1, Cirit, Ü.1, Demir, K.1, Bacinoglu, S1, Pabuccuoglu, S.1, İrez, T2., Ak, K.1, İleri, İK.1

1Istanbul University, Veterinary Faculty, Department of Reproduction and Artificial Insemination; 2Istanbul University, Cerrahpasa Faculty of Medicine, Dept. of Gynaecology and Obstetrics, IVF Unit, Istanbul , Turkey Transfer of frozen embryos enables the establishment of elite herds, control of diseases and storage of genetic materials for longer periods. However, although intercontinental transfer of frozen embryos is possible, post-thaw degenerations are encountered and pregnancy rates are not at the expected level. Embryos especially degenerate during freezing and thawing procedures. These degenerations are thought to be due to the exposure time and toxic effects of used cryoprotectants. In this study slaughtered cattle ovaries were used. Oocytes were collected from ovaries using the aspiration method and matured in their own group in 700 microliter TCM-199 for 23 h at a gas atmosphere of 5% CO2, 5% O2, 90% N2 and at 38.8 ºC. Matured oocytes were fertilized for 18-24 h in IVF-TALP medium. After fertilization cleavage was 67.05% (865/1290) at 48th

h. Embryos were cultured up to early blastocyst-blastocyst stage (34.91%) in SOF medium supplemented with 10 % FCS for 7 days at a gas atmosphere of 5% CO2, 5% O2, 90% N2 and at 38.8 ºC. 302 embryos at the early blastocyst stage were frozen after an exposure to vitrification solution for various time periods (15, 30, 60, and 90). Four groups have been established for this purpose (Groups 1, 2, 3, 4). Each group has included 67, 64, 63 and 60 embryos respectively. All embryos were first kept in 10% Glycerol+10% FCS containing PBS solution (Vs1) for 5 minutes and then in 10% Glycerol+10% FCS+20% Ethylene Glycol containing PBS (Vs2) solution for 5 minutes. Later, embryos were taken to straw 25% Glycerol+10% FCS+25% Ethylene Glycol+0.1 M sucrose containing freezing solution (Vs3) and exposed for various time periods (15,30,60,90 sec), then frozen by dipping into liquid nitrogen. Totally 48 embryos were used for toxicity test without freezing, and 34 of these continued their development. After thawing (37ºC) embryos were washed several times in washing medium supplemented with 0.5 M sucrose and SOF medium, then embryos of each group were incubated again for another 48 hours. Chi-square test was used in this study. Post thaw development to expanded blastocyst stage was highest in Group 1 with 52.2% (35/67) followed by Group 2 with 45.3% (29/64), Group 3 with 22.2% (14/63) and Group 4 with 5% (3/60). No statistical significance was observed between Groups 1 and 2. The statistical difference between Group 1 and 3 was at P<0.01 and between Group 1 and 4 was P<0.001 level. This project were supported by Research Fund of Istanbul University, Project number: 277/22092004.

P512 Interspecies nuclear transfer of chicken embryo fibroblast cell into porcine oocyte Park, CS*; Cong, PQ; Song, ES; Kim, ES; Yi, YJ Research Center for Transgenic Cloned Pigs, Chungnam National University, South Korea Introduction Cytoplasm of porcine oocyte was expected to support the development of embryos produced by nuclear transfer of other species in mammalian and other species that correlation between relatives are relatively far, such as Aves. In this study, we examined the developmental ability of porcine oocyte cytoplasm to support proliferation of somatic cell nuclei from poultry. The fusion efficiency, rate of cleavage and blastocyst development were evaluated in this experiment. Methods Ovaries were collected from prepubertal gilts at a local slaughter house. Follicular fluid and cumulus-oocyte complexes (COCs) were aspirated from follicles. COCs were cultured in tissue culture medium (TCM) 199 for 44 h. Chicken embryo fibroblast cells were derived from 9-day-old eggs. Porcine fetal fibroblast cells were derived from a fetus on day 35 of pregnant gilt. Cells were cultured in DMEM medium supplemented with 10% FBS, 75 ㎍/ml penicillin G and 50 ㎍/ml streptomycin, respectively. Before nuclear transfer, cells were treated with 0.05% trypsin and 0.5 mM EDTA. Oocytes were enucleated by removing the first polar body along with adjacent cytoplasm containing the metaphase plate using a micropipette with an inner diameter of about 25 µm. A single donor cell was placed into the perivitelline space of an enucleated oocyte to form a couplet. Fusion/activation was accomplished with 1 DC pulse of 1.2 kV/cm for 30 µsec provided by a BTX Electro-cell Manipulator 200 (BTX, USA). After fusion and activation, the reconstructed embryos were immediately cultured in PZM-3 medium containing 0.3% BSA at 38.5oC, 5% CO2 in air. The rates of embryos at the cleavage and blastocyst stages were evaluated at 48 h and 6–7 days after activation, respectively. Results Fusion rates were not significantly different between intraspecies fusion and interspecies fusion. However, the rates of cleaved oocytes (94.0%) and blastocysts (33.8%) in the pig-pig nuclear transfer (NT) units were higher compared to those of cleaved oocytes (76.8%) and blastocysts (1.7%) in the pig-chicken NT units. Also, the cell numbers per blastocyst (40.2) in the pig-pig NT units were higher than those per blastocyst (28.5) in the pig-chicken NT units. Conclusion This study demonstrated the developmental ability of porcine oocyte cytoplasm to support proliferation of chicken embryo fibroblast cell. P513 Comparison between wild and domestic cat oocyte Pavone, L1*, Minoia, R1, Laricchiuta, P3, Aiudi, G1, Bozzo, G2, Lacalandra, GM1 1Department of Animal Production, University of Bari, Italy; 2Department of Animal Health and Wellbeing, University of Bari, Italy; 3ZOO SAFARI Fasano (BR), Italy Introduction Non domestic cats are among the most threatened on earth, and numerous species are believed to be threatened with extinction in their natural environment. The knowledge about size of oocyte in wild-cat is lacking behind other species. There are a number of reasons for this situation, first of all the paucity of subject so it would be advantageous to recover gametes post mortem. In this study, morphology and sizes of oocyte from non domestic cat (Panthera pardus), was described and compared with domestic cats (Felis catus). The stage of oocyte was detect by fluorescent stains for labelling DNA in fluorescence microscopy. Many researches has been done on study of preantral follicles from wild and domestic cats, however this is the first study that show the size of GV and oocyte of leopard compared with domestic cat. Methods Ovaries were collected from sexually mature queens following routine ovariohysterectomy at veterinary clinic. Leopard ovary were collect by natural dead subject (age: 10 years; weight: 80

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 197 Kg) of zoo (ZOO SAFARI-Fasano-BR). Ovaries were kept in physiological saline and maintained at 35°C before oocyte recovery. Ovary were placed in phosphate buffered saline (PBS) supplemented with 50 micrograms/ml of gentamicin. Each ovary was sliced repeatedly with scalpel blade to release cumulus-oocyte complex (COCs) in a 90 mm culture dish containing PBS at 37°C. COCs were immediately fixed in formalin (2%) and they remain over-night at 4°C temperature. Subsequently oocyte were collect and fixed on slide two each. Only one oocyte was collect by leopard ovaries. Oocytes was stained with Hoechst 33258 and observed at fluorescence microscope (E600 Nikon, 365 nm excitation) for assess the meiotic status. Evaluation of oocytes diameter was done by stereomicroscope (Nikon ECLIPSE 50 I). Results Cat oocyte external diameter (100 micron on average) was smaller than in leopard (230 micron on average), however the nucleus-cytoplasm ratio is approximately the same 0,13 micron (14,17 micron GV diameter Vs 109 micron oocyte diameter for cat’s oocyte) vs 0,17 micron (50,13 micron GV diameter Vs 229,65 micron oocyte diameter for leopard oocytes). Conclusions Though the effective size of leopard oocytes is greater than cat’s oocytes the proportion of oocytes share are keeped. Is only the first study that shown the size of oocyte in leopard, and other research needed. Knowledge of morphology and size is important for subsequent in vitro maturation (IVM) an in vitro fertilization (IVF) for maintenance of genetic diversity in dangerous species. P514 Correlation analyses of a porcine in vitro production system for prediction of blastocyst rates Petersen, KM*, Avery, B; Schmidt, M; Bogh, IB Veterinary Obstetrics and R, Faculty of Life Sciences, University of Copenhagen, Denmark The aim was to find the best predictor for blastocyst formation in a standard porcine IVP system. For that purpose blastocyst rates were compared with 2-pronuclear-, polyspermy- and cleavage rates, where rates were calculated over total number of IVF oocytes, and the data subjected to correlation analyses (GraphPad Prism 3), under the assumption that when two variables vary together, there is a correlation between them. The correlation coefficient r, which ranges from – 1 to + 1, quantifies the direction and magnitude of correlation, and how well X and Y vary together. The best way to interpret the value of r is to calculate r2, which ranges from zero to one, and is the fraction of the variance in the two variables that is shared. For example, if r2=0.25 then 25 % of the variance in X can be explained by variation in Y. Linear regression assumes that the data are linear, and finds the line that best predicts Y from X, according to the equation Y = αX + B. An r2 value of 0 means that there is no linear relationship between X and Y, where an r2 value of 1 indicates a perfect correlation. The oocytes were collected from slaughterhouse sow ovaries, IVM was performed for 44 h in TCM-199 with EGF, hCG, eCG and 10 % ECS, IVF for 24 h in a Krebs-Ringer bicarbonate based solution with 2 mM caffeine and 0.6 % BSA, supplemented with washed semen, originating from fresh ejaculates in extender, and IVC for a week in PZM with 5 % ECS. IVM and IVF incubations were done under 5 % CO2 in 95 % air, and IVC in 5 % CO2, 5 % O2, and 90 % N2 at 38.5 º C. Blastocyst and cleavage rates were assessed at day 6 post insemination, penetration rates after fixation 24 h post IVF in acid methanol and subsequent Orcein staining. In conclusion, none of the combinations showed perfect correlation; however the most precise predictor for blastocyst formation was the 2-pronuclear rates, which showed a significant correlation, whereas the correlations for polyspermy or cleavage were very weak (low r2 and high P). The weak correlation for the cleavage rate is probably due to the fact that cleaved embryos are a mix of 2-PN and polyspermic oocytes, which pulls in opposite directions with regard to blastocyst formation.

P515 Influence of oocyte and embryo transport interval time on efficiency and commercial profitability of a large bovine in vitro embryo production scale Rodrigues, JL1*, Queiroz, LM2, Feltrin, C1, Peixer, M2, Malard, P2, Santana, G2, Xavier, M2, Rodrigues, B1 1Laboratory of Embryology and Biotechnics of Reprod, Faculty of Veterinary Medicine, Federal University of Rio Grande do Sul, Brazil; 2Animal Biotechnology, BIO, Brazil Introduction During the last 5 years the extraordinary increase in the number of Nelore females submitted to ultrasound guided follicular aspiration (ovum pick up - OPU) in Brazil, has leading to the development of different estrategies to overcome logistical barriers and achieve profitable pregnancy rates after transfer of IVF embryos. The objective of this experiment was to evaluate the influence of interval time transport on viability of oocytes and embryos: Group 1 (G1) 1 to 2 h; Group 2 (G2) 3 to 5 h; Group 3(G3) 6 to 9 h and Group 4 (G4) 10 to 16 h. Materials and Methods Oocytes were collected by OPU (zero time), washed in modified PBS solution, and loaded into plastic cryovials containing modified TCM199 HEPES maintained at 38°C to provide oocyte in vitro maturation (IVM) during the transport period to the laboratory. At arrival to the laboratory oocytes were transferred to modified TCM199 and cultured at 39ºC in a 100% humidified atmosphere containing 5% CO2. The in vitro fertilization procedure was initiated 24 hours after OPU, and during the next 24 hours the oocytes were incubated with the spermatozoa in the same conditions as described above. After that, the presumptive zygotes were transferred to modified SOFaa medium and then cultured for 7 days at the same IVM conditions under atmosphere containing 5% CO2, 5% O2 and 90 N2 %. On day 7 the embryos were evaluated, morphologically classified and loaded in 0,25 ml straws containing modified SOFaa HEPES supplemented with BSA and kept at 38°C. The embryos were transferred into previously synchronized recipients and pregnancy diagnosis was performed by ultrasound 60 days later. Statistical analysis was performed by the Chi-square test (P <0.05). Results The development rate to the blastocyst stage was 48% (740/1548) in G1, and this rate was higher than the observed with Groups 2 (903/2400, 38%), G3 (1840/4625, 40%) and G4 (3055/8471, 36%). The pregnancy rates did not differ among the three experimental groups: G1 (307/740, 41%), G2 (365/903, 40%) and G3 (674/1840, 37%), and were different from the observed G4 rate (1050/3055, 34%). Looking at the total IVP logistical efficiency (pregnancy/collected oocyte), Group 1 (307/1548, 20%) showed a higher efficiency in comparison with the others groups: G2 (365/2400, 16%), G3 (674/4625, 15 %), and G4 (1050/8471, 12%). Conclusion OPU and IVP are commercially feasible reproductive technologies to produce offsprings from animals kept at distant locations from the laboratory. P516 Cloning of porcine embryos by one-step nuclear transfer Park, SK; Kang, H; Choi, Y-J; Sung, J; Roh, S* Embryo Biotechnology Lab, CLS21, and Dental Research Institute, Seoul National University School of Dentistry, Korea Introduction Mammalian cloning has been studied by many groups, but the success rate is still low. Removal of maternal chromosomes from unfertilized oocytes (enucleation) and injection of donor cells into the enucleated oocytes are the most important steps for improvement of cloning efficiency. Here, we introduce a novel one-step nuclear transfer (OSNT) system. In general, somatic cell nuclear transfer (SCNT) is completed by many processes including enucleation and donor cell fusion. However, OSNT is a simple method in which donor cell is directly injected into ooplasm without any fusion process. In addition, chromosomal enucleation and donor cell injection are performed simultaneously in OSNT. Methods A fibroblast cell was first aspirated into a 10-µm inner diameter beveled-tip pipette. Metaphase II plate of a matured oocyte was protruded by demecolcine treatment and the chromosome with a

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 198 P o s t e r A b s t r a c t s small volume of adjacent cytoplasm was aspirated into the same pipette. Then, the pipette was withdrawn from the oocyte and the karyoplast was released out. Thereafter the pipette with the remaining donor cells was re-introduced into ooplasm through the same hole of zona pellucida which was made during enucleation, and the donor cell was directly introduced into the cytoplasm of the enucleated oocyte. The reconstructed embryos were activated by electrical stimulation and cultured for 7 days. Results The blastocyst rate of the novel OSNT embryos was 14.5% (16/110) while the same blastocyst rate for standard SCNT embryos was 10.7% (15/140, P < 0.05). In addition, OSNT reduced steps and duration for SCNT program in our laboratory. Conclusion The simple, new OSNT system enables large scale cloning by reduction of procedural steps. Gene expression analysis data of HSP70, Glut-1, poly A, Pou5f, Nanog, Sox9, Cdx2 and Eomes will be presented at the meeting. This study was supported by the Korea Science and Engineering Foundation (KOSEF) grant funded by the Korea government (MOST) (M10641000001-06N4100-00110 and R01-2007-000-10316-0). P517 Porcine parthenogenote embryo developmental competence under different in vitro maturation systems using Roscovitine Salvador, I1*, Alfonso, J2, Garcia-Rosello, E3, Garcia-Mengual, E4, Silvestre, MA4 1CITA (Centro de Investigación y Tecnología Animal), Instituto Valenciano de Investigaciones Agrarias (CITA-IVIA), Spain; 2Instituto de Medicina Reproductiva, Spain; 3Universidad CEU-Cardenal Herrera, Spain; 4Instituto Valenciano de Investigaciones Agrarias, Spain With the aim of extending the “time frame” to manipulate oocytes for techniques such as ICSI and NT, we adopted a parthenogenetic model to determine the developmental potential of oocytes submitted to different in vitro maturation conditions, involving the use of roscovitine and longer IVM duration. Immature cumulus-oocyte complexes (COC) collected from ovaries of slaughtered gilts were matured in four different maturation systems: 45IVM (control group); 50IVM; corresponding to 45 or 50 hours maturation, respectively, in IVM medium (M199 supplemented with 0.1% PVA, 0.57 mM cysteine,10 ng/mL EGF, antibiotics and hormones for the first 22h maturation period (0.1 IU/ml recombinant human-FSH and -LH); 5R+40IVM and 5R+45IVM, in which COC were cultured in hormone-free IVM medium with 50 µM of roscovitine (Sigma, R7772) for the first 5h, then washed twice and allowed to reach normal maturation in IVM medium for 40 or 45 hours, respectively. Parthenogenote development was induced by stimulating MII oocytes with an electrical set of two DC pulses of 1.2 kV/cm for 30 µsec delivered on an electro-cell porator. After activation, embryos were washed twice and allowed to culture for 7 days in PZM-3 (Yoshioka et al., 2002). When COC were cultured with the 5R+40IVM treatment, nuclear maturation and cleavage rate were significantly lower than with the 45IVM, 50IVM and 5R+45IVM culture treatments (54% vs. 73 -77%, P < 0.05 and 59%; 81-88%, P < 0.05, respectively). However, this difference between groups did not reach statistical significance in blastocyst rates (ranged from 17% to 25%). Regarding embryo quality, blastocysts from 5R+40IVM group presented the lowest average number of cells per blastocyst (P < 0.05). No differences were observed either in MII, cleavage and blastocyst rates or in blastocyst cell number between 45IVM, 50IVM and 5R+45IVM experimental groups. Under our experimental conditions and using parthenogenote embryos as model, we observed that it is feasible to prolong the “time frame” by at least 5 hours to manipulating porcine oocytes in the laboratory without loss of efficiency by using either 5h pre-treatment with roscovitine or prolonging until 50 hours in vitro maturation. This work was supported by INIA and FEDER (RTA2007-0110-00-00).

P518 Melatonin supplementation during ovine oocyte IVM enhance blastocyst output and affects protein expression patterns Succu, S1*; Satta, V1; Bebbere, D2; Madeddu, M2; Berlinguer, F2; Leoni, G1; Naitana, S2 1Dept. of Physiological, Biochemical and Cellular Sciences; 2Dept. Animal Biology; Veterinary Medicine Faculty; Sassari University, v. Vienna 2, 07100 Sassari (Italy) Melatonin exerts a variety of systemic and local functions. Recently evidence of the presence of melatonin receptors in the ovary has been demonstrated. It has been shown to increase the cleavage rates of bovine and porcine preimplantation embryos in vitro, most likely by its anti-apoptotic effect and scavenging activity. The aims of the current study were to test whether melatonin supplementation during ovine oocyte in vitro maturation is able to enhance further developmental rates in vitro, and to verify if its actions at the germ cell level are mediated by a modification in oocyte protein expression pattern. Adult ovine oocytes collected after slicing of abattoir derived ovaries were randomly divided into three experimental groups for in vitro maturation: A) TCM199 plus 10 µg/ml FSH/LH and 100µM cysteamine (MM) supplemented with 10% oestrus sheep serum; B) MM containing 0.4% bovine serum albumin (BSA); C) MM containing 0.4% BSA and 100 μM melatonin. After 24h, oocytes were fertilized and cultured in vitro up to the blastocyst stage. The cleavage rate did not differ between the three groups (85%, 82.9% and 87.8% for A, B and C respectively). Blastocyst output was significantly higher (P < 0.01) in A (47.1%) and B (41.7%) groups when compared to C (23.5%). 2D-electrophoresis was performed on both matured oocytes (10 oocytes/group) and granulosa cells of B and C groups. Silver staining of electrophoresed gels demonstrated a high protein number expressed in C electrophoretic gels compared to B, while two proteins were evidenced in B but not in C gels. Some of these differences may be related to a shift of the isoelectric point, probably due to post-translational modifications. These data provide evidence that melatonin added to oocyte in vitro maturation medium is able to enhance blastocyst output to levels comparable to those obtained routinely using oestrus ovine serum as medium supplement. Moreover, 2D-electrophoresis results revealed that melatonin acts altering oocyte and cumulus cell protein expression patterns, inducing both ex-novo protein synthesis and post-translational modifications. New insights on melatonin actions at the COC level will be drawn after sequencing ex-novo expressed proteins found after in vitro maturation with melatonin (Supported by Fondazione Banco di Sardegna). P519 Establishment of parthenogenetic embryonic stem cell lines in mouse Rungarunlert, S1; Rungsiwiwut, R1; Suphankong, S2; Panasopolkul, S1; Thongphakdee, A1; Dinnyes, A3,4; Tharasinit, T1; Techakumphu, M1* 1Department of Obstetrics, Gynaecology and Reproduction, Faculty of Veterinary Science, Chulalongkorn University, Bangkok, 10330 Thailand; 2Department of Medical Science, Faculty of Medicine, Chulalongkorn University, Bangkok, 10330 Thailand; 3Molecular Animal Biotechnology Laboratory, Szent Istvan University, H-2100 Gödöllö, Hungary; 4BioTalentum Ltd, H-2100 Gödöllö, Hungary Introduction Establishment ES cell from parthenogenetic activated blastocysts would allow creating histocompatible cells for regenerative medicine. Objective The objective of this study to establish embryonic stem (ES) cell lines from parthenogenetically activated of mouse oocytes as a model system for human research. Methods Mature oocytes (n=145) were collected from oviducts at 15 h post-hCG injection and subsequently activated by using 10 mM/ml Sr2+ with 5 µg/ml Cytochalasin B in Ca 2+-free CZB medium for 6 h. Activated oocytes with two pronuclei (2PN) (n=131) were cultured further in vitro in KSOM-AA medium at 37ºC, 5% CO2 in a humidified atmosphere. 96 h after activation expanded blastocysts

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 199 were used for ES cells establishment (n=18) or differential stained for cell number counting. All pathenogenetic embryonic stem (pES) cell lines were characterized by morphology, pluripotency marker of murine ES cells (AP, Oct-4, SSEA-1, Sox2 and Nanog), chromosome number as well as in vitro differentiation. Result The rate of activation and blastocyst formation from MII oocytes were 90±3.13 and 82.5±2.95%, respectively. The total cell number, ICM cell number and ICM: trophectoderm ratios of parthenogenetic blastocysts were 66.8±2.88, 8.1± 0.63 and 1:7.24, respectively. Four pES cell lines were established and the efficiency of ES cell lines establishment were 10-37.5%. All pES cell lines presented a typical morphology of murine ES cell with high nuclear: cytoplasmic ratio, round shape and clear edge colonies. Three of them presented normal chromosome number (2n=40). The pES cell lines possessed high levels of alkaline phosphatase and expressed pluripotency marker including Oct4, Sox2, SSEA1 and Nanog after detecting by immunocytochemistry and RT-PCR. During in vitro differentiation, the pES cell lines formed cystic embryoid bodies in suspension culture and created spontaneous beating clusters in gelatine-coated culture dishes. Conclusion We succeeded to produce ES cell lines from parthenogenetic blastocysts with presenting pluripotency markers and normal chromosome numbers in mouse model. This work was supported by grant from CHE-TRF Senior Scholars, grant No RTA5080010, The National Research Council of Thailand, The Royal Thai Government Scholarship (PhD-SW-INV_20060202/49) and EU FP7 (IAPP 2007 - 218205). P520 Vitrification versus slow-cooling: higher survival rates for vitrified two-cell mouse embryos Temple-Smith, P*; Wang, X; Aguirre Maclennan, I; Momtaz, F; Fage, R; Patel, D; Philips, S; Pangestu, M; Catt, S Education Program in Reproduction and Development, Centre for Reproduction and Development, Monash Institute of Medical Research, Australia Introduction Cryopreservation of cleavage stage embryos by slow cooling is now routine but recently vitrification has gained prominence. Few studies, however, have compared the two techniques using the same cohort of embryos. Here we compare embryo viability in slow-cooled, vitrified or fresh cultured two-cell mouse embryos (2-CEs). Methods Oocytes collected from superovulated female mice [F1 (C57Bl6JxCBA)] were fertilised in vitro with epididymal sperm. Oocytes were washed free of cumulus and sperm and cultured (24h; modified KSOM, 5% CO2 in air). All 2-CEs (cleavage rate, 84%) were distributed randomly into 3 groups (slow-cooling, vitrification and unfrozen controls). For vitrification, 2-CEs were equilibrated (3 min; 37°C) in 10% v/v ethylene glycol, 10% v/v DMSO and placed in vitrification solution (17% v/v ethylene glycol, 17% v/v DMSO, 0.75M sucrose). Each 2-CE was transferred to a fibreplug (2ul), touched on a pre-cooled metal block in liquid N2 and inserted in a pre-cooled straw (CVM kit, Cryologic). For slow-cooling (SC), up to seven 2-CEs were put in 11% v/v propanediol in KSOM Hepes (10 mins) followed by 10 min in a final freeze solution [11% v/v propanediol, 0.5M sucrose in KSOM Hepes medium; room temp (RT)], and frozen individually in straws using conventional slow-cooling protocols in a programmable freezer (Cryologic CL856). Vitrified embryos were warmed at 37°C in 3 solutions (0.3M, 0.2M, 0.1M sucrose, 5min in each); SC embryos were thawed at RT in 3 solutions (0.5, 0.25, 0.125M sucrose). Lysis was assessed 2h after thawing, and all surviving 2-CEs were cultured (72h) to blastocyst and hatching blastocyst stages assessed. Differences between groups were examined using a Chi Square test. Results Lysis rates after thawing were higher for SC embryos (29/113 21.2% cf 4/88 4.5%, P=0.001). Survival and hatching rates after thawing for vitrification (70/84, 82.6%; 42/84, 50% respectively) and SC (67/84, 79.7%; 42/84, 50% respectively) groups were not significantly different from unfrozen controls (73/94, 77.6% and 54/94, 57.7% respectively). However, blastocyst development rate

(67/113, 59.2%) of thawed 2-CE in the SC group was significantly lower than in the vitrification group (70/88, 79.5%, P=0.002). Conclusion Comparison of two cryopreservation methods on the same cohort of cleavage stage embryos revealed lower lysis rates after vitrification than after slow cooling, but not higher blastocysts rates from those 2-CE that survived. We suggest that either or both methods could be used for cryopreserving cleavage stage embryos. P521 Flat-headed cat cloned embryos and preliminary embryo transfer Thongphakdee, A1*, Manee-In, S1, Rungsiwiwut, R1, Numchaisrika, P1, Siriaroonrat, B2, Kamolnorranath, S2, Chatdarong, K1, Techakumphu, M1 1Department of Obstetrics Gynaecology and Reproduct, Faculty of Veterinary Science, Chulalongkorn University, Thailand; 2Zoological Park Organization of H.M. the King, Thailand Introduction Critically endangered flat-headed cat (FC; Prionailurus planiceps) is one of the small wild cats in Thailand’s captive breeding program. Inter-generic nuclear transfer (ig-NT) offers the possibility of FC embryos/offspring production. The purposes of the study were to evaluate (1) in vitro development and quality of ig-NT FC embryos (Study 1) and (2) in vivo developmental competence of their transfer to recipients (Study 2). Methods In Study 1, 145 ig-NT FC couplets were reconstructed by fusion of the enucleated in vitro matured (IVM) domestic cat oocyte together with the starved FC fibroblast cell. The couplets were activated by inducing electrical pulses, with subsequently incubation in activation medium, comprised of cycloheximide and cytoclalasin B, for 4 h. The embryos were cultured in synthetic oviductal fluid medium supplemented with amino acids and fetal bovine serum, at 38.5°C, 5% CO2 in the humidified atmosphere, and monitored for 7 days. The blastocyst quality was evaluated by cell number count. Total of 620 IVM cat oocytes were in vitro fertilized (IVF) and served as control. The cleaved embryos collected at 27 h postinsemination (pi) were divided for their in vitro development observation in Study 1 (n = 171) and in vivo development after transferred to recipients in Study 2. The rest of the cleaved embryos were selected for further study. In Study 2, reconstructed ig-NT FC (n = 135) and IVF cat embryos (n = 75) were transferred to uterine tubes of gonadotrophin-treated recipients (n = 3 in each group) on Day 2 after hCG-induced ovulation. Pregnancy was assessed by ultrasonography on Day 30. Results The reconstructed ig-NT FC couplets were 73.8% successfully fused. The fused couplets developed to 88.8% cleavage, 44.8% morula and 8.4% blastocyst stages. Oocytes from control IVF cleaved 54.5% at 27 h pi and those embryos developed to 98% 8-cell, 92% morula and 63% blastocyst stages. The cell number of ig-NT FC (n = 5) and IVF cat blastocysts (n = 22) was not significantly different (69±21 vs. 106.4±43). All (3/3) recipients receiving IVF cat embryos became pregnant and 2 recipients gave to-term kittens, whereas, none (0/3) receiving ig-NT FC embryos was pregnant. Conclusions This study establishes the efficiency of ig-NT FC embryo production. However, developmental ability of ig-NT FC embryos may be one of the limiting factors of pregnancy establishment. P522 Retinol during in vitro fertilization improves development of mouse embryo Towhidi, A1*, Farshidpour, MR2, Chamani, M3, Gerami, A4, Nouri, M1 1Animal Science, Islamic Azad University, Shahre Qods Branch, Islamic Republic of Iran; 2Animal Science, Islamic Azad University, Varamin Branch, Islamic Republic of Iran; 3Animal Science, Islamic Azad University, Science and Research branch, Islamic Republic of Iran; 4Statistics, University of Tehran, Islamic Republic of Iran Introduction Retinoids are recognized as important regulators of vertebrate development, cell differentiation, and tissue function. Pervious studies, were performed both in vivo and in vitro, indicated the influence of retinoids on several reproductive events, including follicular development, oocyte maturation and early embryonic

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 200 P o s t e r A b s t r a c t s development. The present study investigated in vitro effects of adding all-trans retinol to media containing fertilizing and developing embryos of mouse. Methods The mice were maintained according to guidelines of the committee at laboratory animals of Razi Institute. Oocytes were produced by the superovulating 150, six week old NMRI female mice. Sperm was obtained from the cauda epididims of 4, four month old NMRI male mice. In first experiment, collected mouse oocytes were fertilized in concentration 0 (control), 1, 5 and 10 micromole of retinol in HTF medium and were transferred to CZB culture medium. In second experiment, fertilized mouse embryos were cultured in concentration 0 (control), 1, 5 and 10 micromole of all-trans retinol in CZB medium. Embryos were evaluated to blastocyst stage every day. The data analysis was carried out by using proc MIXED of SAS and the Duncan’s multiple-range test was used to determine differences among means. Results In the 1st experiment, addition of 1 or 5 micromole of retinol improved (P<0.05) fertilization rate. Mean unfertilized oocytes was 14.71%, 8.60%, 7.17% and 15.46% for 0, 1, 5 and 10 micromole group, respectively. 5 micromole of retinol compared to control significantly increase mean 2 PN Oocytes (79.70% vs. 75.18%), 2 cells embryos (78.58% vs. 69.56%), 4 cells embryos (77.00% vs. 63.92%), 8 cells embryos (74.89% vs. 58.24%), morula embryos (73.47% vs. 55.80%) and blastocyst embryos (68.50% vs. 52.07%). There were not significant differences among 0, 1 and 10 micromole groups. Also, 5 micromole retinol improved quality of embryo’s morphology (P<0.05). Mean embryo with grade 1 was 35%, 46%, 55% and 48% for 0, 1, 5 and 10 micromole groups, respectively. In the 2nd experiment, Adding 1, 5 and 10 micromole of retinol to in vitro culture medium had no effect on embryo development and morphology compared to control. Conclusions The results suggested that supplementation of all-trans retinol to fertilization medium, but not to in vitro culture medium, may improve embryonic development of mouse. P523 Cytoplasmic Polyadenylation-Element-Binding protein (CPEB) is an important factor of meiosis in bovine oocytes Uzbekova, S*, Traverso, JM; Thélie, A, Perreau, C; Papillier, P; Dupont, J; Mermillod, P; Dalbiès-Tran, R Station de la Physiologie de la Reproduction et des Comportements, INRA, Nouzilly, France Introduction Maternal mRNAs accumulate in oocyte during its growth; some of them are polyadenylated and translated during meiotic maturation in order to assure the first cleavages of embryo development. In Xenopus and mice oocytes, cytoplasmic polyadenylation and sequential translation of a number of maternal transcripts are mediated by CPEB. CPEB is a protein which binds to the cytoplasmic polyadenylation element, CPE, an U-rich cis-element present in 3’ untranslated region of some mRNAs, such as coding for cyclin B1 or MOS. The aim was to characterize the expression of CPEB throughout meiosis in bovine oocytes: i) during folliculogenesis, in oocytes arrested in meiotic prophase-I; ii) during in vitro maturation (IVM) through germinal vesicle breakdown (GVBD), progression to metaphase-I (M-I), and arrest at metaphase-II stage (M-II). Results By RT-PCR analysis of twelve bovine tissues, CPEB mRNA was found to be strongly expressed in ovary and pituitary and to a lower extent in hypothalamus and in testis. Within the ovary, CPEB was detected only in oocytes. CPEB protein was localized in the cytoplasm of oocytes from primary to antral follicles. Level of CPEB mRNA in oocytes did not change significantly during IVM as measured by quantitative RT-PCR. As detected by Western blots, CPEB was hyperphosphorylated from the time of GVBD before degrading during M-I/M-II transition. Most of the CPEB protein was degraded in M-II oocytes. The remnant of CPEB protein was detected in the region of the polar body separation, which might be a contractile ring / midbody. The active Thr-phosphorylated Aurora A kinase, one of the potential activators of CPEB, was also detected in

this location. The oocytes were treated during IVM by modulators of different signaling pathways involved in meiosis: i) Roscovitine, inhibitor of CDC2/cyclinB1 complex activity, ii) U0126, inhibitor of MAPK kinase; iii) Metformine, AMP-activated protein kinase activator; iv) 3’-deoxyadenosine, an inhibitor of RNA polyadenylation. In all cases, treated oocytes did not reach the M-II stage after 24h of IVM culture, the level of MAP kinases ERK1/ERK2 phosphorylation was lower as compared with control IVM oocytes, and CPEB protein was neither hyperphosphorylated, nor degraded. Conclusion CPEB might be involved in the regulation of polyadenylation-dependent translation of oocyte transcripts during follicular growth and meiotic maturation. The hyperphosphorylation and subsequent degradation of CPEB is necessary for the correct meiotic divisions and polar body extrusion; and this might be regulated by MAPKs. P524 Selection of high quality bovine oocytes with Brilliant Cresyl Blue staining can not guarantee lower levels of apoptosis during in vitro embryo development Vandaele, L* ; Maes, D ; Van Soom, A Department of Reproduction, Obstetrics and Herd Health, Faculty of Veterinary Medicine, Ghent University, 9820 Merelbeke, Belgium Brilliant Cresyl Blue (BCB) is a marker for glucose-6-phosphate dehydrogenase (G6PD) activity in oocytes. Good quality oocytes stain blue because they lack G6PD to break down the stain. Such BCB+ oocytes are more likely to have completed their growth phase and be developmentally competent, as has been shown for bovine, caprine and porcine BCB+ oocytes. However, it is not known whether this oocyte marker may be useful to predict occurrence of apoptosis during embryo development. Therefore in the present study we compared prevalence of apoptosis in bovine embryos generated from BCB+ and BCB- oocytes. A total of 1600 immature bovine oocytes (4 replicates) were stained with 26µM BCB for 90 min and divided in BCB+ and BCB- under a stereomicroscope. After maturation and fertilization, all presumed zygotes (377 unstained controls, 1107 BCB+ and 264 BCB-) were cultured in modified SOF medium with 10% FCS at 39.0° C in 5% CO2, 5% O2 and 90% N2. Cleavage rate was determined at 45 hpi for all embryos. Embryos were selected if they possessed at least 2 cells at 45 hpi; 5 cell at 80 hpi; 9 cells at 117 hpi or were blastocysts at 168hpi. All selected embryos were fixed in 4% paraformaldehyde overnight and stained with TUNEL/anti-caspase staining (Gjørret et al., 2007). The apoptotic cell ratio (ACR) was determined for each embryo by means of fluorescence microscopy (casACR for caspase and TunACR for TUNEL is number of positive cells/total cell number*100). Mixed model analysis of variance and logistic regression were used to analyze cleavage rate and blastocysts rate, respectively. For the statistical analysis of ACR, non-parametric Mann-Whitney U test was used. Cleavage and blastocyst rate were both significantly higher in control (72.0% and 24.2%) and BCB+ (66.1% and 19.2%) in comparison with BCB- (51.1% and 7.8%) (P<0.05). Since none of the selected BCB- blastocysts possessed 60 cells, they were not incorporated in the analysis of ACR. CasACR was not significantly different at 45, 80 or 117 hpi (3.7%, 9.1% and 16.7% in BCB+ and 20.1%, 10.6% and 13.5% in BCB-). TunACR was not detectable at 45 and 80 hpi and did not differ at 117 hpi (7.4% and 5.7% for BCB- and BCB+, respectively). In conclusion, BCB+ oocytes do not necessarily generate embryos with lower levels of ACR during development, although cleavage and blastocyst development are clearly better after fertilization of BCB+ oocytes. This study was supported by a grant of Research Foundation - Flanders (aspirant 1.1.084.04N00).

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 201 P525 Laparoscopic ovum pick-up (OPU) in goat and sheep Wieczorek, J*, Kosenyuk, Y, Rynska, B; Cegla, M

Department of Biotechnology of Animal Reproduction, National Research Institute of Animal Production, Krakowska 1, Balice/Kraków Poland

New techniques for repeated, minimal-invasive oocyte recovery in living donor including goat and sheep are necessary. The employment of laparoscopy and videosurgery allowed for the working out the OPU methods. However, their use is restricted by the relatively low efficacy and reproducibility of the results. The aim of the study was to develop new techniques for repeated recovery of goat and sheep oocytes useful for culture and fertilization in vitro and cloning and evaluation of the efficacy of the established method. Oocytes were aspirated with originally designed catheter for aspiration. The oocytes donors were 65 goats and 45 sheep. Estrus was synchronized with intravaginal sponges (Chronogest CR, Intervet) for 14 days. Superovulation was obtained by the single injection of eCG (1000 IU IM) 16 - 24 hours before the removal of the sponges. Oocytes were collected 24 hours after sponge removal. The animals were premedicated, then general anesthesia was induced. The general anesthesia lasted about 15 – 20 min. The endoscope was inserted into the abdominal cavity through umbilicus. Two trockars for putting the manipulators were inserted 15 cm below the udder. Oocytes were collected by aspiration of the follicular fluid from the ovarian follicles. Depending on the size, the single aspiration of up to 8 follicles was performed. The collected oocytes were evaluated under stereo microscope. The following classification of the oocytes were established: class I – homogenous cytoplasm, at least 3 layers of the granulosa cells, class II – homogenous cytoplasm, 1-2 layers of granulosa cells, class III – homogenous cytoplasm, no granulosa cells, class IV – heterogenous cytoplasm, independent of the granulosa cells. Oocytes class I, II and III were qualified for the culture. Goats: 488 ovarian follicles were aspirated, 276 (56.6%; p<0.0001) oocytes were obtained. 95 were qualified as class I (34.4%), 132 – class II (47.8%), 41 – class III (14.9%), 8 – class IV (2.9%). 268 (97.1%; p<0,005) of the obtained oocytes were qualified for the culture. Sheep: 205 ovarian follicles were aspirated. 137 (66.8%; p<0.0005) oocytes were collected, including 44 in class I, 58 – class II, 16 – class III, 19 – class IV. 118 (81.6%; p<00001) of the collected oocytes were qualified for the culture, including 31.2% - class I, 42.3% - class II, 11.7% - class III. 13.9% (p<0.0001) of the oocytes were not qualified for the culture. The obtained results suggest the proposed technique allows for the collection good quality oocytes that can be used for IMV/IVF techniques and cloning. P526 In vitro fertilization with liquid boar semen stored at 4oC on porcine oocytes Yi, YJ*, Li, ZH; Kim, ES; Song, ES; Cong, PQ; Zhang, YH; Park, CS Research Center for Transgenic Cloned Pigs, Chungnam National University, Republic Of Korea Introduction The use of liquid semen will increase on a worldwide basis because countries continue to improve their transport methods, thus, liquid semen can be quickly delivered from a boar stud to a pig farm both within and between countries. This study were carried out to develop a method of liquid storage of boar sperm at 4oC by using the modified BF5 diluent with BSA and N-acetyl-D-glucosamine (GPL4 diluent), and to test it by in vitro fertilization with liquid semen in GPL4 diluent on porcine oocytes. Methods Semen was collected from adult Duroc boars 15-22 months of age. Boar semen was diluted with 10 ml GPL4 diluent, and was preserved in a refrigerator at 4oC for 5 days. Ovaries were collected from prepubertal gilts at a local slaughter house. Follicular fluid and cumulus-oocyte complexes (COCs) were aspirated from follicles. COCs were cultured in tissue culture medium (TCM) 199 for 44 h. After maturation, oocytes were inseminated with different sperm concentrations (2.5, 5, 10 and 20×105 sperm/ml) of liquid semen in GPL4 diluent. After insemination, oocytes were transferred into PZM-3 medium containing 0.4% BSA for further culture. The rates of

sperm penetration, monospermic oocytes, polyspermic oocytes, cleaved oocytes and blastocyst formation, and the cell numbers per blastocyst were observed under epifluorescence microscope after DAPI staining. Results There were significant differences on sperm motility according to storage period and incubation time, respectively. The normal acrosome rapidly declined at 5 h incubation at 1 day of storage. The percentage of sperm viability steadily declined from 1 to 5 day of storage during incubation. The percentage of monospermic oocytes (40.3-45.7%) did not show any differences from 2.5 to 20×105 sperm/ml. However, the percentage of polyspermic oocytes in the sperm concentration of 2.5×105 sperm/ml (18.9%) was lower than that in the sperm concentrations of 5, 10 and 20×105 sperm/ml (39.6, 45.1 and 45.2%). The percentage of blastocyst from the cleaved oocytes at 2.5×105/ml sperm concentration (15.7%) was significantly lower than that at 5, 10 and 20×105 sperm/ml sperm concentrations (30.8, 33.6 and 37.1%). The mean cell numbers of per blastocyst at 5 and 10×105 sperm/ml sperm concentrations (30.1 and 33.7) were higher than those at 2.5 and 20×105/ml sperm concentrations (26.4 and 26.8). Conclusion We confirmed that the boar sperm in GPL4 diluent can be stored at 4oC for 5 days and used for in vitro fertilization of porcine oocytes. P527 Cinematographic analysis of porcine embryo development in a chemically defined medium: comparison of in vivo-derived and in vitro-produced embryos Yoshioka, K*, Noguchi, M; Suzuki, C Research Team for Production Diseases, National Institute of Animal Health, Japan Developmental kinetics of porcine embryos matured and fertilized in vivo or in vitro from the one-cell to the blastocyst stage was investigated by time-lapse cinematography. Seven gilts were superovulated with injections of 1500 IU eCG, followed 72 h later by 750 IU hCG and were artificially inseminated 27 h after hCG administration. In vivo-derived zygotes collected 50 h after hCG administration and in vitro-produced (IVP) zygotes at 10 h after in vitro fertilization were cultured in a chemically defined medium (porcine zygote medium-5) for 140 h under cine-recording conditions. The percentage of in vivo embryos that developed into blastocysts (49/67, 73.1%) was significantly higher than for IVP embryos (46/120, 38.3%), while cleavage rates did not differ between in vivo (56/67, 83.6%) and IVP (89/120, 74.2%) embryos. When the time of cleavage to 2-cell in each embryo was defined as 0 h, the mean time of first appearance at the 3- to 4-cell, the 5- to 8-cell, and the 9-cell to the morula stages was significantly delayed in IVP embryos compared to in vivo embryos. The mean duration of the second cell cycle for in vivo embryos (9.6 h) was significantly shorter than for IVP embryos (15.5 h). The duration of the third (34.1 to 34.7 h) and fourth (18.8 to 19.0 h) cell cycles did not differ between in vivo and IVP embryos. Of the embryos that reached to the more than 9-cell stage by day 6, the proportion undergoing developmental arrest (lag-phase) around the 4-cell stage (from 3- to 8-cell) significantly differed between in vivo (53/53, 100%) and IVP (45/54, 83.3%) embryos. The number of cells in embryos at the onset of lag-phase was significantly lower for embryos that developed to the blastocyst stage by day 6 (4.2 cells) compared to embryos that ceased to develop at the 9-cell to morula stage (4.9 cells). Time of onset of the lag-phase for embryos that ceased to develop at the 9-cell to morula stage, was significantly later than for embryos that developed into blastocysts. However, the mean duration of the lag-phase (37.6 to 39.7 h) did not differ between groups. Our results suggest that the characteristics of the lag-phase, such as stage and time of onset of the lag-phase, may influence subsequent embryo development. Since the lag-phase is considered to reflect the transition from maternal to embryonic control of development, differences in the duration of the second cell cycle between in vivo and IVP embryos may relate to the quality of oocyte maturation.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 202 P o s t e r A b s t r a c t s P528 Development of reconstructed embryos from human somatic cells and ovine enucleated oocytes and isolation of putative human embryonic stem cell clones Zhou, MH*; Zhao, J Faculty of Bioengineering, Inner Mongolia Agricultural University, China Introduction Since the difficulty of obtaining human embryos limited the production of human embryo stem cells this research was to clone heterogeneous embryos by using human fetal skin fibroblast cells as nuclear donor cells and the enucleated ovine oocytes as recipient cytoplasts for examining the developmental potential of the reconstructed embryos to attempt to isolate human embryonic stem cells. Methods Ovine oocytes were collected from slaughterhouse-derived ovaries, in vitro matured and enucleated then used as recipient cytoplasm. Human fibroblast cells was obtained from an aborted 4-month aged fetus skin and employed as donor somatic cells. The cell was injected to sub-zona pellucida of oocyte and fused electrically into ooplasm then activated by Inomycin with 2 M/ml 6-dimethylaminopurine (6-DMAP). Only the activated reconstructed embryos were co-cultured with ovine cumulus cells in synthetic oviduct fluid supplemented with amino acid (SOFaa) and 10% (v/v) fetal calf serum (FCS). These heterogeneously cloned embryos were morphologically monitored for their developmental competence at 48h to 168 h of culture. The cell mass of morula or blastocysts were cultured on mouse fibroblast feeder layer and used for the isolation of embryonic stem cell clones. The clones of putative human embryonic stem cell were identified by alkaline phosphatase (AKP). Results The human fetal skin fibroblast cells maintained morphologically normal characteristics and normal numbers of chromosomes (2n = 64) in culture. The reconstructed human embryos completed the first cleavage of between 24 to 48 h and morula/blastocyst development in 72 h to 168 h after activation. 27% of the reconstructed embryos underwent the cleavage while only 15% of the cleaved embryos proceeded to develop to morula/blastocyst. The clones of putative embryonic stem cell grew on fibroblast cell layer, with nest- or islet-like morphology after 3 to 7 days culture. AKP staining of the clones showed positive reaction. Conclusions Human fetal fibroblast cell nuclei can be reprogrammed in ovine enucleated oocytes. The heterogeneously nuclear-transferred human embryos can undergo the meiosis division and subsequent development to morula/blastocyst stage thus serving as an alternative for obtaining human embryonic stem cells. The improvement of the reconstructed embryo developmental ability, however, is a future challenge. Poster 19 - Biomedical Models in Reproductive and Regenerative Medicine P529 Embryonic Stem Cells derived from Separated Blastomeres of Cynomolgus Monkey as a Model System of Regenerative Medicine Hosoi, Y1*, Teramura, T2, Takenoshita, M3, Takehara, T1, Matsumoto, K1, Saeki, K1, Fukuda, K2, Iritani, A1 1Dept of Genetic Engineering, Kinki University, Japan; 2Dept of Orthopedic Surgery, Kinki University, Japan;3Keari Co. Ltd., Japan Objective Recently, ESCs (Embryonic Stem Cells) were established from single blastomeres of preimplantation embryos in mice and humans. These methods have been suggested to reduce ethical concerns since we can obtain pluripotent ESCs without interfering embryonic development. Furthermore, these results also give rise to important information about polarity of mammalian embryos. Although totipotencies of separated blastomeres have been experimentally determined in rodents and some domestic animals, only one live-birth was reported in primate. Here, we succeeded in

establishment of ESCs from single blastomeres of two-cell and four-cell embryos in cynomolgus monkey. Methods In this study, we cultured the separated blastomere in zona pellucida prepared from inmatured oocytes. Manipulated embryos were cultured in mCMRL medium until blastocyst stage. By this method, the blastomeres could maintain cell-to-cell interaction with each blastomere after cleavage, and resulted in blastocysts with normal morphology. ICMs were collected from the embryos by immunosurgery, and cultured on mitotically inactivated-MEF feeder layer. Pluripotency and undifferentiated status of ESCs were evaluated by RT-PCR, immunocytochemical staining and formation of teratoma. Results Two ESCs were established from separated blastomeres (Two-cell; 1/8, Four-cell; 1/4, Normal embryos as control; 3/11). Both cell lines expressed ALP, Oct-4, Nanog, SSEA-4, TRA1-60 and TRA1-81 in undifferentiated state. Furthermore, differentiation potencies were also determined by in vitro differentiation and teratoma formation. Conclusion We succeed to establish ESCs from separated blastomeres of non-human primate. It could be important model for developmental competence of cleaved blastomeres, and suggest an effective tool for pre-clinical research for a regenerative medicine. P530 Effects of physiological and non-physiological insulin-like growth factor-1 (IGF-1) concentrations on the in vitro development of bovine embryos Velazquez, MA1,2*; Korsawe, K1; Niemann, H1 1Department of Biotechnology, Institute for Animal Breeding, Mariensee, Neustadt, Germany; 2Escuela Superior de Ciencias Agropecuarias, Universidad Autonoma de Campeche, Mexico Introduction Physiological concentrations of IGF-1 can exert positive effects in bovine embryos. However, detrimental effects on bovine oocyte morphology (Reproduction 133:1121-28, 2007) and murine embryo development were found with high concentrations of IGF-1, resembling the non-physiological IGF-1 levels associated with early pregnancy loss in women with the polycystic ovary syndrome (Diabetes 56:2228-34, 2007). Determination of the effects of normal and abnormal IGF-1 milieus on embryo development is important for the understanding of embryonic plasticity in order to improve the effectiveness of embryo technologies. The goal of this study was to determine the effects of physiological and non-physiological concentrations of IGF-1 on the development and number of cells of in vitro-produced bovine embryos. Materials and methods Oocytes obtained by slicing from abattoir ovaries were matured (24 hrs) and fertilized (18 hrs) in vitro. For culture, zygotes were placed randomly in three groups: a) control (synthetic oviduct fluid [SOF]/Bovine serum albumin [BSA]), b) physiological IGF-1 (SOF/BSA + 100 ng/mL IGF-1) or c) non-physiological IGF-1 (SOF/BSA + 1000 ng/mL IGF-1). On day 8, blastocyst rates were recorded and differential cell staining was applied to count the number of inner cell mass (ICM) and trophectoderm (TE) cells. Data from 14 replicates were analyzed statistically. Results Cleavage was improved by both 1000 (62.7 ± 2.1, P=0.001) and 100 (59.3 ± 3.7, P=0.04) ng IGF-1 over controls (52.4 ± 3.2). The proportion of hatched blastocysts was enhanced by 100 (5.1 ± 1.3, P=0.006) and 1000 (4.1 ± 0.8, P=0.02) ng IGF-1 compared to controls (1.9 ± 0.4). Total blastocyst rate was increased by 100 ng IGF-1 (30.9 ± 1.8, P=0.03) over controls (25.0 ± 1.9), but not by 1000 ng IGF-1 (28.4 ± 2.0 P=0.25). There was a tendency (P = 0.07) for the 100 ng IGF-1 group (45.0 ± 4.5) to have less degenerated embryos compared to 1000 ng IGF-1 (53.9 ± 3.8). 1000 ng IGF-1 increased the number of cells in the ICM (37.0 ± 2.2, P=0.007) and the proportion of blastocysts (22.8% P=0.01) with an increased ICM:total cell ratio (≥ 40 %) compared to controls (26.0 ± 1.4 and 0% respectively). Perspective Gene expression and apoptosis analysis are needed to further characterized the effects of different IGF-1 milieus on bovine preimplantation embryo development. M.A.V. is supported by DAAD.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 203 Poster 20 - Gene Modified Animals (Transgenics) P531 Glycemia and leptinemia are related to changes in reproductive fitness of transgenic mice overexpresing pancreatic glucokinase Ballester, J1*; Agudo, J1; Bosh, F1; Rodriguez-Gil, JE2 1CBATEG, Autonomous University of Barcelona, E-08193 Bellaterra. Spain; 2Dept. Animal Medicine and Surgery, Autonomous University of Barcelona, E-08193 Bellaterra. Spain This study was focused in the effects of the overexpression of the glucokinase (GK) gene in pancreatic islets on reproductive fitness by utilising an specific Ins-GK transgenic mice showing this phenotype. The GK overexpression induced a clear drop in the prolificacy of Ins-GK mice (8.14±0.83 newborn/delivery in control mice vs. 3.73±0.17 newborn/delivery in Ins-GK animals). At the same time, Ins-GK animals showed a clear hypoglycemia (90.4±2.9 mg/dL in control mice vs. 61.3±2.4 mg/dL in Ins-GK animals) besides a significant (P<0.05) decrease in serum leptin levels (4.3 ng/mL in control mice vs. 1.3 ng/mL in Ins-GK animals). Strikingly, insulinemia was not changed by GK overexpression. All of these hormone changes were associated with concomitant changes in serum levels of several reproductive hormones. In this way, serum FSH dropped significantly from 20.1±3.8 ng/mL control mice to 8.12±1.2 ng/mL in Ins-GK animals, whereas serum LH and testosterone were not significantly different between groups. Serum FSH decrease was also associated with a concomitant decrease in epydydimal sperm total count (17.1x106 ± 0.7x106 sperm in control mice vs. 12.3x106 ± 0.5x106 sperm in Ins-GK animals) that was correlated with a decrease of tubule diameter and tubule density in the testis through morphometric analysis. Moreover, Ins-GK mice had around 30% less normal spermatozoa than control mice. Basically, it was due to an increase of sperm abnormalities in the head (4.3±0.7% in control vs. 7.1±2.1% in Ins-GK) and neck-midpice (28.4±1.7% in control vs. 57.7±1.3% in Ins-GK). Our results suggest the hypoglycemia-associated decrease of serum leptin levels could lead to the observed, concomitant decrease in FSH, since previous studies have involved leptin as an stimulating factor of gonadotrophin release from hypophysis. As a final result of the combined drop of both leptin and FSH, spermatogenesis would be affected, despite of libido of transgenic mice were not affected, as indicate serum testosterone and LH levels. The resultant spermatogenesis alteration would result in the observed increase of sperm abnormalities, which, in turn, would be in the basis of the observed decrease in the overall reproductive fitness of Ins-GK mice. P532 Presence of exogenous DNA reduces the viability and motility of frozen thawed bovine spermatozoa Cánovas, S1*; Gutiérrez-Adan, A2; Gadea, J1 1Department of Physiology. Faculty of Veterinary Science, University of Murcia, Spain; 2Department of Animal Reproduction. INIA, Madrid, Spain Introduction Sperm mediated gene transfer is an alternative for generating transgenic cattle by means of using natural ability of spermatozoa to transfer DNA into the eggs (Schellander et al., 1995; Sperandio et al., 1996). Sperm motility is a major factor on its ability to fertilize. However, contradictory results about the effect of exogenous DNA on motility have been reported (Rieth et al., 2000; Anzar and Buhr, 2005). The aim of this study was to evaluate if the incubation of the spermatozoa with exogenous DNA affects further viability and motility, using CASA system and flow cytometry that provided objective, accurate, and reproducible methods compared to traditional microscopy-based methods (Verstegen et al, 2002; Graham, 2001). Methods Frozen semen from 4 tested bulls were thawed and processed with a Percoll gradient and finally diluted on Sperm-Talp (Parrish et al. 1988). DNA-group consisted of 1x108 sperm/ml incubated with 5μg DNA/ml (linealized plasmid EGFP DNA 5.4 kb) and kept in an incubator at 37°C for 60 min. Control group was the

same but without DNA incubation. Sperm viability was assayed by staining with propidium iodide (500ng/ml) and measured by flow cytometry (Coulter Epics XL, Beckman Coulter) at 1, 5, 15, 30, 45 and 60 minutes of incubation. Motion parameters were determined using a CASA system (Sperm Class Analyzer, Microptic, Barcelona, Spain). Three replicates per bull were analyzed. Results Results showed that the incubation of bovine spermatozoa with exogenous DNA (5µg/ml) increased the percentage of unviable bovine spermatozoa (20.94±0.21 vs.23.37±0.21; p<0.01), decreased total motility (83.98±0.50 vs. 75.12±0.56%; p<0.01) and progressively motility (81.40±0.53 vs. 71.71±0.61%; p<0.01). Moreover, sperm motion parameters as curvilinear, straight-line and average path velocities, linearity of the curvilinear trajectory, straightness and beat cross-frequency were reduced after the incubation with DNA. However a significant increase in the amplitude of lateral head displacement was detected in DNA group. Besides, significant differences between males and an effect of time of incubation were observed. Conclusions The observed decrease of the viability and motility of the frozen-thawed bovine spermatozoa incubated with exogenous DNA could be due to activation of sperm endonucleases in response to the interaction with foreign DNA, which could cause apoptosis-associated DNA cleavage and subsequent cell death as it has been previously suggested (Anzar and Buhr, 2005; Maione et al., 1997). Supported by BIOCARM 10BIO2005/01-6463 and MEC-FEDER AGL2006-03495 P533 Bovine Sperm Mediated Gene Transfer: Use of flow cytometer to evaluate binding exogenous DNA to sperm and its further viability Cánovas, S1; Gutiérrez-Adan, A2; Gadea, J1* 1Department of Physiology. Faculty of Veterinary Science, University of Murcia, Spain; 2Department of Animal Reproduction. INIA, Madrid, Spain Introduction The sperm mediated gene transfer (SMGT) is a technique that provides the opportunity to generate transgenic animals using the capacity of the spermatozoa to bind to exogenous DNA (Lavitrano et al, 1989). The binding of exogenous DNA to bull spermatozoa has already been reported by scintillation counting, autoradiography and epifluorescence microscopy (Atkinson et al., 1991; Schellander et al., 1995; Anzar and Buhr, 2006; Alderson et al., 2006, Hoelker et al., 2007). Objetive Our goal in this study was to evaluate the capacity of binding of exogenous DNA to bovine spermatozoa and the further sperm viability by means of flow cytometry, that provides an objective, accurate and reproducible method compared to traditional microscopy-based methods (Graham, 2001). Methods Frozen semen from 4 tested bulls were thawed and processed by a Percoll gradient and finally diluted on Sperm-Talp (Parrish et al. 1988). Linealized plasmid EGFP DNA (5.4 kb), marked with random primed DNA labeling method with fluorescein-12-dUTP (Roche, Germany) was added (1x108 sperm/ml+ 5μg DNA/ml) and incubated at 15ºC during 90 min. At the same time viability was assayed by staining with propidium iodide (500ng/ml). DNA binding and sperm viability was simultaneously measured by flow cytometry (Coulter Epics XL, Beckman Coulter) at 1, 5, 10, 15, 30, 45, 60, 75 and 90 minutes of incubation. 3 replicates per bull were analyzed, measuring 30.000 cells per sample at each incubation time. Results Bovine spermatozoa were able to bind exogenous DNA as soon as in 5 minutes (from 3.38±0.94 at min 1 to 26.10±1.12% at min 5, p<0.01) and maintained close to 30% of DNA binding during all the incubation period (90 min). Also significant differences between males were observed (p<0.01) ranging the mean values of DNA binding from 19.96±0.91 to 30.77±1.44. During the incubation a reduction in viability was detected (p<0.01) from 21.13±1.12 at 1 min to 27.15±1.13% dead cells after 90 min. When the number of live spermatozoa with DNA-bound was assessed we observed as mean value 13.84±0.22 % and the mean value of dead spermatozoa bound to DNA was 15.21±0.28%.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 204 P o s t e r A b s t r a c t s Conclusions These preliminary data suggest that flow cytometry could be used for evaluating sperm DNA binding capacity. Besides this study shows that under our experimental conditions the capacity of binding of DNA to bull frozen-thawed bull spermatozoa is related to viable and unviable cells. These facts maintain opened the possibility of using this technique in IVF systems for generation of transgenic bovine embryos. Supported by BIOCARM 10BIO2005/01-6463 and MEC-FEDER AGL2006-03495 P534 On the role of LIF and LIFR expression during rabbit embryonic stem cell line establishment Gócza, E.*, Catunda, AP., Hiripi, L., Bősze, Zs. Agricultural Biotechnology Center, 2100, Szent-Györgyi A. str. 4, Gödöllő, Hungary Embryonic stem cells (ES) have become an important tool for generating transgenic mice. Embryonic like stem cells and ES chimeric animals have been reported for several farm animal species, but germ line transmission was not reported. Rabbit ES cells, established in our laboratory, by their growth in tightly packed, flat colonies resembled to human ES cell lines, while expression of alkaline phosphatase, Oct-4, Nanog, SSEA-1 and CD9 which were detected by immunostaining made them similar to mouse ES cells. Leukemia inhibitory factor (LIF) is necessary for mouse ES cell self-renewal, but it fails to maintain self-renewal in human and non-human primate ES cells. To examine the role of LIF and leukemia inhibitory factor receptor (LIFR) at rabbit ES cell line establishment, the expression patterns of LIF and LIFR were analysed at different stages of rabbit embryonic development and LIFR expression in rabbit ES cells by RT-PCR at different passages. LIFR mRNA was first detected around implantation in 6.5 d.p.c. rabbit embryos, while LIF mRNA expression was already present at rabbit blastocyst stage. In attached ICM and in ES cells after the 1st passage, very low level of LIFR expression was found. After the 2nd passage high expression of LIFR was detected in rabbit ES cells. Since commercial rabbit LIF is not available we had to find the most effective recombinant LIF for rabbit ES cell establishment. With this object human, rat and mouse recombinant LIFs were compared. At early passages we could not find any difference in their effect, but at higher passage numbers, the rat LIF was found to be the most efficient factor in the prevention of the differentiation. LIF withdrawal resulted the differentiation of rabbit ES like cells into cardiomyocytes. These findings suggest that the the LIF-LIFR signal pathway has an important role in maintenance of pluripotency of rabbit ES cells. This work was supported by grant OM-00367/2004, OTKA T037582 and Bilateral Intergovernmental S and T Cooperation D-26/02 (HUN02/045). P535 Succesful h-lactoferrin transgenic goat embryo transfer after SCNT Mutto, A1*#; Kaiser, GG2#; Mucci, N2#; Hozbor, F2; Sanchez, E2; Ugalde, R1; Alberio, RH2 1IIB, UNSaM, Argentina; 2INTA Balcarce, Argentina #Authors contributed equally to the present work Because of its properties (digestibility, composition, taste), goat milk is suitable to be used as a substitute for cow milk in patients with cow milk allergy and for human nursling babies with no tolerance to lactose. By adding some sugars, lisozime C and lactoferrin it will be possible to have a “humanized” goat milk. The objective of this work was to produce transgenic clone embryos and pregnancies for human lactoferrin in goats by using somatic cell nuclear transfer of transfected fetal goat fibroblasts. Materials and methods A 1960bp human lactoferrin cDNA (Gen Bank n: NM_002343) obtained from ATCC encompassing the entire coding region was used as template. It was cloned into pBC1 milk expression vector (Invitrogen, Ca, USA) between the intron 1, exon 2

and exon 7 of goat β-casein gene. An eukaryotic selection marker cassette with a Blasticidin-S resistence gene was added, under h-EF1α promotor. Goat fetal fibroblasts obtained from 30 day pregnancies were sexed by PCR and karyotyped and female cell lines were transfected by liposomes (Lipofectamine 2000®, Invitrogen, USA). Colonies were selected after 10 days of culture with Blasticidin and grown in complete culture media (D-MEM). Stable transfections were confirmed by FISH. Oocytes were obtained by laparoscopic ovum pick-up of stimulated goats during the reproductive season, in vitro matured and subjected to nuclear transfer as described by Baldassarre et al (2004). Presumptive zygotes (24 hs after NT) were transfered by a surgical procedure in both oviducts of those animals that presented at least 2 hemorrhagic corpora lutei. Results A total number of 331 oocytes were recovered from 480 follicles after 5 sessions of LOPU (8 goats each session). All oocytes that presented a polar body were enucleated and transferred (n=238). There was an overall fusion rate of 51%. A total number of 121 presumptive zygotes were transfered to 12 goats (7 to 12 per recipient), resulting in 5 pregnancies at day 30 (41.6% pregnancy rate) and 2 at day 83 (16.6%). Two pregnancies were twins, one remaining until day 83. We can conclude that under our conditions it is posible to obtain transgenic goat fetal fibroblasts, embryos and pregnancies for human lactoferrin. For our best knowledge this is the first report of goat h-lactoferrin transgenic pregnancies by using SCNT technique. P536 Towards generation of human A20 gene transgenic pigs with improved features in xenotransplantation Oropeza, M1,2*, Petersen, B1, Herrmann, D1, Hassel, P1, Lucas-Hahn, A1, Lemme, E1, Queisser, AL1, Niemann, H1 1Dept. of Biotechnology, Institute for Animal Breeding, Mariensee, Neustadt, Germany; 2University of Veterinary Medicine, Hannover, Germany Introduction Xenotransplantation is considered as promising to close the growing gap between demand and availability of appropriate human organs. While the hyperacute rejection response can already be reliably controlled, the acute vascular rejection (AVR) remains a major hurdle for longterm survival of xenografts in a porcine-to-primate organ transplantation. The human A20 (hA20) gene exhibits both antiapoptotic and anti-inflammatory properties in endothelial cells (Transplantation 82 : 36-40, 2006) and could thus prevent endothelial cell activation leading to AVR and xenograft destruction. The goal of this project is to produce transgenic pigs with improved features in xenotransplantation by transgenic expression of hA20. Materials and Methods The hA20-expression vector driven by the ubiquitous CAGGS hybrid promoter (chicken β-actin-/ rabbit β-globin) containing an IRES-neomycin resistance cassette (9.1 kb) was transfected into porcine fetal fibroblasts (PFFs) derived from German Landrace porcine fetal explant cultures. Transfection of 3 x 106 cells was accomplished at 450 V and 350µF with 10 µg plasmid DNA. G418-resistant (800 µg/mL) cell clones were screened by PCR with hA20 specific primers for hA20-integration. Somatic cell nuclear transfer (SCNT) was performed as recently described (Cloning Stem Cells 7: 35-44, 2005). Results A total of 80 cell clones were hA20-positive in PCR screening from 4 rounds of transfection after a 14 days G418 selection period. 30 positive cell clones were re-selected for 14 days with G418. Four of these cell clones were used as donor cells for SCNT. Immediately after SCNT, reconstructed embryos were transferred to a total of 10 synchronized recipient sows. Ultrasound examination on day 23-25 of pregnancy confirmed established pregnancies in 7 of 10 recipient sows. Two animals were sacrified on day 30 of pregnancy and a total of 8 fetuses were isolated. PCR and Southern Blot analysis showed integration of the hA20 gene in 6 of 8 fetuses. Conclusions The hA20-vector can be integrated in PFFs and hA20 transgenic PFFs can successfully be used in SCNT to establish pregnancies. Further analysis will focus on the expression patterns in A20-positive cell clones and the biological function of hA20 in transgenic piglets. A second approach will be to introduce an

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 205 endothelial specific promoter active in pigs and thus target expression of hA20 to the endothelial cell layer. Providing the endothelial cells with a higher antiapoptotic potential could decrease their susceptibility to cell death. P537 Expression of an omega-3 fatty acid desaturase gene from scarlet flax in bovine transgenic embryos cloned from transfected somatic cells Saeki, K1*, Indo, Y1, Tatemizo, A1, Suzuki, I2, Matsumoto, K1, Hosoi, Y1, Murata, N3 1Department of Genetic Engineering, School of Biology-Oriented Science and Technology, Kinki University, Japan; 2Laboratory of Plant Physiology and Metabolism, University of Tsukuba, Japan; 3National Institute for Basic Biology, Japan Introduction Long chain n-3 fatty acids are considered desirable in human diets because they can lower the risk of coronary artery disease, cancer and inflammatory diseases. n-3 fatty acids are found in fish oils and specific plant oils. But their levels in animal meats are quite low, because mammals lack the gene for converting linoleic acid to alfa-linolenic acid. Recently, it has been reported that a humanized nematode gene, hfat-1, can be used to increase the levels of n-3 fatty acids in transgenic pigs. We report here functional expression of a plant-derived gene for an omega-3 fatty acid desaturase (FAD3) in gene-transfected bovine cells and production of embryos cloned from the transfected cells. Methods The gene was isolated from immature seeds of scarlet flax, because the level of alfa-linolenic acid of the flax seeds is the highest among terrestorial plants. Bovine muscle satellite cells were isolated from a 9-month-old male calf. The codon usage of the flax FAD3 cDNA was optimized (humanized) for high expression in mammalian cells. A plasmid (pIRES2-EGFP) containing the humanized FAD3 gene (hFAD3) under the control of the CAG promoter, and a neomycin-resistance cassette (pCAG/hFAD3/IRES/EGFP/(neor)) was transfected to the satellite cells with a transfection reagent ( GeneJammer ). The stably transfected cells were differentiated to multilocular adipocytes by culturing with bFGF, dexamethasone and octanoic acid. Total lipids were isolated from the adipocytes and their fatty acid composition was analyzed by gas chromatography. We then produced cloned bovine embryos using the hFAD3 cells. The cloned embryos were cultured to the blastocyst stage. Blastocyst rates and gene expression of EGFP and hFAD3 were then examined. Results The level of total n-3 fatty acids in the hFAD3 cells (12.5%) was higher than that in the control cells (9.1%, P<0.05). Moreover, the level of 22:6n-3 was higher in the hFAD3 cells (6.4%) than in the control cells (3.6%). In addition, the level of n-6 fatty acids was lower in the hFAD3 cells (19.2%) than in the control cells (23.9%, P<0.05). Blastocyst rates of the hFAD3 clones were the same as the control clones (21% vs 35%, P>0.05). EGFP expression was detected in all of the hFAD3 blastocysts. hFAD3 transcripts were detected in all of the blastocysts by RT-PCR. Conclusions Our results indicate that the hFAD3 gene was functionally expressed in bovine culture cells and was expressed in cloned embryos reconstructed with the transfected bovine cells. P538 Sperm characteristics in boars produced by two methods of cloning Schmidt, M1*, Boe-Hansen, GB2, Synnestvedt, B1, Bøgh, IB1 1Faculty of Life Sciences, University of Copenhagen, Denmark; 3School of Veterinary Science, University of Queens, Australia In several species, nuclear transfer has shown to cause an increased frequency of high birth weight, malformations, and neonatal death, however, the reproductive capacity of the surviving clones has not yet shown to be compromised. The aims of this study were to investigate the sperm characteristics of boars produced by handmade cloning (HMC) and compare the parameters with littermates produced by traditional cloning (TC), and of boars produced by AI. Materials and

methods: HMC embryos were produced from one foetal cell line (LY x D) and TC embryos from another (LYD x LYD) by techniques described (Du et al, 2007). Through an abdominal incision 40-60 embryos (69% HMC and 31% TC) were transferred to each of 12 sows. Caesarean sections were performed at D115 and the piglets reared with their dam. They were weaned at an age of 4 weeks, and at 8 month the surviving boars (6 TC and 10 HMC) were trained to ejaculate. At 9-10 months of age two ejaculates were collected 3-4 weeks apart and examined for volume, motility, sperm concentration and viability (NucleoCounter, ChemoMetec A/S, Dk), and morphology (Eosin Nigrosin stain). Aliquots of 1 mL were frozen in LN2 for later examination of sperm chromatin structure. Ejaculates from five boars of the same age and size from an AI station served as controls. The data were analysed using Fishers SEM values. One TC boar had±Exact test and presented as LS means fever at the days of semen collection and the samples were rejected. Furthermore, three HMC boars were eliminated from the study, because of immaturity (n=2) or due to continuous masturbation (n=1). Results: No differences in total sperm number, motility and viability were found between neither boars produced using the two cloning methods nor between cloned and control boars. However, the sperm morphology was compromised in the cloned boars since a lower proportion of live (eosin negative) normal sperms without defects were detected in semen from the cloned boars (63.9 ± 2.3%) than control boars (83.3 ± 3.4%). Especially an increase in the number of sperms with head defects was detected. Conclusion: These preliminary results demonstrate that littermates created using two methods of porcine cloning produce semen of apparently normal concentration and motility; however an increase in the number of morphological defects was found compared to the control AI boars. The examination of the sperm chromatin structure is still in progress and may elucidate this difference. P539 Role of overexpression of inhibin α (1-32) fragment in bovine granulosa cell proliferation, apoptosis, steroidogenesis and development of co-cultured oocytes Geng, LY; Fang, M; Jiang, F; Muhammad, MD; Yang, LG; Wen, QY* College of Animal Science & Technology，Huazhong Agricultural University, China Introduction Inhibin is one of important regulators of folliculogenesis and the best marker of ovarian cancer. The fragment of inhibin α-subunit mimics biological function of the complete inhibin chain. In our previous studies, we have constructed several kinds of recombinant plasmids containing inhibin α (1-32) fragment gene, and the bioactivity has been proven by both immune cross reactions and active immunization experiments in rat, sheep and cattle. This study aims to evaluate the effects of overexpression of inhibin α(1-32) fragment (pEGISI) on proliferation, apoptosis, and steroidogenesis of GCs (granulosa cells), oocyte maturation and subsequent embryonic development. Methods pEGISI, containing two inhibin α (1-32) fragments linked to HBsAg S (Hepatitis B surface Antigens) with an EGFP (Enhanced Green Fluoresce Protein) at the 3’ terminal, was constructed previously in our laboratory. GCs from both small (1 to 4 mm in diameter) and medium (>4 to 8 mm in diameter) sizes of ovarian follicles were transfected with liposome alone, both liposome and EGFP, or liposome and EGFP in combination with pEGISI respectively. The transfection procedure was performed according to the Lipofectamine2000 manufacturers’ instructions. Cell proliferation was quantified by the CellTiter 96® AQueous One Solution Cell Proliferation Assay. Cell apoptosis was detected using an Annexin V-FITC/Propidium Iodide for flow cytometry. Steroidogenesis was evaluated by measurements of both estradiol and progesterone in culture via radioimmunoassay methods. Maturation of oocytes co-cultured with transfected GCs and subsequent embryo developments were also investigated. Results The transfection with pEGISI inhibited proliferation of GCs from medium follicles (P<0.05), but had no effect on GCs from small

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 206 P o s t e r A b s t r a c t s follicles. The apoptosis of GCs was increased in pEGISI treatment group compared with controls from both medium and small follicles (P<0.01). Estradiol synthesis of transfected GCs was increased in a time dependence manner in medium cultured for 48 h. However, after culture for 96 h, it inhibited estradiol production of GCs from medium follicles. The transfection with pEGISI inhibited the progesterone synthesis of GCs from both medium and small sizes of follicles (P<0.05). Moreover, maturation rate of oocytes co-cultured with transfected GCs from medium follicles was decreased, although the subsequent embryo developments were not influenced. Conclusions The results showed that overexpression of inhibin α (1-32) fragment could regulate GCs development and the subsequent oocyte maturation and the effects changed with the development stage of follicles. Poster 21 - New Methods in Care of Reproduction P540 In vitro Differentiation and Cryopreservation of Bovine Male germ-line stem cells Chen, J* Institute of Animal Science, Xinjiang Academy of Animal Science, China Male germ-line stem cells (mGSCs) have capability of self-renewal and latent capability of differentiation. mGSC is the unique diploid immortal cell which can transfer genetic information to filial generation. The combination of transgenic technology and mGSCs hetero-traspanting will supply some new opportunities and paths for cloning animal, transgenic animal and gene therapy of some human hereditary disease. The experiment studied the isolation, cultivation and cryopreservation of mGSC which isolated and purified from four 5-6 month old bovine fetal testisis, new born bovine testisis by adopting mixed enzymes digestion and different attaching velocities methods. The results as follow: 1.The results showed bovine testis in this period is suitable for isolating and purifying Sertoli cells; 0.25% trypsin+0.02%EDTA is an efficient method to digest bovine fetal Sertoli cells; we also found that the optimal period for in vitro study of Sertoli cells is 3-20 days, bovine fetal Sertoli cells in logarithmic phase can significantly promote the development of bovine IVF embryo in vitro. 2. The Sertoli cells is indispensable to mGSC’s proliferation and differentiation in vitro. The Sertoli cells in logarithmic phase obviously promote the attaching, proliferation and differentiation on mGSC. After 48h co-culture with Sertoli cells, some mGSC divides to a pair (Apr) and then to chains from 3 to 13 cells (Aal) after 4 days culture. After 6 days, bird-nest-like and mountain-like colonies were observed with positive alkaline phosphatase (AKP) staining. 13 days later, spermatocyte were observed, which characteristic of twofold volume of mGSC, and nucleus were amethyst, cytoplasmas were spodo-violet staining by Wright-Giemsa. After 16 days co-culture with Sertoli cells, mGSC differentiated into elongation spermtids. 3. The upper limit time of bovine fetal’s testis preservation in 4℃ is 48h. Those methods are not suitable for cryopreservation of mGSC, which are program freezing of Bovine embryo ,cryopreservation of Bovine semen and vitrificated cryopreservation of Bovine embryo. Cryopreservation of mGSC method should refer to cell line freezing method. It is suggested that mGSC cryopreserved should be separated at first. Key words: bovine, Sertoli cells, Male germ-line stem cells (mGSCs) inducing differentiation, Cryopreservation

P541 Sperm DNA fragmentation in mammalian species is a dynamic process: evaluation using the sperm chromatin dispersion test (SDC) Gosalvez, J1*, Roy, R1, Gosalbez, A1, Arroyo, F1, García-Hurtado, J1, Fernandez, JL2, Cortes-Gutierrez, E1, Lopez-Fernandez, C1 1Biology, Universidad Autonoma de Madrid, Spain; 2Genetica, Hospital Juan Canalejo, Spain The main objective of this investigation was determine the differential dynamic increase of sperm cells with fragmented DNA in semen samples from mammalian species after exposure to a temperature excursion episode (chilled/frozen) and 37C temperature rewarming, to simulate insemination. To this purpose, a prospective study in 10 different species was performed. Frozen sperm samples, as used for artificial insemination, were thawed and incubated at 37C and sperm DNA fragmentation was assessed at different times (from T0 up to various days, depending on the species). Species: Human, boar (2), bull, ram, goat, stallion, donkey, rabbit and koala. A total of 965 individuals were included in the analysis. Sperm DNA Fragmentation (SDF) was assessed using the Sperm Chromatin Dispersion test (SCD-test; commercial modification Sperm-Halomax and Halosperm). The SDF index commonly found among individuals which were selected for reproductive characteristics (boar, bull, ram, goat, rabbit) was relatively low (5 to 10%), while in those species selected for other biological characteristics (human, stallion, donkey) exhibited a wider range of SDF (in some cases close to 50%). In all species, when spermatozoa experience a severe (frozen) or mild (cooled) change in the biological temperature, SDF is induced and causes the subsequent decline of sperm quality. In all analyzed species, SDF index increases when the biological sperm temperature is resumed. However, the period of time for SDF triggering varies from one species to another and could be detected just at the onset of the biological temperature recovery (human, ram, goat, stallion, rabbit, donkey) or could be delayed for a period of 72 h of incubation (bull) or even several days (some boars). In most species, SDF in frozen-thawed samples was detected at the onset of sperm incubation at 37C, but an increase of SDF was not observed if the fragmentation was immediately assessed after thawing. Interestingly, the general pattern of SDF timing was not totally strict within the same species and differences were observed when different individuals were compared. P542 Comparison between combined laparoscopic-open ovariectomy (CLOO) and laparotomic ovariectomy Minoia, G.*, Rizzo, A., Mutinati, M., Spedicato, M., Roscino, MT., Sciorsci, RL. Department of Animal Production, Faculty of Veterinary Medicine, Bari, Italy Combined Laparoscopic-Open Ovariectomy (CLOO) is a new technique consisting of the classic induction of pneumoperitoneum followed by the introduction of a tiny videocamera in order to visualize uterine horns (laparoscopy) and by an incision of the abdominal wall at the landmark of the ovarian bursas, in order to exteriorize them and to proceed with the excision of the ovaries (open). The aim of this study is to compare the systemic impact of CLOO, with the laparotomic one. 50 mix-bred anestral bitches (2 to 7 years) weighing 10-30 kg underwent a clinical evaluation in order to assess the phase of the oestrous cycle and to confirm their healthy status. The bitches were randomly divided in two groups, each consisting of 25 animals: Group A, undergoing ovariectomy by CLOO technique; and Group B, undergoing classic ovariectomy. In order to evaluate the concentrations of cortisol and Reactive Oxygen Species (ROS), 6 venous blood samples were collected from each bitch: T0=just before premedication; T1=20 minutes after the beginning of surgery; T2=at the end of the skin closure; T3, T4, T5=1 hour, 24 hours and 96 hours after the end of the skin closure, respectively. 3 arterial blood samples (T0, T1, T2) were collected from the femoral artery of each bitch at the same times of the corresponding venous blood samples, in order to detect the partial pressures of O2, CO2 and

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 207 pH. The mean duration of surgery was 30±10 minutes (Group A) and 20±5 minutes (Group B). Average healing times were 5 days (Group A) and 7 days (Group B). As for pCO2, statistically significant differences (p<0.05) were found between the groups, at T1 and T2. The values of pO2 didn’t show any statistically significant difference, within and between the groups. The levels of pH showed statistically significant differences (p<0.01) within both groups at T0 vs T1 vs T2. The concentrations of cortisol showed similar trends in both groups, as they increased during surgery and returned to basal levels at T4. A statistically significant difference occurred in Group A, at T0 vs T5 and between the groups at T1 (p<0.01). ROS concentrations showed similar profiles in both groups, even if those found at T5 were statistically lower in Group A than in Group B (p< 0.05). Our results indicate that pneumoperitoneum slightly increases the levels of pCO2 during surgery, as expected, even if a return to their basal levels occurs by the end of surgery. However, the reduced healing times as well as the lower levels of blood cortisol and ROS confirm CLOO to be a less invasive procedure. Poster 22 - Stress, Diseased State and Reproduction P543 PUFA-induced lipid peroxidation in rabbit sperm: protective role of dried tomato pulp Kokoli, A1*, Lavrentiadou, S2, Zervos, I2, Tsantarliotou, M2, Nikolaidis, E3 and Taitzoglou, I2 1Clinic of Companion Animals, 2Dept. of Physiology, 3Dept. of Pharmacology; Veterinary Faculty, Thessaloniki, Greece Spermatozoa, unlike other cells, are unique in structure, function, and susceptibility to damage by lipid peroxidation (LPO) because their membranes contain large quantities of polyunsaturated fatty acids (PUFA) and they lack scavenging systems. The lipid components located in the sperm membranes are involved in regulation of many sperm functions. Obviously, peroxidation of sperm lipids may disturb sperm functions, and in extreme cases even completely inhibit spermatogenesis. Spermatozoa contain a number of other proteinases besides acrosin with less well-documented role in reproduction. Cumulative evidence suggests that the plasminogen activators may play an essential role in mammalian spermatogenesis, capacitation and fertilization. The aim of this study was to investigate the potential protective role of natural antioxidants found in dried tomato pulp (DTP) on PUFA-mediated lipid peroxidation in rabbit buck sperm. Thirty two week-old New Zealand male rabbits were assigned to five different diets: standard diet (control), n-3-supplemented diet (2% ROPUFA oil), or n-3 diet supplemented with 5% or 10% DTP. Vitamin E (300 mg/kg diet)-supplemented n-3 diet was used as a standard antioxidant-supplemented diet. Lipid peroxidation in ejaculated spermatozoa was determined on the basis of their malondialdehyde (MDA) content. MDA, the compound used as an index of lipid peroxidation, was determined by a selective third-order derivative spectrophotometric method. The results indicate that PUFA-enriched spermatozoa are more susceptible to LPO, presenting a significant elevation in the MDA levels compared to control spermatozoa. However, supplementation of diet with 5% or 10% DTP, resulted in significant decrease in the MDA content compared with the corresponding PUFA-treated group. The protective role of DTP was comparable to that of vitamin E. Plasminogen activator activity was determined in sperm extracts by spectrophotometry using the chromogenic substrate S-2251. The differential regulation of plasminogen activators by LPO and antioxidants indicates that the whole situation is of particular interest and complexity.

P544 Subclinical mastitis lowers steroid concentrations and gene expression in preovulatory follicles of lactating cows Lavon, Y1*; Leitner, G2; Meidan, R1; Moallem, U3; Klipper, E1; Wolfenson, D1 1Faculty of Agriculture, the Hebrew University, Rehovot, Israel; 2National Mastitis Laboratory, the Veterinary Institute, Bet Dagan, Israel; 3Institute of Animal Science, Agricultural Research Organization, Bet Dagan, Israel Introduction Recently we showed that 30% of cows with naturally occurring mastitis had low estradiol levels at estrus and low or delayed LH surge, resulting in delayed ovulation. These data suggest that mastitis may directly affect ovarian follicles. The aim of this study was to examine the effect of mastitis on the characteristics of the preovulatory follicle in cows. Methods Cyclic lactating Holstein cows were diagnosed for mastitis by somatic cell counts and bacteriological examinations. Follicular fluids and granulosa cells were aspirated from preovulatory follicles of synchronized cows by ultrasound-guided procedure. Total RNA was isolated from granulosa cells and gene expression was determined by real-time quantitative PCR. Data were analyzed by ANOVA, and means and SE are presented. Results Of 16 cows with sub-clinical mastitis, about 30% (n=5) exhibited low estradiol concentrations in the follicular fluid, as compared with 70% (n=11) exhibiting normal estradiol levels (42±19 vs. 654±90 ng/ml, respectively; P<0.01). Cows with sub-clinical mastitis and low follicular estradiol levels also exhibited low plasma estradiol concentrations. Such a distribution in estradiol levels was not observed in healthy cows (n=17) or in those exhibiting a clinical mastitic event (n=8) about 43 days earlier (692±101 and 1026±177 ng/ml, respectively). Similarly, the follicular androstenedione levels were about 9-fold lower (P<0.05) in the cows with sub-clinical mastitis and low estradiol levels, compared with the three other groups. Progesterone levels did not differ among groups. Cows with sub-clinical mastitis exhibiting low estradiol concentrations (n=4) also had a 5 to 8-fold reduction in mRNA expression for P-450-aromatase and LH receptors (LHr), compared with healthy (n=10) and clinical mastitic (n=4) cows (P<0.05); a 4-fold reduction (P<0.05) in LHr, but not in the expression of P-450-aromatase, was noted in comparison to cows with sub-clinical mastitis exhibiting normal estradiol levels (n=6). Expression of mRNA for FSHr and inhibin did not differ among groups. Conclusions These findings suggest that in 30%, the presence of sub-clinical mastitis induced a pronounced decrease in steroid concentrations and gene expressions in preovulatory follicles. Reduced gene expression, resulting in low follicular steroid concentrations and low preovulatory plasma estradiol levels could consequently delay LH surge and ovulation, as documented in our earlier studies. These mechanisms may explain, at least partially, mastitis-induced low fertility in dairy cows. P545 Association of Neospora caninum Infection with Pregnancy Rates in Embryo Recipient Cows Leite, R*, Paz, R; Rajão, D Veterinary School, Federal University of Minas Gerais, Brazil Introduction- Infection of cows with Neospora caninum during pregnancy may result in reproductive symptoms, such as abortion, stillbirth, neonatal mortality, fetal death and embryo reabsorption. Neospora is transmitted mainly by vertical route and the reproductive manifestations are influenced by the gestation period in which the infection occurs. Abortions are usually identified at four to six months pregnancy and the fetuses infected at the end of pregnancy are born healthy and seropositive for N. caninum antibodies. Methods-A total of 275 half blood Nelore and Simmental breed heifers, ranging in age from 14 to 20 months, were used as recipient cows for embryo transfer from pure breed Nelore donors, all of them from a homogeneous herd. Using a commercial ELISA kit for the detection of antibodies to Neospora caninum, the heifers were divided into two groups of 33 animals, one seropositive and the other seronegative.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 208 P o s t e r A b s t r a c t s |Both groups were kept together under the same management conditions. Fifty days after embryo transfer, the pregnancy diagnosis was performed. Results- The group of seropositive recipient heifers showed a pregnancy rate of 72.7% and the seronegative group a pregnancy rate of 81.8%. There was no significant difference between them. Conclusions- There was no interference of Neospora caninum infection on the pregnancy rates of embryo recipient heifers during the first third of the gestation period. P546 Alleviation of maternal hyperthermia-induced early embryonic death by administration of DL-α-tocopherol acetate accompanied by a reduction of physiological oxidative stress in mice Ozawa, M1*, Sakamoto, N2, Yokotani-Tomita, K2, Morimoto, A2, Ijiri, D2, Hirabayashi, M2, Ushitani, A2, Yukio, K2 1Division of Animal Sciences, Reproductive Biology, National Institute of Agrobiological Sciences, Japan; 2Graduate School of Life and Environmental Science, University of Tsukuba, Japan Maternal hyperthermia induces pre-implantation embryo death, which is accompanied by enhanced physiological oxidative stress. We evaluated whether the administration of DL-α-tocopherol acetate (TA) to hyperthermic mothers mitigated pre-implantation embryo death. Mice were exposed to heat stress (35°C, 60% relative humidity) for 12 h or not heated (25°C) on the day of mating. Twelve hours before beginning the temperature treatment, TA was injected intraperitoneally at a dose of 1 g/kg body weight. After the treatment, zygotes were recovered and the developmental abilities and intracellular glutathione (GSH) levels were evaluated. Another set of mice, with or without TA treatment, was exposed to heat stress for 12, 24, and 36 h and the urinary levels of the oxidative stress marker 8-hydroxy-2’-deoxyguanosine (8-OHdG) were measured. Heat stress significantly decreased the blastocyst development rate and the GSH content in zygotes, as compared to the non-heat-stressed embryos, while TA administration significantly mitigated the deleterious effects of heat stress with regard to both parameters. Moreover, although the urinary levels of 8-OHdG gradually increased according to the duration of heat exposure, with or without TA administration, the levels were lower in the TA-administered group than in the placebo-injected mice. These results suggest that heat stress enhances physiological oxidative stress, and that TA administration alleviates the hyperthermia-induced death of pre-implantation embryos by reducing physiological oxidative stress. P547 Heat shock-induced damage in bovine oocytes Paula-Lopes, FF1*, Milazzotto, MP1; Assumpção, MEOA1; Visintin, JA1 1 Department of Animal Reproduction, School of Veterinary Medicine and Animal Sciences, University of São Paulo, Brazil The series of events associated with oocyte growth and maturation are susceptible to disruption by elevated temperature compromising the ability of the oocyte to undergo adequate fertilization and embryonic development. The objective of the current study was to examine whether exposure of bovine oocytes to a physiological heat shock (HS) during IVM induces cell death and compromises oocyte developmental competence. In the first study slaughterhouse crossbred Bos indicus cumulus-oocyte complexes (COCs) were exposed to control (39°C for 22 h) or HS (41°C for 12 h followed by 39°C for 10 h) during IVM. Approximately 22 h after IVM oocytes were denuded (1 mg/ml hyaluronidase) and subjected to a membrane permeability based triple staining using 5 µg/ml Hoechst 33342, 1 µg/ml propidium iodide (PI) and 2.5 µM YO-PRO1 as DNA staining markers for live, necrotic and apoptotic cells, respectively. Exposure of bovine oocytes to HS during IVM reduced the proportion of oocytes that reached the metaphase II stage (61.43 + 6.25 and 30.13 + 6.25% for control and HS, respectively; p< 0.05). This experiment was replicated 5 times using a total of 152-161 COCs/treatment. Even though HS compromised oocyte nuclear maturation there was no effect on the proportion of necrotic and apoptotic oocytes. In the

second experiment COCs were exposed to control or HS temperatures as described in experiment 1. Oocytes were subjected to in vitro fertilization and culture at 39°C. Heat shock reduced the proportion of oocytes that cleaved (62.90 + 2.06 and 49.64 + 2.06% for control and HS, p< 0.0001) and reached the blastocyst stage (20.01 + 1.08 and 7.41 + 1.14 % for control and HS; p< 0.0001). This experiment was replicated 10 times using a total of 1309-1042 COCs/treatment. A blastocyst subset harvested from 4 random replicates (n=65 and 25 blastocyst/treatment for control and HS) was subjected to the membrane permeability based triple staining as described in experiment 1. Exposure of bovine oocytes to HS did not affect blastocyst cell number or the percentage of necrotic cells/blastocyst. However, HS increased the proportion of apoptotic cells/blastocyst (8.75 + 1.14 and 13.00 + 1.71% for control and HS, respectively; p< 0.05). Therefore, exposure of bovine oocytes to a physiological HS during IVM compromised oocyte maturation and developmental competence. However, such moderate HS did not induce oocyte apoptosis or necrosis. In conclusion, direct exposure of crossbred Bos indicus oocytes to a physiological HS compromised the oocyte machinery without inducing oocyte death. (Support: CNPq). P548 Efficacy of 18 and 36 mg subcutaneous melatonin implant to reversibly suppress estrus in queens Stornelli, MA1*, Giménez, F1, Stornelli, MC1, Savignone, CA1, Tittarelli, C1, Videla Dorna, I2, De La Sota, RL1 1Servicio y Cátedra de Reproducción Animal, Facultad de Ciencias Veterinaria. Universidad Nacional de La Plata, Argentina; 2Syntex SA, Argentina The aim of this study was to assess the efficacy of 18 and 36 mg subcutaneous melatonin implant (SMI) to reversibly suppress estrus in queens. Fourteen queens aged between 12 and 14 months and weighting between 2 and 4 kg were maintained under artificial illumination (14 h light: 10 h dark) and assigned to one of two treatments (TRT). At interestrus (IE), queens assigned to TRT18 received a SMI (18 mg; Syntex SA, Argentina; =7), and queens assigned to TRT36 received SMI (36 mg; Syntex SA, Argentina; n=7). Blood samples were taken when queens showed proestrus signs (PE) to measure E2 by RIA. Before implant administration and once a month during IE, blood samples were taken to measure P4 by RIA and melatonin (MEL) by ELISA. After the trial was concluded, ten queens were mated and pregnancy was diagnosed by ultrasonography 20 days after mating. No significant differences in IE length, serum MEL concentration, or the area under the curve were detected between TRT18 and TRT36 queens (65.0±14.9 vs. 65.6±13.4 d, P>0.97; 42.6 vs. 45.6 vs. 9.4, P>0.89; 2682±726 vs. 2732±593, P>0.95). A significant rice in serum MEL concentration was observed after implant insertion in both TRT (before vs. after insertion, 30.2 vs. 43.8±2.9 pg/ml, P<0.02), however, after the second sample, no significant differences between TRT were detected (43.5±8.4 vs. 30.4±7.7 pg/ml, P>0.27). E2 serum concentrations were similar between TRT18 and TRT36 implants (E2, 54.9±10.7 vs. 60.1±9.6 pg/ml, P>0.73). On the contrary, a significant difference in serum P4 concentrations was detected. On day of implant insertion, serum P4 concentrations were higher than 4 ng/ml in 6 of 14 queens studied and decreased below 1 ng/ml around 19.6±13.4 d of implant insertion in both groups (TRT18 [n=1] vs. TRT36 [n=5], P>0.39). During this period serum P4 concentrations were similar for both groups (P>0.11). In the other 8 queens no significant differences in serum P4 concentrations were detected between TRT (P>0.46) and concentrations were below 1 ng/ml during the study period. Although spontaneous ovulation and pseudopregnancy may explain high P4 concentrations (>4 ng/ml) and non return to estrus during the first 19 d of IE, after day 19MEL concentrations from the implant were responsible maintaining the non return to estrus from day 19 onwards in these 6 queen. The pregnancy rate to the first mating was 60% (6/10). Thus, both MEL implants were equally effective to temporarily and reversibly suppress estrus in queens for two months with no side effects. Key words: queen; reversible contraception; melatonin

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 209 P549 Effects of husbandry practices and animal welfare on reproductive indicators in sheep Veksler Hess, J.*; Schuh, A.; Coppola, M.; Decaminada, E.; Miralles, M.; Ghirardi, M. Department of Veterinary Sciences; University of Buenos Aires. Buenos Aires. Argentina With the purpose of evaluating the influence of husbandry practices and animal welfare on reproductive indicators in sheep we determined the impact of both factors on a Romney Marsh pure- breed flock in a farm in “General Lavalle”, Buenos Aires, in a region known as “Cuenca del Salado”. We evaluated the effects of two treatments (A and B) on a flock of 50 ewes (n=50) ranging from 19-30 months of age, with a Body Score of 3.5 (Scale 1-5). Both treatments received the same sanitary and reproductive management, with natural service using 2% rams. In treatment A, husbandry practices followed the Animal Welfare regulations (Thirsty-free; hunger-free; comfortability, free of fear and stress). The diet during the maximum requirement stages (mating, G2, milking) consisted of Lotus tenui, Trifolium repens and Lolium perenne. Treatment B differed from A in husbandry practices and nutritional management. This treatment not corresponded with the University\'s animal welfare rules. The basic regulations of animal welfare were not followed (change of personnel, aggressive treatment of animals, inadequate facilities and herding, etc.). In treatment B the diet consisted of a natural pasture composed primarily of Distichlis spicata, a graminea frequently found everywhere in Buenos Aires province, preferably in salty and humid soils, due to its salinity tolerance. Its nutritional value is acceptable but since it is a small plant, its forrage offer is scarce. In treatment B the requirements of the different productive stages were not taken into account and the ewes grazed always in the same paddocks. Method A resulted in 42 finished lambs (n=42) which represented 113% lambing rate. Method B resulted in 35 lambs (n=35); 70% lambing rate. Significant differences were observed (p<0.05) in the reproductive indicators of both methods. It is concluded that, although sheep have an enormous capacity for recuperation, inadequate management affects production in the short term; from one reproductive cycle to the next. Poster 23 - Conservation of Biodiversity P550 Sperm charateristics in ejaculated and epididymal Blue wildebeest (Connochaetes taurinus) Anel, E.1*; Borragan, S.2; Alvarez, M.1; Nicolas, M.1; Gomes-Alves, S.1; Mata, M.3; Boixo, JC.1; Anel, L.1 1Animal Reproduction and Obstetrics, 3Cell Biology University of León, Spain; 2Parque de la Naturaleza de Cabárceno, Spain The objective of this work was to characterize the quality and quantity of electroejaculated an epididymal sperm from a 5 year old wildebeest -236 kg- (housed in Cabarceno Park, Cantabria, Spain) which was castrated. Previous general anaesthesia with hydrochloride etorphine+acepromazine (0.02 mg/kg+0.08 mg/kg) plus xylazine (0.50 mg/kg), semen was collected by electroejaculation (3V-75 mA). Sperm concentration was 250×106 spermatozoa/mL (1128.6×106 total spz). After castration spermatozoa were collected making several incisions on the cauda epididymes (2mL), obtaining a sperm concentration of 12441.3×106 spermatozoa/mL (24882.6×106 total spzs). Samples were diluted to 200×106 spz/mL (TesT-fructose-egg yolk and glycerol) and chilled to 5ºC during 2 hours. From fresh and diluted-chilled semen samples we assessed: sperm total motility TM: % total motile; PM: % progressive; VAP: average path velocity (μ/sec); VCL: velocity according to actual path (μ/sec) and LIN: % linearity, with CASA system. Viability (VIAB: % viable sperm) was assessed using SYBR-

14 (0.1 mM), acrosomal status (ACR: % viable spermatozoa with intact acrosomes) was assessed using propidium ioide (7.4 mM) and PNA-FITC (0.1 mM); and mitochondrial status (MIT: % of sperm with active mitochondria) using JC-1 (6.8 μM). All stainings were analyzed by flow citometry. Fresh sample results from electroejaculated and epididymal were respectively: TM: 94.73 vs 88.40%; MP: 63.80 vs 13.28%; VAP: 131.71 vs 38.54; VCL: 147.84 vs 66.39; LIN: 80.64 vs 59.85; VIAB: 87.0 vs 87.0%; ACR: 93.0 vs 86.5%; MIT: 79 vs 83%. No important differences were detected between electroejaculated and epididimal sperm neither TM nor viability (both had high values). However, there were differences in motility parameters (MP, VAP, VCL, LIN were lower in the epididymal sample). Citoplasmatic droplets and abnormal forms (bent tails) were 0 vs 98% and 10 vs 35% from electroejaculated and epididymal samples respectively. Diluted chilled sample results from electroejaculated and epididymal were respectively: TM: 89.54 vs 79.20%; MP: 60.67 vs 39.16%; VAP: 107.90 vs 39.62; VCL: 123.80 vs 59.39; LIN: 81.22 vs 78.57; VIAB: 75.97 vs 83.26%; ACR: 82.37 vs 87.06%; MIT: 85 vs 87%. No differences were observed between fresh and diluted samples; nevertheless MP and LIN show an increase after dilution in epididymal samples. Both sources of sperm are suitable to be used in assisted reproductives techniques. This work was supported in part by Cantur P551 Comparison of two cryoprotective agents (DMSO vs. PROH): toxicity before freezing and efficacy during cryopreservation of cow ovarian tissue Buff, S*; Neto, V; Lefranc, AC; Corrao, N; Joly, T; Guérin, P; Université de Lyon, Unité Cryobio - ENVL/ISARA Lyon, Ecole Nationale Vétérinaire de Lyon, 1 avenue Bourgelat, 69280 Marcy l’Etoile Introduction The use of frozen semen in bovine did early allow the preservation and the diffusion of the genetic progress, but no technique is currently available to efficiently preserve the female gametes. The cryopreservation of the ovarian tissue may allow the preservation of endangered domestic breeds, threatened wild bovine species or high genetic value females. Previously, the use of an experimental design allowed us to define the composition of a suitable freezing media. However, the choice of the best cryoprotectant (dimethylsulfoxide [DMSO] or propylene glycol [PROH]) remained questionable. The objective of the present study was (1) to evaluate the toxicity of DMSO and PROH before freezing, and (2) to evaluate the cryoprotective properties of DMSO and PROH related to the follicular morphology and the viability. Methods (1) Ovarian cortices (n=5 cows) were equilibrated at room temperature during 20 min, in a solution composed of 2M DMSO or PROH to evaluate the toxicity before freezing. Then, the cryoprotectant was gradually removed and the ovarian cortices were treated for histology. (2) After equilibration in the freezing solution (Euroflush® supplemented with Albumax®, trehalose and DMSO or PROH), ovarian cortices (n=5) were frozen according to a slow freezing process. After thawing, cortices were treated for the morphological evaluation and for the viability test. Results The equilibration in the freezing solution induced a reduction (p<0.03) of the proportion of normal follicles for both cryoprotectants (51.8 ± 4.7% with DMSO and 55.6 ± 2.6% with PROH) as compared to control group (69.0 ± 3.9%). The freezing process allowed the preservation of 51.6 ± 3.9% of viable follicles with DMSO and 58.2 ± 3.3% of viable follicles with PROH (51.8 ± 7.6% in control group; p>0.05). Moreover, 68.9 ± 23.7% (DMSO) and 84.4 ± 26.0% (PROH) (p>0.05) of the initially normal follicles remained intact after cryopreservation. But the proportions of the degenerated follicles were significantly increased after freezing. Conclusion Our results suggest that cryoprotective solution is toxic for the preantral follicles. Moreover, freezing solution composed of PROH seems to be more adapted to the cryopreservation of bovine ovarian tissue. Nevertheless, evaluation of such freezing solution needs to be performed in a larger population. (Grant from Region Rhône-Alpes)

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 210 P o s t e r A b s t r a c t s P552 Effect of semen collection method on pre- and post-thaw Black Manchega ram spermatozoa and its relationship with heterologous in vitro fertilization ability García-Álvarez, O1*; Maroto-Morales, A1; Martínez-Pastor, F2, Garde, JJ2, Pérez-Guzman, MD1; Soler, AJ1,2 1CERSYRA. Consejería de Agricultura de Castilla-La Mancha, Valdepeñas, Spain; 2IREC, (CSIC-UCLM-JCCM), Albacete, Spain Introduction The Black Manchega sheep is an endangered species and the FAO suggests its conservation. However, there are no studies about sperm cryopreservation for this breed for constitution of a sperm bank in order to preserve this specie. For it, the objective of this work was to evaluate the effect of two methods of semen recovery (electroejaculation or post-mortem from the epidydimes) on the production and quality of fresh and cryopreserved Black Manchego ram spermatozoa and on heterologous in vitro fertilization ability. Methods Semen was collected from six adult black Manchego rams. After sperm recovery, the samples were diluted at room temperature in a commercial extender Biladyl® and were frozen after a cooling period. We evaluated the effect of semen collection method on fresh and frozen-thawed spermatozoa quality parameters, including: subjective sperm motility (SM), intact apical ridge using a phase-contrast microscopy, sperm membrane integrity by nigrosin-eosin staining and for frozen-thawed semen, we also evaluated membrane stability by YOPRO-1 using flow cytometry. Furthermore, we studied sperm velocity parameters (VCL, VSL, VAP) determined by CASA (SCA®). The fertilizing ability of frozen-thawed sperm samples was assessed using calf oocytes matured and fertilized in vitro. Thawed spermatozoa were co-incubated with the oocytes (one million per well) for 40 h, and the cleavage rate was evaluated. Statistical analysis carried out was a GLM. Significance level was set at p<0.05. Results Before freezing, there were no differences between the collection methods for the sperm parameters evaluated and only the viability was higher for epididymal sperm samples than electroejaculated ones (94.67 vs 82.00%, p<0.05). At thawing, motility (SM) was lower (p<0.05) for the samples obtained by electroejaculation (36.67 vs 57.50%). Also the membrane stability was lower (p<0.05) for electroejaculated sperm samples than epididymal ones (6.92 vs 9.86). Likewise, the epididymal sperm samples showed higher values (p<0.05) for the curvilinear velocity (VCL) 151.65 vs 108.90 µm/seg; the straight-line velocity (VSL) 94.11 vs 61.43 µm/seg and the average-path velocity (VAP) 117.26 vs 76.29 µm/seg. However, the percentage of cleaved calf oocytes was higher (p<0.05) for sperm obtained by electroejaculation than for epididymal spermatozoa (32.69 vs 21.84%). Conclusions In summary, although epididymal sperm samples showed higher values in most sperm parameters assessed before and after freezing, we noticed better fertilization rates using heterologous in vitro fertilization test for electroejaculated sperm samples. Supported by Consejería de Educación y Ciencia de Castilla-La Mancha (PBI-05-011). Garcia-Alvarez enjoyed a studentship from the INIA. P553 Effects of dilution before centrifugation on spermatozoa quality from brown bear (Ursus arctos) Gomes-Alves, S1*, Anel, E1, Alvarez, M1, Borragan, S2, Nicolas, M1, Martinez-Pastor, F3, De Paz, P4, Anel, L1 1Animal Reproduction and Obstetrics, University of Leon, Spain; 2Parque de la Naturaleza de Cabárceno, Spain; 3IREC (CSIC-UCLM-JCCM), Spain; 4Cell Biology, University of Leon, Spain The establishment of genetic resource banks is essential to prevent the loss of endangered populations as Cantabrian brown bear. It is necessary to develop protocols of semen cryopreservation adapted to this wild carnivore. The aim of this experiment was to improve our knowledge on the cryobiology of brown bear spermatozoa, studying the effect of semen dilution before centrifugation on sperm quality. Ejaculates were obtained by electroejaculation during breeding season (June-July) from 4 males (220-330Kg) living in a half-freedom

regime in Cabarceno Park (Cantabria, Spain). Animals were anaesthetized using tiletamine+zolazepan (Zoletil 100®) and ketamine (Imalgene 1000®); and electroejaculated (3-electrode probe, 6-10 V/250-300 mA). We used 6 fractions (urine free) from different ejaculates. Each sample was divided into two aliquots, one diluted 1:1 with a centrifugation extender (a) (Tris-Fructose-Citric acid-Antibiotics) and the other one undiluted (b). It was centrifuged at 600 g for 6 min (Centrifuge 2-15, Sigma). After removing supernant, sperm pellets were diluted 1:1 with a freezing extender (Tes-Tris-Fructose-20% Egg yolk-8% Glycerol-Antibiotics), cooled to 5ºC, followed by a second dilution with the same extender to a final concentration of 100x106 spz/ml and equilibrated at 5ºC for 1 hour. Diluted semen was packaged in 0.25 ml straws and frozen using a biofreezer (from 5ºC to -100ºC at -20ºC/min; Kryo 10, Planer). Samples were thawed at 65ºC for 6 s. Fresh, pre-freezing and posthawed samples were analysed for motility (total motility TM, %; progressive motility PM, %; path velocity VAP, µ/sec; track speed VCL, µ/sec; progressive velocity VSL, µ/sec, using a sperm class analyzer (SCA, Microptic), and viability (%) using a staining technique (SYBR-14 and propidium iodide) by flow cytometry. No significant differences were found at the motility and viability parameters between diluted and undiluted semen. Motility parameters in fresh samples were TM:73.8; PM:34.74; VAP:123.83; VCL:157.57 and VSL:91.92; in pre-freezing semen: (TM: a 71.85; b 77.83; PM: a 29.02; b 36.03; VAP: a 73.78; b 80.54; VCL: a 121.54; b 117.47; VSL: a 53.54; b 61.43) and in posthawed samples (TM: a 60.36; b 64.5; PM: a 20.36; b 22.18; VAP: a 67.89; b 65.23; VCL: a 124.58; b 119.38; VSL: a 51.3; b 48.98). Results of viability were: fresh semen: 71.73; pre-freezing semen (a 69.8; b 66.59) and posthawed semen (a 51.37; b 54.23). As dilution does not affect sperm quality it could be used to wash polluted samples (urine). Supported by CICYT (CGL2007-63788/BOS) and Cantur. P554 Differences between fresh and frozen-thawed semen from endangered asturiana de la montaña bulls selected for a genetic resource bank Hidalgo, CO1*; Rodríguez, A1; Pérez-Garnelo, SS2; Palasz, AT2; De la Fuente, J2, Carbajo, M.3; Tamargo, C1

1SERIDA, Camino de los Claveles, Gijon, Spain, 2INIA Ctra de la Coruña Km 5.9, Madrid, Spain, 3Facultad de Veterinaria, León, Spain

There is an urgent need to establish gene banks to conserve animal biodiversity, because it is essential to satisfy basic human needs. The aim of this work was to characterize the semen of a local cattle breed, Asturiana de la Montaña, that has being classified as in risk of extinction, before its incorporation to a germplasm bank. Ejaculates (n=392) from 8 bulls, 20-35 months of age, were weekly collected by an artificial vagina along the year. Semen was extended with a commercial extender (Bioxcell, IMV Technologies, France), loaded into 0.25 ml plastic straws , frozen and stored. Overall sperm motility and individual kinematic parameters of motile spermatozoa, determined using a CASA system, were evaluated before freezing and after 0 and 3 h of post-thaw incubation at 37 ºC. Five fields per sample were evaluated (minimum 500 spermatozoa/sample) under a phase contrast microscope (100x). The followed parameters were recorded: curvilinear velocity (VCL, µm/s); straigh-line velocity (VSL, µm/s); average path velocity (VAP, µm/s); percentage of linearity; percentage of straightness and wobble coeficient. Statistical analysis was carried out by ANOVA procedure. The mean (±SD) total sperm motility in the fresh semen samples collected from the 8 bulls was 86.74±5.00 %, and after cryopreservation it decreased to 51.8±16.3 % at 0 h post-thawing and 27.3±14.2% after 3h of incubation at 37 ºC. In the same way, progressive sperm motility was 69.94±9.71 % in fresh semen, 38.6±13.3 % immediatly after thawing and 19.4±11.8% after 3h. There was an observed difference between fresh and frozen-thawed semen samples in the kinematics parameters (data not shown). In general, such differences indicated that the sperm velocity parameters (VCL, VSL, VAP) decrease after cryopreservation and also during post-thaw incubation. Regarding to kinematic evaluation, differences were observed among bulls in some,

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 211 but not all the parameters; the magnitude of the changes in the sperm kinematic parameters was quite similar for each of the 8 bulls between fresh and post-thaw semen. Immediatly after thawing, VCL and VAP showed significant differences among the 8 bulls, however VSL was no significantly different. Individual variation in semen freezability is recognized to exists in bovine, and has been related with the incidence of motile distinct sperm subpopulations in the fresh ejaculate, but further results are needed to complete the Asturiana de la Montaña genetic resource bank characterization. This work was performed in collaboration with ASEAMO and supported by RZ2004–00031–C02–01. P555 Captive breeding strategies affect sperm traits in Peromyscus leucopus Martinez-Pastor, F1*; Malo, AF2,3; Alaks, G2; Lacy, RC2

1National Wildlife Research Institute (IREC) (UCLM-CSIC-JCCM) and Institute of Regional Development (IDR), University of Castilla-La Mancha, Spain; 2Chicago Zoological Society, Dept. of Conservation Science, 3300 Golf Road, Brookfield, IL 60513, USA; 3Smithsonian Institution, Center for Conservation and Evolutionary Genetics, National Zoological Park, Washington D.C. 20008, USA Captive breeding programs are the only option for many endangered species. However, it is believed that inbreeding and genetic adaptation to captivity may make the descendants from many captive programs unsuitable for release back into the wild. Male fertility is one of the traits potentially affected, so there is a need to known how captive breeding programs affect sperm traits. We have measured the effects of 10 generations of three different captive breeding strategies on Peromyscus leucopus, originating from the same wild population: (1) random mating (RAN), (2) minimizing the mean kinship (MK) of the offspring (Species Survival Plan breeding strategy; SSP) and (3) selecting for docility (DOC), by which more docile mice (behavioral scores) are bred (mimicking the default breeding strategy in captivity). Twenty males from each group were euthanized (CO2). Cauda epididymes were collected and put in a 0.5-mL drop of modified Tyrode (300 mOsm/kg), covered with paraffin oil (37 °C), and pierced. After 5 min, the medium was transferred to microtubes. We evaluated the number of spermatozoa (Neubauer hemocytometer), % of motility (light microscopy ×400) and viability (eosin/nigrosin staining, ×400). Spermatozoa were challenged using an osmotic resistance test (ORT): osmolality was raised to 500 mOsm/kg, and after 5 min reverted to 300 mOsm/kg, assessing motility and viability 5 min later. The effect of the 3 groups on sperm traits was analyzed by ANOVA and Tukey test (results as median and interquartile range). RAN yielded significantly more spermatozoa (146.4×106 [113.3, 191.6]) than DOC (100.8×106 [80.3, 116.7]), SSP being in between (138.2×106 [85.1, 176.6]). Motility (77.5% [68.8, 85]) and viability (61% [53.8, 70.6]) were not different between groups. After ORT, viability decreased (48% [38.9, 55]), but the change was not significantly different among groups. However, motility was significantly lower for DOC (27.5% [20, 36.3]) than for RAN (40% [35, 42.5]) or SSP (42.5% [38.8, 55]). Overall, sperm numbers and motility were reduced in the DOC group, announcing the negative reproductive effects of not minimizing MK and suggesting the absence of large differences between RAN and SSP. Our results suggest that the breeding strategy affects sperm traits, and that selecting the more docile individuals as breeders might pose a risk. However, genetic drift might also be playing a role. Lastly, this study might help with the setup of sperm banks for the conservation of endangered species from this genus (e.g., Alabama beach mouse, P. polionotus ammobates).

P556 Ovarian tissue cryopreservation in the doe rabbit: from freezing to birth Neto, V*; Joly, T; Salvetti, P; Lefranc, AC; Corrao, N; Guérin, P; Buff, S Université de Lyon, Unité Cryobio - ENVL/ISARA Lyon, Ecole Nationale Vétérinaire de Lyon, 1 avenue Bourgelat, 69280 Marcy l’Etoile Introduction Ovarian tissue cryopreservation aims to preserve simultaneously thousands of immature (primordial to primary stage) follicles of the ovarian stock. It may allow preservation of the reproductive potential of women who are at risk of becoming sterile and may also contribute to preserve the animal genetic resources. The objectives of this study in the doe rabbit were to determine the influence of different freezing parameters and to propose a slow freezing process for the cryopreservation of the ovarian tissue. Methods A fractional experimental design was used to discriminate 5 freezing parameters. The nature (DMSO vs. 1,2-PROH) and the concentration (1.5M vs. 2M) of the cryoprotectant, the nonpenetrating cryoprotectant (sucrose or trehalose), the equilibration process (1 vs. 3 steps) and the post-seeding freezing rate (0.3 vs. 2°C/min) were evaluated. The morphological analysis of the preantral follicles was performed before (control) and after freezing. The best combination of freezing parameters was finally challenged by orthotopic autograft and in vivo resumption of folliculogenesis. Cryopreserved ovarian fragment was grafted to the controlateral ovarian pedicle of 16 females. Then, females were inseminated along 9 months. Results The experimental design showed that 1,2-PROH (p=0.08) and trehalose (p=0.07) tended to improve the morphology of preantral follicles submitted to freezing. The freezing rate seemed to have the greatest impact on the follicular morphology which was improved by the use of a freezing rate of 0.3°C/min (p<0.01). No significant effect was observed for the other freezing parameters. Thus, transplantations were performed with ovarian tissues frozen in a medium containing 1.5M 1,2-PROH and 0.2M trehalose (3 step-equilibration process, seeding then 0.3°C/min). The proportion of morphologically normal follicles was significantly decreased after freezing as compared to fresh control (65.8 ± 4.8% vs. 82.6 ± 2.8%; p<0.001). Overall, 9 pups were born after graft of cryopreserved ovarian tissue. Conclusion The doe rabbit ovarian tissue seems to be successfully preserved by this slow freezing process using a media composed with 1.5M 1,2-PROH and 0.2M trehalose. This freezing protocol could be used as a complementary tool to preserve the genetic resources of rabbit species. (Grant from region Rhône-Alpes) Poster 24 - Toxicology of Reproduction P557 2,4-DCP–induced testicular toxicity and effects of soybean extract and L-tryptophan Aydin, H1*, Baran, A2, Aktas, A3, Demir, K2, Sahin, E1, Kayar, A4, Pabuccuoglu, S2, Daglioglu, S3

1Istanbul University, Faculty of Veterinary Medicine, Department of Pharmacology and Toxicology, 34320, Avcilar, Istanbul, Turkey; 2Istanbul University, Faculty of Veterinary Medicine, Department of Reproduction and Artificial Insemination, 34320, Avcilar, Istanbul, Turkey; 3Department of Histology, 34320, Avcilar, Istanbul, Turkey; 4Department of Internal Medicine, 34320, Avcilar, Istanbul, Turkey 2,4-Dichlorophenol (2,4-DCP), an environmental pollutant has been in agriculture and synthetic chemical industry. The aim of present study was to analyse the testicular toxicity of 2,4-DCP which caused biochemical, spermatological and histological changes in male mice and to evaluate the possible ameliorative effect of soybean extract and L-tryptophan (L-TRP). Soybean extract (25 mg/kg bw per day) and L-TRP (150 mg/kg bw per day) were given by intraperitoneal (ip) route for 3 weeks. 2,4-DCP was administered to male mice with drinking water at dose of 1000 ppm for 3 weeks. Biochemical parameters in serum [(glucose, creatinine, blood urea nitrogen (BUN), aspartate transaminase (AST), alanine transaminase (ALT), lactate

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 212 P o s t e r A b s t r a c t s dehydrogenase (LDH)], spermatological and histological changes were investigated at the end of the 3 weeks comparatively with control group (n=6). It was observed there was a statistically significance in serum ALT, AST and LDH levels (P<0.05). In our histological investigations, while increasing of necrotic cell counts in 2,4-DCP-treated groups were observing, a decrease of necrotic cell counts were observed in TRP + 2,4-DCP and soy extract + 2,4-DCP-treated groups. Similarly, it was showed that an amelioration in sperm motility and abnormal spermatozoa rates. We conclude that soy extract and L-TRP decrease 2,4-DCP testicular toxicity. P558 Effects of urban air pollution on follicle number in mice ovaries Veras, MM.1; Damaceno-Rodrigues, NR.2*; Scoriza, JN.1; Caldini, EG. 2; Dolhnikoff, M. 1; Saldiva, PHN 1 1Laboratory of Experimental Air Pollution, Department of Pathology, School of Medicine, Sao Paulo University, Brazil; 2Laboratory of Cell Biology, Department of Pathology, School of Medicine, Sao Paulo University, Brazil Urban air pollution comprises a complex mixture of chemical substances, including dioxin-like compounds, polycyclic aromatic hydrocarbons, trace metals and bysphenyls. These compounds have been shown to cause female reproductive toxicity, disrupting the normal reproductive function. Previous studies from our group have shown reduced indices of fertility and changes in estrous cyclicity in mice exposed to ambient levels of air pollution in Sao Paulo, Brazil (Animal Reprod. v.3, n.2 p. 310, 2006). One possible mechanism involved in this process of reproductive toxicity is the depletion of ovarian follicles. Therefore, the aim of this study was to evaluate if the exposure to ambient levels of urban air pollution could affect the ovarian follicles number in female mice. Experiments were carried out in downtown São Paulo city, near a crossroad with high traffic density. Animals employed in the present study corresponded to the third generation of mice that were raised and maintained in two inhalation chambers, one receiving ambient air (polluted chamber) and the other filtered air (clean chamber), both kept in the same conditions of temperature and humidity. Five nulliparous 12 week-old female mice from each chamber were euthanized in estrus phase. One ovary per female was excised, fixed for histology and analyzed following EPA protocol (EPA, OPPTS 870.3800, 1996) for follicle quantification. For this purpose follicles were classified in 4 categories: small, growing, antral and pre-ovulatory follicles. The mean number (±SEM) of total follicles per ovary was 4442.6±285.0 in mice from the clean chamber and 2888.8±679.3 from the polluted chamber. We found no significant differences in the number of small and growing follicles between groups; however, a significant decrease in antral and pre-ovulatory follicles was observed in the polluted group (p< 0.04). The results show that air pollution affects mice ovarian follicles during advanced stages of maturation. We suggest that changes in follicle maturation could be one of the mechanisms involved in reduced fertility in female mice exposed to ambient levels of air pollution. P559 Does gossypol have a genotoxic effect on chios ram sperm? Dessiris, EA1*, Lymberopoulos, AG1, Khalifa, TAA1, Theodosiadou, E2, Kotsaki-Kovatsi, VP3, Belibasaki, S1 1NAGREF-Veterinary Research Institute, Ionia, Thessaloniki, Greece; 2Laboratory of Physiology, Faculty of Veterinary Medicine, University of Thessaly, Karditsa, Greece; 3Laboratory of Pharmacology, School of Veterinary Medicine, Aristotle University of Thessaloniki, Thessaloniki, Greece It has been suggested that gossypol, a phenolic compound produced by the cotton plant, affects DNA protamination during spermatid metamorphosis. In this study we evaluated nuclear chromatin stability of ejaculated sperm after giving rams (treatment, n = 6) a cottonseed meal (500 ppm free gossypol / day) for a period of 6 months. The directive 2003/100/EC of the European Commission sets

this dose as the maximum limit for free gossypol in the feedingstuffs of sheep. A control group (n=6) of rams received a soybean meal during the study period (May to November 2004). At the beginning of the experiment, the age and average body weight of rams were 15 months and 62.50 kg. Semen samples (n=4 to 5/ram) were collected using an artificial vagina and examined for quality characteristics (volume, sperm concentration, motility, viability and morphological abnormalities of sperm tail) and sperm susceptibility to nuclear chromatin instability (NCI) using acridine orange test. Likewise, heparinized bood samples (n=36 to 54/ram) were collected for determination of plasma testosterone concentration (TC). Results of regression analysis revealed a significant (P<0.01) effect for treatment on sperm NCI (r=0.50), plasma TC (r=-0.30) and all semen quality traits (r=-0.21 to -0.87) except bent tail defect. The comparison between two groups by unpaired two-tailed t-test showed that gossypol increased (P<0.001) the incidence of sperm NCI from 6.34 to 25.24%. Plasma TC and semen traits accounted (P<0.01) for 4.84 to 20.25% of the variation range (0 to 80%) in sperm susceptibility to NCI among semen ejaculates. In conclusion, gossypol has a destabilizing effect on nuclear chromatin of ram spermatozoa. The low correlation coefficients between level of NCI and other sperm attributes indicate the importance for assessment of sperm genomic integrity as an independent parameter in the toxicological studies. P560 Exposure of stallions to mycotoxin zearalenone and its in vitro effect on sperm chromatin structure stability (SCSA) Filannino, A1*; Lacalandra, GM1; Minervini, F2; Nicassio, M1; Dell’Aquila, ME1; Visconti, A2 1Department of Animal Production, University of Bari, Italy; 2Institute of Sciences of Food Production (ISPA), National Council of Research (CNR), Bari, Italy Zearalenone (ZEA) and its derivatives (α and β-zearalenol, α and β zearalanol and zearalanone) are mycotoxins synthesized by fungi of Fusarium species, common parasites of cereals. These substances exert estrogenic activity because of their chemical structure similar to 17β estradiol. Several in vivo and in vitro studies have been carried out on sensitive animal species, such as swine, but few reports on exposure and toxicity are available in the horse. This study concerned the assessment of natural exposure of stallions to mycotoxin zearalenone by using ELISA (Ridascreen Zearalenon detection limit= 50 pg/ml) on 38 urine samples after chemical extraction. The frozen-thawed spermatozoa were incubated for 2 h at 38.5 °C in TALP-HEPES medium with the aforesaid methanolic urine extracts containing mycotoxins. The stability of sperm chromatin (SCSA) was measured by flow cytometry using acridine orange. This probe emits green or red fluorescence, when it links to double-stranded DNA (native) or single-stranded DNA (damaged structure of DNA), respectively, after acid in situ denaturation. The susceptibility of sperm chromatin was measured by using different parameters of DNA Fragmentation Index (DFI), such as the mean (X DFI) and the percentage of DFI (% DFI). The ZEA levels found in 11 Italian stallion urine samples were 10 times lower (2.56 ng/ml median value) than the remaining Romanian urine samples (n=27). Concerning SCSA analysis, control samples of stallion spermatozoa, at time 0, (CTR T0) showed the median X DFI of 151 (range 127-187) and the median % DFI of 12 (range 2.5-25). After 2 h exposure with 5% methanol, control spermatozoa samples (CTR T2h+MeOH) showed values of DFI parameters not significantly modified compared with CTR T0. Only 4 Italian stallion urine samples, containing low levels of ZEA and its derivatives, induced sperm chromatin instability after 2 h exposure. In particular, the X DFI values were significantly increased (p<0.05) after exposure to ZEA urine levels ranging from 1.8 to 3.9 ng/ml. The toxic effect found only in few samples could depend on different pattern of zearalenones in urines or/and on the short time of exposure, selected on the basis of sperm viability. This is the first report concerning the ZEA exposure assessment in stallions and the influence of ZEA on SCSA in this animal species.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 213 P561 Precocious development of bulbourethral glands in male pigs exposed to di(2ethylhexyl) phthalate before puberty Ljungvall, K1, Veeramachaneni, KNR2, Magnusson, U1* 1Division of Reproduction, Dep Clinical Sciences, Swedish University of Agricultural Sciences, Sweden; 2Animal Reproduction and Biotechnology Laboratory, Colorado State University, United States Phthalates are common industrial chemicals used in large volumes in, for instance, cosmetic products, in paints, and as plastic softeners. Acute toxicity is generally considered to be low, but reproductive effects have been reported in laboratory rodents. Typically these effects have been seen after exposure during development, especially during the foetal period. Data on effects in other, non-rodent, mammals is scarce and so are those regarding accessory reproductive glands. The objective of the current study was therefore to investigate the effect of di(2-ethylhexyl) phthalate (DEHP) on the bulbourethral glands in the pig. In this split-litter design experiment, male piglets were exposed orally three times weekly to 300mg/kg of DEHP or placebo between 3 and 7 weeks of age. The effects on the bulbourethral glands were examined morphologically immediately after the exposure at seven weeks of age in one sub-group, and postpuberally at nine months of age in the other. Three of the seven DEHP- treated animals in seven-week-old group had bulbourethral glands at a stage of maturation far more advanced than that of controls. While there were no obvious differences in the cellular composition between the treatment groups in nine-month-old animals, the bulbourethral glands were heavier (p<0.05) in DEHP-treated boars. Collectively, these features indicate that adolescent exposure to DEHP induces precocious maturity of bulbourethral glands in pigs with persistent effects lasting into adulthood. These novel data suggest that DEHP may also have an enhancing effect on the development of the male reproductive system. P562 The presence of endocrine disrupting chemicals in tissues and body fluids from dairy cows in Belgium Petro, EML1*; Leroy, JLMR1; Covaci, A2; Dirtu, AC2; Goovaerts, IGF1; De Coen, W3; Bols, PEJ1 1Laboratory for Veterinary Physiology, Department of Veterinary Sciences, University of Antwerp, Belgium; 2Laboratory for Toxicology, Department of Pharmaceutical Sciences, University of Antwerp, Belgium; 3Laboratory of Ecophysiology, Biochemistry and Toxicology, Department of Biology, University of Antwerp, Belgium Introduction During the last decennium, awareness has increased about the potential harmful influence of endocrine disrupting chemicals on domestic animals. The fertility decline of high producing dairy cows has previously been suggested to be linked to the exposure to endocrine disruptors. Much information about these possible deleterious effects arises from in vitro research. It is however essential to mimic the in vivo situation as much as possible e.g. by adding potentially hazardous chemicals to in vitro cell cultures at environmental relevant exposure concentrations. Therefore, reliable data concerning tissue and body fluid concentrations of these chemicals are crucial, but at this moment only scarcely available. Methods Therefore, we have selected dairy cows (≥ 6 year) from diverse locations in Belgium and analysed several tissue [liver – fat (n=13), muscle – kidney – ovaria (n=3)] and body fluid samples [serum – follicular fluid (n=13)] by means of GC/MS for their content of well-known or suspected endocrine disrupting chemicals: 24 polychlorinated biphenyl congeners (PCBs), 8 polybrominated diphenylether congeners (PBDEs), DDT and metabolites, chlordanes and metabolites, α-, β-, γ-hexachlorocyclohexanes (HCH) and hexachlorobenzene (HCB). Results Overall, the levels of these (suspected) endocrine disrupting chemicals were very low in all analysed samples. Only few compounds could be detected (PCBs, HCHs, HCB, p,p’-DDE and p,p’-DDT), with CB 138, CB 153 and p,p’-DDE being present in nearly every tissue sample. PCB concentrations were the highest in liver tissue (average sum PCBs: 19.7 ng/g lipid weight). In addition,

none of the investigated compounds could be detected above their limit of quantification in follicular fluid samples. Conclusion Because overall concentrations of the most prevalent endocrine disrupting chemicals in tissue and body fluids are very low, compared to other species (e.g. birds, fish), and because we did not find any contamination in the follicular fluid, exposure to endocrine disrupting chemicals can hardly be considered as a major cause of declining fertility in high producing dairy cows in Belgium. P563 The incidence of heavy metals (Lead and Cadmium) in the reproductive organs of wild boar (Sus scrofa) from Monfragüe National Park (Extremadura, Spain) Roy, TJ1*, Gallego, E2,Hernández, D2, Pérez, M2 and Soler, F2 1Area of Reproduction and Obstetrics; 2Area of Toxicology. Faculty of Veterinary Medicine, University of Extremadura, Avda. Univeridad s/n. 100071 Cáceres. Spain; tjroy@unex.es Heavy metals such as cadmium (Cd) and lead (Pb) are environmental pollutants which can have adverse effects on both the male and female reproductive system. The objective of the present study was to determine the contents of Cd and Pb in different tissues (ovary, testes, liver and kidney) of wild boar (Sus scrofa) from Monfragüe National Park (Extremadura, Spain) that might influence the reproductive success. Wild boar (n=26) were sampled from hunting season. After wet digestion with progressive thermal treatment, Cd and Pb concentrations were determined by means of anodic stripping voltammetry (ASV). In reproductive organs the cadmium levels ranged from <dl to 0.044µg/g, while lead concentrations ranged from <dl to 7.42µg/g. Ovaries showed generally higher Cd and Pb concentrations than testis. There were no correlations in the content of Pb between the different tissues, for Cd there were statistically significative correlations between ovary-liver and ovary-kidney. P564 Effects of urban air pollution on follicle number in mice ovary Scoriza, JN.1; Damaceno-Rodrigues, NR. 2; Caldini, EG. 2; Veras, MM. 1*; Saldiva, PHN. 1 1Laboratory of Experimental Air Pollution, Department of Pathology, School of Medicine, Sao Paulo University, Brazil; 2Laboratory of Cell Biology, Department of Pathology, School of Medicine, Sao Paulo University, Brazil Urban air pollution comprises a complex mixture of chemical substances, including dioxinlike compounds, polycyclic aromatic hydrocarbons, trace metals and bysphenyls. These compounds have been shown to cause reproductive toxicity in the female, disrupting the normal reproductive function. One mechanism of reproductive toxicity is the depletion of ovarian follicles, either interfering with estrous/menstrual cyclicity or fertility. Previous studies from our group have shown reduced indices of fertility and changes in estrous cyclicity (Animal Reprod. v.3, n.2 p. 310, 2006) in mice exposed to ambient levels of air pollution in Sao Paulo city. Considering this, the aim of this study was to evaluate if the exposure to ambient levels of urban air pollution could affect the follicles number. Experiments were carried out in downtown São Paulo city, near a crossroad with high traffic density. Animals employed in the present study corresponded to the third generation of mice that were raised and maintained in two chambers, one receiving ambient air (polluted chamber) and the other filtered air (clean chamber), both kept in the same condition of temperature and humidity. Five nulliparous 12 weeks old female mice from each chamber, were euthanized in estrus phase, and one ovary per female were excised, fixed for histology and analyzed following EPA protocol (EPA, OPPTS 870.3800, 1996) for follicle quantification. For this purpose follicles were classified in 4 categories: small, growing, antral and pre-ovulatory follicles. The average number (±SEM) of total follicles per ovary was 4442.6 ±285.02 in mice from clean chamber and 2888.8 ± 679.32 from the polluted chamber. We found no significant difference in number of small and growing follicles, however, a significant reduction of antral

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 214 P o s t e r A b s t r a c t s and preoovulatory follicles number in the exposed group (p< 0.04) were observed. Ambient air pollution seems to affect selectively the ovarian follicles, decreasing the antral follicle number and not affecting the pool of immature follicles (small and growing). These results suggests that changes in follicle maturation could be one of the mechanisms involved in reduced fertility in female mice exposed to ambient levels of air pollution. Poster 25 - Developments in Sustainable Animal Production and Reproduction P565 Reproductive efficiency of F1 Holstein x Zebu crossed cows raised in pasture conditions of central part of Brazil Ruas, JRM1*, Silva, MA2, Borges, AM3, Carvalho, BC4, Ferreira, IC5, Valente, DB5, Menezes, GCC5, Matos, CRA5 1Research Department, Minas Gerais Agricultural Research Corporation-EPAMIG, Brazil; 2Animal Science Department, Faculty of Veterinary Medicine-UFMG, Brazil; 3Veterinary Clinics and Surgery, Faculty of Veterinary Medicine-UFMG, Brazil; 4MG Agricultural Research Corporation-EPAMIG, Brazil; 5Faculty of Veterinary Medicine-UFMG, Brazil During the last decade significant increase in milk production and expressive reduction in reproductive efficiency of herds of specialized cows in Brazil were observed. Intensive genetic selection for maximizing milk production has resulted in metabolic and hormonal modifications that negatively affected milk production. Today the Brazilian’s great challenge of milk production systems is to search for adapted genotypes that show high productive and reproductive efficiency in pastures conditions, high profitability and preserve the environment This research evaluated the reproductive efficiency of 243 F1 Holstein x Zebu crossed cows raised in pasture conditions of the central part of Brazil in the Experimental Research Center of EPAMIG (Minas Gerais Agricultural Research Corporation). The cows during the summer season are maintained in pastures of Brachiaria decumbens and Brachiaria brizantha and during the dry season lactating cows are additionally fed corn silage and sugar cane. Mechanic milking with cow’s calf presence and natural mating are used in the herd. First mating average (24 months), cow average age (33.6 months) and cow average weight at first calving (451.5kg) were considered satisfactory since these cows were raised in pasture conditions. Cow body weight increased up to fourth calving suggesting these animals did not reach the adult body weight yet. Milk production average of 2,773.1kg was very high in comparison to national milk production average 1,350.0kg (Embrapa – CNPGL, 2006). Days open averages were, respectively, equals to 163.7, 96.0, 88.4 and 70.6 for first, second, third and fourth calving cows. Productive efficiency can be evaluated by kilogram of milk / calving interval ratio but days open that is a reproductive trait has an effective effect on herd productive efficiency. The results suggest a great ability of F1 Holstein x Zebu cows to adapt to pasture conditions and to show high reproductive and productive efficiency in this production systems. Factors related to animal behavior and to mechanic milking adaptation should be considered in further studies.

Poster 26 - Trends in Research, Care and Teaching of Reproduction P566 Scanning Electron Microscopic (SEM) analyses of the trophoblast of the term placenta of the Asian elephant (Elephas maximus) Loderstedt, S.1; Hoffmann, A.1; Eulenberger, K.2; Flügger, J.3; Seeger, J.1 1Institute of Veterinary Anatomy, Department of Histology and Embryology, Faculty of Veterinary Medicine, University of Leipzig, An den Tierkliniken 43, 04103 Leipzig; 2Zoological Garden Leipzig GmbH, Pfaffendorfer Straße 29, 04105 Leipzig; 3Zoo Hagenbeck Hamburg GmbH, Lokstedter Grenzstraße 2, 22509 Hamburg-Stellingen Cognitions about structure and physiology of the Elephant placenta are rare. The detailed characterization of the epithelial layer of the chorion on different locations is poorly understood. Investigation with ultrastructural procedures, scanning electron microscopic (SEM) analyses are the first findings to investigate the morphological features of the fetale membrane of the placenta in the Asian elephant (Elephas maximus). We used 3 term placentas (Zoological Garden Leipzig, Zoo Hagenbeck Hamburg) and selected different sites of the placental band and the extra placental Allantochorion. The placental band has a sponge like surface, and consists of fetal lamellae enclosing maternal blood vessels. The lamellae are covered from the cytotrophoblast. The trophoblast cells show surface modifications, like microvilli and mikroplicae. The fetal capillaries are located directly underneath the cytotrophoblast and tend to invade the epithelium. In some locations there are less than 2µm between basallaminae of maternal and fetal intraepithelial capillaries. In none of the investigated specimens the placental border has been reduced. There is always a narrow trophoblastic cytoplasm band in between. Microscopically the placental band can be divided in to two portions. The apical, towards the uterus, and the basal, towards the fetus. The apical layer is dispersed. Between the fetal, placental lamellae, blood cells and amorphic material are located. The surface of the basal part of the placental band is very dense. Fetal lamellae getting in direct contact with maternal capillaries. Free blood cells, like in the apical part can not be found. Maternal blood vessels are surrounded from thickened basallaminae. There is a distinct difference between the basallaminae of ematernal and fetal blood vesels. It must be proposed, that the trophoblast cells are eroding the maternal basallaminae, and the endothelial cells are producing even more collagenic material to keep the laminae intact. The chorionic surface is structured, and chorionic villi can be shown entirely. The SEM analyses revealed a cobblestone-like architecture of the epithelial cells, wich are covered with microvilli and microplicae themselve. Surprisingly, the findings of intraepithelial capillaries intend the trophoblast cells presume an nutrient exchange also outside of the placental band with her gross functional metabolism. This study revealed some unknown and interesting features of the epithelial layer of the chorion in the placenta of an Asian Elephant. Perhaps, with a detailed knowledge of the morphology of the epithelium we convey an better understanding of functional cohesions of elephant placentation. Acknowledgements We are extremley gratful to Dr. M. Flügger of the Zoo Hagenbeck Hamburg and also Prof. K. Eulenberger, Dr. J. Junhold and Mrs. Bachmann of the Zoological Garden Leipzig for their continued interest in this investigation and for their practical help in gathering samples.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 215 P567 Effect of in utero metabolic programming on postnatal metabolism of mink kits Matthiesen, CF.1*; Blache, D.2; Tauson, A-H.1 1Faculty of Life Sciences, Department of Animal and Veterinary Basic Sciences, University of Copenhagen, Denmark; 2Faculty of Natural and Agricultural Sciences, School of Animal Biology, University of Western Australia Introduction It is well recognised that in utero malnutrition may cause long-term metabolic programming in the offspring, increasing the risk of disease in later life. The outcome of in utero malnutrition may depend on when it is imposed and whether this occurs during certain sensitive time periods called “critical windows” in gestation. These critical periods in development are periods of rapid cell division in a developing tissue. Inadequate nutrient supply in each of these critical periods may cause a different metabolic programming response in the offspring. The objective of the present study was to investigate how in utero nutrient supply affects growth and metabolism of mink kits during the first two months of postnatal life. Materials and methods Thirty two male mink kits were used, out of which 16 (P) were exposed to in utero metabolic programming by feeding their dams a low protein diet for three weeks in late gestation, whereas the dams of the remaining 16 kits (C) had been adequately fed during gestation. The kits were divided into two feeding groups, each comprising 8 C and 8 P. One group was given an adequate level of protein (A; 32% of metabolizeble energy (ME) from protein) and the other was given an insufficiently low level of protein (L; 18% of ME from protein) during three weeks, starting when the kits were 7 weeks old. All animals were fed ad libitum and feed intake was recorded. Respiration and balance experiments were performed by means of indirect calorimetry in an open-air circulation system. Plasma samples were collected for analyses of insulin, IGF-1, cortisol, GH, leptin, T3 and T4 by radioimmunoassays. The animals were killed at the end of the experiment for collection of organ material to perform Quantitative RT-PCR on fat and liver samples. Results and Conclusions The body and liver weights of kits fed the A diet postnatally were significantly higher (P<0.001) than those of kits fed the L diet, irrespective of in utero nutrition. The quantitative metabolism data were also significantly affected by kit diet irrespective of in utero treatment, but no significant differences were found in body composition. The preliminary results on hormonal data show no differences between the treatment groups. There was a tendency for higher abundances of mRNA of glucose-6-phosphatase (P=0.06) for the diet groups receiving the A protein diet postnatally. These results indicate that possible effects on fetuses of an in utero protein restriction were alleviated by an adequate protein supply during postnatal growth. P568 Fetal hepatic expression of mRNA for a key gluconeogenic enzyme reflects low in utero protein supply in a strict carnivore, the mink Matthiesen, CF, Thomsen, PD and Tauson, A-H* Department of Basic Animal and Veterinary Sciences, Faculty of Life Sciences, University of Copenhagen, Grønnegaardsvej 3, DK- 1870 Frederiksberg C, Denmark; Corresponding author: Anne-Helene Tauson telephone: +45 35 33 30 39 fax: +45 35 33 30 20 e-mail: aht@life.ku.dk The mink is a strict carnivore and a seasonal breeder with induced ovulation and delayed implantation. Mink diets usually have a high protein and low carbohydrate content, suggesting that glucose homeostasis to a large extent is supported by gluconeogenesis. It remains to be elucidated if gluconeogenic activity, as measured at the transcriptional level, can be adapted to different nutrient supply and if the fetal liver expresses gluconeogenic activity. Our objective was to estimate relative abundance of the mRNA of glucose-6-phosphatase (G-6-Pase), as a marker for gluconeogenesis, by quantitative RT-PCR in livers from mink dams and their fetuses when the dams were fed either a diet adequate (A) or deficient (D) in protein from implantation until parturition. Since the fetus obtains glucose from the mother

through the placenta we expected fetal values for G-6-Pase to be lower than those of the mother. Sixteen (8 A and 8 D) 11 months old dams were euthanized in mid to late true gestation, but seven turned out to be barren, so only data from nine (3 A and 6 D) could be used. Fetal (n=9) and maternal (n=9) livers were quickly excised and flash frozen in liquid nitrogen. RNA was isolated and translated into cDNA using random hexamer priming. PCR primer oligonucleotides were designed from canine mRNA sequences and tested on mink liver cDNA samples and on canine liver cDNA and canine genomic DNA samples as control. A fragment of the mink 18S rRNA was amplified and used as a measure of RNA in the PCR. The primers produced amplification of the expected band on canine cDNA samples and of similar size on mink DNA. Quantifying of enzyme cDNA levels was subsequently done by real time PCR using SYBR Green I detection and the LightCycler System (Roche Diagnostics). The average relative abundance of mRNA for G-6-Pase was much greater among dams (1.81) than fetuses (0.10; P<0.001). The dams, but not the fetuses, could be expected to have a high gluconeogenic activity, likely to be reflected in high abundances of mRNA for G-6-Pase. Diet did not affect G-6-Pase mRNA in dams, but in fetal livers the relative abundance was more than twice as high in A (0.16) as in D (0.07), the difference however being non-significant (P=0.11). Our findings of a high abundance of mRNA for G-6-Pase in dams compared to fetuses, hence suggest that G-6-Pase level may be used as indicator of gluconeogenic activity. The tendency for diet effect in fetuses indicates that maternal diet affected fetal metabolism, and it remains to be elucidated if a permanent metabolic programming effect was caused. Poster 27 - Trace Minerals and Reproduction This topic was sponsored by Alltech Hungary Ltd. P569 The effect of Selenium and vitamin E administration to heifers during the late stage of pregnancy on reproduction performances Moeini, MM; Karami, H; Mikaeili, E; Mostafaei, A; Noorian, E* Razi University College of agriculture, Kermanshah , Iran Sixty heifers at the late stage of gestation were randomly assigned to one of three treatments. Heifers were homogeneous for age, weight and time of calving. Four and two weeks before expected calving the heifers were injected 0 ml (c), 20 ml (T1), and 40 ml (T2) Se and vitamin E supplements respectively (each ml of the supplement containing of 0.5 mg Se as sodium selenite and 50 IU of d, L-α-tocopheryl acetate). Blood samples were collected from heifers four weeks before expected calving and at calving day. The reproductive parameters retained placenta, calving interval, service per conception and milk production were recorded. Selenium concentration in serum was measured by hydride generation atomic absorption spectrophotometer (AAS). Supplementation of Selenium increased concentration of Se significantly in serum of dams at parturition, similarly calves of cows that were supplemented with Se had a higher Se in serum at birth and 7 days of age. Injection of Se and vitamin E had no significant effects on service per conception, average gestation length. Calving to conception interval was not different among groups, although in T3 treatment tended to be lower. Heifers retaining the placenta > 12 hours were (15%) in control groups but in T1 and T2 heifers retaining the placenta more than 12 hours were not observed. During the first 3 months of lactation the heifers in T2 produced more milk than did control group.

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 216 P o s t e r A b s t r a c t s Poster 28 – Other topics P570 Opinions and regulations of breed registries in Europe on stud book registration of cloned horses Aurich, J1*, Knauss, L2, Aurich, C2 1Animal Breeding and Reproduction, University of Veterinary Sciences, Austria; 2Graf Lehndorff Institute for Equine Science, Neustadt (Dosse), Germany Cloning of production farm animals so far is virtually irrelevant for breeding programmes. In contrast, horses with high breeding value are cloned with the goal to produce offspring and contribute to genetic progress. Of special interest is the cloning of geldings successful in equestrian sports in order to produce offspring from copies obtained by somatic cell nuclear transfer. The use of cloning requires acceptance of this biotechnology by the regulations of breed registries, i.e. stud book registration of cloned horses and their offspring. We have conducted a survey on the regulations of European breed registries for cloned horses and the opinion of the persons responsible for breeding programmes. A total of 34 questionaires were returned from 8 countries. None of the breed registries have so far registered cloned horses. Only two registries have specific regulations for cloned horses while 29 have not (no answer: 3). With current regulations, 5 breeds would register cloned horses (4 in Germany, one in Austria) and 5 registries are planning changes in the regulations. There are no regulations on validation of cloned status. Registry managers considered cloning mainly a technique for conservation of endangered horse breeds (82%) and less to obtain clones from elite mares (44%), stallions (33%) or geldings (37%) or to obtain copies from individual horses with high emotional value for the owner (4%). Out of the persons asked, only few thought that cloning will contribute to genetic progress (15%) but most expected cloning to help maintaining genetic material in rare breeds (78%). Out of the registry managers, one was of the opinion that performances tests of the „parent“ should be valid for the clone, 30 expected clones to undergo performance testing, 23 agreed that cloned horses should be admitted to equestrian competitions. Ethical objections against assisted reproductive technologies were raised in 15% and against cloning in 35% of the questionaires, only 19% had objections against cloning for animal welfare reasons. When asked on the opinion of their members on cloning, 77% of breed managers expected a rejection of cloning and 13% classified their members as slightly positive, 52% answered that their members were sceptical but interested in current developments on cloning. In conslusion, a board acceptance of cloning by sport horse breed registries is unlikely. There are no major ethical concerns but cloning is not expected to contribute to genetic progress. This biotechnology appears to be more justified for breeding programmes in rare breeds. P571 The effect of addition of vitamin B12 in the extender on the post-thaw motility, acrosome morphology and plasma membrane integrity in the bull semen Hu, JH1, Chen, YL1*, Li, QW1,2, Jia, YH3, Zhu, DN3 , Wang, LQ1 1College of Animal Science and Technology, Northwest A & F University, Yangling, ShaanXi Province 712100, P.R. China; 2College of Environment and Chemistry Engineering, YanShan University,Qinhuangdao, HeBei Province 066004, P.R. China; 3Domestic Animal Improving Station in ShaanXi Province, Jingyang, shaanXi 713702, P.R. China *Corresponding author. Yu-Lin Chen. Present address: College of Animal Science and Technology, Northwest A & F University, Yangling, ShaanXi Province 712100, P.R. China, Tel.:+86 29 87092102; Fax.: +86 29 87092164; E-mail address: myxy11@263.net To investigate the effects of supplementation of vitamin B12 on bovine sperm post-thaw motility and quality, it was added at concentrations of 1.25, 2.50, 3.75 and 5.00 mg/ml to bovine semen cryoprotective medium. Analysis of results showed that the motility and the primary motion characteristics were improved in the presence of vitamin B12

in the extender, as compared to the control. The results indicated that the motility and VSL, VCL, STR, VAP values of sperm supplemented with 2.50 mg/ml vitamin B12 were significantly higher than that of other concentrations (p<0.05). No significant difference was observed for LIN, ALH values and the percentage of grade a spermatozoa (rapidly progressive) between the extenders of containing 2.50 mg/ml and 3.75 mg/ml vitamin B12 (p>0.05). However, vitamin B12 significantly decreased sperm motion characteristics and the percentage of grade a spermatozoa at a concentration of 5.00 mg/ml in extender. The percentages of acrosome-intact and plasma membrane-intact spermatozoa was significantly improved (p<0.05) by supplementation with 2.50 mg/ml vitamin B12. With all parameters measured, the concentration of 2.50 mg/ml vitamin B12 showed a better effect on the quality of bovine semen in freezing-thawing. In conclusion, we propose that addition of 2.50 mg/ml vitamin B12 to the extender improve bovine frozen semen quality. Key words Bovine semen; Vitamin B12;Cryopreservation; Sperm motility; CASA P572 Changes in ovarian follicle, corpus luteum and progesterone concentrations following GnRH-steroid treatments in Bactrian camel (Camelus Bactrianus) Moghiseh, A1, Niasari-Naslaji, A1, Nikjou, D1, Mostafaee, M2, Gerami, A3, Razavi, K4, Eshlami, M*

1Department of Clinical Sciences, Faculty of Veterinary Medicine, University of Tehran, Tehran, Iran; 2Research Center for Agriculture and Natural Resources, Ministry of Jihad-e-Agriculture, Ardabil, Iran; 3School of Mathematics, Statistics and Computer Science, University of Tehran, Tehran, Iran; 4Animal Science Research Institute, Karaj, Iran Present study was conducted to characterize ovarian follicle development and corpus luteum formation following GnRH-steroid treatment in Bactrian camel. Bactrian camels (6-14 years old; n=7) in two consecutive follicular wave cycles were used in a change over design for this study. In both follicle wave cycles, ovulation was induced by an intramuscular injection of GnRH analogue (25µg; Luliberin-A; Aburaihan, Iran), when there was a mature follicle (13-17 mm in diameter) on the ovary. The ovaries were examined daily by trans-rectal ultrasonography between Day -2 and +7 of the experiment (Day 0 = Induction of ovulation). In the second follicle wave cycle, 2 days after inducing ovulation, female were given an intramuscular injection of estradiol benzoate (2mg; Aburaihan, Iran) and progesterone (100mg; Aburaihan, Iran). Ovulation was induced when an average size of follicle was 15.77±0.43 mm in diameter in both follicle wave cycles. In both cycles, mature follicle ovulated within 2 days after GnRH treatment. There was no significant effects of steroid treatment on ovarian follicle development, CL formation and progesterone concentrations (P>0.05). Therefore, the data were pooled for both cycles and reported as a single data set. New follicle wave emerged on Day 3-4. This follicle reached to 9.51± 0.47 mm in diameter on Day 7 after GnRH treatment. Corpus luteum was detected at the size of 14.86±0.58 (12-17.3) mm on Day 5 after induction of ovulation. Corpus luteum continued to grow until Day 7 when it reached to maximum size of 16.81±0.84 (12-21) mm. Progesterone concentrations initiated to increase on Day 5 and reached to maximum concentrations of 1.12±0.14 ng/ml on Day 7. In conclusion, steroid treatment (2 mg estradiol benzoate + 100 mg progesterone), injected on Day 2 after induction of ovulation, did not have any effect on follicle development, CL formation and progesterone concentrations in Bactrian camel. Key words Bactrian camel; Steroids; GnRH; Follicle development; Progesterone

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 217 P573 Sperm morphology of beef bulls evaluated by nigrosin-eosin and differential interference phase contras Freneau, G1*, Chenoweth, P2, Ellis, RW3, Rupp, G4 1Lab. Andrologyand Semen Technology Animal Sc, Veterinary school / Federal University of Goias, Brazil; 2School of Agricultural and Veterinary Sciences, Charles Sturt University, Wagga Wagga, NSW, Australia; 3Dept. of Clinical Sciences Integrated Livestock Ma, Colorado State University, United States; 4Great Plains Veterinary Educational Center, University of Nebraska, United States The objectives of this study were to compare two different methods of evaluating bull sperm morphology: bright-field (BF) microscopy of eosin-nigrosin (EN) stained dry-mount semen smears and differential interference phase contrast (DIC) microscopy of wet-mount semen ‘fixed’ in isotonic formal saline; both at 1000X. Seventy-two ejaculates were evaluated, representing both pre- and post-breeding season ejaculates collected from 40 2-yr. old beef bulls via electro-ejaculation. For both methods, 200 sperm were counted in random fields with defects categorized as major (MAD) and minor (MID). Sperm abnormalities were also placed into two other categories: those considered to be most influenced by process (wet or dry; METHD) and those whose depiction could be influenced by optics (BF or DIC; OPTD). Differences (P<0.05) occurred between DIC and BF methods respectively: MAD 23.3 / 16.1, MID 7.6 / 13.4, acrosome 3.8 / 1.1, midpiece 9.2 / 11.7, tail 2.0 / 4.7, droplets 8.3 / 4.2, PROD 14.2 / 21.4 and OPD 13.0 / 5.5; but not (P>0.05) in percent normal sperm 69.1 / 70.4 or sperm head defects 7.5 / 8.3. Acrosome, tail and droplet defects were observed in 98.2 / 80.5, 86.1 / 100 and 98.2 / 94.4 percent of bulls for DIC and BF respectively (P<0.05). As percent normal sperm did not differ between methods, bright-field microscopy assessment of EN preparations was considered to be a satisfactory method to categorize breeding soundness of bulls. However, DIC was more effective in visualizing major defects, while BF (which included stained smear preparation) was considered to cause more minor defects. Thus DIC was considered the preferred method of semen assessment for accurate assessment of sperm morphology in bulls. P574 Integrated regulation of porcine spermatozoa motility by PKA, PI3K and GSK3α signaling pathways Aparicio, IM; Santa-Catalina, MO; Garcia-Herreros, M; Bragado, MJ; Gil, MC; Garcia-Marin, LJ* Research Group of Intracellular Signaling and Technology of Reproduction, Faculty of Veterinary Medicine, Universidad de Extremadura, Spain Introduction Porcine spermatozoa motility is mainly regulated by protein kinase A (PKA) and also, as demonstrated by our group, by the phosphoinositide 3 kinase (PI3K) and glycogen synthase kinase 3 alpha (GSK3α). It has been proposed, in other cell types, that PI3K, through the regulation of intracellular calcium levels and the subsequent stimulation of phosphodiesterases might inhibit the PKA pathway. Aim Our objective was to investigate the biochemical interactions between PKA, PI3K and GSK3α in the regulation of porcine spermatozoa motility. Methods Semen from 8 Duroc boars was used. Spermatozoa motility parameters were measured by computer assisted ISAS® program and GSK3α activity was evaluated in spermatozoa lysates by the analysis of its serine phosphorylation state by Western blotting. Results Direct activation of PKA by 8Br-cAMP or indirect activation by incubation in a capacitating medium significantly inhibits GSK3α activity and simultaneously leads to a significant increase in porcine spermatozoa motility parameters. The inhibition of PI3K by LY294002 in porcine spermatozoa leads to a significant decrease in GSK3α activity and simultaneously to a significant increase in spermatozoa motility parameters. The effects of activation of PKA or inhibition of PI3K on GSK3α activity and spermatozoa motility are fully prevented by treatment with the PKA inhibitor H89. An increase in the intracellular calcium concentration due to incubation of porcine spermatozoa with calcium ionophore A23187 leads to both, a

significant increase in GSK3α activity and a significant inhibition of porcine spermatozoa motility parameters. Conclusions Our work allows us to propose that PKA activation leads to the serine phosphorylation of GSK3α and therefore to its enzymatic inactivation, which ultimately increases the motility of porcine spermatozoa. Our data also suggest that PI3K inhibits spermatozoa motility through the inhibition of the PKA pathway. We propose that this effect of PI3K on PKA might be likely mediated by an increase in intracellular calcium levels. Supported by MCYT AGL-2005-01205. P575 NANOG is expressed by the progenitor-type stem cells and differentiated germ cells in pig testis Goel, S1, 2*; Fujihara, M1; Minami, N1; Yamada, M1; Imai, H1

1Laboratory of Reproductive Biology, Graduate School of Agriculture, Kyoto University, Kyoto, Japan; 2Centre for Cellular and Molecular Biology (CCMB), Hyderabad, India Nanog is a homodomain-bearing transcription factor, which is transcribed specifically in pluripotential cells in mouse preimplantation embryos, embryonic stem (ES), embryonic germ (EG) and embryonic carcinoma (EC) cells, and monkey and human ES cells. In case of mice, Nanog expression is detected immunohistochemically in germ cells of embryos from E7.75 days onwards until E14.5 - E16.5 in male gonads and E13.5 - E14.5 in female gonads. Therefore, after reaching the developing gonads, Nanog expression is down-regulated in male germ cells in mitotic arrest and in female germ cells in meiosis. No germ cells stains positive for Nanog in testes and ovaries of adult mice. Till date, no data is available describing NANOG expression in testis other than that of mice and its role on spermatogenesis. While searching for a candidate marker for porcine male germ cells, we detected NANOG expression in the porcine testis. Testes sections of neonatal porcine testis until one week of age reveled that the primitive/progenitor-type stem cells (gonocytes) expressed NANOG. Further, as the age increased, NANOG expression was lost progressively and germ cells stained weakly in 2-and 3-week-old testes sections. In 5-month-old testes sections, NANOG expression was seldom detected in spermatogonia, but a strong expression in spermatocytes was observed. Co-immunolocalization of lectin Dolichos biflorus agglutinin, DBA and ZBTB16 (a specific marker of porcine gonocytes, Goel et al. 2007 Biology of Reproduction 77, 127-137), with NANOG in germ cells of neonatal testes confirmed that most gonocytes expressed NANOG. Stem cell activity of porcine gonocytes was studied by transplanting the isolated testicular cells from neonatal pigs into the recipient mice. Porcine gonocytes colonized the recipient mice testes and exhibited the morphological appearance of proliferation i.e., formation of cell chains connected by cytoplasmic bridges that stained with DBA. These findings strongly indicate that porcine gonocytes can be a potential target for establishing a germ stem cell line that would enable genetic modification of pigs. This is the first observation of NANOG expression in the porcine testis that suggests that NANOG might have a crucial role in primitive/progenitor-type stem cells and in meiotic stage germ cells in pig testis. In conclusion, NANOG shows a unique pattern of expression during porcine spermatogenesis and is quite different from those reported in mice. P576 Investigation of Calving Behavior of Gayal(Bos frontalis) under Semi-wild in China Zhanxing, H1*; Xiping, Y1; Kaixin, Q1; Bizhi H; Wenzhang, M2, Yehua, S2; Ziliang, L2; Shaohua, Y3 1Beefcattle and pasture research center of Yunnan province, P.R. of China; 2Animal husbandry and veterinary bureau of Lushui county of Yunnan province, P.R. of China; 3Mithun conservation farm of Phenix mountain of Lushui county of Yunnan province, P.R. of China Gayal or Mithun(Bos frontalis), known as “Dulong cattle” in China, is a rare ruminant species, surviving semi-wildly located mainly in remote and dense forest at Lushui county of Yunnan province,

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n 218 P o s t e r A b s t r a c t s southwest of China. Gayal has a calving behavior that the cows are out of the herd lonely when calving. The special calving behavior has not been covered so far. The objective of this study was, through the investigation of calving behavior of to collect relevant information on ethology, which, hopefully, would benefit in protecting the herds in immigration and feeding management whenever making the most of gayal scientifically. The study was carried out on the Mithun conservation farm of Phenix mountain at Lushui county in Yunnan province (98°59′--99°03′E, 25°58′--26°04′N, an altitude of 2700--3200m)from June 1st to 21st, 2007, by observing three gayal cows being about to delivery(two of multiparous, one of primiparous, average age of 9.0±5.6) and one adult bull(age of 3.5 years old) under free grazing on two hectare fenced improved pasture consisting of Dactylis glomerata, Trifolium repense and free grazing on the sward of native grasses with the same management. Average temperature and relative humidity recorded during the experiment were 16.85±1.01� and 74.27±4.54%, respectively to an elevation of 2420m. Relative behavior was recorded with digital vidicon and camera on Day 3 before the parturition, and monitored gayal cow with full track at daylight and at every 2h interval for 30 min at night. The results were shown that gayal behaved out a series of preparative behavior before the delivery, namely calving behavior were expressed as: � 60% cows would leave the herd to look for food and proper delivering place alone from 10 to 3 days before calving, preventing milk sucking from the previous calves with more watchful walking from 24 to 12hours before calving. Impatience and mounting behavior (including mounting on gayal bull) of the cows were observed from 8 to 1 hour before calving. In a few hours before calving, Gayal cows performed strongly the behavior of signory, rudely chasing the other animals. Rather flat sward on the higher place with lower gradient was naturally selected by cows as parturition site, where the tall grass in 4~6m2 was cleaned up by the cows to provide a convenient and safe parturition area for calves. Calving was from 7 o’clock in the morning to 6 o’clock in the afternoon, tending towards a sort of daylight delivering system. Activity of calving took 63.33±101.16min after chasing other animal and lying on the ground for calving, 25.00±5.00min. From calf born to placenta expelled, it took 11.74±10.89h. The number of getting up and lying down of cows were 7.00±6.00 times during the delivery course. Average birthweight was 17.83±1.04kg for male and female without any dystocia case. � Activity time of new calf: From birth to the first standing, it took 52.70±29.69min; from the first standing to the first milk sucking, 38.7±29.14min and from the first milk sucking to walking around, 61.33±1.53 min. The study indicated that calving performance of gayal was orderly processed with hardly undystocia case, good maternity, better ability of rearing calf, and the best capability of reproduction and survival in the wild condition. Keywords System of Semi-intensive management; Mithun(Bos frontalis); calving behavior; investigation. P577 Treatment of postpartum dairy cows ‘not-detected in oestrus’ with gonadotrophin releasing hormone, prostaglandin and progesterone McDougall, S Animal Health Centre, New Zealand Oestradiol benzoate (ODB) has been extensively used in synchrony programmes in dairy cattle to manage follicle wave emergence and timing of oestrus. However, ODB has recently been banned by the European Union and hence removed from other markets. Thus alternate protocols to synchronise cows are required. The objective of this study was to assess the efficacy of 3 treatments of dairy cows ‘not detected in oestrus’ before the start of seasonal breeding programme (PSM). The ovaries of 2222 cows not detected in oestrus by 9 days before the PSM were examined using ultrasonography and randomly assigned to be treated with: 1. Gonadotrophin releasing hormone (GnRH), prostaglandin F2a and GnRH at 7 and 2-day intervals, respectively; with fixed time artificial insemination 1 day after the second GnRH treatment (‘GPG’ programme), 2. ‘GPG’ and insertion of an intravaginal progesterone-releasing device between the first

GnRH injection and the PG, with fixed time artificial insemination 1 day after the second GnRH treatmen (GPG + P4) , 3. As for 2, but with oestrus detection for 3 days after the PG treatment, and with the second GnRH treatment occurring only where oestrus has not been detected by 3 days after PG (GPG + P4 + heat), or 4. No treatment (Control). Pregnancy status was assessed using ultrasonography at 35 days after the PSM. Data were analysed using logistic regression models which included treatment group, age, herd, CL status (presence or absence) and days from calving to the PSM. Estimated marginal means (95% CI) were calculated and the multiple comparisons among treatment groups accounted for by using the Bonferroni adjustment. The conception rate to service within the first 7 days was higher in the treatment groups which included progesterone than in the control or GPG groups (0.43 (0.36-0.50), 0.56 (0.49-0.63), 0.48 (0.41-0.55), 0.34 (0.23-0.44) for the GPG, GPG+P4, GPG+P4+heat and Control groups, respectively; p = 0.48, 0.001, and 0.04 compared to the Control group). Additionally, the pregnancy rate (i.e. total number of cows confirmed pregnant/total number of cows treated) varied among groups (0.40 (0.34-0.47), 0.54 (0.47-0.60), 0.46 (0.40-0.54), 0.08 (0.05-0.11) for the GPG, GPG+P4, GPG+P4+heat and Control groups, respectively. The control was lower than all other groups (p<0.05), the GPG and GPG+P4+heat group did not differ (p=0.45) and the GPG+P4 was higher than the GPG and control groups (p<0.001). It is concluded that treatment with GPG+P4 results in a higher conception and pregnancy rates than no treatment or GPG treatment. P578 Effect of calcium-gluconate intravenous treatment on reproductive performance and metabolic status in parturient dairy cows Pazzola, M*; Bua, S; Carcangiu, V; Dettori, ML; Atzeni M; Vacca, GM Dipartimento di Biologia Animale, Università degli Studi di Sassari, Italia Hypocalcaemia has been documented in parturient dairy cows, both in subclinical and in clinical forms. It is associated with metabolic (ketosis), organic (displaced abomasum) and reproductive diseases (retained placenta). All these dysfunctions affect the duration of open days and pregnancy rate, as well as the incidence of pharmacological treatment and, as a result, the economic income of dairy farms. The aim of this study was to asses the effect of intravenous calcium-gluconate treatment in high-producing dairy cows. The study was carried out in a commercial herd, made up of 350 Italian-Friesian cows, located in Sardinia, Italy. 60 multiparous cows were randomly selected and assigned within 24 hours after parturition to each of two protocols: the first group (Treated, T) receiving a 250 mL intravenous solution containing 50 g calcium-gluconate (Glucalene®, Ceva Vetem S.p.A. Milano, Italy); the second group (Control, C) receiving no treatment. For each cow the following data were registered: placenta retention; body condition score (BCS) at calving, 14, 21, 28, and 35 days after parturition (D0, D14, D21, D28 and D35); on D14 and D21, by transrectal ultrasonography examination, the diameter of the uterine horns and the presence of follicle/corpus luteus; ketonaemia 7 days after parturition. Moreover, each diagnosis, drug administrations and their cost were recorded. Data was submitted to statistical analysis using ANOVA and χ2-test. There was no difference between Group T and C as regards frequency of retained placenta (1 vs. 2; P>0.05) and in recovering BCS after parturition. The diameter of the uterine horns was smaller in Group T both on D14 (5.35 ± 2.7 vs. 8.38 ± 2.3 cm; P<0.05) and on D21 (3.65 ± 1.8 vs. 5.85 ± 2.3 cm; P<0.05). In Group C it took a longer time for the resumption of the ovarian activity, as the number of cows with the presence of follicle or corpus luteus was lower in comparison with Group T on D14 (13 vs. 4; P<0.01) and D21 (17 vs. 13; P<0.01). No difference was found in ketonaemia (0.61 ± 0.3 in Group T and 0.42 ± 0.2 mmol/L in Group C; P>0.05). Mean cost of pharmacological treatment was lower in Group T (15.20 vs. 20.60 €/cow). In conclusion, this preliminary report shows that treatment of high-producing dairy cows with intravenous calcium-gluconate solution could be a suitable method to improve the reproductive performance in the post partum. Furthermore, as the

1 6 t h I n t e r n a t i o n a l C o n g r e s s o n A n i m a l R e p r o d u c t i o n P o s t e r A b s t r a c t s 219 incidence of subclinical hypocalcaemia varies between 5% and 10% of all dairy cows, it could be a safe of money. P579 Boar sperm quality after addition of pentoxifylline to short-term extender Yeste, M*; Briz, M; Pinart, E; Sancho, S; Bussalleu, E; Casas, I; Fàbrega, A; Puigmulé, M; Garcia-Bonavila, E; Bonet, S Biotechnology of Animal and Human Reproduction, Department of Biology, University of Girona Pentoxifylline has been used in humans to improve sperm motility in low motility ejaculates and for inducing an early onset of sperm capacitation. The aim of the present study was to assess sperm viability, motility, morphology and capacitation after adding five different concentrations of pentoxifylline (Ptx): 0.25, 0.5, 1, 2 and 4 mM to semen diluted in Beltsville thawing solution (BTS) over two-day of storage at 15ºC. Semen samples were obtained from 21 healthy Piétrain post-pubertal boars and sperm parameters were determined before (control) and after applying the five treatments. Sperm viability was assessed using a multiple fluorochrome staining procedure, sperm motility and morphology by means of computer assisted sperm analysis (CASA) and the capacitation status using chlortetracycline (CTC) antibiotic staining. In each case, the various sperm parameters outlined above were assessed after incubation at 37ºC for 15 min (day 0), or after 1 or 2 days of storing at 15 ºC. Data were transformed to arcsin √x when necessary for accomplishing normality assumptions and then analysed with a repeated measures ANOVA and post-hoc Dunnet’s test. The level of significance was set at P<0.05. Immediately after its addition, Ptx (4 mM) provoked a general impairment of sperm quality, revealing a high percentage of acrosome-reacted, non-viable and immotile spermatozoa, so that this concentration is cytotoxic for cooled boar sperm. Conversely, two concentrations of Ptx (0.5 mM and 1 mM) presented the highest percentages of both viable and progressive motile sperm comparing with control, and increased some velocity parameters such as straight line velocity (VSL), curvilinear velocity (VCL), average path velocity (VAP), linearity (LIN), and straightness (STR). These increases were mainly observed after 1 and 2 days of preservation. In terms of capacitation status, Ptx (at 0.5-4 mM) significantly (P<0.05) increased the percentages of capacitated spermatozoa and acrosome reacted spermatozoa. As for sperm morphology, no significant differences (P>0.05) were observed. We can conclude that the addition of Ptx to boar seminal doses does not produce harmful effects on sperm quality parameters, but it can not be used to improve the ability of BTS to store spermatozoa because induces the sperm capacitation. P580 Effects of seasonal changes on semen quality in Qin-chuan cattle Hu, JH1, Zan, LS1*, Zhao, XL1, Jia, YH2, Zhu, DN2 1College of Animal Science and Technology, Northwest A & F University, Yangling, ShaanXi Province 712100, P.R. China; 2Domestic Animal Improving Station in ShaanXi Province, Jingyang, shaanXi 713702, P.R. China; *Present address: College of Animal Science and Technology, Northwest A & F University, Yangling, ShaanXi Province 712100, P.R. China; Tel.:+86 29 87091148; Fax.: +86 29 87092164; E-mail address: zanls@yahoo.com.cn The objective of this study was to investigate the effects of seasonal changes on semen quality parameters in Qin-chuan cattle. 36 cattle from the Domestic Animal Improving Station in ShaanXi Province (China) was used in this experiment. In fresh semen the volume, concentration, motility and the percentage of normal spermatozoa were evaluated and in frozen-thawed semen the motility and the viability were determined. To analyze seasonal differences four periods of 3 months each were defined as follows: spring (March, April, May), summer (June, July, August), autumn (September, October, November) and winter (December, January, February). The results showed that semen quality varied with season, including high production of spermatozoa in autumn and spring and low production

in summer. The volume, total sperm count and sperm motility in fresh semen were significantly (P<0.05) higher in autumn and spring compared to winter and summer while sperm concentration was significantly (P<0.05) lower in summer than at any other time of the year. The percentage of normal spermatozoa was significantly (P<0.05) higher in autumn than in winter and summer. In frozen-thawed semen, sperm motility and viability were significantly (P<0.05) improved in autumn compared to summer. In conclusion, our results clearly demonstrate that season exerts a significant influence on semen quality of fresh and frozen semen of Qin-chuan cattle, with the best performance occurring the autumn period. The semen collected in autumn demonstrated good quality, and was more suitable for cryopreservation. Keywords Qinchuan cattle; Seasonal dynamics; Semen quality; Cryopreservation P581 Colostrum of the first milking launches abomasal parietal cells secretory activity via neurotransmitters (free amino acids) in preruminant calves Zhirkov , I Veterinary, Volgograd State Agricultural Academy, Russian Federation Cow colostrum of the first milking contents large quantity of free amino acids (AA). The first two places belong to glycine (GLY) and glutamic acid (GLU) (in equimolar concentrations). These substances pointed as neurotransmitters, so the aim of this communication is to show the physiological action of free GLY and GLU in abomasal acid secretion. Physiological trials were carried out on five operated Black-and-White calves under the vivarium conditions. Animals were fed from pail the colostrum (milk) obtained from their dams two times a day (in 9.00 and in 19.00). All calves had isolated pouches on the fundal abomasum and π-shaped duodenal cannulae fitted just after pylorus, so the chyme emptied into duodenum was considered as abomasal. Every hour (8.30-13.30) the samples of abomasal contents were collected for measurements. The pH of abomasal chyme was measured every hour with the use of standard pH-meter. The content of free AA was measured in the AA analyzer KLA-3B (Czechoslovakia). Statistical analysis was conducted using the program GB-STAT with the Student’s method. Results are presented in the table below. Dynamics of free AA changes in the abomasal chyme emptied, means ( P<0,05) Time pH Glu, μM Gly, μM 8.30 1,80 155,3 195,0 9.30 4,55 436,0 121,2 10.30 3,70 434,8 139,6 11.30 2,87 309,5 128,0 12.30 2,58 269,7 145,3 13.30 2,22 181,1 152,3 Analyzing the data obtained we concluded that correlation coefficient (r) between pH and Gly was –0,784; between pH and Glu – +0,954. However, between pH and Glu/Gly r=+0,978. Conclusion. Our investigations showed the close correlation between chyme pH and concentration of free GLY and GLU and perhaps there is the connection between the function of abomasal parietal cells and AA composition of calves’ digesta.