PopaSr

D.R

Scho

1. I

extdiffcauas cismgenproto i

Veterinary Microbiology xxx (2013) xxx–xxx

A R

Artic

Rece

Rece

Acce

Keyw

APE

MLS

Phy

Viru

*

G Model

VETMIC-6422; No. of Pages 10

Plpj.v

037

http

pulation structure and virulence content of avianthogenic Escherichia coli isolated from outbreaks ini Lanka

.A. Dissanayake, Sophie Octavia, Ruiting Lan *

ol of Biotechnology and Biomolecular Sciences, University of New South Wales, Sydney, NSW 2052, Australia

ntroduction

Avian pathogenic Escherichia coli (APEC), a subgroup ofraintestinal pathogenic E. coli (ExPEC) enters througherent routes including respiratory and genital tractsses various extra intestinal diseases collectively termedolibacillosis in chickens. So far the virulence mechan-s of APEC are not well defined. A large array of virulencees encoding iron acquisition, adhesion, toxin/cytotoxinduction and serum resistance, have been investigateddentify virulence determinants in APEC (Picard et al.,

1999; Rodriguez-Siek et al., 2005; Moulin-Schouleur et al.,2007). Recent studies showed that the APEC virulencetypes are better classified using combinations of virulenceassociated genes as strains with combinations of certainvirulence genes are more likely to be associated withdiseases (Ewers et al., 2007; Johnson et al., 2008a; Schouleret al., 2012).

It is also well established that the APEC virulencefactors are associated with particular genetic backgrounds(Escobar-Paramo et al., 2004; Ewers et al., 2007). Severalstudies reported that APEC is mainly derived from ECORphylogroup B2 and occasionally from phylogroup D(Johnson and Russo, 2005). However, APEC strains arenow found among all four phylogroups with themajority in phylogroup A (Rodriguez-Siek et al., 2005;

T I C L E I N F O

le history:

ived 20 February 2013

ived in revised form 27 October 2013

pted 22 November 2013

ords:

C

T

logroup

lence factors

A B S T R A C T

Avian pathogenic Escherichia coli (APEC) causes economically significant infections in

poultry. The genetic diversity of APEC and phylogenetic relationships within and between

APEC and other pathogenic E. coli are not yet well understood. We used multilocus

sequence typing (MLST), PCR-based phylogrouping and virulence genotyping to analyse

75 avian E. coli strains, including 55 isolated from outbreaks of colisepticaemia and 20

from healthy chickens. Isolates were collected from 42 commercial layer and broiler

chicken farms in Sri Lanka. MLST identified 61 sequence types (ST) with 44 being novel.

The most frequent ST, ST48, was represented by only six isolates followed by ST117 with

four isolates. Phylogenetic clusters based on MLST sequences were mostly comparable to

phylogrouping by PCR and MLST further differentiated phylogroups B1 and D into two

subgroups. Genotyping of 16 APEC associated virulence genes found that 27 of the clinical

isolates and one isolate from a healthy chicken belonged to highly virulent genotype

according to previously established classification schemes. We found that a combination

of four genes, ompT, hlyF, iroN and papC, gave a comparable prediction to that of using five

and nine genes by other studies. Four STs (ST10, ST48, ST117 and ST2016) contained APEC

isolates from this study and human UPEC isolates reported by others, suggesting that these

STs are potentially zoonotic. Our results enhanced the understanding of APEC population

structure and virulence association.

� 2013 Elsevier B.V. All rights reserved.

Corresponding author. Tel.: +61 2 9385 2095; fax: +61 2 9385 1591.

E-mail address: r.lan@unsw.edu.au (R. Lan).

Contents lists available at ScienceDirect

Veterinary Microbiology

jo u rn al ho m epag e: ww w.els evier .c o m/lo cat e/vetmic

ease cite this article in press as: Dissanayake, D.R.A., et al., Population structure and virulence content of avianathogenic Escherichia coli isolated from outbreaks in Sri Lanka. Vet. Microbiol. (2014), http://dx.doi.org/10.1016/etmic.2013.11.028

8-1135/$ – see front matter � 2013 Elsevier B.V. All rights reserved.

://dx.doi.org/10.1016/j.vetmic.2013.11.028

D.R.A. Dissanayake et al. / Veterinary Microbiology xxx (2013) xxx–xxx2

G Model

VETMIC-6422; No. of Pages 10

Moulin-Schouleur et al., 2007; Dissanayake et al., 2008).Here, we present phylogenetic analysis and virulence geneprofiling of 75 avian E. coli strains from 42 layer and broilerchicken farms in Sri Lanka. We used multilocus sequencetyping (MLST) to determine the diversity and phylogeneticrelationships of the isolates. The MLST data obtained werealso compared with the E. coli reference collection (ECOR)and other APEC and ExPEC data available in the MLSTdatabase (http://mlst.ucc.ie/mlst/dbs/Ecoli), to obtain acomprehensive understanding of the population structureof APEC. Sixteen APEC associated virulence genes weretyped for these isolates to determine their pathogenicpotential.

2. Materials and methods

2.1. Bacterial isolates

E. coli isolates analysed in this study were fromintensively managed commercial broiler and layer chick-ens in Sri Lanka between the period 2001–2006. Dis-sanayake et al. (2008) have previously characterised theseE. coli isolates according to phylogroup, LPS core type,serum resistance and for the presence of three virulencegenes; tsh, iss and cvaC. Of the 196 isolates used in theprevious study, a total of 75 isolates were selected for thepresent study based on the dendrogram constructed usingprevious phylogenetic and virulence genotype data(Supplementary Fig. 1). From each of the nine majorclusters of the dendrogram, more than 40% isolates wereselected to represent the diversity of phylogroup, LPS coretype, virulence gene profiles and source of isolation(clinical or healthy chickens). If the isolates in a particularcluster were identical in terms of phylogroup, LPS core typeand virulence profile, they were assumed to represent asingle clonal strain and a representative sample wasselected.

Supplementary material related to this article can befound, in the online version, at http://dx.doi.org/10.1016/j.vetmic.2013.11.028.

Accordingly, there were 55 strains categorised asclinical and 20 as commensals. Clinical isolates were from55 different outbreaks in 42 farms, including 31 broilerfarms and 11 layer farms. Of those, 40 were small scalefarms whereas the other two were large scale broiler farmsintegrated with two different hatcheries. These farms weregeographically unrelated but some farms might haveobtained the day old chicks from the same hatchery.

Clinical isolates were collected from liver, heart-bloodor spleen of chickens with lesions of colibacillosis.Commensal E. coli isolates were from cloacae of apparentlyhealthy chickens. Isolates were cultured on nutrient agar(Oxoid, UK) and incubated overnight at 37 8C. DNA wasextracted using phenol chloroform method as describedpreviously (Octavia and Lan, 2006).

2.2. Multilocus sequence typing

Multilocus sequence typing (MLST) was performedaccording to Wirth et al. (2006). PCR amplification andsequencing of seven housekeeping gene fragments, i.e.

adenylate kinase (adk), fumarate hydratase (fumC), DNAgyrase (gyrB), isopropylmalate dehydrogenase (icd),malate dehydrogenase (mdh), adenylosuccinate dehydro-genase (purA) and ATP/GTP binding motif (recA), wereperformed following the protocols specified at the E. coli

MLST website, http://mlst.ucc.ie/mlst/dbs/Ecoli. We devel-oped a new set of primers (F50-AGCCAGCGGACATCATTG-30, R50 GACGGAGAAAATGCCCAC-30) to amplify the fumC

gene fragment. The other genes were amplified using thepublished primer sequences (Wirth et al., 2006). The mdh

gene fragment was amplified using a nested PCR. Briefly,the gene fragment was first amplified using the outerprimer pair and then 1 ml of resulting products wasamplified by the inner primer pair. The nested inner primerpair PCR product was used for sequencing. The PCRreaction mixtures (50 ml) contained 0.5 ml of 30 mM foreach forward and reverse primer (Invitrogen), 0.5 ml of10 mM deoxynucleoside triphosphates (dNTPs, New Eng-land BioLabs, Beverly, MA, USA), 5 ml of 10� PCR bufferNew England BioLabs, Beverly, MA, USA), 1.25 U of Taq

polymerase (New England BioLabs, Beverly, MA, USA),20 ng of template DNA and sterile ultrapure (type 1) watercommonly known as MilliQ water (Millipore, Darmstadt,Germany). The PCR conditions were: initial denaturationfor 4 min at 94 8C, followed by 35 cycles of 15 s DNAdenaturation at 94 8C, 30 s primer annealing at 55 8C (60 8Cfor gyrB and mdh gene fragments) and 30 s extension at72 8C with a final extension of 5 min at 72 8C. PCR productswere verified on gel red (Biotium, Hayward, CA) stainedagarose gels before purification using sodium acetate–ethanol precipitation. The PCR sequencing reaction mix-tures contained BigDyeTM version 3.1 (Applied Biosystems,Foster city, CA, USA) and PCR was performed as recom-mended by the manufacturer using appropriate forward orreverse primer (note that mdh was sequenced using one ofthe inner primers). The reaction products were separatedand detected by capillary electrophoresis using ABI3730automated DNA sequence analyzer (Applied Biosystems,Darmstadt, Germany) at the Ramaciotti Centre, Universityof New South Wales, Sydney, Australia.

2.3. In silico MLST analysis

A collection of 316 sequence types (ST) representingAPEC and UPEC available online (http://mlst.ucc.ie/mlst/dbs/Ecoli) and 61 STs identified in the present study wereused for in silico MLST analysis.

2.4. Virulence genotyping and O78 serogrouping

The presence of 13 virulence genes and O78 serogroup-ing were analysed as described previously by single PCRreactions with primers detailed in Table 1. Each 25 mlreaction mixture contained, 0.5 U Taq DNA polymerase(New England BioLabs, Beverly, MA, USA) 2.5 ml of 10� Taq

DNA polymerase buffer (New England BioLabs, Beverly,MA, USA), 0.5 ml of 10 mM dNTP (New England BioLabs,Beverly, MA, USA), 0.15 ml (30 mM) of each oligonucleotideprimer pair (Table 1, Invitrogen), 2 ml (30 ng) of templateDNA and sterile ultrapure (type 1) water (Millipore,Darmstadt, Germany).

Please cite this article in press as: Dissanayake, D.R.A., et al., Population structure and virulence content of avianpathogenic Escherichia coli isolated from outbreaks in Sri Lanka. Vet. Microbiol. (2014), http://dx.doi.org/10.1016/j.vetmic.2013.11.028

2.5.

COfor

by

MLandsevseq(Re199unw(UPent

NC200

Tab

Prim

Ge

Iroiro

iu

sit

sit

iu

Adpa

Pa

GI

fel

tsh

Prom

hl

frz

(o

ae

ae

iss

cv

O7

Viru

et a

D.R.A. Dissanayake et al. / Veterinary Microbiology xxx (2013) xxx–xxx 3

G Model

VETMIC-6422; No. of Pages 10

Plpj.v

Bioinformatic analyses

Sequences were edited using the PHRED-PHRAP-NSED package (Gordon et al., 1998). Allele numbersseven gene fragments of each isolate were obtainedcomparing with corresponding allele available in

ST E. coli database (http://mlst.ucc.ie/mlst/dbs/Ecoli) ST of each isolate was determined by combiningen allelic profiles (Wirth et al., 2006). The multiple-uence alignments were done using MULTICOMPeves et al., 1994). PHYLIP package (Felsenstein,3) was used to generate neighbour-joining (NJ) tree,eighted pair group method with arithmetic means

GMA) dendrogram and bootstrap values. Salmonella

erica serovar Typhi strain Ty2 (Accession No.:_004631) was used as an outgroup (Deng et al.,3). STRUCTURE version 2.2 (Pritchard et al., 2000), a

Bayesian approach for analysis of MLST data, was used toassess the possibility that each isolate has derived all ofits ancestry from only one population with varyingdegrees of admixture. The ‘‘admixture’’ model was usedto determine the number of populations (K) and in eachrun, the Markov Chain Monte Carlo (MCMC) simulationof 30,000 iterations approximated the posterior prob-ability of K, following a burn-in of 10,000 iterations.Different values of K were run multiple times, and the K

value that generated the highest posterior probabilitywas used as the number of possible populations. Basedupon related ST algorithm, eBURST V3, available athttp://eburst.mlst.net, was used to cluster STs into clonalcomplexes (CCs) with single locus variants (SLV) (Feilet al., 2004). A Minimum spanning tree (MST) usingpairwise difference was generated using Arlequin v. 3.1(Excoffier et al., 2005).

le 1

er sequences and the distribution of virulence genes among clinical and commensal E. coli isolates.

ne Primer sequence (30–50) Size (bp) Temp Ref. Distribution of genes (%) P value

Clinical Commensal

n acquisitionN F AAGTCAAAGCAGGGGTTGCCCG 667 63 8C 78 55 0.0917

R GATCGCCGACATTAAGACGCAG Rodriguez-Siek et al. (2005)

tA F GGCTGGACATCATGGGAACTGG 302 63 8C 69 40 0.04342*

R CGTCGGGAACGGGTAGAATCG Johnson et al. (2008b)

AP F AGGGGGCACAACTGATTCTCG 608 63 8C 72 65 0.7164

R TACCGGGCCGTTTTCTGTGC Rodriguez-Siek et al. (2005)

AC F ATGCACTCGATAAAAAAAGT 860 63 8C 67 65 1

R TTAAGAAGGTCGATATACGT Schouler et al. (2012)

cD F ACAAAAAGTTCTATCGCTTCC 714 58 8C 55 50 0.9305

R CCTGATCCAGATGATGCTC Ewers et al. (2007)

hesinspC F GTGGCAGTATGAGTAATGACCGTTA 205 63 8C 58 45 0.4522

R ATATCCTTTCTGCAGGGATGCAATA Johnson et al. (2008b)

p- F GGCCTGCAATGGATTTACCTGG 258 63 8C 25 40 0.8746

II R CCA CCAAATGACCATGCCAGAC Moulin-Schouleur et al.

(2007)

A F GGTCAASCAGCTAAAAACGGTAAGG 239 61 8C 25 10 0.01057*

R CCTTCAGAAACAGTACCGCCATTCG Moulin-Schouleur et al.

(2007)a 45 10 0.01057*

otectinspT F TCATCCCGGAAGCCTCCCTCACTACTAT 496 63 8C 74 40 0.01222*

R TAGCGTTTGCTGCACTGGCTTCTGATAC Johnson et al. (2008b)

yF F GGCCACAGTCGTTTAGGGTGCTTACC 450 63 8C 72 60 0.439

R GGCGGTTTAGGCATTCCGATACTCAG Morales et al. (2004)

F TCAGTAAGAACGAAAGTGTG 565 53 8C 49 20 0.03322*

rf4) R ACAGGAACAATCCCGTGGAT Schouler et al. (2012)

c26 F ATGAGCGATATGAGTGAAGC 760 58 8C 55 30 0.1052

R TTATCGGAGTAATTTATTGA Schouler et al. (2012)

c4 F AT CGTACCGCCTTCATTATC 135 53 8C 55 35 0.2164

R CTTTACCGTCCTCACC Schouler et al. (2012)a 47 0 0.00041*

aCa 42 20 0.5084

8 F GGTATGGGTTTGGTGGTA 983 50 8C

R AGAATCACAACTCTCGGCA Liu et al. (2010)

lence genes significantly (P < 0.05) associated with clinical isolates are shown with a * mark. Virulence genes tested in the previous study (Dissanayake

l., 2008) are shown with an a mark.

ease cite this article in press as: Dissanayake, D.R.A., et al., Population structure and virulence content of avianathogenic Escherichia coli isolated from outbreaks in Sri Lanka. Vet. Microbiol. (2014), http://dx.doi.org/10.1016/etmic.2013.11.028

D.R.A. Dissanayake et al. / Veterinary Microbiology xxx (2013) xxx–xxx4

G Model

VETMIC-6422; No. of Pages 10

Significance of association between virulence genesamong clinical and commensal E. coli isolates was deter-mined by Pearson’s Chi-square test with Yates continuitycorrection using ‘R’ software (version 2.15.2). Fisher’s exacttest was used to determine the significance of association ofvirulence genes with phylogroup. Differences were con-sidered statistically significant at 5% (P � 0.05).

3. Results

3.1. Allelic profiles, sequence types and clonal complexes of

the strains

We sequenced the internal fragments of seven house-keeping genes (adk, fumC, icd, gyrB, purA and recA) from 75avian E. coli strains isolated from commercial chickens inorder to understand the genetic diversity and phylogeneticrelationship of APEC. Of the seven genes, the most variablegene was fumC with maximum and average pair wisedifferences of 24.3% and 2.89%, respectively and the mostconserved gene was recA with corresponding values of 9.5%and 0.75%, respectively.

The 75 avian E. coli isolates were differentiated into 61STs. Out of the 61 STs, seven STs were represented by morethan one isolate while the remaining 54 STs were eachrepresented by only one isolate, 17 were known STs in theMLST database while 44 were novel STs (ST3949-ST3992).Of the 17 known STs, ST48 was the most common andrepresented by six strains; ST117 by four strains; ST155 bythree strains; ST162 and ST949 by two strains. Twelveknown STs, ST10, ST101, ST206, ST616, ST865, ST1464,ST1634, ST2016 ST2207, ST2732, ST271, ST2750, wereeach represented by one isolate. With the exception thatST117 was isolated twice in two different outbreaks ofthe same farm, all other STs represented by more than oneisolate were collected from different farms. Since theclinical isolates were obtained from outbreaks, the MLSTanalysis showed high diversity of APEC in causing theoutbreaks.

Of the 75 isolates analysed in the present study, 18 werecollected from commercial layer chickens and 57 frombroiler chickens. There was only one ST (ST48) isolatedfrom both layers and broilers with two and four isolatesrespectively. Therefore, we cannot determine whetherthere is any association of particular ST causing infectionsin broiler or layer chickens.

We then performed eBURST analysis to identify CC,which is a group of closely related genotypes that share sixloci to at least one other ST and descended from a commonrecent ancestor. Accordingly, there were nine CCs and 28singletons. The largest CC contained 10 STs and thepredicted founder of the CC was ST10. ST48, the mostcommon ST represented by six strains belonged to this CC.The second and third largest CCs were represented by eight(founder = ST155) and five STs (founder = ST117). Three CCswere represented by three STs with founder STs beingST3967, ST206 and ST3972 respectively while the remainingCCs were represented by only two STs. Clonal complexeswith three or more STs are hereafter referred by thepredicted founder of each complex with the prefix ‘‘CC’’ i.e.CC10, CC155, CC117 and CC206, CC3967 and CC3972.

3.2. Phylogenetic relationships of the isolates

The NJ tree of 75 E. coli isolates, based on theconcatenated sequences of all seven genes, is shown inFig. 1. However, the clustering pattern and the topology ofindividual NJ trees constructed using sequences of eachgene were not congruent to each other (data not shown). Itmay indicate that the recombination is not uncommonamong avian E. coli.

We then reconstructed NJ tree incorporating theconcatenated sequences of ECOR strains (SupplementaryFig. 2). The avian E. coli isolates clustered under ECORphylogroups A, B1, B2, D and E, respectively. There weresome inconsistencies between PCR and MLST basedphylogrouping. As described previously (Clermont et al.,2011), there was a group closely related to B1 but themajority of the isolates fell into this group was identified asphylogroup A by triplex PCR (Clermont et al., 2000). Toexclude the technical errors we repeated the triplex PCR forall isolates and eight isolates previously identified asphylogroup A were corrected as phylogroup B1 (phylogroupof those isolates were highlighted in red in SupplementaryFig. 1). According to our results, inconsistencies betweenPCR and MLST phylogrouping were mainly associated withmisidentification of isolates as phylogroup A by PCR.

Supplementary material related to this article can befound, in the online version, at http://dx.doi.org/10.1016/j.vetmic.2013.11.028.

In the in silico MLST analysis that is performedincluding the sequences of ECOR strains, two subgroupswere identified within the strains identified as phylogroupD by PCR (D and D-I). As shown in Supplementary Fig. 1,three strains (labelled as 41, 111 and 112) clusteredtogether with ECOR48, ECOR49 and ECOR50 (D-I). Theremaining nine strains identified as phylogroup D by PCR(D) were separately grouped.

3.3. Population structure of avian E. coli isolates

We used Bayesian statistics tool, STRUCTURE, to deter-mine the population structure of the 75 avian E. coli isolates.These isolates were divided into five subpopulations (Fig. 2).The ancestry of each isolate was estimated as the sum ofprobabilities from each subpopulation over all informativebases. As shown in Fig. 2, 38.6% (29/75) of the strainspossessed mosaic blocks, which were likely to be resultedfrom gene flows between subpopulations. The proportion ofnucleotide imported from a single or multiple populationsvaried from 1.4% to 55%. When a Q-value (probability ofmembership) of >0.67 was used as the cut-off point, 93% ofthe strains were unambiguously assigned into one of the fivesubpopulations. Four isolates were designated as ADB(marked with * in Fig. 2) and one isolate was designatedas AB1 (marked with ** in Fig. 2) following Wirth et al. (2006).

As shown in Fig. 2, subpopulations identified bySTRUCTURE were mostly correlated with the clonalclusters identified by phylogenetic analysis. However,three strains (41, 111, 112) identified as phylogroup D byPCR were clustered together with phylogroup B2 isolates.

It is noteworthy that the proportion of genes importedby the isolates belonging to B1-I was considerably higher

Please cite this article in press as: Dissanayake, D.R.A., et al., Population structure and virulence content of avianpathogenic Escherichia coli isolated from outbreaks in Sri Lanka. Vet. Microbiol. (2014), http://dx.doi.org/10.1016/j.vetmic.2013.11.028

Fig. 1. Neighbour-Joining tree combining nucleotide sequences of seven housekeeping genes: adk, fumC, icd, mdh, recA and purA. Phylogroup (PCR), sequence

type, lipopolysaccharide core types and virulence genes, were displayed alongside the strain. Black square indicates the presence of the virulence gene.

Virulence clusters (I–IV) were determined by UPGMA (see Supplementary Fig. 2). Numbers at the tip of the terminal branches are strains names and the

numbers on the nodes are bootstrap values (only �50% are displayed). *Type: 1. Clinical isolates 2. Commensal isolates. LPS core types (R1–R4).

(Dissanayake et al., 2008)

D.R.A. Dissanayake et al. / Veterinary Microbiology xxx (2013) xxx–xxx 5

G Model

VETMIC-6422; No. of Pages 10

Please cite this article in press as: Dissanayake, D.R.A., et al., Population structure and virulence content of avianpathogenic Escherichia coli isolated from outbreaks in Sri Lanka. Vet. Microbiol. (2014), http://dx.doi.org/10.1016/j.vetmic.2013.11.028

D.R.A. Dissanayake et al. / Veterinary Microbiology xxx (2013) xxx–xxx6

G Model

VETMIC-6422; No. of Pages 10

than that of other subpopulations. Subpopulation A hasshown the least amount of gene flow. The majority ofcommensal isolates (marked as y in Fig. 2) were inphylogroups A and B1 respectively.

3.4. Distribution of virulence associated factors in

phylogroups

LPS core types and the presence of three virulenceencoding genes (cvaC, tsh and iss) of these isolates have beendetermined previously (Dissanayake et al., 2008). In thepresent study, the isolates were screened for 13 morevirulence associated genes namely, iroN, iutA, sitAP (plas-mid), sitAC (chromosomal), papC, papG (III), felA, ompT, hlyF,frz, aec4, aec26 and iucD since the presence of these geneshave been reported as high predictors for APEC. As shown inTable 1, of the 16 genes tested, iutA, felA, tsh, ompT, iss and frz

were significantly associated with clinical isolates(P < 0.05). To visualise the distribution of virulence genesin different phylogroups, virulence gene profiles of eachisolate is shown alongside the NJ tree (Fig. 1). E. coli isolatesof phylogroups B2 and D showed high percentage ofvirulence genes tested. As shown in Fig. 1 isolatesrepresenting same ST had different virulence gene profiles.

The virulence gene profiles, LPS core types, andphylogroups of 75 E. coli isolates were used to constructUPGMA tree (Supplementary Fig. 3). Virulence gene profilesand phylogroups were superimposed on the tree to visualisethe distribution of virulence genes in each cluster. TheUPGMA tree revealed four major clusters with differentvirulence profiles. As shown in Table 2, the vast majorities ofcommensal isolates were in cluster I and cluster IIIrespectively. None of the isolates of cluster I (20 isolates)possessed cvaC gene and only 15%, 20% and 30% isolatespossessed iss, felA and tsh gene, respectively. However, themajority of isolates (90%) in cluster I contained at least threeiron related genes. Almost all isolates of cluster II harbouredcvaC gene (93%) together with a minimum of three ironrelated genes. Isolates of cluster III lacked many of thevirulence genes tested and only 11% carried at least threeiron related genes. Cluster IV consisted almost entirely (96%)of clinical E. coli isolates (92%) and carried four or more ironrelated genes. Of the 24 isolates belonged to this cluster, 19(79%) possessed more than 10 virulence associated genestested. Among the virulence genes tested, the iss and felA

genes were strictly associated with clinical avian E. coli

isolates. Further, it was very clear that the sitAP, ompT, hlyF

and iroN genes are closely associated with clinical avian E.

coli isolates and more often absent in commensals.Supplementary material related to this article can be

found, in the online version, at http://dx.doi.org/10.1016/j.vetmic.2013.11.028.

3.5. Comparison of APEC and ExPEC STs

To display the relationship of our avian E. coli isolateswith APEC, commensal E. coli and ExPEC from otherstudies, we extracted MLST data of 316 STs representingAPEC, UPEC, avian commensal isolates from the publiclyavailable MLST database (http://mlst.ucc.ie/mlst/dbs/Ecoli). We identified all STs that were related to our STs

1.00

0.80

0.60

0.40

0.20

0.00

20 (ST117)

18 (ST3949)

40† ( ST3117)

36 (ST117)

16 (ST117)

130† (ST3962)

42 (ST155)

56 † (ST155)

33 (ST616)

* 61† (ST3983)

103 (ST3952)

38 (ST3950)

58† (ST3951)

15 (ST949)

53† (ST155)

2 (ST3953)

46† (ST949)

66 (ST1464)

13 (ST3954)

35 (ST3955)

185 (ST3967)

116 (ST865)

55† (ST3957)

78 (ST3959)

49 (ST3991)

133 (ST3963)

167 (ST3966)

115 (ST3961)

147 (ST3964)

188 (ST3968)

164 (ST3965)

141† (ST206)

101 (ST3960)

52† (ST3956)

**140† (ST3984)

156 (ST3972)

59 (ST3958)

29 (ST48)

190 (ST3972)

54† (ST3976)

23 (ST48)

22† (ST2750)

76 (ST2207)

*111 (ST2772)

112 (ST3971)

41† (ST3970)

19 (ST3969)

196 (ST3973)

31† (ST3975)

175 (ST3977)

93 (ST8)

30† (ST48)

3† (ST10)

27(ST48)

178† (ST1634)

50† (ST48)

34 (ST3986)

10 (ST3985)

83 (ST3987)

25 (ST162)

21 (ST3990)

45 (ST3979)

6 (ST3978)

92 (ST162)

90 (ST3992)

32† (ST2741)

7 (ST3988)

48 (ST3980)

12 (ST3989)

24 (ST3989)

142 (ST3982)

60 (ST3981)

138 (ST101)

*70 (ST2016)

*8 (ST3974)

D-I

B1

B2

D-II

A

B1-I

Fig. 2. STRUCTURE analysis of 75 avian E. coli isolates. Five subpopulations

(1–5) identified by STRUCTURE are shown in different colours.

Phylogroup (A, B1, B2 and D) comparable to each subpopulation and

the subgroups of phylogroup B1 (B1-I) and D (D-1) are shown in

parenthesis. Mosaic colours signify the isolates with mixed ancestries and

colours of the mosaic boxes represent the colour of the respective

population where the gene is acquired from. Identification number and

sequence type of the strain are shown in the left. The * sign and ** sign

before the strain name respectively indicate the stains identified as ABD

and AB1 based on Wirth et al., 2006). The y sign after strain name indicates

commensal isolates.

Please cite this article in press as: Dissanayake, D.R.A., et al., Population structure and virulence content of avianpathogenic Escherichia coli isolated from outbreaks in Sri Lanka. Vet. Microbiol. (2014), http://dx.doi.org/10.1016/j.vetmic.2013.11.028

at cby

CC1conin oin oof Aidecloncomavi

weisolnovassST3

4. D

4.1.

and

subAPEwitmahasfactnotHowcomrecSTs(recST

by

(ChbasalleweposSTsrec

Tab

Dist

Cl

(U

I

II

III

IV

To

Thea

b

c

D.R.A. Dissanayake et al. / Veterinary Microbiology xxx (2013) xxx–xxx 7

G Model

VETMIC-6422; No. of Pages 10

Plpj.v

lonal complex level by eBURST and displayed in Fig. 3minimum spanning tree. The largest clonal complex,0 (phylogroup A) containing 24 STs, was mostlysisted of commensal STs. ST48, the most common STur strain collection and one new ST (ST3987) identifiedur study belonged to this CC. CC155 was also comprisedPEC, UPEC and commensal STs and contained eight STs

ntified in the present study. Of the remaining two largeal complexes, CC93 consisted of avian pathogenic andmensal STs whereas the CC88 entirely consisted of

an pathogenic STs.As shown in Fig. 3, ST48, ST117 ST2016 and ST 1567re represented by both APEC and UPEC isolates orates closely associated with both groups. ST3987, ael ST identified in the present study was closely

ociated with ST48. Another four novel STs, ST3949,951, ST3952 and ST3974, were closely related to ST117.

iscussion

Genetic diversity and phylogenetic relationship of clinical

commensal avian E. coli strains

The dataset analysed in the present study revealedstantially high genetic diversity within the subset ofC. The 75 APEC isolates we studied contained 61 STsh 44 being novel. The high genetic diversity observedy in part be due to geographical location where APEC

not been sampled previously. This is reflected by the that the nearly half of the novel STs (21 out of 44) do

belong to any of the known clonal complexes.ever, for the novel STs that belong to known clonalplexes or form clonal complexes among themselves,

ombination seems to be a main driver to generate novel. We examined the nature of the allelic differenceombination or mutation) of each novel ST to its closest

of the same clonal complex. We used the rules devisedFeil et al. (2004) which have been used in other studies’ng et al., 2011). If the allelic difference is due to a singlee difference, we count it as a mutation whereas if thelic difference is due to more than one base difference,

count it as a recombination. We found that of the 28sible allelic differences between a novel ST and other

with one allele difference (see Fig 3), 20 were due to

2.5 times more likely that a novel ST was generated byrecombination than by mutation.

Comparison of our data with the data in the MLSTdatabase revealed that there were certain STs and CCsmore frequently represented by pathogenic E. coli thancommensals. As an example, ST117 was one of the STsidentified in the present study as highly virulent avian E.

coli. There were 17 other ST117 APEC isolates in the MLSTdatabase (http://mlst.ucc.ie/mlst/dbs/Ecoli) confirmingST117 as a pathogen of chickens. Our virulence genotypingrevealed that all four strains representing ST117 in thepresent study had the majority of virulence traits.

The presence of smaller pathogenic units within majorphylogroup was further evidenced by the CC10 and CC93 ofphylogroup A. Strains belonging to phylogroup A are morelikely to be commensal (Johnson and Russo, 2005; Jaureguyet al., 2008). CC10, the largest CC of phylogroup A was almostexclusively consisted of avian commensals. Of the 10 SriLankan isolates belonging to CC10, six did not posses any ofthe APEC virulence gene combinations tested. In contrast,CC93 from phylogroup A was consisted of a number ofpathogenic strains including one of our clinical isolates.

The phenomenon that particular STs or CCs rather thanthe entire phylogroup as more appropriate units ofpathogenicity has been previously shown in a study ofhuman bacteraemic E. coli strains (Jaureguy et al., 2008).Our study supports this observation.

4.2. Association of virulence profiles with phylogenetic groups

The avian E. coli strains used in the present study mainlybelonged to phylogroups B1 and A, and to a lesser extent tophylogroups D and B2. In contrast, it has been shown insome studies that the avian pathogenic clones are mainlyderived from phylogroup B2, and some from phylogroup D(Johnson and Russo, 2005). We screened the isolates for 16virulence associated genes in order to identify whetherthey are true pathogens or commensals causing secondaryinfections.

Virulence profile analysis (16 genes) revealed that theisolates belonged to phylogroup A, B1, B2 and D possessedan average of 6, 9, 14 and 11 virulence genes, respectively.However, the number of genes present in phylogroup Aand B1 strains varied between 1 and 15 while phylogroup

le 2

ribution of isolates with different virulence gene combinations among four UPGMA clusters.

uster Number of strains

Clinical commensal Gene combinations

PGMA) Johnsona Schoulerb sitAP, ompT, hlyF, iroNc

13 7 1 7 (1*) 8 (2*)

10 4 – 5 4

9 8 – – 1 (1*)

23 1 15 16 17

tal 55 20 16 28 (1*) 30(3*)

* mark indicates the number of commensal showing the particular gene combination.

iss, iroN, iutA, hlyF and ompT gene combination described in Johnson et al. (2008a).

Any of the four gene combinations described in Schouler et al. (2012).

Gene combination described in the present study.

and D strains ranged between 6 and 16. Cluster analysis

ombination and eight were due to mutation. Thus, it is B2

ease cite this article in press as: Dissanayake, D.R.A., et al., Population structure and virulence content of avianathogenic Escherichia coli isolated from outbreaks in Sri Lanka. Vet. Microbiol. (2014), http://dx.doi.org/10.1016/etmic.2013.11.028

D.R.A. Dissanayake et al. / Veterinary Microbiology xxx (2013) xxx–xxx8

G Model

VETMIC-6422; No. of Pages 10

by UPGMA on virulence profiles, phylogenetic groups, LPSprofiles identified four main clusters. Cluster I and IIcontained majority of phylogroup B1 isolates and someisolates from phylogroup A and D. Cluster III was largelycomposed of phylogroup A (82%). All four isolates ofphylogroup B2 and seven isolates of phylogroup Dbelonged to the cluster IV and remaining isolates werefrom phylogroups B1 and A. Four clusters showedremarkable variations in the distribution of virulencegenes.

Certain genes (tsh, iucD, iroN, cvaC, and iss) located onlarge transmissible R or ColV plasmids are known to beassociated with APEC strains (Ewers et al., 2007; Johnsonet al., 2006b). Most of the strains in the cluster IVharboured tsh, iucD, iroN and iss genes whereas thesegenes were rarely present among other clusters particu-larly, cluster III. Only half of the isolates of cluster IVpossessed ColV operon encoding gene (cvaC). However,there was a high (93%) association of cvaC gene withcluster II isolates. A previous study (Johnson et al., 2006b)has shown that the genes contained within ColV plasmidare highly conserved and significantly associated withAPEC. Acquisition of those plasmids by commensals couldenhance their virulence potential.

In addition, considerable differences in the presencewere observed for the genes encoding for iron regulation.Cluster IV isolates harboured four or more plasmid encoded

iron related genes while there were only one or two of thosegenes in the isolates from cluster III. Clusters I and II isolatespossessed a minimum of three iron related genes. Iron-acquisition genes are considered to be important for thepathogenesis of avian colibacillosis particularly to evadehumoral immunity (Rodriguez-Siek et al., 2005).

We confirmed that there are gene combinations with agreater association with virulence to chickens as describedpreviously (Johnson et al., 2008a; Schouler et al., 2012).The majority of the isolates in cluster IV were identified ashighly virulent E. coli by the said gene combinations. Asshown in Table 2, 16 of the 75 isolates had the combinationof five genes identified as predictors of high virulence APECby Johnson et al. (2008a) and (28) isolates had at least oneof the gene combinations described by Schouler et al.(2012). Based on the distribution of these gene combina-tions (Johnson et al., 2008a; Schouler et al., 2012), weobserved the presence of sitAP, ompT, hlyF and iroN can beused as the minimum predictor to identify high virulenceAPEC. Of the 55 clinical isolates, 30 possessed this genecombination including 14 isolates harboured the combi-nation of five genes described in Johnson et al. (2008a).However, further research is warranted to confirm thisscenario.

Of the 55 clinical isolates we studied, only 35 carried atleast one gene combination described previously as beingassociated with high or moderately virulent APEC (Johnson

Fig. 3. Minimum Spanning Tree (MST) showing the relationship between APEC, UPEC and commensal E. coli strains. Each circle represents a sequence type

(ST) and the number within the circle is the ST number. Black lines connect the single locus variant STs (STs with one allele different). A cluster of linked STs

corresponds to a clonal complex (CC). Note: Others: APEC, UPEC and commensal, STs reported on MLST database (http://mlst.ucc.ie/mlst/dbs/Ecoli).

Please cite this article in press as: Dissanayake, D.R.A., et al., Population structure and virulence content of avianpathogenic Escherichia coli isolated from outbreaks in Sri Lanka. Vet. Microbiol. (2014), http://dx.doi.org/10.1016/j.vetmic.2013.11.028

et

isolthecompatthepriminfedise(Bacauinfephyourinfe

4.3.

porsalsdise(MostraExPconnotUPEconhoswithasdiff200viruas min tinvpregendevthe

4.4.

bas

(20aviideloget aPCR(45togwit

strastraPrestra

D.R.A. Dissanayake et al. / Veterinary Microbiology xxx (2013) xxx–xxx 9

G Model

VETMIC-6422; No. of Pages 10

Plpj.v

al., 2008a; Schouler et al., 2012). The designation ofates into clinical and commensal is often depending on

site of isolation of the organism. It is not unusual formensal E. coli to invade tissues as opportunistic

hogens or as post-mortem invaders and when isolatedy are identified as clinical E. coli. There are a number of

ary infections such as infectious bursal disease,ctious laryngotracheitis, Newcastle disease and Marekase that can compromise immune system of chickens

lamurugan and Kataria, 2006). Immunosuppressionsed by these infections can pave the way to secondaryction caused by commensal E. coli. High number oflogroup A strains reported in many studies including

own probably reflect the high incidence of secondaryctions in poultry.

Disease association and public health risks of avian E. coli

We expanded the phylogenetic assessment by incor-ating STs representing APEC, UPEC and avian commen-

listed in the MLST database, in order to understand thease association of avian E. coli. A previous studyulin-Schouleur et al., 2007) has shown that some APECins are closely related to clones that include humanEC strains. Our in silico MLST analysis furtherfirmed this and there were a number of CCs (data

shown) including CC155 that contained both APEC andC STs. The absence of STs and CCs exclusivelysisting of APEC suggests that the APEC may not bet-specific. MLST study on E. coli O78 strains associatedh variety of diseases in humans, animals and poultry

also shown that the closely related clones can reside inerent hosts and are potentially zoonotic (Adiri et al.,3). As shown in Mora et al. (2009), ST117 is a highlylent emerging APEC with zoonotic potential. However,entioned earlier, E. coli strains with same ST may differ

he virulent profiles and the ability of those organisms toade different hosts may also be different. As suggestedviously (Clermont et al., 2011; Ron, 2006), subtleetic changes (i.e. changes in adhesions) may help toelop host specificity even among the E. coli strains with

same ST.

Phylogenetic structure of avian E. coli: MLST vs. PCR

ed phylogrouping

We used both triplex PCR described by Clermont et al.00) and MLST to identify phylogenetic structure ofan E. coli. As shown in previous studies, subpopulationsntified by MLST were correlated with ECOR phy-roups (Johnson et al., 2006a; Wirth et al., 2006; Walkl., 2007). However, there were some inconsistencies in

based phylogrouping. High proportion of isolates%) identified as phylogroup A by PCR were clusteredether with phylogroup B1 strains. This was consistenth the findings of Gordon et al. (2008).We further observed that some of the PCR phylogroup Ains clustered with ECOR37, a previously known group Ein which was not assigned by Clermont triplex PCR.

vious studies have also indicated that many of theins identified as group A organisms are actually not the

members of that group (Gordon et al., 2008; Walk et al.,2007). Further, the strains of group E have six of the eightvirulence genes combinations (chuA, yjaA, TSEP4; � � �, �+ �, � � +, + + +, + � + and + � �) described in Clermontet al. (2000). However, the existence of phylogroup E is stillcontentious. In the structure analysis we performed, thosestrains identified as phylogroup E clustered together withthe subgroup of phylogroup B1(B1-I).

MLST analysis divided the strains identified as phy-logroup D by triplex PCR into two groups. Three isolatesidentified as phylogroup D by PCR were clustered togetherwith the phylogroup B2 strain in the STRUCTURE analysis.Our results confirmed the study carried out by Gordonet al. (2008) who found that a number of strains identifiedas Clermont phylogroup D (chuA+, yjaA�, and TSPE4+)belonged to phylogroup B2 based on MLST data. Theysuggest that all strains exhibiting the phylogroup D shouldbe screened for the ibeA gene and if it is present, the strainsare actually belonged to phylogroup B2. The present studyconfirmed that MLST is a better approach in identifyingphylogroups of E. coli. Due to simplicity and inexpensivenature, Clermont triplex PCR is still useful in large scalescreening of isolates. However, strains identified asphylogroup A by this method need further confirmationby MLST or other means.

5. Conclusions

Avian E. coli isolates analysed in this study show highgenetic diversity. Absence of dominant ST suggests thatthere is no predominant genotype of E. coli causingcolibacillosis in chickens. Using both MLST and virulencegenotyping, we have shown that most of phylogroup B2and D strains were highly virulent avian E. coli. There is asmall number of strains with high virulence gene profileswithin phylogroup B1 and A. Strains of phylogroup B1 anda few phylogroup A strains possessed a number of ironrelated genes and ColV plasmid associated genes thatenable them to become potential pathogens. The majorityof avian E. coli isolates in phylogroup A lacked most of thevirulence genes tested and may cause opportunisticinfections in chickens. However, further studies arewarranted to understand the nature of infections causedby E. coli with different gene combinations. We furtheridentified the combination of sitAP, ompT, hlyF and iroN asbeing commonly associated with the E. coli causingsepticaemia in chickens. The high diversity of APECpresents us significant challenges in controlling infectionsdue to APEC.

Conflict of interest

None declared.

Acknowledgments

We would like to thank Professor Ian R Poxton,University of Edinburgh, UK for all his support. Weacknowledge the use of the E. coli MLST database(http://mlst.ucc.ie/) in this study and Prof Mark Achtman

ease cite this article in press as: Dissanayake, D.R.A., et al., Population structure and virulence content of avianathogenic Escherichia coli isolated from outbreaks in Sri Lanka. Vet. Microbiol. (2014), http://dx.doi.org/10.1016/etmic.2013.11.028

D.R.A. Dissanayake et al. / Veterinary Microbiology xxx (2013) xxx–xxx10

G Model

VETMIC-6422; No. of Pages 10

for assistance in MLST data submission. We gratefullyacknowledge the funding support of Australian ResearchCouncil.

References

Adiri, R.S., Gophna, U., Ron, E.Z., 2003. Multilocus sequence typing (MLST)of Escherichia coli O78 strains. FEMS Microbiol. Lett. 222, 199–203.

Balamurugan, V., Kataria, J., 2006. Economically important non-oncogenicimmunosuppressive viral diseases of chicken – current status. Vet.Res. Commun. 30, 541–566.

Ch’ng, S.H., Octavia, S., Xia, Q., Duong, A., Tanaka, M.M., Fukushima, H.,Lan, R., 2011. Population structure and evolution of pathogenicity ofYersinia Pseudotuberculosis. Appl. Environ. Microbiol. 77 (3) 768–775.

Clermont, O., Bonacorsi, S., Bingen, E., 2000. Rapid and simple determina-tion of the Escherichia coli phylogenetic group. Appl. Environ. Micro-biol. 66, 4555–4558.

Clermont, O., Olier, M., Hoede, C., Diancourt, L., Brisse, S., Keroudean, M.,Glodt, J., Picard, B., Oswald, E., Denamur, E., 2011. Animal and humanpathogenic Escherichia coli strains share common genetic back-grounds. Infect. Genet. Evol. 11, 654–662.

Deng, W., Liou, S.R., Plunkett III, G., Mayhew, G.F., Rose, D.J., Burland, V.,Kodoyianni, V., Schwartz, D.C., Blattner, F.R., 2003. Comparativegenomics of Salmonella enterica serovar Typhi strains Ty2 andCT18. J. Bacteriol. 185, 2330–2337.

Dissanayake, D., Wijewardana, T., Gunawardena, G., Poxton, I., 2008.Distribution of lipopolysaccharide core types among avian patho-genic Escherichia coli in relation to the major phylogenetic groups. Vet.Microbiol. 132, 355–363.

Escobar-Paramo, P., Clermont, O., Blanc-Potard, A.B., Bui, H., Le BouguA-nec, C., Denamur, E., 2004. A specific genetic background is requiredfor acquisition and expression of virulence factors in Escherichia coli.Mol. Biol. Evol. 21, 1085–1094.

Ewers, C., Li, G., Wilking, H., Kiessling, S., Alt, K., AntA

!

o, E.M., Laturnus, C.,Diehl, I., Glodde, S., Homeier, T., 2007. Avian pathogenic, uropatho-genic, and newborn meningitis-causing Escherichia coli: how closelyrelated are they? Int. J. Med. Microbiol. 297, 163.

Excoffier, L., Laval, G., Schneider, S., 2005. Arlequin (version 3.0): anintegrated software package for population genetics data analysis.Evol. Bioinform. Online 1, 47.

Feil, E.J., Li, B.C., Aanensen, D.M., Hanage, W.P., Spratt, B.G., 2004. eBURST:inferring patterns of evolutionary descent among clusters of relatedbacterial genotypes from multilocus sequence typing data. J. Bacter-iol. 186, 1518–1530.

Felsenstein, J., 1993. PHYLIP (Phylogeny Inference Package), 3.5 c. Depart-ment of Genetics, University of Washington, Seattle.

Gordon, D., Abajian, C., Green, P., 1998. Consed: a graphical tool forsequence finishing. Genome Res. 8, 195–202.

Gordon, D.M., Clermont, O., Tolley, H., Denamur, E., 2008. AssigningEscherichia coli strains to phylogenetic groups: multi-locus sequencetyping versus the PCR triplex method. Environ. Microbiol. 10, 2484–2496.

Jaureguy, F., Landraud, L., Passet, V., Diancourt, L., Frapy, E., Guigon, G.,Carbonnelle, E., Lortholary, O., Clermont, O., Denamur, E., 2008.Phylogenetic and genomic diversity of human bacteremic Escherichiacoli strains. BMC Genomics 9, 560.

Johnson, J.R., Owens, K.L., Clabots, C.R., Weissman, S.J., Cannon, S.B.,2006a. Phylogenetic relationships among clonal groups of extrain-testinal pathogenic Escherichia coli as assessed by multi-locussequence analysis. Microbes Infect. 8, 1702.

Johnson, J.R., Russo, T.A., 2005. Molecular epidemiology of extraintestinalpathogenic (uropathogenic) Escherichia coli. Int. J. Med. Microbiol.295, 383–404.

Johnson, T.J., Siek, K.E., Johnson, S.J., Nolan, L.K., 2006b. DNA sequence of aColV plasmid and prevalence of selected plasmid-encoded virulencegenes among avian Escherichia coli strains. J. Bacteriol. 188, 745–758.

Johnson, T.J., Wannemuehler, Y., Doetkott, C., Johnson, S.J., Rosenberger,S.C., Nolan, L.K., 2008a. Identification of minimal predictors of avianpathogenic Escherichia coli virulence for use as a rapid diagnostic tool.J. Clin. Microbiol. 46, 3987–3996.

Johnson, T.J., Wannemuehler, Y., Johnson, S.J., Stell, A.L., Doetkott, C.,Johnson, J.R., Kim, K.S., Spanjaard, L., Nolan, L.K., 2008b. Comparisonof extraintestinal pathogenic Escherichia coli strains from human andavian sources reveals a mixed subset representing potential zoonoticpathogens. Appl. Environ. Microbiol. 74, 7043–7050.

Liu, B., Wu, F., Li, D., Beutin, L., Chen, M., Cao, B., Wang, L., 2010. Devel-opment of a serogroup-specific DNA microarray for identification ofEscherichia coli strains associated with bovine septicemia and diar-rhea. Vet. Microbiol. 142, 373–378.

Mora, A., Lopez, C., Dabhi, G., Blanco, M., Blanco, J.E., Alonso, M.P., Herrera,A., Mamani, R., Bonacorsi, S., Moulin-Schouleur, M., 2009. Extrain-testinal pathogenic Escherichia coli O1: K1: H7/NM from human andavian origin: detection of clonal groups B2 ST95 and D ST59 withdifferent host distribution. BMC Microbiol. 9, 132.

Morales, C., Lee, M.D., Hofacre, C., Maurer, J.J., 2004. Detection of a novelvirulence gene and a Salmonella virulence homologue among Escher-ichia coli isolated from broiler chickens. Foodborne Pathog. Dis. 1,160–165.

Moulin-Schouleur, M., Reperant, M., Laurent, S., Bree, A., Mignon-Gras-teau, S., Germon, P., Rasschaert, D., Schouler, C., 2007. Extraintestinalpathogenic Escherichia coli strains of avian and human origin: linkbetween phylogenetic relationships and common virulence patterns.J. Clin. Microbiol. 45, 3366–3376.

Octavia, S., Lan, R., 2006. Frequent recombination and low level ofclonality within Salmonella enterica subspecies I. Microbiology 152,1099–1108.

Picard, B., Garcia, J.S., Gouriou, S., Duriez, P., Brahimi, N., Bingen, E., Elion,J., Denamur, E., 1999. The link between phylogeny and virulence inEscherichia coli extraintestinal infection. Infect. Immun. 67, 546–553.

Pritchard, J.K., Stephens, M., Donnelly, P., 2000. Inference of populationstructure using multilocus genotype data. Genetics 155, 945–959.

Reeves, P.R., Farnell, L., Lan, R., 1994. MULTICOMP: a program for pre-paring sequence data for phylogenetic analysis. Comput. Appl. Biosci.10, 281–284.

Rodriguez-Siek, K.E., Giddings, C.W., Doetkott, C., Johnson, T.J., Fakhr,M.K., Nolan, L.K., 2005. Comparison of Escherichia coli isolates impli-cated in human urinary tract infection and avian colibacillosis. Micro-biology 151, 2097–2110.

Ron, E.Z., 2006. Host specificity of septicemic Escherichia coli: human andavian pathogens. Curr. Opin. Microbiol. 9, 28–32.

Schouler, C., Schaeffer, B., Bree, A., Mora, A., Dahbi, G., Biet, F., Oswald, E.,Mainil, J., Blanco, J., Moulin-Schouleur, M., 2012 b. Diagnostic strategyfor identifying avian pathogenic Escherichia coli based on four pat-terns of virulence genes. J. Clin. Microbiol. 50, 1673–1678.

Walk, S.T., Alm, E.W., Calhoun, L.M., Mladonicky, J.M., Whittam, T.S., 2007.Genetic diversity and population structure of Escherichia coli isolatedfrom freshwater beaches. Environ. Microbiol. 9, 2274–2288.

Wirth, T., Falush, D., Lan, R., Colles, F., Mensa, P., Wieler, L.H., Karch, H.,Reeves, P.R., Maiden, M.C.J., Ochman, H., 2006. Sex and virulence inEscherichia coli: an evolutionary perspective. Mol. Microbiol. 60,1136–1151.

Please cite this article in press as: Dissanayake, D.R.A., et al., Population structure and virulence content of avianpathogenic Escherichia coli isolated from outbreaks in Sri Lanka. Vet. Microbiol. (2014), http://dx.doi.org/10.1016/j.vetmic.2013.11.028