Journal of Immunological Methods 340 (2009) 1–10

Contents lists available at ScienceDirect

Journal of Immunological Methods

j ourna l homepage: www.e lsev ie r.com/ locate / j im

Research paper

Recombinant polymeric IgG anti-Rh: a novel strategy for development ofdirect agglutinating reagents

Ramon F. Montano a,b,⁎, Manuel L. Penichet a,c,d, Douglas P. Blackall e,Sherie L. Morrison a, Koteswara R. Chintalacharuvu f

a Department of Microbiology, Immunology and Molecular Genetics, and the Molecular Biology Institute, University of California, Los Angeles, CA, USAb Centro de Medicina Experimental, Instituto Venezolano de Investigaciones Científicas, Caracas, Venezuelac Division of Surgical Oncology, Department of Surgery, University of California, Los Angeles, CA, USAd The Jonsson Comprehensive Cancer Center, University of California, Los Angeles, CA, USAe Arkansas Children's Hospital, University of Arkansas for Medical Sciences, Little Rock, AR, USAf Chimeric Technologies, Inc., Torrance, CA, USA

a r t i c l e i n f o

Abbreviations: Rh, Rhesus; RBC, red blood cell;mAbs, monoclonal antibodies; Ab, antibody; AHG,CHO, Chinese hamster ovary; IAT, indirect anti-globulibuffered saline solution; BSA, bovine serum albuminnetetraacetic acid (di-sodium salt); CDR, complemregion; FR, framework.⁎ Corresponding author. Laboratorio de Patología

Centro de Medicina Experimental, Instituto VenezolaCientíficas (IVIC), Km. 11, Carretera Panamericana, Ap1020-A, Venezuela. Tel.: +58 212 5041158; fax: +58 21

E-mail address: rmontano@ivic.ve (R.F. Montano).

0022-1759/$ – see front matter © 2008 Elsevier B.V.doi:10.1016/j.jim.2008.09.011

a b s t r a c t

Article history:Received 3 March 2008Received in revised form 14 August 2008Accepted 2 September 2008Available online 9 October 2008

Anti-Rh alloantibodies are used in research and clinic laboratories to define the Rh antigenicprofile of human blood samples. IgM anti-Rh antibodies directly agglutinate Rh-positive RBCs.Anti-Rh antibodies of the IgG isotype bind to Rh antigens with a higher intrinsic affinity thanIgM and sensitize RBCs, but do not induce direct hemagglutination. The aim of this work was toproduce IgG anti-Rh possessing direct hemagglutinating properties of IgM. To achieve this goal,recombinant antibody technology was used to construct genes encoding Ig light and heavychains that will form polymers with anti-Rh specificity. Expression vectors and liposome-mediated DNA transfer were used to generate transfectomas secreting human recombinantIgG3 anti-Rh. ELISA, SDS-PAGE, and hemagglutination were used to identify and characterizethe recombinant antibody produced. Thus, a recombinant polymeric IgM-like IgG3 anti-Rhantibody was produced that directly agglutinates RBCs with specificity identical to that of theparent non-agglutinating IgG. The results obtained suggest that the technology used here togenerate polymeric IgM-like IgG3 anti-Rh antibodies can be applied to produce Rh blood typingreagents. This approach might also be used to develop reagents for which cell surface antigenbinding and agglutination or aggregation is required.

© 2008 Elsevier B.V. All rights reserved.

Keywords:Rh blood groupPolymeric IgGAnti-RhBlood typing

1. Introduction

The Rhesus (Rh) blood group is one of the most poly-morphic and immunogenic systems of alloantigens known in

Ig, immunoglobulin;anti-human globulin;n test; PBS, phosphate; EDTA, ethylendiami-entary determining

Celular y Molecular,no de Investigacionesartado 20632, Caracas2 5041086.

All rights reserved.

humans, and it has clinical importance because some Rhantigens (in particular the RhD antigen) may cause hemolytictransfusion reactions when Rh-positive blood is administeredto a previously sensitized Rh-negative patient (Mollison et al.,1997), and hemolytic disease in newborns due to Rhincompatibility (Rh-HDN) (Urbaniak and Greiss, 2000).Genes encoding two distinct Rh antigen-carrying proteinshave been cloned. The RhCE protein expresses the common Cor c and E or e antigens, whereas the RhD protein carries thecommon D antigen. In addition, RhCE and RhD may carryseveral other alloantigenic determinants raising the numberup to 49 independent antigens identifiedwithin the system sofar (Avent and Reid, 2000; Flegel, 2007). Along with RhAG(the Rh-associated glycoprotein), RhD and RhCE form the Rhprotein family, which can be found in the red blood cell (RBC)

2 R.F. Montano et al. / Journal of Immunological Methods 340 (2009) 1–10

membrane together with other Rh “accessory” proteinsforming the Rh complex (Avent and Reid, 2000; Huanget al., 2000).

IgM anti-Rh monoclonal antibodies (mAbs) of humanorigin can directly agglutinate Rh-positive RBCs, and somehave been used to develop excellent Rh blood typing reagents.Unfortunately, IgM reagents specific to the RhD antigen areunable to agglutinate weak D and DEL RBCs (Wagner et al.,1999; Flegel, 2005), which could lead to inaccurate Rhclassification of blood donors and recipients. So whenever ablood unit is typed in a blood bank facility as negative withone of these IgM reagents, it is necessary to distinguish a trueRhD-negative from a weak D by following up with higheraffinity polyclonal IgG anti-RhD. Since Anti-Rh antibodies ofthe IgG isotype bind to Rh antigens and sensitize RBCs but donot induce direct hemagglutination, the process involvesincubation with the IgG anti-RhD, a washing step, and finallythe addition of an anti-human globulin (AHG) reagent.Alternatively, Rh typing reagents containing mixtures of IgMand IgG, in combinationwith anti-human IgG gel cards can beused to simplify the procedure (Cate and Reilly, 1999).

Recombinant antibody (Ab) technology has been used inthe past to produce polymeric forms of IgG (Smith andMorrison, 1994). Here we describe a polymeric human anti-Rh recombinant Ab containing the variable regions of ahuman IgG1 anti-Rh mAb and the constant region of humanIgG3 with the 18 amino acids tailpiece of IgM (µtp) fused atthe COOH-terminus of the Ig gamma 3 (γ3) heavy chain. Thisnovel polymeric IgG expressed in CHO cells is correctlyassembled and secreted and, most importantly, it directly

Fig. 1. Strategy used for cloning of anti-Rh VH and VL genes. Anti-Rh VH (A) and VL (template and H (1) and L (6) chain specific antisense primers (See Table 1 for oligoindicated with arrows allowed for cloning and modification of anti-Rh VH and VL gplasmid DNA for VH PCR 2 and VL PCR 2A. PCR products from VL PCR 2A and CL PCR 2PCR 2 and PCR 2C (L chain) reactions were cloned, characterized by restriction analysifinal H and L chain expression vectors.

agglutinates RBCs with a pattern of reactivity identical to thatof the parent non-agglutinating IgG.

2. Materials and methods

2.1. Heterohybridomas producing anti-Rh antibodies

The production of human-mouse heterohybridomassecreting human IgG anti-Rh mAbs was previously described(Montano and Romano, 1994). The IgG subclass of the humananti-Rh mAbs was determined using standard class andsubclass-specific reagents as detailed elsewhere (Hamiltonand Morrison, 1993). The production of IgG anti-Rh with Hand L chains of the expected size was confirmed with purifiedmaterial obtained by Protein A affinity chromatography usingSDS-PAGE (Laemmli, 1970) under both reducing and non-reducing conditions.

2.2. Isolation of L and H chain variable region genes

The VL and VH (L and H chain variable region) genes wereisolated from the anti-Rh producing heterohybridoma D19 asdescribed previously (Coloma et al., 1992). The strategy fol-lowed is outlined in Fig.1. Briefly, total RNAwas prepared fromexponentially growing D19 cells using guanidinium thiocya-nate (Chomczynski and Sacchi, 1987). cDNA was synthesizedfrom total RNA using AMV reverse transcriptase (Promega,Madison, WI), a lambda (λ) L chain specific primer for the VL

gene, and a CH1-specific primer for the VH gene (Table 1). VL

and VH genes were amplified from the cDNA using PCR.

B) cDNAs were prepared using total RNA from 5×105 hybridoma D19 cells asnucleotide sequences). Two rounds of PCR using the oligonucleotide primersenes. cDNA was used as template for VH PCR 1, VL PCR 1, and CL PCR 2B, andB were used as templates for PCR 2C. Amplicons of the expected size from VH

s and DNA sequencing, and finally transferred as restriction fragments into the

Table 1Primers design for cloning anti-Rh antibody genes

Name (number) Sequence Target region in template

Primers for cloning the anti-Rh VH genecDNA VHcDNA (1) 5′ AGTAGAGTCCTGAGGACTGTA CH1 γ1 domain exonVH PCR 1 VHsense1a (2) 5′ ATGAAACACCTGTGGTTCTTCCTC Leader region of VH

VHantisense1b (3) 5′ GAAGACCGATGGGCCCTTGGT CH1 γ1 domain exonVH PCR 2 VHsense2c (4) 5′ GGGGATATCCACCATGAAACACCTGTGGTTCTTCCTC Anti-Rh VH leader region

VHantisense2d (5) 5′ GGGGCTAGCTGAGGAGACGGTGACCGTGGT 3′ end of anti-Rh J H segment

Primers for cloning the anti-Rh VL (λ) genecDNA (L chain)cDNAe (6) 5′ GATCCTGCAGCTC(C/T)AG(G/T)CT 3′UTR near the stop codon of CL geneVL PCR 1 VLsenseCf (7) 5′ ATGGCCTGG(T/G/A)C(T/C)C(C/T)(G/T/A)CT(G/C)CTC VL leader region

VLantisenseC (8) 5′ GTTGGCTTG(A/G)AGCTCCTCAGAGGA 5′ end of Cλ genes

Overlap PCR primersVL PCR 2A (VL domain) VLsenseO (9) 5′ ATGGCCTGGTCCCTACTGCTC Anti-Rh VL leader region

VLantisenseC (8) 5′ GTTGGCTTG(A/G)AGCTCCTCAGAGGA 5′ end of Cλ genesCL PCR 2B (CL domain) (J-C)LsenseO (10) 5′ ACCGAGGTGACCGTCCTAGGT The boundary between anti-Rh J L and Cλ

CLantisenseO (11) 5′ CTA(T/A)GA(A/G)CATTCTG(T/C)AGG 3′ end of Cλ genesPCR 2C (L chain) (L)senseg (12) 5′ GGGGATATCCACCATGGCCTGGTCCCTACTGCTC Anti-Rh VL leader region

(L)antisenseh (13) 5′ GGGGAATTCCTATGAACATTCTGTAGG 3′ end of the Cλ2 gene

aDesigned to hybridize to a sequence present in most of the exons encoding the leader peptides associated with V segments belonging to the human VH4 genefamily. Similar oligonucleotides (not shown) corresponding to the other human VH families were designed and used to amplify the anti-Rh VH gene fromhybridoma D19 but only # 2 produced an amplicon with the expected size. bDesigned to hybridize to a sequence in the exon encoding the CH1 γ1 domain locatedupstream from the sequence recognized by primer # 1. cOligonucleotide similar to # 2 but a protected (GGG) EcoRV site (underlined) and a ribosome binding site(bold) have been included at its 5′end. dDesigned to hybridize to the 3′end of the anti-Rh JH segment. A protected (GGG) NheI site (underlined) has been added to its5′end. eRedundant oligonucleotide (degeneracies indicated by alternative nucleotides between parentheses) designed to hybridize to the 3′UTR near the stopcodon of the four functional human Cλ genes. fRedundant oligonucleotide representing a consensus sequence that hybridizes to the vast majority of the exonsencoding the leader peptides associated with V segments belonging to the human lambda L chain genetic complex. gOligonucleotide similar to # 9 but a protected(GGG) EcoRV site (underlined) and a ribosome binding site (bold) have been included at its 5′end. hOligonucleotide designed to hybridize to the 3′end of the anti-Rh Cλ2 gene. A protected (GGG) EcoRI site (underlined) has been added to its 5′end.

3R.F. Montano et al. / Journal of Immunological Methods 340 (2009) 1–10

Oligonucleotides (Table 1) complementary to DNA sequenceslocated at the 5′ ends of either the human CL lambda (λ)constant region gene (for the VL gene) or the human Cγ1constant region gene (for the VH gene)were used as 3′ primersduring thefirst round of amplification. The 5′primers (Table 1)were designed to prime the majority of the reported DNAsequences encoding human leader peptides associated witheither theλ L chain or theH chains. The resulting PCR productswere cloned separately into a TAvector (Invitrogen, San Diego,CA). DNA sequencing of multiple independent clones con-firmed that no errors were introduced as a result of the PCR.The sequences were analyzed to establish V(D)J gene segmentusage and to define the amino acid sequences coded for thecloned variable region DNA. A second round of PCR was thenperformed using the appropriate 5′-leader primers and 3′-Jregion primers (Table 1) whose sequence matched the se-quence of the cloned VH gene. The cloned VL gene was pro-cessed as described below to obtain an entire λ L chain gene.

2.3. Construction of L and H chain expression vectors

To generate the L chain vector, the cloned anti-Rh VL cDNAwas first fused by overlapping PCR to a DNA fragment con-taining the human Cλ2 gene. DNA sequences encoding bothVL and CL domains were amplified by PCR in separatereactions using primers (Table 1) designed to generate PCRproducts with opposing (3′ for VL and 5′ for CL) complemen-tary ends (Fig.1). A second PCRwas performedwith these PCRproducts as templates and “external” primers (Table 1) wereused to obtain the entire anti-Rh L chain DNA. The anti-Rh Lchain DNAwas cloned into a TAvector, analyzed by restriction

enzyme digestion and DNA sequencing, and then transferredinto the expression vector pcDNA 3.1 (−) (Invitrogen, SanDiego, CA) as an EcoRV/EcoRI fragment.

To construct theH chain expressionvector, an intermediateplasmid was first built by combining selected sequences fromplasmids pAH4802 (Coloma et al., 1992), pAG4006 (Smith andMorrison, 1994), and pAN7608, which is a modified version ofpcDNA3.1 (−) that has the neomycin resistance gene asselectable marker. pAH4802 contains EcoRV/NheI restrictionsites for cloning of VH region genes and the DNA encoding thehuman γ3 H chain constant region, and pAG4006 contains aDNA sequence encoding a γ3 H chain with the tail piecefrom the human µ heavy chain (µtp) attached to its carboxyterminus. To generate the final H chain expression vector, thecloned anti-Rh VH cDNAwas transferred into this vector as anEcoRV/NheI fragment.

2.4. Expression of polymeric IgG3 anti-Rh in Chinese hamsterovary (CHO) cells

To obtain a recombinant polymeric IgG3 producing cellline, the L and H chain expression vectors were transfectedsequentially into CHO cells (American Type Culture Collection.Rockville, MD) using Lipofectamine (Invitrogen. Carlsbad, CA)and following the manufacturer's instructions. Stable L chainor IgG3 producing transfectants were selected in supplemen-ted culturemedium (IMDMplus 10% Fetal Calf Serum, 2mM L-Glutamine) containing 0.1 mg/ml Zeocin or 1 mg/ml G418,respectively. After two weeks, culture supernatants werescreened by ELISA. For L chain detection, plates were coatedwith polyclonal anti-human λ Ab (Sigma, St. Luis, MO) and

Fig. 2. SDS-PAGE analysis of the human monoclonal anti-Rh antibody D19.The secreted human monoclonal antibody D19 was purified from culturesupernatants using protein A affinity chromatography and analyzed by SDS-PAGE under non-reducing (A) and reducing (B) conditions. Proteins werestained with Coomassie blue. Positions of the molecular weight proteinstandards are indicated. Lane 1: human monoclonal antibody D19. Includedfor comparison are human recombinant anti-dansyl IgG1 (150 kDa) (Lane 2),human recombinant anti-dansyl IgG2 (150 kDa) (Lane 3), and humanrecombinant anti-dansyl IgG3 (175 kDa) (Lane 4).

4 R.F. Montano et al. / Journal of Immunological Methods 340 (2009) 1–10

bound recombinant L chain was detected using alkalinephosphatase conjugated anti-λ chain Ab (Sigma, St. Luis,MO). Plates were coated with an anti-human γ Ab (ZymedLaboratories, San Francisco, CA) for IgG3 screening and boundrecombinant Ig was detected using an alkaline phosphataseconjugated anti-λ chainAb (Sigma, St. Luis,MO). The human Igclass and subclass of the recombinant Abs was confirmed asindicated above. IgG3-containing supernatants were alsoscreened for Rh antigen binding and capacity to mediatedirect RBC agglutination by the microhemagglutination assaydescribed below.

2.5. Purification of polymeric IgG3 anti-Rh

Selected transfectomas were grown in serum-free med-ium in roller bottles and the Ab present in supernatant waspurified by affinity chromatography using protein G-sephar-ose (Sigma, St. Louis, MO). The molecular weight of thepurified Ab was assessed by SDS-PAGE in 4% acrylamide gelsunder non-reducing conditions. Monomeric IgG3 anti-Rh andcommercial IgM (Sigma, St. Louis, MO) were included as areference in these assays. The Ab was quantified using thebicinchoninic acid assay (BCA Protein Assay, Pierce ChemicalCo., Rockford, IL) and by comparing the intensity of bands tothat of an Ab with known concentration after separatingproteins by SDS-PAGE and Coomassie blue staining.

2.6. Agglutination studies with the polymeric IgG3 anti-Rh

The ability of the polymeric IgG3 anti-Rh to agglutinateRBCs was determined by a hemagglutination assay usingu-bottom microtiter plates. RhD-positive or RhD-negativeRBCs (25 µl of a 3% V/V suspension made up in saline or PBS)

Fig. 3. Nucleotide sequence of V(D)J segments used in the cloned anti-Rh VH and VL gare presented as open reading frames indicating complementary determining regio1989; Siminovitch et al., 1989; Tomlinson et al., 1992; Mattila et al., 1995; Williahomologous germline element found is included for comparison. Dots in cloned Vgermline sequence assigned and nucleotide changes are highlighted with bold chafound in the cloned gene segment and not present in the most homologous germlinthe cloned JH sequence (Fig. 2A), but it actually could occur at any of the TAC trinucleamino acid sequence (one-letter code) is only included where nucleotide changes w

were dispensed in a well containing 50 µl of anti-Rh Ab (asculture supernatant at different dilutions or purified protein)andmixed bygentle shaking. Plateswere incubated for 60minat 4 °C, 22–25 °C or 37 °C, and the pattern of spontaneoussedimentation was visually assessed. In this assay RBCsthat sediment tightly at the bottom of the plates are read asnegative. RBCs that form a carpet-like structure covering awide area of the well are read as positive. Monomeric IgG1and IgM anti-RhD Abs were used as controls for this assay.

The fine specificity of the recombinant polymeric anti-RhAb was assessed by testing it against a panel of reagent redblood cells of known blood group antigen phenotype (OrthoResolve® Panel A. Ortho-Clinical Diagnostics, Raritan, NJ)using a test tube-based assay (Brecher, 2005) or a gel columnmethod (ID-Micro Typing System, Ortho-Clinical Diagnostics,Raritan, NJ), according to the protocol provided by themanufacturer. The gel column method was also used to test430 unclassified human blood samples against the polymericIgG3 anti-Rh using a commercially available anti-RhD reagent(Immucor Inc. Norcross, GA) as a reference.

Hemagglutination studies were also performed in the testtube-based assay using ficin-treated or non-treated RBCs(PANOCELL — 10. Immucor Gamma. Norcross, GA), thepolymeric anti-Rh Ab, and a cryoagglutinin Ab reagent as acontrol (Polyclonal anti-I. BCA-biopool International. WestChester, PA). The reaction mixture (100 µl) containing RhD-negative or RhD-positive reagent red blood cells (3% suspen-sion) and Ab was incubated at 4 °C, 22–25 °C or 37 °C for30 min. RBCs were centrifuged for 20 s at 100 ×g and thepattern of agglutination was determined visually.

2.7. Inhibition of agglutination studies

A recombinant monomeric anti-Rh Ab with the samespecificity (same VH and VL domains) and isotype as thepolymeric Ab studied here was prepared in the laboratoryand used to attempt to inhibit the direct agglutinationmediated by the polymer. Both antibodies were used aspurified proteins having agglutination titers of 1/4000 (poly-meric IgG3) and 1/32,000 (monomeric IgG3, agglutinationtiter estimated by IAT). The polymeric anti-Rh was used attwo different concentrations, 1 μg/ml (equivalent to a 1/500dilution) and 125 ng/ml (equivalent to a 1/4000 dilution) andthe monomeric Ab was used at 0.3, 0.6, 1.2, 2.4, 4.8, 9.6 and96 μg/ml (the lowest Ab concentration being equivalent to adilution of 1/16,000) for each polymeric anti-Rh concentra-tion. Dilutions were made in PBS containing 0.1% BSA, 2%Glycerol, 5 mM EDTA, 0.5% sucrose, and 0.1% sodium azide.Test tubes were set for each condition by adding one drop ofRhD-positive RBCs (3% suspension) and spinning down thecells. Supernatants were aspirated off and the sediment ofRBCs was resuspended by gentle shaking. Equal volumes ofproperly diluted monomeric and polymeric anti-Rh Abs were

enes. Nucleotide sequences were obtained by automated DNA sequencing andns (CDR) according to published data (Udey and Blomberg, 1987; Sanz et al.ms et al., 1996; Corbett et al., 1997). The nucleotide sequence of the mosH and VL gene sequences indicate that the same nucleotide is found in theracters. Stars correspond to deletions (JH, Vλ, and Jλ) or nucleotide residuese element assigned (D). JH TAC deletion was arbitrarily placed 15 bases withinotides characteristically found at the 5′ end of the JH6c gene segment [17]. Theere non-synonymous.

,t

5R.F. Montano et al. / Journal of Immunological Methods 340 (2009) 1–10

Fig. 5. Polymeric IgG3 anti-Rh directly agglutinates Rh-positive RBCs. Aliquotsof Rh-positive RBCs were incubated in a 96-well microplate with a com-mercial anti-RhD IgM (Biotest AG, Germany) (A1), monomeric IgG1 anti-Rh(A2), or culture supernatants containing polymeric IgG3 anti-Rh harvestedfrom five independent transfectomas (B–F) at different dilutions [fromundiluted (position 1) up to a 1/2048 dilution (position 12)]. Dilutions weremade in supplemented culture medium. In this assay RBCs that sedimenttightly at the bottom of the plates are read as negative. RBCs that form acarpet-like structure covering a wide area of the well are read as positive.

Fig. 4. Polymeric IgG3 anti-Rh forms pentamers/hexamers. SDS-PAGE analysis(4% polyacrylamide gel) of purifiedmonomeric IgG3 anti-Rh (lane 1), polymericIgG3 anti-Rh (lane 2), and commercial IgM (lane 3) under non-reducingconditions. The proteins were stained with Coomassie blue.

6 R.F. Montano et al. / Journal of Immunological Methods 340 (2009) 1–10

mixed, added to RBCs, mixed well, and incubated at 20–22 °Cfor 20 min. The pattern of agglutination was determinedvisually.

3. Results

3.1. Production and characterization of heterohybridomassecreting human anti-Rh mAbs

The production and characterization of a number ofhuman-mouse heterohybridomas secreting human anti-RhmAbs was described previously (Montano and Romano,1994). The human anti-Rh present in supernatant of thehighest producing hybridoma known as clone D19 wasfurther studied. Analysis of the Protein A-purified mAb bySDS-PAGE under non-reducing conditions showed that D19cells secreted fully assembled IgG similar to recombinantchimeric IgG1, IgG2, and IgG3 (Fig. 2A, Lanes 1–4). Underreducing conditions, H and L chains with the expectedmolecular weights were observed (Fig. 2B, Lanes 1–4). Isotypespecific ELISA indicated that D19 mAb is an IgG1 with λ Lchain (not shown). Knowledge of the isotypes enabled thedesign of specific primers for cloning the genes encoding thevariable regions of both D19 H and L chains.

3.2. Cloning and sequence analysis of genes encoding anti-Rh VH

and VL regions

The genes encoding VH and VL domains of the D19 mAbwere cloned, sequenced and analyzed. The VH gene segmentbelongs to the human VH4 gene family, and eight nucleotidedifferences were found when its sequence was comparedwith VH4.21 (Tomlinson et al., 1992), the closest germline V inthe family (Fig. 3A). These differences predict five amino acidchanges in the primary sequence of the Ig H chain V domain,three of which lay in complementary determining regions(CDR) 1 and 2 and the other two within framework (FR) 3. Itwas difficult to assign the germline D gene used in this VH

domain partly because of extensive modification found at the

V:D and D:J junctions, probably as a consequence of VDJrecombination. According to length and sequence similarity(Fig. 3A), D2-2 (Corbett et al., 1997) is likely the germline Dgene segment used. The germline gene segment JH6 (allele c)(Mattila et al., 1995) is the most homologous to the sequencefound in the cloned VH. Indeed, germline JH6c and the cloned Jsequences are identical except for a trinucleotide (TAC)deletion that was found in the cloned J segment (Fig. 3A).

The cloned VL gene segment belongs to the human VλIgene family. Only four nucleotide differences were foundbetween the cloned VL and hum1v117 (Siminovitch et al.,1989; Williams et al., 1996) the closest germline segment inthe family (Fig. 3B). These differences predict three aminoacid changes in the primary sequence of the Ig L chain Vdomain, two of which lay in FR2 and the other one withinCDR2. Similarly, four nucleotide differences were found be-tween the cloned JL and Jλ 2/3 (Udey and Blomberg, 1987), theclosest germline segments in the family (Fig. 3B). Thesedifferences predict three amino acid changes in the primarysequence of the Ig L chain V domain.

3.3. Expression and structural characterization of polymericIgG3 anti-Rh

Genes encoding D19 VH and λ VL domains were subclonedinto mammalian Ig expression vectors and transferred byliposome-mediated transfection into CHO cells to obtain arecombinant polymeric IgG3 producing cell line. Several IgG3-producing transfectomas were identified by ELISA (notshown), some of which were selected to scale-up theproduction of the recombinant protein. After purification byprotein-G affinity chromatography, the average yield was169mg of recombinant proteinper liter of culture supernatantprocessed. SDS-PAGE analysis of the purified proteins undernon-reducing conditions (Fig. 4) showed that the recombinantIgG3 anti-Rh migrated with molecular weights of 170 and1000 kDa (lane 2). Monomeric IgG3 anti-Rh (Lane 1) andIgM (Lane 3) are included for comparison. According to theapparent size estimated by SDS-PAGE, IgG3 polymers are inthe form of pentamers and/or hexamers. Similar results wereobtained when transfectomas were labeled in the presence of

Table 2Specificity of polymeric anti-Rh IgG

RecombinantpolymericAnti-Rh

Rh genotype (D antigen status) of reagent RBCs

R1wR1 R1R1 R2R2 Ror r′r r″r rr

(Pos) (Pos) (Pos) (Pos) (Neg) (Neg) (Neg)

A 4+ 4+ 4+ 4+ 4+ 0 0C 4+ 4+ 4+ 4+ 4+ 0 0D 4+ 4+ 3+ 3+ 3+ 0 0G 3+ 2+ 2+ 3+ 2+ 0 0I 4+ 4+ 3+ 3+ 3+ 0 0K 3+ 3+ 3+ 3+ 3+ 0 012 3+ 3+ 2+ 2+ 2+ 0 019 2+ 2+ 2+ 2+ 2+ 0 020 3+ 3+ 3+ 3+ 3+ 0 0Culture medium 0 0 0 0 0 0 0

Several polymeric IgG3 anti-Rh-containing supernatants (A, C, D, G, I, K, 12,19, and 20) coming from independent transfectoma cultures were testedagainst a panel of human RBCs with a broad spectrum of known Rhgenotypes, and using the gel column method. A reagent anti-RhD was run inparallel with the samples tested and was strongly reactive (4+) with RhD-positive and non-reactive (0) with RhD-negative RBCs (not shown). Thestrength of agglutination was arbitrarily assigned following guidelinespreviously established (Marsh, 1972).

7R.F. Montano et al. / Journal of Immunological Methods 340 (2009) 1–10

35S-methionine, the Ig immunoprecipitated from supernatantand analyzed by SDS-PAGE (not shown).

3.4. Functional characterization and specificity of the polymericIgG3 anti-Rh

The reactivity of the recombinant polymeric IgG3 pro-duced was studied with a microhemagglutination assay asdescribed in Materials and methods. Incubation with mono-meric IgG1 anti-Rh secreted by the D19 heterohybridomafailed to agglutinate RhD-positive RBCs (Fig. 5, A2). However,incubation of RhD-positive RBCs with undiluted culturesupernatant containing polymeric IgG3 anti-Rh from fiveindependent transfectomas resulted in direct hemagglutina-tion and a clear positive reaction (Fig. 5, B1–C1–D1–E1–F1),identical to the hemagglutination obtained using a commer-cial IgM anti-RhD (Fig. 5, A1). Serial double-dilution of thesesupernatants (Fig. 5, rows B, C, D, E, and F) eventually leads toa negative reaction, each supernatant showing a differentagglutination titer. As expected, hemagglutination was alsoobtained by the incubation of RhD-positive RBCs with IgG1anti-Rh secreted by the D19 heterohybridoma followed byincubation with a secondary anti-human IgG Ab (not shown).Similar results were obtained using both culture supernatantand purified recombinant protein, and when a test tube-based assay was employed. Taken together, these resultsindicate that the polymeric IgG3 anti-Rh is able to directlyagglutinate Rh-positive RBCs, and suggest that polymeriza-

Table 3Inhibition of agglutination with monomeric IgG3 anti-Rh

Monomeric IgG3 anti-Rh (Inhibitor) (μg/ml)

Absent 0.3 (1/16,000) a 0.6 (1/8000)

Polymeric IgG3 1 (1/500) 4+ 4+ 4+Anti-Rh (μg/ml) 0.125 (1/4000) 2+ 2+ 2+

Purified monomeric and polymeric IgG3 anti-Rh were mixed at the indicated concenmethods. The strength of agglutination was arbitrarily assigned as indicated in the

a Dilution factor.

tion leads to an increase in antibody avidity. To test whetherthis kind of recombinant molecules can behave as bloodtyping reagents, 430 samples of whole blood from unclassi-fied donors were reacted against the polymeric IgG3 anti-Rh,using a gel column-based agglutination assay and a commer-cial anti-RhD IgM reagent as reference. The results obtainedindicate that, under the conditions used, the polymeric IgG3anti-Rh and the commercial reagent displayed a similarpattern of reactivity (not shown).

To study if the increment in avidity of the polymeric IgG3anti-Rh is accompanied by a change in fine anti-Rh specificitywe also analyzed the pattern of reactivity of several polymericIgG3 anti-Rh containing supernatants harvested from inde-pendent transfectoma cultures against a panel of human RBCsrepresenting a broad spectrum of known Rh phenotypes.Polymeric IgG3 anti-Rh agglutinated RhD-positive RBCs ofvarious phenotypes and did not react with RhD-negative RBCssuch as rr and r″r (Table 1). This pattern of reactivity remainedunaltered at 4 °C, 22–25 °C or 37 °C. Furthermore, the culturesupernatant from one of the polymeric IgG3 anti-Rh-secret-ing transfectomas was tested and showed reactivity againstrare RhD-positive RBCs including DIIIa, DVa, DVI (type II),DVII, and R2RN, and did not react with Rhnull RBCs (notshown). As shown in Table 2 the polymeric anti-Rh IgG3 alsoreacted with RhD-negative r'r (dCe/dce) RBCs, a relativelyuncommon Rh blood type among Caucasians (Mollison et al.,1997) suggesting that the recombinant Ab produced has anti-RhG specificity. We confirmed that this pattern of reactivitywas also exhibited by the original human mAb anti-Rh D19,whose variable regions were used to construct the polymericIgG3. Altogether these results suggest that the recombinantpolymeric IgG3 and the monoclonal monomeric IgG1 anti-RhAbs have identical fine specificities and confirm that IgG3polymerization did not lead to a change of specificity. In a testtube-based assay performed with ficin-treated, I-positive,RhD-negative (rr) RBCs and using anti-I cryoagglutinin as acontrol, no agglutination was observed with the polymericIgG3 anti-Rh either at 4 °C, 22–25 °C or 37 °C (not shown).

3.5. Inhibition of agglutination studies

A recombinant monomeric IgG3 with the same specificityas the polymeric anti-Rh Ab studied here was used to attemptto inhibit direct hemagglutination mediated by the polymer.Polymeric IgG3 anti-Rh at two different concentrations was“contaminated” with increasing amounts of monomeric IgG3anti-Rh and incubated with RhD-positive RBCs. Under theconditions tested none of the monomeric anti-Rh concentra-tions usedwas able to inhibit or even reduce the agglutinationobserved with the polymeric anti-Rh Ab alone (Table 3).

1.2 (1/4000) 2.4 (1/2000) 4.8 (1/1000) 9.6 (1/500) 96 (1/50)

4+ 4+ 4+ 4+ 4+2+ 2+ 2+ 2+ 2+

trations and incubated with RhD-positive RBCs as described in Materials andlegend of Table 2.

8 R.F. Montano et al. / Journal of Immunological Methods 340 (2009) 1–10

4. Discussion

Human blood Rh alloantigens, in particular the D antigen,are clinically relevant because of their immunogenicity. Toestablish the individual's Rh status and to prevent D antigenalloimmunization, RhD typing reagents and polyclonal anti-RhD gammaglobulin of human origin are used. IgM anti-RhDmAbs are a standard among the former because they directlyagglutinate RBCs. IgG anti-RhD sensitize RhD-positive RBCsbut do not directly agglutinate them.

Here, we used recombinant antibody technology to pro-duce IgM-like polymers of an IgG anti-Rh antibody andproved that polymerization confers to these recombinantmolecules the capacity to directly agglutinate RBCs. Themethodological approach followed seems to be easier thanone previously used to produce a murine-human chimericIgM anti-Jsb antibody (Huang et al., 2003). After PCR-cloningof anti-Jsb specific V domain genes from a mouse IgG, theseauthors needed several PCR and cloning steps to add se-quences coding for a signal peptide and consensus sequencesat the 5′ end, as well as splice donor sites at the 3′ end of bothcloned genes. In the approach used here the VL and VH regiongenes were directly cloned with and expressed in the contextof its own leader sequence. Since cloning was performed fromthe DNA sequence encoding the leader peptide, prior knowl-edge of the V domain genes was not needed. In addition, theVH and VL genes were directly fused to the CH1 and CL genes inthe H and L chain expression vectors, sparing the need forsplice donor sites. The other major difference between thetwo approaches is that just one expression vector containingboth H and L genes was used to obtain the anti-Jsb antibody.This may make simpler the subsequent gene transfection step(s), but performing sequential transfection of two separateexpression vectors, as we propose, may allow for selection of ahigh L chain-producer cell line where the H chain expressionvector can be confidently transfected. Thus, the chance to endup with a high Ig-producer transfectoma is higher. Addition-ally, in our hands (unpublished) and others (Hackett et al.,1998) IgG-producing transfectants seem to be better Igproducers than IgM transfectants.

DNA sequence analysis indicated that both VH and VL

region genes used to produce the polymeric IgG3 anti-Rh aresomatically mutated. The cloned VH region gene utilize the Vgermline gene segment VH4.21/DP-63 (Sanz et al., 1989;Tomlinson et al., 1992), also named V4-34 (Thorpe et al.,1998). Many IgM anti-Rh alloantibodies have been previouslyreported to use V4-34 (Thompson et al., 1991; Thorpe et al.,1998), including IgM anti-RhD mAbs used as blood typingreagents such as MAD-2, MS201, and RUM-1 (Blancher et al.,1991; Thorpe et al., 1998). Binding to RhD-negative RBCs at4 °C and polyreactivity have been observed among these IgMalloantibodies (Blancher et al., 1991; Thorpe et al., 1997, 1998).To rule out that the polymeric IgG3 anti-Rh described heremight also exhibit cold agglutinin activity, assays wereperformed at 4 °C with ficin-treated or non-treated RhD-positive and RhD-negative RBCs. No evidence was foundindicating a change in the pattern of reactivity that maysuggest cold agglutinin activity either with the original IgG1anti-Rh D19 MoAb or with the recombinant monomeric orpolymeric IgG3 versions of it. A “TAC” deletion was found inthe DNA sequence of the cloned JH segment when it was

comparedwith its most homologous J germline gene segmentJH6c (Mattila et al., 1995). Since the deletion is locatedwithin acharacteristic string of TAC(n) at the 5′ end of the JH6c se-quence, it was not possible to determine whether it occurredat or near the D:J junction (probably resulting from a D:Jrecombination event) or within the J sequence away from the5′ end (making unlikely that it resulted from D:J recombina-tion). If the latter possibility is correct, the cloned J segmentmay represent a germline allele not previously describedbecause this kind of nucleotide changes is not observed as aresult of somatic hypermutation. Extensive allelic sequencevariation in the J region of the human Ig heavy chain genelocus has been described previously (Mattila et al., 1995) andfavors this explanation. However, nucleotide sequence ana-lysis of donor's genomic DNA would be needed to discrimi-nate between the aforementioned possibilities.

According to SDS-PAGE analysis of the purified protein, therecombinant IgG3 polymers produced are in the form ofpentamers and/or hexamers. As expected, the polymeric IgGwith a valency of 10 or 12 behaves in hemagglutination assaysas having the capacity to effectively cross-link and directlyagglutinates RhD-positive RBCs, which suggests that poly-merization lead to an increase in antibody avidity. Apparently,the increased avidity did not affect the specificity of therecombinant Ab since the monoclonal monomeric IgG1 (fromwhich the V regions were obtained to build the recombinantmolecule) and the recombinant polymeric IgG3 anti-Rh Absreacted identically in hemagglutination studies performedwith a panel of human RBCs containing a broad spectrum ofknown Rh phenotypes. The pattern of reactivity against RBCsof different Rh phenotypes suggests that the polymeric IgG3anti-Rh produced is an anti-RhG (Rh12) antibody. RhG isalways present with the RhC antigen (not Rhc) and alsofrequently accompanies the RhD antigen in RhD-positiveRBCs (Mollison et al., 1997; Avent, 1999; Wagner and Flegel,2004), which probably explains why during blood typingtests the polymeric IgG3 anti-Rh and a commercial anti-RhDreagent displayed a similar pattern of reactivity.

Taken together, the data presented above suggest that it ispossible to combine the higher intrinsic affinity of IgG-derived VH and VL regions with the polyvalency offered by apolymeric Ig resulting in a high avidity Ab. This may beparticularly useful when typing Rh donor units since manyanti-RhD IgM reagents are unable to agglutinate weak D andDEL RBCs (Wagner et al., 1999), which may lead to falsenegative results. If polymeric IgG anti-RhD reagents producedapplying the methodology proposed here prove to be betterthan currently available IgM reagents for agglutinating weakD and DEL RBCs, they could be used instead of IgM reagentswhen performing this kind of analysis, saving time and effort,especially in developing countries where other proposedsolutions to this problem, such as RHD genotyping (Flegel,2005), are still difficult to implement.

In addition to IgG3 polymers, a significant amount ofmonomeric IgG3 was seen during the SDS-PAGE analysis ofthe purified recombinant IgG3 anti-Rh. This is consistent withprevious studies showing that transfectants producing any ofthe four human IgG isotypes containing the µtp secrete bothmonomers and polymers (Smith and Morrison, 1994; Smithet al., 1995). Why monomeric IgG is present in these prepa-rations is unclear but it does not seem to be a consequence of

9R.F. Montano et al. / Journal of Immunological Methods 340 (2009) 1–10

polymer instability since similar SDS-PAGE electrophoreticprofiles are obtained with freshly-produced or months-old(even years-old) proteins. Monomers of IgG-µtp are seen evenif these recombinant proteins are expressed in myelomacells that simultaneously produce J chain (Smith andMorrison, 1994). Indeed, under these conditions J chain isnot incorporated into the polymeric IgG (Yoo et al., 1999),suggesting that other structural requirements in addition tothe presence of µtp are needed for J chain incorporation. Inthe particular case of the recombinant IgG3 anti-Rh preparedhere, the anti-Rh titer in direct agglutination assays did notchange with time (not shown). Thus, the presence ofmonomers did not impair the ability of the polymeric IgM-like IgG3 to directly agglutinate RBCs. Moreover, when arecombinant monomeric IgG having the same specificitywas added in increasing amounts to the polymeric IgM-likeIgG3 and the mix was subsequently used to agglutinateRBCs, no changes in the agglutination score were observed.Although we found no evidence for the presence of monomerinterfering with agglutination, monomers can be separatedfrom polymers by size exclusion gel chromatography ifneeded.

In summary, recombinant IgM-like polymers of an IgGanti-Rh antibody were produced. In contrast to the parentalmonomeric IgG, the polymeric antibody directly agglutinatedRBCs. The polymeric IgG3 anti-Rh displayed a similar patternof reactivity against blood samples of unknownphenotype as acommercial blood typing reagent, which suggests that isfeasible to use this kind of recombinant polymeric anti-RBCantibodies for this purpose. By replacing the variable regionsof the present anti-Rh antibody with others having differentanti-Rh specificities, it may also be possible to develop otheranti-Rh antibodies (including anti-D) useful in the develop-ment of Rh blood typing reagents. By expressing a V region ofinterest in the context of other H chain constant regions,polymers of different Ig isotypes can be produced as well.Finally, this technologymay also be applicable to the develop-ment of diagnostic reagents for applications in which cellsurface antigen binding and agglutination or aggregation isrequired.

Acknowledgement

We thank Dr. Marion Reid from the New York Blood Centerfor helping us to profile the reactivity of the recombinantproteins produced against rare Rh blood types. This work wassupported by NIH SBIR Phase I and phase II HL68307 Grants toKRC. The other grants were 5 FO5TWO5292 from The FogartyInternational Center-NIH to RFM and CA-16858, Al029470and Al-39187 from NIH to SLM.

References

Avent, N.D., 1999. The rhesus blood group system: insights from recentadvances in molecular biology. Transfus. Med. Rev. 13, 245.

Avent, N.D., Reid, M.E., 2000. The Rh blood group system: a review. Blood 95,375.

Blancher, A., Roubinet, F., Oksman, F., Ternynck, T., Broly, H., Chevaleyre, J.,Vezon, G., Ducos, J., 1991. Polyreactivity of human monoclonal anti-bodies: human anti-Rh monoclonal antibodies of IgM isotype arefrequently polyreactive. Vox Sang. 61, 196.

Brecher, M.E., 2005. AABB Technical Manual, 15th Ed. AABB Press, Chapel Hill,N.C.

Cate, J.C., Reilly, N., 1999. Evaluation and implementation of the gel test forindirect antiglobulin testing in a community hospital laboratory. Arch.Pathol. Lab. Med. 123, 693.

Chomczynski, P., Sacchi, N., 1987. Single-step method of RNA isolation by acidguanidinium thiocyanate-phenol-chloroform extraction. Anal. Biochem.162, 156.

Coloma, M.J., Hastings, A., Wims, L.A., Morrison, S.L., 1992. Novel vectors forthe expression of antibody molecules using variable regions generatedby polymerase chain reaction. J. Immunol. Methods 152, 89.

Corbett, S.J., Tomlinson, I.M., Sonnhammer, E.L.L., Buck, D., Winter, G., 1997.Sequence of the human immunoglobulin diversity (D) segment locus: asystematic analysis provides no evidence for the use of DIR segments,inverted D segments, “minor” D segments or D-D recombination. J. Mol.Biol. 270, 587.

Flegel, W.A., 2005. Homing in on D antigen immunogenicity. Transfusion 45,466.

Flegel, W.A., 2007. The genetics of the Rhesus blood group system. Dtsch.Arztebl. 104 (10), A651.

Hackett, J., Hoff-Velk, J., Golden, A., Brashear, J., Robinson, J., Rapp, M., Klass,M., Ostrow, D.H., Mandecki, W., 1998. Recombinant mouse-humanchimeric antibodies as calibrators in immunoassays that measureantibodies to Toxoplasma gondii. J. Clin. Microbiol. 36, 1277.

Hamilton, R.G., Morrison, S.L., 1993. Epitope mapping of human immunoglo-bulin-specific murine monoclonal antibodies with domain-switched,deleted and point mutated chimeric antibodies. J. Immunol. Methods158, 107.

Huang, C.H., Liu, P.Z., Cheng, J.G., 2000. Molecular biology and genetics of theRh blood group system. Semin. Hematol. 37, 150.

Huang, T.J., Reid, M.E., Halverson, G.R., Yazdanbakhsh, K., 2003. Production ofrecombinant murine-human chimeric IgM and IgG anti-Jsb for use in theclinical laboratory. Transfusion 43, 758.

Laemmli, U.K., 1970. Cleavage of structural proteins during the assembly ofthe head of bacteriophage T4. Nature 227, 680.

Marsh, W.L., 1972. Scoring of hemagglutination reactions. Transfusion 12,352.

Mattila, P.S., Schugk, J., Wu, H., Makela, O., 1995. Extensive allelic sequencevariation in the J region of the human immunoglobulin heavy chain genelocus. Eur. J. Immunol. 25, 2578.

Mollison, P.L., Engelfriet, C.P., Contreras, M., 1997. Blood transfusion in clinicalmedicine, 9th Ed. Blackwell Science, Oxford, UK.

Montano, R.F., Romano, E.L., 1994. Human monoclonal antiRh antibodiesproduced by human-mouse heterohybridomas express the Gal α(1-3)Gal epitope. Hum. Antibodies Hybridomas 5, 152.

Sanz, I., Kelly, P., Williams, C., Scholl, S., Tucker, P., Capra, J.D.,1989. The smallerhumanVHgene families display remarkable little polymorphism. EMBO J.8, 3741.

Siminovitch, K.A., Misener, V., Kwong, P.C., Yang, P.M., Laskin, C.A., Cairns, E.,Bell, D., Rubin, L.A., Chen, P.P., 1989. A natural autoantibody is encoded bygermline heavy and lambda light chain variable region genes withoutsomatic mutation. J. Clin. Invest. 84, 1675.

Smith, R.I., Morrison, S.L., 1994. Recombinant polymeric IgG: an approach toengineering more potent antibodies. Bio/Technology 12, 683.

Smith, R.I., Coloma, M.J., Morrison, S.L., 1995. Addition of a mu-tailpiece to IgGresults in polymeric antibodies with enhanced effector functionsincluding complement-mediated cytolysis by IgG4. J. Immunol. 154,2226.

Thompson, K.M., Sutherland, J., Barden, G., Melamed, M.D., Randen, I.,Natvig, J.B., Pascual, V., Capra, J.D., Stevenson, F.K., 1991. Human mono-clonal antibodies against blood group antigens preferentially expressa VH4-21 variable region gene-associated epitope. Scand. J. Immunol.34, 509.

Thorpe, S.J., Boult, C.E., Stevenson, F.K., Scott, M.L., Sutherland, J., Spellerberg,M.B., Natvig, J.B., Thompson, K.M., 1997. Cold agglutinin activity iscommon among human monoclonal IgM Rh system antibodies using theV4-34 heavy chain variable gene segment. Transfusion 37, 1111.

Thorpe, S.J., Turner, C.E., Stevenson, F.K., Spellerberg, M.B., Thorpe, R., Natvig,J.B., 1998. Human monoclonal antibodies encoded by the V4-34 genesegment showcold agglutinin activity and variable multireactivity whichcorrelates with the predicted charge of the heavy-chain variable region.Immunology 93, 129.

Tomlinson, I.M., Walter, G., Marks, J.D., Llewelyn, M.B., Winter, G., 1992.The repertoire of human VH sequences reveals about fifty groups ofVH segments with different hypervariable loops. J. Mol. Biol. 227, 776.

Udey, J.A., Blomberg, B., 1987. Human λ light chain locus: organizationand DNA sequences of three genomic J regions. Immunogenetics 25,63.

Urbaniak, S.J., Greiss, M.A., 2000. RhD haemolytic disease of the fetus and thenewborn. Blood Rev. 14, 44.

Wagner, F.F., Flegel, W.A., 2004. Review: the molecular basis of the Rh bloodgroup phenotypes. Immunohematology 20, 23.

10 R.F. Montano et al. / Journal of Immunological Methods 340 (2009) 1–10

Wagner, F.F., Gassner, C., Muller, T.H., Schonitzer, D., Schunter, F., Flegel, W.A.,1999. Molecular basis of weak D phenotypes. Blood 93, 385.

Williams, S.C., Frippiat, J.-P., Tomlinson, I.M., Ignatovich, O., Lefranc, M.P.,Winter, G., 1996. Sequence and evolution of the human germline Vλrepertoire. J. Mol. Biol. 264, 220.

Yoo, E.M., Coloma, M.J., Trinh, R., Nguyen, T.Q., Vuong, L.C., Morrison, S.L.,Chintalacharuvu, K.R., 1999. Structural requirements for polymericimmunoglobulin assembly and association with J Chain. J. Biol. Chem.274, 33771.