Comparative Biochemistry and Physiology, Part C 148 (2008) 101–106

Contents lists available at ScienceDirect

Comparative Biochemistry and Physiology, Part C

j ourna l homepage: www.e lsev ie r.com/ locate /cbpc

Regional differences in mRNA responses in blue mussels within the Baltic proper

Karl Lilja a,b,⁎, Andreas Prevodnik a,b, Johanna Gardeström b, Tina Elfwing b,Michael Tedengren b, Tomas Bollner a

a School of Life Sciences, Södertörn University College SE-141 89 Huddinge, Swedenb Department of Systems Ecology, Stockholm University, S-106 91 Stockholm, Sweden

⁎ Corresponding author. School of Life Sciences, Söder89 Huddinge, Sweden. Tel.: +46 8 608 47 07; fax: +46 8

E-mail address: karl.lilja@sh.se (K. Lilja).

1532-0456/$ – see front matter © 2008 Elsevier Inc. Aldoi:10.1016/j.cbpc.2008.04.001

A B S T R A C T

A R T I C L E I N F O

Article history:

Mussels (Mytilus sp.) from t Received 4 January 2008Received in revised form 2 April 2008Accepted 3 April 2008Available online 10 April 2008

Keywords:Mytilus sp.Baltic SeaCopperPetrolHeat shock proteinsMetallothioneins

wo regions along the permanent salinity gradient within the Baltic proper wereexposed to copper (35 ppb) or petrol (0.3 mL/L) for 10 days and analyzed for mRNA expressions in gill tissue.Expression of mRNAs for the heat shock proteins HSP70 and HSP90 was significantly induced by copper, butnot by petrol. For the metallothioneins MT10 and MT20, regional differences in mRNA expressions could beseen. In mussels from the northern Baltic proper, MT20 expression increased 2.8 and 3.4 times, afterexposure to copper and petrol, respectively. In contrast, no change could be seen in MT20 expression formussels from the southern Baltic proper. MT10 showed a peculiar expression not previously described. Forsome mussels, no expression at all was detected, some showed a weak expression and for some individuals astrong expression could be seen. For the mussels from the southern Baltic proper, the number of individualswith a strong expression of MT10 increased from 1 out of 18 (control), to 7 and 8, after exposure to copperand petrol, respectively. The results clearly show that responses vary between different regions within theBaltic proper, which emphasises the importance to study interactions between contaminants, populationsand regions.

© 2008 Elsevier Inc. All rights reserved.

1. Introduction

The Baltic Sea is an ecosystem of low species diversity, and withmany of the species present being geographically isolated (Remaneand Schlieper, 1971). Populations of many species investigated withinthe Baltic Sea have lower genetic variation compared to Atlanticpopulations, and populations of several species also constitute uniqueevolutionary lineages (Johannesson and André, 2006). The presentbrackish-water state with a stable north–south salinity gradient, alsocause constant osmotic stress, and many of the species present live atthe extreme of their physiological range (Theede, 1984). Furthermore,it is considered to be among the most polluted seas in the world(Jansson and Dahlberg, 1999). This stresses the importance to studyimpacts of contaminants on species inhabiting the Baltic Sea. Still,even though the Baltic Sea has been in focus for extensive research formore than half a century, studies on the effects of contaminants oncellular and organismal levels are relatively scarce (Lehtonen andScheidek, 2006).

A keystone species within the Baltic Sea, also of interest in the fieldof ecotoxicology, is the blue mussel (Mytilus sp.). Since blue musselsare common, sedentary, filter feeders and thus act as integrators ofexposure to pollutants over time, they have been used in environ-

törn University College SE-141608 45 10.

l rights reserved.

mental monitoring worldwide for decades. The Baltic Sea blue musselis evolutionary unique, with genetic components of bothM. edulis andM. trossulus type (Kijewski et al., 2006), and is therefore denominatedMytilus sp. in this paper. Blue mussels in the Baltic Sea differ in bothsize and morphology compared to mussels from the North Sea(Kautsky, 1982), differences mainly attributed to the low salinity(Kautsky et al., 1990; Tedengren et al., 1990). Studies have also showndifferences in stress responses between mussels from the brackishBaltic Sea and mussels from the more saline North Sea, in physiologyas well as in protein and mRNA expressions (Tedengren and Kautsky,1987; Tedengren et al., 1990, 1999; Lyons et al., 2003).

In order to assess biological effects of contaminants, biomarkerscan be employed to detect responses at the molecular, cellular orindividual level (Walker et al., 1996). Biomarker responses may varyspatially and in time, since they depend not only on the contaminant,but also on many other factors affecting the physiology of theorganism. These factors include other chemicals, temperature, salinity,oxygen levels and reproductive state (Leiniö and Lehtonen, 2005;Lehtonen et al., 2006a).

Commonly used biomarkers are metallothioneins (MTs) and heatshock proteins (HSPs). MTs are small cystein-rich proteins involvedin metal homeostasis and detoxification. They are considered to bepotential biomarkers of metal pollution in aquatic environments(reviewed in Amiard et al., 2006). There are also growing evidencefor the involvement of MTs in the cellular antioxidant defencesystem (Viarengo et al., 2000; Correia et al., 2002; Rodrigues-Ortega

Table 2Names, coordinates and salinities of sampling sites

Region of theBaltic proper

Name of sampling site Coordinates Salinity (‰)

South Karlshamn N 56° 09′ E 14° 55′ 7.1South Gudhjem N 55° 12′ E 14° 58′ 7.4South Svenskehamn N 55° 08′ E 15° 08′ 7.4North Singö N 60° 10′ E 18° 48′ 5.1North Grisslehamn N 60° 04′ E 18° 49′ 5.1North Simpnäs N 59° 53′ E 19° 04′ 5.1

102 K. Lilja et al. / Comparative Biochemistry and Physiology, Part C 148 (2008) 101–106

et al., 2002). HSPs are molecular chaperones required in the recoveryof proteins damaged during stress (reviewed by Feder and Hofmann,1999). They are induced by a broad range of protein damagingstressors and were included in this study as general markers ofstress.

The aim of this study was to investigate stress responses in bluemussels collected from two regions along the small, but stable,permanent salinity gradient within the Baltic proper. In the southernand central Baltic proper, blue mussels often dominate hard bottomcommunities (Jansson and Kautsky, 1977), but further north theybecome scarce, and the mussel is absent at salinities below 4–4.5‰(Lassig, 1965). Blue mussels in the northern Baltic proper, experien-cing a salinity of approximately 5‰, are thus close to their tolerancelimit. We have previously shown that mussels from the northern andsouthern Baltic proper differ in scope for growth, levels of proteincarbonyl groups and in disulfide bond profiles after exposure tocopper and petrol (Prevodnik et al., 2007). Petrol is a relevantpollutant in Swedish costal areas due to intensive recreational boatingactivities. Copper is an essential naturally occurring metal, but withinthe Baltic Sea, 82% is estimated to be of anthropogenic origin(Matschullat, 1997).

In this paper, we report the effects on four mRNAs used asbiomarkers — metallothionein 10 and 20 (MT10 and MT20), and heatshock protein 70 and 90 (HSP70 and HSP90). MTs have previouslybeen studied in blue mussels from the Baltic Sea at the protein level.They were for instance evaluated as biomarkers within the BEEPproject (summarized in Lehtonen et al., 2006a), but to our knowledge,this is the first study at the mRNA level on blue mussel MTs within theBaltic Sea. HSP90 has not been analyzed at the level of mRNA in My-tilus sp. previously, nor has the issue of spatial variability of HSPswithin the Baltic Sea been addressed. For some of the biochemicalparameters also analyzed (presented in Prevodnik et al., 2007),responses to xenobiotics have been shown to be higher in gill tissuethan in digestive gland. This has also been shown for MT mRNA levelsafter exposure to metals (Lemoine et al., 2000). Thus, in order to beable to compare the different responses studied, gill tissuewas chosenfor all studied molecular responses.

2. Material and methods

2.1. Cloning

mRNA from Baltic Blue mussel gill tissue were isolated usingDynabeads® mRNA DIRECT™ (DYNAL ASA, Norway). cDNA wassynthesised in the presence of RNasin (Promega, Madison, WI, USA)at 42 °C for 1 h, with AMV Reverse Transcriptase (Promega), exceptHSP90 for which Superscript II (Invitrogen, Carlsbad, CA, USA) wasused. All procedures were performed according to the manufacturersrecommendations.

PCR fragments were amplified using primers and anneal tempera-tures presented in Table 1. Primers were designed based on sequencespublished in GenBank (accession numbers given in Table 1). Thegeneral PCR program used was: 2 min at 94 °C, followed by 35 cycles(30 s at 94 °C, 30 s at the annealing temperature, 2 min at 72 °C)followed by a 5 min extension at 72 °C. The thermostable DNA

Table 1Primer sequences, anneal temperatures and GeneBank accession numbers for sequences us

mRNA Forward primer Reverse primer

Actin AGGGTGTTATGGTTGGTATAG ATCCACATTTGTTGGAAKGT⁎HSP70 GTGATACCCACTTGGGTGG TACAGCTTCATCAGGGTTAATGHSP90 AAGAGCCTGACNAAYGAYTGG⁎ GATCTTGCTYTGYTGNARCAT⁎MT10 CAAATTAAACATGCCTGCAC ATGCATGGGAATAAGTTCGAGMT20 TATGTCTGACCTCCGATAAC TGATGTGATTCGCTTTATGTC

⁎K corresponds to the nucleotides G or T, N to A, C, G, or T, R to A or G, and Y to C or T.

polymerase Pfu (Promega) was used according to manufacturersrecommendations, and the primer concentrations were 1 μM.

Amplified PCR fragments were cloned into plasmids and positivecolonies screened for, using the PCR-Script™Amp Electroporation-Competent Cell Cloning Kit (Stratagene, La Jolla, CA, USA). Positiveclones were sequenced using Big Dye chemistry (Applied Biosystems,Foster City, CA, USA) and sequence identities were verified by BLAST(Altshul et al., 1997).

2.2. Exposure experiment

2.2.1. Sampling and experimental setupAs mentioned in the introduction, the Baltic Sea blue mussel is

evolutionary unique, with genetic components of both M. edulis andM. trossulus type (Kijewski et al., 2006), and is therefore denominatedMytilus sp. in this paper. Mussels were collected in September 2003 ata depth of 5–6 m from three sites within each of two different regions(referred to as north and south) along the stable salinity gradient inthe Baltic proper (Table 2). The northern regionwas chosen to be closeto the species lower salinity tolerance limit. The location for thesouthern sampling region was chosen to be far away from the hybridzone between the North and Baltic Sea blue mussel populationsidentified by Väinölä and Hvilsom (1991), in order to avoidcomparisons of genetically distinct populations. The sampling siteswere not known to be affected by any point sources of pollution. Thirtyspecimens, approximately 2 cm in length, were placed in each of 36aerated flasks, 6 per site thus 18 per region, filled with 2 L artificialseawater (TropicMarine salt, Dr. Biener GmbH,Wartenberg, Germany)with the salinity of the corresponding sampling site (Table 2) at 15 ° C.After an acclimation period of 8–10 days, mussels were either exposedto the nominal concentrations 35 ppb copper or 0.3 ml/L 95-octanepetrol (environmental class 1, Shell), or treated as controls, for 10 days.Petrol was administered as a water-petrol emulsion. For each of the 6sites, there were duplicate flasks for each treatment. Water waschanged, and during the exposure period the toxicant was renewedevery second day. During the acclimation and exposure period,mussels were fed every second day with cultured red algae Rhodo-monas (KAC30) (3.3 mg dw/mussel).

2.2.2. RNA expression analysisAfter 10 days of exposure, 3 mussels from each treatment flask

were sacrificed and stored in RNALater (Ambion Europe Ltd, UK) at−20 °C, until extraction of RNA. Mussels were also sampled for phys-iological measurements, enzyme activities and protein modifications

ed for primer design

Anneal temp. GeneBank access Published by

56 °C AF15749157 °C AF17260751 °C AF135117 Pan et al. (2000)57 °C AJ005451 Barsyte et al. (1999)57 °C AJ005456 Barsyte et al. (1999)

Table 3Expression of MT10 in Mytilus sp. gill tissue, for controls and after exposure to copper(35 ppb) or petrol (0.3‰), for 10 days

Expression level Region Control Copper Petrol

No. of mussels not expressing MT10 North 10/18 13/18 9/17South 12/18 7/18 6/18

No. of mussels with a weak expression of MT10 North 5/18 2/18 6/17South 5/18 4/18 4/18

No. of mussels with a strong expression of MT10 North 3/18 3/18 2/17South 1/18 7/18 8/18

103K. Lilja et al. / Comparative Biochemistry and Physiology, Part C 148 (2008) 101–106

(results presented in Prevodnik et al., 2007), and for genetic analyses(Gardeström et al., in prep.).

Gill tissue from individual mussels stored in RNALater wasdissected, and total RNA extracted using RNAAquous™ (Ambion).RNA concentrations and purities were determined by UV-spectro-photometry and sampleswere stored at −70 °C until further processing.RNA probes were synthesized from the previously generated clones,using the Strip-EZ™ RNA kit (Ambion) and biotinylated UTP (RocheDiagnostics, GmbH, Germany). RNA samples were separated ondenaturing NorthernMax™ (Ambion) agarose gels, 5 µg total RNA foreach sample, transferred to positively charged nylon membranes(Hybond™-N+, Amersham Pharmacia Biotech, UK) and crosslinked tothe membranes by ultraviolet light. Probes were hybridized, in theorder MT20, HSP90, MT10, HSP70 and actin, to the crosslinked RNAovernight. Expression of mRNAs was detected using the BrightStar™BioDetect™ kit (Ambion), and blot images captured by a CCD-camera(Fuji LAS 1000). After detection, the hybridized probe was stripped andthe next probe was hybridized to the blot. All procedures wereperformed according to manufacturers' recommendations. Quantifica-tion of band intensities (arbitrary units, A.U.) was done with theprogram Image Gauge 4.0 (Fuji Photo Film, GmbH, Germany).

2.3. Data treatment and statistics

In order to allow for comparisons between blots, band intensitieswere normalized to control values within each sampling site, meancontrol value set to 1, prior to statistical analyses. Expression of MT20,HSP70 andHSP90were further normalized against the actin expression,to minimize possible effects due to differences in loading and transferefficiency within each blot. Normalized data were log transformed inorder to reduce differences in variances. To analyse treatment effectsand interactions between treatments and region, the log transformeddata was analyzed by a mixed hierarchical linear model. The generallinear model (GLM) procedure in the SAS/STAT software (SAS instituteInc., USA) was usedwithmean squares for replicate flasks as error term.Since expression of MT10 was either strong, weak, or absent, theresponse was not treated as a continuous variable and are insteadreported as numbers of mussels expressing MT10.

3. Results

3.1. Cloning

PCR fragments of expected sizes were successfully amplifiedand cloned into the vector. Analysis of sequenced inserts revealed

Fig.1.Northern blot image for control mussels, andmussels exposed to copper (35 ppb) or peRNA were separated on a 1% denaturing agarose gel, and biotinylated RNA probes were use

high sequence homologies, both at the nucleotide and the proteinlevel, to sequences previously reported to GenBank (data notshown). The sequences are the first reported from Mytilus sp.collected from the Baltic Sea, and sequence data was submitted toGenBank and assigned the following accession numbers: EF140761949 bp Mytilus sp. actin mRNA, EF140762 437 bp Mytilus sp. heat-shock protein 70 (HSP70) mRNA, EF140763 285 bp Mytilus sp.heat-shock protein 90 (HSP90) mRNA, EF140765 266 bp metal-lothionein 10 (MT10) mRNA, EF140766 381 bp metallothionein 20(MT20) mRNA.

3.2. mRNA expression analysis

Northern blot analysis detected expression of MT10, MT20, HSP70,HSP90 and actin, as shown for the site Gudhjem in Fig. 1. Expressionof all mRNAs, except for MT10, was seen in all individual musselsanalyzed.

There was a high individual variation in expression level of theMT10mRNA (Fig. 1). Manymussels did not express detectable levels ofMT10 mRNA at all, some showed a weak expression and for someindividuals a strong expression was observed. No effect of treatmentcould be seen for mussels from the northern Baltic proper, but bothcopper and petrol increased the expression of MT10 in mussels fromthe southern Baltic proper (Table 3). In this region, the total number ofindividual mussels with a detectable (weak or strong) expression ofMT10 increased from 6 out of 18 (control) to 11 (copper) and 12(petrol). The number of individuals with a strong expression increasedfrom 1 to 7 and 8, respectively.

The expression ofMT20mRNA increased both by copper and petroltreatment (F1,16=6.44, p=0.022 and F1,16=7.14, p=0.015, respectively).This increase could be seen for mussels from the northern, but not thesouthern Baltic proper (Fig. 2). Thus, there were interactions betweentreatments and area (F1,16=5.15, p=0.037 for copper; and F1,16=17.56,p=0.0007 for petrol). In the north, expression of MT20 increased 2.8

trol (0.3‰), for 10 days, from site Gudhjem (southern Baltic Proper). Samples of 5 µg totald to detect MT10, MT20, HPSP70, HSP90 and actin mRNAs.

Fig. 2. Expression of MT20 mRNA in Mytilus sp. gill tissue from mussels from thenorthern and southern Baltic proper, treated as controls (C), exposed to copper (Cu)(35 ppb) or petrol (P) (0.3‰) for 10 days. The data was analyzed by a mixed hierarchicallinear model. Both copper and petrol overall significantly increased the expression ofMT20 mRNA (p=0.022 for copper and p=0.015 for petrol), and there were interactionsbetween treatments and area (p=0.037 for copper and p=0.0007 for petrol). Theincrease in MT20 mRNA expression could be seen for mussels from the northern, butnot from the southern Baltic proper. Results are normalized against actin levels andexpressed as relative values with respect to controls set to 1. Error bars express standarderrors of the means (n=6 replicate flasks). For each replicate flask, 3 individual musselswere analysed.

Fig. 4. Expression of HSP90 mRNA in Mytilus sp. gill tissue from mussels from thenorthern and southern Baltic proper, treated as controls (C), exposed to copper (Cu)(35 ppb) or petrol (P) (0.3‰) for 10 days. The expression of HSP90 mRNA increased aftercopper exposure (p=0.001), but no effect was seen after the petrol exposure. Noregional difference in expression could be seen. Results are normalized against actinlevels and expressed as relative values with respect to controls set to 1. Error barsexpress standard errors of the means (n=6 replicate flasks). For each replicate flask, 3individual mussels were analysed.

104 K. Lilja et al. / Comparative Biochemistry and Physiology, Part C 148 (2008) 101–106

times (±0.63 SE) after copper and 3.4 times (±0.58 SE) after petrolexposure.

The HSP70 mRNA was significantly induced by copper, (F1,16=14.3,p=0.002) but not by petrol exposure (Fig. 3). No differences betweenthe northern and southern Baltic proper could be seen in the responseto copper. The expression increased 1.6 times (±0.13 SE) in the north,and 1.6 times (±0.40 SE) in the south. Petrol exposure resulted in aslightly (1.5 times±0.34 SE) increased mean expression of HSP70 inmussels from the northern region, but this increase was notstatistically significant.

The expression of the HSP90 mRNA increased after copperexposure (F1,16=15.48, p=0.001), but no effect was seen after thepetrol exposure (Fig. 4). No differences between the northern andsouthern Baltic proper could be seen in the response to copper. The

Fig. 3. Expression of HSP70 mRNA in Mytilus sp. gill tissue from mussels from thenorthern and southern Baltic proper, treated as controls (C), exposed to copper (Cu)(35 ppb) or petrol (P) (0.3‰) for 10 days. The expression of HSP70 mRNA significantlyincreased by copper (p=0.002) but not by petrol exposure. No regional difference inexpression could be seen. Results are normalized against actin levels and expressed asrelative values with respect to controls set to 1. Error bars express standard errors of themeans (n=6 replicate flasks). For each replicate flask, 3 individual mussels wereanalysed.

expression increased 1.6 times (±0.15 SE) in the north and 1.7 times(±0.29 SE) in the south.

4. Discussion

In this study, we have shown a regional difference in theexpression of MT10 and MT20 mRNAs in gill tissue from Mytilus sp.after exposure to copper or petrol. The results show that both MTsincluded responded to exposure of both copper and hydrocarbons(petrol), MT20mRNA in the north andMT10mRNA in the south. In thenorthern Baltic Sea, MT protein levels have been shown to vary withseason in blue mussel digestive gland (Leiniö and Lehtonen, 2005).This variation only occasionally correlated with water temperature;instead it appeared to follow the reproductive cycle and growth periodwith a peak in May-June. The present study was conducted inSeptember after the reproduction period and no gametes were visiblein mussels from neither region at time of sampling. Differences inreproductive stage thus seem unlikely to be the cause of the regionaldifferences seen. Copper has previously been reported to be a weakinducer of MT10 and MT20 at the mRNA level. Dondero et al. (2005)detected a low induction of MT10 and MT20 mRNA after copperexposure in digestive gland ofM. galloprovincialis,whereas Lemoine etal. (2000) and Lemoine and Laulier (2003) could not detect any effecton MT10 or MT20 mRNA expression in M. edulis after exposure tocopper. Data on hydrocarbons (constituents of petrol) and MTexpression are scarce, since most studies on MT expression focus onmetals and the possible effects of other contaminants are often nottaken into account. An exception is a study by Lehtonen et al. (2006b)that concluded that MT levels in Macoma balthica is not alwayscorrelated to tissue burdens of metals, and that a gradient in organiccontaminants correlated well with levels of MTs. Recently, it has alsobeen shown that MTs in M. galloprovincialis are induced by a mixtureof PAHs, 2,4-D or lindane (Raftopoulou et al., 2006).

The toxic action of both copper and hydrocarbons can be due to theformation of reactive oxygen species by redox cycling (Livingstone,2001; Stohs and Bagchi, 1995), and there is growing evidence forantioxidant functions of MTs (Viarengo et al., 2000; Correia et al.,2002; Rodrigues-Ortega et al., 2002). Antioxidant properties of MTscan be due both to oxyradical scavenger capacity, and complexation ofmetal cations able to generate hydroxyl radicals. Indeed, Dondero etal. (2005) showed that hydroxyl radicals formed via the Fenton

105K. Lilja et al. / Comparative Biochemistry and Physiology, Part C 148 (2008) 101–106

reaction probably induce the basally low expression of MT20 at themRNA level in M. galloprovincialis digestive gland; a combinedexposure to H2O2 and Cu for 24 h, but not H2O2 or Cu alone, inducedMT20 mRNA. They also suggest, in another study, that the cause of anincrease in MT 20mRNA inM. edulis, caged along a copper gradient, tobe due to copper ions giving rise to hydroxyl radicals (Dondero et al.,2006a). In neither of these two studies by Dondero et al. (2005,2006a), an effect on MT10 mRNA levels could be seen. Thus, it seemslike MT20 mRNA is the isoform that responds to oxidative stress.

In the present study, an increase in MT20 mRNA expression couldbe seen in mussels from the north, but not in those from the south,after exposure to copper or petrol. We have previously shown a higherlevel of oxidative stress, indicated by a more pronounced increase inprotein carbonyl groups, after both treatments in the northernmussels (Prevodnik et al., 2007). This, together with our presentresults on MT20 mRNA and those of Dondero et al. (2005, 2006a) allindicate a role of oxidative stress in MT20 mRNA induction.

For the MT10 mRNA, a peculiar expression pattern could be seen.Either a strong, a weak, or no expression at all could be detected (seeFig. 1). This is not in agreement with a constitutively high expressionof MT10 mRNA, previously reported (see for instance Barsyte et al.,1999; Lemoine et al., 2000; Dondero et al., 2005). A pattern similar tothe present, with a strong individual variation in expression of MT10mRNA, can be seen (but is not discussed) in gill tissue of M.galloprovincialis, in the work by Zorita et al. (2007). Several differentisoforms of both MT10 and MT20 mRNA has been found. Barsyte et al.(1999) isolated five different MT10 mRNA sequences from M. edulisdigestive gland. In addition, Leignel et al. (2005) identified a smallerMT10 gene in M. edulis, characterized by the lack of introns.Expression of this shorter MT10 form, designated MT10B, wereshown at the mRNA level in gill tissue, but not in digestive gland ofM. galloprovincialis by Zorita et al. (2007). Most studies on MT10expression do not distinguish between the different isoforms, and thiscould mask variation in the expression of the different forms. Since allreportedMytilus sp. MT10 mRNA sequences show high homology, it islikely that the probes used in our study also detected all forms present.A possible explanation to the pattern observed, could thus be thatfewer forms of MT10 mRNA exist in the Baltic Sea blue mussel,compared to other Mytilus populations.

For the MT10 mRNA, a regional difference in expression could also,as for MT20, be seen. The number of mussels with a strong expressionincreased in response to the treatments for the southern region (Table3). We have previously shown that mussels from the northern Balticproper have a smaller energetic margin, evaluated as scope forgrowth, available to handle additional stress, compared to musselsfrom the southern Baltic proper (Prevodnik et al., 2007). This mighthave limited the ability of mussels from the north to induce theexpression of theMT10mRNA. Another explanation could be that highbasal levels of MT10 proteins in the northern Baltic proper may nothave called for the recruitment of new proteins. Within the BEEPproject, higher total MT protein levels were found in the less salinenorthern study areas of the Baltic Sea, suggesting an effect of salinityon total MT content (Lehtonen et al., 2006a), and MT10 constitutes amajor part of the total MT pool (Geret and Cosson, 2002). It has alsobeen shown that the total MT protein levels in digestive gland in bluemussels from the northern Baltic proper do not increase in response tocopper (Lehtonen and Leiniö, 2003).

Both HSPs investigated showed a similar expression pattern, with ahigher expression in mussels from both regions exposed to coppercompared to controls. Expression changes of HSP70 and HSP90mRNAs caused by anthropogenic stressors has not been analyzed inBaltic Sea blue mussels before, but the results are in agreement withresults on the protein level. Induction of HSP70 protein by copper inBaltic Sea blue mussels has been shown by Radlowska andPempkowiak (2002). In the present study expression of HSP70mRNA was also increased, although not statistically significant, by

petrol in mussels from the northern Baltic proper. Induction of bothHSP70 and HSP90 proteins has previously been shown in Baltic Seablue mussels after exposure to PAHs extracted from contaminatedsediments (Olsson et al., 2004), and Snyder et al. (2001) showed aninduction of HSP70 in M. galloprovincialis exposed to degraded oil. Incontrast, Dondero et al. (2006b) found a down regulation of HSP70,MT10 and MT20 mRNAs inM. edulis after exposure to North Sea crudeoil. However, it is not straight forward to compare results fromexposures to different complex mixtures, such as crude oil, PAHextracts and petrol. The various components present in such mixturescertainly affect different physiological pathways, and they may haveboth synergistic and antagonistic effects.

Petrol is a complex chemical mixture of hydrocarbons of 4 to 12carbons, such as paraffins, naphthenes, olefins and aromatic hydro-carbons. It is also well known to contain several metals, butconcentrations are generally low. Levels of most metals analyzed areusually in the orders of a few micrograms per litre (reviewed in Kornet al., 2007). Thus, similar metal content in the petrol used in thepresent study would add nanograms per litre levels of metals to theexposures, levels lower than found in Baltic Sea waters (Dippner andPohl, 2004; Pohl et al., 2006). It thus seems unlikely that metalcontamination of the petrol used in the present study has affected theresults.

In conclusion, our results clearly show that responses varybetween different regions within the Baltic proper, and also betweenthe Baltic Sea compared to what has been reported from other areas.This can probably be attributed to both environmental factors andpopulation differences. This strongly emphasises the importance tostudy the interactions between contaminants, populations andregions.

Acknowledgements

We are thankful for all the help given by Simon Kronlund, RolfSundberg and Jan-Olof Persson at the Division of MathematicalStatistics, Stockholm University, Christina Esplund at the Departmentof Biology and Environmental Science, Kalmar University whoprovided the algae stock culture, and finally the staff at the Askömarine laboratory. This studywas founded by the Foundation for BalticSea and East European Studies and StockholmMarine Research Centre.

References

Altshul, S.F., Madden, T.L., Schäffer, A.A., Zhang, J., Zhang, Z., Miller,W., Lipman, D.J., 1997.Gapped BLAST and PSI-BLAST: a new generation of protein database searchprograms. Nucleic Acids Res. 25, 3389–3402.

Amiard, J.-C., Amiard-Triquet, C., Barka, S., Pellerin, J., Rainbow, P.S., 2006. Metallothio-neins in aquatic invertebrates: their role in metal detoxification and their use asbiomarkers. Aquat. Toxicol. 76, 160–202.

Barsyte, D., White, K.N., Lovejoy, D.A., 1999. Cloning and characterization ofmetallothionein cDNAs in the mussel Mytilus edulis L. digestive gland. Comp.Biochem. Physiol. C 122, 287–296.

Correia, A.D., Livingstone, D.R., Costa, M.H., 2002. Effects of water-borne copper onmetallothionein and lipid peroxidation in the marine amphipod Gammarus locusta.Mar. Environ. Res. 54, 357–360.

Dippner, J.W., Pohl, C., 2004. Trends in heavy metal concentrations in the Western andCentral Baltic Seawaters detected by using empirical orthogonal functions analysis.J. Mar. Syst. 46, 69–83.

Dondero, F., Piacentini, L., Banni, M., Rebelo, M., Burlando, B., Viarengo, A., 2005.Quantitative PCR analysis of two molluscan metallothionein genes unveilsdifferential expression and regulation. Gene 345, 259–270.

Dondero, F., Dagnini, A., Jonsson, H., Caprì, F., Gastaldi, L., Viarengo, A., 2006a. Assessingthe occurrence of a stress syndrome in mussels (Mytilus edulis) using a combinedbiomarker/gene expression approach. Aquat. Toxicol. 78, S13–S24.

Dondero, F., Piacentini, L., Marsano, F., Rebelo, M., Vergani, L., Venier, P., Viarengo, A.,2006b. Gene transcription profiling in pollutant exposed mussels (Mytilus spp.)using a new low-density oligonucleotide microarray. Gene 376, 24–36.

Feder, M.E., Hofmann, G.E., 1999. Heat-shock proteins. Molecular chaperones, and thestress response: evolutionary and ecological physiology. Annu. Rev. Physiol. 61,243–282.

Geret, F., Cosson, R.P., 2002. Induction of specific isoforms of metallothionein in musseltissues after exposure to cadmium or mercury. Arch. Environ. Contam. Toxicol. 42,36–42.

106 K. Lilja et al. / Comparative Biochemistry and Physiology, Part C 148 (2008) 101–106

Jansson, A.-M., Kautsky, N., 1977. Quantitative survey of hard bottom communities in aBaltic archipelago. In: Keegan, B.F., O'Ceidigh, P., Boaden, P.J.S. (Eds.), Biology ofbenthic organisms.11th Europ. Symp. Mar. Biol., Galway, Oct. 1976. Pergamon Press,Oxford.

Jansson, B.-O., Dahlberg, K., 1999. The environmental status of the Baltic Sea in the1940s, today and in the future. Ambio 28, 312–319.

Johannesson, K., André, C., 2006. Life on the margin: genetic isolation and diversity lossin a peripheral marine ecosystem, the Baltic Sea. Mol. Ecol. 15, 2013–2029.

Kautsky, N., 1982. Growth and size structure in a Baltic Mytilus edulis population. Mar.Biol. 68, 117–133.

Kautsky, N., Johannesson, K., Tedengren, M., 1990. Genotypic and phenotypicdifferences between Baltic and North Sea populations of Mytilus edulis evaluatedthrough reciprocal transplantations. I. Growth andmorphology. Mar. Ecol. Prog. Ser.59, 203–210.

Kijewski, T.K., Zbawicka, M., Väinölä, R., Wenne, R., 2006. Introgression and DNAheteroplasmy in the Baltic populations of mussels Mytilus trossulus and M. edulis.Mar. Biol. 149, 1371–1385.

Korn, M.D.A., dos Santos, D.S.S., Welz, B., Vale, M.G.R., Teixeira, A.P., Lima, D.D., Ferreira,S.L.C., 2007. Atomic spectroscopic methods for the determination of metals andmetalloids in automotive fuels — a review. Talanta 73, 1–11.

Lassig, J., 1965. The distribution of marine brackish water lammellibranchs in thenorthern Baltic area. Commentat. Biol. 28, 1–41.

Lehtonen, K.K., Leiniö, S., 2003. Effects of exposure to copper and malathion onmetallothionein levels and acetycholinesterase activity of the musselMytilus edulisand the clam Macoma balthica from the northern Baltic Sea. Bull. Environ. Contam.Toxicol. 71, 489–496.

Lehtonen, K.K., Scheidek, D., 2006. Monitoring biological effects of pollution in the BalticSea: Neglected — but still wanted? Mar. Pollut. Bull. 53, 377–386.

Lehtonen, K.K., Scheidek, D., Köhler, A., Lang, T., Vuorinen, P.J., Förlin, L., Barsiene, J.,Pempkowiak, J., Gercken, J., 2006a. The BEEP project in the Baltic Sea: overview ofresults and outline for a regional biological effects monitoring strategy. Mar. Pollut.Bull. 53, 523–537.

Lehtonen, K.K., Leiniö, S., Scheider, R., Leivuori, M., 2006b. Biomarker of pollution effectsin the bivalves Mytilus edulis andMacoma baltica collected from the southern coastof Finland (Baltic Sea). Mar. Ecol. Prog. Ser. 322, 155–168.

Leignel, V., Hardivillier, Y., Laulier, M., 2005. Small metallothionein MT-10 genes incoastal and hydrothermal mussels. Mar. Biotechnol. 7, 236–244.

Leiniö, S., Lehtonen, K.K., 2005. Seasonal variability in biomarkers in the bivalves My-tilus edulis and Macoma balthica from the northern Baltic Sea. Comp. Biochem.Physiol. C 140, 408–421.

Lemoine, S., Laulier, M., 2003. Potential use of the mRNA of a specific metallothioneinisoform (MT-20) in mussel (Mytilus edulis) as a biomarker of cadmium contamina-tion. Mar. Pollut. Bull. 46, 1450–1455.

Lemoine, S., Bigot, Y., Sellos, D., Cosson, R.P., Laulier, M., 2000. Metallothionein isoformsin Mytilus edulis (Mollusca, Bivalvia): Complementary DNA characterization andquantification of expression in different organs after exposure to cadmium, zinc,and copper. Mar. Biotechnol. 2, 195–203.

Livingstone, D.R., 2001. Contaminant-stimulated reactive oxygen species productionand oxidative damage in aquatic organisms. Mar. Pollut. Bull. 48, 656–666.

Lyons,C.,Dowling,V., Tedengren,M.,Gardeström, J.,Hartl,M.G.J.,O'Brien,N., vanPelt,F.N.A.M., O'Halloran, J., Sheehan, D., 2003. Variability of heat shock proteins andglutathioneS-transferase ingill anddigestiveglandofbluemussel,Mytilusedulis.Mar. Environ. Res. 56, 585–597.

Matschullat, J., 1997. Trace element fluxes to the Baltic Sea: problems of input budget.Ambio 26, 363–368.

Olsson, B., Bradley, B.P., Gilek, M., Reimer, O., Shepard, J.L., Tedengren, M., 2004.Physiological and proteomic responses in Mytilus edulis exposed to PCBs and PAHsextracted from Baltic Sea sediments. Hydrobiologia 514, 15–27.

Pan, F., Zarate, J.M., Tremblay, G.C., Bradley, T.M., 2000. Cloning and characterization ofsalmon hsp90 cDNA: upregulation by thermal and hyperosmotic stress. J. Exp. Zool.287, 199–212.

Pohl, C., Löffler, A., Schmidt, M., Seifert, T., 2006. A trace metal (Pb, Cd, Zn, Cu) balancefor surface waters in the eastern Gotland Basin, Baltic Sea. J. Mar. Syst. 60, 381–395.

Prevodnik, A., Gardeström, J., Lilja, K., Elfwing, T., McDonagh, B., Petrovic, N., Tedengren,M., Sheehan, D., Bollner, T., 2007. Oxidative stress in response to xenobiotics in theblue musselMytilus edulis L: evidence for variation along a natural salinity gradientof the Baltic Sea. Aquat. Toxicol. 82, 63–71.

Radlowska, M., Pempkowiak, J., 2002. Stress-70 as indicator of heavy metalsaccumulation in blue mussel Mytilus edulis. Environ. Int. 27, 605–608.

Raftopoulou, E.K., Dailianis, S., Dimitriadis, V.K., Kaloyianni, M., 2006. Introduction ofcAMP and establishment of neutral lipids alterations as pollution biomarkers usingthe mussel Mytilus galloprovincialis. Correlation with a battery of biomarkers. Sci.Total Environ. 368, 597–614.

Remane, A., Schlieper, C., 1971. Biology of brackish water, 2nd ed. Die Binnengewässer,vol. 25. E. Schweizerbart'sche Verlagsbuchhandlung, Stuttgart (Nägele u.Obermiller).

Rodrigues-Ortega, M.J., Alhama, J., Funes, V., Romero-Ruiz, A., Rodrigues-Ariza, A.,Lópes-Barea, J., 2002. Biochemical biomarkers of pollution in the clam Chamaeleagallina from south-Spanish littoral. Environ. Toxicol. Chem. 21, 542–549.

Snyder, M.J., Girvetz, E., Mulder, E.P., 2001. Induction of marine mollusc stress proteinsby chemical or physical stress. Arch. Environ. Contam. Toxicol. 41, 22–29.

Stohs, S.J., Bagchi, D., 1995. Oxidative mechanisms in the toxicity of metal ions. FreeRadic. Biol. Med. 18, 321–336.

Tedengren, M., Kautsky, N., 1987. Comparative stress response to diesel oil and salinitychanges of the blue mussel, Mytilus edulis from the Baltic and North Seas. Ophelia28, 1–9.

Tedengren, M., André, C., Johannesson, K., Kautsky, N., 1990. Genotypic and phenotypicdifferences between Baltic and North Sea populations of Mytilus edulis evaluatedthrough reciprocal transplantations. III. Physiology. Mar. Ecol. Prog. Ser. 59,221–227.

Tedengren, M., Olsson, B., Bradley, B., Zhou, L., 1999. Heavy metal uptake, physiologicalresponse and survival of the blue mussel (Mytilus edulis) from marine and brackishwaters in relation to the induction of heat-shock protein 70. Hydrobiologia 393,261–269.

Theede, H., 1984. Physiological approaches to environmental problems in the Baltic.Limnologica 15, 443–458.

Viarengo, A., Burlando, B., Ceratto, N., Panfoli, I., 2000. Antioxidant role ofmetallothioneins: a comparative overview. Cell. Mol. Biol. 46, 407–417.

Väinölä, R., Hvilsom, M.M., 1991. Genetic divergence and a hybrid zone between Balticand North Sea Mytilus populations (Mytilidae: Mollusca). Biol. J. Linn. Soc. 43,127–148.

Walker, C.H., Hopkin, S.P., Sibly, R.M., Peakall, D.B., 1996. Biomarkers. Principles ofEcotoxicology, pp. 175–194.

Zorita, I., Bilbao, E., Schad, A., Cancio, I., Soto, M., Cajaraville, M.P., 2007. Tissue- and cell-specific expression of metallothionein genes in cadmium- and copper-exposedmussels analyzed by RT-PCR. Toxicol. Appl. Pharmacol. 220, 186–196.