1 23

New ForestsInternational Journal on the Biology,Biotechnology, and Management ofAfforestation and Reforestation ISSN 0169-4286 New ForestsDOI 10.1007/s11056-014-9435-7

Light intensity affects the growth andflavonol biosynthesis of Ginkgo (Ginkgobiloba L.)

You Xu, Guibin Wang, Fuliang Cao,Cancan Zhu, Guangyu Wang & YousryA. El-Kassaby

1 23

Your article is protected by copyright and all

rights are held exclusively by Springer Science

+Business Media Dordrecht. This e-offprint

is for personal use only and shall not be self-

archived in electronic repositories. If you wish

to self-archive your article, please use the

accepted manuscript version for posting on

your own website. You may further deposit

the accepted manuscript version in any

repository, provided it is only made publicly

available 12 months after official publication

or later and provided acknowledgement is

given to the original source of publication

and a link is inserted to the published article

on Springer's website. The link must be

accompanied by the following text: "The final

publication is available at link.springer.com”.

Light intensity affects the growth and flavonolbiosynthesis of Ginkgo (Ginkgo biloba L.)

You Xu • Guibin Wang • Fuliang Cao • Cancan Zhu • Guangyu Wang •

Yousry A. El-Kassaby

Received: 30 September 2013 / Accepted: 20 May 2014� Springer Science+Business Media Dordrecht 2014

Abstract Response of growth and secondary metabolites to light intensity are useful

measurements to determine suitable silviculture treatments for the cultivation of medicinal

plants. Here, we analyzed the growth, flavonols (total flavonol, quercetin, kaempferol, and

isorhamnetin) content, flavonols yield per plant, and expression of flavonoid biosynthesis-

related genes in 2-year Ginkgo (Ginkgo biloba L.) seedlings at four different light inten-

sities (100, 76, 40, and 25 % of full sunlight) in a greenhouse setting. Across all light

intensities, the 76 % sunlight treatment produced the highest growth of total biomass, root,

stem, and leaf, indicating negative effects of either fulllight or heavy shading on Ginkgo

seedling development. Both flavonols (total flavonol, quercetin, kaempferol, and isorh-

amnetin) content and expression of flavonoid biosynthesis-related genes [PAL (Phenyl-

alanine ammonia-lyase), CHS (Chalcone synthase), F3H (Flavanone 3-hydroxylase), and

FLS (Flavonol synthase)] in leaves were highest under 100 % sunlight, suggesting that full

sunlight promotes the expression of flavonoid biosynthesis-related genes and increases

flavonoid biosynthesis. The highest and lowest flavonol contents were found in leaves and

stems, respectively. The 76 % sunlight treatment produced the highest flavonols yield

while the 100 % sunlight produced the highest flavonoids content in leaves, indicating that

flavonol production per unit land area depends not only flavonol content but also biomass.

Overall, in order to achieve the highest flavonols yield per area in Ginkgo leaf-harvesting

plantations, it is important to manipulate light conditions of field.

You Xu and Guibin Wang contributed equally to this work.

Y. Xu � G. Wang � F. CaoCollege of Forest Resources and Environment, Nanjing Forestry University, Nanjing 210037,People’s Republic of China

C. ZhuInstitute of Botany, Jiangsu Province and Chinese Academy of Sciences, Nanjing 210014,People’s Republic of China

G. Wang � Y. A. El-Kassaby (&)Faculty of Forestry, University of British Columbia, Vancouver, BC V6T 1Z4, Canadae-mail: y.el-kassaby@ubc.ca

123

New ForestsDOI 10.1007/s11056-014-9435-7

Author's personal copy

Keywords Ginkgo biloba � Light intensity � Biomass production � Secondary

metabolites � Gene expression

Introduction

Plants, including trees, are potential sources of natural bioactive compounds such as

secondary metabolites with commercial importance as pharmaceutical compounds.

Flavonoids are important secondary plant metabolites with wide distribution in many plant

parts (flowers, fruits, seeds, and leaves). Flavonoids are a large group of phenolic plant

constituents and their bioavailability varies greatly among different subgroups and com-

pounds (Erlund 2004). Flavonoids have many biological functions, such as protection

against ultraviolet radiation and phytopathogens (Wang et al. 2009), visual signal that

attracts pollinators (Koes et al. 1994), and controlling fall colour in many plants (Field

et al. 2001). Flavonoids have antioxidant functions in higher plants that are challenged with

a range of environmental (Agati et al. 2012) and wounding stresses (Chalker-Scott 1999).

They have proven benefits to human health such as vasodilatory, anti-inflammatory,

-allergenic, -bacterial, -viral, -carcinogenic, and immune-stimulating, as well as being

inhibitors of some oxidases, such as glutathione reductase, lipoxygenase, cyclooxygenase,

xanthine oxidase, and phospholipase A2 (Jaakola and Hohtola 2010; Rice-Evans et al.

1996; Zhang et al. 2010).

Flavonoid biosynthesis and accumulation in plants are affected by many-factors, such as

light, water, temperature, soil type, microbial interactions, altitude, nutritional status,

pathogenesis, wounding, defoliation, plant growth regulators, and various developmental

processes (Downey et al. 2006; Azuma et al. 2012; Lafuente et al. 2011; Jaakola and

Hohtola 2010; Schmidt et al. 2010; Cohen et al. 2012; Ballizany et al. 2012; Castellarin

et al. 2007). Goto-Yamamoto et al. (2010) reported that high temperature moderately

reduced proanthocyanidin and quercetin concentrations while various temperature and

water regimes had different influences on each group of flavonoids in grape berry skins.

Light is an important environmental factor that drives photosynthesis and regulates

plant growth and development, and it also has been shown to exert an important effect on

flavonoid biosynthesis (Awad et al. 2001). High and low light intensity had significantly

positive and negative effects on flavonoid accumulation in grape bunches, respectively

(Cortell and Kennedy 2006; Fujita et al. 2006; Matus et al. 2009). Visible light primarily

induces biosynthesis of proanthocyanidins and affects their composition, whereas UV light

specifically induces biosynthesis of flavonols (Koyama et al. 2012). Jaakola and Hohtola

(2010) found that photoperiod influences the biosynthesis of many secondary metabolites

in a number of plant species. Accumulation of flavonoids in Brassica napus was sup-

pressed by increasing the amount of far-red light in the spectrum, and addition of UVB

(290–320 nm) to the spectrum altered the flavonoid composition by causing significant

changes in the quantities of individual flavonoids (Gerhardt et al. 2008).

Ginkgo (Ginkgo biloba L.), a deciduous gymnosperm species, is native to China. It is

the only remaining species of the once large order Ginkgoales, with geological records

indicating its presence on earth for 150–200 million years (He et al. 2009). Ginkgo leaves

have been cultivated for their medicinal properties for several thousand years (Ward et al.

2002), and also as an ingredient in functional foods in China. Extracts from Ginkgo leaves

are useful for a broad range of pharmacological activities, and have been used to cure

New Forests

123

Author's personal copy

various common geriatric complaints (Clostre, 1999; Ward et al. 2002). The main bio-

active constituents are flavonoid glycosides and terpene trilactones which are considered

responsible for the pharmacological activities of its standardized leaf extract (Singh et al.

2008; van Beek 2002). Owing to Ginkgo’s multiple beneficial effects on human health, a

substantial production of leaves is required for Ginkgo tea production, for medical use and

for functional food. However, most studies on Ginkgo were focused on extract activities,

whereas less attention was paid to its silvics.

It is of biological and commercial importance to understand the environmental factors

affecting flavonoids biosynthesis as this knowledge is essential to the development and

production of high-flavonoid yielding plantations. Several studies have been conducted to

investigate the effects of light, temperature, and drought on flavonol content in Ginkgo

leaves (Xie and Wang 2006; Leng et al. 2001) and genomic studies have been conducted to

understand their biosynthesis through the cloning and study of several flavonoid biosyn-

thesis genes [e.g., CHS (Pang et al. 2005); PAL (Xu et al. 2008a); ANS (Xu et al. 2008b)].

Understanding the effects of light intensity on leaf yield and flavonoid content is a proper

step towards the development of silvicultural measurement in leaf-harvesting Ginkgo

plantations, so higher flavonoid yield could be attained. Additionally, increasing knowl-

edge about secondary metabolism theory, especially the relation between light intensity

and flavonoid biosynthesis would be beneficial for the commercial utilization of this

resource.

This study was conducted to investigate the inter-relationship of light intensity on

growth and flavonol accumulation in Ginkgo. Furthermore, it has not yet been clarified

how the genes of flavonoid biosynthesis pathway respond to different light intensity (Wang

et al. 2012). The main objectives were to assess the effect of light intensity on growth,

flavonol content (total flavonol, quercetin, kaempferol, and isorhamnetin), and the

expression of flavonoid biosynthesis-related genes. Information generated from this study

is expected to be of great value for providing optimal growing (cropping for leaf har-

vesting) conditions for the commercial production high flavonol yielding Ginkgo

plantations.

Materials and methods

Plant materials and experimental procedures

Wind-pollinated seed of Ginkgo (Ginkgo biloba L. ‘Ddajinzhui’) were harvested in early

October 2009 and were treated with stratification method for dormancy breaking (seed

mixed with wet sand (1:3) and stored at 4 �C for 90 days). After stratification (early

January 2010), seed were field sown for seedling production. After 1-year in the field

(January 2011), seedlings of uniform size were selected and planted in pots (12 9 15 cm

(diameter x height)) containing medium composed of loam, yellow sand, and peat (2:1:1).

The basic nutrients of medium were organic matter 50 g kg-1, soluble nitrogen

121.6 mg kg-1, available phosphorous (P2O5) 27 mg kg-1, available potassium (K2O)

11.7 mg kg-1, and 6.7 pH. Two seedlings of similar size were planted in each pot (mean

height = 33 cm and basal diameter = 6.75 mm) for experimental use.

During 2011 growing season, the experiment was carried out in Nanjing Forestry

University, China (March, 2011) and pots were transferred to greenhouse. After 1 month

(April, 2011) shading treatments were conducted. The experimental design was a ran-

domized block design with three replications. Treatments consisted of four shading

New Forests

123

Author's personal copy

intensities [four light intensity regimens: 100 % of solar radiation without shading net

(L1), 76 % of solar radiation covered with one layer of shading net (L2), 40 % of solar

radiation covered with two layers of shading net (L3), and 25 % of solar radiation covered

with three layers of shading net (L4)]. Shading nets were placed at 2 m above the potted

plants. The average light intensity passing through in each shading treatment was about

1,300, 990, 510, and 300 lmol m-2 s-1 of photosynthetically active radiation (PAR)

during noon time (May 2011) for L1–L4, respectively. The monthly sunshine durations

from April to October were 169.6, 194.4, 162.8, 196.7, 201.6, 164.0 and 164.2 h,

respectively. For each block-replication combination (3 9 4 = 12), 30 pots with 60

seedlings were used. During the experiment, the monthly average temperatures from April

to October were 17.6, 23.1, 26.8, 30.1, 29.6, 25.3, and 19.6 �C in the greenhouse,

respectively, while the outdoor temperature was 2 �C higher. Minor temperature differ-

ences were observed among the four light treatments as they were located within the same

greenhouse. We used the weight method to control soil moisture, and the whole pots

(including soil and plants) would be assessed every 2 days, and any moisture loss through

evaporation was adjusted by adding tap water, so soil moisture of all treatments was the

same. No fertilizer was added during experimental period, so the soil mix and nutrients for

all treatments were identical.

Growth and biomass assessment

Growth and biomass assessments of the seedlings were conducted before the start (April,

2011) and at the end of treatments (October, 2011). Before the start of treatments, the

height and basal diameter of each seedling within each treatment were measured, and the

mean basal diameter and height were calculated. According to mean basal diameter and

height, six seedlings were selected and harvested. After harvesting, each sampled seedling

was washed and leaf, stem, and root components were separated, weighed, and dried at

70 �C. At the end of experiment, the mean basal diameter and height of all seedlings for

each replication were measured, and mean basal diameter and height of each replication

were calculated. According to the mean basal diameter and height, four sample seedlings

were selected and harvested for each replication. After harvesting, each sampled seedling

was also washed and leaf, stem, and root components were separated, weighed, and dried

at 70 �C. The total dry biomass of each seedling was calculated as the sum of the three

parts (leaves, stem, and root) dry weights. All dried samples were ground to fine powder

and stored at room temperature prior to analysis of flavonol contents. Growth of total

biomass (root, stem, and leaves) (GB) = total dry biomass at the end of experiment—total

dry biomass before treatment. The same was calculated for growth of leaves (GL), stem

(GS), and root (GR).

Analysis of flavonol content

The flavonol content of roots, stems, and leaves were determined using high performance

chromatography (HPLC) (Chinese Pharmacopoeia Commission 2010). A 1.0 g of the

powdered sample was refluxed with 50 mL petroleum ether for 2 h in Soxhlet extractors,

then evaporated to dryness to obtain residue with a rotary evaporator. The residue was

refluxed again with 50 mL methanol for 4 h at 80 �C. After the extract was evaporated to

dryness, the residue was refluxed with 25 mL mixture of methanol and HCl (4:1) at 100 �C

for 30 min. The extract was cooled and filtered by a 0.45 lm organic phase filter. The

filtrate was removed to 50 mL volumetric flask, diluted with methanol to volume for HPLC

New Forests

123

Author's personal copy

analysis. Identification and quantification of flavonols was performed injecting 10 lL in

HPLC system (Waters 2695, USA) equipped with a C18 reversed phase column

(200 mm 9 4.6 mm, 5 lm). The isocratic elution was mixture of methanol and 0.4 %

phosphoric acid solution (50:50 v/v). The flow rate was 1.0 mL min-1, and the run time

was 18 min. Detection was performed at a wavelength of 360 nm. Quantitative calcula-

tions of quercetin, kaempferol, and isorhamnetin were carried out according to calibration

curves of standards. Total flavonol content = (quercetin ? kaempferol ? isorhamnetin

contents) 9 2.51 (Chinese Pharmacopoeia Commission 2010). Flavonol yield per

plant = flavonol content 9 leaf biomass per plant.

Expression analysis of flavonoid biosynthesis-related genes

Green leaf samples were harvested to determine relative gene expression of enzymes

related with flavonoid biosynthesis (October, 2011). Samples were immediately frozen in

liquid nitrogen and kept at -80 �C until use. Total RNA was isolated from Ginkgo leaves

(three samples for each treatment) following the method of Pang et al. (2005) and cDNAs

were synthesized using a cDNA synthesis kit (Clontech, USA) following the manufac-

turers’ manuals. The expression level of the flavonoid biosynthesis-related genes (PAL

(Phenylalanine ammonia-lyase), CHS (Chalcone synthase), F3H (Flavanone 3-hydroxy-

lase), and FLS (Flavonol synthase)) was determined along with a fragment of glycer-

aldehyde-3-phosphate dehydrogenase (GADPH) coding glyceraldehyde-3-phosphate

dehydrogenase as a reference by quantitative real-time PCR (qRT-PCR) using an ABI

PRISM 7500 Sequence Detection System (Applied Biosystems, Foster City, CA, USA)

and a SYBR Green PCR Master Mix (Applied Biosystems, Foster City, CA, USA) fol-

lowing the manufacturers’ manuals (Xu et al. 2008a) (see Table 1 for primer information

for amplification of the analyzed genes).

Statistical analysis

Data are reported as the mean ± standard deviation (SD), and all tests were performed

using the SigmaPlot 11.0 statistical software program (Systat Software Inc., Chicago, IL,

USA). After a Levene test for homogeneity of variances, one-way analysis of variance

(ANOVA) was conducted to compare the effect of shading treatments on growth, flavonol

content, flavonoid accumulation per plant, and relative gene expression. Duncan’s multi-

ple-range test was performed for each variable.

Results

Variation in biomass production

Shading had a significant effect (p \ 0.05) on total biomass (GB) of Ginkgo seedlings. The

GB per seedling varied among treatments with the following order L2 [ L3 [ L1 [ L4

(Fig. 1). Generally, this trend persisted across the growth of leaves (GL), stem (GS), and

root (GR) (Fig. 1). The GB of L2 exceeded that of L1, L3, and L4 by 28.0, 16.8, and

46.8 %, respectively. Across the four treatments, biomass allocation for root, stem, and

leaves parts yielding 38.5, 25.0 and 36.5 %, respectively. The highest ratio of leaf to GB

was observed in treatments L2 (39.3 %), whereas the greatest ratios of root and stem were

New Forests

123

Author's personal copy

achieved in treatment L1 (41.6 %) and L4 (30.1 %), respectively. GL per seedling in

treatments L2 was higher than that of L1, L3, and L4 by 55.7, 21.9, and 125.1 %,

respectively.

Variation in flavonol content

Mean flavonol content significantly differed (p \ 0.05) among the different parts of

Ginkgo seedlings (Table 2). Total flavonol content, across the four treatments, was highest

in leaves while stem had the lowest total flavonol content. Leaves’ total flavonol content

was 3.00 and 2.89 times that of stem and root, this trend was consistent across the different

flavonol compounds (Table 2).

Total leaves flavonol content significantly varied (p \ 0.05) across the four light

intensities with L1 and L3 representing the highest and lowest contents, respectively

(Table 3). It is interesting to note that no significant differences were observed between L2,

L3, and L4 (Table 3).

Variation in relative expression of flavonoid biosynthesis related genes

Effect of light intensity on relative gene expression of PAL, CHS, F3H, and FLS in Ginkgo

leaves was significant (p \ 0.05) and varied among treatments (Fig. 2). Generally, the

relative expression of the studied four genes (PAL, CHS, F3H, and FLS) showed

decreasing tendency with light intensity reduction (Fig. 2). Across the four light intensity

treatments, the relative expression of the studied genes was consistently highest under L1

and lowest under L4 (note, there was no significant difference among L2, L3, and L4 for

F3H and FLS) (Fig. 2). Pearson’s Product-Moment correlations (r) between total flavonol

content and the relative expression of PAL, CHS, F3H, and FLS were 0.905, 0.842, 0.883,

and 0.910, respectively, indicating that their expression levels are notably correlated with

total flavonol content in Ginkgo leaves.

Variation in flavonol yield per plant

Leaves’ flavonol content was estimated for each light intensity treatment on individual

seedling level (Fig. 3). Total flavonol yield ranged from 61.1 to 146.5 mg/plant, whereas

Table 1 Primers used for the quantification of gene expression levels by qRT-PCR

Gene name Sequence (50 ? 30) Tm (�C)

PAL Up-50GCGCTGCGGACTCAATCT30 58

Down-50GCCCATCCATTGATTCATAGGA30 51

CHS Up-50CAGCGAATACGGCAACATGT30 60

Down-50CGCATTTCGTCGAGGATGA30 58

F3H Up-50GGCCCAAAGTGGCGTACA30 58

Down-50TCCGGCCAGTGAGATTATGG30 62

FLS Up-50AGCCACGCACACTGTAATGG30 62

Down-50GGCGGCTTTCTGCAACATAT30 60

GAPDH Up-50GGTGCCAAAAAGGTGGTCAT30 60

Down-50CAACAACGAACATGGGAGCAT30 49.6

New Forests

123

Author's personal copy

the yields of quercetin, kaempferol, and isorhamnetin ranged from 7.9 to 18.8, 11.4 to 25.1,

and 5.8 to 13.4 mg/plant, respectively. ANOVA indicated that the effect of shading on

total flavonol yield as well each compound individually per plant was significant

(p \ 0.05). Similar to the trend detected for growth (above), the greatest total flavonol

yield was detected under L2 (Fig. 3).

Component

GL GR GS GB

Dry

bio

mas

s (g

)

0

5

10

15

20

25

30

L1L2L3L4

c

a

b

d

abb

ca

bb

b

a

b

c

d

Fig. 1 Variation in biomass production of Ginkgo seedlings growing under four different shadingtreatments (L1–L4 represent no shading and shading with one-, two-, and three-layer nets, respectively)(mean ± SD). Bars within a component group with different letters indicate treatments’ significantdifferences (p \ 0.05). GL leaves growth, GR root growth, GS shoot growth, and GB biomass growth

Table 2 Mean flavonol content (mg g-1) in root, stem and leaves of ginkgo seedlings (means across lighttreatments ± SD). Means within a column with different letters are statistically significantly different(p \ 0.05)

Component Total flavonol Quercetin Kaempferol Isorhamnetin

Root 4.92 ± 0.56b 0.48 ± 0.03b 0.47 ± 0.03b 1.01 ± 0.01b

Stem 4.74 ± 0.39c 0.45 ± 0.03b 0.44 ± 0.03c 1.00 ± 0.01b

Leaf 14.23 ± 1.26a 1.87 ± 0.45a 2.51 ± 0.43a 1.29 ± 0.08a

Table 3 Mean flavonol content (mg g-1) in Ginko leaves under four light treatments (L1–L4)(mean ± SD). Means within a column with different letters are statistically significantly different (p \ 0.05)

Treatment Total flavonol Quercetin Kaempferol Isorhamnetin

L1 16.67 ± 1.46a 2.39 ± 0.30a 2.90 ± 0.35a 1.35 ± 0.05a

L2 14.03 ± 1.38b 1.83 ± 0.36b 2.45 ± 0.51ab 1.31 ± 0.07ab

L3 12.42 ± 1.29b 1.52 ± 0.29b 2.20 ± 0.22b 1.23 ± 0.09b

L4 13.81 ± 1.12b 1.73 ± 0.39b 2.49 ± 0.35ab 1.28 ± 0.05ab

Quercetin, kaempferol and isorhamnetin content were determined by HPLC, and total flavonol con-tent = (quercetin content ? kaempferol content ? isorhamnetin content) 9 2.51

New Forests

123

Author's personal copy

Discussion

Horticultural production has primarily focused on increasing productivity through

improvement of water and fertilizers management (Stefanelli et al. 2010). However, light

intensity is an important environmental factor influencing tree growth and light compen-

sation and saturation points have been reported to be different for various tree species

PAL CHS F3H FLS

Rel

ativ

e ge

ne e

xpre

ssio

n

0

1

2

3

4

5

6

7

L1L2L3L4

a b c ca

b b c

a

bb

b

a

bb

b

Fig. 2 Variation in relative gene expression (PAL, CHS, F3H, and FLS) in Ginko leaves growing underfour different shading treatments (L1–L4 represent no shading and shading with one-, two-, and three-layernets, respectively) (mean ± SD). Bars within a group with different letters indicate treatments’ significantdifferences (p \ 0.05)

Total flavonol Quercetin Kaempferol Isorhamnetin

Flav

onol

yie

ld (

mg/

plan

t)

0

20

40

60

80

100

120

140

160

180

L1L2L3L4

a

bb

c

aa bc

ab b

c a bb c

Fig. 3 Variation in total flavonol, quercetin, kaempferol, and isorhamnetin yield in Ginkgo leaves growingunder four different shading treatments (L1–L4 represent no shading and shading with one-, two-, and three-layer nets, respectively) (mean ± SD). Flavonol yield per plant = flavonol content 9 leaves biomass perplant. Bars within a group with different letters indicate significant differences (P)

New Forests

123

Author's personal copy

(Zhang et al. 2007). The present study demonstrated that shading had significant effects on

leaf and total biomass production of Ginkgo seedlings and specifically light intensity

treatment, L2, resulted in the highest growth for all the seedlings’ parts (GB, GS, GR, and

GL), indicating that either low or high light intensity would not yield optimum growth of

Ginkgo. The relatively lower biomass accumulation of L1 (no shading) could be explained

by photoinhibition. The light saturation point of 2-year-old Ginkgo is

1,062.2 lmol m-2 s-1, and the light intensity of L1 treatment is 1,300 lmol m-2 s-1 (Tao

et al. 1999), so light intensity is higher than light saturation. The observed growth response

of Ginkgo seedlings to light intensity was similar to that of many tree species growing

under various light intensities (Poorter 1999; Cai et al. 2009; Deng et al. 2012). The present

study also indicates that Ginkgo seedlings increased their leaf biomass ratio at light

intensity (L2), whereas no shading (L1) or heavy shading (L4) elevated the root and stem

biomass ratios, respectively. Under no shading condition, higher transpiration rate leads to

increased root biomass allocation to favor their growth and respiration, so root water

uptake can satisfy the increased water need of the seedlings’ growth. Our results were in

agreement with that reported for Rauvolfia species, Cyclocarya paliurus, Anoectochilus

formosanus, and freshwater macrophytes (Cai et al. 2009; Deng et al. 2012; Ma et al. 2010;

Cronin and Lodge 2003).

Flavonoid accumulation can be influenced by a number of environmental conditions,

such as temperature (Tarara et al. 2008; Goto-Yamamoto et al. 2010), soil moisture (Yuan

et al. 2012), and light (Deng et al. 2012; Ma et al. 2010). Light intensity is known to affect

not only plant growth and development but also the biosynthesis of both primary and

secondary metabolites (Hemm et al. 2004). Deng et al. (2012) reported that shading had a

significant negative effect on contents of total flavonoid, kaempferol, quercetin, and

isorhamnetin in C. paliurus leaves. It has been reported that sunlight-exposed tea

(Camellia sinensis (L.) O. Kuntze) leaves accumulate higher concentration of proantho-

cyanins and O-glycosylated flavonols as compared to their shaded counterparts (Wang

et al. 2012). Cronin and Lodge (2003) also found leaf phenolics content of two freshwater

macrophytes were 72 % higher in unshaded than in shaded plants. In the present study,

shading treatments significantly affected total flavonol, quercetin, kaempferol, and isorh-

amnetin contents in Ginkgo leaves (Table 2). Overall, shading had a significantly negative

effect on the contents of total flavonol, quercetin, kaempferol and isorhamnetin, suggesting

that high levels of photosynthetically active radiation stimulate the biosynthesis of

flavonoids in Ginkgo seedling, and the result is also correlated with antioxidant functions

of flavonoids (Agati et al. 2009). Our results were consistent with other studies on tea

(Wang et al. 2012), C. paliurus (Deng et al. 2012), and freshwater macrophytes (Cronin

and Lodge 2003), suggesting that controlling light intensity would be an effective tool for

stimulating secondary plant metabolite accumulation, especially for medical trees under

intensive management system (Deng et al. 2012). Flavonoid biosynthesis in Ginkgo leaves

requires coordinated expression of genes encoding enzymes in the core phenylpropanoid

pathway and in branch pathways, such as PAL, CHS, CHI, F3H, and FLS. PAL is a link

between primary and secondary metabolism and high PAL expression is often found in

parallel with high levels of flavonoids (Lillo et al. 2008). The CHS gene, which encodes

the first committed enzyme in flavonoid biosynthesis, has been used extensively as a model

for identifying and studying elements that control the expression of flavonoid biosynthetic

genes. F3H and FLS are key enzymes of flavonol biosynthesis as they convert di-

hydrokaempferol or dihydroquercetin to the corresponding flavonols, kaempferol and

quercetin, respectively. In the present study, shading treatments significantly affected the

relative gene expression of PAL, CHS, F3H, and FLS in Ginkgo leaves. The relative

New Forests

123

Author's personal copy

expression of key flavonoid upstream pathway genes PAL and CHS were notably

decreased under shading treatments. F3H and FLS genes, which are involved in the bio-

synthesis of different flavonols, also had notably decreased activity in the shade-treated

leaves. This result suggests that shade treatment was effective in reducing flavonols bio-

synthesis. So, because key enzyme activity is reduced in the flavonol biosynthesis pathway

(phenylpropanoid pathway), flavonol accumulation of Ginkgo leaves decreases under

shading. The relative light intensity related gene expression of Ginkgo leaves was similar

to that reported for other tree species growing under various light intensities (Wang et al.

2012; Azuma et al. 2012).

In leaf-harvest plantations of Ginkgo, we hope to obtain not only higher quality (higher

flavonol content) but also higher yield (higher leaf biomass). In order to achieve this goal,

we can implement specific silvicultural measures in plantations, such as pruning, fertil-

ization, irrigation, and shading, but it should be noted that any measure potentially has a

dual nature. For example, moderate prunning results in higher leaf yield and flavonoid

content, but heavy pruning significantly decreases leaf yield, and light pruning has no

effect on increasing flavonol content (Cao et al. 1999). For C. paliurus, the treatment of full

sunlight (no shading) resulted in the highest flavonol, but yielded the second best leaf

biomass, while the treatment of shading with one layer of netting achieved highest leaf

biomass, but produces the second best flavonol content. Considering flavonol yield per

plant (flavonol content multiplied by leaf biomass), one layer shading treatment is the best

treatment for leaf-harvest plantation (Deng et al. 2012). So, the balance of silvicultural

measures is important in production practice in order to obtain higher flavonol yield. Our

results also highlighted the effect of shading on total flavonol yield per plant in Ginkgo

leaves and identified the role of L2 as the best shading treatment for leaf biomass pro-

duction and the second best for total flavonol content (L1 yielded highest total flavonol

content). These results suggest that L2 condition shows higher effectiveness in maintaining

the balance between biomass production and secondary metabolites content for obtaining

higher yield of health-promoting substances per area in the plantation.

Conclusion

Significant changes in biomass accumulation and allocation were found in Gingko seed-

lings growing under variable light intensities in an experimental settings, and the treatment

of 76 % solar radiation (L2) was the best in achieving the highest dry biomass. Both

flavonol content (including total flavonol, quercetin, kaempferol, and isorhamnetin) and

flavonol yield per plant were significantly affected by light intensity and the highest

flavonol content and flavonol yield were obtained under 100 and 76 % solar radiation (L1

and L2), respectively. These results indicate that 100 % sunlight is conducive to flavonoids

biosynthesis and accumulation in Ginkgo leaves, but flavonoids accumulation per area

depends on biomass production as well. The expression of flavonoid biosynthesis-related

genes (PAL, CHS, F3H, and FLS) and total flavonol content coincided with different light

intensity treatments, which was supported by the notable positive correlations between the

genes’ expression levels and flavonol content.

Acknowledgments This study was supported by a Grant from the research program ‘‘The environmentalinducing mechanisms of flavonoids in the leaves of Ginkgo biloba L.’’ (31070557) provided by the NationalNatural Science Foundation of China, and ‘‘Research and demonstration of oriented cultivation technologyin Ginkgo and neem plantations’’ (2012BAD21B04) provided by Science and Technology Department of

New Forests

123

Author's personal copy

China, and ‘‘The planting technologies of medical plantation for Ginkgo and camphor trees’’ (20120460102)provided by State Forestry Bureau.

References

Agati G, Stefano G, Biricolti S, Tattini M (2009) Mesophyll distribution of ‘antioxidant’ flavonoid gly-cosides in Ligustrum vulgare leaves under contrasting sunlight irradiance. Ann Bot 104:853–861

Agati G, Azzarello E, Pollastri S, Tattini M (2012) Flavonoids as antioxidants in plants: location andfunctional significance. Plant Sci 196:67–76

Awad MA, Wagenmakers PS, de Jager A (2001) Effects of light on flavonoid and chlorogenic acid levels inthe skin of ‘Jonagold’ apples. Sci Hortic 88:289–298

Azuma A, Yakushiji H, Koshita Y, Kobayashi S (2012) Flavonoid biosynthesis-related genes in grape skinare differentially regulated by temperature and light conditions. Planta 236:1067–1080

Ballizany WL, Hofmann RW, Jahufer MZZ, Barrett BA (2012) Multivariate associations of flavonoid andbiomass accumulation in white clover (Trifolium repens) under drought. Funct Plant Biol 39:167–177

Cai ZQ, Wang WH, Yang J, Cai CT (2009) Growth, photosynthesis and root reserpine concentrations of twoRauvolfia species in response to a light gradient. Ind Crops Prod 30:220–226

Cao FL, Jin JL, Wang GB, Li Q, Chu SH (1999) A preliminary study on silvicultural practice of Ginkgoplantation for leaf harvest. J Nanjing For Univ 23(5):60–63

Castellarin SD, Matthews MA, Di Gaspero G, Gambetta GA (2007) Water deficits accelerate ripening andinduce changes in gene expression regulating flavonoid biosynthesis in grape berries. Planta227:101–112

Chalker-Scott L (1999) Environmental significance of anthocyanins in plant stress responses. PhotochemPhotobiol 70:1–9

Chinese Pharmacopoeia Commission (2010) Pharmacopoeia of the People’s Republic of China. ChineseMedical Science and Technology Press, Beijing, pp 243–244

Clostre F (1999) Ginkgo biloba extract (EGb 761). State of knowledge in the dawn of the year 2000. AnnPharm Fr 57(Suppl 1):1S8–1S88

Cohen SD, Tarara JM, Gambetta GA, Matthews MA, Kennedy JA (2012) Impact of diurnal temperaturevariation on grape berry development, proanthocyanidin accumulation, and the expression of flavonoidpathway genes. J Exp Bot 63:2655–2665

Cortell JM, Kennedy JA (2006) Effect of shading on accumulation of flavonoid compounds in (Vitis viniferaL.) Pinot noir fruit and extraction in a model system. J Agric Food Chem 54:8510–8520

Cronin G, Lodge DM (2003) Effects of light and nutrient availability on the growth, allocation, carbon/nitrogen balance, phenolic chemistry and resistance to herbivory of two freshwater macrophytes.Oecologis 137:32–41

Deng BO, Shang XL, Fang SZ, Li QQ, Fu XX, Su J (2012) Integrated effects of light intensity andfertilization on growth and flavonoid accumulation in Cyclocarya paliurus. J Agric Food Chem60:6286–6292

Downey MO, Dokoozlian NK, Krstic MP (2006) Cultural practice and environmental impacts on theflavonoid composition of grapes and wine: a review of recent research. Am J Enol Vitic 57:257–268

Erlund I (2004) Review of the flavonoids quercetin, hesperetin, and naringenin. Dietary sources, bioac-tivities, bioavailability, and epidemiology. Nutr Res (NY) 24:851–874

Field TS, Lee DW, Holbrook NM (2001) Why leaves turn red in autumn. The role of anthocyanins insenescing leaves of red-osier dogwood. Plant Physiol 127:566–574

Fujita A, Goto-Yamamoto N, Aramaki I, Hashizume K (2006) Organspecific transcription of putativeflavonol synthase genes of grapevine and effects of plant hormones and shading on flavonol biosyn-thesis in grape berry skins. Biosci Biotechnol Biochem 70:632–638

Gerhardt KE, Lampi MA, Greenberg BM (2008) The effects of far-red light on plant growth and flavonoidaccumulation in Brassica napus in the presence of ultraviolet B radiation. Photochem Photobiol84:1445–1454

Goto-Yamamoto N, Mori K, Numata M, Koyama K, Kitayama M (2010) Effects of temperature and waterregimes on flavonoid contents and composition in the skin of red-wine grapes. J Int Sci Vigne Vin(special issue Macrowine):75–80

He X, Huang W, Chen W, Dong T, Liu C, Chen Z, Xu S, Ruan Y (2009) Changes of main secondarymetabolites in leaves of Ginkgo biloba in response to ozone fumigation. J Environ Sci 21:199–203

Hemm MR, Rider SD, Ogas J, Murry DJ, Chapple C (2004) Light induces phenylpropanoid metabolism inArabidopsis roots. Plant J 38:765–778

New Forests

123

Author's personal copy

Jaakola L, Hohtola A (2010) Effect of latitude on flavonoid biosynthesis in plants. Plant, Cell Environ33:1239–1247

Koes RE, Quattrocchio F, Mol JNM (1994) The flavonoid biosynthetic-pathway in plants—function andevolution. BioEssays 16:123–132

Koyama K, Ikeda H, Poudel PR, Goto-Yamamoto N (2012) Light quality affects flavonoid biosynthesis inyoung berries of Cabernet Sauvignon grape. Phytochemistry 78:54–64

Lafuente MT, Ballester AR, Calejero J, Gonzalez-Candelas L (2011) Effect of high-temperature-con-ditioning treatments on quality, flavonoid composition and vitamin C of cold stored ‘Fortune’ man-darins. Food Chem 128:1080–1086

Leng P, Su S, Li Y, Wang S, Jiang X (2001) Effects of fertilizer and drought stress on growth as well asflavonol glycosides and terpene lactone content of Ginkgo biloba seedlings. J Beijing Agric Coll16(1):32–37

Lillo C, Lea US, Ruoff P (2008) Nutrient depletion as a key factor for manipulating gene expression andproduct formation in different branches of the flavonoid pathway. Plant, Cell Environ 31:587–601

Ma ZQ, Li SH, Zhang MJ (2010) Light intensity affects growth, photosynthetic capability, and totalflavonoid accumulation of Anoectochilus Plants. HortScience 45:863–867

Matus JT, Loyola R, Vega A, Pena-Neira A, Bordeu E, Arce-Johnson P, Alcalde JA (2009) Post-veraisonsunlight exposure induces MYB-mediated transcriptional regulation of anthocyanin and flavonolsynthesis in berry skins of Vitis vinifera. J Exp Bot 60:853–867

Pang YZ, Shen GA, Wu WS, Liu XF, Lin J, Tan F, Sun XF, Tang KX (2005) Characterization andexpression of chalcone synthase gene from Ginkgo biloba. Plant Sci 168:1525–1531

Poorter L (1999) Growth responses of 15 rainforest tree species to a light gradient: the relative importance ofmorphological and physiological traits. Funct Ecol 13:396–410

Rice-Evans CA, Miller NJ, Paganga G (1996) Structure–antioxidant activity relationships of flavonoids andphenolic acids. Free Radic Biol Med 20:933–956

Schmidt S, Zietz M, Schreiner M, Rohn S, Kroh LW, Krumbein A (2010) Genotypic and climatic influenceson the concentration and composition of flavonoids in kale (Brassica oleracea var. sabellica). FoodChem 119:1293–1299

Singh B, Kaur P, Gopichand, Singh RD, Ahuja PS (2008) Biology and chemistry of Ginkgo biloba.Fitoterapia 79:401–418

Stefanelli D, Goodwin I, Jones R (2010) Minimal nitrogen and water use in horticulture: effects on qualityand content of selected nutrients. Food Res Int 43:1833–1843

Tao J, Chen P, She X (1999) Studies on the photosynthetic characteristics of Ginkgo. Acta Hortic Sinica26(3):157–160

Tarara JM, Lee J, Spayd SE, Scagel CF (2008) Berry temperature and solar radiation alter acylation,proportion, and concentration of anthocyanin in Merlot grapes. Am J Enol Vitic 59:235–247

van Beek TA (2002) Chemical analysis of Ginkgo biloba leaves and extracts. J Chromatogr A 967:21–55Wang CY, Chen CT, Wang SY (2009) Changes of flavonoid content and antioxidant capacity in blueberries

after illumination with UV-C. Food Chem 117:426–431Wang YS, Gao LP, Shan Y, Liu YJ, Tian YW, Xia T (2012) Influence of shade on flavonoid biosynthesis in

tea (Camellia sinensis (L.) O. Kuntze). Sci Hortic 141:7–16Ward CP, Redd K, Williams BM, Caler JR, Luo Y, McCoy John G (2002) Ginkgo biloba extract: cognitive

enhancer or antistress buffer. Pharmacol Biochem Behav 72:913–922Xie BD, Wang HT (2006) Effects of light spectrum and photoperiod on contents of flavonoid and terpene in

leaves of Ginkgo biloba L. J Nanjing For Univ 30:51–54Xu F, Cai R, Cheng SY, Du HW, Wang Y, Cheng SH (2008a) Molecular cloning, characterization and

expression of phenylalanine ammonia-lyase gene from Ginkgo biloba. Afr J Biotechnol 7:721–729Xu F, Cheng H, Cai R, Li LL, Chang J, Zhu J, Zhang FX, Chen LJ, Wang Y, Cheng SH, Cheng SY (2008b)

Molecular cloning and function analysis of an anthocyanidin synthase gene from Ginkgo biloba, and itsexpression in abiotic stress responses. Mol Cells 26:536–547

Yuan Y, Liu YJ, Wu C, Chen SQ, Wang ZY, Yang ZC, Qin SS, Huang LQ (2012) Water deficit affectedflavonoid accumulation by regulating hormone metabolism in scutellaria baicalensis georgi roots.PLoS ONE 7:1–10

Zhang SB, Hu H, Xu K, Li ZR, Yang YP (2007) Flexible and reversible responses to different irradiancelevels during photosynthetic acclimation of Cypripedium guttatum. J Plant Physiol 164:611–620

Zhang J, Shen Q, Lu JC, Li JY, Liu WY, Yang JJ, Li J, Xiao K (2010) Phenolic compounds from the leavesof Cyclocarya paliurus (Batal.) Ijinskaja and their inhibitory activity against PTP1B. Food Chem119:1491–1496

New Forests

123

Author's personal copy