Microsatellite retrieval in lettuce(Lactuca sativa L.)

Clemens van de Wiel, Paul Arens, and Ben Vosman

Abstract: By using enriched genomic libraries, microsatellite-containing sequences were isolated from lettuce(Lactuca sativa) with high efficiency. With this approach, a sizeable fraction (up to 55%) of the clones contained amicrosatellite. In about half of these clones, primers could be designed for PCR amplification of the microsatellite.This yielded 28 primer sets amplifying unambiguously scorable products, of which 26 showed polymorphisms in a testset of six lettuce varieties. Practically all microsatellite-amplifying primer sets yielded products in lettuce’s nearestrelative,L. serriola, but only half of the primer sets yielded products in the more distant speciesL. salignaandL. virosa. An average polymorphism information content (PIC) value of 0.55 and an average number of 3.5 alleles perlocus were in the normal range for a self-fertilizing species like lettuce. In addition, the incidental cloning of amicrosatellite-containing repeat family, apparently specific forLactuca, is reported and the implications for the efficientretrieval of single-locus microsatellite sequences are discussed. The microsatellite loci isolated will be useful fordistinguishing lettuce cultivars and for screening diversity of genetic resources.

Key words: STMS, SSR, repeats, genetic diversity.

Résumé: À l’aide de banques génomiques enrichies, des séquences contenant des microsatellites ont été isolées avecune grande efficacité chez la laitue (Lactuca sativa). Avec cette approche, une proportion appréciable (jusqu’à 55%)des clones contenaient un microsatellite. Chez environ la moitié de ces clones, des amorces PCR permettantl’amplification du microsatellite ont pu être synthétisées. Vingt-huit paires d’amorces permettant d’amplifier desproduits faciles à lire ont été obtenus et vingt-six de ceux-ci ont révélé du polymorphisme parmi un ensemble de sixvariétés de laitue. Presque toutes les paires d’amorces ont permis d’obtenir des produits d’amplification chez leL. serriola, l’espèce la plus apparentée à la laitue, alors que seule la moitié des paires d’amorces ont donné desproduits chez les espèces moins apparentéesL. salignaet L. virosa. Une valeur moyenne de l’indice PIC(«polymorphism information content») de 0,55 et un nombre moyen d’allèles par locus de 3,5 s’avèrent des valeurstout à fait normales chez une espèce autogame telle que la laitue. De plus, les auteurs rapportent le clonage fortuitd’une famille de séquences répétitives qui contient un microsatellite et qui est apparemment spécifique du genreLactuca. Les implications de cette méthode efficace d’isolement de microsatellites à locus simple sont discutées. Lesmicrosatellites isolés seront utiles en identification variétale et en vue de la caractérisation de la diversité desressources génétiques.

Mots clés: STMS, SSR, séquences répétitives, diversité génétique.

[Traduit par la Rédaction] van de Wiel et al. 149

Microsatellites, also called simple sequence repeats(SSRs), have been shown to be excellent molecular markersfor the study of genetic diversity (Karp et al. 1997). This fol-lows from their characteristics: they are tandemly repeatedstretches of 2–8 base pairs that can vary extensively in thenumber of repeats, which is believed to be due to slippage ofDNA polymerase during replication (Schlötterer and Tautz1992). In addition, they occur throughout the whole

eucaryotic genome (Hamada et al. 1982, 1984; Kijas et al.1997). Microsatellites can be probed by using synthetic oli-gonucleotides complementary to these sequences in Southernhybridization, leading to multilocus fingerprints (Vosman etal. 1992; Weising et al. 1995). Microsatellites can also beimplemented as monolocus, codominant markers by convert-ing individual microsatellite loci into PCR-based markers bydesigning primers from unique sequences flanking themicrosatellite, an approach called sequence-tagged microsatellitesite (STMS) (Beckmann & Soller 1990).

In lettuce (Lactuca sativa) genetic diversity has been stud-ied by several molecular marker systems: RFLPs by Kesseliet al. (1991), RAPDs by Waycott and Fort (1994) andKesseli et al. (1994), and AFLPs by Hill et al. (1996). Thesemarker systems were for the most part able to distinguishand relate a series of lettuce accessions. The RAPDs couldeven discriminate between closely related breeding lines(Waycott & Fort 1994). In an earlier study, we showed thatmicrosatellite fingerprinting is capable of distinguishing all

Genome42: 139–149 (1999) © 1999 NRC Canada

139

Corresponding Editor: G.J. Scoles.

Received July 26, 1998. Accepted August 14, 1998.

C. van de Wiel,1 P. Arens, and B. Vosman.Centre forPlant Breeding and Reproduction Research (CPRO–DLO),P.O. Box 16, NL–6700 AA Wageningen, The Netherlands.

1Author to whom all correspondence should be addressed(e-mail: C.C.M.vandeWiel@CPRO.DLO.NL).

accessions of a series covering all known lettuce crop types,using only one (TCT)10 probe / TaqI restriction enzymecombination; the other microsatellite motifs tested did notproduce unambiguously scorable band patterns (van de Wielet al. 1998). However, the data fell short of establishing rela-tionships between accessions, due to the hypervariability ofthe band patterns. Most bands occurred at unique positions,so that no bands common to two or more accessions couldbe scored for clustering analysis.

In the STMS or, as it is also commonly called, SSR ap-proach, comparison between genotypes is possible based onscoring alleles in the form of exactly sized PCR products.For this approach, microsatellites with flanking sequencesfirst have to be isolated from the lettuce genome. Micro-satellites have been shown to be relatively rare in plantgenomes; for instance, Lagercrantz et al. (1993) found themto be five times less abundant than in mammalian genomes.Therefore, in order to perform microsatellite retrieval in themost efficient way, we adopted a procedure based on small-insert genomic libraries enriched for several types of micro-satellites, as described by Karagyozov et al. (1993). In thismethod, enrichment is achieved by selective hybridization ofgenomic fragments to synthetic oligonucleotides comple-mentary to microsatellites of choice attached to nylon mem-branes. Fragments hybridized to such membranes aresubsequently eluted and used for cloning. In the following,the results of this approach are discussed and the applicabil-ity of the method in lettuce is demonstrated.

Plant materialPlant material was obtained from the collections of the Centre

of Genetic Resources (CGN), The Netherlands, and for the com-mercially available lettuce cultivars, from the Section for Registra-tion and Plant Breeder’s Rights (RKO), both part of CPRO–DLO,The Netherlands. All accessions used are listed in Table 1.

DNA isolationDNA was extracted from pooled young plants. Only for a com-

parison within a relatively heterogeneous cultivar (Madrilene),DNA was extracted from individual young plants. Leaves werecollected and immediately frozen in liquid nitrogen and stored at –70°C until use. Nuclear DNA was isolated according to Vosmanet al. (1992).

Microsatellite retrievalMicrosatellite retrieval was performed essentially according to

Karagyozov et al. (1993), with minor modifications. DNA fromlettuce cultivar Balisto was sonicated to fragment sizes of 200–700bp. Fragments were made blunt-ended by T4 DNA polymerase andwere subsequently ligated by T4 DNA ligase, according to manu-facturer’s instructions (LifeTechnologies), to an adaptor consistingof the 21-mer CTCTTGCTTGAATTCGGACTA and the 25-merTAGTCCGAATTCAAGCAAGAGCACA, containing an EcoRIsite for cloning. About 60 ng of the ligated fragments were ampli-fied in a total volume of 100µL, containing 10 mM Tris–HClpH 9.0, 50 mM KCl, 1.5 mM MgCl2, 0.01% (w/v) gelatin, 0.1%Triton X-100, 100µM of each dNTP, 600 nM of the 21-mer asprimer and 0.6 U SuperTrouper DNA polymerase (HT Biotechnol-ogy Ltd., England), by 20 cycles of 45 s at 94°C, 45 s at 55°C, and1 min and 45 s at 72°C.

Microsatellite-containing fragments were selected by hybridiza-tion to nylon membranes with a combination of differentoligonucleotides attached to them as in Edwards et al. (1996). Twocombinations of oligonucleotides were used, namely (GA)12,(GT)12, (TAA)12, and (GATA)8, and (TCT)10, (TGT)9, and(TGTT)8, respectively. These oligonucleotides were chosen, be-cause in previous hybridization experiments with total genomicDNA spotted on nylon membranes these types of microsatelliteswere consistently shown to be well represented in several plantspecies (M.J.M. Smulders et al., in preparation)2 and they werepooled to increase cloning efficiency by combining retrieval ofseveral microsatellite motifs into one reaction. Aliquots of 0.2µgof each oligonucleotide were spotted onto round pieces of HybondN+ (Amersham) with a diameter of 5 mm. The membrane pieceswere air-dried, briefly rinsed in water, and baked at 80°C for 2 h.The membranes were incubated for 3 d in hybridization buffer

© 1999 NRC Canada

140 Genome Vol. 42, 1999

Cultivar oraccession

RKO or CGNnumber

Lettuce crop type orLactucaspecies Origin

Karif RKO 92296 CrispBalisto RKO 93130 ButterheadMadrilene RKO 91232 LatinMonet RKO 90207 CuttingGrise Maraîchère RKO 89212 CosHector RKO 91162 CosTianjin Big Stem CGN 11387 Stalk China

CGN 13386 Crisp or Landrace The NetherlandsCGN 04667 L. serriola through Botanical Garden Rotterdam, The NetherlandsCGN 15671 L. serriola ArmeniaCGN 15684 L. serriola Hatay, TurkeyCGN 10881 L serriola Oudewater, The NetherlandsCGN 15697 L. saligna Balikesir, TurkeyCGN 05310 L. saligna Raananna, IsraelCGN 05327 L. saligna Gerona, SpainCGN 13350 L. virosa Asturia, SpainCGN 13339 L. virosa SpainCGN 05941 L. virosa Israel

Table 1. Lactucacultivars and accessions used in this study.

2M.J.M. Smulders, P. Arens, W. Rus-Kortekaas, G. Bredemeijer, C. van de Wiel, D. Esseling, D. Wouters, and B. Vosman. In preparation.

(50% formamide, 7% SDS, 5 × SSC, 50 mM sodium phosphate,pH 7.0, at 37°C), and subsequently for 10 min in 1% SDS in aboiling water bath, in order to remove all unbound oligo-nucleotides. About 2µg of PCR-amplified ligated fragments, dena-tured by 10 min incubation at 95°C, were hybridized to eachmembrane for 2 d at 37°C in 0.6 mL of the above hybridizationbuffer, to which 10µg of the 21-mer was added to prevent bindingof the fragments to each other by way of the complementary adap-tors at their ends. After hybridization, membranes were washedthree times in 2 × SSC, 1% SDS at 62°C, two times for 15 minwith the final wash for 30 min. Elution of fragments from themembranes was performed in 0.5 mL of 0.5 × SSC, 1% SDS for30 min at 62°C. Eluted fragments were precipitated by adding20 µg glycogen, 100µL of 10 M LiCl and 0.6 mL isopropanol,followed by overnight incubation at –20°C. The precipitate wasdissolved in 20µL of sterilized distilled water. Two microlitres ofthis solution were amplified as before, but for the use of 25 cyclesinstead of 20.

For cloning, the amplified fragments were digested withEcoRIaccording to manufacturer’s instructions (LifeTechnologies) andseparated from the restricted adapter ends by electrophoresis on a2% agarose gel in 1 × TBE. The zone from 250 to 700 bp was cutout from the gel and the fragments were electro-eluted, followedby phenol–chloroform extraction and ethanol precipitation accord-ing to standard procedures (Sambrook et al. 1989). Fragments wereligated into EcoRI-digested pBluescript SK+ (Stratagene) andtransformed to E. coli DH5α (LifeTechnologies). Fragment-containing clones were transferred onto Hybond N+ membranesand screened by hybridization to a mixture of the appropriateoligonucleotides end-labeled with32P by T4 polynucleotide kinase(LifeTechnologies) according to Sambrook et al. (1989) in a bufferconsisting of 5 × SSC, 0.1% N-lauroylsarcosine, 0.02% SDS, and0.5% Blocking reagent (Boehringer Mannheim) at 65°C overnight.

Primer design and evaluationClones positive in the screening for microsatellites were

sequenced with the ABI DyeDeoxy Terminator Cycle Sequencingkit, using the -21M13 forward and M13 reverse primers (AppliedBiosystems). Sequences were run on an ABI 373 Automated DNASequencer. Where possible, primers for amplification of micro-satellites in the cloned fragments were designed with the programsPrimer (Whitehead Inst. Biomed. Res.) and PCR Plan (PC/Gene,Release 6.70). Amplification was performed in 20µL containing75 mM Tris–HCl pH 9.0, 1.5 mM MgCl2, 20 mM (NH4)2SO4,0.01% (w/v) Tween 20, 100µM of each dNTP, 300 nM of eachprimer, 8µL of a 1 ng/µL dilution of template DNA in sterile dis-

tilled water and 0.4 unit Goldstar™ DNA polymerase(Eurogentec). Amplification products were mixed with an equalvolume of formamide containing 10 mM NaOH and 0.05%bromophenol blue and denatured for 5 min at 80°C before beingrun on standard 6% polyacrylamide denaturing sequence gels at110 W. Gels were silver-stained according to the Promega SilverSequence™ DNA Sequencing System. For size determination, asequencing reaction on pGEM-3Zf(+), using the pUC/M13 forward24-mer (Promega) as primer, accompanied the samples. Gels werephotographed on Kodak Duplicating RA 1 films. Amplificationproduct quality was assessed analogous to Arens et al. (1995)according to the following criteria: (1) unambiguously scorableproducts; (2) “stutter” bands present, but product still unambigu-ously scorable; (3) ladders of bands of about equal intensity, pro-hibiting scoring of product; (4) appearance of bands of unexpectedsizes prohibiting unambiguous scoring of product; (5) no or onlyweak product formation. The PIC value (polymorphism informationcontent) was calculated according to the formula (Anderson et al.1993):D = 1 – ∑ pi

2, wherepi is the frequency of thei th allele inthe five cultivars examined. The test set for calculating PIC con-tained five cultivars of lettuce comprising diverse cultivar groups:Hector (cos), Balisto (butterhead), Monet (cutting), Karif (crisp),and Tianjin Big Stem (stalk).

PCR amplification of large productsThe amplification of products of several kb was performed with

the Expand™ Long Template PCR System (Boehringer Mannheim)according to the manufacturer’s instructions, using the system 3buffer (i.e. with 2.25 mM final concentration MgCl2 and deter-gents), 500µM of each dNTP, 300 nM of each primer and 20 ngtemplate DNA in a total volume of 50µL. Amplification condi-tions were 2 min at 92°C, 10 cycles of 10 s at 92°C, 30 s at 50°C,and 8 min at 68°C, followed by 20 cycles as before, but adding20 s to the 68°C step each cycle, ending with a final elongationstep of 15 min. Products were visualized on a 0.8% agarose gel runin 1 × TBE.

Southern hybridizationFor Southern blotting, 2µg of DNA was digested with 20 U of

TaqI restriction endonuclease (LifeTechnologies), followed byProteinase K digestion, phenol–chloroform extraction and ethanolprecipitation. Subsequently, a second round of restriction was per-formed in order to ensure digestion to completion. DNA digestswere separated on a 0.8% agarose gel and capillary alkaline-blottedovernight onto Hybond N+ membranes (Amersham). Probes wereprepared from cloned fragments by PCR amplification as above,

© 1999 NRC Canada

van de Wiel et al. 141

Pool

No. ofclonesscreened

No. ofpositiveclones

No. ofclonessequenced

Microsatellitetype

No. ofsequences

No. ofcompoundmicrosatellites

No. ofprimer setsdesigned

1 460 59 30 GA 7 6 6GT 18 13 12TAA 0 — —GATA 4 3 1— 1 1Total 30 22 20

2 420 231 110 TCT 26 1 11TGT 75 17 33TGTT 0 — —— 9 — —Total 110 18 45

Table 2. Results of microsatellite cloning and sequencing by enriching genomic libraries using two mixtures of syntheticoligonucleotides on filters. Pool 1: (GA)12, (GT)12, (TAA)12, and (GATA)8; Pool 2: (TCT)10, (TGT)9, and (TGTT)8. Compoundmicrosatellites were classified according to the type of basic unit that formed the longest stretch within the total microsatellite.

© 1999 NRC Canada

142 Genome Vol. 42, 1999

Locus RepeatProductsize (bp)

Productqualitya

No. of allelesin L. sativa

No. of alleles incv. Madrilene

PICvalueb

PCR conditions(°C / no. of cycles)

LsA001 (GA)44(GT)11c 186 3/2 4 n.d. 0.80 60°/30

LsA002a (GA)7(GT)15(GA)11c 248 2/3 4 1 0.52 55°/30

LsA003 (GA)45c 166 3/2 3 n.d. 0.72 55°/30

LsA004a (GA)19(GT)7(GAGT)4(GA)10 200 1 2 1 0.52 55°/30(GAGT)2(GA)21(GT)12

c

LsA005 (GA)20(GT)13c 175 2 6 3 0.80 45°/35

LsA006 (GT)10(GA)12 158 2/3 4 1 0.72 60°/30LsB101 (GT)12(AT)5(GT)17

c 184 2 3 2 0.56 55°/30LsB102 (GT)11 174 2/3 3 1 0.64 55°/30LsB103 (GT)10 198 5 1? n.d. - 50°/35LsB104 (GA)5(GT)7TATT(GT)12(T)4 164 2 4 1 0.64 55°/30

(GT)8(GA)11c

LsB105 (GA)15(GT)18c 186 1d 5 1 0.80d 55°/30

LsB106 (GT)13 202 1d 3 1 0.56d 55°/30LsB107 (GT)7...(GT)13

c 199 2d 4 1 0.72d 50°/30LsB108a (GT)8(AT)7(GT)25(GA)2(GT)5 197 2 3 1 0.56 55°/30LsB109 (CA)21(TA)11(CA)7(GA)13 210 2 5 2 0.80 45°/35LsB110 (GT)7...(GT)2(AT)2(GT)9 220 1d 1 1 0 60°/30LsB111a (AT)10(GT)13 149 3/2 3 1 0.72 55°/30LsD101 (TCT)20 187 2d 3 2 0.80d 50°/30LsD102 (TCT)25 176 4 - - - 60°/30LsD103a (TCT)17 143 2 4 2 0.72 50°/30LsD104 (TCT)20

c 186 4 - - - 60°/30LsD105G (TCT)32

c...(TCT)15c 211 4 - - - 50°/30

LsD106G (TCT)17(T)5(TCT)2c 190 2 3 1 0.56 55°/30

LsD107G (TCT)20c 131 2 4 1 0.72 50°/30

LsD108 (TCT)35c 179 2 5 3 0.56 60°/30

LsD109 (TCT)22 155 2 4 1 0.80 55°/30LsD110a (TCT)21(TCC)2(TCT)7 234 4 - - - 55°/30LsE001 (TGT)31

e ?e 3 - - - 50°/30LsE001c (TGT)16(AGT)2(TGT)4

c 143 1 2 2 0.48 50°/30LsE003a (TGT)24(TA)(TGT)10(TAT)2 208 2 2 1 0.32 55°/30

(TGT)3c

LsE004G (TGT)22c 165 4 - - - 55°/30

LsE005 (TGT)7(TGA)5(TGT)32c 182 4 - - - 50°/30

LsE006 (TGT)26c 191 1 2 1 0.32 60°/30

LsE007 (TGT)18c 183 3 - - - 60°/30

LsE008G (TGT)6(TGG)2(TGT)27c 279 4 - - - 55°/30

LsE009 (TGT)20c 195 2 3 2 0.56 60°/30

LsE011 (TGT)26c 181 1 2 1 0.32 60°/30

LsE012 (TGT)28c...(TGT)2 150 4 - - - 50°/30

LsE013 (TGT)21c 197 4 - - - 55°/35

LsE014 (TGT)18 155 4 - - - 50°/30LsE015a (TGT)19...(TCT)2(TCCT)4 189 5 - - - 55°/35

(TCT)LsE016 (TGT)2(TGA)2(TGT)23

c 173 4 - - - 55°/30LsE017a (TGT)14(T)2(TGT)21

c 150 4 - - - 55°/30LsE018 (TGT)14 173 2 1 1 0 60°/30LsG001G (GATA)31(GA)17

c 299 1 3 1 0.72 50°/30LsH001 (TTAT)5 140 3 - - - 50°/35

aPCR product quality score: (1) unambiguously scorable products, (2) stutter bands present, but product still scorable, (3) ladders of bands of aboutequal intensity, prohibiting scoring of product, (4) appearance of bands of unexpected size prohibiting scoring of product, (5) weak or no productformation.

bPIC = 1 –∑ pi2, wherepi is the frequency of thei th allele.

cMicrosatellites with one or more substitutions in one of the repeat units.dMicrosatellites with more than one PCR product, for the calculation of PIC only the products in the size range of the original primer design were

considered.eIndicated number of repeat units longest of seventeen variants cloned, PCR product size not determinable for all the variants cloned (cf. Fig. 2).Note: n.d. = not determined.

using a primer designed on the fragment and the -21M13 forwardor M13 reverse primer (Applied Biosystems), respectively. For hy-bridization, probes were32P-labeled using the Random PrimersDNA Labelling System from LifeTechnologies using [α-32P]dATPaccording to the manufacturer’s instructions. Hybridization wasperformed overnight at 65°C in a buffer consisting of 5 × SSC,0.1% N-lauroylsarcosine, 0.02% SDS, and 0.5% blocking reagent(Boehringer Mannheim).

Microsatellite enrichmentMicrosatellite-enriched libraries can be produced by

selective hybridization of random genomic fragments towardsa filter on which synthetic oligonucleotides complementaryto the desired microsatellite sequences were spotted(Karagyozov et al. 1993). For our study, genomic DNA frag-ments from lettuce cv. Balisto were ligated to adapters con-taining anEcoRI restriction site. Fragments were amplifiedby PCR before being hybridized to filters with the followingcombinations of oligonucleotides: GA together with GT,TAA, and GATA, and TCT together with TGT and TGTT,respectively.

Earlier experiments in our laboratory indicated that thehigh stringency washing (0.1 × SSC) and subsequent elutionof the genomic fragments to be cloned by boiling in 1%SDS of Karagyozov et al. (1993), led to the selection of verylong microsatellite sequences with hardly any flanking se-quences. In the majority of cases, this made it impossible todesign primers (M.J.M. Smulders et al., in preparation).2

Therefore, washing the filters was done with 2 × SSC andsubsequent elution of genomic fragments with 0.5 × SSC.Although this might lead to a lower level of enrichment thanby using high stringency washing, this procedure led to agood efficiency of cloning microsatellites: with the GA/GT/TAA/GATA combination 13% of clones reacted positively tothe correspondingoligonucleotide probes and with theTCT/TGT/TGTT combination even 55% of clones reactedpositively (Table 2). Reasons for this large difference incloning efficiency between the two oligonucleotide pools arenot immediately apparent. It might be related to the occur-rence of the different motifs in the lettuce genome or thespecific conditions used in the enrichment. After sequenc-ing, almost all positive clones were found to contain amicrosatellite. With the GA/GT/TAA/GATA combination,out of 30 clones sequenced 4 contained a GATA and 25 a

dinucleotide repeat. The great majority of dinucleotide re-peats were compound (19 out of 25), i.e. mixtures of GAand GT series, sometimes intermingled with other dinucleo-tide repeats such as AT. Also 3 out of 4 GATA repeats weremixtures with a dinucleotide repeat. One sequence containedno microsatellite conforming to one of the oligonucleotideson the enrichment filter, but a series of T and A repeats. NoTAA microsatellites were found. This might be attributed tothe hybridization conditions used during enrichment and/orscreening the clones for microsatellites, since hybridizationin 5 × SSC at 65°C is relatively stringent for the (TAA)12probe used (calculatedTm 69.2°C, normally a hybridizationtemperature ofTm –5°C to –10°C is successfully used).

With the TCT/TGT/TGTT combination, 101 out of 110clones sequenced contained a microsatellite, all of themtrinucleotide repeats. Of these 101 clones, 26 were TCT- andas many as 75 were TGT-repeats. Only 18 of the trinucleotiderepeats could be called compound, i.e., there were very shortstretches of TCT, TAT, or TCG in an otherwise TGTmicrosatellite (Table 2). No TGTT microsatellite was found,but, remarkably, again one clone showed a mixture of T andA repeats, like that found using the GA/GT/TAA/GATAcombination.

Primer design and evaluationTo put the sequence information obtained in the STMS

approach to use, it is essential that a sufficient number ofbase pairs flank the microsatellite in the cloned fragments inorder to be able to design PCR primers. It was possible todesign primers from 67% of the clones derived from theGA/GT/TAA/GATA combination and from 41% derivedfrom the TCT/TGT/TGTT combination (Table 2). In theother clones too little flanking sequence was left for primerdesign either at one side or even at both sides of themicrosatellite. In 15% of TCT- and 30% of TGT-containingsequences, the microsatellite occupied the complete clonedfragment.

The PCR primer sets were tested on a series of six lettucevarieties, two or three accessions from the most immediatewild relative L. serriola, and one accession each fromL. salignaand L. virosa. In one lettuce cultivar, Madrilene,three individuals were scored. The product quality of theseprimer sets was scored according to Arens et al. (1995). Anoverview of these primer sets is given in Table 3. Twenty-eight of the 45 primer sets tested gave quality 1 or 2 product

© 1999 NRC Canada

van de Wiel et al. 143

Table 3. Lettuce microsatellite primer sets with repeat description; PCR product size based on the primer design from the clonedgenomic fragment from cv. Balisto, PCR product quality, polymorphism information content (PIC), number of alleles found amongthe cultivated lettuce varieties of the test set, and effective PCR conditions (annealing temperature/number of cycles).

Repeat L. sativa L. serriola L. saligna L. virosa Not scorable

GA 5 5 2 2 1GT 10 9 5 6 1TCT 6 6 4 5 4TGT 6 5 3 2 10GATA 1 1 0 1 0

Total 28 26 14 16 16

Table 4. Formation of unambiguously scorable PCR products for five microsatellite typesin four different Lactucaspecies.

and thus can be scored unambiguously. The scorability wasnot the same for the different microsatellite motifs: theprimer sets designed on the TGT-containing fragments pro-duced fewer scorable products than did those designed onthe other motifs (Table 4). Twenty-six of the 28 primer setsproducing scorable products showed polymorphisms be-tween cultivars on silver-stained polyacrylamide gels. Fromthese 26 primer sets, 10 also produced polymorphismswithin the cultivar Madrilene (Table 3). The scorable locihad an average PIC (polymorphism information content) of0.55 and yielded on average 3.4 alleles per locus in culti-vated lettuce. Examples of two scorable primer sets are

shown in Fig. 1. The transferability of product formationfrom the lettuce primer sets toL. serriola was almost com-plete, which is in line with the extremely close relationshipbetween the two species, but to otherLactucaspecies it wasrather low: about half of the primer sets did not give a prod-uct in eitherL. salignaor L. virosa or both (Table 4).

TGT microsatellites forming part of a larger repetitivearray

Nineteen of the 75 genomic fragments containing TGTmicrosatellites sequenced proved to be highly homologous;four of these formed two pairs of identical sequences leav-

© 1999 NRC Canada

144 Genome Vol. 42, 1999

Fig. 1. Silver-stained denaturing polyacrylamide gel electrophoresis of PCR amplification products of two lettuce microsatellites. Formicrosatellite LsD108, lanes contain lettuce cultivars Madrilene (three individuals: lanes 1–3), Hector (4), Balisto (5), Monet (6), Karif(7), and Tianjin Big Stem (8); theL. serriola accessions CGN 4667 (9), and 15671 (10); theL. salignaaccession CGN 15697 (11);and theL. virosa accession CGN 5941 (12). For microsatellite LsB105, lanes contain the lettuce cultivars Grise Maraîchère (1), Balisto(2), Monet (3), Karif (4), and Tianjin Big Stem (5); theL. serriola accessions CGN 4667 (6), 15671 (7), and 15684 (8); theL. salignaaccession CGN 15697 (9); and theL. virosa accessions CGN 5941 (10) and 13339 (11). For some products, the respective sizes areindicated on the left or right (bp).

ing 17 different variants of the LsE001 SSR (Table 2 and 3).These 17 variants are aligned in Fig. 2. The majority of dif-ferences between the sequences flanking the microsatellitewere substitutions and only rarely a small deletion wasfound. The microsatellite itself showed a different number ofbasic TGT repeat units in all 17 variants and, in some in-stances, a substitution in one or a few of the TGT repeatunits (Fig. 2). One fragment (2ls159 in Fig. 2) was aberrantin that at one side of the TGT microsatellite the flanking se-quence was homologous to the rest of the 17 variants,whereas the sequence at the other side was completely dif-ferent. Primers designed on this fragment, i.e., a forwardprimer on the aberrant sequence of 2ls159 (LsE001f F) andthe consensus reverse primer LsE001 R described below onthe homologous sequence at the other side of the micro-satellite (cf. Fig. 2), did not amplify any product (data notshown). This implies that artefacts can occur in the PCR am-plification during the enrichment process or in the subse-quent cloning step, that is, an exchange might have occurredbetween different genomic fragments at the microsatellitesequence that they have in common. However, in the wholeof these experiments this was the only observation indicat-ing that such artefacts might occur during microsatellite re-trieval.

Consensus primers designed on the homologous se-quences around the microsatellite, LsE001 F and R (cf.Fig. 2), show a ladder of products on silver-stained PAGE(Fig. 3A, lane 1), which can be explained by the observedvariation in the number of TGT repeats in the cloned frag-ments. Primers specifically designed with bases unique forone or more of the cloned fragments of the repeat family attheir 3′ ends diminished the number of products (e.g., thecombination of the aforementioned consensus forwardprimer LsE001 F with the more specific reverse primerLsE001a R designed from clones 2ls106 and 2ls053 inFig. 2, leading to the pattern shown in Fig. 3A, lane 2). Onlyin one case where both primers had a unique base at their re-spective 3′ ends (LsE001c F and R designed from clone2ls137 in Fig. 2), was an unambiguously scorable productobtained (Fig. 3A, lane 3) that is variable between acces-sions of lettuce but is not found in the other species(Fig. 3B). This observation, together with the fact that aquarter of the TGT microsatellite-contaning clones se-quenced consisted of these homologous variants, indicatesthat the number of members of this repeat family in the let-tuce genome is rather high.

The following preliminary results give further indicationsof the nature of the LsE001 repeat family in the lettuce ge-nome. Southern blot experiments, using probes preparedfrom the sequences flanking the microsatellite on either side,indicated that, at least for the part cloned, the repeat familyis specific for lettuce and its wild relatives tested. Hybridiza-tion signal could be detected on Southern blots ofTaqI re-striction digests of genomic DNA fromL. sativa, L. serriola,L. saligna, andL. virosa, but in the same hybridization reac-tion no signal was obtained withTaqI digests from potato(Solanum tuberosum), tomato (Lycopersicon esculentum),cauliflower (Brassica oleracea), ryegrass (Lolium perenne),and tulip (Tulipa sp.) (data not shown). Probes from bothsides of the microsatellite produced similar results. PCR am-plifications under conditions favorable for long product for-

mation, gave major products in the size range between 4 and10 kb, both when individual primers and combinations ofprimers were used that direct amplification away from theTGT microsatellite (in fact, the complements of the consen-sus primers LsE001 F and R, cf. Fig. 2) (data not shown).This implies that at least part of the members of the repeatfamily occur within amplifiable range of each other, withvariants occurring as direct as well as variants occurring asinverted repeats. Sequence comparison of the sequencesflanking the TGT microsatellite in the LsE001 repeat familywith the EMBL database revealed no significant homologyto known genes or anonymous sequences. The only uninter-rupted ORF on the LsE001 consensus sequence found alsodid not show significant homologies to any protein sequencein the EMBL database.

Our results show that it is possible to clone microsatellitesequences from lettuce in an efficient way by using amicrosatellite enrichment method. Primers for PCR amplifi-cation were designed from approximately half of the clonedsequences. Three-fifths of these primer sets yielded unam-biguously scorable PCR products. Twenty-six out of the 28primer sets that yielded unambiguously scorable PCR prod-ucts also showed polymorphisms within the speciesL. sativa. From these 26 primer sets, 10 also producedpolymorphisms within a cultivar (Madrilene) that has previ-ously been shown to be variable in Southern hybridizationwith a (TCT)10 probe (van de Wiel et al. 1998). The averagePIC value of 0.55 and the average number of alleles per lo-cus of 3.4 are well comparable to the values of other self-fertilizing species, such as wheat (Bryan et al. 1997: 0.51and 3.5, respectively). Practically all primer sets also yieldedPCR products inL. serriola, which is in accordance with itsknown very close relationship to cultivated lettuce. It lendsfurther support to the contention by Frietema de Vries(1994) thatL. sativa and L. serriola should be regarded asconspecific. Further transferability, however, was rather low,since only about half of the primer sets gave products in ei-ther L. salignaor L. virosa, even though both being speciesthat are regarded as closely related toL. sativa / L. serriola(Feráková 1977, De Vries 1990). A transferability of about50% is comparable to that found between tomato(Lycopersicon esculentum) and potato (Solanum tuberosum)by Smulders et al. (1997).

A few interesting observations regarding the microsatelliteenrichment procedure are worth mentioning. For the enrich-ment filters containing a mixture of GA, GT, TAA, andGATA, the majority (about three quarters) of microsatellitesretrieved were of the compound type, that is mixtures of, forinstance, stretches of GA and GT or GATA and GA. Thismight be a characteristic of these types of microsatellite inlettuce, but in earlier experiments with only one type ofoligonucleotide per filter, more homogeneous GT micro-satellites were found (data not shown). Thus, the use ofoligonucleotide mixtures for enrichment could for sometypes of microsatellites very well lead to selective accumula-tion of compound sequences. Interruptions in the micro-satellite repeat structure have been shown to lead to lowerlevels of polymorphism (Bell and Ecker 1994; Pépin et al.

© 1999 NRC Canada

van de Wiel et al. 145

© 1999 NRC Canada

146 Genome Vol. 42, 1999

Fig. 2. Sequence alignment of the 17 different fragments of the LsE001 TGT microsatellite-containing repeat family cloned (EMBLY17615–Y17631). The “f” and “r” at the end of the fragment names indicate whether the forward or the reverse sequence has beenshown, respectively. The upper sequence represents the consensus sequence with every 50 bp indicated above. The microsatellites aredelimited by a box in the alignment; primers mentioned in text are indicated by grey arrows: consensus primers for amplification ofthe microsatellite are indicated on the consensus sequence, for 2ls106 and 2ls053 only a reverse primer was designed (LsE001a R),for 2ls137 both a forward and reverse primer were designed (LsE001c F and R), for 2ls159 only a forward primer was designed(LsE001f F).

1995). However, the compound microsatellites reported hereshow good levels of polymorphism as indicated by their PICvalues. This will be due to the fact that individual stretchesof homogeneous repeats in these compound microsatellitesare for the most part considerably longer than 8 repeat units(Table 3). A number of 8 repeat units could be regarded asthe lower limit for producing good polymorphism rates(Weber 1990; Smulders et al. 1997).

In a large part of the trinucleotide microsatellites (15% ofTCT and 30% of TGT), the complete cloned fragment con-sisted of the microsatellite, despite the mild conditions usedin the enrichment step, while in the rest of the cases whereno primers could be designed (30% with TCT and 45% withTGT), this was due to the microsatellite being situated atone end of the fragment. This might suggest that the proce-dure used for creating the small genomic fragments, namelysonication, frequently induces breaks in the DNA at the endsof microsatellites. This might be related to the special sec-ondary structure of microsatellite sequences (e.g., Z-DNA,Hamada et al. 1982). Therefore, it may be preferable to pro-

duce small genomic fragments by using 4-base-pair-recognizing restriction enzymes.

In comparison to the other microsatellite motifs, the TGT-containing sequences performed poorly in terms of thescorability of the PCR products from the primer sets de-signed on them. This was mainly due to the production ofladders of PCR products and (or) extra products of unex-pected sizes. The ladders of PCR products can be explainedby the occurrence of TGT microsatellites in a repetitive ar-ray, in which the number of basic repeats of the TGT micro-satellite varies between the different members of the array(cf. our cloned LsE001 repeat family in Fig. 2). Similar lad-ders of PCR products were observed not only with TGTmicrosatellites of which the flanking sequences did not showany homology to the LsE001 family, but also with some ofthe TCT microsatellites. These observations indicate that suchmicrosatellite-containing repeat families are no rare phe-nomenon in the lettuce genome. A microsatellite-containingrepeat family is also reported in the beet genome (Mörchenet al. 1996). These authors found a GT microsatellite in a re-

© 1999 NRC Canada

van de Wiel et al. 147

Fig. 3. Characterization of LsE001 TGT microsatellite-containing repeat array by silver-stained denaturing PAGE of PCR amplificationproducts. (A) PCR amplification from genomic DNA of lettuce cultivar Balisto using as primers (cf. Fig. 2): consensus set LsE001 Fand R (lane 1), consensus forward primer LsE001 F and reverse primer LsE001a from clones 2ls106 and 2ls053 (lane 2), bothforward and reverse primer LsE001c from clone 2ls137 (lane 3). For two products, the respective sizes are indicated on the right (bp).(B) PCR amplification using primer set LsE001c; lanes contain lettuce cultivars Madrilene (three individuals: 1–3), Hector (4), Balisto(5), Monet (6), Karif (7), and Tianjin Big Stem (8); theL. serriola CGN accessions 15684 (9) and 10881 (10); theL. salignaCGNaccession 5310 (11); and theL. virosa CGN accession 13339 (12). TheL. serriola accessions show only a faint product. Product sizesare indicated on the left and right (bp).

peat family. This 320 base pair tandemly repeated satellitesequence from beet shares homology with other plant spe-cies and yeast centromeric sequences. In the case reportedhere, the repeat appears to be specific forLactuca. At leastpart of the repeats apparently occur within amplifiable dis-tance of each other, as judged from our long distance PCRexperiments. On the basis of the small part of the TGTmicrosatellite-containing repeat that has been sequencedhere (686 bp) and these preliminary additional observations,it is hard to judge its relationship to already described typesof repeats. No significant homologies were found to anyDNA or protein sequence present in the EMBL database. Inorder to provide more insight into the nature of the repeatfamily, the whole repeat will have to be sequenced andtested in genomic in situ hybridization experiments.

The occurrence of microsatellites in repetitive sequencesrenders them useless for the STMS approach, unless it is alow-copy number type of repeat. The cloned repeats mightstill be useful for fingerprinting purposes. However, theseexperiences suggest that it might be worthwhile to first re-move repetitive sequences from the genomic DNA beforeembarking on the isolation of microsatellite loci. One way ofdoing this might be the separation of genomic DNA by GC-content, since it has been observed in maize that the part ofthe genome containing the coding sequences shows a verynarrow range of GC-percentage (Carels et al. 1995). Otherpossibilities could be the use of cDNA libraries instead ofgenomic libraries or the prior selection of genomic frag-ments produced by methylation-sensitive restriction en-zymes, such asPstI, which have been reported to producepreferentially single-copy genomic banks in RFLP probeisolation (Miller and Tanksley 1990).

In conclusion, enriched small-insert genomic libraries arean efficient way of microsatellite retrieval, when used withcare. The microsatellite primer sets obtained in lettuce ap-pear to be useful for purposes of identification of cultivarsand accessions, and screening germplasm and material ingenebanks, which will be the aim of future studies.

The authors wish to thank Ir. N. van Marrewijk and Ing.S. van der Wal for helpful discussions and providing mate-rial, Ir. I. Boukema for helpful discussions, Dr. L.W.D. vanRaamsdonk for assistance in the analysis of the STMSprimer sets, and Dr. Ir. A. van Heusden, Dr. J.M. Sandbrink,and Dr. M.J.M. Smulders for critically reading the manu-script. The primers discussed in this publication are avail-able for academic research upon request to the last author.The research was financially supported by EU grantB102CT-930295.

Anderson, J.A., Churchill G.A., Autrique, J.E., Tanksley, S.D., andSorrells, M.E. 1993. Optimizing parental selection for geneticlinkage maps. Genome,36: 181–186.

Arens, P., Bredemeijer, G., Smulders, M., and Vosman, B. 1995.Identification of tomato cultivars using microsatellites. ActaHorti. 412: 49–57.

Beckmann, J.S., and Soller, M. 1990. Toward a unified approach togenetic mapping of eukaryotes based on sequence tagged micro-satellite sites. BioTechnology,8: 930–932.

Bell, C.J., and Ecker, J.R. 1994. Assignment of 30 microsatelliteloci to the linkage map ofArabidopsis. Genomics,19: 137–144.

Bryan, G.J., Collins, A.J., Stephenson, P., Orry, A., Smith, J.B.,and Gale, M.D. 1997. Isolation and characterisation of micro-satellites from hexaploid bread wheat. Theor. Appl. Genet.94:557–563.

Carels, N., Barakat, A., and Bernardi, G. 1995. The gene distribu-tion of the maize genome. Proc. Natl. Acad. Sci. U.S.A.92:11 057 – 11 060.

De Vries, I.M. 1990. Crossing experiments of lettuce cultivars andspecies (Lactuca sect.Lactuca, Compositae). Plant Syst. Evol.171: 233–248.

Edwards, K.J., Barker, J.H.A., Daly, A., Jones, C., and Karp, A.1996. Microsatellite libraries enriched for several microsatellitesequences in plants. BioTechniques,20: 758–760.

Feráková, V. 1977. The genusLactuca L. in Europe. UniverzitaKomenského, Bratislave.

Frietema de Vries, F.T., Van der Meijden, R., and Brandenburg,W.A. 1994. Botanical files on Lettuce (Lactuca sativa) – On thechance for gene flow between wild and cultivated lettuce(Lactuca sativaL. including L. serriola L., Compositae) and thegeneralized implications for risk-assessments on geneticallymodified organisms. Gorteria Supplement, Leiden, The Nether-lands (ISSN 0017-2294),2: 1–44.

Hamada, H., Petrino, M.G., and Kakunaga, T. 1982. A novel re-peated element with Z-DNA-forming potential is widely foundin evolutionarily diverse eukaryotic genomes. Proc. Natl. Acad.Sci. U.S.A.79: 6465–6459.

Hamada, H., Petrino, M.G., Kakunaga, T., Seidman, M., andStollar, B.D. 1984. Characterization of genomic poly(dT-dG).poly(dC-dA) sequences: Structure, organization, and con-formation. Mol. Cell Biol.4: 2610–21.

Hill, M., Witsenboer, H., Zabeau, M., Vos, P., Kesseli, R., andMichelmore, R. 1996. PCR-based fingerprinting using AFLPs asa tool for studying genetic relationships inLactucaspp. Theor.Appl. Genet.93: 1202–1210.

Karagyozov, L., Kalcheva, I.D., and Chapman, M. 1993. Con-struction of random small-insert genomic libraries highly en-riched for simple sequence repeats. Nucleic Acids Res.21:3911–3912.

Karp, A., Edwards, K.J., Bruford, M., Funk, S., Vosman, B.,Morgante, M., Seberg, O., Kremer, A., Boursot, P., Arctander,P., Tautz, D., and Hewitt, G.M. 1997. Molecular technologiesfor biodiversity evaluation: Opportunities and challenges. Na-ture Biotechnol.15: 625–628.

Kesseli, R.W., Ochoa, O., and Michelmore, R. 1991. Variation atRFLP loci in Lactuca spp. and origin of cultivated lettuce(L. sativa). Genome,34: 430–436.

Kesseli, R.V., Paran, I., and Michelmore, R.W. 1994. Analysis of adetailed genetic linkage map ofLactuca sativa(Lettuce) con-structed from RFLP and RAPD markers. Genetics,136: 1435–1446.

Kijas, J.M.H., Thomas, M.R., Fowler, J.C.S., and Roose, M.L.1997. Integration of trinucleotide microsatellites into a linkagemap of Citrus. Theor. Appl. Genet.94: 701–706.

Lagercrantz, U., Ellegren, H., and Andersson, L. 1993. The abun-dance of various polymorphic microsatellite motifs differs be-tween plants and vertebrates. Nucleic Acids Res.21: 1111–1115.

Miller, J.C., and Tanksley, S.D. 1990. Effect of different restrictionenzymes, probe source, and probe length on detecting restriction

© 1999 NRC Canada

148 Genome Vol. 42, 1999

© 1999 NRC Canada

van de Wiel et al. 149

fragment length polymorphism in tomato. Theor. Appl. Genet.80: 385–389.

Mörchen, M., Cuguen, J., Michaelis, G., Hänni, C., and Saumitou-Laprade, P. 1996. Abundance and length polymorphism ofmicrosatellite repeats inBeta vulgarisL. Theor. Appl. Genet.92: 326–333.

Pépin, L., Amigues, Y., Lépingle, A., Berthier, J.L., Bensaid, A.,and Vaiman, D. 1995. Sequence conservation of microsatellitesbetweenBos taurus(cattle), Capra hircus (goat), and relatedspecies. Examples of use in parentage testing and phylogenyanalysis. Heredity,74: 53–61.

Sambrook, J., Fritsch, E.F., and Maniatis, T. 1989. Molecular clon-ing: A laboratory manual. Cold Spring Harbor Laboratory Press,Cold Spring Harbor, New York.

Schlötterer, C. and Tautz, D. 1992. Slippage synthesis of simple se-quence DNA. Nucleic Acids Res.20: 211–216.

Smulders, M.J.M., Bredemeijer, G., Rus-Kortekaas, W., Arens, P.,and Vosman, B. 1997. Use of short microsatellites from data-

base sequences to generate polymorphisms amongLycopersiconesculentumcultivars and accessions of otherLycopersiconspe-cies. Theor. Appl. Genet.94: 264–272.

van de Wiel, C., Arens, P., and Vosman, B. 1998. Microsatellitefingerprinting in lettuce (Lactuca sativaL.) and wild relatives.Plant Cell Rep.17: 837–842.

Vosman, B., Arens, P., Rus-Kortekaas, W., and Smulders, M.J.M.1992. Identification of highly polymorphic DNA regions in to-mato. Theor. Appl. Genet.85: 239–244.

Waycott, W. and Fort, S.B. 1994. Differentiation of nearly identicalgermplasm accessions by a combination of molecular andmorphologic analyses. Genome,37: 577–583.

Weber, J.L. 1990. Informativeness of human (dC-dA)n.(dG-dT)npolymorphisms. Genomics,7: 524–530.

Weising, K., Nybom, H., Wolff, K., and Meyer, W. 1995. DNA fin-gerprinting in plants and fungi. CRC Press, Boca Raton.