Multiple GATA sites: protein binding and physiological relevance for the regulation of the proline...

Molecular Microbiology (2003)

50

(1), 277–289 doi:10.1046/j.1365-2958.2003.03682x

© 2003 Blackwell Publishing Ltd

Blackwell Science, LtdOxford, UKMMIMolecular Microbiology 1365-2958Blackwell Publishing Ltd, 200350

1277289

Original Article

AreA-binding sites in the prnB-prnD promoterD. Gómez, I. García, C. Scazzocchio and B. Cubero

Accepted 17 June, 2003. *For correspondence. E-mail [email protected]; Tel.

+

33 169156356; Fax

+

33 169157808. Presentaddresses:

†

Laboratoire de Physiologie Humaine, Faculté dePharmacie-Médecine, 51 rue Cognac Jay, 51100 Reims, France;

‡

Instituto de Recursos Naturales y Agrobiología, CSIC, Avda. ReinaMercedes, 10, 41012-Sevilla, Spain.

§

D.G. and I.G. have contributedequally to this work.

Multiple GATA sites: protein binding and physiological relevance for the regulation of the proline transporter gene of

Aspergillus nidulans

Dennis Gómez,

1†§

Irene García,

1§

Claudio Scazzocchio

1,2

* and Beatriz Cubero

1‡

1

Institut de Génétique et Microbiologie, Université Paris-Sud, UMR8621 91405-Orsay Cedex, France.

2

Institut Universitaire de France.

Summary

In


, proline can serve both as acarbon and a nitrogen source. The transcription of the

prnB

gene, encoding the proline transporter, is effi-ciently repressed only by the simultaneous presenceof ammonium and glucose. Thus, repression of thisgene demands the activation of the CreA repressorand the inactivation of the positive-acting GATA factorAreA. Repression of all other

prn

structural genesresults largely from inducer exclusion. In an

areA

nullmutation background,

prnB

is repressible by the solepresence of glucose. We have determined by EMSAand missing-base interference experiments that thereare 15 AreA-binding sites in the

prnD-prnB

intergenicregion. Only sites 13/14, in the proximity of the

prnB

TATA box, are clearly involved in transcriptional acti-vation and regulation. Mutation of these sites mimicsqualitatively the regulatory effect of an

areA

nullmutation. The deletion of the TATA box has a measur-able effect on the maximal level of

prnB

transcriptionbut does not alter the regulation pattern of this gene.

Introduction

AreA is a GATA factor necessary for the expression ofscores of genes involved in the utilization of nitrogensources in


. Its role as a wide domainregulator was characterized in 1973 (Arst and Cove, 1973;Wiame

et al

., 1985; Caddick, 1994) Subsequently homo-

logues have been found in all ascomycetes where theyhave been sought (Scazzocchio, 2000).

AreA and homologue proteins bind to HGATAR sites(Ravagnani

et al

., 1997) upstream of structural genes. Inmost previously studied cases, a second, pathway-spe-cific transcription factor, is necessary for gene expressionand both factors act synergistically rather than additively(Gorfinkiel

et al

., 1993; Oestreicher and Scazzocchio,1995; Muro-Pastor

et al

., 1999). A prime example of syn-ergistic activation is the

niiA-niaD (

nitrite and nitrate reduc-tases) bi-directional promoter, where both factors areabsolutely necessary to elicit transcription above analmost nil basal level (Muro-Pastor

et al

., 1999). AreAresponds to the nitrogen status of the cell. Externalammonium or glutamine prevents AreA-mediated activa-tion of gene transcription. Again, a prime example is the

niiA-niaD

bidirectional promoter, where external ammo-nium prevents completely the transcription of both reduc-tase genes (Muro-Pastor

et al

., 1999). Ammonium andglutamine affect AreA DNA binding and transcriptionalactivation at multiple levels, including transcriptional, post-transcriptional and post-translational but this problem willnot be discussed here (Platt

et al

., 1996; Andrianopoulos

et al

., 1998; Morozov

et al

., 2000; 2001).For genes involved in the utilization of metabolites that

can serve only as nitrogen sources, AreA is essential forfull transcriptional activation irrespective of the carbonsource present. On the other hand, for most genesinvolved in the utilization of metabolites that can serve asboth nitrogen and carbon sources, an active AreA factoris necessary only in conditions of carbon cataboliterepression (Arst and Cove, 1973; Arst and Scazzocchio,1985; Davis

et al

., 1993; Gonzalez

et al

., 1997). Thismakes sound teleonomic sense, as it allows the organismto utilize a nitrogen source in the presence of a preferredcarbon source and the same metabolite as a carbonsource in the presence of a preferred nitrogen source.Specifically for

prnB

, AreA is necessary for transcriptiononly when the carbon catabolite repressor protein CreA isbound to its cognate binding sites. Mutation of either ofthe two relevant CreA-binding sites of the

prnD-prnB

inter-genic region suppresses an

areA

null mutation for utiliza-tion of proline as a nitrogen source in the presence of

278

D. Gómez, I. García, C. Scazzocchio and B. Cubero

© 2003 Blackwell Publishing Ltd,

Molecular Microbiology

,

50

, 277–289

glucose (Arst and MacDonald, 1975; Arst

et al

., 1980;Sophianopoulou

et al

., 1993; Cubero and Scazzocchio,1994; Gonzalez

et al

., 1997).The

A. nidulans prn

cluster encodes all the proteinsnecessary for the utilization of proline as a carbon and/ornitrogen source. The biochemistry of proline utilizationnecessitates the two-step conversion of proline toglutamate and is identical in

A. nidulans

,

Saccharomycescerevisiae

and indeed in all organisms where it has beenstudied (Arst and Cove, 1973; Arst and MacDonald, 1975;Brandriss and Magasanik, 1979a, b; Arst

et al

., 1981;Daugherty

et al

., 1993; Xu

et al

., 1995). However, both theorganization of the cognate genes and the patterns ofregulation differ drastically between the two model asco-mycetes (reviewed in Cazelle

et al

., 1998).The cluster has been sequenced and all its transcripts

have been mapped. (Sophianopoulou and Scazzocchio,1989; Cazelle

et al

., 1998; S. Demais, V. Gavrias, R.Gonzalez and C. Scazzocchio, unpubl. database entries

prnA-prnX-prnD

: AJ 223459;

prnC

: AF 252630). Figure 1shows the organization of the cluster and details the gene/protein relationships. The expression of

prnD

,

prnB, prnC

and, to a lesser extent

prnX

is strictly dependent on thetranscriptional activator PrnA and induction by proline(Sharma and Arst, 1985; Gavrias, 1992; Cazelle

et al

.,1998).

The genes involved in proline utilization in

A. nidulans

are typical examples of the set of genes significantlyrepressed only when both ammonium and glucose arepresent and which require conditionally the AreA factor(Arst and Cove, 1973; Arst

et al

., 1980; Gonzalez

et al

.,1997). The repression pattern of the

prn

structuralgenes can be summarized as follows. Only in the pres-ence of both glucose and ammonium is there a sub-stantial transcriptional repression of the

prnB

gene(Sophianopoulou

et al

., 1993). This gene codes for thespecific proline transporter and the parallel repression ofthe

prnD

and

prnC

genes is largely due to inducerexclusion (Arst

et al

., 1980; Cubero

et al

., 2000). CreArepresses

prnB

only in the absence of an active AreA orto put it differently, AreA is necessary for

prnB

transcrip-tion only when CreA is activated by glucose or other

repressing carbon sources (Arst and Cove, 1973; Arstand MacDonald, 1975; Arst

et al

., 1980; Gonzalez

et al

.,1997). The

conditional

requirement of AreA (as an acti-vator) and CreA (as repressor) in the

prn

system differstrikingly from their

absolute

requirement in systemsthat are subject only to nitrogen metabolite repressionor carbon catabolite repression respectively (Arst andCove, 1973; Scazzocchio, 1994). The integration ofnitrogen and carbon catabolite repression in the

prnD-prnB

intergenic region has been studied in detail and amodel has been put forward to account for this regula-tory pattern (Gonzalez

et al

., 1997).

In vitro

and

in vivo

studies have been carried out todefine the binding sites for the transcriptional activatorPrnA (Gómez

et al

., 2002) and the carbon cataboliterepressor protein CreA (Cubero and Scazzocchio, 1994).Work to be published separately, show that the

prnD-prnB

intergenic region is a genuine bi-directional promoter, asmutations in PrnA-binding sites affect the transcription ofboth

prnD

and

prnB

(I. García, D. Gómez, and C. Scaz-zocchio, unpubl. results). In this article we carry out an

invitro

and

in vivo

characterization of the binding sites forthe GATA factor AreA. AreA-binding sites in the

prnC

promoter were also characterized

in vitro

but not studiedfurther in this work. We show that the two

prnB

proximalGATA sites are involved in setting the maximal level oftranscription of

prnB

and in the conceptually differentactivity of AreA, the by-pass of CreA repression. We fur-ther show that the

prnB

TATA box is not essential fortranscription and that neither the AreA nor PrnA transcrip-tional activators can act exclusively by recruiting the TATA-binding protein to the TATA box.

Results

The catalogue of AreA-binding sites

EMSA was used to scan for AreA-binding sites both the

prnD-prnB

and

prnB-prnC

intergenic regions. AGST::AreA (663–809) fusion protein including the wholeDNA-binding domain was used (Langdon

et al

., 1995;Wilson and Arst, 1998 for review; Manfield

et al

., 2000),We have used 15 overlapping probes in the

prnD-prnB

1Kb

prnA prnX prnD prnB prnC

prnA prnX prnD prnB prnC

Fig. 1.

The organization of the

prn

cluster in chromosome VII of


.

prnA

encodes the specific transcription factor of the pathway (Sharma and Arst, 1985; Cazelle

et al

., 1998)

prnX

is a proline-inducible gene of unknown function detected by sequence and transcript studies (V. Gavrias, S. Demais and C.S., unpubl. data).

prnD

encodes proline oxi-dase,

prnB

the specific proline transporter,

prnC

the

D

-1-pyrroline-5-carboxylate dehydro-genase (Jones

et al

., 1981; Hull

et al

., 1989; Sophianopoulou and Scazzocchio, 1989; Gavrias, 1992).

AreA-binding sites in the prnB-prnD promoter

279

© 2003 Blackwell Publishing Ltd,

Molecular Microbiology

,

50

, 277–289

region and two probes in the

prnB-prnC

region and wehave defined five regions (A to E) bearing GATA/Tsequences which bind AreA. An example of the experi-ments carried out is shown in Fig. 2. With the exceptionof probe 16 which is in the

prnB-prnC

intergenic region,and probes defining region B (see below), we have carriedout missing-base interference experiments for bothpurines and pyrimidines with each retarded probe. Anexample of the interference experiments is shown inFig. 3. A summary of the results obtained by the collatedinterference experiments is shown in Fig. 4. The interfer-ence pattern of region B has not been obtained, due toits low affinity for AreA.

Sites 1, 4, 6, 7, 9, 12, 13 and 14 are canonical HGA-TAR AreA-binding sites that respond to the consensusestablished by Ravagnani

et al

. (1997). Surprisingly,

missing base interference does not reveal site 12, whichis a canonical site. A number of non-canonical sites,however, were revealed. Of these, sites 2 and 10 areMGATAT sites (thus non-consensus in the last position)and sites 3, 8 and 15 are AGATTR sites. Site 11 is aGGATAG site. As GST can dimerise, this might intro-duce an artificial apparent cooperativity of binding andsome of the sites revealed could be artefactual. Thisunlikely possibility was ruled out, first, because the siteswere determined by missing-base interference ratherthan protection experiments and second, because wehave repeated and obtained completely consistentresults when using an AreA protein cleaved from itsGST moiety in gel-shift and interference experiments.This includes the physiologically important (see below)region E (Fig. 3C).

Fig. 2.

Detection of AreA-binding sites in the

prn

cluster by EMSA. Right and left panels show gel retardation experiments of two series of overlapping probes in the

prnD-prnB

intergenic region. The length and position of the two series of probes are indicated above the panels as (L) and (R). (L–R) show the regions containing the binding sites, deduced from the results with both series of probes. On a separate line we show the probes used in a similar experiment for the

prnB-prnC

intergenic region (EMSA not shown). Thick lines: strongly binding probes or deduced sequences; thin lines: non-binding probes or sequences; intermediate width lines: weak binding probes or sequences.

prnD prnB prnC

L

A B C D E

R

L-R

1 2 3 4 5 6 7

8 9 10 11 12 13 14 15

16 17

0 37.5 75 375 750

ng GST::AreA(502-657)

L R

5

6

3

1

7

4

151210

14

9

13

8

11

0 37.5 75 375 750

ng GST::AreA(502-657)

280 D. Gómez, I. García, C. Scazzocchio and B. Cubero

© 2003 Blackwell Publishing Ltd, Molecular Microbiology, 50, 277–289

Super-shift experiments

We wanted to determine whether the whole native AreAprotein gave, at least qualitatively, the same results as thefusion protein. Thus all probes shown in Fig. 2 were incu-bated with A. nidulans crude extracts and antibodiesagainst the AreA DNA-binding domain. In every singlecase the super-shift experiments agreed with the EMSAexperiments carried out with the fusion protein. Figure 5shows a super-shift experiment for a probe containingregion E.

Transcriptional levels of prnB and prnD in an areA null background

In Fig. 6 we show that a functional AreA protein is notessential for transcription of either prnB or prnD. ForprnD, induced levels are identical for an areA+ and anareA– null mutation. For prnB, the induced non-repressedlevels are about half of those found in the wild type (seebelow). Transcription is absolutely dependent on prolineinduction for both wild type and areA600 (Gonzalez et al.,1997 Cazelle et al., 1998; shown for the wild type inFigs 8 and 11 of this article). The pattern of repressionis, as expected, different. While in the wild type no glu-cose repression is seen, and efficient repression requiresglucose and ammonium (Sophianopoulou et al., 1993;

Gonzalez et al., 1997), a null areA mutation results inrepression by glucose only. This, which had been shownpreviously at the level of proline uptake and proline oxi-dase activity (Arst et al., 1980), is demonstrated at thelevel of mRNA steady state in Fig. 6. Repression is moredrastic for prnB than for the prnD, as expected, giventhat the pattern of repression of the prnD gene resultsfrom inducer exclusion (Arst et al., 1980; Cubero et al.,2000).

Removal of sites 1–7 does not affect transcription or regulation

We have analysed the function of the different AreAcanonical binding sites by means of deletions and pointmutations in the prnD-prnB intergenic region. This wasdone by substitution of the resident intergenic regionwith different mutated versions, thus avoiding potentialposition effects. The methodology to achieve this hasbeen described previously (Gonzalez et al., 1997). Allthe deletions and mutations employed are schematizedin Fig. 7.

The expression of the prnB and prnD genes was anal-ysed by Northern blots. This provides a semiquantitativeestimate of the effect of the mutations and avoids allartefacts due to the use of reporter genes. Figure 8 shows

Fig. 3. An example of the interference experiments carried out on all probes as described in the text and in Fig. 4. This correspond to the probe 14 defining region E. This probe shows two complexes in EMSA experiments. Only one strand is shown, Fp, free probe, C1, high mobility complex, C2, low mobility complex. Asterisks indicate interference. Both depyrimidination (panel A) and depurination (panel B) experiments reveal the protection of sites 13, 14 and 15 by the GST::AreA (663-889) fusion protein. The depurination interference experiment was repeated with an AreA cleaved 663-809 protein with identical results (panel C).

Fp C1 C2

C

AAAATTATCTCG

TTTTAATAGAGC

5'

AAATGATAAGC

TTTACTATTCG

5'

AAAATTATCTCG

TTTTAATAGAGC

5'

AAATGATAAGC

TTTACTATTCG

5'

TCAGCAATCTGGG

AGTCGTTAGACCC

5'

****

Fp C1 C2

B

Fp C1 C2

A

*****

*****

*******

*******

TCAGCAATCTGGG

AGTCGTTAGACCC

5'

****

AreA-binding sites in the prnB-prnD promoter 281


that point mutations in sites 1 and 2 (prn985, prn986) donot affect either the maximal levels or the pattern of reg-ulation of either prnB or prnD. We have deleted from theprnB-prnD promoter a 187 bp region comprising AreAsites 5–7 and leaving intact the rest of the promoter(prnD567). This deletion has no phenotypic effect on theutilization of proline. Figure 8 shows that this deletiondoes not affect the steady-state levels of prnB or prnDunder any condition.

A deletion resulting in a partially derepressed phenotype

A triple point mutation in sites 9, 10 and 11 (prn994) hasno effect on prnB and prnD expression (Fig. 8). The smalldeletion prnD980, which eliminates all sites in the 8–12cluster, does not affect significantly the maximal levels ofprnB-prnD expression, nor does it result in repression byglucose only. Surprisingly, it results in partial derepressionof the prnB and prnD genes. This is shown in Fig. 8. Thiscannot be due to a shortening of the distance betweenthe PrnA-binding sites to the TATA box or the crucial AreA-

binding sites 13/14 (see below) as an even larger deletionprnD567 does not have this effect. The derepression seenin deletion prnD980 could be explained if the occupationof the relevant GATA sites had a repressing rather than apositive effect on transcription. GATA factors with arepressing effect have been described in S. cerevisiæ(Coffman et al., 1997; Soussi-Boudekou et al., 1997) andit has been proposed that the AreB protein, a GATA factorwith presumably the same binding specificity as AreA,acts as a repressor in A. nidulans (Conlon et al., 2001).This was considered unlikely for our system, as the mul-tiple point mutation of the strongest binding sites has nophenotype. Nevertheless, we checked prnB and prnDexpression in the most extreme loss of function areBmutant available (areB901, Conlon et al., 2001). A straincarrying this mutation has a pattern of expression of theprnB and prnD genes identical to that of a wild-type strain(not shown). The prn980 deletion results in a phenotypesimilar, albeit less extreme, to that of point mutations inthe CreA-binding sites (Sophianopoulou et al., 1993). Wewished to investigate whether this deletion prevented indi-

Fig. 4. A summary of all the interference experiments and all putative GATA sites. Regions A to E belong to the prnD-prnB intergenic region and are defined in Fig. 3. Except for region A, all interference experiments were carried out in both strands. Sites contained in each of the regions defined in Fig. 3 are shown. Interfering bases are labelled with an asterisk. In grey we show all canonical GATA sites. Site 12 is not revealed by interference experiments. Interference experiments were not carried out for region B (weakly retarded in EMSA) and probe 16 (prnB-prnC intergenic region). Several non-consensus sites were revealed, these are sites 2, 3, 5, 8, 10 and 15. The position of canonical (black triangles) and non-canonical (white triangles) GATA sites in the prnB-prnD intergenic region is shown at the bottom of the figure. Distances from the prnD ATG to the first relevant base of cluster 1–3, 64 bp; of site 4, 519 bp; of cluster 5–7, 704 bp; of cluster 8–12, 1331 bp; of cluster 13–15, 1531 bp.

TACC AGATAG TTATCG CTAT-X52-TCCTAGATACAGAAATGG TCTATC AATAGC GATA-X52-AGGATCTATGTCTT

GTAG TAATCT GGCT-X7-AGCA TTATCT CACA ATATCG CGGAAGTTACCC CTATCA GGCA-X26-GACT CTATCT ACTCCATC ATTAGA CCGA-X7-TCGT AATAGA GTGT TATAGC GCCTTCAATGGG GATAGT CCGT-X26-CTGA GATAGA TGAG

9 10 118 12

CTCTATCCAT-X28-CATAG CTATCT CAATATCATCAAATGAGAGATAGGTA-X28-GTATC GATAGA GTTATAGTAGTTTACT

4

GAGTAAAAA TTATCT CGTGCTGGAAA TGATAA GCCGTTGACTCAG CAATCT GGGGCTCATTTTT AATAGA GCACGCCCTTT ACTATT CGGCAACTGAGTC GTTAGA CCCC

13 14 15

GCGG GTATCT TATGTTCTC TTATCT TGTT-X8-TCGC TGATAG TAGGCCGCC CATAGA ATACAAGAG AATAGA ACAA-X8-AGCG ACTATC ATCCG

6 75

TTGA TGATAA GATT-X12-TTAA AGATAT ACTT-X8-TGTA AGATTG CGTTAACT ACTATT CTAA-X12-AATT TCTATA TGAA-X8-ACAT TCTAAC GCAA

1 2 3

prnB-prnC

region A)

region C)

region D)

region E)

region B)

prnB

prnD



rectly CreA binding in vivo. We thus endeavoured to revealthe physiologically active CreA-binding sites, by in vivomethylation protection. Unfortunately, while we obtainedperfect in vivo methylation patterns (not shown), we couldnot reveal any CreA binding in vivo. The limitations of thein vivo protection methylation technique in A. nidulanshave been discussed by Muro-Pastor et al. (1999). Thusthis point could not be investigated further.

The proximal sites 13 and 14 are important for prnB regulation

This has been determined by constructing both a smalldeletion and point mutations. prnD981 is a 21 bp deletionthat removes site 14. prn1300 is a point mutation elimi-nating site 13, while prn1314 is a double mutant eliminat-ing both sites 13 and 14. The double mutant diminishesclearly the induced level of prnB, but not of prnD. Thethree mutations have a very similar effect on the integrationof carbon and nitrogen repression. In all these mutatedstrains, a clear, albeit incomplete, repression by glucosealone can be seen. Figure 9 shows the transcript levelsunder different conditions and Table 1 shows separately

Fig. 5. Super-shift experiment for probe 14 containing region E (AreA-binding sites 13–15). 1: free probe; 2: 20 mg protein of cell-free extract added; 3, 4 and 5: as track 2, plus 1, 3 and 5 ml, respectively, of a 1:1000 dilution of the AreA antibody (see Experimental proce-dures). fp, free probe; bp, bound probe; ss, antibody-AreA-DNA complex.

1 2 3 4 5

fp

bp

ss

Fig. 6. Effect of an areA null mutation on prnB and prnD transcription. Strains were grown in liquid minimal medium with the appropriated supplements plus 1% glucose and 5 mM ammonium-L(+)-tartrate during 7 h at 37∞C, and then cultures were filtered and shifted to minimal media containing the appropriate supplements and neutral carbon and nitrogen sources (5 mM urea and 0.1% fructose) plus 20 mM proline (I), 20 mM proline and a repressing carbon source (1% glucose, IG), or 20 mM proline plus both repressing carbon and nitrogen sources (1% glucose and 20 mM ammonium-L(+)-tartrate, ING). A quantitative analysis is shown under the Northern blot as a percentage of the wild-type induced level grown in parallel in the same experiment.

I IG ING

areA+ areA600

prnB

prnD

acnA

100 97±4 30±12 42±0.7 13±2 7±3

100 97±3 50±16 113±20 64±4 46±1

I IG ING

Table 1. Effects of a null areA mutation and mutations on AreA-binding sites 13/14 on prnB transcription levels.

Relevantgenotype

Inducedvalue

% Repressibilityby glucose

% Repressibilty by glucose+ ammonium

areA+ 100 3 70areA600 42 69 83prn+ 100 18 76prnD981 80 37 68prn1300 87 33 76prn1314 65 35 72

The values of this table are derived from Figs 6 and 9. The wild type is included twice, because the growth conditions are not identical in the twosets of experiments (see legends to the respective figures). The induced values are the percentage averages of the fully induced wild type in thesame experiment. The percentage repressibility values are calculated for each strain in relation to its own fully induced value. These values arecalculated from the relevant values of Figs 6 and 9 where standard errors are also shown.



the effects of these mutations on transcription activationand glucose repressibility. The values for an areA600strain are also included for comparative purposes.

Does the TATA box proximal to the start point of prnB transcription have a physiological function?

Many fungal genes do not show a typical TATA box in theirpromoters. In the prn cluster, only the prnB gene does.This sequence, TATAA is 28 bp before the start of tran-scription of prnB (S. Demais and C. Scazzocchio, unpubl.results). Transcription factors may assist in the recruitmentof a TATA-binding protein to the TATA box (Triezenberg,1995; Lee and Young, 1998). The nearest PrnA site

detected by both in vitro and in vivo footprinting is 940 bpfrom the TATA box (Gómez et al., 2002). On the otherhand, AreA-binding site 14 is only 50 bp from the TATAbox. If AreA promotes transcriptional activation of prnB byrecruiting a TATA-binding protein at the position of theTATA box, we should expect that a mutation in the TATAbox would have the same effect as mutations in sites 13and 14. An A. nidulans gene coding for a typical TATA-binding protein has been characterized (Kucharski andBartnik, 1997). We show in Fig. 10 that there is in A.nidulans crude extracts a protein capable to bind the prnBTATA box. We have deleted the sequence TATA and anal-ysed the transcription of both the prnB and prnD genes.While this deletion decreases clearly prnB (but not prnD)expression, the pattern of regulation of prnB isunchanged. Noticeably, and differently from an areA nullmutant, the deleted strain necessitates both the presenceof glucose and ammonium for efficient repression tooccur. The effect of deleting the TATA box is far less drasticthan that of a deletion of prnA (Fig. 11).

Discussion

We have detected 15 AreA-binding sites in the prnD-prnBintergenic region. Some of these sites are not consensusHGATAR sites, while one consensus site (12) surprisinglyis not revealed by missing-base interference. In vitro workhas shown that WGATTR sites are recovered among ran-dom oligonucleotides revealed by binding with the verte-brate factor GATA-1 (Ko and Engel, 1993; Merika andOrkin, 1993; Whyatt et al., 1993). Except for contacts withthe phosphate backbone by the carboxy-terminus of theDNA-binding domain, AreA and avian GATA-1 bind iden-tically to DNA (Starich et al., 1998), thus the binding toWGATTR sites is not too surprising. The recovery of non-consensus sequences can be rationalized as follows. Allthe non-canonical sites are within 20 bp of a canonicalsite. On the other hand the canonical site 12, which is notrevealed by the interference experiments, is 34 bp fromany other site. Site 4, which is also canonical but is faraway from any other site (canonical or non-canonical),shows very low affinity for the AreA protein in vitro. Pre-vious work has shown cooperative or synergistic interac-tions between the DNA-binding domains of GATA factors,including AreA (Ravagnani et al., 1997) and its N. crassaand S. cerevisiae homologues (Minehart and Magasanik,1992; Feng et al., 1993). Low-affinity sites would bindwhen situated at a distance to a high-affinity site compat-ible with direct interactions of the DNA-binding domains.The interference experiments with the AreA-bindingdomain show that this cooperativity is not an artefact dueto GST dimerization. The fact that super-shift experimentswith crude extracts reveal the same binding complexes asthe AreA-GST or the AreA cleaved protein supports this

Fig. 7. Deletions and mutations in the prnB-prnD intergenic region. Canonical and non-canonical GATA sites are indicated, respectively, by black and white triangles (see Fig. 4). Asterisks indicate a point mutation in a binding site, while a rectangle represents a deletion. AreA-binding sites are numbered as in Fig. 4. The scheme at the bottom of the figure shows the relative position of the AreA 13/14 binding sites, of the two physiologically relevant CreA-binding sites (ovals, Sophianopoulou et al., 1993; Cubero and Scazzocchio, 1994), of the three PrnA-binding sites (arrows, Gómez et al., 2002) and of the prnB TATA box (black circle).

prn∆∆∆∆567

**prn986

*prn985

prn1314

*

*

prn1300

*

prn∆∆∆∆980

prn+

prnB

prnD

1-2-3 4

5-6 8-9-10-11-12 13-15

7 14

prn994

***

prn∆∆∆∆981

prn+



conclusion. It has been described previously that physio-logically important GATA sites are in either a tandem ormultiple organization (Ravagnani et al., 1997; Muro-Pastor et al., 1999; Rai et al., 1999).

A null mutation in areA changes the pattern of repres-sion of prnB. While in an areA+ background repressionnecessitates the presence of both glucose and ammo-nium, in an areA– background the sole presence of glu-cose suffices to repress. In this strain, ammonium has anadditional repressive effect which cannot be mediated byAreA. This is most likely due to a direct effect of ammo-nium on transporters as shown by J. Valdez-Taubas, L.Harispe, C. Scazzocchio, L. Gorfinkiel and A. L. Rosa(submitted) thus intensifying inducer exclusion.

In this article, we endeavoured to determine which cis-acting, AreA-binding site(s) are responsible for the by-pass of CreA-mediated glucose repression.

No mutation of AreA-binding sites affects significantlythe induced transcriptional level of prnD, which is in agree-ment with the results with the strain carrying the nullmutation areA600 and the previous finding that repressionacts on prnD through inducer exclusion. Everything indi-cates that AreA is not directly involved in prnD transcription.

There is a multiplicity of sites in the prnD-prnB inter-genic region and a surprising result is that only mutationsof the prnB proximal sites 13 and 14 have a clear-cuteffect on both the transcriptional levels and the pattern ofregulation. We will consider the pair 13/14 as a unit in thefollowing discussion.

Conceptually, we can distinguish two roles of AreA. Oneis to set the maximal level of expression of prnB; thesecond is to bypass carbon catabolite repression medi-ated by CreA in the presence of glucose. Sites 13/14 areinvolved in both functions.

Fig. 8. Deletions and point mutations in prnD proximal and central GATA sites. prnD567 is a 188 bp deletion eliminating sites 5–7. prnD980 is a 115 bp deletion eliminating sites 8–12. prn985, prn986 and prn994 are point mutations eliminating sites 2, 1–2 and 9–11 respectively (see Experimental procedures and Fig. 7). 106 spores per ml of each strain were inoculated in liquid minimal medium with the appropriate supplements plus 0.1% fructose as carbon source and 5 mM urea as nitrogen source. Mycelia were grown for 8 h at 37∞C and then incubated 2 additional hours at 37∞C (NI), or induced with 20 mM L-proline (I), or induced with 20 mM L-proline and simultaneously either carbon repressed (1% glucose, IG), nitrogen repressed (20 mM ammonium-L(+)-tartrate (IN), or carbon and nitrogen repressed (ING), and incubated 2 h at 37∞C.

acnA

prnD

I IG IN INGNI

prn+ prn985 prn986I IG IN INGNI I IG IN INGNI

prn+ prn∆∆∆∆567I IG IN ING I IG IN ING

prnD

acnA

prnB

prn+ prn994I IG IN ING I IG IN ING

acnA

prnB

prn+ prn∆∆∆∆980I IG IN ING I IG IN INGNINI

prnD

acnA

prnB



Mutation of sites 13/14 affects the maximal inducedlevel of prnB, but not of prnD. However, the effect of themutations is not as extreme as that of a null mutation ofAreA (see Table 1). It is surprising that none of the othercombinations of mutations and deletions tested by usaffect the prnB-induced level. What we can conclude fromour experiments is that only the sites 13/14 are importanton their own, but the quantitative effect of AreA demandsbinding also to other sites, which cannot be detected bysingle or clustered mutations. There would be then a ‘mas-ter’ AreA-binding site(s) (13/14) proximal to the prnB tran-scriptional start, and a redundancy of minor sites which

act additively or synergistically with these sites. Redun-dancy of AreA-binding sites has been shown, albeit in aless extreme form, for the bidirectional niiA-niaD promoterof A. nidulans (Muro-Pastor et al., 1999).

An areA null mutation has also some effect on prnDtranscriptional regulation, an effect that is not seen in

Fig. 9. Mutations in prnB proximal GATA sites. prnD981 is a 21 bp deletion removing site 14, all other mutations are point mutations. prn1300 is a point mutation eliminating site 13, and prn1314 is a point mutation in sites 13 and 14 (see Experimental procedures and Fig. 7). The quantification of the signal relative to the wild-type induced level is shown under each Northern blot (mean ± standard deviation of three independent experiments). Culture conditions were as in Fig. 8.

prnD

prn+ prn∆∆∆∆981I IG IN ING

100 82±2 111±15 27±3 80±1 50±1 85±20 25±0.5

prnB

acnA

I IG IN ING

acnA

prnB

prnD

prn+ prn1300I IG IN ING I IG IN ING I IG IN ING

prn1314

100 82±15 108±2 21±2 87±8 58±2 74±13 21±9 65±12 42±5 73±7 18±6

Fig. 10. prnB TATA-box in vitro footprinting. DNase I protection with a crude protein extract. FP, digestion in the absence of protein; C, digestion in the presence of 20 mg of protein extract. The protected region is shown inside a grey rectangle, the putative TATA-box within an open box.

G FP1 C1

5'GGAATCACTTTTATAACACCCAG3'

NI I NI I

prnA+ prnA404prn+ prnB∆∆∆∆TATA

NI I IG IN ING NI I IG IN ING

prnB

prnD

acnA

Fig. 11. Effect of the prnB TATA box deletion in prnB and prnD transcription and regulation. The prnBDTATA strain is a 11 bp deletion eliminating the putative prnB TATA box (see Experimental procedures). The effect of a deletion of the gene encoding the positive transcription factor PrnA is also shown.



mutations of sites 13/14. This is in agreement with previ-ous work (Cubero et al., 2000) that shows that repressionof prnD is due to inducer exclusion. There is still substan-tial expression of the transporter gene, prnB, in mutationsof sites 13/14; and thus enough proline enters the cell toinduce prnD.

Sites 13/14 are also involved in the integration of carbonand nitrogen metabolite repression, the three mutationstested increasing equally repressibility by glucose in theabsence of ammonium, thus affecting the by-pass ofCreA-mediated repression by an active AreA protein (seeTable 1). Again, as no other mutation or combination ofmutations affects this process we do not know which sitesmay act additively or synergistically with sites 13/14.

The proximity of AreA sites 13/14 to the prnB TATA boxhas led us to investigate the function of this element.Deletion of this element does not mimic the phenotype ofa prnA deletion (Cazelle et al., 1998 and this article,Fig. 11), nor the similarly drastic phenotype of mutationsof the two PrnA consensus binding sites in the prnD-prnBintergenic region (Gómez, 1999; I. García, D. Gómez, andC. Scazzocchio, unpubl. results). Thus we can concludethat the TATA box is unnecessary for inducible transcrip-tion. We should note that the nearest PrnA-binding site is960 bp from the TATA box. A deletion of the TATA box anda null areA mutation have similar effects on the inducedlevels of transcription but the deletion of the TATA boxdoes not mimic the regulatory pattern of the areA600mutation or of a mutation of the AreA-binding sites 13/14.Thus the TATA box is not necessary for AreA bypass ofCreA-mediated repression.

The prnD-prnB intergenic region is a bidirectional pro-moter vis-à-vis induction, mediated by the PrnA protein(Gómez et al., 2002; I. García, D. Gómez, and C. Scaz-zocchio, unpubl. results). Other elements, such as theCreA-binding sites (Sophianopoulou et al., 1993; Cuberoand Scazzocchio, 1994; Cubero et al., 2000), AreA-bind-ing sites 13/14 and not surprisingly the prnB proximalTATA box act only on prnB. This is consistent with a modelwhere specific induction mediated by the PrnA activatorwould act on each individual gene while the other actors(CreA and AreA) act primarily and perhaps exclusivelyregulating the expression of the proline transporter gene,prnB (Arst et al., 1980; Cubero et al., 2000).

Experimental procedures

Plasmids and AreA–GST fusion protein

Probes from the prnD-prnB intergenic region were obtainedby enzymatic restriction of the pCAR plasmid. This plasmidcontains the complete prnD-prnB intergenic region in theNcoI site of pBluescript-II KS+ plasmid. The plasmid bAN926contains a 1.1 kb XhoI–Asp718 fragment of bAN930(Gavrias, 1992; Gonzalez et al., 1997). The GST::AreA (663–

809) protein, containing the entire DNA-binding domain(Langdon et al., 1995; Wilson and Arst, 1998 for review;Manfield et al., 2000), was kindly provided by Dr J. Strauss(Strauss, 1993).

Electrophoretic mobility shift assays (EMSA)

Binding assays were performed as described previously(Cubero and Scazzocchio, 1994). DNA restriction fragmentswere end-labelled with the appropriate [a-32P]-dNTP usingSequenase version 2.0 (USB). Binding assays were per-formed in 20 ml reaction mixtures containing 4 ng of labelledDNA, 2 mg of poly-(dI–dC), 25 mM Tris-HCl (pH 8.0), 100 mMKCl, 4 mM spermidine, 10% glycerol and variables amountsof GST::AreA (663–809) protein. After incubation at roomtemperature for 15 min, the reaction mixtures were run at18 V cm-1 through a non-denaturing 6% polyacrylamide-10%glycerol gel in 0.25¥ TBE buffer at 4∞C.

Missing-base interference assays

The depurination method followed Brunelle and Schleif(1987), as adapted by Suárez et al. (1995). A depyrimidina-tion interference assay was carried out as described byBrunelle and Schleif (1987), modified as follows: depyrimidi-nation mixtures, 20 ml, containing 50 ng of end labelled-probeand 2 mg of yeast tRNA were chilled on ice for 5 min. Hydra-zine (30 ml) was added, and the mixture was incubated for7 min at 20∞C. The reactions were stopped by adding 60 mlof 3 M sodium acetate pH 7 and the DNA was ethanol pre-cipitated. The precipitation was repeated twice and the DNAwas washed with 70% ethanol and resuspended in 10 mlwater. Binding reactions and gel retardation assays wereperformed as described above; bound and free probes wererecovered from the gel by electro-elution and cleaved withpiperidine. The reaction products were separated on a 6%polyacrylamide-urea sequencing gel.

DNase I protection assay

Four ng of labelled DNA probe was incubated with 20 mgprotein extract. Parallel gel shift experiments showed that thewhole probe is bound under these conditions. The mixturewas incubated with 0.01 U of DNase I for 15 min at 4∞C, thenDNA was extracted with phenol and ethanol precipitated.After denaturation at 95∞C for 5 min, the products were sep-arated on a 6% polyacrylamide-urea sequencing gel.

Strains and growth conditions

Wild-type strain was pabaA1. The recipient strain for deletionand point mutation experiments was prn301 pabaA1 riboB2.This strain carries a deletion removing 0.5 kb of the 5¢ regionof prnD, 1 kb of the 5¢ end of prnB and all of the prnD-prnBintergenic region and therefore is unable to use proline as acarbon or nitrogen source (Arst et al., 1981). areA600 is anearly chain termination, null mutation (Bailey and Arst, 1975;Kudla et al., 1990). The strain used was areA600 biA1 sb43.The prnA loss-of-function strain was prnA404 pabaA1, whichbears a deletion eliminating nucleotides +68 to +1510 in theprnA open reading frame (Cazelle et al., 1998; 1999).



pabaA1, riboB2, biA1 and sb43 are standard auxotrophicmarkers (Clutterbuck, 1993).

Isolation of RNA and quantitative analysis

Total RNA was isolated from A. nidulans as described byGonzalez et al. (1997) or using the RNA-Plus RNA ExtractionSolution from Q-Biogene (CA, USA) and following themanufacturer’s instructions. RNA was separated on glyoxalagarose gels as described by Sambrook and Russell (2001).Hybridization was carried out in 0.5 M sodium orthophos-phate, pH 7, 1 mM EDTA, 7% SDS and 1% BSA at 65∞C forat least 14 h. The DNA fragments used as probes were asfollows: the 1.8 kb PstI–PstI fragment of pAN225 (Sophian-opoulou and Scazzocchio, 1989) was used for the detectionof prnB transcription; the 0.4 kb HindIII fragment of pAN910(Gavrias, 1992) was used for prnD mRNA detection and the2.5 kb BamHI–KpnI fragment of plasmid pSF5 (Fidel et al.,1988) was used to detect the actin mRNA of A. nidulans asa internal control to monitor the amount of loaded mRNA.The intensities of RNA bands were quantified with a 400-APhosphoImager (Molecular Dynamics). Data were analysedwith ImageQuant. For all Northern blots presented in thisarticle, a minimum of two repetitions of every experimentwere carried out with consistent results. Means and standarderrors are shown in the crucial experiments (see legends tothe figures).

Site-directed mutagenesis and construction of the mutant Aspergillus strains

In order to obtain the corresponding deletions of the inter-genic region, deleted plasmids were constructed by restric-tion and ligation of bAN926. Deletion of the prnB TATA boxwas performed by in vitro mutagenesis on a single strandDNA (Kunkel et al., 1991) using the bAN926 plasmid and theoligonucleotide 5¢-GCTCAGGAATCACCCAGCCGGG-3¢.Site-directed mutagenesis of GATA sites were performed onthe wild-type or mutated bAN926 plamid using overlap PCRmethods and Pfu polymerase, according to manufacturer’sinstructions (Stratagene). Oligonucleotides used for pointmutations of the GATA site were as follows: site 1, 5¢-CCTTGCAAGTATATATTTAACAGCAC-3¢; site 2, 5¢-CCTTGCAAGTATATATTTAACAGCAC-3¢; site 9, 5¢-GCGATATTGTGAGACAATGCTGACGC-3¢; site 10, 5¢-GGTAACTTCCGCTATATTGTGAGATAATGC-3¢; site 11, 5¢-TCGAGGGTGCCTTATAGGGGTAACTTCC-3¢; site 13, 5¢-CAGCACGACATAATTTTTACTCATGG-3¢; site 14, 5¢-CGT GCTGGAAATGCTAAGCCGTTGACTC-3¢. Only one oligonucleotide ofeach complementary pair is shown. The mutation to beintroduced is shown in bold and underlined.

Mutated plasmids were used to transform the A. nidulansprn301 strain, using the method of Tilburn et al. (1983). Theuse of deletion prnD301 allows exact replacements in the prncluster by the bAN926 plasmid or its derivatives (Gonzalezet al., 1997). Transformants were selected on media contain-ing L-proline as the sole nitrogen source (Gonzalez et al.,1997). In every case, the relevant sequences were amplifiedby PCR and the newly introduced changes checked by

sequencing (Sanger et al., 1977; automatic sequencing,MWG Biotech).

Crude extracts of A. nidulans and super-shift assays

Crude extracts were obtained as described by Oestreicheret al. (1997). For the super-shift assays, 20 mg total proteinswere used in the binding reaction. After incubation at 25∞Cfor 15 min, the anti-AreA antibody was added to the mixtureand the reaction was continued for 5 min at the same tem-perature. The anti-AreA antibody was kindly provided by DrM. Caddick (Peters, 1994).

Acknowledgements

We thank Dr Mark Caddick for providing the areB901 strainand the anti-AreA antibody. D.G. was supported by a predoc-toral scholarship from the French Ministère de l’EducationNationale, de l’Enseignement Supérieur et de la Rechercheand a postdoctoral fellowship from ARC. I.G. was supportedby a postdoctoral fellowships of the Spanish Ministry of Edu-cation and the EU Marie Curie programme. B.C. was sup-ported by INRA and European Union contract BIO2CT930.This work was supported by the Université Paris-Sud, theCNRS, the IUF and the EU contract BIO4-CT96-0535.

References

Andrianopoulos, A., Kourambas, S., Sharp, J.A., Davis, M.A.,and Hynes, M.J. (1998) Characterization of the Aspergillusnidulans nmrA gene involved in nitrogen metabolite repres-sion. J Bacteriol 180: 1973–1977.

Arst, H.N., Jr, and Cove, D.J. (1973) Nitrogen metaboliterepression in Aspergillus nidulans. Mol Gen Genet 126:111–141.

Arst, H.N., Jr, and MacDonald, D.W. (1975) A gene clusterin Aspergillus nidulans with an internally located cis-actingregulatory region. Nature 254: 26–31.

Arst, H.N., Jr, and Scazzocchio, C. (1985) Formal geneticsand molecular biology of the control of gene expression inAspergillus nidulans. In Gene Manipulations in Fungi. Ben-net, J.W., and Lasure, L.L. (eds). Orlando: AcademicPress, pp. 309–343.

Arst, H.N., Jr, MacDonald, D.W., and Jones, S.A. (1980)Regulation of proline transport in Aspergillus nidulans. JGen Microbiol 116: 285–294.

Arst, H.N., Jr, Jones, S.A., and Bailey, C.R. (1981) A methodfor the selection of deletion mutations in the L-prolinecatabolism gene cluster of Aspergillus nidulans. Genet Res38: 171–195.

Bailey, C., and Arst, H.N., Jr (1975) Carbon catabolite repres-sion in Aspergillus nidulans. Eur J Biochem 51: 573–577.

Brandriss, M.C., and Magasanik, B. (1979a) Genetics andphysiology of proline utilization in Saccharomyces cerevi-siae: mutation causing constitutive enzyme expression. JBacteriol 140: 504–507.

Brandriss, M.C., and Magasanik, B. (1979b) Genetics andphysiology of proline utilization in Saccharomyces cerevi-siae: enzyme induction by proline. J Bacteriol 140: 498–503.



Brunelle, A., and Schleif, R.F. (1987) Missing contact probingof DNA–protein interactions. Proc Natl Acad Sci USA 84:6673–6676.

Caddick, M.X. (1994) Nitrogen metabolite repression. ProgInd Microbiol 29: 323–353.

Cazelle, B., Pokorska, A., Hull, E., Green, P.M., Stanway,G., and Scazzocchio, C. (1998) Sequence, exon-intronorganization, transcription and mutational analysis ofprnA, the gene encoding the transcriptional activator ofthe prn gene cluster in Aspergillus nidulans. Mol Microbiol28: 355–370.

Cazelle, B., Pokorska, A., Hull, E., Green, P.M., Stanway, G.,and Scazzocchio, C. (1999) Sequence, exon-intron orga-nization, transcription and mutational analysis of prnA, thegene encoding the transcriptional activator of the prn genecluster in Aspergillus nidulans (Erratum). Mol Microbiol 31:1283.

Clutterbuck, A.J. (1993) Aspergillus nidulans. Genet Maps 6:3.71–3.73.84.

Coffman, J.A., Rai, R., Loprete, D.M., Cunningham, T., Svet-lov, V., and Cooper, T.G. (1997) Cross regulation of fourGATA factors that control nitrogen catabolic gene expres-sion in Saccharomyces cerevisiae. J Bacteriol 179: 3416–3429.

Conlon, H., Zadra, I., Haas, H., Arst, H.N., Jr, Jones, M.G.,and Caddick, M.X. (2001) The Aspergillus nidulans GATAtranscription factor gene areB encodes at least three pro-teins and features three classes of mutation. Mol Microbiol40: 361–375.

Cubero, B., and Scazzocchio, C. (1994) Two different, adja-cent and divergent zinc finger binding sites are necessaryfor CREA-mediated carbon catabolite repression in theproline gene cluster of Aspergillus nidulans. EMBO J 13:407–415.

Cubero, B., Gómez, D., and Scazzocchio, C. (2000) Metab-olite repression and inducer exclusion in the proline utili-zation gene cluster of Aspergillus nidulans. J Bacteriol 182:233–235.

Daugherty, J.R., Rai, R., el Berry, H.M., and Cooper, T.G.(1993) Regulatory circuit for responses of nitrogen cata-bolic gene expression to the GLN3 and DAL80 proteinsand nitrogen catabolite repression in Saccharomyces cer-evisiae. J Bacteriol 175: 64–73.

Davis, M.A., Kelly, J.M., and Hynes, M.J. (1993) Fungal cat-abolic gene regulation: molecular genetic analysis of theamdS gene of Aspergillus nidulans. Genetica 90: 133–145.

Feng, B., Xiao, X., and Marzluf, G.A. (1993) Recognition ofspecific nucleotide bases and cooperative DNA binding bythe trans-acting nitrogen regulatory protein NIT2 of Neuro-spora crassa. Nucleic Acids Res 21: 3989–3996.

Fidel, S., Doonan, J.H., and Morris, N.R. (1988) Aspergillusnidulans contains a single actin gene which has uniqueintron locations and encodes a gamma-actin. Gene 70:283–293.

Gavrias, V. (1992) Etudes moléculaires sur la régulation etla structure du groupe de gènes prn chez Aspergillus nid-ulans. PhD Thesis. Orsay, France: Université Paris-Sud XI.

Gómez, D. (1999) Etude de la régulation transcriptionnelledes gènes prn, catabolisme de la proline, chez Aspergillusnidulans. PhD Thesis. Orsay, France: Université Paris-SudXI.

Gómez, D., Cubero, B., Cecchetto, G., and Scazzocchio, C.(2002) PrnA, a Zn2Cys6 activator with a unique DNA rec-ognition mode, requires inducer for in vivo binding. MolMicrobiol 44: 585–597.

Gonzalez, R., Gavrias, V., Gómez, D., Scazzocchio, C., andCubero, B. (1997) The integration of nitrogen and carboncatabolite repression in Aspergillus nidulans requires theGATA factor AreA and an additional positive-acting ele-ment, ADA. EMBO J 16: 2937–2944.

Gorfinkiel, L., Diallinas, G., and Scazzocchio, C. (1993)Sequence and regulation of the uapA gene encoding a uricacid-xanthine permease in the fungus Aspergillus nidu-lans. J Biol Chem 268: 23376–23381.

Hull, E.P., Green, P.M., Arst, H.N., Jr, and Scazzocchio, C.(1989) Cloning and physical characterization of the L-pro-line catabolism gene cluster of Aspergillus nidulans. MolMicrobiol 3: 553–559.

Jones, S.A., Arst, H.N., Jr, and MacDonald, D.W. (1981)Gene roles in the prn cluster of Aspergillus nidulans. CurrGenet 27: 150–158.

Ko, L.J., and Engel, J.D. (1993) DNA-binding specificities ofthe GATA transcription factor family. Mol Cell Biol 13:4011–4022.

Kucharski, R., and Bartnik, E. (1997) The TBP gene fromAspergillus nidulans-structure and expression in Saccha-romyces cerevisiae. Microbiology 143: 1263–1270.

Kudla, B., Caddick, M.X., Langdon, T., Martinez-Rossi, N.M.,Bennett, C.F., et al. (1990) The regulatory gene areA medi-ating nitrogen metabolite repression in Aspergillus nidulans.Mutations affecting specificity of gene activation alter a loopresidue of a putative zinc finger. EMBO J 9: 1355–1364.

Kunkel, T.A., Bebenek, K., and McClary, J. (1991) Efficientsite-directed mutagenesis using uracil-containing DNA.Methods Enzymol 204: 125–139.

Langdon, T., Sheerins, A., Ravagnani, A., Gielkens, M., Cad-dick, M.X., and Arst, H.N., Jr (1995) Mutational analysisreveals dispensability of the N-terminal region of theAspergillus transcription factor mediating nitrogen metab-olite repression. Mol Microbiol 17: 877–888.

Lee, T.I., and Young, R.A. (1998) Regulation of gene expres-sion by TBP-associated proteins. Genes Dev 12: 1398–1408.

Manfield, I.W., Reynolds, L.A., Gittins, J., and Kneale, G.G.(2000) The DNA-binding domain of the gene regulatoryprotein AreA extends beyond the minimal zinc-finger regionconserved between GATA proteins. Biochim Biophys Acta1493: 325–332.

Merika, M., and Orkin, S.H. (1993) DNA-binding specificityof GATA family transcription factors. Mol Cell Biol 13:3999–4010.

Minehart, P.L., and Magasanik, B. (1992) Sequence of theGLN1 gene of Saccharomyces cerevisiae: role of theupstream region in regulation of glutamine synthetaseexpression. J Bacteriol 174: 1828–1836.

Morozov, I.Y., Martinez, M.G., Jones, M.G., and Caddick,M.X. (2000) A defined sequence within the 3¢ UTR of theareA transcript is sufficient to mediate nitrogen metabolitesignalling via accelerated deadenylation. Mol Microbiol 37:1248–1257.

Morozov, I.Y., Galbis-Martinez, M., Jones, M.G., and Cad-dick, M.X. (2001) Characterization of nitrogen metabolite



signalling in Aspergillus via the regulated degradation ofareA mRNA. Mol Microbiol 42: 269–277.

Muro-Pastor, M.I., Gonzalez, R., Strauss, J., Narendja, F.,and Scazzocchio, C. (1999) The GATA factor AreA isessential for chromatin remodelling in a eukaryotic bidirec-tional promoter. EMBO J 18: 1584–1597.

Oestreicher, N., and Scazzocchio, C. (1995) A single aminoacid change in a pathway-specific transcription factorresults in differing degrees of constitutivity, hyperinducibilityand derepression of several structural genes. J Mol Biol 16(249): 693–699.

Oestreicher, N., Scazzocchio, C., and Suárez, T. (1997) Muta-tions in a dispensable region of the UaY transcription factorof Aspergillus nidulans differentially affect the expressionof structural genes. Mol Microbiol 24: 1189–1199.

Peters, D.G. (1994) Characterisation of GATA binding pro-teins using Aspergillus nidulans as a model organism. PhDThesis. Liverpool: University of Liverpool.

Platt, A., Langdon, T., Arst, H.N., Jr, Kirk, D., Tollervey, D.,Sanchez, J.M., and Caddick, M.X. (1996) Nitrogen metab-olite signalling involves the C-terminus and the GATAdomain of the Aspergillus transcription factor AREA andthe 3¢ untranslated region of its mRNA. EMBO J 15: 2791–2801.

Rai, R., Daugherty, J.R., Cunningham, T.S., and Cooper,T.G. (1999) Overlapping positive and negative GATA factorbinding sites mediate inducible DAL7 gene expression inSaccharomyces cerevisiae. J Biol Chem 274: 28026–28034.

Ravagnani, A., Gorfinkiel, L., Langdon, T., Diallinas, G., Adj-adj, E., Demais, S., et al. (1997) Subtle hydrophobic inter-actions between the seventh residue of the zinc finger loopand the first base of an HGATAR sequence determinepromoter-specific recognition by the Aspergillus nidulansGATA factor AreA. EMBO J 16: 3974–3986.

Sambrook, J., and Russell, D. (2001) Molecular Cloning: aLaboratory Manual. Cold Spring Harbor, NY: Cold SpringHarbor Laboratory Press.

Sanger, F., Nicklen, S., and Coulson, A.R. (1977) DNAsequencing with chain-terminating inhibitors. Proc NatlAcad Sci USA 74: 5463–5467.

Scazzocchio, C. (1994) The proline utilisation pathway, his-tory and beyond. Prog Ind Microbiol 29: 259–277.

Scazzocchio, C. (2000) The fungal GATA factors. Curr OpinMicrobiol 3: 126–131.

Sharma, K.K., and Arst, H.N., Jr (1985) The product of theregulatory gene of the proline catabolism gene cluster ofAspergillus nidulans is a positive-acting protein. CurrGenet 9: 299–304.

Sophianopoulou, V., and Scazzocchio, C. (1989) The prolinetransport protein of Aspergillus nidulans is very similar toamino acid transporters of Saccharomyces cerevisiae. MolMicrobiol 3: 705–714.

Sophianopoulou, V., Suárez, T., Diallinas, G., and Scazzoc-chio, C. (1993) Operator derepressed mutations in theproline utilisation gene cluster of Aspergillus nidulans. MolGen Genet 236: 209–213.

Soussi-Boudekou, S., Vissers, S., Urrestarazu, A., Jauniaux,J.C., and Andre, B. (1997) Gzf3p, a fourth GATA factorinvolved in nitrogen-regulated transcription in Saccharomy-ces cerevisiae. Mol Microbiol 23: 1157–1168.

Starich, M.R., Wikstrom, M., Arst, H.N., Jr, Clore, G.M., andGronenborn, A.M. (1998) The solution structure of a fungalAREA protein-DNA complex: an alternative binding modefor the basic carboxyl tail of GATA factors. J Mol Biol 277:605–620.

Strauss, J. (1993) Bases moléculaires de la régulation desgènes de la voie d’assimilation du nitrate chez Aspergillusnidulans. PhD Thesis. Orsay, France: Université Paris-SudXI.

Suárez, T., de Queiroz, M.V., Oestreicher, N., and Scazzoc-chio, C. (1995) The sequence and binding specificity ofUaY, the specific regulator of the purine utilization pathwayin Aspergillus nidulans, suggest an evolutionary relation-ship with the PPR1 protein of Saccharomyces cerevisiae.EMBO J 14: 1453–1467.

Tilburn, J., Scazzocchio, C., Taylor, G.G., Zabicky-Zissman,J.H., Lockington, R.A., and Davies, R.W. (1983) Transfor-mation by integration in Aspergillus nidulans. Gene 26:205–221.

Triezenberg, S.J. (1995) Structure and function of transcrip-tional activation domains. Curr Opin Genet Dev 5: 190–196.

Whyatt, D.J., deBoer, E., and Grosveld, F. (1993) The twozinc finger-like domains of GATA-1 have different DNAbinding specificities. EMBO J 12: 4993–5005.

Wiame, J.M., Grenson, M., and Arst, H.N., Jr (1985) Nitrogencatabolite repression in yeasts and filamentous fungi. AdvMicrob Physiol 26: 1–88.

Wilson, R.A., and Arst, H.N., Jr (1998) Mutational analysis ofAREA, a transcriptional activator mediating nitrogenmetabolite repression in Aspergillus nidulans and a mem-ber of the ‘streetwise’ GATA family of transcription factors.Microbiol Mol Biol Rev 62: 586–596.

Xu, S., Falvey, D.A., and Brandriss, M.C. (1995) Roles ofURE2 and GLN3 in the proline utilization pathway inSaccharomyces cerevisiae. Mol Cell Biol 15: 2321–2330.

Multiple GATA sites: protein binding and physiological relevance for the regulation of the proline...

Documents

Transcript of Multiple GATA sites: protein binding and physiological relevance for the regulation of the proline...