ORIGINAL ARTICLE 710J o u r n a l o fJ o u r n a l o f

CellularPhysiologyCellularPhysiology

Neural Stem Cells Modified to

Express BDNF AntagonizeTrimethyltin-InducedNeurotoxicity Through PI3K/Aktand MAP Kinase Pathways

PATRIZIA CASALBORE,1 ILARIA BARONE,2 ARMANDO FELSANI,1 IGEA D’AGNANO,1

FABRIZIO MICHETTI,3 GIULIO MAIRA,4 AND CARLO CENCIARELLI1*1Institute of Neurobiology and Molecular Medicine, National Research Council, Rome, Italy2Institute of Neurosciences, National Research Council, Pisa, Italy3Institute of Anatomy and Cell Biology-Catholic University, Rome, Italy4Institute of Neurosurgery, Catholic University, Rome, Italy

In vitro expansion of neural stem cells (NSC) lentivirally transduced with human BDNF may serve as better cellular source for replacingdegenerating neurons in disease, trauma and toxic insults. In this study, we evaluate the functional role of forced BDNF expression bymeans of NSC (M3GFP-BDNF) obtained from cerebral cortex of 1-day-old mice respect to NSC-control (M3GFP). We find that M3GFP-BDNF induced to differentiate significantly accumulate BDNF and undergone to high potassium-mediated depolarization, show rapidBDNF recycle and activation of Trk receptors signaling. Differentiated M3GFP-BDNF exhibit neurons and oligodendrocytes withextended processes although quantitative analyses of NSC-derived cell lineages show none statistical significance between both cellpopulations. Moreover, those cells show a significant induction of neuronal and oligodendroglial markers by RT-PCR and Western blotrespect to M3GFP, such as bIII-Tubulin, microtubule associated protein 2 (MAP2), neurofilaments heavy (NF-H), oligodendroglial myelinglycoprotein (OMG) and some molecules involved in glutamatergic synapse maturation, such as receptors tyrosine kinases (TRKs), post-synaptic density (PSD-95) and N-methyl-D-aspartate receptors 2 A/B (NMDA2A/B). After treatment with the neurotoxicant trimethyltin(TMT), differentiated M3GFP-BDNF exhibit an attenuation of cellular damage which correlates with a significant activation of MAPK andPI3K/Akt signaling and delayed activation of death signals, while on M3GFP, TMT induces a significant reduction of cell survival, neuronaldifferentiation and concomitant earlier activation of cleaved caspase-3. We demonstrate that overexpression of BDNF firmly regulate cellsurvival and differentiation of NSC and protects differentiated NSC against TMT-induced neurotoxicity through the PI3K/Akt and MAPKsignaling pathways.

J. Cell. Physiol. 224: 710–721, 2010. � 2010 Wiley-Liss, Inc.

Additional Supporting Information may be found in the onlineversion of this article.

Contract grant sponsor: Catholic University of Rome, Institute ofNeurosurgery and Human Anatomy and Cell Biology-Rome.Contract grant sponsor: Association for Advanced NeurosurgeryTechnologies (ATENA Onlus-Rome).

*Correspondence to: Carlo Cenciarelli, Institute of Neurobiologyand Molecular Medicine, National Research Council, Via del Fossodi Fiorano, 64/65-00143 Rome, Italy.E-mail: carlo.cenciarelli@inmm.cnr.it

Received 14 January 2010; Accepted 12 March 2010

Published online in Wiley InterScience(www.interscience.wiley.com.), 28 April 2010.DOI: 10.1002/jcp.22170

Neural stem cells are clonogenic cells endowed with self-renewal and multipotency, able to generate neurons, astrocytesand oligodendrocytes. Now today the major plausiblehypothesis suggests a glial origin of NSC in the neurogenic nichesof the subgranular zone of hippocampus (SGZ) and thesubventricular zone of lateral ventricles (SVZ) (Gage, 2000).Recently, the circumventricular organs represent novel sites forthe continued generation of neurons and glia in the adult brain(Bennett et al., 2009). Following to brain traumatic injury newneurons formation from SVZ migrate through the rostralmigratory stream in proximity of sites of lesion. Such as eventsmay be regarded as attempts of NSC to compensate neuronalloss, but scarcely differentiate and functionally integrate intocorrect neural circuitry (Taupin and Gage, 2002). In this respect,the knowledge of biological processes induced in NSC tocounteract lesions appears to be of interest in order tounderstand more general injury-induced brain processes (Paganiet al., 2008; Nguyen et al., 2009). The organotin compoundtrimethyltin chloride (TMT), selectively induces neuronaldamage in both human and rodent CNS. The effects of thisneurotoxin were significant in the pyramidal cells of the CA1 andCA3 and GABA interneurons of the rat hippocampus. TMT-induced neurodegeneration involved also the pyriform cortexand amygdaloid nucleus (Brown et al., 1984). TMT-treatedanimals exhibit cognitive deficits and behavioral alterations, thusTMT has also been regarded as a potential tool for the study ofmemory dysfunction in animal models, including Alzheimer’sdisease (Geloso et al., 1997). The molecular mechanisms of

� 2 0 1 0 W I L E Y - L I S S , I N C .

neuronal death induced by TMT remain unclear. One hypothesisis that TMT compromises the ability of astrocytes to maintain atrans-membrane Kþ gradient and induces alterations of uptakeand efflux of glutamate and aspartate (Aschner et al., 1992). Theprolonged presence of excitatory amino acids in theextracellular fluid elicits an increase of intracellular calcium withsevere cytotoxic effectson neurons (Piacentini et al., 2008). PKCactivation as well as inhibition of oxidative phosphorylationcontribute to cytotoxicity by TMT (Snoeij et al., 1987). We alsoreported cycloxygenase-2 and caspase-3 expression intrimethyltin-induced apoptosis in the mouse hippocampus

B D N F O V E R E X P R E S S I O N A N T A G O N I Z E T M T - I N D U C E D A P O P T O S I S 711

(Geloso et al., 2002). We have reported that only 1% oftransplanted rat fetal NSC survive and differentiate into neuronsand astrocytes, suggesting that the TMT-induced modification ofthe local microenvironment, may influence the fate oftransplanted cells, as shown for other models of brain injury(Geloso et al., 2007).

Neurotrophins (NT) were discovered as fundamentalregulators of development, growth and differentiation ofdifferent neuronal populations in the central and peripheralnervous system (Hamburger and Levi-Montalcini, 1949).The actions of NT are dictated by two classes of cell surfacereceptors: Trk receptors tyrosine kinases and the p75neurotrophin receptor (p75NTR), a member of the tumornecrosis factor (Nykjaer et al., 2005). The neurotrophin BDNFacts in autocrine and paracrine manner and is produced in theentorhinal cortex throughout life. After binding, NT and theirreceptors undergo internalization and retrogradely transportedfrom axon terminals to cell bodies. BDNF serve also asanterophin which is consistent with presynaptic synthesis,vescicular store, release and modulatory actions on synaptictransmission (Stoop and Poo, 1996; Nawa and Takei, 2001).Engagement of Trk receptors results in increases of cyclic AMPresponse element-binding protein (CREB) and extracellularsignal-related kinase 5 activities (Erk5), as well asphosphatidylinositol 3-kinase (PI3K) and phospholipaseC-gamma 1 (PLC-g1) phosphorylation (Coffer et al., 1998;Watson et al., 1999; Canossa et al., 2001). Several groupsconcurrently identified Akt1 as a downstream target of PI3Kactivation. Phosphorylated Akt1 positively regulates CREB andNF-kB, which mediate the expression of several pro-survivalgenes (Cardone et al., 1998). Besides his trophic effects on targetneurons, BDNF appears to be part of a general mechanism foractivity-dependent modification of synapses in the developingand adult nervous system (Yano and Chao, 2004) as well infacilitating hippocampal and cortical long-term potentiation(Korte et al., 1995). Regulated BDNF release can be inducedeither by high Kþ or high frequency stimulation of glutamatergicsynapses (Canossa et al., 1997; Hartmann et al., 2001).Alterations in BDNF synthesis and secretion has been observedin some neurodegenerative diseases: Alzheimer’s, Parkinson’s,and Huntington’s diseases (Phillips et al., 1991; Siegel andChauhan, 2000; Murer et al., 2001; Nagahara et al., 2009;Zuccato and Cattaneo, 2009). In the present study, wegenerated NSC genetically modified to overexpress BDNFwhich may serve as better and unlimited biological source forreplacing damaged neurons by insults or neurodegenerativediseases. BDNF-secreting neural stem cells showed intracellularBDNF storage and when exposed to depolarization conditions,it was rapidly recycled and concomitantly Trk signalingincreased. BDNF overexpression induced up-regulation ofneuronal (bIII-Tub, MAP2, NF-H) and oligodendroglial (OMG)differentiation markers and under neuronal differentiation (ND)medium, M3GFP-BDNF revealed the presence of neuronsNMDA2A/B-positives, suggesting a role in the maturation ofglutamatergic synapses. Interestingly, BDNF secreting-NSCexposed to TMT showed a significant resistance against theneurotoxin-induced apoptosis, accompanied with increase inAkt1 and Erk1/2 phosphorylation and a significant minoractivation of caspase-3 respect to control-NSC. Our dataprovide the first evidence that BDNF ameliorates the recoveryof NSC from TMT insult, offering information possibly useful toelucidate the mechanisms of neural cell reaction to injury.

Materials and MethodsCell culture and NSC depolarization

NSC-derived primary neurospheres were obtained fromdissociation of cerebral cortex from CD1 mice at postnatal day 1 as

JOURNAL OF CELLULAR PHYSIOLOGY

reported previously (D’Ascenzo et al., 2006). Single cells wereseeded in 75 cm2 cell culture flask in growth medium which brieflyconsist of DMEM/F12 (1:1) serum-free (Invitrogen, Carlsbad, CA)supplemented with human recombinant EGF (20 ng/ml;PeproTech, Rocky Hill, NJ), human recombinant bFGF (10 ng/ml;PeproTech), L-glutamine (2 mM), glucose (0.6%), putrescine(9.6mg/ml), progesterone (0.025 mg/ml), sodium selenite (5.2 ng/ml), insulin (0.025 mg/ml), apo-transferrin sodium salt (0.1 mg/ml),sodium bicarbonate (3 mM), HEPES (5 mM) (all from Sigma–Aldrich, St. Louis, MO). Neurospheres were split at low densityevery 3–4 days with Accutase (Millipore, Temecula, CA). Primarycultures were clonally diluted and plated one-two cells per mini-well into 96-well plates to assess new neurospheres generation.We picked up and expanded six clones and fully characterized onecell line for all of experiments. We have noted a clonogenicefficiency of 4–5% and cell ability to be cultured up to fortiethpassage. For in vitro differentiation cells were plated on matrigel-coated chamber slides and 100 mm dishes under either basaldifferentiation conditions (BD) [culture medium containing 1% fetalcalf serum (FCS-Hyclone)] or neuronal differentiation conditions(ND) which contains 1% FCS along with 2mM all-trans-retinoic acid(ATRA) and 100mM cyclic AMP (Sigma–Aldrich). Cells were left indifferentiation media for varying time periods, up to 5 days in vitro(DIV) before processing. All experiments were done at earlypassages. The depolarization experiments for ELISA assay wereconducted on NSC differentiated in BD up to 3 days and thenstimulated for 10 sec, 5 and 15 min with a depolarizing solution (inmM: NaCl 98; KCl 170; HEPES 20; NaHCO3 3.6; CaCl2 2.3; MgCl21; glucose 5.6, all from Sigma–Aldrich) to obtain 50 mM Kþ finalconcentration. The experimental conditions of depolarization forWestern blot analysis were modified with a short exposure to highKþ (10 sec), followed by harvesting cell pellets at different timepoints (15, 60, and 120 min).

Lentivirus construction

pLentiTrident1, a variant of third generation of multigenic lentiviralvectors, was purchased by Cistronics Cell Technology GmbH(Zurich, Switzerland). NSC expressing GFP (M3GFP) or GFP-BDNF (M3GFP-BDNF) were obtained by infection of nativeNSC with pLentiTrident1-CMV::GFP or pLentiTrident1-CMV::GFP::2Ires::hBDNF, whose were constructed as follow: thecDNA fragment coding GFP was derived from pEGFP-C1purchased by Clontech (Gene Bank accession number U55763)using PCR with high fidelity DNA Polymerase (TripleMaster PCRsystem, Eppendorf). Forward and reverse primer sequences(50–30) containing Nhe1 and Spe1 sites were respectively:AAAGCTAGCACTAGTATGGTGAGCAAGGGCGAGGAG andCCCGCTAGCACTAGTTTATCTAGATCCGGTGGATCC. PCR productwas digested with Nhe1, and then ligated to pLentiTrident1.pLentiTrident1-CMV::GFP::2Ires::hBDNF was constructed asfollow: cDNA fragment coding the human BDNF was derivedfrom pcDNA3-1 hygro-hBDNF (Gene Bank accession numberNM_001709). Forward primer sequence containing Pac1–Not1sites and the Kozak sequence was the following:CCCTTAATTAAGCGGCCGCGCCACCATGACCATCC-TTTTCCTTACT, the reverse oligonucleotide containingSwa1–Cla1 sites (50–30) was as follow: CCCCCCATTTAAATATCGA-TCTATCTTCCCCTTTTAATGGT. The PCR product, digested firstwith Pac1 and Swa1 enzymes and the ligated downstream tosecond IRES of the lentiviral vector. The BDNF and GFP PCRproducts were successively sequenced to verify accuracy (PrimmBiotech, Milano, Italy). 293T cells in log-phase growth weretransiently transfected with either pLentiTrident1-CMV::GFP orpLentiTrident1-CMV::GFP::2Ires::hBDNF along with expressionplasmids package (Invitrogen Packaging Plasmids, Carlsbad, CA) byusing standard LipofectAmine Reagent (Invitrogen). Mediacontaining virions were collected 3 days after transfection and usedto infect NSC.

712 C A S A L B O R E E T A L .

Protein extracts and Western blots

NSC differentiated (2–3� 106 cells) in both BD and ND wereharvested after 5 DIV, lysed and sonicated with two pulses of 5 secwith 50% of amplitude (Sonics and Materials, Newtown, CT) in asmall volume of detergent lysis buffer containing: 1% NP-40, 0.01%SDS, 20 mM Tris–HCl pH 7.4, 300 mM NaCl, 1 mM EGTA, 1 mMEDTA, 0.1 mM DTT, 1 mM Na3VO4 and protease inhibitorscocktail (Sigma–Aldrich). Equal amount (30–50mg) of total proteinextracts, determined using Bio-Rad protein Assay (Bio-Rad,Munchen, Germany), were loaded on NuPAGE Bis-Tris gels(Invitrogen), transferred on Hybond-C Extra membrane(Amersham Biosciences, GE Healthcare Life Science,Buckinghamshire, UK) and immunoblotted using the followingprimary antibodies: rabbit anti-BDNF (Chemicon, Temecula, CA),mouse anti-GFP (Clontech Laboratories, Montain View, CA),mouse anti-Trk (B3; Santa Cruz Biotechnology, Santa Cruz, CA),rabbit anti-p-Trk (Y490; Cell Signaling, Beverly-MA), rabbit anti-p-Trk (Y706/707; Cell Signaling, MA), rabbit anti-Erk1/2 (Chemicon),rabbit anti-p-Erk (S202/Y204; Chemicon), rabbit anti-Akt1(Calbiochem-Merck Chemicals, Nottingham, UK), rabbit anti-p-Akt1 (S473; Calbiochem), rabbit anti-p-PLCg1 (Y783; CellSignaling), rabbit anti-p-PKC (Pan Antibody; Cell Signaling), rabbitanti-GFAP (Dako, Glostrup, Denmark), mouse anti-GFAP(Covance, Princeton, NJ), mouse anti-bIII-Tub (Chemicon), rabbitanti-NF-H (Chemicon), mouse anti-MAP2 (Chemicon), rabbit anti-NG2 (Chemicon), mouse anti-O4 (Chemicon), mouse anti-PSD-95(Santa Cruz Biotechnology), rabbit anti-NMDA2A/B receptors

Fig. 1. BDNF overexpression modulates NSC growth. (A). Immunofluor(Ab-e) in M3GFP-BDNF respect to M3GFP. BDNF co-localizes with GFP (Ablot from NSC differentiated for 5 DIV in BD medium. Quantification of Bnormalised respect to b-actin levels. Values are expressed as mean W SD oadded as positive control. The picture of western blot is representative of tsignificant. C: Proliferation curves of NSC at 3, 6, and 9 days after seedingsignificant increase of cell proliferation in M3GFP-BDNF by cell countingindependentexperiments.ValuesdifferssignificantlywithMP < 0.05.D:MTSto the media and measuring the color change at 490 nm after 1 h incubatiomajor increase in cell proliferation of M3GFP-BDNF respect to M3GFP w

JOURNAL OF CELLULAR PHYSIOLOGY

(Santa Cruz), rabbit anti-Caspase-3 and Caspase-9 (Chemicon),rabbit anti-Bcl2 (Chemicon), anti-b-actin ascites fluid (Sigma–Aldrich). After three washing with TBS-T buffer, immunoreactiveproteins were detected using rabbit-anti-mouse and donkey-anti-rabbit horseradish-peroxidase-conjugated secondary antibodiesdirected to the appropriate primary antibodies (JacksonImmunoresearch Laboratories,WestGrove, PA). The proteins werethen visualized using the chemiluminescence system (Millipore). Thedensitometric analysis of BDNF bands normalized tob-actin proteinlevels and the relative phosphorylation of pAkt1/Akt1 and pErk/Erkwere performed using the ImageQuant5 software.

Immunocytochemistry

Immunocytochemistry was performed on 3� 104 M3GFP andM3GFP-BDNF seeded on matrigel-coated glass chamber slides inBD and ND after 5 DIV. Cells were fixed in 4% paraformaldehydeand then permeabilized in 0.2% TritonX-100/PBS, wereimmunostained with antibodies against GFAP, bIII-Tub, MAP2,NF-H, NG2, O4, and a quantitative cell analysis was performed bycounting five fields per well in duplicate wells from each of threeindependent experiments. Secondary antibodies used were TRITCaffinity purified goat anti-rabbit absorbed for dual labeling(Chemicon), and FITC affinity purified donkey anti-mouseabsorbed for dual labeling (Chemicon). The nuclei were counter-stained with Hoechst 33342 staining (1mg/ml, Sigma–Aldrich).NSC were then visualized using a Olympus microscope BX52equipped with an image analysis programme (IAS 2000; Delta

escences show an efficient overexpression of BDNF protein and GFPc-f). Scale bar, 10mm. B: BDNF expression was evaluated by WesternDNF bands was performed by ImageJ (NIH, USA) and subsequentlyf three experiments. Recombinant human BDNF (rec BDNF, 2ng) is

hree independent experiments. Values with MP < 0.05 were consideredof 2 T 104 cells/well on matrigel pre-coated 6-well dishes, reveal a

a 3 and 6 days of culture. Data are expressed as mean W SD of fourassayisconductedonparalleldishesbyaddingtheone-solutionreagentn at the end of each time point of cell growth. The results confirm theith values statistically significant (MP < 0.05).

Fig. 2. Monitoring of BDNF in differentiated NSC by ELISA.A: Detection of extracellular (supernatant) and intracellular BDNF(cell pellet) from NSC differentiated in BD medium (3 and 5 days),show a significant increase of intracellular store of BDNF (1,380 W 92and 5,626 W 128 pg/ml) in M3GFP-BDNF respect to M3GFP (620 W 56and 1,850 W 40 pg/ml) rather than the extracellular fraction of BDNF;quantification isreported inpg/mlrespecttothetotalproteincontent.B: M3GFP-BDNF differentiated under BD medium for 3 days wereexposed to depolarization conditions (by adding 50 mM KCl at finalconcentration), and supernatants and cell pellets harvested atdifferent time points (10 sec, 5 and 15 min) for BDNF proteindetermination. Quantification data are expressed as mean W SD ofthree independent experiments. Values with MP < 0.05 and MMP < 0.01were considered significant.

B D N F O V E R E X P R E S S I O N A N T A G O N I Z E T M T - I N D U C E D A P O P T O S I S 713

Sistemi, Rome, Italy) connected to a computer, and photographedat 40� and 60� magnification with either two filter or three filtersets.

ELISA

Enzyme-linked Immunosorbent Assay (ELISA) for BDNF wasperformed using the Kit BDNF Emax ImmunoAssay System(Promega-Italia) following the manufacturer’s instructions. Briefly,2.5� 104 cells were seeded on matrigel coated 35 mm in BD after 3and 5 DIV. Supernatants were collected and acidified to determinethe total amount of BDNF (mouse and human) released in themedia. The remaining cell pellets were treated with a detergentbuffer before acidification treatment following the immuno-detection procedure. Optical abosorbance was read at 450 nmwith microplate reader.

Real-time PCR

We used a 7900HT instrument equipped with SDS 2.3 software toperform a quantitative real-time PCR (RT-PCR, AppliedBiosystems, Foster City, CA). Gene expression measures werederived from three independent experiments assayed in triplicates.Table S1 reports the GenBank Ref Seq used in this study. UniversalProbe Library (UPL) refers to universal oligonucleotides providedfor accurate quantification (Roche Applied Science, Monza, Italy).Briefly, cells were plated on matrigel pre-coated 100 mm dishes andcultured either in BD and ND as described previously. Preparationof total RNAs and cDNAs was performed using Ribo Pure kit(Ambion, Austin, TX) and the high capacity cDNA ReverseTranscriptase kit (Applied Biosystems). The expression of eachgene was normalized to the amount of TBP (TATA Box-bindingProtein) in order to calculate relative levels of transcripts. For dataanalysis, the mathematical process used for deriving relativequantification values is described by the manufacturer’s guide(Applied Biosystems).

MTS assay

We used the CellTiter 96 Aqueous One Solution Reagent(Promega), a cell proliferation colorimetric assay containing anovel tetrazolium compound [3-(4,5-dimethylthiazol-2-yl)-5-(3-carboxymethoxyphenyl)-2-(4-sulfophenyl)-2H-tetrazolium; MTS]and an electron-coupling reagent (phenazine methosulfate).Neurospheres were dissociated into single cells and plated2.5� 104 cells/well on matrigel pre-coated six-well platescontaining proliferation medium. Cells were incubated with 100ml/ml MTS at 378C for approximately 1 h, and metabolically active cellsreduced MTS into a soluble formazan product, the absorbance ofwhich was measured at 490 nm after 3, 6, and 9 DIV in growthmedium. The absorbance values of the collected samples weresubtracted from the background absorbance of medium-onlycontrol and expressed as percentage of the untreated. MTS assayswere all performed in BD medium and the TMT chloride (Sigma–Aldrich) was added to the medium depending on the experimentfor 24, 48, and 72 h at 3 DIV. For the pharmacological study, cellswere treated for 48 h with the inhibitors, added 1–2 h prior to MTTtreatment: 50mM PD98059 (MAPKK inhibitor, Calbiochem) or20mM LY294002 (PI3K inhibitor, Calbiochem).

Apoptosis assay

TUNEL assay was performed on cells subjected to BD for 5 daysand exposed or not to TMT for 48 and 72 h. Recombinant hBDNF(rec BDNF, 20ng/ml, Chemicon) was added to dishes at time ofplating and refreshed every 2 days. Apoptosis was studied by usingterminal deoxynucleotidyl transferase-mediated Br-dUTP nick endlabeling assay (TUNEL), according to the manufacturer’sinstructions (APO-BRDU Kit, Invitrogen). Briefly, cells were fixedin 4% paraformaldehyde, permeabilized in 0.1% Triton X-100 and

JOURNAL OF CELLULAR PHYSIOLOGY

0.1% sodium citrate, then washed with PBS. Each sample wasincubated in 50ml of reaction mixture (terminal deoxynucleotidyltransferase and Br-dUTP) for 1 h at 378C, washed in PBS, thenincubated for 1 h with an anti-Bromo-deoxyuridine monoclonalantibody (Becton Dickinson Biosciences, San Jose, CA). Afterincubation with F(ab0)2 anti-mouse IgG R-PE conjugated (SouthernBiotech, Birmingham, Alabama), cells were measured by flowcytometry using a FACScan cytofluorimeter (Becton Dickinson,Franklin Lakes, NJ). Data are expressed as mean� SD of threeindependent experiments.

Statistical analysis

Statistical analysis was performed with Microsoft Office Excel2007. Data are reported in the text as mean average� standarderrors. MTS and TUNEL data were analyzed by One-way analysis ofvariance (ANOVA) with the post-hoc Newman–Keuls test. Valuesof P< 0.05 and P< 0.01 were considered statistically significant.

714 C A S A L B O R E E T A L .

ResultsBDNF overexpression in NSC

Mouse NSC are grown at the first passage as neurospheres inserum-free medium containing EGF and FGF2 growth factorsand plated at clonal density (Cenciarelli et al., 2006). Based ontheir ability to generate neurospheres and to be multipotent,one cell line is selected and infected by lentiviral vectorsexpressing the enhanced green fluorescent protein (GFP) orGFP-BDNF sequences. Immunocytochemical experimentsrevealed an increase in BDNF and GFP staining in M3GFP-BDNF, which is mostly localized in the nuclei and less along theramifications of NSC-derived neuronal and glial cells after 5 DIVin basal differentiation (BD) medium (Fig. 1A). BDNF proteinlevels, determined by densitometric analysis and expressed asmean� SD of three experiments, were significantly higher(�P< 0.05) in M3GFP-BDNF respect to M3GFP (Fig. 1B). SinceBDNF serve as an autocrine and paracrine factor, we evaluatedwhether higher levels of BDNF would affect NSC proliferation.Cell growth kinetics showed a significant increase in cellproliferation at 3, 6, and 9 days by MTS assay (Fig. 1D), insteadby cell counting (Fig. 1C) only at 3 and 6 days we found an higherindex of cell growth statistically significant between cellpopulations (�P< 0.05). BDNF detected by ELISA under BDmedium, is weakly increased in the cultured media of M3GFP-BDNF only at 5 days (1,400 pg/ml� 32) respect to M3GFP(900 pg/ml� 27). At contrary, intracellular BDNFconcentrations are significantly higher in M3GFP-BDNF(1,380� 92 and 5,626� 128 pg/ml) than those observed in

Fig. 3. BDNF overexpression enhances the expression of neuronal and oimmunofluorescences (IFs) performed on NSC differentiated for 5 DIV in Breveal the presence of precursors NG2-positive (green) and mature oligod33342(1mg/ml).Scalebar,10mm.B:Westernblotsperformedinthesamecand NF-H in M3GFP-BDNF versus control. C: RT-PCR, performed on paralinM3GFP-BDNFcomparedwithM3GFP.RT-PCRvaluesareexpressedasmMMP < 0.01 were considered significant.

JOURNAL OF CELLULAR PHYSIOLOGY

M3GFP (620� 56 and 1,850� 40 pg/ml) after 3 and 5 DIV,respectively (Fig. 2A). In conclusion BDNF is mostly retainedinside the cells respect to the released fraction. To determinewhether M3GFP-BDNF showed a fine recycle of intracellularBDNF, we undergone those cells to depolarization stimuli byhigh potassium concentrations (Fig. 2B). Differentiated cells for3 days in BD medium were treated with 50mM KCl for differenttime points (10 sec, 5 and 15 min) and cell culture supernatantsand cell extracts harvested for BDNF dosage. The highest levelsof BDNF in the cultured media (1,150� 23 pg/ml) wereobserved 10 sec after Kþ stimulation with an increase of 26%respect to unstimulated cells, and declined between 5 and15 min to 690� 21 and 260� 16 pg/ml, respectively. We mayconclude that, as reported in the literature for post-mitoticneurons, BDNF has a functional role in NSC and in fact hisproduction, release and store occurs in a very regulated fashion(Canossa et al., 2001; He et al., 2000).

BDNF overexpression in NSC induces transcriptionaland protein up-regulation of neuronal andoligodendroglial markers

To explore the role of BDNF overexpression on neural stemcells differentiation, neurospheres were dissociated into singlecells and allowed to differentiate under BD medium by removalof mitogenic factors and added of 1% FCS for 5 DIV. Cellswere processed for immunocytochemistry, Western blot andquantitative real-time PCR. Fluorescent immunostainingrevealed the presence of astrocytes positives to glial fibrillary

ligodendroglial differentiation markers in M3GFP-BDNF. A: DoubleD medium reveal expression of GFAP (green)/MAP2 (red). Single IFsendrocytes O4-positive (red). Nuclei are stained (blue) with Hoechstultureconditionsrevealan increase inprotein levelsofbIII-Tub,MAP2

leldishes, reveal a significant up-regulationof MAP2,TUBB3 andOMGean W SDofthree independentexperiments.ValueswithMP < 0.05and

B D N F O V E R E X P R E S S I O N A N T A G O N I Z E T M T - I N D U C E D A P O P T O S I S 715

acidic protein (GFAP), oligodendrocytes positives tochondroitin sulfate proteoglycan (NG2) and myelin/oligodendrocyte specific protein (O4), and neurons positives tobIII-Tub, neurofilaments heavy (NF-H) and microtubuleassociated protein 2 (MAP2). Quantitative analysis of cellphenotypes showed none significant difference between twogroups (data not shown), although M3GFP-BDNF revealed thepresence of neurons with more evident bipolar and multipolarprocesses respect to M3GFP (Fig. 3A, MAP2 staining, 60Xmagnification). The effects of BDNF were confirmed byRT-PCR (Fig. 3C) with a significant transcriptional increase ofTUBB3 (fold of increase 3.8� 0.31) and MAP2 (fold of increase1.4� 0.11) in M3GFP-BDNF versus control-NSC, similar datawere also confirmed by Western blots (Fig. 3B). Theseoutcomes suggest that BDNF overexpression in NSC improveneuronal differentiation at morphological and molecular levelrather than determining their cellular fate. To verify whetherconstitutive expression of BDNF in NSC modulated thematuration toward specific neuronal lineages, we subjectedNSC either to BD or ND medium for 5 DIV (Fig. 4), the latterconsisting of 1% FCS along with 2mM ATRA and 100mM cyclicAMP. Under ND medium, we noted by RT-PCR a significantup-regulation of 3.75� 0.25-fold (average� SD) of NMDA2B(Fig. 4C), as well a signal to 28.62 Ct� 0.21 (average� SD) ofNMDA2A, that was absent in M3GFP (Table S2). The presenceof NMDA2A/B expression was also observed by

Fig. 4. EffectsofneuronaldifferentiationmediumonNSC.A:DoubleIFonstaining of N-methyl-D-aspartate receptor subunit 2A/B (NMDA2A/B recrespecttocontrol-NSC.NucleiarestainedwithHoechst33342(blue).ScaleincreaseinlevelsofTrkreceptors(pan-Trkandp75NTR)densityprotein95(Pin BD and ND media, display a significant increase in mRNA levels of (C) NMonly in presence of ND medium respect to control-NSC. RT-PCR values awith MP < 0.05 and (a)P < 0.01 were considered significant.

JOURNAL OF CELLULAR PHYSIOLOGY

immunocytochemistry (Fig. 4A). Receptor tyrosine kinasetropomyosin-related kinases (Trks), p75NTR and thepostsynaptic density-95 (PSD-95) were increased at proteinlevel (Fig. 4B). We observed by RT-PCR a significant increase of2.85� 0.54-fold of TRKB (Fig. 4D) and of 1.87� 0.26-fold ofPSD-95 (Fig. 4E). The synaptosomal-associated protein 25(SNAP25) showed up early at 25 Ct� 0.43 in M3GFP-BDNF,but was not detected in M3GFP (Table S2). We also reportednone expression of choline acetyl-transferase (ChAT),dopamine transporter (DAT). Unexpectedly, M3GFP-BDNFshowed a transcriptional gene repression of almost three- andtwofold of dopaminergic transcriptional factors as steroid/thyroid hormone orphan nuclear receptor (NURR1) andneurogenin 2 (NGN2) respect to control-NSC (Table S2),suggesting a role of BDNF-secreting NSC preferentially forglutamatergic synapse formation (Volpicelli et al., 2007; Yoshiiand Constantine-Paton, 2007). BDNF overexpression alsoaffected differentiation of NSC into mature oligodendrocyteslineage. Indeed, mRNA levels of myelin/oligodendrocyteglycoprotein (OMG) were up-regulated of 3.19� 0.19-fold inM3GFP-BDNF versus M3GFP (Fig. 3C). The percentages ofoligodendrocytes NG2 and O4-positives (Fig. 3B) determinedin M3GFP-BDNF were 9� 0.80% and 6� 0.15% versus7� 0.70% and 3� 0.10% in M3GFP, respectively(average� SD). These data suggest that BDNF also amelioratesoligodendroglial differentiation of NSC and this is related to his

NSC,inducedtodifferentiatefor5daysinNDmedium,showabrightereptors) which merge with MAP2-positive neurons in M3GFP-BDNFbar,10mm.B:Westernblotsperformedfromparalleldishes,displayanSD-95).C–E:RT-PCRanalysesfromNSCinducedtodifferentiatebothDA2B, (D) BDNF receptor (TRKB) and (E) PSD-95 in M3GFP-BDNF

re expressed as mean W SD of three independent experiments. Values

Fig. 5. High KCl-mediated depolarization induces a greateractivation of Trk signaling in differentiated M3GFP-BDNF. A: Proteinextracts from5days-differentiatedNSCinBDmediumandundergoneto fast (10 sec) membrane depolarization in presence of high KR,were probed with antibodies to phosphorylated proteins: p-Trks(Y490), p-Erk1/2 (T202/Y204), p-PLCg1 (Y783), p-Akt1(S473)and pan-p-PKC. Higher activation was observed only for p-Trksand p-Erk1/2 in M3GFP-BDNF. b-Actin levels were used asnormalization control; NS (not specific band). B: Schematicrepresentation of TrkB receptor activation and downstream majorintracellular signaling cascades.

716 C A S A L B O R E E T A L .

key role in axons myelination in CNS, although none significantdifference was observed by cell counts between two groups ofcells immunostained for NG2 and O4.

High potassium-mediated cell depolarization activatesTrk signaling in differentiated NSC

To evaluate the effects of BDNF overexpression on Trksignaling, NSC differentiated 5 DIV in BD medium weresubjected to high potassium-mediated depolarization for ashort time (10 sec). After washing, fresh medium was replacedand cells harvested at 15, 60, and 120 min after stimulation.Protein extracts obtained from depolarized NSC wereanalyzed by Western blots. Levels of phosphorylated Trks(Y490) were strongly increased in M3GFP-BDNF versusM3GFP, which were modulated from 15 min until 1 h afterstimulation and disappeared at 2 h (Fig. 5A). Instead none signalwas found using an antibody against Y706/707 (data not shown).Three major pathways have been demonstrated to mediateeffects of BDNF through TrkB receptor, these are: mitogen-activated protein kinase (MAPK), phosphatidylinositol-3-OHkinase/protein kinase B (PI3K/Akt) (Akt; a serine-threonineprotein kinase, which is also known as protein kinase B) andphospholipase C gamma 1 (PLC-g1) signaling cascades (Fig. 5B).Phosphorylated Erk1/2 (T202/Y204) were detected first at15 min in either cell populations, moreover this activationpersisted until 60 min in M3GFP-BDNF but rapidly declined inM3GFP, suggesting that the lasting activation of this pathwaymay be dependent by BDNF overexpression. An increase inphosphorylation of p-Akt1 (S473) but more modest in p-PLC-g1 (Y783) levels were detected after treatment with highpotassium, but none difference was observed between thetwo cell populations. In depolarization conditions Pan-phosphorylated-protein kinase C (Pan-p-PKC) activationsuggests a modulation of this signaling cascade, most likelydepending on increase of intracellular Caþ, diacyl glycerol(DAG) and inositol 1,4-5-triphosphate (IP3).

BDNF protects differentiated NSC fromTMT-induced apoptosis

NSC releasing BDNF may represent a model in vitro for studieson neurodegeneration mediated by TMT. To determinewhether M3GFP-BDNF antagonized TMT-mediatedneurotoxicity, cells cultured up to 5 DIV in BD medium weretreated with 2mM TMT for 24, 48, and 72 h and their survivaland apoptotic cell death were assessed. M3GFP-BDNFsignificantly rescued TMT-induced damage by MTS assay, with acell viability of 83� 2.0% versus 54� 2.3% in M3GFP at 48 h(Fig. 6B); values differ significantly with �P< 0.05, ��P< 0.01. At72-h TMT exposure we found similar levels of living cells, with45� 2.0% of control cell population respect to 47� 2.1% ofM3GFP-BDNF. We also evaluated apoptosis by TUNEL assay, acommon method to detect DNA fragmentation, and asexpected (Fig. 6C), M3GFP-BDNF exposed to TMT for 48 h,revealed that the percentage of damaged cells was significantlysmaller than M3GFP (17� 2.0% vs. 30� 2.70%, ��P< 0.01). Alonger exposure to TMT until 72 h abolished the differencesabove with 55� 3.20% versus 50� 3.60%, values wereconsidered not significant. These data demonstrated thatBDNF overexpression was not sufficient to counteract TMT’stoxic effect on prolonged time of exposure. Moreover, M3GFP-BDNF not exposed to TMT, displayed a better survival indexthan M3GFP. An ameliorative and synergic effect on NSCsurvival was observed with addition of recombinant hBDNF(recBDNF, 20 ng/ml) on 48-h TMT-treated NSC (values differssignificantly with ��P< 0.01), but were not consideredsignificant at 72 h of TMT treatment (Fig. 6C). In conclusion,BDNF overexpression significantly protects differentiated NSCfrom TMT-induced apoptosis only in the first 48 h and delayed

JOURNAL OF CELLULAR PHYSIOLOGY

Fig. 6. BDNF prevents TMT–induced apoptosis in differentiated NSC. A: Representative phase-contrast images of NSC cultured in BD mediumfor 5 DIV and treated with 2mM trimethyltin for 24 h (Ab,f) and 48 h (Ad,h), show a better resistance to neurotoxic insult by M3GFP-BDNF ratherthan M3GFP. Scale bar, 10mm. B: MTSassays show asignificantattenuation ofneurotoxic damage in M3GFP-BDNF at24and48 h, whereasat72 hreport similar decreased cell viability in both cell populations. C: Graphic representation of flow-cytometry analyses performed on apoptotic NSC(TUNEL staining) cultured under BD medium for 5 DIV, show a physiological apoptotic cell death of M3GFP-BDNF versus M3GFP (6 W 1.2% vs.8 W 1.0% at 48 h and 9 W 2.1% vs. 12 W 2.2% at 72 h). Apoptosis index is significant increased in M3GFP up to 30 W 2.7% compared with 17 W 2.0% inM3GFP-BDNF after 48 h of TMT treatment. Cell death is reinforced to 55 W 3.6% versus 50 W 3.2% after 72 h of TMT treatment. Significantreductionofapoptoticdeathto5 W 1.8% inM3GFP-BDNFand12 W 1.7%inM3GFPisobservedwhenBDNFisaddedexogenously2–3 hpriorto48-hTMT treatment. Values are representative of the percentages of cell death calculated from four experiments. Differences between groups wereexamined for statistical significance with MP < 0.05 and MMP < 0.01 considered significant.

B D N F O V E R E X P R E S S I O N A N T A G O N I Z E T M T - I N D U C E D A P O P T O S I S 717

cell death. Phase-contrast pictures of 5 days-differentiated NSCin presence of TMT, showed the effective neurotrophic role ofBDNF overexpression on neurite outgrowth and the extensivenetwork of cell arborization in M3GFP-BDNF versus M3GFP(Fig. 6A). In fact, M3GFP-BDNF maintained at most an healthycell morphology and connectivity (Fig. 6Af,h). In contrast,M3GFP consistently revealed a severe retraction of dendritesand cell detachment, this due to TMT’s ability to take effect onneuronal damage (Fig. 6Ab,d).

MAPK and PI3K/Akt signaling modulation indifferentiated NSC during TMT-induced apoptosis

In order to investigate the molecular mechanisms of survivaland cell death in response to TMT, we explored the activationsof pro-survival genes and caspases in NSC differentiated 5 DIVin BD medium in presence of TMT for 24 and 48 h (Fig. 7A). Wethus examined the levels of Akt1 and Erk1/2 and of their activephosphorylated forms p-Akt1, p-Erk1/1 after each time oftreatment. The levels of relative phosphorylation of p-Akt1 andp-Erk1/2 (Fig. 7D,E) refereed to CTR samples were risen duringNSC differentiation in both of cell populations. Following TMTtreatment, M3GFP showed a significant decrease of the relativephosphorylations of Akt1 and Erk1/2 versus respective CTR,contrary to M3GFP-BDNF which showed a significant increaserelatively to CTR (�P< 0.05; ��P< 0.01). The relativephosphorylations were calculated by dividing the units ofp-Akt1 and p-Erk1/2 by total levels of Akt1 and Erk1/2 ateach exposure time and expressed as mean� SD from threeindependent experiments. Each value was normalized respectto b-actin expression (Fig. 7D,E). To evaluate the involvement

JOURNAL OF CELLULAR PHYSIOLOGY

of caspases in TMT-induced apoptosis of NSC, we determinedthe expression levels of active forms of procaspase-3 and 9(Fig. 7A). In particular, we noted that 24-h TMT treatmentproduced a marked elevation of cleaved procaspase-3 (Fig. 7C)in M3GFP respect to CTR (��P< 0.01), which was significantlyhigher respect to that observed at the same time of treatment inM3GFP-BDNF ((a)P< 0.01). To the contrary, M3GFP-BDNFshowed a slower and progressive activation of caspase-3 duringthe TMT exposure relatively to CTR (�P< 0.05). These datawere consistent with the significant loss of neurons (bIII-Tubulin staining) in TMT-treated M3GFP compared with CTR(Fig. 7A,B). None statistical significance was found regardingbIII-Tub expression levels in M3GFP-BDNF in the same cultureconditions (Fig. 7B). The values were mean� SD from threeindependent experiments, and expressed the relative amountsrespect to M3GFP at 24 h (CTR). Each value was normalisedrelatively to b-actin expression levels. An enhanced GFAPexpression in NSC-derived astrocytes in vitro was visible at48-h TMT treatment, which is described as reactive gliosis inrodent models of TMT-mediated neurodegeneration (Fig. 7A).Trks activation was not affected by TMT treatment, suggesting amechanism of cell survival through PI3K/Akt1 and MAPKsignaling activation-Trk independent. To evaluate theinvolvement of these pathways in TMT-induced cell death,we assessed the effects of PD98059, a MAPKK inhibitor, andLY294002, a PI3K inhibitor, on differentiated M3GFP-BDNF(Fig. 8). As shown in Figure 8B, a 48-h TMT exposure of thesecells produced an irrelevant reduction of cell viability(83� 2.5%), whereas combined with PD98059 or LY294002,produced a significant effect on cell survival (61� 3.2% and54� 1.5%, respectively); values differ significantly: (a)P< 0.05;

Fig. 7. Effects of TMT treatment on survival and apoptotic pathways of differentiated NSC. A: Cell extracts obtained from NSC after 5 DIV in BDmediumwithorwithoutexpositiontoTMT(2mM)for24and48 h,wereprobedwiththeantibodies indicated infigure.NeuroprotectionofM3GFP-BDNF from TMT toxicity correlates with greater and significant levels of expression and phosphorylation of Akt1 and Erk1/2 (MP < 0.05), as well ofBCL2proteinexpressionrespecttoeachCTR.Pan-Trkandp-Trkprotein levelsareunchangedfollowingTMTtreatment inbothNSCpopulations.M3GFP show a significant reduction of cell survival pathways (measured by relative phosphorylation of p-Akt1/Akt1 and p-Erk/Erk) observed at24and 48 h of TMT treatment respect to each CTR (MP < 0.05, MMP < 0.01). Concomitantly, a significant increased cleavage of procaspase-3 is firstobserved at24 hof TMTtreatment in M3GFPrespect toM3GFP-BDNF((a)P < 0.01).A strong inductionofastrocytic marker (GFAP) is reported inTMT-treatedNSCat48 h.B,C:ThebarsrepresenttherelativeamountsofbIII-Tub(B)andofcleavedcaspase-3 (C)respecttoM3GFPCTRat24 h,and normalised respect to b-actin blots. D,E: Relative phosporylations of p-Akt1 and p-Erk1/2 against total Akt1 and Erk1/2 protein levels arenormalised respect to b-actin levels. All values express mean W SD of three separate experiments with MP < 0.05, MMP < 0.01, (a)P < 0.05, and(b)P < 0.01 considered significant.

718 C A S A L B O R E E T A L .

(b)P< 0.01. Moreover, M3GFP-BDNF treated for 48 h withTMT alone did not display significant neuronal loss asdetermined by immunoblotting and immunofluorescencefor bIII-Tub (Figs. 7A,B and 8Ab–d), whereas TMT treatmentalong with PD98059 determined a decrease of neuronsbIII-Tub-positive, which resulted more effective in presence ofLY294002 (Fig. 8Af–h).

Discussion

A strong body of evidences show that neurotrophic factors, andin particular BDNF, result of fundamental utility not only

JOURNAL OF CELLULAR PHYSIOLOGY

because is widely expressed in the adult mammalian brain, butalso for being critically involved in Alzheimer’s and Huntington’sdiseases (Nagahara et al., 2009; Zuccato and Cattaneo, 2009).Recently, it has been shown that BDNF knockdown within NSCabolishes the cognitive benefits of NSC delivery (Blurton-Joneset al., 2009). Particularly abundant in the hippocampus andcerebral cortex, BDNF is a crucial neuronal survival anddifferentiation factor, therefore the possibility to deliverBDNF-secreting NSC or increasing endogenous BDNFproduction may impede or delay the progression of somehuman diseases (Koda et al., 2004). In previous works wecharacterized mouse NSC for self-renewal and multipotency

Fig. 8. Effects of MAPKK or PI3K inhibitors on TMT-treated M3GFP-BDNF with regard to cell viability and neuronal death (A). Phase-contrastimages and immunofluorescences on M3GFP-BDNF differentiated 5 DIV in BD medium show an effective reduction of neurons stained withbIII-TubantibodybyaddingofMAPKK(Ae,f)andPI3Kinhibitors (Ag,h)respect toTMTtreatmentalone(Ac,d).NucleiarestainedwithHoechst33342(blue). Scale bar, 10mm. B: MTS assays from M3GFP-BDNF exposed to PD98059 (50mM, MAPKK inhibitor) or LY294002 (20mM, PI3K inhibitor)2–3 h prior to 48-h TMT treatment. Values express mean W SD from three independent experiments with (a)P < 0.05 and (b)P < 0.01. C: Proteinextracts fromM3GFP-BDNFtreatedwithTMTaloneandalongwithPD98059orLY294002,areprobedwithspecificantibodiestophosphorylatedproteins, which show a decreased phosphorylation levels of p-Erk1/2, p-Akt1. Afterwards, filters are stripped and re-probed to measure totalamount of the same proteins. b-Actin levels indicate a correct loading of the proteins.

B D N F O V E R E X P R E S S I O N A N T A G O N I Z E T M T - I N D U C E D A P O P T O S I S 719

(Cenciarelli et al., 2006) and studied the role of L-type calciumchannels in neuronal differentiation (D’Ascenzo et al., 2006).Herein, NSC modified to stably express human BDNF, werecharacterized and tested for their ability to counteract the toxiceffects induced by TMT, a well-known organotin compound. Inparticular, monitoring of BDNF production in differentiatedNSC showed a significant intracellular storage in BDNF-secreting NSC, very likely to impact on cell survival and synapticplasticity (Lessmann and Heumann, 1998, Poo, 2001). Sinceprevious reports indicated that regulated BDNF release can beinduced either by high Kþ or high frequency stimulation ofglutamatergic synapses (Canossa et al., 1997; Hartmann et al.,2001), treatment of BDNF-secreting NSC with high Kþ

resulted in rapid BDNF recycle with consequent iper-phosphorylation of TrkB and Erk1/2, important mediators ofneurite outgrowth and neuronal plasticity (Gokce et al., 2009).In this study, we provided evidence that BDNF-secreting NSC,driven toward neuronal differentiation medium, promotedtranscriptional up-regulation of neuronal glutamatergic genessuch as NMDA2A/B, TRKB, PSD-95, SYN1, and SNAP25 (seeTable S2), whose have all implicated in long-term potentiationand synapses formation (Korte et al., 1995; Yoshii andConstantine-Paton, 2007; Bogen et al. 2009). In fact, BDNF isknown to modulate several aspects of synaptic transmission andenhances NMDA receptors via modulation of the NMDA2Bsubunit (Crozier et al., 1999). BDNF is also thought to beinvolved in glial cell proliferation as well as myelination. We

JOURNAL OF CELLULAR PHYSIOLOGY

have reported that BDNF played a role on oligodendroglialdevelopment in vitro, and others observed the same results invivo (Ikeda et al., 2002; De Groot et al., 2006; Van’t Veer et al.,2009). Oligodendroglial differentiation under BD mediumshowed a mixed population comprising of immature processesimmunostained for NG2 and mature myelin/oligodendrocytespecific protein O4, with a more complex branching in M3GFP-BDNF than that observed in M3GFP. We also have exploredthe gene expression of other neurotrophic factors such asneurotrophin-3 (NTF3), glial-cell-line-derived neurotrophicfactor (GDNF) and ciliary neurotrophic factor (CNTF), whoseare all possible candidate molecules for cell therapies in animalmodels of human neurological disorders (Zhang et al., 2009),but we did not report data in support of their effective role inthis context. Earlier studies have demonstrated that in vivotreatment with trimethyltin chloride produced severe neuronaldamages (Geloso et al., 1997; Jenkins and Barone, 2004). Wereport the first evidence that BDNF provides neuroprotectionin NSC cultures from TMT-initiated apoptotic pathway withinthe first 48 h of treatment, but it failed to produce beneficialeffect to a long lasting exposure to TMT. Our data indicate thatNSC-control were highly susceptible to TMT, in fact thisorganotin compound has the ability to activate the procaspase-3 concomitant to DNA fragmentation and to cause a significantdecrease of Erk1/2 and Akt1 phosphorylation levels duringdifferentiation. By the literature, the activation of Akt1 signalhas been demonstrated to exhibit anti-apoptotic effects against

720 C A S A L B O R E E T A L .

a variety of toxic stimuli such as oxidative and osmotic stress,irradiation and ischemic shock (Dudek et al., 1997; Lee et al.,2009). The increased activation of PI3K/Akt and MAPK signalingpathways in BDNF-secreting NSC treated with TMT associatedto an ameliorative survival of neuronal differentiation respect toNSC-control. The pharmacological inhibition of these pathwaysin M3GFP-BDNF affected significantly their cell viability andneuronal survival. Consistently, the susceptibility to TMT ofproliferating neural progenitor cells has been observed byothers (Yoneyama et al., 2009). Our previous findings indicatinga toxic effect of TMT on NSC, might in part explain the failure oftransplanted NSC to satisfactorily survive and differentiate inthe TMT-treated rat hippocampus (Geloso et al., 2007). It isevident that BDNF offer a great promise for the development oftherapies against several neurological disorders (Blurton-Joneset al., 2009; Nagahara et al., 2009). Notably, significantalterations did not occur for Trk receptors expression as wellas for phosphorylated p-Trk at 24 and 48 h after TMT treatmentunder basal differentiation conditions. These outcomes suggestthat Trk receptors activation is not directly involved inaugmented Akt1 and Erk1/2 phosphorylation during TMT-mediated apoptosis. In the literature has been reported a rolefor the stress-activated protein kinases p38 and c-Jun N-terminal kinase (JNK) in TMT-stimulated apoptosis of PC12 orcortical neurons of mice respectively (Jenkins and Barone,2004, Shuto et al., 2009). Thus, we explored the possibility ofJNK’s involvement in TMT-induced apoptosis of NSC, but byimmunoblotting analyses we did reveal none expression forJNK cascade before and after TMT treatment (data not shown).TMT induced GFAP protein expression from NSC–derivedastrocytes and this might affect the biological processes hereinstudied, through secretion of trophic factors, or toxicmolecules or excitatory amino acids. Neuropharmacologystudies on neural stem cells could be considered a confidentexperimental model to understand the molecular mechanismsof neurodegeneration and regeneration.

Acknowledgments

This work was supported by a grant from ATENA Onlus and byfunds of Catholic University-School of Medicine, Rome. Wethank Prof. F. Lee who kindly provided the plasmid pcDNA3-1hygro-hBDNF. We also are grateful to Dr. M. Budoni for herskilful technical assistance. This work is dedicated in memory ofRosella Caracci, my mother.

Literature Cited

Aschner M, Gannon M, Kimelberg HK. 1992. Interactions of trimethyl tin (TMT) with ratprimary astrocyte cultures: Altered uptake and efflux of rubidium, L-glutamate and D-aspartate. Brain Res 582:181–185.

Bennett L, Yang M, Enikolopov G, Iacovitti L. 2009. Circumventricular organs: A novel site ofneural stem cells in the adult brain. Mol Cell Neurosci 41:337–347.

Blurton-Jones M, Kitazawa M, Martinez-Coria H, Castello NA, Muller FJ, Loring JF, YamasakiTR, Poon WW, Green KN, Laferla FM. 2009. Neural stem cells improve cognition viaBDNF in a transgenic model of Alzheimer disease. Proc Natl Acad Sci USA 106:13594–13599.

Bogen IL, Haug KH, Roberg B, Fonnum F, Walaas SI. 2009. The importance of synapsin I and IIfor neurotransmitter levels and vesicular storage in cholinergic, glutamatergic andGABAergic nerve terminals. Neurochem Int 55:13–21.

Brown AW, Verschoyle RD, Stret BW, Aldridge WN, Grindley H. 1984. The neurotoxicity oftrimethyltin chloride in hamsters, gerbils and marmosets. J Appl Toxicol 4:12–21.

Canossa M, Griesbeck O, Berninger B, Campana G, Kolbeck R, Thoenen H. 1997.Neurotrophin release by neurotrophins: Implications for activity-dependent neuronalplasticity. Proc Natl Acad Sci USA 94:13279–13286.

Canossa M, Gartner A, Campana G, Inagaki N, Thoenen H. 2001. Regulated secretion ofneurotrophins by metabotropic glutamate group I (mGluRI) and Trk receptor activation ismediated via phospholipase C signalling pathways. EMBO J 20:1640–1650.

Cardone MH, Roy N, Stennicke HR, Salvesen GS, Franke TF, Stanbridge E, Frisch S, Reed JC.1998. Regulation of cell death protease caspase-9 by phosphorylation. Science 282:1318–1321.

Cenciarelli C, Budoni M, Mercanti D, Fernandez E, Pallini R, Aloe L, Cimino V, Maira G,Casalbore P. 2006. In vitro analysis of mouse neural stem cells genetically modified to stablyexpress human NGF by a novel multigenic viral expression system. Neurol Res 5:505–512.

Coffer PJ, Jin J, Woodgett JR. 1998. Protein kinase B (c-Akt): A multifunctional mediator ofphosphatidylinositol 3-kinase activation. Biochem J 335:1–13.

JOURNAL OF CELLULAR PHYSIOLOGY

Crozier RA, Black IB, Plummer MR. 1999. Learn Mem Blockade of NR2B-containing NMDAreceptors prevents BDNF enhancement of glutamatergic transmission in hippocampalneurons. Learn Mem 6:257–266.

D’Ascenzo M, Piacentini R, Casalbore P, Budoni M, Pallini R, Azzena GB, Grassi C. 2006. Roleof L-type Ca2þ channels in neural stem/progenitor cell differentiation. Eur J Neurosci23:935–944.

De Groot DM, Coenen AJ, Verhofstad A, van Herp F, Martens GJ. 2006. In vivo induction ofglial cell proliferation and axonal outgrowth and myelination by brain-derivedneurotrophic factor. Mol Endocrinol 20:2987–2998.

Dudek H, Datta SR, Franke TF, Birnbaum MJ, Yao R, Cooper GM, Segal RA, Kaplan DR,Greenberg ME. 1997. Regulation of neuronal survival by the serine-threonine proteinkinase Akt. Science 275:661–665.

Gage FH. 2000. Mammalian neural stem cells. Science 287:1433–1438.Geloso MC, Vinesi P, Michetti F. 1997. Calretinin containing neurons in trimethyltin-induced

neurodegeneration in the rat hippocampus. An immunocytochemical study. Exp Neurol146:67–73.

Geloso MC, Vercelli A, Corvino V, Repici M, Boca M, Haglid K, Zelano G, Michetti F. 2002.Cyclooxygenase-2 and caspase 3 expression in trimethyltin-induced apoptosis in themouse hippocampus. Exp Neurol 175:152–160.

Geloso MC, Giannetti S, Cenciarelli C, Budoni M, Casalbore P, Maira G, Michetti F. 2007.Transplanted foetal neural stem cells into the rat hippocampus during trimethyltin-inducedneurodegeneration. Neurochem Res 32:2054–2061.

Gokce O, Runne H, Kuhn A, Luthi-Carter R. 2009. Short-term striatal gene expressionresponses to brain-derived neurotrophic factor are dependent on MEK and ERKactivation. PLoS ONE 4:e5292.

Hamburger V, Levi-Montalcini R. 1949. Proliferation, differentiation and degeneration in thespinal ganglia of the chick embryo under normal and experimental conditions. J Exp Zool111:457–4502.

Hartmann M, Heumann R, Lessmann V. 2001. Synaptic secretion of BDNF after highfrequency stimulation of glutamatergic synapses. EMBO J 20:5887–5897.

He X, Yang F, Xie Z, Lu B., 2000. Intracellular Ca(2þ) and Ca(2þ)/calmodulin-dependentkinase II mediate acute potentiation of neurotransmitter release by neurotrophin-3. J CellBiol 149:783–792.

Ikeda O, Murakami M, Ino H, Yamazaki M, Koda M, Nakayama C, Moriya H. 2002. Effects ofbrain-derived neurotrophic factor (BDNF) on compression-induced spinal cord injury:BDNF attenuates down-regulation of superoxide dismutase expression and promotesup-regulation of myelin basic protein expression. J Neuropathol Exp Neurol 61:142–153.

Jenkins SM, Barone S. 2004. The neurotoxicant trimethyltin induces apoptosis viacaspase activation, p38 protein kinase, and oxidative stress in PC12 cells. Toxicol Lett147:63–72.

Koda M, Hashimoto M, Murakami M., et al. 2004. Adenovirus vector-mediated in vivo genetransfer of brain-derived neurotrophic factor (BDNF) promotes rubrospinal axonalregeneration and functional recovery after complete transection of the adult rat spinalcord. J Neurotrauma 21:329–337.

Korte M, Carroll P, Wolf E, Brem G, Thoenen H, BonhoefferT. 1995. Hippocampal long-termpotentiation is impaired in mice lacking brain-derived neurotrophic factor. Proc Natl AcadSci USA 92:8856–8860.

Lee HJ, Kim MK, Kim HJ, Kim SU. 2009. Human neural stem cells genetically modified tooverexpress Akt1 provide neuroprotection and functional improvement in mouse strokemodel. PLoS ONE 4:e5586.

Lessmann V, Heumann R. 1998. Modulation of unitary glutamatergic synapses byneurotrophin-4/5 or brain-derived neurotrophic factor in hippocampal microcultures:presynaptic enhancement depends on pre-established paired-pulse facilitation. Neurosci86:399–413.

Murer MG, Yan Q, Raisman-Vozari R. 2001. Brain-derived neurotrophic factor in the controlhuman brain, and in Alzheimer’s disease and Parkinson’s disease. Prog Neurobiol 63:71–7124.

Nagahara AH, Merrill DA, Coppola G, et al. 2009. Neuroprotective effects of brain-derivedneurotrophic factor in rodent and primate models of Alzheimer’s disease. Nat Med15:331–337.

Nawa H, Takei N. 2001. BDNF as an anterophin: A novel neurotrophic relationship betweenbrain neurons. Trends Neurosci 24:683–684.

Nguyen N, Lee SB, Lee YS, Lee KH, Ahn JY. 2009. Neuroprotection by NGF and BDNFagainst neurotoxin-exerted apoptotic death in neural stem cells are mediated through Trkreceptors, activating PI3-kinase and MAPK pathways. Neurochem Res 34:942–951.

Nykjaer A, Willnow TE, Petersen CM. 2005. p75NTR-live or let die. Curr Opin Neurobiol15:49–57.

Pagani L, Cenciarelli C, Casalbore P, Budoni M, Sposato V, Aloe L. 2008. Identification andearly characterization of genetically modified NGF-producing neural stem cells grafted intothe injured adult rats brain. Neurol Res 30:244–250.

Phillips HS, Hains JM, Armanini M, Laramee GR, Johnson SA, Winslow W. 1991. BDNFmRNA is decreased in the hippocampus of individuals with Alzheimer’s disease. Neuron7:695–702.

Piacentini R, Gangitano C, Ceccariglia S, Fa AD, Azzena GB, Michetti F, Grassi C. 2008.Dysregulation of intracellular calcium homeostasis is responsible for neuronal death in anexperimental model of selective hippocampal degeneration induced by trimethyltin. JNeurochem 105:2109–2121.

Poo M.M., 2001. Neurotrophins as synaptic modulators. Nat Rev Neurosci. 2:24–32.Shuto M, Seko K, Kuramoto N, Sugiyama C, Kawada K, Yoneyama M, Nagashima R, Ogita K.,

2009. Activation of c-Jun N-terminal kinase cascades is involved in part of the neuronaldegeneration induced by trimethyltin in cortical neurons of mice. J Pharmacol Sci 109:60–70.

Siegel GJ, Chauhan NB. 2000. Neurotrophic factors in Alzheimer’s and Parkinson’s diseasebrain. Brain Res Rev 33:199–227.

Snoeij NJ, Penninks AH, Seinen W. 1987. Biological activity of organotin compounds-anoverview. Environ Res 44:335–353.

Stoop R, Poo MM. 1996. Synaptic modulation by neurotrophic factors: Differential andsynergistic effects of brain-derived neurotrophic factor and ciliary neurotrophic factor.J Neurosci 16:3256–3264.

Taupin P, Gage FH. 2002. Adult neurogenesis and neural stem cells of the central nervoussystem in mammalian. J Neurosci Res 69:745–749.

Van’t Veer A, Du Y, Fischer TZ, Boetig DR, Wood MR, Dreyfus CF. 2009. Brain-derivedneurotrophic factor effects on oligodendrocyte progenitors of the basal forebrain aremediated through trkB and the MAP kinase pathway. J Neurosci Res 87:69–78.

Volpicelli F, Caiazzo M, Greco D, Consales C, Leone L, Perrone-Capano C, Colucci D’AmatoL, di Porzio U. 2007. Bdnf gene is a downstream target of Nurr1 transcription factor in ratmidbrain neurons in vitro. J Neurochem 102:441–453.

B D N F O V E R E X P R E S S I O N A N T A G O N I Z E T M T - I N D U C E D A P O P T O S I S 721

Watson FL, Heerssen HM, Moheban DB, Lin MZ, Sauvageot CM, Bhattacharyya A, PomeroySL, Segal RA. 1999. Rapid nuclear responses to target-derived neurotrophins requireretrograde transport of ligand-receptor complex. J Neurosci 19:7889–7900.

Yano H, Chao MV. 2004. Mechanisms of neurotrophin receptor vesicular transport. JNeurobiol 58:244–257.

Yoneyama M, Seko K, Kawada K, Sugiyama C, Ogita K. 2009. High susceptibility of corticalneural progenitor cells to trimethyltin toxicity: Involvement of both caspases and calpain incell death. Neurochem Int 55:257–264.

JOURNAL OF CELLULAR PHYSIOLOGY

Yoshii A, Constantine-Paton M. 2007. BDNF induces transport of PSD-95 to dendritesthrough PI3K-AKT signaling after NMDA receptor activation. Nat Neurosci 10:702–711.

Zhang L, Ma Z, Smith GM, Wen X, Pressman Y, Wood PM, Xu XM. 2009. GDNF-enhancedaxonal regeneration and myelination following spinal cord injury is mediated by primaryeffects on neurons. Glia 57:1178–1191.

Zuccato C, Cattaneo E. 2009. Brain-derived neurotrophic factor in neurodegenerativediseases. Nat Rev Neurol 5:311–322.