doi:10.1152/ajpheart.00731.2008 295:2503-2511, 2008. First published Oct 24, 2008;Am J Physiol Heart Circ Physiol

Lopes, M. M. Teixeira and V. S. Lemos L. S. A. Capettini, S. F. Cortes, M. A. Gomes, G. A. B. Silva, J. L. Pesquero, M. J.

You might find this additional information useful...

61 articles, 24 of which you can access free at: This article cites http://ajpheart.physiology.org/cgi/content/full/295/6/H2503#BIBL

including high-resolution figures, can be found at: Updated information and services http://ajpheart.physiology.org/cgi/content/full/295/6/H2503

can be found at: AJP - Heart and Circulatory Physiologyabout Additional material and information http://www.the-aps.org/publications/ajpheart

This information is current as of December 9, 2008 .  

http://www.the-aps.org/.ISSN: 0363-6135, ESSN: 1522-1539. Visit our website at Physiological Society, 9650 Rockville Pike, Bethesda MD 20814-3991. Copyright © 2005 by the American Physiological Society. intact animal to the cellular, subcellular, and molecular levels. It is published 12 times a year (monthly) by the Americanlymphatics, including experimental and theoretical studies of cardiovascular function at all levels of organization ranging from the

publishes original investigations on the physiology of the heart, blood vessels, andAJP - Heart and Circulatory Physiology

on Decem

ber 9, 2008 ajpheart.physiology.org

Dow

nloaded from

Neuronal nitric oxide synthase-derived hydrogen peroxide is a majorendothelium-dependent relaxing factor

L. S. A. Capettini,1 S. F. Cortes,2 M. A. Gomes,3 G. A. B. Silva,4 J. L. Pesquero,1 M. J. Lopes,1

M. M. Teixeira,5 and V. S. Lemos1

Departments of 1Physiology and Biophysics, 2Pharmacology, 3Parasitology, 4Morphology, and 5Biochemistryand Immunology, ICB, Federal University of Minas Gerais, Belo Horizonte, Brazil

Submitted 14 July 2008; accepted in final form 22 October 2008

Capettini LS, Cortes SF, Gomes MA, Silva GA, Pesquero JL,Lopes MJ, Teixeira MM, Lemos VS. Neuronal nitric oxide synthase-derived hydrogen peroxide is a major endothelium-dependent relaxingfactor. Am J Physiol Heart Circ Physiol 295: H2503–H2511, 2008. Firstpublished October 24, 2008; doi:10.1152/ajpheart.00731.2008.—En-dothelium-dependent vasorelaxation in large vessels is mainly attrib-uted to N�-nitro-L-arginine methyl ester (L-NAME)-sensitive endo-thelial nitric oxide (NO) synthase (eNOS)-derived NO production.Endothelium-derived hyperpolarizing factor (EDHF) is the compo-nent of endothelium-dependent relaxations that resists full blockade ofNO synthases (NOS) and cyclooxygenases. H2O2 has been proposedas an EDHF in resistance vessels. In this work we propose that in miceaorta neuronal (n)NOS-derived H2O2 accounts for a large proportionof endothelium-dependent ACh-induced relaxation. In mice aortarings, ACh-induced relaxation was inhibited by L-NAME and N�-nitro-L-arginine (L-NNA), two nonselective inhibitors of NOS, andattenuated by selective inhibition of nNOS with L-ArgNO2-L-Dbu-NH2 2TFA (L-ArgNO2-L-Dbu) and 1-(2-trifluoromethylphehyl)imida-zole (TRIM). The relaxation induced by ACh was associated withenhanced H2O2 production in endothelial cells that was prevented bythe addition of L-NAME, L-NNA, L-ArgNO2-L-Dbu, TRIM, andremoval of the endothelium. The addition of catalase, an enzyme thatdegrades H2O2, reduced ACh-dependent relaxation and abolishedACh-induced H2O2 production. RT-PCR experiments showed thepresence of mRNA for eNOS and nNOS but not inducible NOS inmice aorta. The constitutive expression of nNOS was confirmed byWestern blot analysis in endothelium-containing vessels but not inendothelium-denuded vessels. Immunohistochemistry data confirmedthe localization of nNOS in the vascular endothelium. Antisenseknockdown of nNOS decreased both ACh-dependent relaxation andACh-induced H2O2 production. Antisense knockdown of eNOS de-creased ACh-induced relaxation but not H2O2 production. Residualrelaxation in eNOS knockdown mouse aorta was further inhibited bythe selective inhibition of nNOS with L-ArgNO2-L-Dbu. In conclu-sion, these results show that nNOS is constitutively expressed in theendothelium of mouse aorta and that nNOS-derived H2O2 is a majorendothelium-dependent relaxing factor. Hence, in the mouse aorta, theeffects of nonselective NOS inhibitors cannot be solely ascribed toNO release and action without considering the coparticipation ofH2O2 in mediating vasodilatation.

vasorelaxation; acetylcholine; antisense; knockdown

NEURONAL NITRIC OXIDE (NO) synthase (nNOS) is a Ca2�/calmodulin-dependent isoform of NO synthase (NOS) consti-tutively expressed in neurons and in many other differenttissues (17, 32, 36, 50, 57). In the cardiovascular system, nNOS

is expressed in vascular smooth muscle cells (6, 7), vascularendothelium (1, 23), and cardiac myocytes (53). nNOS has aphysiologically relevant role in modulating cardiac function(10), myogenic tone (16), systemic arterial pressure (28), andcerebral blood flow (19). Recent studies have shown thatdeletion of nNOS reduces vasodilation induced by ACh (40) inthe mouse aorta.

Most evidence linking NO and vasorelaxation derives fromstudies that use inhibitors of NOS, including N�-nitro-L-argi-nine methyl ester (L-NAME) and N�-nitro-L-arginine (L-NNA).It is not clear whether NO is the only vasoactive mediatorinvolved in ACh-induced vasorelaxation because NOS gener-ates several intermediates as a result of electron transportduring enzymatic cycling, including H2O2 (22, 45, 55). In largeconductance vessels, such as aorta, NOS inhibitors preventvasodilation, and hence NO is believed to be the main endo-thelium-derived relaxant factor (EDRF) (42). In resistancevessels, the participation of endothelium-derived hyperpolar-izing factors (EDHF) is largely accepted (18). Classically,EDHF-mediated responses are defined as the endothelium-dependent relaxation after the blockade of the synthesis of NOand vasodilator prostaglandins (56). The chemical nature ofEDHF remains controversial (15). Recently, H2O2 was de-scribed as a new EDHF in murine and human mesentericresistance arteries (33, 34) and canine (58) and human (38)coronary arteries. Furthermore, H2O2 has been shown to elicitboth hyperpolarization and vasodilatation of peripheral andcerebral arteries (5, 25, 33) to activate Ca2�-activated K�

channels in vascular smooth muscle cells (2, 3, 8) and anonselective cation channel in endothelial cells (26).

In the present study, we demonstrate that H2O2 producedafter stimulation of endothelial cell-derived nNOS accounts fora large portion of the relaxation induced by ACh in the mouseaorta. Hence classical nonselective inhibitors of NOS preventthe production of both NO and H2O2, suggesting that both NOand H2O2 can be defined as EDRF in the mouse aorta.

MATERIALS AND METHODS

Animals. All experimental protocols were performed in accordancewith guidelines for the humane use of laboratory animals at ourInstitute and were approved by the Animal Ethics Committee of theFederal University of Minas Gerais (Protocol No. 26/2007). We used12- to 14-wk-old male C57BL/6J mice obtained from the Universityanimal facility.

Address for reprint requests and other correspondence: V. S. Lemos, Dept.of Physiology and Biophysics, ICB, Federal Univ. of Minas Gerais. Av.Antonio Carlos, 6627, Pampulha 31270-901, Belo Horizonte, MG, Brazil(e-mail: vslemos@icb.ufmg.br).

The costs of publication of this article were defrayed in part by the paymentof page charges. The article must therefore be hereby marked “advertisement”in accordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Am J Physiol Heart Circ Physiol 295: H2503–H2511, 2008.First published October 24, 2008; doi:10.1152/ajpheart.00731.2008.

0363-6135/08 $8.00 Copyright © 2008 the American Physiological Societyhttp://www.ajpheart.org H2503

on Decem

ber 9, 2008 ajpheart.physiology.org

Dow

nloaded from

Organ chamber experiments. Rings from the thoracic aorta wereobtained and set up as previously described (37). ACh (Sigma, StLouis, MO), exogenous H2O2 (Merck, Darmstadt, Germany), sodiumnitroprusside (SNP; Sigma), and diethylamine NONOate diethylam-monium salt (DEA-NONOate; Sigma) were added in increasingcumulative concentrations once the response to 0.1 �mol/l phenyl-ephrine (Sigma) had stabilized. The vessels were washed thoroughlyand stood for 60 min. The vessels were then incubated for 20 min withthe indicated drugs, with the exception of aminotriazole (ATZ), and asecond cumulative concentration-response curve for ACh was con-structed. ATZ (50 mmol/l), a catalase inhibitor (4, 9, 11, 14, 43, 47,52, 59), was added to the preparation 40 min before the addition of theindicated drugs. In experiments performed to assay the inhibitoryeffect of ATZ over catalase (2,400 IU/ml; Calbiochem, San Diego,CA; and Sigma), both drugs were incubated together in solution for 40min, and after this time tissues were treated with these drugs for anadditional 20 min. In experiments using H2O2, SNP and DEA-NONOate, another vessel segment from the same animal, were usedto construct the second curve. Mechanical activity was recordedisometrically, as previously described (30).

RT-PCR. Frozen tissues (aorta, heart, and brain) were homogenizedin TRIzol (Life Technologies, Gaithersburg, MD), total RNA wasextracted, and RT-PCR was performed as previously described (29).The following primers (Invitrogen, Carlsbad, CA) were used in theexperiments: for endothelial NOS (eNOS), TTCCGGCTGCCACCT-GATCC (forward) and AACATATGTCCTTGCTCAAG (reverse);for inducible NOS (iNOS), CTTGCCCCTGGAAGTTTCTC (for-ward) and GGGCATTCCTCCAGGCCATC (reverse); for nNOS,TTCAACTACATCTGTAACCA (forward) and TCTGCAGCGGT-ACTCATTCTC (reverse); and for �-actin, GTTCCGATGCC-CCGAGGATCT (forward) and GCATTTGCGGTGCACGATGGA (re-verse). The sizes of the expected products were: 341 bp for eNOS, 579bp for iNOS, 693 bp for nNOS, and 600 bp for �-actin.

Western blot analysis. Western blot was performed as previouslydescribed (49) with some modifications. Briefly, the frozen tissues(aorta and brain) were homogenized in lyses buffer of (in mmol/l) 150NaCl, 50 Tris �HCl, 5 EDTA.2Na, and 1 MgCl2 containing 1% TritonX-100 and 0.5% SDS plus protease inhibitors (SigmaFAST; Sigma).Equal amounts of protein were denatured and separated in denaturingSDS/7.5% polyacrylamide gel. Proteins were transferred onto a poly-vinylidene fluoride membrane (Immobilon P; Millipore, MA). Blotswere blocked at room temperature with 2.5% non-fat dry milk in PBSplus 0.1% Tween 20 before incubation with rabbit polyclonal anti-nNOS (diluted 1:1,000; Santa Cruz Biotechnology, Santa Cruz, CA),rabbit polyclonal anti-eNOS (diluted 1:1,000; Sigma), or rabbit poly-clonal anti-GAPDH (diluted 1:3,000; Santa Cruz Biotechnology) at

room temperature. The immunocomplexes were detected by chemi-luminescent reaction (ECL� kit; Amersham, Les Ulis, France) fol-lowed by densitometric analyses with software ImageQuant.

Immunohistochemical procedure. The aorta was removed, imme-diately fixed with 10% Formalin, dehydrated, and embedded inparaffin. Sections (6 �m thick) were stained with anti-nNOS rabbitantibody (diluted 1:100) overnight at 4°C. The reaction was detectedusing biotinylated anti-rabbit IgG antibody (LSAB � PEROXIDASESystem; Dako, Glostrup, Denmark). Staining was performed with 14mg of 3,3�-diaminobenzidine tetrahydrochloride and 10% H2O2 inPBS solution. The sections were not counterstained.

Measurements of H2O2 in vascular segments. Luminol-dependentchemiluminescence induced by H2O2 was measured using a BioOrbit1250 Luminometer. Ring segments of mouse aorta (2 to 3 mm) wereplaced in tubes containing 1 ml Krebs-HEPES buffer solution of (inmmol/l) 110.8 NaCl, 5.9 KCl, 25.0 NaHCO3, 1.07 MgSO4, 2.49CaCl2, 2.33 NaH2PO4, 11.51 glucose, and 10 HEPES (pH 7.4)containing 100 �mol/l luminol (Sigma) continuously stirred andmaintained at 37°C. The reaction was initiated by the addition of 6IU/ml of horseradish peroxidase (54) and ACh. When necessary, thevessels were preincubated for 20 min with different drugs, as indi-cated before the initiation of the reaction. In some experiments, theendothelial layer of aorta segments was removed as described else-where (30). The absence of relaxant responses to ACh was taken asevidence that the vessel segments were functionally denuded ofendothelium.

Spectrophotometric and fluorescent measurement of H2O2. Spec-trophotometric determination of H2O2 was performed according to theferrous oxidation-xylenol (FOX-2) method with some modifications(41). Aortic rings were removed as described previously and incu-bated in tubes containing Krebs-Henseleit solution, maintained at37°C. Vessels were stimulated with ACh (100 �mol/l) and 200 �l ofperfusate taken 5 min later. The perfusate was mixed with 1,800 �l ofFOX-2 reagent. The reaction was allowed to run in the dark for 30 minat room temperature, and the absorbance was monitored at 560 nm.Complete absence of H2O2 was ensured by adding catalase (2,400IU/ml). Fluorescent detection of H2O2 in endothelial cells was per-formed according to Matoba et al. (34) with some modifications.Briefly, aortic rings were cut longitudinally and incubated in 5 �mol/l2�,7-dichlorodihydro-fluorescein diacetate (DCF; Calbiochem, SanDiego, CA), a peroxide fluorescent dye (34), for 15 min and thenplaced on a slide glass and observed using an epifluorescence IX70Olympus microscope (Tokyo, Japan). Fluorescence was excited at480 nm with use of a xenon lamp, and emitted fluorescence was beingfiltered by a 490- to 530-nm band-pass filter. Fluorescent images ofthe endothelium were obtained before and 5 min after the application

Fig. 1. Effect of nonselective inhibition of nitric oxide (NO) synthase (NOS) and cyclooxygenase (A), selective inhibition of neuronal NOS (nNOS; B), andcatalase (2,400 IU/ml) and aminotriazole (ATZ; 50 mmol/l) (C) in ACh-induced relaxation in the mouse aorta. A: N�-nitro-L-arginine methyl ester (L-NAME;300 �mol/l), N�-nitro-L-arginine (L-NNA; 100 �mol/l), and removal of endothelium-abolished vasodilatation induced by ACh. Indomethacin (10 �mol/l) hada minor effect. B: L-ArgNO2-L-Dbu-NH2 2TFA (L-ArgNO2-L-Dbu; 1 �mol/l) and 1-(2-trifluoromethylphehyl)imidazole (TRIM; 300 �mol/l) attenuated therelaxant response to ACh. C: catalase reduced vasodilation induced by ACh and ATZ potentiated the vascular response to ACh. ATZ inhibited the effect ofexogenous catalase on vascular response to ACh (n � 5–8). ***P � 0.001. E�, endothelium removal.

H2504 nNOS-DERIVED H2O2 IS AN EDRF IN MOUSE AORTA

AJP-Heart Circ Physiol • VOL 295 • DECEMBER 2008 • www.ajpheart.org

on Decem

ber 9, 2008 ajpheart.physiology.org

Dow

nloaded from

of 100 �mol/l ACh, which was achieved by dropping 10 �l Krebs-HEPES buffer solution containing ACh onto the slide glass. Relativefluorescence intensity was calculated using images obtained underbasal conditions without ACh by means of a digital camera Optronicsmodel DEI-470 and the processing image software Image Pro-Plus5.0. To determine the effect of catalase on ACh-induced increasein fluorescence, tissues were pretreated for 10 min before theaddition of ACh.

Nitrite measurement. Nitrite measurements were performed byusing 2,3-diaminonaphthalene (DAN; Sigma) fluorescent method ac-cording to Misko et al. (37) with modifications. Briefly, 20 �l of 0.05mg/ml DAN were added to 200 �l of perfusate obtained as describedin Spectrophotometric and fluorescent measurement of H2O2. After 10min incubation at 20°C protected from light, the reaction was stoppedwith 10 �l of 2.8 mol/l NaOH. Formation of fluorescent product wasmeasured using a fluorescent plate reader (Cary Eclipse Microplatereader; Varian) with excitation at 360 nm and emission read at 440 nmwith a gain setting at 100%.

Antisense oligonucleotides. To silence eNOS and nNOS, we tookadvantage of the antisense oligodeoxynucleotides (aODNs) technique.The 18-base phosphorothioated aODNs were constructed based on themouse sequence (46). Both are stable and enter the cell (31, 46). Weused the specific sequences 5�-CTCTTCAAGTTGCCCATGT-3� foreNOS and 5�-AACGTGTGCTCTTCCATGG-3� for nNOS (GenbankAccession No. NM 008713 and NM 008712) purchased from Euro-gentech North America (San Diego, CA). The phosphorothioatedmismatch oligodeoxynucleotides (MM-ODNs) sequence with thebase composition 5�-GTCTTGAACTTCCCGATCT-3� was used ascontrol oligodeoxynucleotides (ODNs).

In vivo administration of ODNs and evaluation of the nNOS andeNOS efficiency in vivo. Mice received 2 nmol aODNs or 2 nmolMM-ODNs intravenously 24 and 48 h before the experiments accord-ing to Dick et al. (12) with some modifications. The aODNs and senseoligodeoxynucleotides (sODNs) were dissolved in a total volume of200 �l saline and injected with a 26-gauge needle in the penile vein.Animals were anesthetized by intraperitoneal injection (3 ml/kg) of a

Fig. 2. Effect of catalase (2,400 IU/ml) on NO-in-duced vasorelaxation (A) and effect of exogenousH2O2 on vascular response (B). A: catalase did not altervascular response to diethylammonium(z)-1-(N,N-diethylamino)diazen-1-ium-1,2-diolate (DEA-NONO-ate) and sodium nitroprusside (SNP). B: exogenousH2O2 induced vascular endothelium-independent re-laxation and ATZ improved the response to H2O2 (n �5–8). ***P � 0.001.

Fig. 3. H2O2 production measured by chemilumines-cence (A and B) and ferrous oxidation-xylenol (FOX-2)method (C). A: L-NAME (300 �mol/l), L-NNA (100�mol/l), L-ArgNO2-L-Dbu (1 �mol/l), and TRIM (300�mol/l) reduced ACh-induced H2O2 production. Cata-lase (2,400 IU/ml) or endothelium removal (E�) abol-ished H2O2 production, and hemoglobin (10 �mol/l) orN�-nitro-D-arginine methyl ester (D-NAME; 300 �mol/l)did not alter the response. B: SNP (10 �mol/l) did notinduce chemiluminescent signals. C: FOX-2 method alsoshowed that L-NAME, L-NNA, TRIM, catalase, andendothelial removal, but not D-NAME, reduced ACh-induced H2O2 production. D: fluorescence detection ofH2O2 in endothelial cells in the absence and presence ofcatalase (n � 5–8). ***P � 0.001; **P � 0.01. RLU,relative luminescence units; au, arbitrary units.

H2505nNOS-DERIVED H2O2 IS AN EDRF IN MOUSE AORTA

AJP-Heart Circ Physiol • VOL 295 • DECEMBER 2008 • www.ajpheart.org

on Decem

ber 9, 2008 ajpheart.physiology.org

Dow

nloaded from

mixture of ketamine (100 mg/ml) and xylazine (20 mg/ml) 1:4(vol:vol). The efficiency of the aODNs to block the expression ofnNOS and eNOS was evaluated by Western blot analysis and byfunctional assay of ACh-induced vasorelaxation.

Statistical analysis. Data are expressed as means SE. Two-wayANOVA with Bonferroni multiple comparisons posttest was used tocompare concentration-response curves obtained in aortic rings. Stu-dent’s t-test was used in the other experiments.

RESULTS

Vascular reactivity. ACh induced a concentration-dependentvasorelaxation, which was prevented by the nonselective inhi-bition of NOS with L-NAME (300 �mol/l) and L-NNA (100�mol/l) and by removal of endothelium (Fig. 1A). Preincuba-tion of vessels with L-ArgNO2-L-Dbu-NH2 2TFA (L-ArgNO2-L-Dbu; 1 �mol/l; Ki � 0.13 �mol/l for nNOS and 200 �mol/l

for eNOS) (24) and 1-(2-trifluoromethylphehyl)imidazole(TRIM; 300 �mol/l; Ki � 28 �mol/l for nNOS and 1,060�mol/l for eNOS) (20), two selective inhibitors of nNOS,markedly decreased the vasorelaxant response induced by ACh(Fig. 1B). Indomethacin (10 �mol/l) had only minor effects(Fig. 1A). Catalase, an enzyme that specifically decomposesH2O2 into oxygen and water (44, 61), was used to evaluate therole of H2O2 in ACh-induced vasorelaxation. Catalase (2,400IU/ml) reduced the vasodilator effect of ACh to the sameextent as the inhibition of nNOS (compare Fig. 1, B and C).ATZ (50 mmol/l), an inhibitor of catalase, abolished theinhibitory effect of catalase on ACh-induced relaxation (Fig.1C) and potentiated endothelium-dependent relaxation inducedby ACh (Fig. 1C).

To account for any nonspecific effect of catalase on NOlevels, the enzyme was tested against the vasodilator effect oftwo NO donors: DEA-NONOate and SNP. Catalase (2,400IU/ml) had no effect on DEA-NONOate- and SNP-inducedrelaxation in endothelium-denuded mice aortic rings (Fig. 2A).

Exogenous H2O2 induced a concentration-dependent relax-ation of endothelium-denuded aortic rings (pEC50 � 4.4 0.08; Fig. 2B), as it has been described in other vessels (35,38). This response was potentiated (10-fold; pEC50 � 5.8 0.19) by ATZ (Fig. 2B). On the other hand, ATZ did notchange the relaxant response to DEA-NONOate and SNP (datanot shown).

ACh stimulates production of H2O2 in the mouse aorta,which is decreased by inhibition of nNOS. ACh induced aconcentration-dependent increase in H2O2 production in themouse aorta, as assessed by luminol/horseradish peroxidasechemiluminescence (supplemental Fig. 1; all supplementalmaterial can be found with the online version of this article).H2O2 production was abolished by the removal of endotheliumand by catalase (2,400 IU/ml; Fig. 3A). Exposure of aortic

Fig. 4. Measurement of nitrite by fluorescence method with 2,3-diaminonaph-thalene (DAN) reagent. Data show that L-NAME (300 �mol/l), L-NNA (100�mol/l), and removal of endothelium (E�) decreased nitrite synthesis in themouse aorta. TRIM (300 �mol/l) had a minor effect on nitrite production.D-NAME (300 �mol/l) did not alter the response (n � 5–8). ***P � 0.001;*P � 0.05.

Fig. 5. Endothelial NOS (eNOS), inducible NOS (iNOS), and nNOS mRNA levels in aorta, heart, and brain of mouse. Data show that eNOS (A) and nNOS (C)but not iNOS (B) mRNA were expressed in mouse aorta (n � 3).

H2506 nNOS-DERIVED H2O2 IS AN EDRF IN MOUSE AORTA

AJP-Heart Circ Physiol • VOL 295 • DECEMBER 2008 • www.ajpheart.org

on Decem

ber 9, 2008 ajpheart.physiology.org

Dow

nloaded from

rings to L-NAME (300 �mol/l), L-NNA (100 �mol/l), TRIM(300 �mol/l), and L-ArgNO2-L-Dbu (1 �mol/l) also dramati-cally reduced ACh-induced H2O2 production, whereas N�-nitro-D-arginine methyl ester (D-NAME), the inactive analog ofL-NAME (300 �mol/l), was ineffective (Fig. 3A). L-NAME,L-NNA, TRIM, and L-ArgNO2-L-Dbu did not interfere with thechemiluminescence signal induced by the addition of exoge-nous H2O2 (data not shown). Stimulation of the vessels withSNP (100 �mol/l) did not produce any increase in the chemi-luminescence signal (Fig. 3B), and scavenging of NO withhemoglobin (10 �mol/l) did not affect H2O2 production stim-ulated by ACh (Fig. 3A). Together, the results with SNP andhemoglobin show that our chemiluminescence signal was notdue to an increase in NO production. Using the FOX-2 method,we confirmed that there was inhibition of H2O2 production inthe absence of endothelium and in the presence of L-NAME,L-NNA, TRIM, or catalase (Fig. 3C). H2O2 increases mediatedby ACh were also measured directly in endothelial cells loadedwith DCF using an epifluorescent microscope. In this system,although the endothelial monolayer was clearly distinguished,the underlying smooth muscle cell layer could not be visual-ized. As seen in Fig. 3D (for images, see supplemental Fig. 2),ACh produced an increase in the DCF fluorescence intensity inendothelial cells that was abrogated in the presence of catalase.

ACh stimulated production of nitrite in the mouse aorta.Stimulation of aortic rings with ACh induced an increase innitrite production (Fig. 4). The removal of endothelial cells,sequestration of NO with hemoglobin, or inhibition of NOSwith L-NAME (300 �mol/l) or L-NNA (100 �mol/l), but notD-NAME, greatly decreased nitrite production (Fig. 4). ThenNOS inhibitor TRIM partially inhibited the production ofnitrite induced by ACh, showing that nNOS contributes withpart of the total NO produced in the mouse aorta (Fig. 4).

nNOS expression in the mouse aorta. Brain and hearts ofmice expressed mRNA for all three isoforms of NOS. Incontrast, there was a significant expression of mRNA for eNOSand nNOS, but not iNOS, in the aorta (Fig. 5). Constitutiveexpression of nNOS was confirmed by Western blot analysis inbrain and endothelium-containing aortas (Fig. 6A). Removal ofendothelium decreased by 90% the detection of nNOS in themouse aorta (Fig. 6A). Immunohistochemistry for nNOS per-formed in the mouse aorta indicates this enzyme is localized inthe vascular endothelium but is undetectable from vascularsmooth muscle or adventitia (Fig. 6, B–E). Western blotanalysis of eNOS is shown for comparison in supplementalFig. 3.

Effect of eNOS and nNOS knockdown on relaxation andH2O2 production induced by ACh. The lowest level of nNOS(by 82.6% reduction; Fig. 7A) and eNOS (by 75.4%reduction; Fig. 7B) expression in the mouse aorta was achieved48 and 24 h after the aODNs injection, respectively. Antisenseknockdown of nNOS decreased by 50% ACh-dependent relax-ation (Fig. 7C) and ACh-induced H2O2 production (Fig. 7D) inthe mouse aorta compared with MM-ODNs animals. Specificinhibition of nNOS with L-ArgNO2-L-Dbu (1 �mol/l) decreasedrelaxation (Fig. 7C) and H2O2 (Fig. 7D) production induced byACh in MM-ODNs mouse aorta, in the same proportion asknockdown of nNOS, but did not modify both responses in theaortas of ODN-treated animals. Antisense knockdown ofeNOS reduced by 50% ACh-induced relaxation (Fig. 7E)and did not modify ACh-dependent H2O2 production (Fig. 7F)

in the mouse aorta. Selective inhibition of nNOS withL-ArgNO2-L-Dbu (1 �mol/l) further decreased the relaxantresponse in aortas of eNOS knockdown animals (Fig. 7E).

DISCUSSION

There are three major findings reported in the present study:1) H2O2 accounts for a substantial portion of ACh-inducedrelaxation in the mouse aorta; 2) nNOS is expressed in thevascular endothelium, contributes to ACh-induced relaxation,

Fig. 6. A: Western blot analysis of nNOS. This gel is representative of 3experiments with similar results. Results were normalized by GAPDH contentin samples. B–E: immunolocalization of nNOS. Immunohistochemical micro-graphs of aorta labeled with polyclonal nNOS antibody are shown. B andC: incubation of aorta sections with polyclonal anti-nNOS demonstrates nNOSlocalization in the vascular endothelium. In D and E, aortas were labeled onlywith anti-rabbit peroxidase. Arrows indicate the endothelium. N, nucleus.***P � 0.001.

H2507nNOS-DERIVED H2O2 IS AN EDRF IN MOUSE AORTA

AJP-Heart Circ Physiol • VOL 295 • DECEMBER 2008 • www.ajpheart.org

on Decem

ber 9, 2008 ajpheart.physiology.org

Dow

nloaded from

and is a main source of H2O2; and 3) nonspecific blockade ofNOS greatly decreases the production of both NO and H2O2

and abolishes ACh-induced vasorelaxation. Hence the effectsof NOS inhibitors in the mouse aorta cannot be solely ascribedto the inhibition of NO production.

It is well established that NO is the main EDRF in largeconductance vessels (42). This statement is fundamentallybased on the observation that endothelium-mediated vasore-laxation is blocked in the presence of the nonspecific blockadeof NOS (27, 56). Consistent with these data, we found that inthe mouse aorta ACh-induced relaxation was strongly inhibitedin the presence of L-NAME or L-NNA and abolished after theremoval of the endothelium. Using two distinct methods, we

showed that ACh induces the production of H2O2. This in-crease in H2O2 production was prevented in the absence ofendothelium and catalase inhibited, suggesting that the mainsource of H2O2 was the endothelial cell. This hypothesis wasfurther confirmed by our fluorescence experiments directlyshowing H2O2 production by endothelial cells. Our results alsoshow that exogenous H2O2 has a direct vasorelaxant effect inendothelium-denuded aorta, and endogenous H2O2 plays a rolein mediating ACh-induced vasorelaxation in the mouse aorta.The lack of effects of catalase on the vasodilator effect of NOdonors suggests that the enzyme was not having a direct effecton NO-induced vasorelaxation. These results are in accordancewith other studies showing that exogenous H2O2 produced a

Fig. 7. Effect of antisense oligodeoxynucle-otides (ODNs) knockdown (AS-ODNs) ofnNOS and eNOS on ACh-induced relaxationand H2O2 production. A and B: Western blotanalysis of nNOS AS-ODNs (A) and eNOSAS-ODNs (B) compared with the mismatchODNs (MM-ODNs). This gel is representa-tive of 3 experiments with similar results.Results were normalized by GAPDH contentin samples. C and D: relaxation mediated byACh in AS-nNOS (C) and AS-eNOS (D)knockdown mouse aorta compared with theMM-ODNs. Notice that inhibition of nNOSwith L-ArgNO2-L-Dbu (1 �mol/l) further in-hibited relaxation to ACh in eNOS (D) but notin nNOS (C) aortas. E and F: H2O2 produc-tion mediated by ACh in aortas from nNOS(E) and eNOS (F) knockdown animals (n �5–8). ***P � 0.001.

H2508 nNOS-DERIVED H2O2 IS AN EDRF IN MOUSE AORTA

AJP-Heart Circ Physiol • VOL 295 • DECEMBER 2008 • www.ajpheart.org

on Decem

ber 9, 2008 ajpheart.physiology.org

Dow

nloaded from

vasodilator effect in cerebral and skeletal muscle arteries (13).It may be argued that the concentration of H2O2 necessary toinduce vasodilation is relatively high. The functionality of ourarteries was unaffected with concentrations of H2O2 up to 1mmol/l (data not shown). Moreover, an interaction betweenexogenous H2O2 and endogenous peroxidases may affect thereal H2O2 concentration in smooth muscles, the site of actionof this vasorelaxant agent. This hypothesis is consistent withour result showing that ATZ improves vasorelaxation inducedby exogenous H2O2. Therefore, our results are consistent withan important role for H2O2 in mediating ACh-induced relax-ation in the mouse aorta.

An interesting finding was the decrease of H2O2 productionwhen aortic rings were treated with L-NAME and L-NNA, butnot by D-NAME. The latter results are consistent with animportant role of NOS in the production of H2O2. Indeed,endothelial H2O2 can be originated from NOS and otheroxidases in resistance vessels (for review, see Ref. 51). It islargely accepted that eNOS is the main isoform of NOS presentin the vascular endothelium (21, 32). nNOS was also reportedto be present in the cardiovascular system (1, 6, 7, 10, 16, 23,28, 40, 53, 60), but relatively little is known about the rolenNOS plays in cardiovascular homeostasis. Antihypertensiveactions have been attributed to nNOS, and selective inhibitorsof this isoform have been reported to attenuate flow-inducedvasodilatation in eNOS�/� mice (23). ACh-induced vasorelax-ation is reduced in aorta of nNOS�/� mice (40). In agreementwith the latter study, we showed nNOS expression on vascularendothelium. Moreover, L-ArgNO2-L-Dbu and TRIM, two se-lective inhibitors of nNOS, greatly reduced vasorelaxationmediated by ACh with a good correlation with the inhibitionfound with catalase. TRIM only partially decreased NO pro-duction, whereas L-NAME and L-NNA almost completelyabolished NO increases after the stimulation of the vessels withACh. Importantly, both L-ArgNO2-L-Dbu and TRIM and non-selective inhibitors strongly decreased ACh-mediated produc-tion of H2O2. Thus nNOS is expressed on the vascular endo-thelium of the mouse aorta and contributes to H2O2 productionand to endothelium- and H2O2-dependent vasodilatation.

Antisense knockdown of nNOS decreased both relaxationand H2O2 production induced by ACh in the same proportionas catalase and selective inhibition of nNOS, suggesting thatH2O2 is the main mediator of nNOS-mediated relaxation.Antisense knockdown of eNOS decreased ACh-induced relax-ation in the same extent as nNOS knockdown but did notchange the production of H2O2 mediated by ACh. The residualrelaxation found in aorta from eNOS knockdown animals wasmainly mediated by nNOS since selective inhibition of nNOSwith L-ArgNO2-L-Dbu further decreased the relaxant response.Together, these results suggest that eNOS, nNOS, and NO andH2O2 importantly contribute to ACh-mediated relaxation in themouse aorta.

In contrast to our findings, a previous study (39) has reportednegative findings with regard to expression of nNOS in endo-thelium of wild-type mice. Possible reasons for this discrep-ancy may be related to the type of vessels used and agedifferences and even the methodology for evaluating the ex-pression of nNOS. Although we used aorta from 12- to 14-wk-old C57BL/6J mice, they used the carotid artery from 8- to10-wk-old C57BL/6 mice. Further experiments are necessary

to clarify these issues, but our results clearly show the expres-sion of nNOS in the aorta of C57BL/6J mice.

Endothelial tissues synthesize and release several relaxingfactors, including NO, EDHF, and prostacyclin (PGI2). Theresponse attributed to EDHF is the endothelium-dependentrelaxation after the blockade of the synthesis of NO andvasodilator prostaglandins (56). In resistance vessels H2O2 wasproposed to be an EDHF originated from NOS (34, 35). Herewe found that the endothelium-derived relaxant response toH2O2 is also blocked by NOS inhibition in a conductancevessel. Current unpublished data from our laboratory show thatH2O2 hyperpolarizes smooth muscle cells from the mouseaorta. In this regard, H2O2 can be considered an EDHF in themouse aorta. Hence an important finding of our work is the factthat NOS inhibitors will prevent not only NO production butalso the production of H2O2. Since both mediators are capableof relaxing vessels and derive from the same enzyme, ourresults suggest that the use of NOS inhibitors may not besufficient to account for the participation of NO in mediatingvasorelaxation in many circumstances. Such possibility clearlydeserves further investigation since it impacts the way weroutinely evaluate the role of NO/NOS in biological systems.

In conclusion, our data are first to provide unequivocalevidence that nNOS-derived H2O2 is an EDRF and accountsfor a substantial portion of ACh-induced vasorelaxation in themouse aorta. By inference, the use of nonselective inhibitors ofNOS is no longer enough to guarantee the exclusive participa-tion of NO in relaxations induced by ACh in murine arteries.

ACKNOWLEDGMENTS

We thank CNPq/Brazil (Conselho Nacional de Desenvolvimento Cientıficoe Tecnologico) and FAPEMIG (Fundacao de Apoio a Pesquisa do Estado deMinas Gerais) for financial support. L. S. A. Capettini thanks CAPES/Brazil(Coordenacao de Aperfeicoamento de Pessoal de Nıvel Superior) for financialsupport.

REFERENCES

1. Bachetti T, Comini L, Curello S, Bastianon D, Palmieri M, BrescianiG, Callea F, Ferrari R. Co-expression and modulation of neuronal andendothelial nitric oxide synthase in human endothelial cells. J Mol CellCardiol 37: 939–945, 2004.

2. Barlow RS, El-Mowafy AM, White RE. H2O2 open BKCa channels viathe PLA2-arachidonic acid signaling cascade in coronary artery smoothmuscle. Am J Physiol Heart Circ Physiol 279: H457–H483, 2000.

3. Barlow RS, White RE. Hydrogen peroxide relaxes porcine coronaryarteries by stimulating BKCa channel activity. Am J Physiol Heart CircPhysiol 275: H1283–H1289, 1998.

4. Bayliak M, Gospodaryov D, Semchyshyn H, Lushchak V. Inhibition ofcatalase by aminotriazole in vivo results in reduction of glucose-6-phosphate dehydrogenase activity in Saccharomyces cerevisiae cells. Bio-chemistry (Mosc) 73: 420–426, 2008.

5. Beny JL, von der Weid PY. Hydrogen peroxide: an endogenous smoothmuscle cell hyperpolarizing factor. Biochem Biophys Res Commun 176:378–384, 1991.

6. Boulanger CM, Heymes C, Benessiano J, Geske RS, Levy BI, Van-houtte PM. Neuronal nitric oxide synthase is expressed in rat vascularsmooth muscle cells: activation by angiotensin II in hypertension. Circ Res83: 1271–1278, 1998.

7. Brophy CM, Knoepp L, Xin J, Pollock JS. Functional expression ofNOS1 in vascular smooth muscle. Am J Physiol Heart Circ Physiol 278:H991–H997, 2000.

8. Bychkov R, Pieper K, Ried C, Milosheva M, Bychkov E, Luft FC,Haller H. Hydrogen peroxide, potassium currents, and membranepotential in human endothelial cells. Circulation 99: 1719 –1725, 1999.

9. Chen X, Patel K, Connors SG, Mendonca M, Welch WJ, WilcoxCS. Acute antihypertensive action of Tempol in the spontaneously

H2509nNOS-DERIVED H2O2 IS AN EDRF IN MOUSE AORTA

AJP-Heart Circ Physiol • VOL 295 • DECEMBER 2008 • www.ajpheart.org

on Decem

ber 9, 2008 ajpheart.physiology.org

Dow

nloaded from

hypertensive rat. Am J Physiol Heart Circ Physiol 293: H3246 –H3253,2007.

10. Danson EJ, Choate JK, Paterson DJ. Cardiac nitric oxide: emerging rolefor nNOS in regulating physiological function. Pharmacol Ther 106:57–74, 2004.

11. Dayal D, Martin SM, Limoli CL, Spitz DR. Hydrogen peroxide medi-ates the radiation-induced mutator phenotype in mammalian cells. Bio-chem J 413: 185–191, 2008.

12. Dick JM, Van Molle W, Libert C, Lefebvre RA. Antisense knockdownof inducible nitric oxide synthase inhibits the relaxant effect of VIP inisolated smooth muscle cells of the mouse gastric fundus. Br J Pharmacol134: 425–433, 2001.

13. Drouin A, Thorin-Trescases N, Hamel E, Falck JR, Thorin E. Endo-thelial nitric oxide synthase leads to dilatory H2O2 production in mousecerebral arteries. Cardiovasc Res 73: 73–81, 2007.

14. Edwards DH, Li Y, Griffith TM. Hydrogen peroxide potentiates theEDHF phenomenon by promoting endothelial Ca2� mobilization. Arte-rioscler Thromb Vasc Biol 28: 1774–1781, 2008.

15. Feletou M, Vanhoutte PM. Endothelium-derived hyperpolarizing fac-tor: where are we now? Arterioscler Thromb Vasc Biol 26: 1215–1225,2006.

16. Fleming I. Brain in the brawn: the neuronal nitric oxide synthase as aregulator of myogenic tone. Circ Res 93: 586–588, 2003.

17. Frandsen U, Lopez-Figueroa M, Hellsten Y. Localization of nitric oxidesynthase in human skeletal muscle. Biochem Biophys Res Commun 227:88–93, 1996.

18. Garland CJ, Plane F, Kemp BK, Cocks TM. Endothelium-dependenthyperpolarization: a role in the control of vascular tone. Trends PharmacolSci 16: 23–30, 1995.

19. Hagioka S, Takeda Y, Zhang S, Sato T, Morita K. Effects of7-nitroindazole and N-nitro-L-arginine methyl ester on changes incerebral blood flow and nitric oxide production preceding developmentof hyperbaric oxygen-induced seizures in rats. Neurosci Lett 382:206 –210, 2005.

20. Handy RLC, Moore PK. Mechanism of the inhibition of neuronal nitricoxide synthase by 1-(2-Trifluoromethylphenyl) imidazole (TRIM). LifeSci 60: 389–494, 1997.

21. Harrison DG. Cellular and molecular mechanisms of endothelial celldysfunction. J Clin Invest 100: 2153–2157, 1997.

22. Heinzel B, John M, Klatt P, Bohme E, Mayer B. Ca2�/calmodulin-dependent formation of hydrogen peroxide by brain nitric oxide synthase.Biochem J 281: 627–630, 1992.

23. Huang A, Sun D, Shesely EG, Levee EM, Koller A, Kaley G. NeuronalNOS-dependent dilation to flow in coronary arteries of male eNOS-KOmice. Am J Physiol Heart Circ Physiol 282: H429–H436, 2002.

24. Huang H, Martasek P, Roman LJ, Masters BSS, Silverman RB.N�-nitroarginine-containing dipeptide amides. Potent and highly selectiveinhibitors of neuronal nitric oxide synthase. J Med Chem 42: 3147–3153,1999.

25. Iida Y, Katusic ZS. Mechanisms of cerebral arterial relaxations tohydrogen peroxide. Stroke 31: 2224–2230, 2000.

26. Ji G, O�Brien CD, Feldman M, Manevich Y, Lim P, Sun S, AlbeldaSM, Kotlikoff M. PECAM-1 (CD-31) regulates a hydrogen peroxide-activated nonselective cation channel in endothelial cells. J Cell Biol 157:173–184, 2002.

27. Jiang MH, Kaku T, Hada J, Hayashi Y. Different effects of eNOS andnNOS inhibition on transient forebrain ischemia. Brain Res 946: 139–147,2002.

28. Kurihara N, Alfie ME, Sigmon DH, Rhaleb NE, Shesely EG, CarreteroOA. Role of nNOS in blood pressure regulation in eNOS null mutant mice.Hypertension 32: 856–861, 1998.

29. Lauton-Santos S, Guatimosim S, Castro CH, Oliveira FA, AlmeidaAP, Dias-Peixoto MF, Gomes MA, Pessoa P, Pesquero JL, PesqueroJB, Bader M, Cruz JS. Kinin B1 receptor participates in the control ofcardiac function in mice. Life Sci 81: 814–822, 2007.

30. Lemos VS, Silva DM, Walther T, Alenina N, Bader M, Santos RA. Theendothelium-dependent vasodilator effect of the nonpeptide Ang(1-7)mimic AVE 0991 is abolished in the aorta of mas-knockout mice.J Cardiovasc Pharmacol 46: 274–279, 2005.

31. Li YF, Wang Y, Channon KM, Schultz HD, Zucker IH, Patel KP.Manipulation of neuronal nitric oxide synthase within the paraventricularnucleus using adenovirus and antisense technology. Methods Mol Med112: 59–79, 2004.

32. Luhrs H, Papadopoulos T, Schimidt H, Menzel T. Type I nitric oxidesynthase in the human lung is predominantly expressed in capillaryendothelial cells. Respir Physiol 129: 367–374, 2002.

33. Matoba T, Shimokawa H, Kubota H, Morikawa K, Fujiki T, KunihiroI, Mukai Y, Hirakawa Y, Takeshita A. Hydrogen peroxide is anendothelium-derived hyperpolarizing factor in human mesenteric arteries.Biochem Biophys Res Commun 290: 909–913, 2002.

34. Matoba T, Shimokawa H, Nakashima M, Hirakava Y, Mukai Y,Hirano K, Kanaide H, Takeshita A. Hydrogen peroxide is an endothe-lium-derived hyperpolarizing factor in mice. J Clin Invest 106: 1521–1530, 2000.

35. Matoba T, Shimokawa H. Hydrogen peroxide is an endothelium-derived hyperpolarizing factor in animals and humans. J Pharm Sci 92:1– 6, 2003.

36. Middendorff R, Muller D, Wichers S, Holstein A, Davidoff M. Evi-dence for production and functional activity of nitric oxide in seminiferoustubules and blood vessels of the human testis. J Clin Endocrinol Metab 82:4154–4161, 1997.

37. Misko TP, Schilling RJ, Salvemini D, Moore WM, Currie MG. Afluorometric assay for the measurement of nitrite in biological samples.Anal Biochem 214: 11–16, 1993.

38. Miura H, Bosnjak JJ, Ning G, Saito T, Miura M, Gutterman DD. Rolefor hydrogen peroxide in flow-induced dilation of human coronary arte-rioles. Circ Res 92: e31–e40, 2003.

39. Morishita T, Tsutsui M, Shimokawa H, Horiuchi M, Tanimoto A,Suda O, Tasaki H, Huang PL, Sasaguri Y, Yanagihara N, NakashimaY. Vasculoprotective roles of neuronal nitric oxide synthase. FASEB J 16:1994–1996, 2002.

40. Nangle MR, Cotter MA, Cameron NE. An in vitro investigation of aortaand corpus cavernosum from eNOS and nNOS gene-deficient mice. EurJ Appl Physiol 448: 139–145, 2004.

41. Nourooz-Zadeh J, Tajaddini-Sarmadi J, Wolff SP. Measurement ofplasma hydroperoxide concentrations by the ferrous oxidation-xylenolorange assay in conjunction with triphenylphosphine. Anal Biochem 220:403–409, 1994.

42. Pohl U, De Wit C, Gloe T. Large arterioles in the control of blood flow:role of endothelium-dependent dilation. Acta Physiol Scand 168: 505–510,2000.

43. Putnam CD, Arvai AS, Bourne Y, Tainer JA. Active and inhibitedhuman catalase structures: ligand and NADPH binding and catalyticmechanism. J Mol Biol 296: 295–309, 2000.

44. Rhee SG, Yang KS, Kang SW, Woo HA, Chang TS. Controlledelimination of intracellular H2O2: regulation of peroxiredoxin, catalase,and glutathione peroxidase via post-translational modification. AntioxidRedox Signal 7: 619–626, 2005.

45. Rosen GM, Tsai P, Weaver J, Porasuphatana S, Roman LJ, StarkovAA, Fiskum G, Pou S. The role of tetrahydrobiopterin in the regulationof neuronal nitric oxide synthase-generated superoxide. J Biol Chem 277:40275–40280, 2002.

46. Rosenblum WI, Murata S. Antisense evidence for two functionallyactive forms of nitric oxide synthase in brain microvascular endothelium.Biochem Biophys Res Commun 224: 535–543, 1996.

47. Salvi M, Battaglia V, Brunati AM, La Rocca N, Tibaldi E, PietrangeliP, Marcocci L, Mondov� B, Rossi CA, Toninello A. Catalase takes partin rat liver mitochondria oxidative stress defense. J Biol Chem 282:24407–24415, 2007.

48. Santos RA, Haibara AS, Campagnole-Santos MJ, Simoes e SilvaAC, Paula RD, Pinheiro SV, Leite MF, Lemos VS, Silva DM,Guerra MT, Khosla MC. Characterization of a new selective antag-onist for angiotensin-(1-7), D-pro7-angiotensin-(1-7). Hypertension41: 737–743, 2003.

49. Schwarz PM, Kleinert H, Forstermann U. Potential functional signifi-cance of brain-type and muscle-type nitric oxide synthase I expressed inadventitia and media of rat aorta. Arterioscler Thromb Vasc Biol 19:2584–2590, 1999.

50. Segal S, Bett S, Sessa W. Codistribution of NOS and caveolin throughoutperipheral vasculature and skeletal muscle hamsters. Am J Physiol HeartCirc Physiol 277: H1167–H1177, 1999.

51. Shimokawa H, Matoba T. Hydrogen peroxide as an endothelium-derivedhyperpolarizing factor. Pharmacol Res 49: 543–549, 2004.

52. Suvorava T, Lauer N, Kumpf S, Jacob R, Meyer W, Kojda G.Endogenous vascular hydrogen peroxide regulates arteriolar tension invivo. Circulation 112: 2487–2495, 2005.

H2510 nNOS-DERIVED H2O2 IS AN EDRF IN MOUSE AORTA

AJP-Heart Circ Physiol • VOL 295 • DECEMBER 2008 • www.ajpheart.org

on Decem

ber 9, 2008 ajpheart.physiology.org

Dow

nloaded from

53. Tambascia RC, Fonseca PM, Corat PDC, Moreno H Jr, Saad MJA,Franchini KG. Expression and distribution of NOS1 and NOS3 in themyocardium of angiotensin II-infused rats. Hypertension 37: 1423–1428,2001.

54. Tarpey MM, Fridovich I. Methods of detection of vascular reactivespecies: nitric oxide, superoxide, hydrogen peroxide, and peroxynitrite.Circ Res 89: 224–236, 2001.

55. Tsai P, Weaver J, Cao GL, Pou S, Roman LJ, Starkov AA, RosenGM. L-arginine regulates neuronal nitric oxide synthase production ofsuperoxide and hydrogen peroxide. Biochem Pharmacol 69: 971–979,2005.

56. Vanhoutte PM. Endothelium-dependent hyperpolarizations: the history.Pharmacol Res 49: 503–508, 2004.

57. Xu K, Huso D, Dawson T, Bredt D, Becker L. Nitric oxide synthase incardiac sarcoplasmic reticulum. Proc Natl Acad Sci USA 96: 657–662, 1999.

58. Yada T, Shimokawa H, Hiramatsu O, Katita T, Shigeto F, Goto M,Ogasawara Y, Kajiya F. Hydrogen peroxide, an endogenous endotheli-um-derived hyperpolarizing factor, plays an important role in coronaryautoregulation in vivo. Circulation 107: 1040–1045, 2003.

59. Yang ES, Park JW. Antioxidant enzyme inhibitors enhance peroxyni-trite-induced cell death in U937 cells. Mol Cell Biochem 301: 61–68,2007.

60. Yang XP, Liu YH, Shesely EG, Bulagannawar M, Liu F, CarreteroOA. Endothelial nitric oxide gene knockout mice: cardiac phenotypes andthe effect of angiotensin-converting enzyme inhibitor on myocardialischemia/reperfusion injury. Hypertension 34: 24–30, 1999.

61. Zamocky M, Koller F. Understanding the structure and function ofcatalases: clues from molecular evolution and in vitro mutagenesis. ProgBiophys Mol Biol 72: 19–66, 1999.

H2511nNOS-DERIVED H2O2 IS AN EDRF IN MOUSE AORTA

AJP-Heart Circ Physiol • VOL 295 • DECEMBER 2008 • www.ajpheart.org

on Decem

ber 9, 2008 ajpheart.physiology.org

Dow

nloaded from