(This is a sample cover image for this issue. The actual cover is not yet available at this time.)

This article appeared in a journal published by Elsevier. The attachedcopy is furnished to the author for internal non-commercial researchand education use, including for instruction at the authors institution

and sharing with colleagues.

Other uses, including reproduction and distribution, or selling orlicensing copies, or posting to personal, institutional or third party

websites are prohibited.

In most cases authors are permitted to post their version of thearticle (e.g. in Word or Tex form) to their personal website orinstitutional repository. Authors requiring further information

regarding Elsevier’s archiving and manuscript policies areencouraged to visit:

http://www.elsevier.com/copyright

Author's personal copy

Microarray analysis of the inflammatory and immune responses in head kidneyturbot leucocytes treated with resveratrol

Berta Domínguez a,1, Belén G. Pardo b,1, Manuel Noia a, Adrián Millán b, Antonio Gómez-Tato c,Paulino Martínez b, José Leiro d, Jesús Lamas a,⁎a Departamento de Biología Celular y Ecología, Facultad de Biología, Universidad de Santiago de Compostela, 15782 Santiago de Compostela, Spainb Departamento de Genética, Facultad de Veterinaria, Universidad de Santiago de Compostela, Campus de Lugo, 27002 Lugo, Spainc Departamento de Geometría y Topología, Facultad de Matemáticas, Universidad de Santiago de Compostela, 15782 Santiago de Compostela, Spaind Departamento de Microbiología y Parasitología, Instituto de Investigación y Análisis Alimentarios, Universidad de Santiago de Compostela, 15782 Santiago de Compostela, Spain

a b s t r a c ta r t i c l e i n f o

Article history:Received 7 January 2013Received in revised form 29 January 2013Accepted 31 January 2013Available online 15 February 2013

Keywords:ResveratrolTurbotMicroarrayInflammationImmunity

A DNA oligo-microarray enriched in genes and involved in inflammatory and immune responses was used toevaluate the effects of resveratrol on gene expression in turbot head kidney leucocytes. Leucocyteswere culturedfor 3, 6 and 24 h, in the presence or absence of resveratrol, or were stimulatedwith themembrane fraction of theparasite Philasterides dicentrarchi or with the membrane plus resveratrol. Gene expression changed considerablyin control cells, and several of the regulated genes were related to inflammatory and immune responses and tothe cytoskeleton. Similar changes in gene expression occurred in control cells and in cells stimulated withP. dicentrarchi membrane fraction. Treatment with resveratrol induced changes in the expression (mostlydown-regulation) of several genes involved in immune responses and inflammation. Thus, the down-regulationof the transcription factor PU.1, pentraxin-multidomain protein, hemeoxygenase 1, S100 calcium-bindingproteinA-16 (S100A16) and the signal transducer and activator of transcription 4was observed after all three incubationtimes. The down-regulation of the suppressor of cytokine signalling 3a, LPS-induced tumour necrosis alpha,hepcidin, metallothionein, TLR8 and the calcium dependent lectin A was observed after 3 and 6 h. Resveratrolalso decreased the expression of CCL20, IL-8, apolipoprotein E and glutathione S-transferase after incubation for6 and 24 h, and of TNF-α after incubation for 3 and 24 h. Resveratrol also induced strong regulation of severalcytoskeleton-relatedgenes. Theuse of the turbot oligo-microarray enabled us to discover geneswhose expressionwas not previously suspected of being modulated by this polyphenol.

© 2013 Elsevier B.V. All rights reserved.

1. Introduction

Resveratrol (trans-3,5,40-trihydroxystibene) is a natural polyphenolthat has been found in several plants, such as grapevines, cranberriesand peanuts. This polyphenol exerts many physiological effectsin mammals, including anti-inflammatory, anti-oxidant, anti-aging,cardioprotective, neuroprotective and cancer chemopreventive activi-ties [1]. The antioxidant activities of reservatrol have been widelystudied and there are apparently several mechanisms of activity. Res-veratrol decreases the intracellular and extracellular production of reac-tive oxygen and nitrogen species [2] and induces the activity ofantioxidant enzymes [3]. Resveratrol has also been reported to slow

down aging by activating sirtuins [4] and to have a cardioprotective ef-fect, via stimulation of eNOS activity, and antihypercholesterolemic andantidiabetic effects [5]. Many reports have suggested a neuroprotectiveeffect of this compound, which is often attributed to its antioxidant ca-pacity, and anticancer activities via several mechanisms including anti-oxidant activity and stimulation of apoptosis [1]. Resveratrol elicitsinhibitory effects at all stages of the inflammatory response: it modifiesthe activity of inflammatory cells by inhibiting production of reactiveoxygen and nitrogen species; it regulates enzyme expression, and it de-creases the activity of several enzymes involved in the synthesis of pro-inflammatory mediators [6]. This polyphenol has effects on cell signal-ling pathways involved in inflammation: it modulates the expressionofmany genes and alsomodifies the activity ofmanymolecules, includ-ing nuclear factor-kappa B, a pro-inflammatory transcription factor in-volved in many cell activities [7]. This suggests that resveratrol hasmany targets and also explains why the mechanisms involved in theanti-inflammatory activity of this polyphenol are not yet completelyunderstood.

International Immunopharmacology 15 (2013) 588–596

⁎ Corresponding author at: Departamento de Biología Celular y Ecología, Facultad deBiología, Universidad de Santiago de Compostela, Rúa Lope Gómez de Marzoa, 15782Santiago de Compostela, Spain. Tel.: +34 881816954.

E-mail address: jesus.lamas@usc.es (J. Lamas).1 These authors contributed equally to this work.

1567-5769/$ – see front matter © 2013 Elsevier B.V. All rights reserved.http://dx.doi.org/10.1016/j.intimp.2013.01.024

Contents lists available at SciVerse ScienceDirect

International Immunopharmacology

j ourna l homepage: www.e lsev ie r .com/ locate / in t imp

Author's personal copy

The use of cDNAmicroarrays constitutes a powerful tool for studyingcomplex processes in whichmany genes are involved. Because resvera-trol is a multitarget molecule that modifies the expression and functionof many genes/molecules, we believe that the use of an immune and in-flammatory gene-enriched microarray could help us to understand themechanism of action of this molecule. A turbot oligo-microarray has re-cently been designed [8] and used to study gene expression in the im-mune organs in response to the bacterium Aeromonas salmonicida andto the parasite Philasterides dicentrarchi [9,10]. This oligo-microarraycontains 2716 specific probes and includes genes involved in the acutephase response, immune and inflammatory responses and transcriptionfactors. In previous studies, we have found that resveratrol affects sever-al activities of turbot leucocytes: it inhibits intracellular and extracellu-lar myeloperoxidase (MPO) activities, affects the production of reactiveoxygen species and generation of prostaglandin E2 and modulatesthe expression of the important pro-inflammatory mediator TNF-α[11,12]. The turbot Scophthalmus maximus (Division Teleostei, OrderPleuronectiformes), a flatfish belonging to one of themost evolutionari-ly advanced orders of teleosts, is a fish species thatwe are using to studythe inflammatory response in vertebrates. This species is also the mostimportant farmed flatfish in Europe, and the annual production is cur-rently more 10,000 t. Considering that the turbot immune system canbe modulated by resveratrol, the purpose of the present study was toevaluate how resveratrol affects gene expression in immune and in-flammatory responses, by making use of the recently developed turbotoligo-microarray.

2. Materials and methods

2.1. Fish

Specimens of the turbot Scophthalmus maximus (L.), weighingapproximately 100 g, were obtained from a local fish farm. The fishwere maintained in 250 l tanks with re-circulating aerated seawater,held at 16 °C, and were fed daily with commercial pellets. Fish wereacclimatized to laboratory conditions for two weeks before the exper-iments began. All experimental protocols were approved by theInstitutional Animal Care and Use Committee of the University ofSantiago de Compostela (Spain). For all procedures, the fish wereanaesthetized with benzocaine (50 mg/l).

2.2. Isolation of head kidney cells

Head kidney leucocytes were isolated from anaesthetised turbotas previously described [13]. Briefly, the head kidney was removedaseptically and placed in a Petri dish containing L-15 medium with2% foetal calf serum (FCS), heparin (10 Uml−1) and P/S (100 Uml−1

of penicillin G, 0.1 mg ml−1 of streptomycin sulphate). Small pieces ofhead kidney were pushed through a 100 μm nylon mesh with a glassrod, and the resultant cell suspension was layered onto a 30%/49% v/vPercoll gradient (GEHealthcare). After centrifugation, the cells at the in-terface were collected, washed twice in L-15 with P/S and 0.1% FCS andcounted with a haemocytometer. Unless stated, all chemicals wereobtained from Sigma-Aldrich (Madrid, Spain).

2.3. Isolation and culture of P. dicentrarchi and preparation of themembrane fraction

Specimens of P. dicentrarchi were obtained aseptically from asciticfluid of turbot suffering an outbreak of scuticociliatosis [14]. The cili-ates (isolate I1) were cultured at 18 °C in L-15 Leibovitz mediumsupplemented with 10% inactivated foetal bovine serum (FBS), lipids(lecithin and Tween 80), nucleosides, glucose and an antibioticantimycotic solution (100 units/ml of penicillin G, 0.1 mg of strepto-mycin sulphate and 0.25 mg/ml of amphotericin B) (complete L-15),as previously described [15].

The membrane fraction was obtained as indicated by [15]. Para-sites (106/ml) were suspended in PBS containing 250 mM sucrose.The suspension was sonicated until all of the ciliates were broken,and it was then centrifuged at 8000 ×g for 5 min. The pellet wasresuspended in 3 ml of HEPES and layered onto a HEPES/sucrose gra-dient (1.5, 1 and 0.5 M). The gradient was centrifuged at 6000 ×g for20 min at 4 °C, and the 1 M sucrose layer containing the membranefraction (MF) was collected. This fraction was dialyzed at 4 °C withPBS and concentrated to the desired concentration. The protein con-centrations in the samples were determined by the Bradford method(Bio-Rad Protein Assay kit: Bio-Rad Laboratories, Germany), with BSAas standard.

2.4. Stimulation of head kidney cells with P. dicentrarchi membranefraction and resveratrol

Head kidney cells (1 ml, 106 cells/ml) obtained from five fish wereincubated under three conditions, with two replicate samples for eachcondition: i) resveratrol (R, 50 μM in L-15 medium); ii) ciliate mem-brane (M, 25 μg protein/ml in L-15medium); or iii) resveratrol plus cil-iate membrane (MR), for 3, 6 and 24 h at 18 °C. Duplicate batches ofcontrol cells (C) were incubated in L-15 medium for 0, 3, 6 and 24 hand harvested at the same time as the treated cells.

2.5. RNA extractions and microarray hybridizations

The stimulated cells were pelleted, and total RNA was extractedusing the RNAeasy Mini kit (Qiagen) according to manufacturer's rec-ommendations. All extractionswere performed by the same researcher.RNA quality and quantification were evaluated respectively in aBioanalyzer (Bonsai Technologies) and in a NanoDrop® ND-1000 spec-trophotometer (NanoDrop® Technologies Inc.), prior to labelling andhybridization.

An 8x15K Agilent oligo-microarray (2716 probes) including fivereplicates of each probe (gene) per microarray [8] was used to evalu-ate the gene expression profiles under the three conditions tested.Three slides were used in the experiment, one per incubation time,following a 1-colour labelling approach. This method provided verysimilar results as the 2-colour protocol [16,17], particularly whenthe previous turbot oligo-microarray was used [10]. All 8 microarrays(1 control+3 conditions, all duplicated) were used in each slide. Inone slide, the cell samples incubated with membrane and resveratrolfor 24 h were substituted by control 0 h, because the RNA integritynumber (RIN) obtained for these samples was less than 7.5. Hybrid-izations were performed by staff in the Agilent Technology Gene Ex-pression Unit of the Functional Genomics Platform at the Universityof Santiago de Compostela (USC). Briefly, 50 ng of total RNA was la-belled using the Low Input Quick Amp Labeling Kit, One-Color (Cy3)(Agilent Technologies, USA). cRNA was hybridized overnight withthe corresponding buffers for 17 h at 65 °C and washed on the follow-ing day. Hybridized slides were scanned in an Agilent G2565B micro-array scanner (Agilent Technologies, USA). All work was carried outon consecutive days and by the same researcher.

2.6. Microarray analysis

Microarray processing and filtration were performed as describedby [8]. The signal was captured and processed in an Agilent scanner(G2565B, Agilent Technologies). The scanner images were segmentedwith Agilent Feature Extraction Software (v9.5) by use of theGE1-v5_95 protocol. Extended dynamic range implemented in theAgilent software was applied to avoid saturation in the highest inten-sity range. The Agilent feature extraction was used as raw data forfurther preprocessing. The processed signal (gProcessed-Signal)value was chosen for the statistical analysis. All microarrays were

589B. Domínguez et al. / International Immunopharmacology 15 (2013) 588–596

Author's personal copy

subjected to quality and filtering criteria before statistical analysis,following the criteria outlined by [8].

Since normality of the log (lognormality) microarray signal (andgene signal) is assumed, the log2 transformation of the absolute sig-nal or of the ratio treatment/control was used in the statistical analy-sis. Normalization within each microarray was carried out by theLOESS method, which assumes that most genes in microarrays arenot differentially expressed relative to the control. The mean log2ratio for each of the 2176 genes in the microarray was obtained by av-eraging the values obtained for the two replicates per microarray.Two criteria were used simultaneously to identify differentiallyexpressed (DE) genes: i) genes with log2 ratios ≥2 or ≤−2 for up-and down-regulated genes, respectively; and ii) genes that deviatedfrom the null hypothesis (mean log2 ratio=0) (t-test at Pb0.05,after Bonferroni correction).

2.7. Q-PCR microarray validation

To validate microarray results by Q-PCR, we used a modified ver-sion of the random stratified procedure proposed by [18], as de-scribed by [9]. A set of 14 genes covering the range of variation infold change (FC) across the different experimental conditions was se-lected (between −6.91 for apolipoprotein E in RESV plus ciliatemembrane 6 h (MR6) and 4.58 for MID1 interacting G12-like proteinin RESV 24 h (R24) (C)). The FCs of these genes in the 24 microarrayswere ordered by FC value (14 genes×24 microarrays=336 cases)and were stratified considering both the width and the abundanceof values within each stratum. Sets of FCs were selected at randomwithin each stratum, completing 43 cases out of the 336 possible.Ubiquitin A-52 was used as housekeeping gene for Q-PCR analysis,on the basis of our previous results [9]. The same RNA samples usedfor microarray hybridizations were used for Q-PCR. RNA (1 μg) wasreverse transcribed into cDNA by using the AffinityScript MultipleTemperature cDNA Synthesis kit according to the supplier's protocol(Agilent Technologies). The Q-PCR analysis was carried out as previ-ously described [9]. For each gene, the fold change in transcriptlevel was determined by the relative quantitative method (ΔΔCt)[19].

2.8. RT-PCR and Q-PCR in different biological samples

Because the microarray was used to analyze duplicates of thesame leucocyte population obtained from the kidney of five fish,Reverse Transcription PCR (RT-PCR) and Q-PCR assays were carriedout with head kidney leucocytes from a different group of fish.Some of the genes were analysed by RT-PCR because the primersand incubation conditions for these genes had already beenoptimised. Leucocytes from five fish were mixed and incubated withresveratrol, with the parasite membrane fraction or with the mem-brane and resveratrol, as indicated above. Unstimulated leucocyteswere used as controls. The cells were then pelleted and total RNAwas extracted as indicated above. cDNA synthesis was performedwith reverse transcriptase (Promega), following the manufacturer in-dications. The primers used in the RT-PCR and Q-PCR are described inTable 1.

For RT-PCR, thermal cycling, separation of PCR products was car-ried as previously described [12]. The amounts of mRNA in eachband were quantified by densitometry analysis (ImageJ, Image Pro-cessing and Analysis in Java, National Institutes of Health, USA) andwere expressed relative to the amount of mRNA in the band corre-sponding to the control gene GDPH, which was processed on thesame gel. For Q-PCR, qPCR amplifications were performed with anEco Real-Time PCR system (Illumina, USA) and 10 μl of reaction vol-ume containing 5 μl of the reagent from a Kappa SYBR FAST qPCRkit (KappaBiosystems, USA), each primer at a concentration of0.5 mM, and 10 ng of template cDNA. After polymerase activation at

95 °C for 3 min, 40 cycles were run with denaturation for 15 s95 °C, annealing for 30 s at 60 °C, and extension for 60 s at 72 °C.To establish the coefficient of correlation of the PCR assay, a seriesof tenfold dilutions of the genomic DNA was prepared, and each dilu-tion was run in triplicate experiments. For data analysis, the meltingcurve and cycle threshold (Cq) values were selected as the evaluationparameters. To verify that the primer pair only produced a singleproduct, a dissociation protocol was added after thermocycling; dis-sociation of the PCR products was determined at between 65 °C and95 °C. Positive reactions were validated by a readout of the reactionwith melting temperatures of 80 °C to 85 °C, a dF/dT fluorescencevalue above 2, and a Cq value below the Cq of the detection limit.

3. Results and discussion

3.1. Quality of microarray data and validation by Q-PCR

The RNA extracted from cultures of head kidney leucocytes was ofhigh quality, with the exception of RNA obtained from cells incubatedwith P. dicentrarchi membrane fraction plus resveratrol for 24 h. TheRIN values for these RNA samples were below 7.5, and the sampleswere therefore discarded. The RIN values of the other samples werehigher than 8.8 and mostly above 9 (mean value 9.2).

In total, of 43 cases of the following genes selected to representmostof the FC range were used to validate microarray data: glutathioneS-transferase (FE946309), heme oxygenase 1 (FE949297), hepcidin 1(FE951921), TNF superfamily member 14 (FE947258), S100-A16(FE944143), complement component C1q B chain (FE944254), apolipo-protein E (FE943259), transcription factor PU.1 (FE951774), suppressorof cytokine signalling 3a (FE945875), fatty acid-binding protein(EY454744), TBT-binding protein (FE951052) and cleavage andpolyadenylation specificity factor subunit 5 (FE949894). The numberof cases analysed per gene in different microarrays ranged from 2 to 5because of the random selection approach used. All microarrays werevalidated with at least 4 genes and up to a maximum of 6 genes (onaverage 5 genes/microarray). Ubiquitin A-52, the selected housekeep-ing gene, varied very little across the experimental conditions tested(mean=−0.03; SD=0.13) and no significant differences weredetected when the FC values of the experimental conditions were com-pared against the null hypothesis (FC=0) (t=−0.868; P=0.414).Q-PCR and oligo-microarray expression values showed the same FCsense in most cases (86%) and discrepancies were minor and only ob-served within the ±2 FC range (Fig. 1), as reported in other studies[10,16,20]. Absolute differences between both techniques ( FC microar-ray−FCQ-PCR )were similar for up- and down-regulated genes (meandifferences: 0.76 vs 0.80). The greatest difference was detected forheme oxygenase 1 in R3 andM6 (2.88 and 2.74, respectively), althoughin 70% cases the divergence was b1. The data sets were highly signifi-cantly correlated (Pearson ρ coefficient=0.87; P=0), and a t-test didnot show any significant differences between microarray and Q-PCR(t=−1.473; P=0.145). These values are similar to those observed inother studies [16,21] and support the consistency of the microarraydata, as found in previous studies in turbot [8–10].

3.2. Changes in gene expression in control cells with time

To evaluate the effects of resveratrol on gene expression, head kid-ney leucocytes were stimulated with a membrane fraction of the cil-iate pathogen P. dicentrarchi, at a concentration that induces aconsiderable increase in the respiratory burst activity [15], in thepresence or absence of resveratrol. Gene expression profiles wereobtained at 3, 6 and 24 h, and because the interaction with theplate surface may change cell activity, gene expression was also eval-uated in control cells at 0, 3, 6 and 24 h. Microarray analysis revealedthat gene expression in control cells changed considerably after beingadded to the plate and that the cells contained 29, 38 and 119

590 B. Domínguez et al. / International Immunopharmacology 15 (2013) 588–596

Author's personal copy

down-regulated genes and 15, 32 and 48 up-regulated genes at 3, 6and 24 h, respectively, in comparison with control cells at 0 h(Table 2, Table 2 suppl.). Detailed analysis of those genes revealedthat cultured leucocytes increased expression of several genes at 3,6 and 24 h, including leucocyte cell-derived chemotaxin 2 (LECT2),LPS-induced tumour necrosis alpha factor (LITAF) and phospholipaseA2. Other genes such as IL-8 and metallothionein were up-regulatedat 6 and 24 h, and TNF-αwas up-regulated at 24 h. Functional studiescarried out in mammals indicate that those genes are involved in theinflammatory response [22–24], which suggests that leucocytes

became stimulated after being in contact with the plate surface. In ad-dition, at 3, 6 and 24 h, there was strong up-regulation of cytochromeP450 1A1 (CYP1A1), and expression of which is induced via the arylhydrocarbon receptor after interaction with xenobiotics [25]. The in-creased CYP1A1 expression may be a response to interaction betweenthe aryl hydrocarbon receptor and the plate surface, although an in-crease in CYP1A1 has also been found in activated mice leucocytesin the absence of exogenous ligand [26]. A large number of geneswere down-regulated. Of these, some chemokines, including CCL1and CCL2 like-chemokines, were down-regulated at 3, 6 and 24 h.

GADPH

TFPU1

MW C0 M3 MR3 M6 MR6 M24 MR24A

ApoE

TFPU1

HO1

SOCS3

CP450

B

1.4

1.6

1.8

TFPU1

0.8

1

1.2 ApoE

HO1

SOCS3

CP450

0.2

0.4

0.6

Rel

ativ

ety

ban

d d

ensi

ty

IL-8

TNF-α

STAT3

0

C0 M3 MR3 M6 MR6 M24 MR24

Fig. 1. A) Representative gels electrophoresis of RT-PCR products of glyceraldehyde 3-phosphate dehydrogenase (GADPH), transcription factor PU.1 (TFPU1), apolipoprotein E(ApoE), heme oxygenase 1 (HO1), suppressor of cytokine signalling 3 (SOCS3) and cytochrome P450 1A (CP450) in untreated leucocytes (CO) and in leucocytes incubated withP. dicentrarchi membrane (M), or membrane and resveratrol (MR) for 0, 3, 6 and 24 h. B) Quantification graph showing the relative optical densities of TFPU1, ApoE, HO1,SOCS3, CP450, tumour necrosis factor alpha (TNF-α), interleukin 8 (IL-8) and transcription factor STAT3 in an electrophoresis gel. Optical densities from each band were normalisedrelative to GAPDH level.

Table 1Gene-specific primers used in Q-PCR and reverse transcription PCR (RT-PCR) assays.

Gene name Forward primer (5′→3′) Reverse primer (5′→3′)

Glyceraldehyde 3-phosphate dehydrogenase F: CGGCCGTATTGGCCGTCTGG R: GAGCATCAGGGGAGGGGGCAS100-A16 F: CGGCTCTATGATGGAGGAAA R: GATCCACTCTTGCGCTGACTApolipoprotein E F: CAGTGACTCTGCCACCAAGA R: ATGATGTTCCCAACCTGCTCGlutathione S-transferase F: CAGTTCAAGTCCCAGGGAAA R: AGGTATCCCTCCCACAGCTTTranscription factor PU.1 F: GCCTGTACCAGTTCCTCCTG R: GGCCATTTTCTGGTAGGTCAHeme oxygenase 1 F: GGGCTTTCGTTCTTCTCCTT R: AGACGACGTTGGATTGGTTCSTAT3 F: CCTGACAATCGAACAGCTCA R: CCCTCTCCTTGCTGATGAAGIL-8 F: CCATCAGTGAAGGGGTGAGT R: GAGTGTTTCAGGGTGGCAATLeukocyte cell-derived chemotaxin 2 F: CTTCGTTGTGGTCGTGTTTG R: GGTCGGTGTAGACGGTGACTSOCS3 F: CAGATGGTGCTCGCCACGCT R: CGCCGCGTCACATTGCACACTNF-α F: CCCTTATCATTATGGCCCTT R: TCCGAGTACCGCCATATCCTCytochrome P450 1A1 F: CCAGAAGCTGCACTTCAACA R: GCATCATGGCTCTCAGGTG

591B. Domínguez et al. / International Immunopharmacology 15 (2013) 588–596

Author's personal copy

CCL2 displays chemotactic activity for monocytes and basophils butnot for neutrophils [27]. CCL1 acts as a potent chemoattractant formonocytes and lymphocytes [28]. Because the function of somechemokines is to regulate recruitment of leucocytes on demand, thisresponse may be related to some initial inhibition of expression ofchemokines that attract monocytes/macrophages, probably in favourof neutrophil migration, which mimics an early inflammatory re-sponse. Turbot head kidney cultures contained a mixture of neutro-phils, macrophages, lymphocytes and immature cells [13], andstudies with human neutrophils also show that priming and activa-tion induce delayed expression of CCL2 [29]. Moreover, the controlcells showed strong up-regulation of LECT2, a chemotaxin found inseveral fish species [30–33] and which has been described as a che-motactic factor for neutrophils [34].

Several cytoskeleton-related genes were also expressed differen-tially over time (Table 2). Thus, three genes related to microtubules(tubulin-specific chaperone c-like, tubulin beta-2C, MID1 interactingG12-like protein) and α-actin and annexin 6 were up-regulated.Other genes related to actin were down-regulated (coronin 1A,calponin, RhoGEF and PH domain containing 3 mild down, proline-serine-threonine phosphatase interacting protein 1a and tropomyo-sin 1α). Head kidney leucocytes were separated by mechanicalmethods and then added to the plate. Cells spread out on the platesurface or interact with other cells, and such cell processes mayhave a profound effect on cell structure and gene expression, assuggested by other authors [35]. Although the microarray used inthe present study is not especially rich in cytoskeleton-relatedgenes, the expression of proteins related to the two components in-volved in cell motion and adhesion, actin and microtubules, wasclearly affected in control cells.

3.3. Stimulation of turbot leucocytes with P. dicentrarchi membranefraction

Gene expressionwas compared in cells stimulatedwith P. dicentrarchimembrane fraction and in control cells. The microarray data showedthat gene expression in cells incubated with P. dicentrarchimembraneswas very similar to that in control cells at 3, 6 and 24 h, and differencesin expression were found only in 7 genes (Table 3). P. dicentrarchi is ascuticociliate that causes severe mortalities in cultured turbot. In previ-ous studies, we have shown stimulation of the respiratory burst in cul-tured leucocytes incubated with P. dicentrarchi membrane fraction, atthe same concentrations used in the present study [15]. However,such differences in cell activity were not reflected by differences ingene expression, at least not in the genes present in the microarray,suggesting that themembrane fraction did not induce leucocyte stimu-lation or, if did, the response wasmasked by the stimulation induced bythe plate surface.

3.4. Treatment of cells with resveratrol or with P. dicentrarchimembranes plus resveratrol

Resveratrol, at the concentration used in the present study, has aninhibitory effect on the migratory response, on the production of reac-tive oxygen species and on the generation of the pro-inflammatoryme-diator prostaglandin E2 (PGE2) in turbot head kidney cells and alsoinhibited intracellular and extracellular MPO activity in turbot neutro-phils, without affecting cell viability [15]. Microarray analysis revealed97 and 136 differentially expressed genes in cells incubated with res-veratrol or with membranes and resveratrol, respectively. In relationto the incubation time, at 3, 6 and 24 h, respectively 42, 135 and 63genes were regulated (Table 4, Table 4 supplementary). Among thosegenes, 32 were regulated after 3 h and 6 h, 20 genes after 6 h and24 h and only 5 genes after all three incubation times. Regulation at dif-ferent times may happen in cells incubated with resveratrol or withmembrane and resveratrol. The 5 genes that were down-regulated atthe three times were the transcription factor PU.1, the pentraxin-multidomain protein, the heme oxygenase 1 (HO-1), S100 calcium-binding proteinA-16 (S100A16) and the signal transducer and activatorof transcription 4 (STAT4) (Table 4). Four of these are involved in in-flammation. The transcription factor PU.1 is required for early andlate stages of lymphoid andmyeloid differentiation [36], but it also par-ticipates in inflammatory processes, as demonstrated by studies inmammals. The inflammatory response is affected in PU.1-deficient chi-maeramice, via attenuatedNF-κB activation and decreasedneutrophiliclung inflammation in response to endotoxemia [37]. Pentraxins are alsoinvolved in the acute inflammatory responses in fish and in mammals[38]. HO-1 is also involved in inflammation, although HO-1 is common-ly regarded as a potent anti-inflammatory enzyme and has anti-inflammatory properties [39]. The results of the present study suggestthat resveratrol affects the expression of inflammatory genes. However,more studies (with different incubation conditions) are needed to re-solve some of these discrepancies. Studies in mammals indicate thatresveratrol affects the expression of HO-1, and that it expression in-creases or decreases depending on the conditions [40,41]. However, asfar as we know, there is no information about the effects of resveratrolon the expression of transcription factor PU.1 or pentraxins. These activ-ities should be evaluated in future research, to gain a better understand-ing about the effects of resveratrol on these genes. Resveratrol alsodown-regulated the expression of STAT4, a transcription factor that isexpressed in activated peripheral blood monocytes, dendritic cells andmacrophages at sites of inflammation [42] and that has been associatedwith susceptibility to some immune diseases [43]. STAT4. In addition tothose genes, there was also down-regulation of S100A16, a highly con-served protein that is widely distributed in human tissues, although itsphysiological function is still not clearly defined [44]. As far aswe know,

Table 2Gene expression in control cells incubated for 3, 6 and 24 h in L-15 medium. Tableshows the regulated genes involved in inflammatory and immune response and in cy-toskeleton. Results are expressed as mean expression ratio (log2-control 3, 6 and 24 hvs control 0 h) in descending order. Colours represent up-regulation (red) ordown-regulation (green).

GenBank Gene name Log2 C3/C0 Log2 C6/C0 Log2 C24/C0

Inflammatory and immune functions

HS032189 Leucocyte cell-derived chemotaxin 2 4.06 4.98 9.67

HS031670 zf-LITAF-like multi-domain protein 3.18 4.28 4.72

FE948834 Cytochrome P450 1A1 3.15 3.99 3.36

HS032394 Tributyltin binding protein type 2.95 3.75 5.06

FE951921 Hepcidin 1 2.84 4.07 6.36

FE944736 Phospholipase A2 2.03 2.51 3.30

HS032354 Apolipoprotein E 0.69 3.50 3.81

FE949043 Interleukin-8 0.70 2.61 3.40

EY455032 Transferrin-a 0.85 2.50 6.33

FE944870 Metallothionein 1 1.74 2.43 4.48

FE950169 Tumor necrosis factor alpha –0.11 0.10 3.74

HS031800 Mannose receptor, C type 1b –2.99 –4.74 –3.55

HS032348 Chemokine CC-like protein 1 –2.68 –3.71 –4.63

FE948519 CC chemokine 2 –2.49 –2.70 –3.54

Cytoskeleton

FE950441 Tubulin-specific chaperone c-like 5.21 6.17 3.93

FE946972 Calponin 3, acidic a –0.08 0.61 2.68

HS030687 Actin, alpha 1 –0.14 1.26 2.29

HS029973 Tubulin beta-2C chain –0.57 –0.03 2.25

EY455317 MID1 interacting G12-like protein –0.45 0.20 2.19

FE946234 Annexin A6 –0.20 0.71 2.15

EY454630 RhoGEF and PH domain containing 3 –2.01 –1.00 –2.05

FE950289 Coronin-1A –1.01 –2.39 –2.01

HS031079 Tropomyosin 1 (alpha) –1.40 –3.04 –1.97

EY455773 Keratin 8 –0.24 –0.41 –2.40

592 B. Domínguez et al. / International Immunopharmacology 15 (2013) 588–596

Author's personal copy

there are no studies showing how resveratrol affects S100A16 gene ex-pression, and further work is also required to clarify such effects.

As already mentioned, 32 genes were regulated after incubationtimes of 3 and 6 h. Of those, several genes involved in inflammationand in the immune response were down-regulated: suppressor of cy-tokine signalling 3a (SOCS-3), LPS-induced tumour necrosis alphafactor (zf-LITAF), hepcidin, metallothionein, TLR8, and calcium de-pendent (C type) lectin A (Table 4). Resveratrol has previously beenshown to modulate the expression of SOCS-3 and metallothionein[45,46]. The effects of SOCS-3 on the inflammatory reaction appearcomplex, and the protein plays an important role in coordinating in-nate and acquired responses [47]. Very few studies have investigatedthe effects of resveratrol on SOCS-3 expression, and existing studiesinvolve the function of SOCS-3 in cancer cells, in which deregulationof expression has been associated with an increase in the develop-ment of certain cancers. Studies carried out in vitro with cancercells have also shown that treatment with resveratrol induced a re-duction in SOCS-3 expression of more than 40% [45]. In addition, res-veratrol inhibited cytochrome P450 1A1 (CYP1A1) and S100 calciumbinding protein A-14 expression (S100A14). The level of CYP1A1 ex-pression can be increased by stimulation of aryl hydrocarbon receptor(ARH), and resveratrol is an ARH antagonist that inhibits the CYP1A1expression levels in stimulated human cells [48], suggesting that resver-atrol has similar effects on fish cells. Resveratrol has not been found toaffect S100A14 gene expression in previous studies. The present studyalso showed that resveratrol induced up-regulation of thioredoxin-likeprotein, a small redox protein, or butyrate response factor 1-like, a fac-tor that regulates the expression levels of short-livedmRNAs containingAU-rich elements located in the 3′ untranslated region. Resveratrolmodulates the expression of many genes, apart from those involved ininflammatory processes, and previous studies also have shown that res-veratrol increased the levels of thioxiredoxins [49], although no effectson butyrate response factor 1 gene have been described.

Fourteen genes were regulated after incubation times of 6 and24 h. Resveratrol induced up-regulation of C-C motif chemokine 20and down-regulation of IL-8, apolipoprotein E (ApoE) or glutathioneS-transferase (Table 4). CCL20 has a dual role in inflammation andis capable of attracting cells that inhibit immune reactions, but alsoplays an important role in attracting activators and effectors of in-flammation [50]. For these reasons, the effects of increased geneexpression in resveratrol-treated cells on inflammation deserve fur-ther attention. ApoE is a plasma lipoprotein of great importance inlipid transport and atherosclerosis pathogenesis, as well as in neuro-degenerative disorders and also as modulator of production ofproinflammatory cytokines [51]. Transcription of macrophage ApoEappears to be regulated by several factors, including the NF-κB tran-scription factor [52], and NF-kB expression can be inhibited by

resveratrol [53]. In the present experiments, inhibition of resveratrolon ApoE expression was not detected at 3 h: the inhibition was prob-ably not related to a direct effect of resveratrol on this gene, but theeffect was probably mediated through other molecules. Such aspectsmust be elucidated in future research. Il-8 was also down-regulatedin cells treated with resverastrol. Studies with human leucocyteshave also shown that resveratrol impairs early expression of IL-8[54]. IL-8 production is known to involve several signalling pathways,including the ERK and NF-κB pathways. Resveratrol suppresses theexpression of IL-8 through a decrease in the intracellular levels ofERK 1/2 and NF-κB activation in humans [55], and something similarmay occur in turbot cells.

Some genes in the microarray were regulated by resveratrol afterincubation times of 3 and 24 h. One of those genes was theproinflammatory cytokine TNF-α. This gene was also down-regulatedafter 6 h, although not to a significant degree. However, in a separateexperiment, we found that TNF-α was also clearly down-regulatedafter 6 h. These findings are consistent with previous studies showingthat resveratrol inhibits expression of TNF-α in mammalian and fishleucocytes [12,54].

Although very few genes were affected by resveratrol at 3 h, sev-eral genes were regulated after 6 h; more genes in cells incubatedwith membranes plus resveratrol were affected than in cells incubat-ed only with resveratrol. These results suggest that the parasite mem-brane has some effect on turbot leucocytes, although this effect wasnot detected in control cells incubated with resveratrol. Cells incubat-ed with parasite membranes plus resveratrol showed up-regulationof tumour necrosis factor receptor-associated factor 2 and down-regulation of transcription factor STAT3 and TNF superfamily member14-like, a member of the TNF superfamily that is involved in inflamma-tion and defence against infection [56]. Previous studies have alsoshown that resveratrol down-regulates transcription factor STAT3 inmicroglia after LPS stimulation [57], and it has been suggested that res-veratrolmay affect the JAK1/STAT3pathway. Somegeneswere also reg-ulated exclusively at 24 h and most of them showed a decrease inexpression. Down-regulation of CC chemokine 3, also known asmacro-phage inflammatory protein1-α (MIP-1α), was observed. The presentresults are consistent with a previous report indicating that resveratrolattenuated the production of MIP-1α in C5a-stimulated mice neutro-phils [58].

3.5. Gene expression in different biological samples

The samples tested in the microarray were all from the same cellpopulation, and we were interested in confirming the resultsobtained for these cells with a leucocyte population obtained from adifferent group of fish but subjected to the same treatments. For

Table 3Gene expression in cells incubated with the membrane fraction of the parasite for 3, 6 and 24 h. Results are expressed as mean expression ratio (log2-membrane vs control) indescending order. Colours represent up-regulation (red) or down-regulation (green).

GenBank Gene name Log2 M3/C3 Log2 M6/C6 Log2 M24/C24

FE949297 Heme oxygenase 1 2.1587503 2.0424325 0.6405

HS032189 Chemotaxin 1 0.66666 2.003792 0.5986666

EY454744 Fatty acid-binding protein H6-isoform 0.34986 0.7 2.8230176

HS032430 FLJ41993 protein-like 0.1041 0.54563 2.119769

EY454873 Macrophage stimulating 1 (hepatocyte growth factor-like) 0.787865 0.566544 1.999597

FE943236 C-type lectin A –1.2995026 –2.6073267 –0.160007

EY456866 SSU rRNA 0.00135 –0.344657 –2.4174488

593B. Domínguez et al. / International Immunopharmacology 15 (2013) 588–596

Author's personal copy

this purpose, we selected 11 genes involved in inflammatory and im-mune responses and whose expression was highly modified in themicroarray by treatment with resveratrol. We analysed expression

of these genes in leucocytes obtained from a different group of fish.The results obtained also showed that resveratrol modified the ex-pression of the selected genes, and the response followed a similar

Table 4Gene expression in cells incubated with resveratrol (R) or with the membrane fraction of the parasite plus resveratrol (MR) for 3, 6 and 24 h. Table shows the regulated genes in-volved in inflammatory and immune response and in cytoskeleton. Results are expressed as mean expression ratio (log2-resveratrol vs control; log2-membrane resveratrol vsmembrane) in descending order. Colours represent up-regulation (red) or down-regulation (green).

GenBank Gene name Log2 R3/C3 Log2 R6/C6 Log2 R24/C24 Log2 MR3/M3 Log2 MR6/M6

Inflammatory and immune responses

FE945635 C-C motif chemokine 20 0.61 2.70 3.88 –1.95 –0.36

HS032348 Chemokine CC-like protein 1 0.50 2.07 –0.34 0.06 0.59

EY455748 Heme oxygenase 0.23 0.09 –3.38 –4.19 –2.82

HS032227 Signal transducer and activator of transcription 4 0.28 0.65 –2.89 –2.20 –3.15

FE950629 Pentraxin multi-domain protein 0.30 0.27 –2.63 –4.02 –4.70

FE945763 S100-A16 0.19 –0.37 –2.28 –4.20 –4.71

FE951774 Transcription factor PU.1 –0.23 –0.10 –2.28 –2.62 –2.57

FE949043 Interleukin-8 –1.14 –1.07 –2.45 NaN –4.68

HS032313 Glutathione S-transferase A –0.38 –1.59 –2.19 –0.77 –2.67

HS032354 Apolipoprotein E –1.88 –3.67 –2.90 NaN –6.91

FE948834 Cytochrome P450 1A1 –4.52 –3.45 –1.25 NaN NaN

FE945875 Suppressor of cytokine signaling 3a –2.17 –1.48 –0.65 –3.43 –4.05

FE950169 Tumor necrosis factor alpha –1.98 –1.19 –3.34 –2.13 –1.57

FE948519 CC chemokine 2 –0.26 –0.37 –2.61 –2.81 –1.80

HS031670 zf-LITAF-like multi-domain protein –2.83 –2.13 –1.67 NaN NaN

FE944870 Metallothionein 1 –0.19 –0.14 0.49 –2.56 –2.09

FE951921 Hepcidin 1 –0.61 –0.54 0.30 –2.13 –2.60

FE949477 Toll-like receptor 8 –2.09 NaN NaN –2.20 –4.46

FE943236 C-type lectin A 0.53 –1.96 NaN –2.69 –3.68

FE947818 S100-A14 –0.42 –0.70 –0.71 –3.57 –3.80

HS031477 Myeloperoxidase 1.06 1.02 –2.34 1.70 0.56

FE950045 CC chemokine 3 0.07 –0.54 –2.32 0.84 0.27

HS032189 Leucocyte cell-derived chemotaxin 2 –0.10 0.97 0.94 –2.16 –0.55

FE947258 Tumor necrosis factor (ligand) superf., member 14 –0.79 –1.06 0.26 –1.67 –2.12

FE943495 Transcription factor Stat3 –0.40 –1.62 –0.44 –0.57 –2.01

Cytoskeleton

EY455186 Profilin –0.23 1.05 –1.54 0.72 2.59

FE946330 Tropomodulin 4 0.40 0.60 0.69 0.63 2.60

EY455108 Beta-actin 0.14 0.57 0.42 0.68 2.87

FE946234 Annexin A6 protein –1.06 –2.09 –0.63 –1.43 –2.93

EY454630 Rho guanine nucleotide exchange factor (GEF) 3 –1.36 –2.42 –2.66 0.51 0.05

HS031907 keratin 18-like 0.27 0.00 –0.59 –3.02 –3.02

HS031079 Tropomyosin 1 (alpha) 0.71 0.42 –3.68 1.14 1.68

HS030461 Novel protein similar to vertebrate scinderin (SCIN) 0.13 –0.79 –3.31 –0.59 –1.08

FE950289 Coronin 1A –0.07 –0.63 –2.39 0.29 1.23

EY455773 Keratin 8 0.32 1.02 0.61 –2.15 –1.92

594 B. Domínguez et al. / International Immunopharmacology 15 (2013) 588–596

Author's personal copy

pattern to that obtained in the samples used in the microarray. Somegenes that were down-regulated in the microarray and in the RT-PCRassays are shown in Fig. 1.

We can conclude that resveratrol modulates the expression ofmany genes involved in inflammation and immune responses viadown-regulation. This confirms the anti-inflammatory activity ofthis polyphenol. The regulation of some of those genes and othersnot described in the present paper by resveratrol has already beenreported in studies in mammalian leucocytes. However, oligo-themicroarray allowed us to show that resveratrol also affects the ex-pression of other genes, some of which are very important in inflam-matory processes, but which were not suspected of being modulatedby this polyphenol. We believe that this information is important inhelping to understand how resveratrol affects inflammation and thepossible use of this compound as an anti-inflammatory drug. Resver-atrol affects the expression of many genes at the same time [6], ap-parently by targeting several cell signalling pathways, although themolecular basis of this process is still unknown. The present findingssuggest that modulation of gene expression in turbot leucocytes byresveratrol shares many similarities with the modulation describedin mammalian leucocytes and that fish may also be a good modelfor studying the effects of resveratrol on inflammatory responses.

3.6. Modulation of other responses

Some of the genes described above have multiple functions ininflammatory/immune responses, but also have other functions. Fur-thermore, other genes were also differentially expressed. Resveratrolinduced up- or down-regulation of several genes related to actin(β-actin, profilin, tropomodulin, annexin A6, coronin, RhoGEF andPH domain containing 3, scinderin, tropomyosin alpha 1) (Table 4).The regulation of cytoskeleton-related genes reflects an interestingrole for resveratrol, which has been less well explored than its anti-inflammatory activity. The modulatory effect of resveratrol can proba-bly be observed because these genes were previously differentially reg-ulated as a consequence of the interaction between the cells and theplate surface. Studies in mammals show that resveratrol modifies cellmorphology, focal adhesion and cell migration [59,60], which are cellfunctions related to actin and microtubules. These changes may beat least partly related to changes in the expression of the above-mentioned genes, and such aspects deserve to be analysed in detail infuture studies.

Supplementary data to this article can be found online at http://dx.doi.org/10.1016/j.intimp.2013.01.024.

Acknowledgements

This study was financially supported by grants 08MMA007237PR,08MMA025E and 10MMA001E from the Xunta de Galicia; AGL2006-12072-CO2-01/ACU, AGL2008-03866/ACU, AGL2010-21219/ACU andAGL2011-29927-C02-01 from the Comisión Interministerial de Cienciay Tecnología (CICYT; Spain), and grant INCITE07/PX1203039ES fromAquagenomics project funded through the Consolider-Ingenio 2010programme, by the Spanish Ministerio de Eduación y Ciencia (MEC).

References

[1] Brisdelli F, D'Andrea G, Bozzi A. Resveratrol: a natural polyphenol with multiplechemopreventive properties. Curr Drug Metab 2009;10:530–46.

[2] Leiro J, Alvarez E, Arranz JA, Laguna R, Uriarte E, Orallo F. Effects of cis-resveratrolon inflammatory murine macrophages: antioxidant activity and down-regulationof inflammatory genes. J Leukoc Biol 2004;75:1156–65.

[3] Gedik E, Girgin S, Ozturk H, Obay BD, Ozturk H, Buyukbayram H. Resveratrol at-tenuates oxidative stress and histological alterations induced by liverischemia/reperfusion in rats. World J Gastroenterol 2008;14:7101–6.

[4] Kaeberlein M. Resveratrol and rapamycin: are they anti-aging drugs? Bioessays2010;32:96–9.

[5] Penumathsa SV, Maulik N. Resveratrol: a promising agent in promotingcardioprotection against coronary heart disease. Can J Physiol Pharmacol2009;87:275–86.

[6] de la Lastra CA, Villegas I. Resveratrol as an anti-inflammatory and anti-agingagent: mechanisms and clinical implications. Mol Nutr Food Res 2005;49:405–30.

[7] Shakibaei M, Harikumar KB, Aggarwal BB. Resveratrol addiction: to die or not todie. Mol Nutr Food Res 2009;53:115–28.

[8] Millán A, Gómez-Tato A, Fernández C, Pardo BG, Alvarez-Dios JA, Calaza M, et al.Design and performance of a turbot (Scophthalmus maximus) oligo-microarraybased on ESTs from immune tissues. Mar Biotechnol (NY) 2010;12:452–65.

[9] Millán A, Gómez-Tato A, Pardo BG, Fernández C, Bouza C, Vera M, et al. Gene ex-pression profiles of the spleen, liver, and head kidney in turbot (Scophthalmusmaximus) along the infection process with Aeromonas salmonicida using animmune-enriched oligo-microarray. Mar Biotechnol (NY) 2011;13:1099–114.

[10] Pardo BG, Millán A, Gómez-Tato A, Fernández C, Bouza C, Alvarez-Dios JA, et al.Gene expression profiles of spleen, liver, and head kidney in turbot (Scophthalmusmaximus) along the infection process with Philasterides dicentrarchi using animmune-enriched oligo-microarray. Mar Biotechnol (NY) 2012;14:570–82.

[11] Castro R, Lamas J, Morais P, SanmartínML, Orallo F, Leiro J. Resveratrol modulates in-nate and inflammatory responses in fish leucocytes. Vet Immunol Immunopathol2008;126:9–19.

[12] Leiro JM, Varela M, Piazzon MC, Arranz JA, Noya M, Lamas J. The anti-inflammatory activity of the polyphenol resveratrol may be partially related to in-hibition of tumour necrosis factor-alpha (TNF-alpha) pre-mRNA splicing. MolImmunol 2010;47:1114–20.

[13] Castro R, Couso N, Obach A, Lamas J. Effect of different β-glucans on the respirato-ry burst of turbot (Psetta maxima) and gilthead seabream (Sparus aurata) phago-cytes. Fish Shellfish Immunol 1999;9:529–41.

[14] Iglesias R, Paramá A, Álvarez MF, Leiro J, Fernández J, Sanmartín ML. Philasteridesdicentrarchi (Ciliophora, Scuticociliatida) as the causative agent of scuticociliatosisin farmed turbot Scophthalmus maximus in Galicia (NW Spain). Dis Aquat Organ2001;46:47–55.

[15] Piazzon MC, Wiegertjes GF, Leiro J, Lamas J. Turbot resistance to Philasteridesdicentrarchi is more dependent on humoral than on cellular immune responses.Fish Shellfish Immunol 2011;30:1339–47.

[16] Ferraresso S, Milan M, Pellizzari C, Vitulo N, Reinhardt R, Canario AVM, et al.Development of an oligo DNA microarray for the European sea bass and its appli-cation to expression profiling of jaw deformity. BMC Genomics 2010;11:354.

[17] Patterson TA, Lobenhofer EK, Fulmer-Smentek SB, Collins PJ, Chu TM, Bao W, et al.Performance comparison of one-color and two-color platforms within the Micro-Array Quality Control (MAQC) project. Nat Biotechnol 2006;24:1140–50.

[18] Miron M, Woody OZ, Marcil A, Murie C, Sladek R, Nadon R. A methodology forglobal validation of microarray experiment. BMC Bioinformatics 2006;7:333.

[19] Livak KJ, Schmittgen TD. Analysis of relative gene expression data using real-timequantitative PCR and the 2(-Delta Delta C(T)). Methods 2001;25:402–8.

[20] Tingaud-Sequeira A, Chauvigne F, Lozano J, Agulleiro MJ, Asensio E, Cerda J. Newinsights into molecular pathways associated with flatfish ovarian developmentand atresia revealed by transcriptional analysis. BMC Genomics 2009;10:434.

[21] Fleury E, Moal J, Boulo V, Daniel JY, Mazurais D, Hénaut A, et al. Microarray-basedidentification of gonad transcripts differentially expressed between lines of Pacificoyster selected to be resistant or susceptible to summer mortality. Mar Biotechnol2010;12:326–39.

[22] Tang X, Metzger D, Leeman S, Amar S. LPS-induced TNF-alpha factor (LITAF)-deficient mice express reduced LPS-induced cytokine: Evidence for LITAF-dependentLPS signaling pathways. Proc Natl Acad Sci U S A 2006;103:13777–82.

[23] Medzhitov R. Origin and physiological roles of inflammation. Nature 2008;454:428–35.

[24] Kobayashi Y. The role of chemokines in neutrophil biology. Front Biosci 2008;13:2400–7.

[25] Ma Q, Lu AY. CYP1A induction and human risk assessment: an evolving tale of invitro and in vivo studies. Drug Metab Dispos 2007;35:1009–16.

[26] Crawford RB, Holsapple MP, Kaminski NE. Leukocyte activation induces aryl hy-drocarbon receptor up-regulation, DNA binding, and increased Cyp1a1 expres-sion in the absence of exogenous ligand. Mol Pharmacol 1997;52:921–7.

[27] Deshmane SL, Kremlev S, Amini S, Sawaya BE. Monocyte chemoattractantprotein-1 (MCP-1): an overview. J Interferon Cytokine Res 2009;29:313–26.

[28] Harpel PC, Haque NS. Chemokine receptor-8: Potential role in atherogenesis. IsrMed Assoc J 2002;4:1025–7.

[29] Yamashiro S, Kamohara H, Wang JM, Yang D, Gong WH, Yoshimura T. Phenotypicand functional change of cytokine-activated neutrophils: inflammatory neutro-phils are heterogeneous and enhance adaptive immune responses. J Leukoc Biol2001;69:698–704.

[30] Kokkinos PA, Kazantzi A, Sfyroera G, Zarkadis IK. Molecular cloning of leukocytecell-derived chemotaxin 2 in rainbow trout. Fish Shellfish Immunol 2005;18:371–80.

[31] LiMY, Chen J, Shi YH.Molecular cloning of leucocyte cell-derived chemotaxin-2 genein croceine croaker (Pseudosciaena crocea). Fish Shellfish Immunol 2008;24:252–6.

[32] Chen J, Lu XJ, Yang HY, Shi YH. An interaction between a C-type lectin receptorand leukocyte cell derived chemotaxin 2 of ayu, Plecoglossus altivelis. Fish Shell-fish Immunol 2010;28:245–8.

[33] Harikrishnan R, Kim JS, Kim MC, Balasundaram C, Heo MS. Expressed sequencetags (ESTs) based identification of genes and expression analysis of leukocytecell-derived chemotaxin-2 (LECT2) from Epinephelus bruneus. Gene 2012;491:88–101.

[34] Yamagoe S, Yamakawa Y, Matsuo Y, Minowada J, Mizuno S, Suzuki K. Purificationand primary amino acid sequence of a novel neutrophil chemotactic factor LECT2.Immunol Lett 1997;52:9–13.

595B. Domínguez et al. / International Immunopharmacology 15 (2013) 588–596

Author's personal copy

[35] Yeung T, Georges PC, Flanagan LA, Marg B, Ortiz M, Funaki M, et al. Effects of sub-strate stiffness on cell morphology, cytoskeletal structure, and adhesion. CellMotil Cytoskeleton 2005;60:24–34.

[36] Turkistany SA, DeKoter RP. The transcription factor PU.1 is a critical regulator of cel-lular communication in the immune system. Arch Immunol Ther Exp (Warsz)2011;59:431–40.

[37] Karpurapu M, Wang X, Deng J, Park H, Xiao L, Sadikot RT, et al. Functional PU.1 inmacrophages has a pivotal role in NF-κB activation and neutrophilic lung inflam-mation during endotoxemia. Blood 2011;118:5255–66.

[38] Magnadottir B, Audunsdottir SS, Bragason BT, Gisladottir B, Jonsson ZO,Gudmundsdottir S. The acute phase response of Atlantic cod (Gadus morhua): hu-moral and cellular response. Fish Shellfish Immunol 2011;30:1124–30.

[39] Ndisang JF. Role of heme oxygenase in inflammation, insulin-signalling, diabetesand obesity. Mediators Inflamm 2010;2010:359732.

[40] Chen CY, Jang JH, Li MH, Surh YJ. Resveratrol upregulates heme oxygenase-1 ex-pression via activation of NF-E2-related factor 2 in PC12 cells. Biochem BiophysRes Commun 2005;331:993–1000.

[41] Cerny D, Canova NK, Martinek J, Horinek A, Kmonickova E, Zídek Z, et al. Effects ofresveratrol pretreatment on tert-butylhydroperoxide induced hepatocyte toxicityin immobilized perifused hepatocytes: involvement of inducible nitric oxidesynthase and hemoxygenase-1. Nitric Oxide 2009;20:1–8.

[42] Frucht DM, Aringer M, Galon J, Danning C, Brown M, Fan S, et al. Stat4 is expressedin activated peripheral blood monocytes, dendritic cells, and macrophages at sitesof Th1-mediated inflammation. J Immunol 2000;164:4659–64.

[43] Korman BD, Kastner DL, Gregersen PK, Remmers EF. STAT4: genetics, mechanisms,and implications for autoimmunity. Curr Allergy Asthma Rep 2008;8:398–403.

[44] Sturchler E, Durussel I, Weibel M, Heizmann CW. S100A16, a novel calcium-bindingprotein of the EF-hand superfamily. J Biol Chem 2006;281:38905–17.

[45] Horndasch M, Culig Z. SOCS-3 antagonizes pro-apoptotic effects of TRAIL and res-veratrol in prostate cancer cells. Prostate 2011;71:1357–66.

[46] Yousuf S, Atif F, Ahmad M, Hoda N, Ishrat T, Khan B, et al. Resveratrol exerts itsneuroprotective effect by modulating mitochondrial dysfunctions and associatedcell death during cerebral ischemia. Brain Res 2009;1250:242–53.

[47] Dimitriou ID, Clemenza L, Scotter AJ, Chen G, Guerra FM, Rottapel R. Putting outthe fire: coordinated suppression of the innate and adaptive immune systemsby SOCS1 and SOCS3 proteins. Immunol Rev 2008;224:265–83.

[48] Macpherson L, Matthews J. Inhibition of aryl hydrocarbon receptor-dependenttranscription by resveratrol or kaempferol is independent of estrogen receptorα expression in human breast cancer cells. Cancer Lett 2010;299:119–29.

[49] Kairisalo M, Bonomo A, Hyrskyluoto A, Mudò G, Belluardo N, Korhonen L, et al.Resveratrol reduces oxidative stress and cell death and increases mitochondrialantioxidants and XIAP in PC6.3-cells. Neurosci Lett 2011;488:263–6.

[50] Comerford I, BuntingM, Fenix K, Haylock-Jacobs S, LitchfieldW, Harata-Lee Y, et al. Animmune paradox: how can the same chemokine axis regulate both immune toleranceand activation?: CCR6/CCL20: a chemokine axis balancing immunological toleranceand inflammation in autoimmune disease. Bioessays 2010;32:1067–76.

[51] Zhang H, Wu LM, Wu J. Cross-talk between apolipoprotein E and cytokines. Medi-ators Inflamm 2011:949072.

[52] Kockx M, Jessup W, Kritharides L. Regulation of endogenous apolipoprotein E se-cretion by macrophages. Arterioscler Thromb Vasc Biol 2008;28:1060–7.

[53] Leiro J, Arranz JA, Fraiz N, Sanmartín ML, Quezada E, Orallo F. Effect ofcis-resveratrol on genes involved in nuclear factor kappa B signaling. IntImmunopharmacol 2005;5:393–406.

[54] Richard N, Porath D, Radspieler A, Schwager J. Effects of resveratrol, piceatannol,tri-acetoxystilbene, and genistein on the inflammatory response of human pe-ripheral blood leukocytes. Mol Nutr Food Res 2005;49:431–42.

[55] Kang OH, Jang HJ, Chae HS, Oh YC, Choi JG, Lee YS, et al. Anti-inflammatory mech-anisms of resveratrol in activated HMC-1 cells: pivotal roles of NF-kappaB andMAPK. Pharmacol Res 2009;59:330–7.

[56] Stanley AC, de Labastida Rivera F, Haque A, Sheel M, Zhou Y, Amante FH, et al.Critical roles for LIGHT and its receptors in generating T cell-mediated immunityduring Leishmania donovani infection. PLoS Pathog 2011;7:e1002279.

[57] Capiralla H, Vingtdeux V, Zhao H, Sankowski R, Al-Abed Y, Davies P, et al. Resver-atrol mitigates lipopolysaccharide- and Aβ-mediated microglial inflammation byinhibiting the TLR4/NF-κB/STAT signaling cascade. J Neurochem 2012;120:461–72.

[58] Issuree PD, Pushparaj PN, Pervaiz S, Melendez AJ. Resveratrol attenuatesC5a-induced inflammatory responses in vitro and in vivo by inhibiting phospho-lipase D and sphingosine kinase activities. FASEB J 2009;23:2412–24.

[59] Bruder JL, Hsieh T, Lerea KM, Olson SC, Wu JM. Induced cytoskeletal changes inbovine pulmonary artery endothelial cells by resveratrol and the accompanyingmodified responses to arterial shear stress. BMC Cell Biol 2001;2:1.

[60] Azios NG, Dharmawardhane SF. Resveratrol and estradiol exert disparate effectson cell migration, cell surface actin structures, and focal adhesion assembly inMDA-MB-231 human breast cancer cells. Neoplasia 2005;7:128–40.

596 B. Domínguez et al. / International Immunopharmacology 15 (2013) 588–596