Phylogenetic analysis of the genus Thricops Rondani (Diptera: Muscidae) based on molecular and...

Phylogenetic analysis of the genus Thricops Rondani(Diptera: Muscidae) based on molecular andmorphological characters

JADE SAVAGE 1 , TERRY A . WHEELER 1 and BR IAN M. WIEGMANN2

1Department of Natural Resource Sciences, McGill University, Macdonald Campus, Ste-Anne-de-Bellevue, Quebec, Canada

and 2Department of Entomology, North Carolina State University, Raleigh, North Carolina, U.S.A.

Abstract. The muscid genus Thricops Rondani comprises forty-four species andtwo subspecies restricted to the northern hemisphere. A species-level phylogeneticanalysis of Thricops was conducted using forty-four morphological characters,426 bp of the nuclear gene white and 523 bp spanning the 50 end of the cytochromec oxidase subunit I (COI), the tRNA leucine gene (L2 region) and the 30 end of thecytochrome c oxidase subunit II (COII). Thirty-nine species and two subspecies ofThricops were included in the analysis. Two species of Azelia Robineau-Desvoidyand one species of Hydrotaea Robineau-Desvoidy were used as outgroups. Mor-phological characters were coded for all included species, the mitochondrial genefragment (COIþ II) was sequenced for a subset of seventeen species of Thricops andthree outgroup species, and white for twelve of those seventeen Thricops species andtwo outgroup species. Six separate maximum parsimony analyses were performed onthree taxon sets of different sizes (n¼ 14, n¼ 20, n¼ 44). Results from the partitionhomogeneity test indicated no significant incongruence between data partitions, andfour combined maximum parsimony analyses were conducted (DNAþmorphologyfor n¼ 14; COIþ IIþmorphology for n¼ 20; DNAþmorphology for n¼ 20;DNAþ morphology for n¼ 44). The relative contribution of each data partitionto individual nodes was assessed using partitioned Bremer support. Strict consensustrees resulting from the unweighted analyses of each dataset are presented. Combi-nation of datasets increased resolution for the small taxon set (n¼ 14), but not forthe larger ones (n¼ 20, n¼ 44), most probably due to increasing amounts of missingdata in the larger taxon sets. Results from both individual and combined analyses ofthe smaller taxon sets (n¼ 14, n¼ 20) provided support for the monophyly ofThricops and a complete division of the genus into two monophyletic subgroups.The strict consensus cladograms resulting from the analysis of the morphologicaldata alone and the combined data for the large taxa set (n¼ 44) both supported themonophyly of the genus, but placed the species Thricops foveolatus (Zetterstedt) andThricops bukowskii (Ringdahl) at the base of the ingroup, in a polytomy with arelatively well-resolved branch comprising all remaining species of the genus. Thebasal position of these two species, included in the morphological taxon set butabsent in the others, illustrates the potential pitfalls of taxon sampling and missingdata in phylogenetic analyses. The synonymy of Alloeostylus with Thricops asproposed by previous authors was supported by our results. Relative contributionsof different data partitions is discussed, with the mitochondrial sequence generallyproviding finer resolution and better branch support than white.

Correspondence: Jade Savage, Department of Natural Resource

Sciences, McGill University, Macdonald Campus, Ste-Anne-de-

Bellevue, Quebec, Canada, H9X 3V9. E-mail: [email protected]

Systematic Entomology (2004) 29, 395–414

# 2004 The Royal Entomological Society 395

Introduction

Thricops Rondani is a morphologically diverse genus of the

family Muscidae. Several anthophilous muscid flies are

considered to be major pollinators of open blossoms in

arctic and subarctic ecosystems (Pont, 1993), and species

of Thricops can often be found in large numbers feeding on

the pollen and nectar of a variety of flowering plants. In

northern Sweden, Thricops was shown to be among the

most important flower visitors above the timberline (Elberling

& Olesen, 1999). The world fauna of Thricops was revised

recently (Savage, 2003) and now includes forty-four species

and two subspecies. All species are restricted to the northern

hemisphere, wheremost favour arctic or alpine habitats.Most

species are endemic to either the Palaearctic or Nearctic

regions, with a few known exclusively from the Oriental

region. Two species are found in all three realms and seven

have a Holarctic distribution.

In spite of the broad interspecific spectrum of colour, size

and external structures displayed by members of Thricops,

all species can be separated easily from related groups based

on the combination of the following characters: posterior

surface of hind coxa setulose, vein A1 extending more than

halfway to the wing margin, the presence of a strong poster-

odorsal bristle on the apical third of the hind tibia (calcar)

and the presence of more than one pair of frontal bristles in

the male.

Thricops was erected by Rondani (1856), who designated

Anthomyza hirtula Zetterstedt as the type species. No

hypothesis of phylogenetic relationships exists withinThricops,

but Schnabl (1888a, b, c, 1889) attempted to organize parts of

the Palaearctic fauna into a variety of genera and subgenera.

Schnabl (1888a) erected the genus Alloeostylus for a

new species which was distinguished mainly by the peculiar

genitalia with elongated surstyli. Soon, however, Schnabl

(1888b) transferred more species to Alloeostylus, including

some with short surstyli such as those seen in Thricops as

well as most other azeliine genera. As more species were

added to Alloeostylus, eventually no character other than the

presence or absence of a posteroventral bristle on the midtibia

was left to separate Alloeostylus from Thricops.

Most of Schnabl’s later generic and subgeneric divisions

of Thricops (see Savage, 2003 for the complete synonymy)

were ignored or modified by most subsequent authors

(Malloch, 1921; Ringdahl, 1947; Hennig, 1962, 1965; Huckett,

1965a, b; Skidmore, 1985), except for the recognition of

Alloeostylus. Skidmore (1985) suggested that Alloeostylus

should be maintained as a genus distinct from Thricops,

based on larval and pupal characters of six species. Adult

morphology, however, suggests otherwise (Hennig, 1962),

and the presence of a posteroventral bristle as the single

character to separate Alloeostylus from Thricops has

left many unconvinced (Malloch, 1921; Hennig, 1962,

1965; Huckett, 1965a). The aberrant Palaearctic species

T. bukowskii (Ringdahl), for example, has elongated surstyli,

similar to those seen in the type species of Alloeostylus, but no

posteroventral bristle on the midtibia. Males of the Nearctic

species T. tarsalis (Walker) have the bristle, but it is absent

occasionally in females, and a few specimens ofT. rufisquamus

ssp. rufisquamus (Schnabl), a striking species placed tradition-

ally in Alloeostylus, lack a posteroventral bristle on the mid-

tibia of both sexes. Consequently, the use of this bristle as the

single character supporting the monophyly ofAlloeostylus has

not been accepted by all researchers, and the genus was even-

tually synonymized with Thricops (Pont, 1986a). It should be

noted, however, that the synonymy was made in a catalogue

and therefore was not based on a phylogenetic analysis.

In view of these problems in classification, the primary

objective of the current study was to carry out a phylogen-

etic analysis of the species of Thricops sensu Pont (1986a)

in order to test the monophyly of Thricops and Alloeostylus.

A growing trend among systematists over the last decade

has been to combine morphological and molecular data in a

single ‘total evidence’ analysis. When datasets are not sig-

nificantly incongruent with one another, this approach will

generally increase phylogenetic accuracy (Bull et al., 1993;

Chippindale & Wiens, 1994; Kluge, 1998). However, many

species of Diptera are rarely collected or known only from

old type series. Therefore, it is impossible to acquire mater-

ial suitable for DNA extraction for some taxa. Technical

difficulties related to the amplification and sequencing of

DNA as well as the relatively high cost of gathering mole-

cular characters are additional problems limiting the num-

ber of species included in phylogenetic analyses. To cope

with these issues, many scientists use the exemplar

approach, in which a sample of species is selected to repre-

sent the major lineages of a higher taxon. This was the case

here: almost all species of Thricops were included in the

morphological dataset, but less than half could be included

in the molecular datasets.

Three character sets were used: morphological characters

of adult flies; mitochondrial DNA sequence data from a

fragment spanning the end of the cytochrome c oxidase

subunit I (COI), the tRNA leucine gene (L2 region), and a

small section of the cytochrome c oxidase subunit II (COII);

and nuclear DNA sequence data from a fragment of the

nuclear gene white. The use of three character sets also allowed

us to examine congruence among these data sources and to

compare the relative contribution of the three character sets to

the overall phylogeny. We also compared phylogeny estimates

based on a small matrix of exemplar species with one based

on a larger matrix containing nearly all described species.

Materials and methods

Morphological data

Thirty-nine species and two subspecies of Thricops were

included in the morphological analysis (Table 1). Thricops

flavidus Xue, T. jiyaoi Feng and T. tuberculatus Deng, Mao

& Feng were excluded because no specimens were available

396 J. Savage et al.

# 2004 The Royal Entomological Society, Systematic Entomology, 29, 395–414

for examination and data from the literature were not

detailed enough to allow coding of most of the characters.

The generic placements of T. jiyaoi and T. tuberculatus

appear to be correct based on original descriptions, but

T. flavidus obviously does not belong to Thricops (see

Savage, 2003). Almost 60% of morphological characters

used in this study pertain exclusively to structures of

males, resulting in large proportions of missing data for

T. angelorum Savage and T. ineptus (Stein), described only

from females. Several studies (Novacek, 1992a, b; Wilkinson

& Benton, 1995; Wilkinson, 1995) have demonstrated that

highly incomplete character matrices tend to reduce the over-

all accuracy of estimated trees. Preliminary analyses includ-

ing the two incompletely scored Thricops species resulted in

high numbers of conflicting equally parsimonious trees and a

substantial decrease in resolution in a consensus tree. The

uncertainty added to the matrix by just these two taxa thus

substantially obscures the phylogenetic signal in male

Table 1. Taxa included in the morphological analysis. See Savage (2003) for the locations of the type material and a detailed list of specimens

examined.

Species Distribution Material examined

Ingroup

Thricops aculeipes (Zetterstedt) Palaearctic Lectotype

Thricops aduncus Savage Nearctic Holotype

Thricops albibasalis (Zetterstedt) Holarctic Holotype

Thricops beckeri (Pokorny) Palaearctic Nontypes

Thricops bukowskii (Ringdahl) Palaearctic Syntypes (4)

Thricops calcaratus (Porchinskiy) Palaearctic Nontypes

Thricops coquilletti (Malloch) Holarctic Holotype

Thricops culminum (Pokorny) Palaearctic Nontypes

Thricops cunctans (Meigen) Palaearctic Nontypes

Thricops dianae Savage Nearctic Holotype

Thricops diaphanus (Wiedemann) Holarctic, Oriental Lectotype

Thricops fimbriatus (Coquillett) Nearctic Holotype

Thricops foveolatus (Zetterstedt) Palaearctic Holotype

Thricops furcatus (Stein) Holarctic Nontypes

Thricops genarum (Zetterstedt) Palaearctic Holotype

Thricops hakusanus (Shinonaga & Kano) Palaearctic Nontypes

Thricops hirtulus (Zetterstedt) Holarctic Neotype

Thricops innocuus (Zetterstedt) Holarctic Lectotype

Thricops lividiventris lividiventris (Zetterstedt) Holarctic Lectotype

Thricops lividiventris plumbeus (Hennig) Palaearctic Paratypes (4)

Thricops longipes (Zetterstedt) Palaearctic Lectotype

Thricops nepalensis (Pont) Oriental Holotype

Thricops nigriabdominalis Savage Palaearctic Holotype

Thricops nigrifrons (Robineau-Desvoidy) Palaearctic Nontypes

Thricops nigritellus (Zetterstedt) Palaearctic Lectotype

Thricops ponti Savage Palaearctic Holotype

Thricops rostratus (Meade) Palaearctic Holotype

Thricops rufisquamus rufisquamus (Schnabl) Holarctic Nontypes

Thricops rufisquamus himalayensis (Pont) Oriental Holotype

Thricops semicinereus (Wiedemann) Palaearctic Lectotype

Thricops separ (Zetterstedt) Palaearctic Lectotype

Thricops septentrionalis (Stein) Nearctic Nontypes

Thricops simplex (Wiedemann) Palaearctic Nontypes

Thricops spiniger (Stein) Holarctic Nontypes

Thricops sudeticus (Schnabl) Palaearctic Nontypes

Thricops tarsalis (Walker) Nearctic Syntype (1)

Thricops tatricus Gregor Palaearctic Paratypes (5)

Thricops thudamensis Shinonaga Palaearctic Holotype

Thricops vaderi Savage Palaearctic Holotype

Thricops villicrus (Coquillett) Nearctic Holotype

Thricops villosus (Hendel) Palaearctic Nontypes

Outgroups

Azelia cilipes (Haliday) Holarctic Nontypes

Azelia gibbera (Meigen) Holarctic Nontypes

Hydrotaea spinifemorata Huckett Nearctic Nontypes

Phylogenetic analysis of Thricops 397


characters. For this reason, the two species were excluded

from all analyses presented here.

All morphological characters included in the data matrix

derive from external and genitalic structures of adults. All

characters were treated as unordered and multistate charac-

ters as nonadditive. Five cases of polymorphism in terminal

taxa were treated as such, adding extra steps to the overall

tree length for each instance of polymorphism. The complete

set of morphological characters and states is provided in

Appendix 1 and the data matrix is shown in Appendix 2.

Outgroups

Species from two other azeliine genera, Hydrotaea and

Azelia, were chosen as outgroup taxa. Azelia is considered

the sister group of Thricops (Hennig, 1965; Skidmore, 1985;

Savage & Wheeler, in press) and Hydrotaea was included to

root the cladograms. The only male Hydrotaea specimen

available for this study was identified by the senior author

as Hydrotaea spinifemorata Huckett. However, because the

holotype (and only known male specimen) is apparently lost

(R. J. Gagne, pers. comm.), the precise identity of the speci-

men used in the molecular analysis could not be confirmed.

Nevertheless, the modified fore femur of the specimen leaves

no doubt concerning its generic assignment. Outgroups are

used only to polarize characters, and as long as generic

assignment of an outgroup exemplar is accurate and the

chosen specimen is not aberrant or highly autapomorphic,

the exact species identification, although preferable, is not

crucial to the outcome of the analysis.

Notes were taken on the external morphology of the

specimen before DNA extraction, but only the legs were

saved as vouchers. Therefore, the genitalia of this specimen

were not available for the coding of characters. However,

based on the presence of a basal spine on the hind femur,

the specimen could be assigned to the Hydrotaea armipes spe-

cies group (¼Hydrotaea occulta species group sensu Hennig,

1962) (see Pont, 1986b for an explanation of the synonymy of

Hydrotaea occulta (Meigen) with Hydrotaea armipes (Fallen)).

The armipes species group was recently shown to occupy a

basal position within Hydrotaea (Savage & Wheeler, in press).

The genitalia of most other members of this group were exam-

ined and found to be very homogeneous. Therefore, genitalic

characters for the exemplar ofHydrotaea used here were coded

according to the structures seen within the armipes species

group rather than the specimen itself.

Molecular data – DNA extraction, amplification and

sequencing

The COIþ II gene region and white gene fragment were

obtained for only a subset of the study taxa due to a limited

number of adequately preserved specimens available to the

project (COIþ II: seventeen species; white: twelve species;

Table 2). Where possible, the exemplar species were chosen

to cover the breadth of morphological variation found in

the group. All specimens used for DNA extraction were

collected alive and transferred directly to 95% ethanol.

Parts of the original specimen, or a second conspecific speci-

men (identification by the senior author) from the same

collection site, were preserved as vouchers, deposited in

the North Carolina State University Insect Collection

(Raleigh, North Carolina, U.S.A.) and stored at �80 �C.For T. tarsalis, a dry specimen was used in the extraction

and the voucher was deposited in the Canadian National

Collection of Insects, Ottawa, Ontario, Canada.

Genomic DNA was extracted from a single fly using

a standard protocol involving homogenization in lysis

buffer, proteinase K incubation, phenol/chloroform extrac-

tion and isopropanol precipitation of nucleic acids (Hillis

et al., 1996; Stahls & Nyblom, 2000). A Chelex1-based

extraction procedure was used to obtain amplifiable DNA

from a dry specimen of T. tarsalis. In this procedure, a few

muscle fibres from the thorax of the specimen were used

following Skevington & Yeates (2000) as modified from

Walsh et al. (1991). All genomic DNA samples were stored

at �80 �C.Two gene fragments were amplified: COIþ II, a region

spanning the 30 end of the mitochondrial gene COI, the L2

region and the first half of the COII gene; and a portion of

white, a nuclear gene involved in eye pigmentation (primers

in Table 3). Polymerase chain reaction (PCR) amplification

reactions followed standard protocols (Kocher et al., 1989)

with TaKaRa Ex TaqTM (Mirus Corp., Madison, Wisconsin,

U.S.A.). The amplification programme for the mitochondrial

fragment was as follows: one cycle of 95 �C (5min), 93 �C(20 s), 50 �C (40 s), 72 �C (1min); thirty-three cycles of 93 �C(20 s), 50 �C (40 s), 72 �C (1min); one cycle of 72 �C (5min).

For white, the amplification programme followed: one cycle

of 94 �C (5min); thirty-five cycles of 94 �C (1min), 47 �C(1min), 72 �C (1min 30 s). The resulting PCR products

were either used directly in the sequencing reaction or were

gel purified prior to cycle sequencing.

Sequences were obtained by dye terminator cycle sequen-

cing using the ABI Prism dRhodamine Terminator Cycle

Sequencing Kit (PE Biosystems, Warrington, U.K.) and run

on the Applied Biosystems automated DNA sequencer

(ABI Prism 377). Sequence confirmation was accomplished

by comparing complementary DNA strands. Editing

nucleotide sequences, contig assembly, and consensus

sequence calculation were performed using the software

program SEQUENCHER (Gene Codes Corp., Ann Arbor,

Michigan, U.S.A.). The reverse strand of the white gene

failed to satisfactorily sequence for T. diaphanus (Wiede-

mann), T. longipes (Zetterstedt), T. spiniger (Stein) and

T. semicinereus (Zetterstedt). However, the high quality of

the forward sequence for these taxa and confirmation by

protein translation allowed their inclusion in the analysis.

Data analysis

After editing the sequences, �192 bp from the 30 end of

COI, the L2 region (�73 bp) and �258 bp from the 50 end of



COII were aligned for the analysis. For the white gene,

�426 bp were aligned. Alignment was achieved manually

requiring few indels and was confirmed by translation of

protein coding regions. Nucleotide sequence alignments

may be obtained upon request from the senior author or

from TreeBase (http://www.treebase.org).

For both genes, third positions were included in the analy-

sis. The distribution of parsimony informative sites between

codon position differed between the mitochondrial and the

nuclear genes. ForCOIþ II, 50.8–57.9% of parsimony informa-

tive characters were found at the third position, whereas this

value rose to 89.4% for white. The 30 end of the L2 region

contained a small number of variable sites requiring inser-

tion of gaps in the alignment. Gaps were treated as missing

data in the analyses reported below. Parallel analyses run

with these seven nucleotide positions excluded did not

change any of the reported tree topologies.

Ten different analyses were performed on three taxon sets

of different sizes (n¼ 14, n¼ 20, n¼ 44).

The first set of analyses included only taxa for which all

three data partitions were available (Table 2). This taxon set

(n¼ 14) included twelve exemplar species of Thricops sensu

lato and two outgroup species, Azelia gibbera (Meigen) and

Hydrotaea spinifemorata. All character partitions (COIþ II,

white, morphology) were analysed separately and then in

combination.

Table 2. Taxa used for DNA extraction, collecting data, voucher type and GenBank accession numbers.

Accession number

Taxon Collecting data Voucher type COIþ II white

Ingroup

Thricops aculeipes Sweden: Mt. Nuolja. 5.viii.2001. J. Savage Conspecific specimen AY367142 –

Thricops albibasalis U.S.A.: NH, Mount Washington. 16.vii.2001. J. Savage Hind legs, abdomen AY367139 AY367159

Thricops cunctans Sweden: Abisko Ntl. Pk. 6.viii.2001. J. Savage Conspecific specimen AY367143 –

Thricops diaphanus Sweden: Jebrenjokk. 9.viii.2001. J. Savage Conspecific specimen AY367144 AY367162

Thricops furcatus Sweden: Mt. Nuolja. 5.viii.2001. J. Savage Conspecific specimen AY367141 AY367161

Thricops genarum Sweden: Jebrenjokk. 9.viii.2001. J. Savage Conspecific specimen AY367140 AY367160

Thricops hirtulus U.S.A.: NH, Mount Washington. 16.vii.2001. J. Savage Conspecific specimen AY367145 AY367163

Thricops innocuus Sweden: Abisko Ntl. Pk. 30.vii.2001. J. Savage Conspecific specimen AY367146 AY367164

Thricops lividiventris Sweden: Abisko Ntl. Pk. 6.viii.2001. J. Savage Conspecific specimen AY367147 –

Thricops longipes Sweden: Jebrenjokk. 7.viii.2001. J. Savage Conspecific specimen AY367148 AY367165

Thricops nigrifrons Sweden: Jebrenjokk.7.viii.2001. J. Savage Conspecific specimen AY367149 AY367166

Thricops nigritellus Sweden: Jebrenjokk.7.viii.2001. J. Savage Conspecific specimen AY367150 AY367167

Thricops semicinereus Sweden: Jebrenjokk. 9.viii.2001. J. Savage Conspecific specimen AY367151 AY367168

Thricops separ Sweden: Abisko Ntl. Pk. 30.vii.2001. J. Savage Conspecific specimen AY367155 –

Thricops septentrionalis U.S.A.: NH. Mt. Washington. 16.vii.2001. J. Savage Conspecific specimen AY367152 AY367169

Thricops spiniger U.S.A.: NH. Mount Washington. 16.vii.2001. J. Savage Conspecific specimen AY367153 AY367170

Thricops tarsalis Canada: MB. Along Souris river. 9.vi.1993. B. Gallaway Dry specimen AY367154 –

Outgroups

Azelia cilipes U.S.A.: VT, Camel’s hump trail. 26.viii.2001. S.E. Brooks Hind legs, abdomen AY367157 –

Azelia gibbera Sweden: Abisko Ntl. Pk. 8.viii.2001. J. Savage Conspecific specimen AY367156 AY367171

Hydrotaea spinifemorata U.S.A.: NC, GSMNP; Ravensford, nr. Cherokee,

9–16.vi.2001. B.Cassel

Legs AY367158 AY367172

COI þ II¼ cytochrome c oxidase subunits I and II.

Table 3. The primers used to amplify mitochondrial and nuclear genes. The direction of the primers is provided by S or F (sense or forward)

and A or R (antisense or reverse).

Gene region Primer name and sequence Reference

COI þ COII S2792lep: ATACCTCGACGTTATTCAGA Brown et al. (1994)

A3389lep: TCATAAGTTCARTATCATTG Brown et al. (1999)

white white-1F: TGYGCNTATGTNCARCARGAYGA Baker et al. (2001)

white-2R: ACYTGNACRTAAAARTCNGCNGG Baker et al. (2001)

white-3R: ACATAR AARTCNGCNGGRTTRTARTT J. K. Moulton, pers. comm.

TMwhite 1F: TGTAAAACGACGGCCAGT þ white-1F J. K. Moulton, pers. comm.

TMwhite 2R: CAGGAAACAGCTATGACC þ white-2R J. K. Moulton, pers. comm.

COIþII¼ cytochrome c oxidase subunits I and II.



The second set of analyses (n¼ 20) included five more

ingroup species (Table 2) and an additional outgroup

species, Azelia cilipes (Haliday). No white sequence could

be obtained for these additional species, thus only the

morphology and the mitochondrial gene were analysed

separately. Two combined analyses were conducted for

this taxon set, one including COIþ II and morphology,

and another including the incomplete white character set.

The third set of analyses (n¼ 44) included twenty more

species and two subspecies of Thricops and the same three

outgroup taxa as in the previous analyses (Table 1). Only

morphological data were available for these additional taxa.

The large morphological matrix was analysed separately

and a final combined analysis was performed including all

available data.

All phylogenetic analyses were conducted under the par-

simony criterion, using PAUP* version 4.0b10 (Swofford,

2002). Unweighted parsimony analyses were performed on

the morphology and molecular datasets separately. For

smaller datasets (n¼ 14, n¼ 20), the branch and bound

algorithm was used (addition sequence¼ furthest). Heuristic

searches were performed on the larger datasets (1000

random addition sequences, tree bisection-reconnection

(TBR) swapping, collapse branch if maximum length¼ 0).

Tree statistics are presented in Table 4, uncorrected pairwise

sequence divergence in Table 5, average nucleotide composi-

tion and percentage of parsimony informative characters per

codon position in Table 6.

The incongruence length difference test (Farris et al.,

1995a, b), implemented in PAUP* as the partition homo-

geneity test, was used to assess the degree of incongruity

between various partitions (P< 0.05 indicates significant

incongruence between data partitions). The results of the

partition homogeneity test (Table 7) indicated no signifi-

cant incongruence between pairwise comparisons of all

data partitions of the same size. Based on these results,

four combined maximum parsimony analyses were con-

ducted (DNAþmorphology for n¼ 14; COIþ IIþmorph-

ology when n¼ 20; DNAþmorphology for n¼ 20;

DNAþmorphology when n¼ 44) using the same search

parameters as those used for individual datasets of the same

size.

Evidential support for different clades in all individual

and combined analyses was assessed using nonparametric

bootstrap and Bremer support (BS) indices (Bremer, 1994).

For datasets including twenty or less species, we performed

100 bootstrap replicates excluding uninformative characters

and using the same parameters as in the parsimony

analyses, whereas for the larger datasets (n¼ 44), we set

the maximum number of trees to be retained at each repeti-

tion to 2000. BS and partitioned Bremer support (PBS), a

measure used to evaluate the relative contribution of each

partition to the overall BS at a particular node (Baker &

DeSalle, 1997), were calculated with TREEROT v.2c

(Sorenson, 1999).

Results and discussion

The results are presented for each taxon set, from the

smallest to the largest, to demonstrate progressively the

effects of missing data and taxon sampling on the outcome

of each analysis.

Small taxon set (n¼ 14)

COIþ II. Analysis of the 523 bp of mitochondrial DNA

for this small exemplar dataset yielded five equally parsi-

monious trees. The strict consensus tree (Fig. 1A) supported

the monophyly of Thricops sensu lato, and a well-supported

division of the ingroup into two major clades. One of these

clades (BS¼ 8, bootstrap¼ 100) contained only species pre-

viously placed in Alloeostylus, and was named the diaphanus

group. The other clade (BS¼ 7, bootstrap¼ 97) contained

only species belonging to Thricops sensu stricto, and was

named the semicinereus group. The diaphanus group was

fully resolved, with strong support for each node, whereas

the semicinereus group showed poor basal resolution and

support, with the exception of the sister-group relationship

Table 4. Tree statistics for all separate and combined analyses.

Data partitions Total PI EPT Length CI RI

COIþ II (n¼ 14) 523 67 5 178 0.664 0.753

white (n¼ 14) 426 45 48 171 0.708 0.770

Morphology (n¼ 14) 44 33 4 63 0.672 0.768

Combined small (n¼ 14) 993 145 1 415 0.672 0.754

COIþ II (n¼ 20) 523 95 12 246 0.613 0.750

Morphology (n¼ 20) 44 36 28 69 0.652 0.832

Combined COIþ II and morphology (n¼ 20) 567 131 22 320 0.611 0.765

Combined medium (n¼ 20) 993 176 34 493 0.632 0.762

Morphology (n¼ 44) 44 44 6 117 0.513 0.848

Combined large (n¼ 44) 993 184 46 980 540 0.596 0.793

Total¼ total number of characters; PI¼ parsimony informative characters; EPT¼ number of equally parsimonious trees; length¼ length of the mostparsimonious tree(s); CI¼ consistency index; RI¼ retention index; COI¼ cytochrome c oxidase subunit I; COII¼ cytochrome c oxidase subunit II.



between T. septentrionalis (Stein) and T. spiniger. Uncor-

rected pairwise divergence (Table 5) for species in the diapha-

nus group (3.2–6.0%) was considerably higher than in the

semicinereus group (0.4–4.2%).

White. The analysis of the white fragment (426 bp)

generated forty-eight most parsimonious trees (strict

consensus tree in Fig. 1B). Basal relationships were the

same as those supported by the mitochondrial sequence

but with lower branch support values, and the range of

uncorrected pairwise sequence divergence (Table 5) among

species of the diaphanus group was also higher (1.9–6.1%)

for this gene than among species of the semicinereus group

(1.0–3.5%). Within the diaphanus group, white supported a

sister-group relationship between T. genarum (Zetterstedt)

and T. furcatus (Stein), which was in conflict with the

positions of T. genarum and T. furcatus supported by the

mitochondrial sequence (Fig. 1A). The nuclear gene failed

to resolve relationships within the T. semicinereus group,

with the exception of the strongly supported sister-

group relationship between T. septentrionalis and

T. spiniger.

Morphology. The analysis of morphological characters

for this dataset resulted in four most parsimonious trees

(strict consensus tree in Fig. 1C). The deep branch relation-

ships were the same as those in Fig. 1(A) and (B), but with

low support for the monophyly of the semicinereus group

(BS¼ 1, bootstrap 54). Within the diaphanus group,

T. diaphanus stood as the sister group to an unresolved

polytomy including T. genarum, T. albibasalis (Zetterstedt)

and T. furcatus. As with the other datasets, there was poor

basal resolution within the semicinereus group, with the

exception of a well-supported sister-group relationship

between T. septentrionalis and T. spiniger.

Combined data. The combination and analysis of all

three datasets generated a single most parsimonious tree

(Fig. 2). This tree was better resolved and had much higher

branch support for the basal nodes than any of the previous

ones but showed some conflict at some of the internal and

terminal nodes. Within the diaphanus group, PBS showed

that the sister-group relationship between T. albibasalis and

T. genarum was supported strongly by COIþ II, but in

conflict with white. Mild conflict was seen within the semi-

cinereus group. The individual contribution of both mole-

cular partitions to most internal nodes within the

semicinereus group was either low or mildly conflicting

with other partitions and most of the support for those

branches could be attributed to the morphological dataset.

Although T. nigrifrons (Robineau-Desvoidy) and

T. longipes are extremely similar in both external and internal

morphology, both molecular datasets provided only weak

support for a sister-group relationship between these two

species. By contrast, T. spiniger and T. septentrionalis,

another pair of very similar species, did receive strong

support from all partitions. Evidence from the individual

and combined analyses of the smaller taxon set indicated

that Alloeostylus could regain full generic status and be

treated as the sister genus to Thricops.

Table 5. Uncorrected pairwise sequence divergence between species for small (n¼ 14) and medium (n¼ 20) taxon sets.

Taxa COIþ II (tRNA included) COI only L2 only COII only white

Small taxon set (n¼ 14)

Across all taxa (n¼ 14) 0.4–13.1% 0.0–15.1% 0.0–10.2% 0.4–13.6% 1.0–20.0%Within ingroup (n¼ 12) 0.4–11.2% 0.0–12.5% 0.0–10.2% 0.4–12.0% 1.0–9.1%T. diaphanus group (n¼ 4) 3.2–6.0% 3.3–6.8% 0.0–5.6% 3.1–7.0% 1.9–6.1%T. semicinereus group (n¼ 8) 0.4–4.2% 0.0–5.3% 0.0–2.9% 0.4–3.3% 1.0–3.5%

Medium taxon set (n¼ 20)

Across all taxa (n¼ 20) 0.4–13.1% 0.0–15.3% 0.0–10.2% 0.4–13.6% –

Within ingroup (n¼ 17) 0.4–11.8% 0.0–14.1% 0.0–10.2% 0.4–12.0% –

T. diaphanus group (n¼ 6) 3.2–8.6% 3.4–9.7% 0.0–7.0% 3.1–8.9% –

T. semicinereus group (n¼ 11) 0.4–5.2% 0.0–8.9% 0.0–3.0% 0.4–4.7% –

COI¼ cytochrome c oxidase subunit I; COII¼ cytochrome c oxidase subunit II.

Table 6. Average nucleotide composition and percentage of parsimony informative (PI) characters per codon position for small (n¼ 14) and

medium (n¼ 20) datasets.

Gene and taxon set Average proportion of A :C :G :T % of PI characters per codon position

COIþ II small (n¼ 14) 34 : 12 : 10 : 44 39.3, 9.9, 50.8

COIþ II medium (n¼ 20) 34 : 12 : 10 : 44 33.0, 9.1, 57.9

white small (n¼ 14) 25 : 23 : 25 : 27 8.5, 2.1, 89.4




Medium taxon set (n¼ 20)

COIþ II. Analysis of the mitochondrial fragment for this

taxon set yielded twelve equally parsimonious trees (strict

consensus tree in Fig. 3A). When compared with the analy-

sis of COIþ II for the smaller dataset (Fig. 1A), this con-

sensus tree still showed good support for the basal branches

(BS¼ 6, bootstrap¼ 99 for the diaphanus group; BS¼ 5,

bootstrap¼ 96 for the semicinereus group) as well as

increased resolution within the semicinereus group, but

with low support for almost all branches.

Morphology. The analysis of morphological characters

generated twenty-eight equally parsimonious trees (strict

consensus tree in Fig. 3B). The addition of taxa to this

dataset did not improve the internal resolution of the two

major clades but slightly increased branch support for the

diaphanus and semicinereus groups. There were several dif-

ferences between the trees seen in Fig. 3(A) and B, especially

within the semicinereus group. Although most nodes in

Fig. 3A were weakly supported, the placement of T. separ

and T. longipes was quite different between the two trees.

Combined COIþ II and morphology. The combination of

these two datasets yielded twenty-two equally parsimonious

trees (strict consensus tree in Fig. 4A). This consensus tree

showed strong support for the monophyly of Thricops, as

well as the division of the group into two separate clades

(BS¼ 10, bootstrap¼ 100 for the diaphanus group; BS¼ 9,

bootstrap¼ 99 for the semicinereus group). Basal relation-

ships within the diaphanus group were unresolved, but all

resolved nodes within this group were well supported.

Within the semicinereus group, T. aculeipes stood as the

sister group to the other species, but this node was weakly

supported. The basal relationships of the remaining species

were unresolved, but there was relatively good support for

the placement of T. separ as the sister group to T. spiniger

and T. septentrionalis, and good support for a sister-group

relationship between T. longipes and T. nigrifrons. PBS

showed very little conflict in this combined analysis, with

weak disagreement seen only in two branches of the semi-

cinereus group.

Combined DNA and morphology. The strict consensus

tree presented in Fig. 4(B) resulted from the analysis of all

species with at least one molecular dataset. This combined

analysis yielded thirty-four equally parsimonious trees. The

Table 7. The results of the partition homogeneity test.

Partition comparison P value

COIþ II (n¼ 14) and white (n¼ 14) 0.76

COIþ II (n¼ 14) and morphology (n¼ 14) 0.47

Morphology (n¼ 14) and white (n¼ 14) 1.0

COIþ II (n¼ 20) and morphology (n¼ 20) 0.21


T. albibasalisT. genarumT. furcatusT. diaphanusT. hirtulusT. innocuusT. longipesT. septentrionalisT. spinigerT. nigrifronsT. semicinereusT. nigritellusA. gibberaH. spinifemorata

diaphanusgroup

semicinereusgroup

9897

72

100100

96

3

3

98

7

2

A

11

1

T. albibasalisT. genarumT. furcatusT. diaphanusT. hirtulusT. innocuusT. longipesT. nigrifronsT. nigritellusT. semicinereusT. septentrionalisT. spiniger A. gibberaH. spinifemorata

A. gibbera

T. albibasalisT. genarumT. furcatusT. diaphanusT. hirtulusT. innocuusT. septentrionalisT. spinigerT. longipesT. nigrifronsT. nigritellusT. semicinereus

H. spinifemorata

54

1

832

99

82

2

3

C

1 98

4

76

1

93

3

90

4

987 57

180

2

B

653

Fig. 1. A–C, Results of individual analyses of all three data

partitions for the reduced taxon set (n¼ 14). A, Maximum

parsimony strict consensus of five most parsimonious trees for

cytochrome c oxidase subunits I and II; B, maximum parsimony

strict consensus of forty-eight most parsimonious trees for white; C,

maximum parsimony strict consensus of four most parsimonious

trees for morphology. The values above the branches refer to

bootstrap values (from 100 replicates). The values below the

branches refer to Bremer support.



consensus tree resulting from this analysis was almost iden-

tical to Fig. 4(A), with the exception that T. aculeipes was

included in the basal polytomy of the semicinereus group.

When compared with the combined analysis of COIþ II

and morphology (Table 4), the addition of the incomplete

white dataset (missing data for T. lividiventris, T. tarsalis, T.

aculeipes, T. culminum, T. separ, and A. cilipes) has had little

impact. It resulted in a small increase in the number of

equally parsimonious trees, a slight loss of basal resolution

in the semicinereus group and some mild conflict in the PBS

at a number of nodes.

Large taxon set (n¼ 44)

Morphology. The analysis of the large morphological

matrix (n¼ 44) generated six equally parsimonious trees.

The strict consensus tree (Fig. 5A) was well resolved but

with relatively low branch support for most nodes, as

expected from a dataset with the same number of characters

as taxa. There is topological similarity with Figs 1–4, with

all species formerly placed in Alloeostylus forming a mono-

phyletic group. Also present was a branch comprising

almost all species of Thricops sensu stricto. However, the

major contrast with previous topologies was that two spe-

cies of Thricops sensu stricto, T. foveolatus (Zetterstedt) and

T. bukowskii, formed a basal polytomy with the branch

comprising the semicinereus þ diaphanus groups.

This has some implications for the diaphanus group, in

that in spite of its monophyly, this branch constitutes a

derived clade nested within Thricops sensu stricto, rather

than a true sister group and thus Alloeostylus cannot be

treated as valid without rendering Thricops sensu stricto

paraphyletic.

One of the six equally parsimonious trees generated by

the analysis of the large morphological matrix is shown in

Fig. 6 with character changes plotted on the tree. The

monophyly of Thricops was supported by six apomorphic

character states, two of which are uniquely derived synapo-

morphies. As predicted by Michelsen (1978), the presence

of flared lateral sclerites (character 31: 1) is unique to Thri-

cops.

The basal placement of T. foveolatus is not surprising, as

it has retained many of the ground plan character states

present in both Hydrotaea and Azelia. However, the basal

position of T. bukowskii is puzzling. Thricops bukowskii is

a peculiar species, with the genitalia superficially resembling

those of an apical clade of the diaphanus species group

(Fig. 7C). However, the resemblance stops at the elongated

surstyli, as the other genitalic structures of this species differ

from any other in the genus (Fig. 8C). The mesolobus

(Fig. 7C) is very flat, completely cleft medially and equipped

with very few setae. Internally (Fig. 8C), the basiphallus of

T. bukowskii is extremely well sclerotized and forms a long

tube in lateral view. The distiphallus abruptly expands from

an apical constriction of the basiphallus, rather than gradu-

ally expanding from base to apex. The lateral sclerites are

almost rectangular in lateral view and very well sclerotized

dorsally. Long narrow pregonites are found in some species

of the diaphanus group (i.e. Fig. 8B), but those of

T. bukowskii differ by the very narrow base and the rounded

apex. Finally, the postgonite has a bulbous base and a

strongly tapered apex, rather than a flat base and a rounded

apex. These differences have often made it hard to homo-

logize structures between T. bukowskii and other species,

and on two occasions (the shape of the mesolobus and the

shape of the postgonite), an additional character state had

to be included to properly describe the structures observed

in this taxon. The placement of this highly autapomorphic

diaphanusgroup

A. gibbera

T. albibasalis

T. genarum

T. furcatus

T. diaphanus

T. hirtulus

T. nigritellus

T. innocuus

T. septentrionalis

T. spiniger

T. longipes

T. nigrifrons

T. semicinereus

H. spinifemorata

semicinereusgroup

3(0.3, 1.1, 1.6)

14(6, 5, 3)

1(–0.4, 0.4, 1)

1(–0.6, 0.6, 1)

9(4, 3, 2)

19(9, 7.5, 2.5)

2(3, –1, 0)

78100

100

15(8, 4, 3)

93

1(–0.4, 0.4, 1) 72

100

11(4, 3, 4)100 77

4(0.4, 0.7, 2.9)

Fig. 2. The single most parsimonious tree resulting from the maximum parsimony combined analysis for the reduced taxon set (n¼ 14). The

values above the branches refer to bootstrap values (from 100 replicates). The values below the branches refer to Bremer support and

partitioned Bremer support (cytochrome c oxidase subunits I and II, white, morphology).



species should be considered doubtful until more data are

obtained. Unfortunately, T. bukowskii is rare and attempts

to amplify DNA from dry material in our possession failed.

All other ingroup species were included in a large clade

supported by a well-developed prealar bristle (7: 1) and the

uniquely derived presence of a long epiphallus (35: 1). This

clade was then divided into the diaphanus and semicinereus

species groups.

The diaphanus species group was well supported, and the

presence (at least in the male) of a posteroventral bristle on

the midtibia (18: 1) is a uniquely derived synapomorphy for

this group, although that bristle is occasionally absent in

aberrant specimens of T. r. rufisquamus. The presence of

long surstyli (28: 1), originally a diagnostic character of

Alloeostylus, supported a large derived clade of eleven spe-

cies. This character state was also present in T. bukowskii,

but obviously as the result of homoplasy. Another genitalic

character, the presence of a V-shaped mesolobus (30: 1),

also supported this group.

The semicinereus species group was supported by three

characters. None of these was uniquely derived, but the

shape of the pregonite (36: 1) and the attachment of the

epandrial arms (39: 0) are character states which arose

only once within the ingroup. Thricops beckeri (Pokorny),

a species with a dichoptic male, stood as sister to the

remaining species. Most basal relationships within the semi-

cinereus group presented in this cladogram should be treated

with caution, as most nodes are supported by characters

which are highly variable within Thricops as well as other

azeliine genera.

Combined data. The analysis of all available data resulted

in 46 980 equally parsimonious trees (strict consensus tree in

Fig. 5B). This high number can be explained mostly by

excessive missing data as well as mild conflict within the

semicinereus group. As mentioned earlier, highly incomplete

taxa are often recognized to have a negative impact on

overall phylogenetic accuracy. Incomplete character sets,

however, appear to be more forgiving when analysed in

combination with at least one other complete dataset

(Wiens, 1998). Based on simulated datasets, Wiens (1998)

demonstrated that the addition or combination of incom-

plete character sets is generally more likely to increase or

have little impact than decrease phylogenetic accuracy,

especially if the added dataset contains less than 50% miss-

ing data. The large combined dataset studied here had more

than 50% missing data, accounting for the large number of

equally parsimonious trees.

The strict consensus tree resulting from the combined

analysis of all available data summarizes our current view

of Thricops relationships. The basal relationships are iden-

tical to those of Fig. 5(A), with T. foveolatus and

T. bukowskii placed as the basal species. Among the remain-

ing species, the diaphanus clade was by far the best sup-

ported and better resolved. Low support for the basal

branches of this lineage suggests that these relationships

should be viewed with caution. Unfortunately, the most

basal clade including T. r. rufisquamus was the only major

branch of the diaphanus group for which no molecular data

were available. However, based on morphology, we are

confident that this group does hold a basal position within

the diaphanus group. The terminal clade of eleven species

containing T. sudeticus (Schnabl) had low branch support,

but similarities in genitalic structures within this group

provide evidence strongly supporting its monophyly.

Branch support for the semicinereus group in Fig. 5(B) is

low (bootstrap¼ 63) but slightly higher than on Fig. 5(A).

In spite of this low value, we consider this group to be valid,

especially as it was well supported in all other combined

analyses where missing data had less impact on branch

3

1

4

2

8278

T. albibasalisT. genarumT. furcatusT. lividiventrisT. diaphanusT. tarsalisT. aculeipesT. cunctansT. nigritellusT. hirtulusT. innocuusT. longipesT. nigrifronsT. semicinereusT. septentrionalisT. spiniger T. separ A. gibberaA. cilipesH. spinifemorata

973

88

1

381

95

89B985

156

100

107

291

10099

A

14

2

6

T. albibasalisT. genarumT. furcatusT. lividiventrisT. diaphanusT. tarsalisT. aculeipesT. cunctansT. hirtulusT. innocuusT. longipesT. septentrionalisT. spiniger T. nigrifronsT. semicinereusT. separ T. nigritellusA. gibberaA. cilipesH. spinifemorata

diaphanusgroup

semicinereusgroup

67

965 1

39411

1 11

100

Fig. 3. A, B, The results of individual analyses of cytochrome c

oxidase subunits I and II and morphology for the medium taxon

set (n¼ 20). A, Maximum parsimony strict consensus of twelve

most parsimonious trees for cytochrome c oxidase subunits I and

II; B, maximum parsimony strict consensus of twenty-eight most

parsimonious trees for morphology. The values above the branches

refer to bootstrap values (from 100 replicates). The values below

the branches refer to Bremer support.



support values. The semicinereus group lost most basal

resolution in this combined analysis. This was to be

expected, as no individual dataset provided well-supported

relationships for these nodes.

Relative contributions of different character partitions

The mitochondrial sequence seems, overall, to have per-

formed better, providing finer resolution and better branch

support than white. For the same number of taxa (n¼ 14),

the COIþ II dataset had twenty-twomore parsimony informa-

tive characters (33%) than the white dataset. Overall,

COIþ II was only slightly more variable than white

(12.8% of parsimony informative sites over the total length

of the fragment for COIþ II vs 10.6% for white) but the

fragment used in the analysis of the mitochondrial gene was

longer by 97 bp.

Combination of characters

Combined datasets generated a better resolved tree for

the small taxon set (Fig. 2), but not if more species were

added (Fig. 4B). In the case of our study, 30% of missing

data in the white dataset was enough to generate more

equally parsimonious trees and a slight loss of resolution

in the consensus tree of the combined analysis when com-

pared with the trees generated by the complete COIþ II and

morphology (Fig. 3A, B), or by the combination of these

last two datasets (Fig. 4A). This is not surprising; Wiens

(1998) suggested that as much as 50% of missing data in

one character set of a combined analysis is unlikely to

T. albibasalis

T. genarum

T. furcatus

T. lividiventrisT. tarsalis

T. diaphanus

T. aculeipes

T. cunctans

T. hirtulus

T. innocuus

T. semicinereus

T. septentrionalis

T. spiniger

T. separ

T. longipes

T. nigrifrons

T. nigritellus

A. gibbera

A. cilipes

H. spinifemorata

diaphanusgroup

semicinereusgroup

(0.5, –0.2, 2.7)

(0.3, 0.7, 0)

3

42

1

(–0.4, –0.5, 2.9)(4, 0, 0)

7699

83

(2, –1, 0)

15

1

(10, 0, 5)

68

100

T. albibasalis

T. genarum

T. furcatus

T. lividiventrisT. tarsalis

T. diaphanus

T. aculeipes

T. cunctans

T. semicinereus

T. hirtulus

T. innocuusT. septentrionalis

T. spiniger

T. separ

T. longipes

T. nigrifronsT. nigritellus

A. gibbera

A. cilipes

H. spinifemorata

11

9(7.8, 0, 1.2)

100

16(15.3, –0.5, 1.2)

8

95

B(8, 0, 3)

11(7, 0, 4)

(2.9, 2.9, 2.2)

(14.3,, 2.7)

4(4, 0)2

(–0.7, 2.7)

3(2.4, 0.6)

17

6498

81

100

A2

(2, 0)

15(10, 5)

82

1009(7, 2)

100

10(6, 4)

100

(2.5, 2.5)5

88

9(8.3, 0.7)

99

1(0.9, 0.1)

100

100

100

Fig. 4. A, B, The results of combined analyses for the medium taxon set (n¼ 20). A, Maximum parsimony strict consensus of twenty-two

most parsimonious trees resulting from the combined analysis of cytochrome c oxidase subunits I and II and morphology; B, maximum

parsimony strict consensus of thirty-four most parsimonious trees resulting from the combined analysis of all taxa with data available for at

least one molecular data partition. The values above the branches refer to bootstrap values (from 100 replicates). The values below the

branches refer to Bremer support and partitioned Bremer support (cytochrome c oxidase subunits I and II, white, morphology).



decrease phylogenetic accuracy, but that study was based

on simulated datasets free of homoplasy and with the

branch length held constant across all branches of a tree.

Overall, the total evidence approach has allowed us to

increase our confidence in those nodes which were sup-

ported by all datasets, while also enabling us to determine

what parts of the tree were supported by each data parti-

tion. Based on the PBS values shown in Fig. 2, both genes

were generally more useful in resolving the basal nodes,

whereas most terminal resolution derived from morph-

ological characters.

Effects of taxon sampling

Zwickl & Hillis (2002) argued that an increase in taxon

sampling would generally result in more accurate phylo-

genetic hypotheses. This seems to be the case here, at least

T. genarumT. hakusanusT. furcatusT. l. lividiventrisT. l. plumbeusT. tatricusT. simplexT. calcaratusT. sudeticusT. pontiT. diaphanusT. nepalensisT. tarsalisT. aduncusT. r. himalayensisT. r. rufisquamusT. thudamensisT. aculeipesT. hirtulusT. culminumT. vaderiT. innocuusT. septentrionalisT. spinigerT. separT. fimbriatusT. villicrusT. longipesT. nigrifronsT. dianaeT. cunctansT. semicinereusT. nigriabdominalisT. rostratusT. coquillettiT. nigritellusT. villosusT. beckeriT. bukowskiiT. foveolatus

H. spinifemorata

A. cilipesA. gibbera

T. genarumT. hakusanusT. furcatusT. l. lividiventrisT. l. plumbeusT. tatricusT. simplexT. calcaratusT. sudeticusT. pontiT. diaphanusT. nepalensisT. tarsalisT. aduncusT. r. himalayensisT. r. rufisquamusT. thudamensisT. aculeipesT. cunctansT. hirtulusT. culminumT. innocuusT. septentrionalisT. spinigerT. separT. fimbriatusT. villicrusT. longipesT. nigrifronsT. nigritellusT. semicinereusT. nigriabdominalisT. coquillettiT. dianaeT. rostratusT. vaderiT. villosusT. beckeriT. bukowskiiT. foveolatusA. cilipesA. gibberaH. spinifemorata

A

diaphanusgroup

semicinereusgroup

1

1

1

4

1

21

1

21

3

32

1

11

1

1

21

21

21

1

1

1

1

1

1

2

3

1

62

99

57

6991

66

91

81

7288

60

5990

58

85

76

59

77

93

68

94

70

52

7091

78

99

75 8883

66

84

67

7080

91

63

88

99

56

T. albibasalis T. albibasalisB

Fig. 5. A, B, The results of an individual analysis of morphology and a combined analysis of all data for the large taxon set (n¼ 44). A,

Maximum parsimony strict consensus tree of six most parsimonious trees resulting from the analysis of morphology; B, maximum parsimony

strict consensus of 46 980 most parsimonious trees resulting from the combined analysis of all available data. The values above the branches

refer to bootstrap values (from 100 replicates). The values below the branches refer to Bremer support.



with the morphological data. The large taxon set generated

a consensus tree (Fig. 5A) which was better resolved than

those generated by the smaller datasets (Figs 1C, 3B).

Whereas all analyses based on the exemplar approach indi-

cated that Alloeostylus could regain its generic status, it is

now apparent that some taxa (T. foveolatus and T. bukowskii)

left out of the exemplar taxon set were critical. This

illustrates a disadvantage of the exemplar approach, in

which one is never certain to have sampled accurately the

full ‘tree diameter’ of a taxonomic group until a phylo-

geny is actually produced.

Conclusions

Our data support the monophyly of Thricops sensu Pont

(1986a). The synonymy of Alloeostylus with Thricops by Pont

(1986a) is also supported, as all species formerly included in

Alloeostylus belong to a derived clade nested within Thricops.

Although the data analysed here provided some import-

ant insights into the species-level relationships of Thricops,

additional data would help us to refine our phylogenetic

hypothesis. First, the sequences of COIþ II and white for

T. foveolatus and T. bukowskii would allow us to test the

basal relationships presented here. The inclusion of an

exemplar species of the T. r. rufisquamus branch might

also provide additional support to the basal relationships

of the diaphanus group. Finally, additional nucleotide data

from the mitochondrial genome or from more rapidly

evolving gene regions from the nuclear genome should

allow us to resolve relationships more fully within the semi-

cinereus group.

All sources of data used in this study proved useful

in understanding the basal relationships within the

genus Thricops. Because of the high congruence for all

datasets at the basal nodes, we are confident that the basal

placement of T. foveolatus (and possibly T. bukowskii),

even if supported only by morphological characters, is

reliable.

-

15:124:1

------

--

---

--

-

---

3:15:19:210:040:1

*

4:16:128:130:333:236:341:1

9:110:118:134:1

*

*

38:1

3:117:143:144:1

23:15:0

20:130:237:1

**

3:121:140:1

14:123:1

*8:019:1

15:1

5:&6:1

1:1 *

*

11:120:140:2

36:139:041:1

20:124:1

1:1

3:16:125:0

25:1

27:136:1

*

16:2*

42:1

16:1

25:0

7:0

*

*

1:1

7:0

24:0

8:041:0

T. d

iaph

anus

T. n

epal

ensi

s

T. a

lbib

asal

is

T. h

akus

anus

T. g

enar

um

T. fu

rcat

us

T. l.

livi

dive

ntris

T. l.

plu

mbe

us

T. ta

tric

us

T. s

impl

ex

T. c

alca

ratu

s

T. s

udet

icus

T. p

onti

T. a

cule

ipes

T. h

irtu

lus

T. c

ulm

inum

T. v

ader

i

T. d

iana

e

T. c

unct

ans

T. lo

ngip

es

T. n

igrif

rons

T. b

ecke

ri

A. g

ibbe

ra

A. c

ilipe

s

H. s

pini

fem

orat

a

T. ta

rsal

is

T. b

ukow

skii

T. fo

veol

atus

T. in

nocu

us

T. s

epte

ntrio

nalis

T. s

pini

ger

T. s

epar

T. fi

mbr

iatu

s

T. v

illic

rus

T. s

emic

iner

eus

T. n

igria

bdom

inal

is

T. r

ostr

atus

T. c

oqui

lletti

T. n

igrit

ellu

s

T. v

illos

us

T. a

dunc

us

T. r.

him

alay

ensi

s

T. r.

ruf

isqu

amus

T. th

udam

ensi

s1:129:133:236:240:1

*

*

*

*

14:124:1

* 12:124:1

8:&26:&

20:1

4:125:0

20:022:125:0

*

27:1

7:135:1

6:132:133:2

5:028:130:1*

3:143:1

15:1

8:025:0

**

13:114:2

25:0

4:16:1

*

*

6:114:330:433:234:1

*

26:1

5:18:125:131:133:139:1

**

2:1* -

-----

---

-

- --

--

------

--

-

--

--

- -

---

----

-

-

---

-

---

---

------ -

--

----

-------

---

--

----

-

-----

--

---

--

--

---

*

8:0-

*

*

*

25:& 6:&-

Fig. 6. One of six most parsimonious cladograms for the large morphological matrix. Uniquely derived character states are marked with an

asterisk, polymorphisms are denoted by ‘&’.



Acknowledgements

We thank Brian Cassel (North Carolina State University)

for his technical support with the molecular sequencing and

John K. Moulton (University of Tennessee) for his assist-

ance in primer design. We also thank Shaun Winterton

(North Carolina State University) and Jeff Skevington

(Canadian National Collection of Insects) for advice and

suggestions related to combined phylogenetic analyses.

Brian Driscoll (McGill University) kindly allowed access

to his Macintosh computer. Scott Brooks (McGill Univer-

sity) and Brian Cassel provided fresh specimens for the

molecular analysis, and Jeff Cumming (Canadian National

Collection of Insects) and Nigel Wyatt (The Natural His-

tory Museum, London) gave us permission to extract DNA

from dry material housed in their respective institutions. We

are grateful to Adrian Pont (University Museum of Natural

History, Oxford), Michael Ackland (University Museum of

Natural History, Oxford), Bernhard Merz (Museum d’His-

toire Naturelle, Geneva) and Doreen Verner (Berlin) for

their help during the 2001 collecting expedition to Sweden,

and to Joelle Perusse (Yale University) for her help during

the 2001 collecting expedition to Mount Washington

(U.S.A.). The support of Nils Ake Andersson while staying

at the Abisko Scientific Research Station (Sweden) was also

greatly appreciated. We thank the Abisko National Park

Fig. 7. A–E, Male genitalia external structures, posterior view. A, Thricops calcaratus; B, Thricops furcatus; C, Thricops bukowskii;

D, Thricops hirtulus; E, Thricops rufisquamus rufisquamus. F, Azelia cilipes %, mesolobus, posterior view. G, H, Male sternite 5. G, Thricops

furcatus; H, Thricops hirtulus. epand¼ epandrium; meso¼mesolobus; sur¼ surstylus.



for permission to collect specimens. We thank Insect

Systematics and Evolution Supplements for permission to

reproduce Figs 1B, 2E, 3B, F, G, 4C, 10A, C, 11A, C,

16G, 19A, C, D, G, 22A, D, G, H, 36A, C, E, 41H and

43G from Savage (2003) . Figure 11, p. 1120 fromManual of

Nearctic Diptera, Volume 2, 1987, Agriculture and Agri-

Food Canada, was reproduced here with the permission of

the Minister of Public Works & Government Services

Canada, 2003. Laboratory space was provided at the

North Carolina State University, the Lyman Entomological

Museum and the Abisko Scientific Research Station.

Financial support was provided by NSERC Postgraduate

Scholarship (Canada), bourses d’etudes FQRNT (Quebec),

The Dipterology Fund, Abisko Scientific Research Station,

research grants to Terry A. Wheeler from NSERC, and

Brian M. Wiegmann from the U.S. National Science

Foundation.

References

Baker, R.H. & DeSalle, R. (1997) Multiple sources of character

information and the phylogeny of Hawaiian drosophilids.

Systematic Biology, 46, 654–673.Baker, R.H., Wilkinson, G.S. & DeSalle, R. (2001) Phylogenetic

utility of different types of molecular data used to infer

evolutionary relationships among stalk-eyed flies (Diopsidae).

Systematic Biology, 50, 87–105.Bremer, K. (1994) Branch support and tree stability. Cladistics, 6,

369–372.Brown, B., Emberson, R.M. & Paterson, A.M. (1999) Phylogeny of

‘Oxycanus’ lineages of hepialid moths from New Zealand

inferred from sequence variation in the mtDNA COI and II

gene regions. Molecular Phylogenetics and Evolution, 13,

463–473.Brown, J.M., Pellmyr, O., Thompson, J.N. & Harrison, R.G.

(1994) Phylogeny of Greya (Lepidoptera: Prodoxidae), based on

nucleotide sequence variation in mitochondrial cytochrome

Fig. 8. A–E, Male genitalia internal structures, lateral view. A, Thricops hirtulus; B, Thricops rufisquamus rufisquamus; C, Thricops bukowskii;

D, Thricops furcatus; E, Thricops calcaratus. d inf¼dorsal infold; epiph¼ epiphallus; hypd¼hypandrium; lat scl¼ lateral sclerite;

phap¼phallapodeme; preg¼ pregonite.



oxidase I and II: congruence with morphological data.

Molecular Biology and Evolution, 11, 128–141.Bull, J.J., Huelsenbeck, J.P., Cunningham, C.W., Swofford, D.L. &

Waddel, P.J. (1993) Partitioning and combining data in

phylogenetic analyses. Systematic Biology, 42, 384–397.Chippindale, P.T. & Wiens, J.J. (1994) Weighting, partitioning and

combining characters in phylogenetic analyses. Systematic

Biology, 43, 278–287.Elberling, H. & Olesen, J.M. (1999) The structure of a high latitude

plant-flower visitor system: the dominance of flies. Ecography,

22, 314–323.Farris, J.S., Kallersjo, M., Kluge, A.G. & Bult, C. (1995a)

Constructing a significance test for incongruence. Systematic

Biology, 44, 570–572.Farris, J.S., Kallersjo, M., Kluge, A.G. & Bult, C. (1995b) Testing

significance of incongruence. Cladistics, 10, 315–319.Hennig, W. (1962) 63b. Muscidae. Die Fliegen der Palaearktischen

Region 7 (2) (ed. by E. Lindner), p. 625. Schweizerbart’sche,

Stuttgart.Hennig, W. (1965) Vorarbeiten zu einem phylogenetischen System

der Muscidae (Diptera: Cyclorrhapha). Stuttgarter Beitrage zur

Naturkunde, 141, 1–100.Hillis, D.M., Mable, B.K., Larson, A., Davis, S.K. & Zimmer, E.A.

(eds) (1996) Chapter 9. Nucleic acids IV: sequencing and

cloning. Molecular Systematics, 2nd edn, pp. 321–381. Sinauer

Associates, Sunderland, Massachusetts.Huckett, H.C. (1965a) The Muscidae of northern Canada, Alaska,

and Greenland (Diptera). Memoirs of the Entomological Society

of Canada, 42, 1–369.Huckett, H.C. (1965b) Family Muscidae. A Catalog of Diptera of

America North of Mexico (ed. by A. Stone, C. W. Sabrowsky,

W. W. Wirth, R. H. Foote and J. R. Coulson), pp. 869–914.

Agriculture Handbook no. 276. United States Department of

Agriculture, Washington, DC.Kluge, A.G. (1998) Total evidence or taxonomic congruence:

cladistic or consensus classification. Cladistics, 14, 151–158.Kocher, T.D., Thomas, W.K., Meyer, A., Edwards, S.V., Paabo, S.,

Villablanca, F.X. & Wilson, A.C. (1989) Dynamics of

mitochondrial DNA evolution in animals: amplification and

sequencing with conserved primers. Proceedings of the National

Academy of Sciences USA, 86, 6196–6200.Malloch, J.R. (1921) A synopsis of the anthomyiid genus

Trichopticus Rondani (Diptera). Canadian Entomologist, 52

[1920], 271–274.Michelsen, V. (1978) Cryptophyra lundbecki n. gen. et n. sp. from

north Europe, with some notes on allied hydrotaeine genera

(Diptera: Muscidae). Entomologica Scandinavica, 9, 85–92.Novacek, M.J. (1992a) Fossils as critical data for phylogeny.

Extinction and Phylogeny (ed. by M. J. Novacek and Q. D.

Wheeler), pp. 46–88. Colombia University Press, New York.Novacek, M.J. (1992b) Fossils, topologies, missing data, and the

higher level phylogeny of eutherian mammals. Systematic

Biology, 41, 58–73.Pont, A.C. (1986a) Family Muscidae. Catalogue of Palaearctic

Diptera, Vol. 11. Scathophagidae–Hypodermatidae (ed. by

A. Soos and L. Papp), pp. 57–215. Academiai Kiado, Budapest.Pont, A.C. (1986b) A revision of the Fanniidae and Muscidae

described by J. W. Meigen (Insect: Diptera). Annalen des

Naturhistorischen Museums in Wien, 87B, 197–253.

Pont, A.C. (1993) Observation on anthophilous Muscidae and

other Diptera (Insects) in Abisko National Park, Sweden.

Journal of Natural History, 27, 631–643.Ringdahl, O. (1947) Bestimmungstabelle der mir bekannten

europaischen und nordamerikanischen Arten von Alloeostylus

und Lasiops (Dipt: Musc.). Opuscula Entomologica, 12, 90–95.Rondani, C. (1856) Dipterologiae Italicae Prodromus. Vol. I.

Genera Italica ordinis Dipterorum ordinatim disposita et distincta

et in familias et stirpes aggregata. A. Stoschi, Parma.Savage, J. (2003) Revision of the genus Thricops Rondani (Diptera:

Muscidae). Insect Systematics and Evolution Supplement, 61,

1–143.Savage, J. & Wheeler, T.A. (in press) Phylogeny of the Azeliini

(Diptera: Muscida). Studia Dipterologica, in press.Schnabl, J. (1888a) Alloeostylus, nov. gen. Anthomyidarum.

Entomologisches Nachrichten Berlin, 14, 49–50.Schnabl, J. (1888b) Nachtrag zur Gattung Alloeostylus Schnabl.

Entomologisches Nachrichten Berlin, 14, 82–83.Schnabl, J. (1888c) Hera, nov. gen. Anthomyidarum, (0Hra,

Mutter der Gracien). [Aricia, pt. auctt. Yetodesia, pt. auctt.

Hyetodesia, pt. auctt. Lasiops, pt. Mg. Trichophthicus, pt.

Mydaea, pt.]. Entomologisches Nachrichten Berlin, 14, 113–120.Schnabl, J. (1889) Contributions a la faune dipterologique. Trudy

Russkago Entomologicheskago Obshchestva [¼ Horae Societatis

Entomologicae Rossicae], 23, 313–347.Skevington, J.H. & Yeates, D.K. (2000) Phylogeny of the

Syrphoidea (Diptera) inferred from mtDNA sequences and

morphology with particular reference to classification of the

Pipunculidae (Diptera). Molecular Phylogenetics and Evolution,

16, 212–224.Skidmore, P. (1985) The biology of the Muscidae of the world.

Series Entomologica, Vol. 29. Dr W. Junk, The Hague.Sorenson, M.D. (1999) Treerot, Version 2. Boston University,

Boston.Stahls, G. & Nyblom, K. (2000) Phylogenetic analysis of the genus

Cheilosia (Diptera, Syrphidae) using mitochondrial COI

sequence data. Molecular Phylogenetics and Evolution, 15,

235–241.Swofford, D.L. (2002) PAUP*: Phylogenetic Analysis Using

Parsimony (* and Other Methods), Version 4.0b10. Sinauer,

Sunderland, Massachusetts.Walsh, P.S., Metzger, D.A. & Higuchi, R. (1991) Chelex1100 as a

medium for simple extraction of DNA for PCR-based typing

from forensic material. Biotechniques, 10, 506–513.Wiens, J.J. (1998) Does adding characters with missing data

increase or decrease phylogenetic accuracy? Systematic Biology,

47, 625–640.Wilkinson, M. (1995) Coping with abundant missing entries in

phylogenetic inference using parsimony. Systematic Biology, 44,

501–514.Wilkinson, M. & Benton, M.J. (1995) Missing data and rhynch-

osaur phylogeny. Historical Biology, 10, 137–150.Zwickl, D.J. & Hillis, D.M. (2002) Increased taxon sampling

greatly reduces phylogenetic error. Systematic Biology, 51,

588–598.

Accepted 14 December 2003



Appendix 1

List of characters and character states for morphological

data.

1. Eye (male): (0) bare; (1) setulose.

2. Gena: (0) very narrow, with lower eye margin strongly

extending ventrally below level of vibrissae (Fig. 9B); (1)

relatively broad, with lower eye margin not or only

weakly extending ventrally below level of vibrissae

(Fig. 9A).

3. Interfrontal bristles (female): (0) present; (1) absent.

4. Aristal pubescence: (0) short; (1) plumose.

5. Presutural acrostichal bristles: (0) present; (1) absent.

6. Dorsocentral bristles: (0) 2þ 4; (1) 2þ 3.

7. Prealar bristles: (0) weak,<0.5� length of second

notopleural bristle; (1) strong,>0.75� length of second

notopleural bristle.

8. Lower katepisternal bristle: (0) absent or very weak; (1)

present.

9. Metathoracic spiracle: (0) small and round (Fig. 9D); (1)

large and triangular (Fig. 9C); (2) small and triangular

(Fig. 9E).

10. Setulae on metathoracic spiracle: (0) simple (Fig. 9D, E);

(1) branched (Fig. 9C).

11. Scutellum colour: (0) dark; (1) mostly to completely

yellow.

12. Basal half of midfemur (male): (0) not swollen; (1)

swollen (Fig. 9F).

13. Apical third of midfemur (male): (0) without dense

brush of hairs on apical third; (1) with dense brush of

hairs on apical third.

14. Posteroventral surface of midfemur (male): (0) with

hairs only; (1) with one to two rows of recurved

spinules on basal half; (2) with a row of very long and

Fig. 9. A, B, Head. A, Thricops vaderi ?; B, Hydrotaea anxia ? (source: Manual of Nearctic Diptera, Vol. 2, 1987, p. 1120, fig. 11). C–E,

Posterior thoracic spiracle. C, Thricops diaphanus/; D, Thricops vaderi /; E, Thricops furcatus/. F, Thricops spiniger ?, midfemur, anterior

view; G, Thricops semicinereus ?, fore tarsomeres 2–5, anterior view; H, Thricops diaphanus ?, hind tibia, anterior view; I, Thricops

rufisquamus rufisquamus ?, fore tibia, posterior view. hlt¼halter; ktg¼ katatergite; p spr¼posterior spiracle.



strong straight bristles; (3) bare except for a single

strong spine in middle.

15. Fore tibia (female): (0) without posteroventral bristle;

(1) with one to two posteroventral bristles.

16. Apical third of fore tibia (male): (0) without strong

spines on apical third; (1) with one row of six to eight

strong posteroventral spines; (2) with two strong

posterior and one to three strong posteroventral spines.

17. Posteroventral surface of fore tibia (male): (0) without

short flat spines; (1) with two rows of short flat spines

(Fig. 9I).

18. Midtibia (at least in male): (0) without one to two

posteroventral bristles; (1) with one to two poster-

oventral bristles.

19. Posterodorsal surface of hind tibia (male): (0) without a

fringe of long bristles; (1) with a fringe of six to eight

long bristles.

20. Ventral surface of hind tibia (male): (0) without apical

or preapical spur; (1) with apical or preapical spur

(Fig. 9H).

21. Apicoventral surface of hind tibia (male): (0) without a

fringe of spinules; (1) with a fringe of short spinules.

22. Fore tarsomere 4 (male): (0) without a pad of poster-

oventral spinules; (1) with a pad of posteroventral

spinules (Fig. 9G).

23. Fore tarsomere 5 (male): (0) flat and rounded; (1)

pointed and projecting dorsally (Fig. 9G).

24. Midtarsomeres 3–5 (male): (0) without a fringe of pale

posteroventral setulae; (1) with a distinct fringe of pale

posteroventral setulae.

25. Halter colour (male): (0) yellow; (1) dark.

26. Sternite 1 (male): (0) bare; (1) haired.

27. Length of sternite 5 (male): (0) short, <1.3� as long as

wide (Fig. 7G); (1) long, >1.4� as long as wide

(Fig. 7H).

28. Shape of surstyli (male): (0) short and bent medially

(Fig. 7D, E); (1) long and projecting ventrally (Fig.

7A–C).

29. Shape of apical portion of surstyli in posterior view

(male): (0) not very broad; (1) very broad with apex

flat medially (Fig. 7E).

30. Shape of mesolobus (male): (0) broad and flat, about as

high as long (Fig. 7D, E); (1) V-shaped (Fig. 7B); (2)

rectangular and strongly cleft medially (Fig. 7A); (3)

rectangular, split but uncleft (Fig. 7C); (4) broad with

raised central area, about as high as long (Fig. 7F).

31. Lateral sclerites of distiphallus (male): (0) narrow or

weakly developed; (1) well sclerotized and flared

apically (Fig. 8A–E).

32. Lateral sclerites of distiphallus (male): (0) fused

dorsally with one another on basal half only,

not forming a tube; (1) fused dorsally with one

another along most of the dorsal margin, forming a

long tube.

33. Dorsal infold of distiphallus (dorsal sclerite of Savage,

2003) (male): (0) large and very strongly sclerotized

with long black spines and weakly invaginated; (1)

large, with or without spinules and deeply invaginated;

(2) reduced and membranous, without spinules and

weakly invaginated.

34. Dorsal infold of distiphallus (male): (0) partially to

completely split longitudinally; (1) completely fused.

35. Length of epiphallus (male): (0) <0.5� length of

phallapodeme (Fig. 8C); (1) >0.75�length of phallapo-

deme (Fig. 8B).

36. Shape of pregonite (male): (0) broad and short, with

apex blunt (Fig. 8D); (1) broad at least on basal two

thirds and with apex projecting laterally (Fig. 8A); (2)

long and narrow, with apex bent ventrally at a 90�

angle (Fig. 8B); (3) long and narrow, with apex rounded

(Fig. 8C).

37. Apex of pregonite (male): (0) mostly well sclerotized,

never jagged; (1) strongly desclerotized and jagged

(Fig. 8E).

38. Length of hypandrial arms (male): (0) short; (1) very

long (Fig. 8D).

39. Attachment of hypandrial arms (male): (0) attached to

surstyli before apex; (1) attached to surstyli at apex.

40. Tergite 8 (female): (0) split in two relatively parallel rods

(Fig. 10B, C); (1) connected medially and M-shaped

(Fig. 10A); (2) connected anteriorly and posteriorly,

forming a hollow rectangle (Fig. 10D).

41. Spines of tergite 8 (female): (0) straight (Fig. 10A); (1)

weakly to strongly recurved (Fig. 10B).

42. Sternite 8 (female): (0) divided into two mostly parallel

rods (Fig. 10F); (1) fused posteriorly and V-shaped

(Fig. 10G).

43. Tergite 10 (female): (0) bare (Fig. 10A, B, D); (1)

haired at least on apical half (Fig. 10C).

44. Cercus (female): (0) bare or with setulae only on apical

half; (1) densely setulose over most of the ventral

surface (Fig. 10E).



Fig. 10. A–D, Female genitalia, dorsal view. A, Thricops furcatus; B, Thricops hirtulus; C, Thricops tarsalis; D, Thricops diaphanus. E,

Thricops rufisquamus rufisquamus &, cercus, ventral view. F, G, Female genitalia, ventral view. F, Thricops hirtulus; G, Thricops spiniger.

cerc¼ cercus; tg 8¼ tergite 8; tg 10¼ tergite 10; st 8¼ sternite 8; st 10¼ sternite 10.



Appendix 2.

Complete morphological data matrix. Missing characters noted as (?), polymorphic characters noted as (&). All polymorphic

characters variable only for states 0 and 1.

12345678911234567890

11111111121234567890

22222222231234567890

33333333341234567890

44441234

T. albibasalis 0110001111 0000100100 1000000101 1011100011 0000T. aculeipes 1100101100 0000000000 0010111000 1010110000 1000T. aduncus 1100101111 0000100100 0000100010 1021120011 0000T. beckeri 0110111100 0000000000 0000000000 1010110000 1000T. bukowskii 0101110100 0000000000 0000100103 1020030010 1000T. calcaratus 1100001111 0000100101 0000000102 1011101110 0000T. coquilletti 1100100000 0001000001 0011101000 1010110000 0000T. culminum 11001&1100 0001000000 0001111000 1010110000 1000T. cunctans 1100101100 0001000001 0011101000 1010110000 1000T. dianae 1101101100 0001000001 0000001000 1010110000 1000T. diaphanus 0100101111 1000100101 0000000000 1011100012 0000T. fimbriatus 1100100000 0100010010 0001101000 1010110000 1100T. foveolatus 0000100100 0000000000 0000100000 1010000010 0000T. furcatus 0110111120 0000100100 0000000101 1121100111 0000T. genarum 0110&11111 0000100100 1000000101 1011100011 0000T. hakusanus 0110001111 0000100100 1000000101 1011100011 0000T. hirtulus 1100101100 0001000000 0001111000 1010110000 1000T. innocuus 1100101100 0000000000 0000101000 1010110000 1100T. lividiventris 0110111120 0000100100 0000000101 1121100111 0000T. livi. plumbeus 0110111120 0000100100 0000000101 1121100111 0000T. longipes 1101101100 0000100000 0001001000 1010110000 1000T. nepalensis 0100001111 1000100101 0000000000 1011100012 0000T. nigriabdominalis 11?0100100 0001?00000 0110001000 101011000? ????T. nigrifrons 1101101100 0000100000 0001001000 1010110000 1000T. nigritellus 0101111100 0001000001 0011101000 1010110000 1000T. ponti 01?0001111 0000?00101 0000000102 101110111? ????T. rostratus 1100100100 0001000001 0010101000 1010110000 1000T. rufisquamus 1110101111 0012001100 0000000010 1021120011 0011T. rufi. himalayensis 1110101011 0012001100 0000&00010 1021120011 0011T. semicinereus 1100100100 0001000000 0110001000 1010110000 1000T. septentrionalis 1100101000 0100020010 0001101000 1010110000 1100T. simplex 0100011111 0000100100 0000000101 1121100110 0000T. spiniger 1100101000 0100020010 0001101000 1010110000 1100T. tarsalis 0110101111 0000000100 0000000000 1011100010 0010T. separ 1100101000 0100010010 0001001000 1010110000 1100T. sudeticus 1100001111 0000100101 0000000102 1011101110 0000T. tatricus 0110111120 0000100100 0000000101 1121100111 0000T. thudamensis 11?0101111 0012?00100 0000100010 102112001? ????T. vaderi 1100101100 0000000000 0000111000 1010110000 1000T. villicrus 1100101&00 0000000010 00001&1000 1010110000 1100T. villosus 0100101000 0000000001 0001101000 1010110000 1000A. cilipes 0000010000 0003000000 0000000004 0021000000 0000A. gibbera 0000010000 0003000000 0000100004 0021000000 0000H. spinifemorata 0000000000 0000000000 0000001000 0000010000 0000



Phylogenetic analysis of the genus Thricops Rondani (Diptera: Muscidae) based on molecular and...

Documents

Transcript of Phylogenetic analysis of the genus Thricops Rondani (Diptera: Muscidae) based on molecular and...