This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

Author's personal copy

Short Communication

Mitochondrial and nuclear phylogeny of circum-Mediterranean tree frogsfrom the Hyla arborea group

Matthias Stöck a,*, Sylvain Dubey a,b, Cornelya Klütsch c,d, Spartak N. Litvinchuk e, Ulrich Scheidt f,Nicolas Perrin a

a Department of Ecology and Evolution, University of Lausanne, Biophore, CH-1015 Lausanne, Switzerlandb Heydon-Laurence-Building A08, University of Sydney, NSW 2006, Australiac Zoologisches Forschungsmuseum Alexander Koenig, Adenauerallee 160, D-53113 Bonn, Germanyd KTH—Royal Institute of Technology, Gene Technology, Roslagstullsbacken 21, 10691 Stockholm, Swedene Institute of Cytology, Russian Academy of Sciences, Tikhoretsky pr. 4, 194064 St. Petersburg, Russiaf Museum für Naturkunde, Grosse Arche 14, D-99084 Erfurt, Germany

a r t i c l e i n f o

Article history:Received 8 April 2008Revised 25 July 2008Accepted 28 August 2008Available online 12 September 2008

1. Introduction

The Hylidae constitute one of the largest (ca. 870 species) fam-ilies of anurans, mostly distributed in the neo-tropics. Within therich (ca. 590 species) subfamily Hylinae, the monophyletic genusHyla comprises 31 species from Holarctic regions (N-America, Asia,Europe and N-Africa) clustered into four species groups (arborea,cinerea, versicolor and eximia; Faivovich et al. 2005). Few of the cur-rently 16 members of the Hyla arborea group have been included inmolecular phylogenies (Faivovich et al., 2005; Smith et al., 2005;Wiens et al., 2005) and no phylogeny of Western Palearctic specieshas been proposed. The relationships among the seven so-far ac-cepted Western Palearctic nominal Hyla taxa (H. arborea, H. a. kret-ensis, H. a. molleri, H. intermedia, H. meridionalis, H. sarda, H.savignyi) are still poorly understood, and many forms (originallydescribed as variations or subspecies) are mainly recognized onthe basis of morphological and bioacoustic traits (e.g. Pailette,1967; Schneider, 1974), or hybridization experiments (e.g. Kuram-oto, 1984). Recently, Recuero et al. (2007) published a mitochon-drial phylogeographic study of H. meridionalis from North Africaand Iberia, while Nascetti et al. (1995) and Canestrelli et al.(2007a,b) investigated the phylogeography of H. intermedia fromthe Apennine Peninsula with allozyme and mitochondrial data. Inthe present note, we are using sequence information of �3320 bpmitochondrial (mtDNA) and �820 bp of nuclear DNA (nuDNA) to

propose a molecular phylogenetic framework for all nominal cir-cum-Mediterranean species and subspecies (‘‘taxa”) of Hyla. Wealso include at least one species from each of the Hyla speciesgroups from Asia and the New World.

2. Material and methods

We obtained tissue samples as (1) frozen specimens of voucherindividuals from the Museum of Vertebrate Zoology (MVZ, Univer-sity of California, Berkeley), (2) ethanol preserved tissues takenfrom vouchers in the Natural History Museum of Erfurt (NME, Ger-many), the Natural History Museum of Crete (NHMC, Heraklion,Greece) and the Zoologisches Forschungsinstitut und MuseumKoenig (ZFMK, Bonn, Germany), and (3) swab and tissue samplescollected by us in the field or provided by several colleagues, oftenwithout accompanying voucher individuals (Appendix 1).

To amplify the four different mtDNA fragments and RAG1 (eachca. 0.8–1 kb; Table 1), we used published and new primers. Forthree mtDNA segments (Table 1; amplified as four fragments),we developed primers by aligning and adapting published onesto the complete mtDNA of H. chinensis (GenBank AY458593) andgreen toads (our unpubl. data), or created new ones in conservedregions (details: Table 1 with optimized PCR conditions). Each frag-ment was sequenced in both directions, strands were aligned usingSequencher 4.7, and mitochondrial fragments were concatenatedusing Se-Al 2.0 (http://tree.bio.ed.ac.uk/software/seal/). Thealignments were submitted to Treebase (http://www.tree-base.org/treebase/index.html). For the mtDNA and RAG1 (Table1), the best fitting model of sequence evolution was selected using

1055-7903/$ - see front matter � 2008 Elsevier Inc. All rights reserved.doi:10.1016/j.ympev.2008.08.029

* Corresponding author. Fax: +41 21 692 41 65.E-mail addresses: matthias.stoeck@unil.ch (M. Stöck), s.dubey@usyd.edu.au (S.

Dubey), cornelya.kluetsch@biotech.kth.se (C. Klütsch), slitvinchuk@yahoo.com (S.N.Litvinchuk), ulrich.Scheidt@erfurt.de (U. Scheidt), nicolas.perrin@unil.ch (N. Perrin).

Molecular Phylogenetics and Evolution 49 (2008) 1019–1024

Contents lists available at ScienceDirect

Molecular Phylogenetics and Evolution

journal homepage: www.elsevier .com/locate /ympev

Author's personal copy

MrModeltest (vers. 2.0 modified from Modeltest, Posada andCrandall, 1998, by J.A. Nylander, Uppsala Univ., Sweden).

Some DNA samples were of poor quality, as frogs were origi-nally not preserved for molecular work. The entire dataset(mtDNA: 3320 bp, nuDNA: 820 bp) could be generated from 68and 63 circum-Mediterranean individuals, respectively, (Fig. 2).For all remaining individuals, clade membership was confirmedwith one to three mtDNA markers. We never found discordancebetween clade membership inferred from partial vs. the wholedata set.

Maximum likelihood (ML) phylogenies of mitochondrial andnuclear sequence alignment were generated using PhyML version2.4.5 (Guindon and Gascuel, 2003) using HKY (mtDNA) or GTR(nuDNA) models. In each case, we choose a BioNJ as a starting tree,and the options to optimize the topology, branch length, and rateparameters. All other parameters were used as in the default ofthe program (http://atgc.lirmm.fr/phyml/ for details). We gener-ated bootstrap values based on 1000 resampled data sets. We com-pared mitochondrial and nuclear tree topologies for thoseindividuals, for which both datasets were available, using a SH-test(Shimodaira and Hasegawa, 1999) with 1000 re-sampled esti-mated log-likelihood (RELL)-replicates.

3. Results and discussion

We obtained sequences for 94 individuals from all currentlyrecognized circum-Mediterranean nominal Hyla species and sub-species (and 6 outgroup species), with multiple samples or popula-tions from much of the known range (Appendix 1, Fig. 1). Ourmitochondrial phylogeny (Fig. 2, left) includes those 69 (ingroupand outgroup, two sequences from GenBank) samples from whichwe obtained the complete 3320 bp of mtDNA, and shows circum-Mediterranean Hyla to form at least 10 major distinct mtDNAclades, each of which with a bootstrap support of 100% (except ori-entalis: 80%). Phylogenetic trees with H. japonica only as the out-group (not shown) had the same topology as the ones using Bufoas the outgroup. Most mtDNA clades also were recovered as mono-phyletic entities using the highly conserved RAG1-fragment, someof which with low statistical support, however. While the overalltopologies are similar between mtDNA and nuDNA trees, a Shimo-

daira–Hasegawa-test confirmed the slight topology differences tobe significant; a reason to analyze and depict both trees separately.Below, we discuss the ML-phylograms shown in Fig. 2 (right:clades a–k).

The nominal species Hyla meridionalis Boettger, 1874 is com-posed of two major clades (a, b).

(a) H. meridionalis occurs in Morocco (loc. 1–6), Iberia (loc. 7–9),southern France (loc. 10), northwestern Italy (loc. 11) and on theCanary islands (the latter include the type locality). We did not re-cover the split of H. meridionalis into two subclades (one in N-Mor-occo/NE-Iberia/Canary islands and one in W-Morocco/SW-Iberia)supported by Recuero’s et al. (2007) Bayesian posterior values(but not their ML and MP bootstrap).

(b) Hyla new taxon (hereafter n. t.) 1 was detected in Algeria(loc. 12) and Tunisia (loc. 13).

Both of these clades (a, b) were also recovered as apparentmonophyletic entities at the nuclear level, but here received a verylow (a: 53%; b: <50%) bootstrap support. Recuero et al. (2007) al-ready identified these two clades and, based on mtDNA phylogenyas well as phylogeographic and paleogeographic references, andproposed a separation time between 2 and 12 Mya (with a prefer-ence for the older scenario). Resolving this issue (and the questionof whether and where both clades separate geographically) will re-quire future research with a denser sampling at intermediate local-ities (Algeria).

The occurrence of H. cinerea and H. pseudopuma as sister to H.meridionalis (clades a, b) in the mtDNA but not the nuDNA tree rep-resents a strong discordance between our mtDNA and nuDNA treetopologies (that differ significantly according to the SH-test), andshould be addressed in future research with additional nuclearmarkers.

(c) H. sarda (de Betta, 1853), endemic to Corsica (loc. 14, 15) andSardinia (loc. 16) emerged as a sister clade of H. orientalis + H. mol-leri (d, e) (and close to H. intermedia (f), Hyla n.t. 2 (g), and H. arbo-rea (h)) in the mtDNA phylogeny, but appeared a very weaklysupported sister taxon of H. meridionalis/Hyla n.t. 1 (a, b) basedon the nuclear marker. The species name sarda was coined by deBetta (1853) and resurrected by Lanza (1983). This step was sup-ported by preliminary allozyme data (only abstracts cited in Nistriand Giacoma, 2007) and differences in advertisement calls (e.g.

Table 1PCR conditions and primers (used and developed) to amplify four mitochondrial and one nuclear DNA fragment

Primer name 50 => 30sequence Origin Ann.-T. (�C) DNA fragment length/gene(abbreviation in text)

Best fitmodelof sequenceevolution

Amp3F CAATACCAAACCCCCTTRTTYGTWTGATC

San Mauro et al. (2004) 42 Ca. 860 bp, mtDNA CytochromeOxidase I gene (COI)

HKY+I+G

Amp3R GCTTCTCARATAATAAATATYAT

San Mauro et al. (2004) 42

82L8331 AAAGCRTYRGCCTTTTAAGC San Mauro et al. (2004) 42–48 Ca. 1600 bp (2 overlapping pieces), mtDNA,part of the tRNA Lysine (Lys), ATP synthasesubunits 6 and 8 (ATP6, ATP8), part of theCytochrome Oxidase III gene (COIII)

HKY+I+GHy 82L8331 CAAGCRAYAGCCTTTTAAGC This paper 42P5R GCAATTTCTAGTATAGTTAA Recuero et al. (2007) 42–48Hy P5R TTTTCGACTTAGAAATTGC This paper 42–48P5F CAGCTACCCTAGCCCTACTAT Recuero et al. (2007) 48–55Hy P5F CAGCCACCCTAGCCCTACTA This paper 48–55MNCN COIII R ACGTCTACRAARTGTCAGTATCA San Mauro et al. (2004) 48Hy MNCN COIII R GTCTACRAARTGTCAGTATCA This paper 48–55HylaUpP5F ATAGCCCTAGGDGTTCGACTCAC This paper 55LO ATGGCCCCTGTTTTACGCAA This paper 48 Ca. 960 bp, mtDNA, Cytochrome b (Cyt b) GTR+I+GH1046 TAAATGGGTCTTCTACTGG This paper 48MARTFL1 AGCTGGAGYCARTAYCAYAARATG Chiari et al. (2004) Touch down 60–

45 (15 cycles) + 45(38 cycles)

Ca. 850 bp, nuDNA, Recombinationassociated gene 1 (RAG1)

GTR+I+GRAGIF CCAATGTCGCAGTGCAAR GCRTC Biju and Bossuyt (2003)

All mtDNA PCRs were performed with 94 �C, 1 min; 38� (94 �C 30 s, annealing temperature 1 min; 72 �C lmin), 72 �C 5 min. For RAG1, a touch-down PCR with 15 cycles withannealing temperatures decreasing from 60 to 45 �C, plus 38 cycles at 45 �C, was used.

1020 M. Stöck et al. / Molecular Phylogenetics and Evolution 49 (2008) 1019–1024

Author's personal copy

Schneider, 1974; Castellano et al., 2002), but no other phylogeneticevidence has been provided to our knowledge. Recuero et al.(2007) hypothesized a ‘‘sister relationship between H. sarda andTunisian H. meridionalis” (= our Hyla n.t. 1), but this is at bestpoorly supported by our nuDNA topology, and contradicted byour mtDNA tree, and should be addressed in future research withadditional nuclear markers.

(d) A monophyletic clade (Hyla orientalis (Bedriaga, 1890)) withsubstantial substructure emerged at the mitochondrial level (80%bootstrap support), as well as at the nuclear level (69%), includingsamples from the type region of H. arborea var. orientalis Bedriaga1890 (Romania: Tultscha = Tulcea, loc. 39a; and Ukraine: Kharkov,loc. 39b), European Turkey and south-western Anatolia (loc. 39–41) as well as a disjunctive range part (loc. 42) in the Talysh moun-tains (type locality of H. arborea gumilevskii, Litvinchuk et al. 2006).Tree frogs from this entire region were previously included into H.arborea, but now appear as a mitochondrial sister taxon to geo-graphically distant H. molleri. Future research needs to addressthe status of H. schelkownikowi Chernov, 1926 (described fromnorthern Armenia and Georgia), while H. arborea gumilevskii Litvin-chuk, 2006 (loc. 42) is now a junior subjective synonym of Hylaorientalis.

(e) In northern and Western Iberia, tree frogs originallydescribed as Hyla arborea var. molleri (Bedriaga, 1890) occur.Surprisingly, the closest mitochondrial relatives of two frogsfrom Spain (loc. 54) and Portugal (loc. 55) are Hyla orientalisfrom Asia Minor and Eastern Europe, while the nuclear DNAof H. molleri (99% support) does not reflect thisrelationship.

The single nominal species H. intermedia also forms two well-supported subclades on the mtDNA level; one from:

(f) the southern Apennine Peninsula (loc. 19) and Sicily (loc. 20–24), the latter including the type locality (Palermo Dubois, 1996) ofH. intermedia Boulenger, 1874; and one from:

(g) southern Switzerland (loc. 17–18): Hyla n.t. 2.These two clades correspond to the most southern and northern

of the three main mitochondrial lineages recognized by Canestrelliet al. (2007b) (we did not sample the third, from central Italy). ThemtDNA split, however, is not well supported (57% bootstrap) bynuDNA, suggesting for Hyla n.t. 2 a status of subspecies of H. inter-media. Based on allozymes, Canestrelli et al. (2007a) found the cen-tral and southern groups to be more closely related and geneticallyhomogeneous, being possibly derived from the northern group thatis apparently characterized by ‘‘the retention of ancestral polymor-phism”. However, while H. intermedia (sensu lato: clades f, g) is sep-arated from H. arborea (h) by the Alps to the north, contacts and(past) hybridizations towards the northeast (our loc. 31–33) havebeen shown by Nascetti et al. (1995). The population at loc. 18may have surmounted the Alps or could be a human introductionas Dubey et al. (2006) assumed.

(h) H. arborea (Linnaeus, 1758) inhabits Crete and the GreekPeninsula (loc. 25–30), the northeastern Adriatic coast (loc. 31–33), and Western Europe north and west of the Alps (loc. 34–38)to the Atlantic coast (loc. 38a). This clade is also present (ourunpublished results) in the restricted type region (Zurich, Switzer-land) that was geographically limited through a nomenclatural actof Dubois and Ohler (1997). Regarding the mtDNA, this group issister to clade (c–g), with which it forms a polytomy (in a broadsense, all internodes below 50% support). While exhibiting extremeuniformity at the mtDNA level, two subclades emerged from thenuclear phylogeny, one comprising the samples from Greece, Creteand Croatia (53% bootstrap support); the other (83%) includes all

Fig. 1. Map with approximate range limits of Western Palearctic tree frogs (drawn according to maps available through the Global amphibian assessment http://www.globalamphibians.org/) with sampling localities (see Map IDs in Appendix 1). Some localities (e.g. 46) were situated outside the known ranges.

M. Stöck et al. / Molecular Phylogenetics and Evolution 49 (2008) 1019–1024 1021

Author's personal copy

samples from north of the Alps. This combination of genetic homo-geneity at the fast-evolving mtDNA with nuDNA diversity in thesouth of the range (Balkan) suggests retention of ancient polymor-

phism in a possible Pleistocene Balkanian refugium, and the spread(selective sweep?) of a single mtDNA lineage. From our data, thesubspecies H. a. kretensis Ahl 1931 (loc. 25–29), established on

Middle East,Cyprus

Arabia,Levante

Anatolia,SE-Europe

Balkan,Central

and W-Europe

Sicily,Calabria

Corsica,Sardinia

Iberia,W-EuropeNW-Africa,

Canaryislands

TunisiaAlgeria

Outgroup

N. ApenninePeninsula

Geographic range

3320 bp mtDNA

*

*

0.05

**

*savignyi_H394_Georgia

savignyi_MVZ245918_Iran

savignyi_Cyprus1

cf. savignyi_H122_Yemencf. savignyi_H155_Yemen

cf. savignyi_H10_Syria

arborea_NME674_00_Croatiaarborea_NME676a_00_Croatia

*

*

arborea kretensis_NHMC_802721_Cretearborea kretensis_NHMC_80275_Crete

*

arborea_NME902a/01_Greecearborea_NME902b/01_Greece

arborea_M1_NW-Francearborea_M2_NW-France

arborea_BAC6_Germanyarborea_NME1228/04_Germany

arborea_BAC5_Germany

arborea_BAC2_Switzerlandarborea_BAC1_Switzerland

molleri_HPA248_Portugalmolleri_SW-Spain

intermedia_NME915/01a_Sicily

intermedia_103_Sicilyintermedia_102_Sicilyintermedia_101_Sicily

intermedia_NME916/01a_Calabriacf. intermedia__Ti02_Switzerland

cf. intermedia_G7.1_Switzerlandcf. intermedia_Ti01_Switzerland

*

*

*

*

sarda_1_1_Corsica

sarda_3_1_Corsica

meridionalis_2/1_Tunisia

meridionalis_1_Algeriameridionalis_2_Algeria

sarda_4_1_Corsicasarda_4T_Corsica

orientalis_H205_Anatoliaorientalis_H204_Anatolia

sarda_23_Sardiniasarda_22_Sardinia

orientalis_Ingn2_Europ. Turkeyorientalis_Ingn1_Europ. Turkey

orientalis_HLi49_Ukraine

cinerea_MVZ15007pseudopuma_MVZ149764

chinensis_AY458593japonica_AB303949

femoralis_MVZ145402

Bufo

meridionalis_NME946/02a_Portugalmeridionalis_NME946/02b_Portugalmeridionalis_MVZ186012_Spainmeridionalis_NME307_97_Portugal

meridionalis_MVZ231943_Spainmeridionalis_MVZ231741_Morocco

72

*

*

*94

95

99

meridionalis_MVZ186158_Morocco

meridionalis_Hm38_Italymeridionalis_Hm39_Italymeridionalis_Hm40_Italy

meridionalis_NME299/97b_Tenerife

80

*

meridionalis_NME299/97c_Tenerifemeridionalis_MVZ186151_Morocco

intermedia_81_Sicily

orientalis_HLi50_Ukrainegumilevskii_Azerbaizan

76

93

(clade) Nominal taxa

H. savignyi Audouin, 1827

Hyla new taxon 3

H. orientialis (Bedriaga, 1890)

H. intermediaBoulenger, 1882

H. sarda(De Betta, 1853)

H. meridionalis Boettger, 1874

Hyla new taxon 1

Hyla new taxon 2

H. arborea(Linnaeus, 1758)

820 bp RAG 1

(i)

(h)

(g)

(f )

(d)

(c)

(a)

(b)

(k)

0.01

99

99

92

sarda_24_Sardinia

sarda_6m_Sardiniasarda_16f_Sardinia

japonica_HjM1

97

savignyi_H71_Turkeysavignyi_H103_Syria

squirella_MVZ145422

pseudopuma_MVZ149764

Hm41_Italy

51

HmNew1_France

arborea_Bo1_Francearborea_Bo2_France

Bufo

meridionalis_MVZ231938_Morocco

69

99

83

57

99

53

savignyi_H88_Iraq

savignyi_H102_Syria

savignyi_Cyprus2

savignyi_Cyprus3

savignyi_H70_Turkeysavignyi_H87_Iraq

63

E-Asia,N-America

substitutions/site Outgroup

73

53

N-IberiaH. molleri

(Bedriaga, 1890)(e)

*

85

Fig. 2. Phylogenetic trees (Maximum-Likelihood phylograms) obtained with the program PhyML version 2.4.5 (Guindon and Gascuel 2003) with bootstrap support valuesobtained from 1000 resampled data sets (*refers to a Bootstrap support of 100%; major nodes below 50% remained unlabeled, below 30% were collapsed). Note that colorcodes of clades correspond to those of localities in Fig. 1.

1022 M. Stöck et al. / Molecular Phylogenetics and Evolution 49 (2008) 1019–1024

Author's personal copy

morphological grounds but with no specific call characteristics(Schneider 1974), is a junior subjective synonym of H. arborea L.,as it is genetically identical to mainland frogs. Similar to our study,Smith et al. (2005) proposed on the basis of combined mtDNA andnuDNA evidence that H. arborea (a single individual from Croatia,close to our loc. 31–33) forms a sister taxon to ‘‘H. savignyi” fromsouthern Syria (but possibly belonging to n.t. 4, see below). Futureresearch needs to explore the distribution and possible contacts toH. orientalis in the undersampled northeast of the range, which hasbeen studied so far based on allozymes (Litvinchuk et al., 2006).

The single nominal species H. savignyi forms a monophyleticgroup composed of two very strongly supported and reciprocallymonophyletic subclades (i, k) based on both mtDNA and nuDNAdata, implying that both deserve the status of separate species.

(i) With high support values on the mtDNA (100%) and nuDNA(99%) data, tree frogs from southwestern Syria (loc. 49) and a dis-junctive range (loc. 50–53) in southern Arabia (Yemen) form aclade (Hyla n.t. 3). Klütsch et al. (2004) and Klütsch (2006) have re-cently studied its distribution and population structure.

(k) Another reciprocally monophyletic group (bootstrapmtDNA: 100%, nuDNA: 99%) occurs on Cyprus, southern Turkey,north-eastern Syria, Iraq and Western Iran, for which we maintainhere the name H. savignyi Audouin, 1827. Recently, Grach et al.(2007) reviewed the nomenclature of H. savignyi Audouin, 1827,described from ‘‘Egypt” and considered it to be widespread from‘‘Turkey, Transcaucasia and northwestern Iran over Syria and Leb-anon to central Jordan and Israel and the southwestern ArabianPeninsula”. Faivovich et al. (2005) used a specimen of Hyla fromYemen (= our Hyla n.t. 3) that emerged as a sister taxon of H. arbo-rea (‘‘pet trade”, no locality) in their equally weighted parsimonytree with concatenated mtDNA and nuDNA data.

Hyla heinzsteinitzi (Grach et al. 2007), restricted to three locali-ties from the Jerusalem region and sympatric to the widespread H.savignyi (our n.t. 3), was recently described based on morphologyand bioacoustics. We found two mtDNA fragments (COI, Cyt b;Appendix 1) from a single, topotypic sample (Mamilla reservoir,Jerusalem) to be almost identical to homologous sequences of H.japonica (AB303949). Comparisons of pictures, morphologicaldescriptions, and call oscillograms all seem to corroborate our ge-netic identification, and suggest these localized populations to re-sult from a human introduction of H. japonica to Israel. Werecommend a careful comparison of morphometric data andsequencing of additional samples.

Our study thus revealed cryptic species and clades that had onlypartly been recognized by previous work. We found (1) H. meridio-nalis to be strongly differentiated from all other circum-Mediterra-nean Hyla species [see a similar topology in Smith et al. (2005) forH. meridionalis (Morocco), H. arborea (Croatia), and H. savignyi (Syr-ia, possibly our n.t. 3)] and consisting itself of two major clades; (2)traditionally recognized H. savignyi to represent two monophyleticspecies, and (3) the relationships of six forms representing H. arbo-rea, H. orientalis and H. molleri, H. intermedia (with two subclades),and H. sarda to be more or less polytomic. We restrain ourselvesfrom dating the divergences in the present state of research, butspeculate this latter polytomy may correspond to the flooding ofthe Mediterranean at the end of the Messinian crisis (5.3 Mya) thatwould have isolated these lineages on Sardinia/Corsica, the Apen-nine Peninsula, the Balkan, and in Asia Minor (and Iberia). Assum-ing roughly constant rates of mtDNA evolution (Fig. 2, left), thishypothesis would fit the assumption of Smith et al. (2005) whoproposed, ‘‘that the common ancestor of extant European Hyla spe-cies is at least 10 million years old”. Hyla n.t. 3 was highly sup-ported by both mitochondrial and nuclear markers, suggestingspecies-level distinctiveness. Hyla n.t. 2 rather appears a subspe-cies within H. intermedia. More data are required to resolve the sta-tus of Hyla n.t. 1, and to better understand the relationship of H.

molleri and H. orientalis. We finally note that the topology of the ac-tual outgroup species of H. cinerea and H. pseudopuma is discordantin the mtDNA and nuDNA trees. A more complete outgroup repre-sentation is required to understand whether this is a sign ofmtDNA saturation and resulting homoplasy (e.g. Moritz et al.,1987).

Acknowledgments

We are very grateful to the following people and institutionswho contributed tissue samples: the tissue collection of the Mu-seum of Vertebrate Zoology, University of California, Berkeley (C.Cicero, J. McGuire), N. Bruyndonckx and L. Fumagalli (Lausanne),A. Sicilia (Palermo), V. Gvozdik (Prague), P. Lymberakis (Heraklion),P. Kyriakopoulou-Sklavounou (Thessaloniki), A. Olivier (Tour duValat), J. Jaquiéry and G. Evanno (Rennes), J. W. Arntzen (Leiden)and all other collectors who are listed in the appendix. We thankK. Ghali (Lausanne) for help in the laboratory, J. J. Wiens (StonyBrook) for a reference, and D. Gotzek (Lausanne) for help withanalyses. Financial support was provided by the Swiss NationalScience Foundation (grant 3100A0-108100 to N.P.) and partly bya RFBR grant (08-04-01184) to S.N.L.

Appendix A. Supplementary data

Supplementary data associated with this article can be found, inthe online version, at doi:10.1016/j.ympev.2008.08.029.

References

Ahl, E., 1931. Amphibien. In: Wettstein O., Herpetologie der Insel Kreta. Ann.Naturhist. Mus. Wien 45, 159–172.

Bedriaga, J.v., 1890. Die Lurche Europa’s. Bull. Soc. Imp. Natural. Moscou. N.S. 3,466–622.

Biju, S.D., Bossuyt, F., 2003. New frog family from India reveals an ancientbiogeographical link with the Seychelles. Nature 425, 711–712.

Canestrelli, D., Verardi, A., Nascetti, G., 2007a. Genetic differentiation and history ofpopulations of the Italian treefrog Hyla intermedia: lack of concordance betweenmitochondrial and nuclear markers. Genetica 130, 241–255.

Canestrelli, D., Cimmurata, R., Nascetti, G., 2007b. Phylogeography and historicaldemography of the Italian treefrog, Hyla intermedia, reveals multiple refugia,population expansions and secondary contacts within peninsular Italy. Mol.Ecol. 16, 4808–4821.

Castellano, S., Cuatto, B., Rinella, R., Rosso, A., Giacoma, C., 2002. The advertisementcall of the European treefrogs (Hyla arborea): a multilevel study of variation.Ethology 108, 75–89.

Chiari, Y., Vences, M., Vieites, D.R., Rabemananjara, F., Bora, P., RamilijaonaRavoahangimalala, O., Meyer, A., 2004. New evidence for parallel evolution ofcolour patterns in Malagasy poison frogs (Mantella). Mol. Ecol. 13, 3763–3774.

Dubey, S., Ursenbacher, S., Fumagalli, L., 2006. Origine des populations de rainetteverte (Hyla spp.) de l’ouest de la Suisse. Rev. Suisse Zool. 113, 879–887.

Dubois, A., 1996. The valid scientific name of the Italian treefrog, with comments onthe status of some early scientific names of Amphibia Anura, and on somearticles of the Code concerning secondary homonyms. Dumerilia 2, 55–71.

Dubois, A., Ohler, A., 1997. Early scientific names of Amphibia Anura. II. An examplecase: Rana arborea Linneaus, 1758. Bull. Mus. Natl. Hist. Nat. Paris, Ser. 4(A) 18(3–4), 321–340.

Faivovich, J., Haddad, C.F.B., Garcia, P.C.A., Frost, D.R., Campbell, J.A., Wheeler, W.C.,2005. Systematic review of the frog family Hylidae, with special reference toHylinae: phylogenetic analysis and taxonomic revision. Bull. Am. Mus. Nat. Hist.294, 1–240.

Guindon, S., Gascuel, O., 2003. A simple, fast, and accurate algorithm to estimatelarge phylogenies by maximum likelihood. Syst. Biol. 52, 696–704 (for PhyMLvers. 2.4.5; see also http://atgc.lirmm.fr/phyml/).

Grach, C., Plesser, Y., Werner, Y.L., 2007. A new, sibling, tree frog from Jerusalem(Amphibia: Anura: Hylidae). J. Nat. Hist. 41 (9–12), 709–728.

Kuramoto, M., 1984. Systematic implications from hybridization experimemts withsome Eurasian tree frogs (genus Hyla). Copeia 1984 (3), 609–616.

Klütsch, C., 2006. Evolutionary history of Southern Arabian faunal elements with aspecial focus on habitat fragmentation of two model organisms, Reissitasimonyi (Rebel, 1899; Lepidoptera: Zygaenidae) and Hyla savignyi (Audouin,1827; Amphibia: Hylidae [http://hss.ulb.uni-bonn.de/diss_online/math_nat_fak/2006/kluetsch_cornelya/kluetsch.htm].

Klütsch, C.F.C., Grosse, W.-R., Misof, B., Nasher, A.K., Naumann, C.M., 2004.Distribution of the yellow-lemon tree frog, Hyla savignyi (Audouin, 1827), insouthern Arabia: updates and extensions of previous records. Zool. Midd. East31, 47–52.

M. Stöck et al. / Molecular Phylogenetics and Evolution 49 (2008) 1019–1024 1023

Author's personal copy

Lanza, B., 1983. Ipotesi sulle origini de popolamento erpetologico della Sardegna.Lav. Soc. Ital. Biogeo. Forli, N.S. 8, 723–744.

Litvinchuk, S.N., Borkin, L.J., Rosanov, J.M., Skorinov, D.V., 2006. Allozyme andgenome size variation in tree frogs from the Caucasus, with description of a newsubspecies Hyla arborea gumilevskii from the Talysh Mountains. Russ. J.Herpetol. 13, 183–206.

Moritz, C., Dowling, T.E., Brown, W.M., 1987. Evolution of animal mitochondrialDNA; relevance for population biology and systematics. Ann. Rev. Ecol. Syst. 18,269–292.

Nascetti, G., Lanza, B., Bullini, L., 1995. Genetic data for the specific status of theItalian treefrog (Amphibia: Anura: Hylidae). Amphibia-Reptilia 16, 215–227.

Nistri, A., Giacoma, C., 2007. Sardinian tree frog (Hyla sarda). In: Sindaco, R.,Giuliano, D., Razzetti, E., Bernini, F. (Eds.), Atlante degli Anfibi e dei Rettilid’Italia [Atlas of Italian Amphibians and Reptiles]. Societas Herpetologica Italica,Edizioni Polistampa, Firenze, pp. 326–329.

Pailette, M., 1967. Rhytme d’activité acoustique des Hyla arborea (Linné) et Hylameridionalis Boettger (Amphibiens–Anoures). C.R. Soc. Biol. 161, 986–992.

Posada, D., Crandall, K.A., 1998. Modeltest, testing the model of DNA substitution.Bioinformation 14, 817–818.

Recuero, E., Iraola, A., Rubio, X., Machordom, A., Garcia-París, M., 2007.Mitochondrial differentiation and biogeography of Hyla meridionalis (Anura:Hylidae): an unusual phylogeographical pattern. J. Biogeo. 34 (7), 1207–1219.

San Mauro, D., Gower, D.J., Oommen, O.V., Wilkinson, M., Zardoya, R., 2004.Phylogeny of caecilian amphibians (Gymnophiona) based on completemitochondrial genomes and nuclear RAG1. Mol. Phylogen. Evol. 33, 413–427.

Shimodaira, H., Hasegawa, H., 1999. Multiple comparisons of log-likelihoods withapplications to phylogenetic inference. Mol. Biol. Evol. 16, 1114–1116.

Schneider, H., 1974. Structure of the mating calls and relationships of the Europeantree frogs (Hylidae, Anura). Oecologia (Berlin) 14, 99–110.

Smith, S.A., Stephens, P.R., Wiens, J.J., 2005. Replicate patterns of species richness,historical biogeography and phylogeny in Holarctic tree frogs. Evolution 59(11), 2433–2450.

Wiens, J.J., Fetzner Jr., J.W., Parkinson, C.L., Reeder, T.W., 2005. Hylid frog phylogenyand sampling strategies for speciose clades. Syst. Biol. 54 (5), 719–748.

1024 M. Stöck et al. / Molecular Phylogenetics and Evolution 49 (2008) 1019–1024