Biochemical Genetics, Vol. 31, Nos. 1/2, 1993

Microsatel l i te Variation in a Social Insect

Madhusudan Choudhary, I Joan E. Strassmann, 1 Carlos R. Soils, 1 and David C. Queller 1

Received 14 Sept. 1992--Final 17Nov. 1992

We undertook a study to explore the potential of microsatellite loci as genetic markers for investigating kinship patterns in a social wasp Parachartergus colobopterus. A plasmid library with small inserts was screened for several oligonucleotide repeat motifs. Positive clones were sequenced and several were selected for further work. PCR primers were constructed that would amplify the tandem repeat region and a number of female wasps were scored for variation in the number of tandem repeats at these loci. The five amplified loci were far more variable than allozymes, with an average heterozygosity of 0.35.

KEY WORDS: microsatellites; genetic markers; social insects; wasps; Parachartergus.

INTRODUCTION

Studies of population genetic structure require genetic markers. The more genetic markers available, and the more variable they are, the more detailed are the genetic questions that can be answered with them. The need for genetic markers is particularly great in the social insects. Here, estimates of genetic relatedness are crucial for using kin selection theory (Hamilton, 1964a,b) to understand the evolution of socially altruistic behavior. Methods for estimating relatedness using genetic markers are available and allozyme markers have been widely used to estimate mean genetic relatednesses within colonies (Queller et al., 1988; Strassmann et al., 1989; Gadagkar, 1991). But most social insects are in the insect order Hymenoptera and possess the haplodiploid genetic system (males haploid and females dip-

This work was supported by NSF Grants BSR-9021514 and IBN-9210051. 1 Department of Ecology and Evolution, Rice University, P.O. Box 1892, Houston, Texas 77251.

87 0006-2928/93/0200~0087507.00/0 © 1993 Plenum Publishing Corporation

88 Choudhary, Strassmann, Solis, and Queller

loid). Haplodiploids typically have poor variability in allozymes (Graur, 1985), and this has limited the precision of the answers to questions that have been asked about genetic relatedness in social insects and has also limited the kinds of questions that can be asked. For example, while we know something about average relatedness to colony-mates, we know very little about average relatedness within individual colonies and next to nothing about individual relationships within a colony.

Recent work has uncovered a new class of genetic markers, microsatel- lites, that tend to be highly variable (Weber and May, 1989; Tautz, 1989; Litt and Luty, 1989) and also very abundant (Weber, 1990). They have been reported from a wide variety of eukaryotes, including insects (Hamada et al., 1982; Tautz and Renz, 1984; Pardue et al., 1987). Microsatellites [also known as short tandem repeats (STRs), simple sequence repeats (SSRs), and simple sequence length polymorphisms (SSLPs)] are stretches of DNA consisting of a number of tandem repeats of very simple motifs. There are often multiple alleles that differ in the number of repeat units, probably because of past slippage mutations (Tautz and Renz, 1984; Schl6tterer and Tautz, 1992). Most work on microsatellites has focused on dinucleotide re- peats, such as (CA)n (e.g., Hudson et al., 1992; Dietrich et al., 1992; Weissen- bach et al., 1992) but trinucleotide and tetranucleotide repeats are also variable and useful as genetic markers (e.g., Edwards et al., 1991; Serikawa et al., 1992). In this paper we report the results of a pilot study to determine if highly variable microsatellite loci could be found in a social insect.

MATERIALS AND METHODS

The Study Species

Parachartergus colobopterus is a social wasp (Hymenoptera: Vespidae). Its colonies average over 250 adult females that tend an average of over a thousand brood cells (Strassmann et al., 1991). It is of particular interest because most colonies have multiple queens [mean = 27, SE = 6 (Strass- mann et al., 1991)]. There may therefore be many matrilines per colony and the resulting variation in relatedness among colony-mates raises interesting questions about kinship and behavior. For example, do individuals act most altruistically to members of their own matriline and less altruistically to other colony members? Such questions are the target of future studies once sufficient genetic variation can be found to ask precise questions about kinship.

Wasps were collected from wild colonies on the grounds of the Univer- sidad Central de Venezuela in Maracay, Venezuela. They were frozen in liquid nitrogen, brought back to the lab, and transferred to a -70°C freezer

Microsatellite Variation in a Social Insect 89

until needed. Vouchers have been deposited at the American Museum of Natural History and at the Instituto de Zoologia Agricola at the Universidad Central de Venezuela in Maracay.

General Methods

The general approach is similar to that employed in several studies of other organisms (Cornall et al., 1991; Rassmann et aL, 1991; Hudson et aL, 1992; Dietrich et al., 1992; Weissenbach et al., 1992). First, a genomic library is made for the species, using small inserts that facilitate sequencing. The library is screened with a labeled oligonucleotide probe consisting of multi- ple repeats of the desired microsatellite sequence. Positive clones are identified and their inserts are sequenced. Inserts with a large number of the repeats [microsatellites with more than 10 repeats tend to be more variable (Weber, 1990)] are selected for further work. The sequences flanking the repeat region are used to design primers for the polymerase chain reaction (PCR) (Saiki et al., 1985; Mullis et aL, 1986). The primers are synthesized and can then be used to amplify the microsatellite alleles of any individual. The DNA is radioactively labeled during amplification and is then run out on denaturing polyacrylamide ("sequencing") gels. The products are visual- ized by exposure of the gels to X-ray film.

Finding Microsatellite Loci

The genomic library of small (400-600 bases) P. colobopterus inserts in pUC19 was kindly supplied by Colin Hughes. The transformed cells (Esche- richia coIi strain DH5o 0 were plated out on nylon filters (Hybond-N) lying on ampicillin (50 ~g/ml) containing LB plates (Ausubel et al., 1992). Replica filters were prepared, these filters were treated to lyse the bacteria, and the DNA was bound to the nylon by baking at 80°C for 2 hr. A control filter of bacterial colonies bearing pUC19 plasmids was prepared and treated in the same way as the replica filters.

Clones containing wasp microsatellite sequences were identified by probing with three radiolabeled oligonucleotides. These oligonucleotides, (GT)10, (CAC)7, and (AAT)~0, were synthesized on an Applied Biosystems machine and then purified by either butanol extraction (Sawadogo and Van Dyke, 1991) or desalting and buffer exchange using Econo-Pacl0 columns (Bio-Rad). Oligonucleotides were end-labeled using terminal deoxynucleo- tidyl transferase and [a3aP]dCTP (Rosenberg et al., 1990) and hybridized to DNA bound to the replica filters. The filters were prehybridized for at least 2 hr at 45°C in a 25-ml solution containing 5 x SSPE, 5 x Denhardt's, 0.1% SDS, and 0.5 ml denatured sonicated nonhomologous DNA (1 p,g/ml). The

90 Choudhary, Strassmann, Soils, and Queller

prehybridization solution was removed and the probe was added in a 5-ml solution containing 5x SSPE, 5x Denhardt's, and 0.1% SDS. Hybridiza- tions were carried out for 48 hr at 50°C (24 hr should be sufficient). The filters were washed three times in a 50-ml solution, once for 20 rain with 2x SSPE, 0.1% SDS at room temperature, once for 20 min with l x SSPE, 0.1% SDS at 55°C, and once for 20 min with 0.5x SSPE, 0.1% SDS at 55°C, at which point they registered 5-20 counts/sec. They were then exposed to X-ray film overnight at room temperature. The plasmid DNAs were purified from the putative positive clones. Pvull restriction digests of these clones were subjected to Southern blotting and hybridization with the end-labeled repeat probes. Clones with a strong positive signal were sequenced using the dideoxy chain termination method and universal M13 sequencing primers (Sequenase 2 kit from US Biochemicals). PCR primers were designed for selected loci containing high repeat numbers.

PCR of Population Samples

Genomic DNA was extracted from whole P. colobopterus adult females using a DTAB/CTAB method (Gustincich et aL, 1991) or by a tissue squash tech- nique (Langridge et aL, 1991). Depending on the locus, between 20 and 33 individuals were scored, each from a different colony. Target DNA se- quences were amplified by PCR using the primers in Table II. Amplification reactions were performed in a total volume of 5 ~L1 using 5 ng of genomic DNA, 20 ~ dNTPs, 1 ~LCi of [35S]dATP, a 0.5 ~ concentration of each primer, and 0.125 U of Taq polymerase (Amplitaq, Perkin-Elmer Cetus) in the buffer supplied in the Gene AMP kit. After heating at 92°C for 4 rain, samples were run through 40 cycles of amplification, which consisted of denaturation for 60 see at 92°C, an annealing cycle that varied among loci (Table II), and extension for 45 sec at 72°C in a genetic thermal cycler from Precision Scientific. Aliquots of the amplified DNA were electrophoresed on standard 6% denaturing polyacrylamide DNA sequencing gels for 2 to 4 hr, depending upon the expected size of the amplified products from different loci.

RESULTS

We sequenced 11 clones identified with the (GT)10 probe, 8 identified with the (CAC)7 probe, and 4 identified with the (AAT)10 probe. Table I shows the repeat sequences found in each clone.

We designed primers for six clones with long repeat regions: three GT clones, two CAC clones, and one AAT clone that included CTT and GTT repeats along with the expected AAT motif. The primers are given in Table II with the PCR annealing conditions. One locus did not amplify (CAC

Microsatel l i te Variation in a Social Insect

Table I. Repeat Sequences Identified in Positive Clones a

Clone number Repeat sequence

91

PACO-1GT (AT)s(GT)I1 PACO-2GT (GT)~6 PACO-3GT (GT)ls PACO-4GT (GT)~3 with one imperfection PACO-15GT (GT) 10(AT)I; PACO-25GT (AT)8 PACO-29GT (GT)10 PACO-30GT (AT) 10 PACO- 1 CAC (CAC) 12 PACO-6CAC (CAC) 11 PACO-8CAC (CAC)5 PACO-9CAC (CAC)6 PACO-17CAC (CAC)13 with two imperfections PACO-20CAC (CAC)s with two imperfections PACO-22CAC (CAC)6 with one imperfection PACO-5AAT (AAT)s with two imperfections PACO-13AAT (CTT)7(AAT)s(GTT)3 PACO-18AAT (AAT)6

aAn imperfection is a base which interrupts the regular repeat pattern. Five other positive clones did not show the expected repeat sequences.

clone n u m b e r 6) and the remain ing five p roduced products of the sizes listed

in Table II. Popula t ion screens for var ia t ion in the five amplifying loci gave the

results displayed in Table III. The two t r inucleot ide repeat loci were variable, bu t not at a very high level, with two or three alleles and m e a n

observed heterozygosities below 0.1. The three CA repeats were much more variable. They had 12, 5, and 3 alleles and the average heterozygosity

observed at the three loci was 0.52.

Table II. PCR Primers and Annealing Conditions for Microsatellite Sequences

Annealing Product temperature length

Locus PCR primers (5' to 3') and time (bases)

PACO-2GT

PACO-3GT

PACO-4GT

PACO-ICAC

PACO-13AAT

GCACGATCTTATCTCCTTGCACGTTTG 65°C, 60 sec 92-124 CCGTAATAACACCCTTTAGTAGGCGCGC CGCACATACATATACGTATAC 60°C, 90 sec 106-116 CGTTCCTTTGCATTTTCTCTGATTTACGG CCTCGGGAATACGTTTGCGTACGTATATGC 60°C, 90 sec 92-98 CGTTGGATTTCTTGATTGCAATATG CGCTTCTCTTCGATCACG 45°C, 60 sec 74-83 CGAGTCGACGTAAACAAC GAAAGAAGAAAAATACGGTAG 45°C, 60 sec 115-121 GCTTATCATCACACG

92 Choudhary, Strassmann, Soils, and Queller

Table III. Allele Frequencies and Heterozygosities for Five Microsatellite Loci in Parachartergus colobopterus

Allele Locus (number of repeats) Frequency

PACO-2GT (n a = 33)"

Heterozygosity b PACO-3GT

(n = 29)

Heterozygosity PACO-4GT

(n = 33)

Heterozygosity PACO-1CAC

(n = 24)

10 0.05 11 0.05 14 0.02 15 0.02 16 0.21 17 0.03 18 0.29 19 0.20 20 0.05 24 0.02 25 0.05 26 0.05

0.83 (0.58)

11 0.02 12 0.76 13 0.02 15 0.17 16 0.03

0.40 (0.38)

12 0.39 13 0.56 15 0.05

O.54 (0.61)

12 0.92 15 0.08

Heterozygosity 0.15 (0.08) PACO-13AAT

(n --- 20) 7 0.02 8 0.95 9 0.02

Heterozygosity 0.09 (0.10) Ave. heterozygosity 0.40 (0.35)

aNumber of adult females scored, each from a different colony. bExpected heterozygosity calculated using Eq. 2 of Nei (1978). Observed heterozygosities in parentheses.

D I S C U S S I O N

M i c r o s a t e l l i t e s a p p e a r to b e a p r o m i s i n g k ind o f g e n e t i c m a r k e r for s tud ies

o f k insh ip in socia l insects . M o s t o f t h e loci s c r e e n e d w e r e v a r i a b l e to s o m e

d e g r e e , a n d s o m e of t h e m w e r e h ighly va r i ab le . P r e v i o u s a l l o z y m e w o r k on

Parachartergus colobopterus ( S t r a s s m a n n et al., 1991) s h o w e d l i t t le va r i ab i l -

Microsatell ite Variation in a Social Insect 93

ity, typical of haplodiploid Hymenoptera. Of 27 allozyme loci scored, 7 were variable, and of these, only 1 locus had a second allele that was more common than 5%. Clearly microsatellites offer a way to obtain more useful genetic markers in this species.

Pedigree studies in other species have shown that microsatellites are inherited in typical Mendelian codominant fashion (e.g., Litt and Luty, 1989; Tautz, 1989; Weber and May, 1989). We did not verify this for our loci because P. colobopterus lives in complex family groups where parentage cannot be independently determined. One of the advantages of microsatel- lites is that the banding patterns are so simple: there should always be one or two strong bands and alleles should differ in size by integer multiples of the repeat unit. This makes it possible to be reasonably confident of the inheritance pattern without breeding studies. Microsatellite mutation rates are comparatively high [between 10 -3 and 10 -6 (Dietrich et aI., 1992; Edwards et al., 1992; Kwiatkowski et al., 1992; Weissenbach et al., 1992)]. This could cause occasional problems for questions such as paternity exclusion but it would not lead to significant errors in statistical estimates of relatedness (Queller and Goodnight, 1989).

One of the main uses for these kinds of markers in social insects will be for studies of kin interactions within single colonies, so it is important to have an idea of how much genetic variation will be available within individ- ual colonies. Our data do not show this directly, because we scored one individual per colony in order to maximize independence in the data. However, we know from extensive allozyme studies that relatedness among female colony mates is about 0.3 (Strassmann et al., 1991, and unpublished data). This means that only 30% of the genetic variance is between colonies and 70% will be within colonies.

In our sample the dinucleotide loci were highly variable, while the trinucleotide loci were much less variable. However, data from other species suggest that this pattern is not general and may simply be due to the limited number of loci we have scored. Trinucleotide loci can be highly variable in humans (Edwards et al., 1991) and work in our lab shows that they are highly variable in another social wasp, Polistes annularis [six AAT repeat loci had a mean heterozygosity above 0.5 (Hughes and Queller, in press)].

Trinucleotide repeat loci seem to offer one advantage over dinucleotide repeats; they are often easier to score (Edwards et al., 1991; Hearne et al., 1992). Microsatellite loci often show one or more bands in addition to the most prominent one. These bands are usually one or two repeat lengths different from the main product and probably arise from slippage during replication in the PCR reaction. These slippage products seem to be more prominent for dinucleotide repeat loci and more care may be required in scoring compared to the trinucleotide loci. For example, the secondary

94 Choudhary, Strassmann, Solis, and Queller

bands at locus PACO-2GT may have made it difficult to distinguish homozy- gotes from heterozygotes with alleles differing by only one repeat unit. We conservatively scored ambiguous cases as homozygotes and this might explain the apparent deficit of heterozygotes observed at this locus (there are about eight fewer heterozygotes than expected; Table III).

Among the many possible types of molecular markers, microsatellites offer certain advantages. They are much more variable than allozyme loci, as our study confirms. In addition the number of microsatellite loci that can be pulled from libraries is extremely large. Groups interested in genetic map- ping of humans and mice have already identified hundreds of variable loci (Hudson et al., 1992; Dietrich et al., 1992; Serikawa et al., 1992; Weissenbach et al., 1992). Even this is a small percentage of the loci available; it has been estimated that there are at least 35,000 loci in the human genome bearing at least 12 tandem CA repeats (Weber, 1990).

Compared to restriction fragment length polymorphisms (RFLPs), microsatellites typically have more alleles, and the procedures do not require Southern blotting. DNA fingerprints (Jeffreys et al., 1985) provide more information per gel, but the information is of lower quality because individ- ual loci usually cannot be identified and because comparisons across gels are difficult. Genomic libraries can be probed with the fingerprint probes to obtain single VNTR loci which, like microsatellites, vary in the number of tandem repeats, though the repeat motif is longer (Nakamura et aI., 1987). These are highly variable, but they have some disadvantages compared to microsatellites. Like multilocus fingerprints, they are usually scored through Southern blotting of agarose gels and adjacent alleles may not always be distinguishable, requiring binning strategies (Budowle et al., 1991). More- over, they are sometimes locally distributed in the genome, so that different loci may often be linked and will therefore provide less independent information about kinship (Hanotte et al., 1992). Microsatellite loci appear to be widely and fairly uniformly distributed throughout the genome (Stall- ings et al., 1991; Dietrich et al., 1992). Finally, because the microsatellite method employs PCR, it does not require as much tissue as most other methods.

ACKNOWLEDGMENT

We owe a great debt to Colin Hughes for providing the library and for other assistance in the lab.

R E F E R E N C E S

Ausubel, F. A., Brent, R., Kingston, R. E., Moore, D. D., Seidman, J. G., Smith, J. A., and Struhl, K. (eds.) (1992). Current Protocols in Molecular Biology, Greene and Wiley- Interscience, New York.

Microsatel l i te Variat ion in a Social Insect 95

Budowle, B., Giusti, A. M., Waye, J. S., Baechtel, F. S., Fourney, R. M., Adams, D. E., Presley, E. A., Deadman, H. A., and Monson, K. L. (1991). Fixed-bin analysis for statistical evaluation of continuous distributions of allelic data from VNTR loci, for use in forensic comparisons.Am. J. Hum. Genet. 48:841.

Cornall, R. J., Aitman, T. J., Hearne, C. T., and Todd, J. A. (1991). The generation of a library of PCR-analyzed microsatellite variants for genetic mapping of the mouse genome. Genomics 10:874.

Dietrich, W., Katz, H., Lincoln, S. E., Shin, H.-S., Friedman, J., Dracopoli, N. C., and Lander, E. S. (1992). A genetic map of the mouse suitable for typing intraspecific crosses. Genetics 131:423.

Edwards, A., Civitello, A., Hammond, H. A., and Caskey, C. T. (199l). DNA typing a genetic mapping with trimeric and tetrameric repeats. Am. J. Hum. Genet. 49:746.

Edwards, A., Hammond, H., Jin, L., Caskey, C. T., and Chakraborty, R. (1992). Genetic variation at five trimeric and tetrameric tandem repeat loci in four human population groups. Genomics 12:241.

Gadagkar, R. (1991). On testing the role of genetic asymmetries created by haplodiploidy in the evolution of eusociality in the Hymenoptera. J. Genet. 70:1.

Graur, D. (1985). Gene diversity in Hymenoptera. Evolution 39:190. Gustincich, S., Manfioletti, G., Del Sal, G., Schneider, C., and Carnici, P. (1991). A fast method

for high-quality DNA extraction from whole human blood. Biotechniques 11:298. Hamada, H., Petrino, M. G., and Kakunaga, T. (1982). A novel repeated element with

Z-DNA-forming potential is widely found in evolutionarily diverse eukaryotic genomes. Proc. Natl. Acad. Sci. 79:6465.

Hamilton, W. D. (1964a). The genetical evolution of social behaviour. I.J. Theor. Biol. 7:1. Hamilton, W. D. (1964b). The genetical evolution of social behaviour. II. J. Theor. Biol. 7:17. Hanotte, O., Bruford, M. W., and Burke, T. (1992). Multilocus DNA fingerprints in gallina-

ceous birds: General approach and problems. Heredity 68:481. Hearne, C. M., Ghosh, S., and Todd, J. A. (1992). Microsatellites for linkage analysis of genetic

traits. Trends Genet. 8:288. Hudson, T. J., Engelstein, M., Matthias, K. L., Ho, E. C., Rubenfield, M. J., Adams, C. P.,

Housman, D. E., and Dracopoli, N. C. (1992). Isolation and chromosomal assignment of 100 highly informative human simple sequence repeat polymorphisms. Genomics 13:622.

Hughes, C. R., and Queller, D. C. Detection of highly polymorphic microsatellite loci in a species with little enzyme polymorphism. Mol. Ecol. (in press).

Jeffreys, A. J., Wilson, V., and Thein, S. L. (1985). Hypervariable "minisatellite" regions in human DNA. Nature 314:67.

Kwiatkowski, D. J., Henske, E. P., Weimer, K., Ozelius, L., Gusella, J. F., and Haines, J. (1992). Construction of a GT polymorphism map of human 9q. Genomics 12:229.

Langridge, U., Schwall, M., and Langridge, P. (1991). Squashes of plant tissue as substrate for PCR. Nucleic Acids Res. 19:6954.

Litt, M., and Luty, J. A. (1989). A hypervariable microsatellite revealed by in vitro amplification of a dinucleotide repeat within the cardiac muscle actin gene. Am. J. Hum. Genet. 44:397.

Mullis, K., Faloona, F., Scharf, S., Saiki, R., Horn, G., and Erlich, H. (1986). Specific enzymatic amplification of DNA in vitro: The polymerase chain reaction. Cold Spring Harbor Syrup. Quant. Biol. 51:263.

Nakamura, Y., Leppert, M., O'Connell, P., Wolff, R., Holm, T., Culver, M., Martin, C., Fujimoto, E., Hoff, M., Kumlin, E., and While, R, (1987). Variable number of tandem repeat (VNTR) markers for human genome mapping. Science 235:1616.

Nei, M. (1978). Estimation of average heterozygosity and genetic distance from a small number of individuals. Genetics 89:583.

Pardue, M. L., Lowenhaupt, K., Rich, A., and Nordheim, A. (1987). (dC-dA)n • (dG-dT)n sequences have evolutionarily conserved chromosomal locations in Drosophila with impli- cations for roles in chromosome structure and function. EMBO J. 6:1781.

Queller, D. C., and Goodnight, K. F. (1989). Estimating relatedness using genetic markers. Evolution 43:258.

Queller, D. C., Strassmann, J. E., and Hughes, C. R. (1988). Genetic relatedness in colonies of tropical wasps with multiple queens. Science 242:1155.

96 Choudhary, Strassmann, Soils, and Queller

Rassmann, K., Schl6tterer, C., and Tautz, D. (1991). Isolation of simple-sequence loci for use in polymerase chain reaction-based DNA fingerprinting. Electrophoresis 12:113.

Rosenberg, H. F., Ackerman, S. J., and Tenen, D. G. (1990). An alternative method for labeling oligonucleotide probes for screening cDNA libraries. Biotechniques 8:384.

Saiki, R., Scharf, S., Faloona, F., Mullis, K., Horn, G., Erlich, H., and Arnheim, N. (1985). Enzymatic amplification of the beta globin genomic sequences and restriction site analysis for diagnosis of sickle cell anemia. Science 230:1350.

Sawadogo, M., and Van Dyke, M. W. (1991). A rapid method for the purification of deprotected oligodeoxynucleotides. Nucleic Acids Res. 19:694.

Schl6tterer, C., and Tautz, D. (1992). Slippage synthesis of simple sequence DNA. Nucleic Acids Res. 20:211.

Serikawa, T., Kuramoto, T., Hilbert, P., Mori, M., Yamada, J., Dubay, C. J., Lindpainter, K., Ganten, D., Gu6net, J.-L., Lathrop, G. M., and Beckmann, J. S. (1992). Rat gene mapping using PCR-analyzed microsatellites. Genetics 131:701.

Stallings, R. L., Ford, A. F., Nelson, D., Torney, D. C., Hildebrand, C. E., and Moyzis, R. K. (1991). Evolution and distribution of (GT)n repetitive sequences in mammalian genomes. Genomics 10:807.

Strassmann, J. E., Hughes, C. R., Queller, D. C., Turillazzi, S., Cervo, R., Davis, S, K., and Goodnight, K. F. (1989). Genetic relatedness in primitively eusocial wasps. Nature 342:268.

Strassmann, J. E., Queller, D. C., Soils, C. R,, and Hughes, C. R. (1991). Relatedness and queen number in the neotropical wasp, Parachartergus colobopterus. Anita. Behav. 42:461.

Tautz, D. (1989). Hypervariability of simple sequences as a general source for polymorphic DNA markers. Nucleic Acids Res. 17:6463.

Tautz, D., and Renz, M. (1984). Simple sequences are ubiquitous repetitive components of eukaryotic genomes. Nucleic Acids Res. 12:4127.

Weber, J. L. (1990). Informativeness of human (dC-dA), • (dG-dT)n polymorphisms. Genomics 7:524.

Weber, J. L., and May, P. E. (1989). Abundant class of human DNA polymorphisms which can be typed using the polymerase chain reaction.Am. J. Hum. Genet. 44:388.

Weissenbach, J., Gyapay, G., Dib, C., Vignal, A., Morissette, J., Millasseau, P., Vaysseix, G., and Lathrop, M. (1992). A second-generation linkage map of the human genome. Nature 359:794.