ORIGINAL PAPER

Redescription and resurrection of Bertiella satyri (Cestoda,Anoplocephalidae) parasitizing the orangutan (Pongo abelii)in Indonesia

Ivona Foitová & Šárka Mašová & František Tenora & Božena Koubková &

Iveta Hodová & Martina Vyskočilová & Vlastimil Baruš & Wisnu Nurcahyo

Received: 11 January 2011 /Accepted: 17 February 2011 /Published online: 22 March 2011# Springer-Verlag 2011

Abstract The tapeworm species Bertiella satyri from asemi-wild Sumatran orangutan (Pongo abelii: Ponginae) is

Introduction

Parasitol Res (2011) 109:689–697DOI 10.1007/s00436-011-2300-0

redescribed and the sequence of its 18S rDNA ispresented. The tapeworms parasitizing the genera Pan,Pongo, Homo and Hylobates from Muséum Nationald'Histoire Naturelle, Paris and from Muséum d´HistoireNaturelle, Genève are also presented. The validity of B.satyri is confirmed. B. satyri (BSA) differs from the mostsimilar species Bertiella studeri (BSTU) in the followingcharacteristics: (1) testes number, BSTU 300–400; BSA116–124, (2) genital opening, BSTU regularly alternate;BSA irregularly alternate, (3) Cirrus-sac, BSTU short,0.250–0.320, does not reach excretory ducts; BSA long,0.630×0.495, reaches excretory ducts, (4) egg size, BSTU0.053–0.060; BSA 0.030–0.051, (5) host BSTU Pantroglodytes, Africa; BSA Pongo pygmaeus, P. abelii,Indonesia (Borneo, Sumatra). Both species differ accord-ing to our material and the name B. satyri (Blanchard,1891) is resurrected.

The first record of tapeworms in the orangutan was reportedand described as Bertiella satyri (Blanchard, 1891). Afragment of a strobila in faeces from a rehabilitatedorangutan (Pongo abelii Lesson, 1827) from Bohorok(former reintroductions Centrum for orangutan in Langkat,North Sumatra, Indonesia) was reported almost 100 yearslater by Collet et al. (1986). The authors said in thediscussion “that it is probably Bertiella studeri (Blanchard,1891)”. The record of tapeworm eggs in the same host andat the same locality was published as "Cestoda sp." by Mulet al. (2007). In this work, the authors call attention to theneedfulness of parasite identification at the species level.Previously, tapeworm eggs were recorded in one sample byCummings et al. (1973) from a captive orangutan [Pongopygmaeus (Linnaeus, 1760)] (Yerkes Regional PrimateResearch Centre, USA). From abovementioned records, itis obvious that the first description of B. studeri andBertiella satyri by Blanchard (1891) did not provide theexact determination of the orangutan tapeworm.

Our material from P. abelii is the first finding from thenative territory of distribution. We describe the morpholo-gy, morphometry and molecular genetics for future com-parative studies with Bertiella tapeworms parasitizing non-human primates as well as humans, and evaluate museummaterial of Bertiella species, too.

Materials and methods

The village of Bukit Lawang (location of a formerrehabilitation centre for orangutans and the source for ourmaterial) is situated on the southwest boundary of the

I. Foitová (*) : Š. Mašová : F. Tenora : B. Koubková :I. Hodová :M. Vyskočilová :V. BarušDepartment of Botany and Zoology, Faculty of Science,Masaryk University,Kotlářská 2,611 37, Brno, Czech Republice-mail: ivona_foi@hotmail.com

I. Foitováe-mail: foitova@sci.muni.cz

W. NurcahyoDepartment of Parasitology, Kedokteran Hewan Faculty,Gadjah Mada University,Yogyakarta, Indonesia

Gunung Leuser National Park (Northern Sumatra, Indone-sia) (03°32.983′ N, 098°06.908′ E) at an altitude of 1,061 ftabove sea level. The annual variations of temperaturesrange between 21°C and 28°C with humidity between 80%and 100%. Annual rainfall variations are between 2,000–3,200 mm. The majority of orangutans (P. abelii) in thisarea are semi-wild populations (released after a reintroduc-tion process).

Two fragments of the tapeworm strobilae were collectedfrom the faeces of two orangutans caged separately while inthe quarantine between May and July 2000. Four pieces ofthe tapeworm strobilae were fixed in 70% ethanol, laterstained by the standard method with iron aceto-carmine,dehydrated and prepared as whole mounts in Canadabalsam. Permanent specimens were studied using anOlympus BX light microscope equipped with differentialinterference contrast (Nomarski DIC), and the digitalImage Analysis system (AnalySIS) was used for meas-urements. All measurements are given in millimeters.Line drawings were made with aid of a drawingattachment. Other pieces of strobilae were fixed in 70%ethanol for molecular analysis and in 10% formaldehydesolution for histological study. Standard histologicaltechniques were used. Material was embedded in histo-plast and sectioned. Transverse and longitudinalsections 7 μm thick were stained with hematoxylin-eosine. Fully developed eggs removed from the uteruswere examined in solution of glycerine and 70% ethanol(1:3). Names of the mammals from the order Primatesused in this study correspond with the nomenclature usedby Wilson & Reeder (2005).

Tapeworm strobila fragments were removed fromethanol and genomic DNA was extracted using theDneasyTM Tissue Kit (Qiagen). Partial 18S, the ITS1, theITS2 and partial 28S regions of rDNA were amplifiedusing the Mastercycler ep gradient S (Eppendorf) in a 50-μl PCR reaction containing 1X buffer with 2 mMMgSO4, 200 μM dNTPs, an aliquot of 30 ng of genomicDNA, 1.25 unit of Pfu DNA Polymerase (Fermentas)with proof reading activity and 0.5 μM of each primer—forward S18 and reverse L3T (Drogemuller et al. 2004).The reactions were amplified for 30 cycles of 95°C for1 min, 56°C for 45 s and 72°C for 3 min; initialdenaturation at 95°C for 2 min, and final extension at72°C for 10 min.

The PCR product was observed on a 1.5% agarose geland then cloned using the CloneJET™ PCR Cloning Kit(Fermentas) and JM109 competent cells (Promega). Fiveclones per parasite were purified with Wizard® SV Mini-preps DNA Purification System (Promega) and sent toMacrogen Inc. (Korea) for sequencing. The clones weresequenced in both direction using plasmid specific forwardand reverse primers. Direct sequencing of the PCR product

was performed using the same primers as for the PCR.DNA sequences were analyzed using Sequencher software(Gene Codes Corp.) and aligned using BioEdit version7.0.5.3 (Hall 1999). New sequences of Bertiella satyri weredeposited in GenBank with the accession numbersEU908290.1 and FJ006535.1.

Materials from museums

Material from Muséum National d’Histoire Naturelle, Paris

Bertia satyri Blanchard, 1891

Material was determined by Blanchard (1891) to be fromthe host P. pygmaeus (Linnaeus, 1760), syn. Simiasatyrus Linnaeus, 1758, distributed in Borneo. Materialswere represented on four slides with the followingnumbers: No. 82 C VII/1, No. 82 C VII/2, No. 83 CVII/1 and No. 83 C VII/2. These slides have affixedmacerated material, with 2–4 proglottids on each slide. Itis not possible to distinguish the tapeworm anatomy onthe slides with precision and the material is—with theexception of the host and distribution—inapplicable forpresent studies.

B. studeri Blanchard, 1891

Material was determined by Blanchard (1891) to be fromthe host Pan troglodytes (Blumenbach, 1775), distributed inAfrica. Materials were represented on nine slides with thefollowing numbers: No. 77 C VII1–81 C VII.

The slides included fragments of macerated proglottids,internal organs are not recognizable. Only the preparationNo. 81C VII forms a distinct uterus with ripe eggs of thesize 0.0508×0.0538. Similar to the name of host anddistribution, these data can be used for present taxonomicstudies.

Materials from Muséum d’Histoire Naturelle, Genève

Bertiella satyri (Blanchard, 1891)

Two slides of No. 45199 and two slides No. 45200, fromthe host Macacus in the locality of Hanoi, 1921, arewithout the name of the author’s determination.

The comparison of the material listed in the slides asoriginally described by Blanchard (1891) from the host P.pygmaeus (Borneo) with our own material from P. abelii(Sumatra) proved that the material from Macacus exhibitscharacteristics that are missing in the species Bertiellasatyri. Such characteristics are, for example, a smallernumber of testes (not more than 110), small cirrus-sac

690 Parasitol Res (2011) 109:689–697

which does not exceed the excretory ducts, and ovariumand vitellarium that are divided in two parts.

Bertiella satyri (Blanchard, 1891)

Determination and publication of the 12 slides of No.42181 from human (Homo sapiens) host, Calcutta8.4.1925, was performed by Chandler (1925).

Comparison of material (similar to the abovementioned)showed that material from Homo had features that did notcorrespond with traits from Bertiella satyri. Such character-istics include a smaller number of testes (not more than100), small cirrus-sac not exceeding the excretory ducts,larger eggs (0.046–0.049 mm) and an observed small knob-like projection [compare Fig. 1 in Chandler (1925) with thepresent Fig. 1.]

Determination and publication of 11 slides of No. 40298,host Hylobates hoolock, Calcutta, was performed byChandler (1925).

Comparison of material (similar to the abovementioned)showed that material from H. hoolock had features that didnot correspond with characteristics of Bertiella satyri.These are, for example, regularly alternating genital poresin mature proglottids, variation in egg size (0.042–0.046),number of testes (less than 100), and the ovary divided intwo parts.

No. 37232 Bertiella satyri, eight slides, locality notmentioned, author of determination and commentaryunknown. Each slide is signed twice. On one side of theslide, host P. pygmaeus, “Type”, while on other side“Bertiella satyri (Bl), type “HOMO”. This material ispresented with accompanying text: “Original name Bertiasatyri, current name B. studeri, host Homo according toslides, but Bourquin (1905) and Spasskii (1951) give hostas P. pygmaeus”.

From the aforesaid facts, they ensue that the materialregistered under No. 37232 is completely worthless andcannot be used for any serious scientific investigation.

cs

v

ca

b

d

Fig. 1 Line drawings ofBertiellasatyri sensu Chandler (1925)from human (a) and H. hoolock(b–d), both from Calcutta, India.a Scolex, cat. no. MHNG 42181,b detail of terminal genitalia,cirrus-sac (cs), vagina (v), cat.no. MHNG 40298, c part ofstrobila, genital pores alternatingirregularly, cat. no. MHNG40298, d mature proglottids, cat.no. MHNG 40298. Scale bars: a,c=250 μm, b=200 μm, d=500 μm

Parasitol Res (2011) 109:689–697 691

Results

Family Anoplocephalidae Cholodkovsky, 1902Genus Bertiella (Blanchard, 1891)Bertiella satyri (Blanchard, 1891) Stiles and Hassall

1902 (Figs. 2, 3 and 4)Syn.: Bertia satyri Blanchard, 1891

Description of our original material

Material of the tapeworm fragments without scoleces fromtwo specimens of P. abelii were the following: firstfragment is 82 mm long, composed of 85 proglottids;second fragment is 19 mm long, composed of 22proglottids. Proglottids craspedote: The parenchyma pre-sented small calcareous corpuscles (Fig. 2c). Matureproglottids 0.806–0.829 (n=5) long, 14.00–19.00 (n=5)wide, gravid proglottids 2.01–2.89 (n=5) long, and 12.03–14.02 (n=5) wide. The excretory system consists of fourlongitudinal ducts, visible throughout the entire length of

fragments of strobila. Genital openings alternate irregularly(Fig. 2a). The cirrus-sac is 0.251–0.322 (n=5) long, 0.10–0.12 (n=5) wide, overlayed by the glandular vagina, andreaches excretory canals (Fig. 2f). Cirrus unarmed. Testesapproximately 116–124 (n=2) per proglottid, and thesemeasure 0.079–0.111×0.052–0.063 (n=5). Male and fe-male pores lead into common atrium and overlap (Figs. 2e,f). Vaginal cavity is surrounded by layer of glandular cells(Fig. 3a). Vagina is 0.790–0.984 (n=5) long, 0.18–0.20 (n=5) wide, anterior to cirrus-sac (Figs. 1b and 2f). Uterus issingle, transverse, and posterior to testes (Fig. 3d), notreaching or only slightly surpassing the level of excretorycanals. Uterus develops anterioposterior diverticula filledwith eggs (Fig. 3c). Eggs spherical, oncosphere with sixhooks present, each with three envelopes including thepyriform apparatus (Fig. 4d). External envelope 0.030–0.051, mean 0.040±0.006, internal envelope 0.020–0.036,mean 0.026±0.004 in diameter, pyriform apparatus 0.017–0.032, mean 0.021±0.003 in length and 0.012–0.023, mean0.016±0.002 in width (for all eggs measurement n=50),

a b

c

d

ef

cs

v

ed

Fig. 2 a–f Line drawings ofBertiella satyri from P. abelii(Sumatra), our material. a Partof strobila with the uterus andgenital pores alternating irregu-larly, b transverse section ofstrobilar musculature, c calcare-ous corpuscles, d ripe egg, e, fterminal genitalia, cirrus-sac(cs), vagina (v), excretory duct(ed). Scale bars: a=1 mm, b–d=20 μm, e–f=400 μm

692 Parasitol Res (2011) 109:689–697

Fig. 3 a–d Histology transver-sal sections of proglottids Ber-tiella satyri from P. abelii(Sumatra), our material. a Partof gravid proglottid with vagina(va), part of uterus (ut) andgenital atrium (ga), b position ofmuscles (mu) and calcareouscorpuscles (arrows), c uterus (ut)filled with eggs, d testes (te) andpart of uterus with eggs (eg).Scale bars: a–d=200 μm

Fig. 4 a–d Photos of Bertiellasatyri eggs from differentposition and maturity, host P.abelii (Sumatra), our material,wet preparation. a–b Nonripeegg, d ripe egg. Scale bars:a–d=20 μm

Parasitol Res (2011) 109:689–697 693

oncosphere 0.011–0.021, mean 0.014±0.002 (n=30)(Figs. 2d, 4a–d).

DNA characterization

Genomic DNA from one individual of Bertiella satyri yieldedPCR products of approximately 2 kb. The first part of thenucleic acid sequence spanned 841 bp of partial 18S rDNAand partial ITS-1 regions and was deposited in GenBankwith the accession numbers EU908290.1 whereas the 838 bpof the second part included the partial internal transcribedspacer 2 (ITS-2) and partial 28S rDNA and was deposited inGenBank with the accession numbers FJ006535.1.

BLAST searches (blastn) reveal that Bertiella satyri is thefirst species of genus Bertiella to have these sequencesreported and can now be found at http://www.ncbi.nlm.nih.gov. The sequences showed greatest similarity with speciesof the family Anoplocephalidae. The partial sequences of18S rDNA (273 bp) and 28S rDNA (298 bp) were comparedwith known, referenced individuals of the family Anoploce-phalidae in GenBank, and the differences of the 18S rDNAsequences are presented in Fig. 5. The similarity between thesequences of Bertiella satyri and other anoplocephalidsequences included an alignment ranging between 99% and97% for 18S rDNA and between 99% and 93% for 28S

rDNA. The similarity between 86% and 78% was found byBLAST search for the sequence of ITS-1 with fragmentsapproximately 122 bp and 138 bp for the ITS-1 of fourindividuals of family Anoplocephalidae [Anoplocephalaperfoliata (Goeze, 1782), Paranoplocephala mamillana(Mehlis, 1831), Schizorchis sp. and Mosgovoyia pectinata(Goeze, 1782)]. The ITS-2 region of Bertiella satyri isunique and no similarity was found by BLAST searchbetween ITS-2 and sequences of other Cestoda (Fig. 5).

Taxonomic summary

Host: P. abelii (Hominidae)Locality: Sumatra (Indonesia)Material: from feacesThe tapeworm strobilar fragments and four permanent

mounts have been deposited in the helminthological collec-tion of the Research Centre for Biology, Indonesian Institutefor Sciences at Cibinong, Indonesia (Cat. No.: MZBNa 414.).

Notes

Our presented material is not fully described. This is due tothe fact that the material of tapeworms from the excrement

B.satyri GGCGGTGTCAACGAGTCAGACCTTCTGGCCTGAAAAGGCTGGGTAAACTGGTCAATCACC 60A.dentata ......................................T.....................A.cuniculi ......................................T.....................A.perfoliata ......................................T.....................P.mamillana ......................................T.....................M.ctenoides ......................................T....C................

B.satyri GTCATGACAGGGATCGGGGCTTGGAATTATTCCCCGTGAACGAGGAATTCCTAGTAAGTG 120A.dentata ............................................................A.cuniculi ............................................................A.perfoliata ............................................................P.mamillana ............................G...............................M.ctenoides ............................................................

B.satyri CAAGTCATAAGCTTGCGCTGATTACGTCCCTGCCCTTTGTACACACCGCCCGTCGCTACT 180A.dentata ............................................................A.cuniculi ............................................................A.perfoliata ............................................................P.mamillana ............................................................M.ctenoides ............................................................

B.satyri ACCGATTGAATGGTTTAGTAAGGTCCTTGGATTGGCGCCATCTT-GGTG-CCCCGAAAGG 238A.dentata ................................C...........-....-..........A.cuniculi ................................C...........-....-.....G....A.perfoliata .........................................T..-....G..........P.mamillana ................................C...........-....-..........M.ctenoides ...................G.....................-..C....-..........

B.satyri TGGCTACCTGGCCGGTGCTGAGAAGACGACCAAAC 273A.dentata ...................................A.cuniculi ...................................A.perfoliata ..........A........................P.mamillana ...................................M.ctenoides .........AA........................

Fig. 5 Bertiella satyri from P.abelii (Sumatra), sequencecomparison of 18S rDNA ofBertiella satyri and other relatedspecies of the family Anoploce-phalidae. The following sequen-ces of 18S rDNA retrieved fromthe GenBank were used: Ano-plocephaloides dentata Z98358,Andrya cuniculi AJ555163,Anoplocephala perfoliataAJ578153, Paranoplocephalamamillana AJ578155, Mosgo-voyia ctenoides AJ555166,DNA sequences were alignedBioEdit version 7.0.5.3

694 Parasitol Res (2011) 109:689–697

of P. abelii was not sufficiently stained. It was thus notpossible to reliably distinguish certain organs, such as thesize of the ovaries, vitellaria, Mehlis' gland, distribution ofthe testes, etc. from the sections. These need to besupplemented by new material. However, these circum-stances do not preclude the possibility of choosing from theknown facts such features that differentiate the speciesBertiella satyri from B. studeri.

Discussion

Blanchard (1891) described two tapeworm species: Bertiastuderi and Bertia satyri. B studeri is a parasite of Pantroglotydes from Africa, whilst B. satyri is a parasite of P.pygmaeus from Indonesia—Borneo. The name Bertia wasalready taken, so Stiles and Hassall (1902) proposed thenew name Bertiella and placed the two abovementionedspecies within this genus. Whereas the species B. studeri,having priority in the original description by Blanchard(1891) (p. 187–190) is documented fairly well, Bertiellasatyri is poorly described. Blanchard (1891) determinedonly one character (with the exception of the host anddistribution), which distinguished Bertiella satyri from B.studeri: “Ce doit être un Ver d’assez grande dimension”.

Extended redescription of B. studeri from African P.troglodytes was given by Bourquin (1905). However, Baer(1927) did not accept Bertiella satyri as a valid taxon on thebasis of material revision of B. studeri from the GenevaMuseum. He gave a compilatory description of B. studerifrom different redescriptions, different hosts (monkeys,Homo), different authors and from different geographicaldistribution (Africa, Asia). Baer (1927) evaluates Bertiellasatyri as a variety of B. studeri and suggested that thename Bertiella satyri to be classified as synonymous withB. studeri.

Characteristics of the species B. studeri after classifica-tion by Baer (1927) are respected, for example by Joyeuxand Baer (1929, 1936), Joyeux and Dollfus (1931), Sprehn(1932), Adams and Webb (1933), Neveu-Lemaire (1936),Bonne (1940), Stunkard (1940), Wardle & McLeod (1952),López-Neyra (1954), Yamaguti (1959), D’Alessandro et al.(1963), Denegri (1985), Schmidt (1986), Kagei et al.(1992), Panda & Panda (1994), and others.

Galán-Puchades et al. (2000), based on the literature andtheir own findings (Galán-Puchades et al. 1996; 1997a, b),stated: “A comparative study with other earlier descriptionsof the species suggest that B. studeri should be regarded asa Bertiella studeri species complex”. Foitová et al. (2009)published an overview of parasites in orangutans whichincluded Cestoda sp. only. Even after 2000, some studieswere published in which the species B. studeri wasdiscussed only as the name without comments. For example

the studies of Xuan et al. (2003) on material from Vietnam,El-Dib et al. (2004) on material from Saudi Arabia, and Sunet al. (2006) on material from China, all find B. studerifrom humans. Above reports of B. studeri from Homo thusneed revision, as all reports are from geographic locationswhere the typical host of B. studeri, the chimpanzee (P.troglotydes), is not found.

Other authors (Blanchard 1913; Chandler 1925; Mukerji1927; Sharma 1930), in contrast to the authors mentionedabove, acknowledge Bertiella satyri as a valid taxon. Asalready noted, it is a species of tapeworm which parasitizesP. pygmaeus in Indonesia (Borneo). Ever since the descrip-tion of the taxon (1891), no other findings have beenregistered for this species in the host P. pygmaeus. Scientificliterature lists Bertiella satyri in different hosts (Homo, H.hoolock) with distribution in Asia or in the oriental countries.When Blanchard (1913) discovered Bertiella satyri in Homo,he based his finding on a hypothesis “… on croyait quechaque espèce animale avait ses parasites particuliers, qui nepouvaient se rencontrer chez d’autres animaux que trèsexceptionnellement…Aujourd’hui, cette opinion doctrinaleest détruite…”. And, in addition,“… un tel échanges’accomplit aussi, evec une réelle activité, entre l’Hommeet les animaux et entre animaux d’espèces très differentes.”This hypothesis has not been unambiguously accepted inrecent years (Beveridge 1985; Hasegawa 1999; Tenora et al.2004; Hoberg 2006). Our reexamination of the material ofChandler (1925) indicates that he did not work with thespecies Bertiella satyri. Chandler himself notes that, “Al-though the measurements of the human parasites heredescribed do not coincide exactly with those given byBlanchard (1891), (1913) this seems to be readily explicableon account of the great variation due to the state ofcontraction.” The findings by Mukerji (1927) and Sharma(1930), concerning the species Bertiella satyri in humans arebased on eggs from excrement and were not subject to amore thorough analysis. Another finding of Bertiella satyrideposited in the Geneva Museum is registered on the basisof material from Macacus. It does not state any author orlocality. By reviewing this material, we came to theconclusion that it does not belong to the species Bertiellasatyri (see part 3 “Materials from museums”). By analysingthe preserved material of the tapeworm species Bertiellafrom Muséum National d'Histoire Naturelle, Paris andMuséum d'Histoire Naturelle, Genève (see materials) andby re-describing the species B.studeri from Bourquin(1905) and our own material, we determined basic criteriafor distinguishing between the species B. studeri (BSTU)and Bertiella satyri (BSA). These characteristics are asfollows (in mm): (1) testes number, BSTU 300–400, BSA116–124; (2) genital opening, BSTU regularly alternate,BSA irregularly alternate; (3) cirrus-sac, BSTU short,0.250–0.320, not exceeding excretory ducts, BSA long,

Parasitol Res (2011) 109:689–697 695

0.630×0.495, exceeding excretory ducts; (4) eggs size,BSTU 0.053–0.060, BSA 0.030–0.051; 5) host BSTU P.troglodytes, Africa, BSA P. pygmaeus, P. abelii, Indonesia(Borneo, Sumatra).

Our analysis shows that with the morphometricalcharacteristics used for differentiation of the taxa B. studeriand Bertiella satyri, together with findings from ourmaterial, it is possible to differentiate both species and wethus propose the resurrection of the name Bertiella satyri(Blanchard, 1891).

The species B. studeri (Africa) and Bertiella satyri(Asia) vary also in their zoogeographical distribution, inparticular if the phylogenic relations among living GreatApes and humans are taken into account (Chen and Li2001). Orangutans (Ponginae, Pongo) (Goodman et al.1998; Gaisler & Zima 2007) are a basal branch of hominids(Hominidae). Taking the orangutan speciation date as 12 to16 million years ago, the gorilla (Gorillinae, Gorilla)lineage separated from the human branch 1.6 to 2.2 millionyears earlier than the Chimpanzee (Homininae, Homo +Pan), whose divergence is estimated at 4.6 to 6.2 millionyears (Chen & Li 2001) ago. The phylogeny of these hostgroups thus supports the hypothesis that there has beensufficient time for the co-evolution and co-speciation of theBertiella—tapeworm ancestor into different species.

Materials from the tapeworm species Bertiella deter-mined as Bertiella satyri, which do not correspond to theset of specified characteristics for Bertiella satyri, belong tothe “species complex” of Bertiella-parasitizing primates.The acquisition of new material including DNA (the basisfor analysis of which is presented in this paper), whilepaying particular attention to its specific relation to its host(Beveridge 1985), could help clarify the systematic positionof the hitherto definitively taxonomically undeterminedmaterial.

Acknowledgements Authors would like to thank the State Ministryof Research and Technology (RISTEK) and Directorate General forNatural Conservation (PHKA) for their cooperation and for grantingpermission to conduct research in Gunung Leuser National Park. Thestudy was financially supported by the Foundation “UMI—Saving ofPongidae” Parasites and Natural Antiparasitics in Orangutan, by theLong-term Research Plan MSM 0021622416 (Ministry of Education,Youth and Sports of the Czech Republic) and by Czech Academy ofSciences Grant P505/11/1163. Vlastimil Baruš was supported byResearch Project of the Faculty of Agrobiology, Food and NaturalResources Czech University of Life Sciences in Prague, No. MSM6046070901 and Šárka Mašová by the Czech Science Foundation,Grant No. 526/09/H025. The authors would also like to thank Dr. IanBeveridge, Australia and two anonymous reviewers for their helpfulcomments. Special thanks go to Mr. Jimmy Cassone, Chargés desCollections d’Helminthes, Muséum National d'Histoire Naturelle,Paris and to Dr. Jean Mariaux, Muséum d´Histoire Naturelle, Genèvefor lending the type specimens. We are grateful to Emma Hankinsonand David Pearton for editing and grammar suggestions.

References

Adams ARD, Webb L (1933) Two further cases of human infestation withBertiella studeri (Blanchard, 1891) Stiles and Hassall, 1902, withsome observation on the probable synonymy of the specimenspreviously recorded from man. Ann Trop Med Parasitol 27:471–475

Baer JG (1927) Monographie des Cestodes de la Famille Anoploce-phalidae. B Soc Biol Fr Belg 10:1–241

Beveridge I (1985) The genus Bertiella (Cestoda: Anoplocephalidae)from Australian mammals: new species, new records andredescriptions. Syst Parasitol 7:241–289

Blanchard R (1891) Sur les helminthes des Primates anthropoids.Mem Soc Zool Fr 4:186–196

Blanchard MR (1913) Communications. I. Bertiella satyri, del’Orang-outang, est aussi parasite de l'Homme. B Acad MedParis 69:286–296

Bonne C (1940) Over Bertiella studeri (Blanchard 1891). Bertiellasatyri Stiles & Hassal 1926. Bertia satyri Blanchard 1891.Geneesk Tijdschr Ned India 80:2222–2230

Bourquin J (1905) Cestodes de Mammifères. Le genre Bertia. RevSuisse Zool 13:415–506

Chandler AC (1925) New records of Bertiella satyri (Cestoda) in manand apes. Parasitology 17:421–425

Chen FC, LiWH (2001) Genomic divergences between humans and otherhominoids and the effective population size of the common ancestorsof humans and chimpanzees. Am J Hum Genet 68:444–456

Collet JY, Galdikas BMF, Sugarjito J, Jojosudharmo S (1986) Acoprological study of parasitism in Orangutans (Pongo pygmaes)in Indonesia. J Med Primatol 15:121–129

Cummings LB, Keeling ME, McClure HM (1973) Preventive medicinein anthropoids: parasite control. Lab Anim Sci 23:819–822

D’Alessandro AB, Beaver PC, Masi Pallares R (1963) Bertiellainfection in man in Paraguay. Am J Trop Med Hyg 12:193–198

Denegri GM (1985) Considerationes sobre sistematica y distributiongeografica del genero Bertiella (Cestoda-Anoplocephalidae) en elhombre y en primates no humanos. Neotropica 31:55–63

Drogemuller M, Beelitz P, Pfister K, Schnieder T, von Samson-Himmelstjerna G (2004) Amplification of ribosomal DNA ofAnoplocephalidae: Anoplocephala perfoliata diagnosis by PCRas a possible alternative to coprological methods. Vet Parasitol124:205–215

El-Dib NA, Al-Rufaii A, El-Badry AA, Al-Zoheiry AA, El-Aall AA(2004) Human infection with Bertiella species in Saudi Arabia.Saudi Pharm J 2:168–169

Foitová I, Huffman MA, Nurcahyo W, Olšanský M (2009) Parasites andtheir impacts on orangutan health. In: Wish SA, Suci SU, Setia TM,Schaik CP (eds) Orangutans geographic variation in behavioralecology and conservation. Oxford Press, New York, pp 157–169

Gaisler J, Zima J (2007) Zoologie obratlovců. Academia PrahaGalán-Puchades MT, Simarro PP, Fuentes MV, Franco JR, Ndong P,

Mas-Coma S (1996) First report of human cestodiasis inequatorial Guinea. Res Rev Parasitol 56:143–145

Galán-Puchades MT, Fuentes MV, Mas-Coma S (1997a) HumanBertiella studeri in Spain, probably of African origin. Am J TropMed Hyg 56:610–612

Galán-Puchades MT, Fuentes MV, Simarro PP, Mas-Coma S (1997b)Human Bertiella studeri in equatorial Guinea. T Roy Soc TropMed H 91:678

Galán-Puchades MT, Fuentes MV, Mas-Coma S (2000) Morphologyof Bertiella studeri (Blanchard, 1891) sensu Stunkard (1940)(Cestoda: Anoplocephalidae) of human origin and a proposal ofcriteria for the specific diagnosis of bertiellosis. Folia Parasitol47:23–28

696 Parasitol Res (2011) 109:689–697

Goodman M, Porter CA, Czelusniak J, Page SL, Schneider H,Shoshani J, Gunnell G, Groves CP (1998) Towards a phyloge-netic classification of primates based on DNA evidence com-plemented by fossil evidence. Mol Phylogenet Evol 9:585–598

Hall TA (1999) BioEdit: a user-friendly biological sequence alignmenteditor and analysis program for Windows 95/98/NT. NucleicAcids Symp Ser 41:95–98

Hasegawa H (1999) Phylogeny, host-parasite relationship and zooge-ography. Korean J Parasitol 37:197–213

Hoberg EP (2006) Phylogeny of Taenia: species definitions andorigins of human parasites. Parasitol Int 55:23–30

Joyeux Ch, Baer JG (1929) Les cestodes rares de l'homme. Bull SocPathol Exot 23:114–136

Joyeux Ch, Baer JG (1936) Faune de France: les cestodes.Lechavalier, Paris

Joyeux Ch, Dollfus RP (1931) Un nouveau cas de Bertiella studeri (R.Bl.) chez l'homme. Société de biologie de Marseille, Séance du24. Mars 1931, 35–36

Kagei N, Purba Y, Sakamoto O (1992) Two cases of human infectionwith Bertiella studeri in North Sumatra, Indonesia. Jpn J TropMed H 22:165–168

López-Neyra CR (1954) Anoplocephalidae. Rev Ibér Parasitol 14:13–130Mukerji A (1927) The incidence of helminthic infections in the

Carmichael hospital for tropical diseases, Calcutta. Ind MedGazet 62:695–696

Mul IF, Paembonan W, Singleton I, Wich SA, van Bolhuis HG (2007)Intestinal parasites of free-ranging, semicaptive and captivePongo abelii in Sumatra, Indonesia. Int J Primatol 28:407–420

Neveu-Lemaire M (1936) Traité d'helminthologie médicale et véter-inaire. Am J Trop Med 16(5):641–642

Panda DN, Panda MR (1994) Record of Bertiella studeri (Blanchard,1891), an anoplocephalid tapeworm, from a child. Ann Trop MedParasitol 4:451–452

Schmidt GD (1986) Handbook of tapeworm identification. CRS Press,Boca Raton

Sharma AN (1930) Helmintic infections in Shillong. Ind Med Gazet65:200–203

Spasskii AA (1951) Essentials Cestodology. Anoplocephalata cest-odes of domestic and wild animals, vol 1.. Akademiya NaukSSSR, Moscow

Sprehn CEW (1932) Lehrbuch der Helminthologie. Eine Naturge-schichte der in deutschen Säugetieren und Vögeln schmarotzen-den Würmer, unter besonderer Berücksichtigung der Helminthendes Menschen, der Haustiere und wichtigsten Nutztiere. Verlagvon Gebrüder Borntraeger, Berlin

Stiles CW, Hassall A (1902) Bertiella, a new name for the cestodegenus Bertia Blanchard, 1891. Science 16:434

Stunkard HW (1940) The morphology and life history of the cestode,Bertiella studeri. Am J Trop Med Hyg 20:305–333

Sun X, Fang Q, Chen XZ, Hu SF, Xia H, Wang XM (2006) Bertiellastuderi infection, China. Emerg Infect Dis 12:176–177

Tenora F, Baruš V, Prokeš M (2004) Discussion to severaltapeworm species from the families Hymenolepididae,Anoplocephalidae and Davaineidae parasitising rodents andman. Acta Universitatis Agriculturae et Silviculturae Mende-lianae Brunensis 52:23–28

Wardle RA, McLeod JA (1952) The zoology of tapeworms.University of Minnesota Press, Minneapolis

Wilson DE, Reeder DA (2005) Mammals species of the world. Ataxonomic and geographic reference. The Johns HopkinsUniversity Press, Baltimore

Xuan LT, Anantaphruti MT, Tuan PA, Tu LX, Hien TV (2003) Thefirst human infection with Bertiella studeri in Vietnam. SoutheastAsian J Trop Med Public Health 34:289–300

Yamaguti S (1959) Systema helminthum, the cestodes of vertebrates,vol II. Interscience Publishers, New York

Parasitol Res (2011) 109:689–697 697