www.elsevier.com/locate/ymcne

Mol. Cell. Neurosci. 33 (2006) 371–380

Induced expression of Olig2 is sufficient for oligodendrocytespecification but not for motoneuron specificationand astrocyte repression

Zhong-Wei Du, Xue-Jun Li, Giang D. Nguyen, and Su-Chun Zhang⁎

Departments of Anatomy and Neurology, School of Medicine and Public Health, Waisman Center, WiCell Institute,University of Wisconsin, Madison, WI 53705, USA

Received 15 June 2006; revised 15 August 2006; accepted 22 August 2006Available online 10 October 2006

To dissect out interactions between the transcription factor Olig2 andother intrinsic and extrinsic factors in neural cell fate determination, weestablishedamouse embryonic stem (ES) cell linewith induced expressionof Olig2 along neural differentiation. During neuronal differentiation,both the control andOlig2-induced groups produced a similar proportionofHB9-expressingmotoneurons in the presence of retinoic acid (RA) andsonic hedgehog (SHH), but both generated few motoneurons in theabsence of SHH. InducedOlig2 expression did not alter the pattern of genetranscription without SHH, suggesting that Olig2 requires cooperationwith RA and SHH for motoneuron specification. During glial differen-tiation, the Olig2-induced group generated significantly more oligoden-drocytes and fewer neurons and astrocytes than the control group. Thiseffect was not blocked by inhibition of SHH signaling, suggesting thatOlig2 bypasses the need of SHH in oligodendrocyte specification.However, treatment with ciliary neurotropic factor (CNTF) markedlyincreased astrocyte and decreased oligodendrocyte differentiation evenwhenOlig2 is sustained in the nuclei, suggesting that Olig2 cannot bypassthe CNTF-STAT signaling to repress astrocyte differentiation.© 2006 Elsevier Inc. All rights reserved.

Introduction

The formation of the vertebrate central nervous system involvesa fundamental cell diversification in which the generation ofneurons, astrocytes and oligodendrocytes from multipotent stemcells occurs in a highly precise manner, both temporally andspatially (Gage, 1998). The molecular mechanisms determiningneural cell fate specification remain poorly understood. Increasingevidence suggests that this fate specification requires bothextracellular factors and intrinsic molecules involving varioustranscription factors (Edlund and Jessell, 1999; Rowitch, 2004).Olig2, a basic helix–loop–helix transcription factor has recentlybeen indicated to play a critical role in the choice between neuronaland glial fates (Anderson et al., 2002).

⁎ Corresponding author. Fax: +1 608 263 5267.E-mail address: zhang@waisman.wisc.edu (S.-C. Zhang).Available online on ScienceDirect (www.sciencedirect.com).

1044-7431/$ - see front matter © 2006 Elsevier Inc. All rights reserved.doi:10.1016/j.mcn.2006.08.007

Olig2 was first identified as an oligodendrocyte lineage gene,which marks the oligodendrocyte precursors and their progeny (Luet al., 2000; Takebayashi et al., 2000; Zhou et al., 2000). However,Olig2 is expressed at a much earlier stage when neurons are beinggenerated. In the murine spinal cord, Olig2 is expressed as early asE8.5 within a specific ventral region named pMN (Zhou et al.,2001). Misexpression of Olig2 is sufficient to induce differentia-tion of ectopic motoneurons in more dorsal regions of the spinalcord through collaboration with Ngn2 (Mizuguchi et al., 2001;Novitch et al., 2001). In loss-of-function experiments, there is acomplete loss of both motoneurons and oligodendrocytes in thespinal cord, and the mutant pMN domain is converted into V2domain which sequentially generates V2 interneurons and thenastrocytes (Lu et al., 2002; Takebayashi et al., 2002; Zhou andAnderson, 2002). These data suggest that Olig2 plays sequentialdual roles in promoting motoneurons and repressing V2 inter-neurons at early neurogenesis stage, and promoting oligodendro-cytes and repressing astrocytes at the later gliogenesis stage.

The expression of Olig2 is regulated by sonic hedgehog (SHH)produced in the ventral midline structures. The SHH sets up aconcentration gradient along the ventral–dorsal axis of the neuraltube and functions as a morphogen to induce the expression ofClass II transcription factors and at the same time represses theexpression of Class I transcription factors (Briscoe et al., 2000;Jessell, 2000), which establish molecular codes for the identity ofthe ventral neural tube. Several studies indicate that SHH is bothnecessary and sufficient for the generation of motoneurons andoligodendrocytes in the spinal cord (Ericson et al., 1996; Orentas etal., 1999; Alberta et al., 2001). However, it is unclear whether theeffect of SHH is completely transduced through Olig2.

Mouse embryonic stem (ES) cells can be genetically modifiedand induced to differentiate into various neural cell types includingmotoneurons, oligodendrocytes and astrocytes in vitro (Billon etal., 2002; Wichterle et al., 2002). They therefore provide a simpleand controllable in vitro system for studying neural fate specifica-tion. To delineate interactions of Olig2 with other transcriptionfactors and morphogens in the specification of motoneurons and

372 Z.-W. Du et al. / Mol. Cell. Neurosci. 33 (2006) 371–380

oligodendrocytes, we established a mouse ES cell line with inducedexpression of Olig2 during neural differentiation. Using this ES cellline, we demonstrated that expression of Olig2 is not sufficient formotoneuron specification and astrocyte repression, but obviates therequirement of SHH for oligodendrocyte specification.

Results

ES cell lines are established with induced expression of Olig2

The tetracycline-inducible expression system was established inmouse ES cell line Ainv15 (Kyba et al., 2002). As shown in Fig. 1A,the reverse tetracycline transactivator (rtTA) was inserted byhomologous recombination into the constitutively active ROSA26locus, and the tetracycline response element (TRE) with a specialtargeting loxP site was integrated into the transcriptionally openchromatin 5′ to the HPRT gene on the X chromosome. Olig2 cDNAwas cloned into the inducible construct pLox, and co-electroporatedalong with pSALK-Cre into Ainv15 cell line. After Cre-LoxPrecombination, a functional antibiotic resistance gene (Neo) wasregenerated to facilitate efficient selection with G418 (250 μg/ml).The transfected cell clones were confirmed by PCR (data not shown)and named ES-Olig2.

We induced neural differentiation from ES cells (Fig. 1B) bymodifying a previously describedmethod (Bain et al., 1995). RAwasused to promote the induction of caudalized neural precursor cells.Under this culture condition, nestin+ neural precursor cells were firstobserved 2 days after differentiation and βIII-tubulin+ neurons atDay 6. GFAP+ astrocytes and O4+ oligodendrocytes were observedmainly after 12 days of differentiation. Thus, the temporal patternof neural differentiation from ES cells is consistent with the in vivosequence of neuronal and glial development considering mouse EScells are equivalent to the inner cell mass of a 3.5-day-old embryo.

Fig. 1. Establishment of ES cell lines with induced expression of Olig2. (A) Schemneural differentiation from ES cells. Olig2 was expressed in a few nestin+ neural preprecursors under Dox induced condition (D). Olig2 expression (red) was detected inmature GFAP+ astrocytes (F). Scale bar=50 μm.

The induced expression of Olig2 was examined during neuraldifferentiation. Doxycycline (Dox) was added in the culture mediumfrom Day2 to Day 12 (Fig. 1B). Immunocytochemical analysesindicated that nearly all nestin+ neural progenitors after 6 days ofdifferentiation showed Olig2 expression under Dox induction,comparing to fewOlig2+ progenitor cells under uninduced condition(Figs. 1C, D). βIII-tubulin+ neurons after 12 days of differentiationfrom the ES-Olig2 cells exhibited induced Olig2 expression innuclei (Fig. 1E). Because of endogenous Olig2 expression in theoligodendroglial lineage, we only examined induced Olig2 expres-sion in astrocytes. ES-Olig2 cells generated a significant populationof GFAP+ astrocytes after 18 days of differentiation under normalcondition (not shown). However, few GFAP+ astrocytes wereobserved in cultures differentiated under Dox treatment (Fig. 1F).Among the GFAP+ astrocytes, only a few co-expressed Olig2 in thecell nuclei and these double positive cells exhibited immature glialmorphology (arrows in Fig. 1F). Thus, the inducedOlig2 expressionis sustained when the ES-Olig2 cells are differentiated to neuralprecursors and neurons, but not in astrocytes.

Expression of Olig2 is not sufficient for motoneuron specificationin the absence of SHH

ES-Olig2 cells, cultured in suspension for 2 days followed bytreatment with RA (0.5 μM) and SHH-N (1 μg/ml) for 4 days,generated about 25% HB9+ motoneurons in the cell aggregates(Fig. 2A). Similar cultures treated with RA alone (without SHH)contained a few HB9+ motoneurons, less than 1% (Fig. 2C).Addition of cyclopamine (5 μM), a SHH signalling inhibitor, resultedin the absence of Olig2+ cells and HB9+ cells (Fig. 2E), confirmingthe necessity of SHH in motoneuron specification in vitro.

Since Olig2 expression is induced by SHH signalling, we askedwhether induced expression of Olig2 bypasses SHH signalling for

atic diagram of Tet-inducible Olig2 expression in ES cells. (B) Protocol forcursors under Dox uninduced condition (C), but in most of the nestin+ neuralβIII-tubulin+ neurons (E), and in immature GFAP+ cells (arrows), but not in

Fig. 2. Motoneuron differentiation from ES-Olig2 cells. ES cell aggregates were treated with RA and SHH for 4 days to differentiate into motoneurons.Under both uninduced and Dox induced condition, ES-Olig2 cells gave rise to HB9-expressing motoneurons at a similar efficiency (A, B). In the presence ofRA alone, few motoneurons were generated (C, D). In the presence of SHH inhibitor cyclopamine, no motoneuron was detected (E, F). ES-Olig2 cellsproduce similar proportion of βIII-tubulin+ neurons under both induced and uninduced conditions (G, H). Scale bar=50 μm. Blue represent Hoechst stainednuclei. (I) Quantification of Olig2 and HB9+ cells under RA plus SHH treatment.

373Z.-W. Du et al. / Mol. Cell. Neurosci. 33 (2006) 371–380

motoneuron specification. When the Olig2 expression was inducedby Dox treatment, more than 95% cells showed Olig2 expressionin the cell aggregates under all conditions, which is significantlyhigher than 35% Olig2+ cells in RA plus SHH group underuninduced condition (Figs. 2B, D, F, I). However, ES-Olig2 cellsgenerated a similar number of HB9+ motoneurons under Doxinduction condition as under uninduced condition. About 25%HB9+ neurons were generated in the presence of RA and SHH(Figs. 2B, I), a few HB9+ motoneurons in the presence of RA alone(Fig. 2D), and no HB9+ motoneurons with cyclopamine treatment(Fig. 2F). Under Dox induction condition, HB9 expression wasmostly overlapped with the induced Olig2 expression, which israre under uninduced condition. In the presence of RA and SHH,ES-Olig2 cells produce a similar proportion of βIII-tubulin+

neurons under both uninduced and induced condition (Figs. 2G,H). The βIII-tubulin+ neurons comprised about 60–70% of the totalHoechst labeled cells. Hardly any GFAP+ astrocyte and PDGFRα+

oligodendrocyte progenitors were observed at this stage. Theseresults suggest that induced expression of Olig2 does not alterneuronal differentiation and that Olig2 is not sufficient to inducemotoneuron differentiation without the RA and SHH treatment.

SHH is required to induce proneural gene Ngn2 and establish thecombinatorial dorsal–ventral transcription factor codes formotoneuron specification even under Olig2 expression

The prerequisite step for motor neuron specification is theproneural state (expression of Ngn2) and the conducive dorsal–ventral transcriptional codes (expression of Nkx6.1 and Pax6 but not

Nkx2.2, Irx3, and Dbx1) in the precursor cells (Jessell, 2000). RT-PCR analyses indicated that Olig2 expression was upregulated inES-Olig2 cell aggregates with RA plus SHH treatment, whereasonly a trace amount of Olig2 expression was detected with RAtreatment alone and no Olig2 expression was observed whencyclopamine was added to the RA treated cultures With Doxinduction, Olig2 expression was upregulated significantly in allthree conditions (Fig. 3A). Strong HB9 expression was seen incultures treated with both RA and SHH and trace amount was visiblein the RA treatment alone group in both uninduced and inducedcondition, consistent with the immunocytochemistry results (Fig. 2).The expression pattern of two other motoneuron-related transcrip-tion factors Isl1 and Lhx3 was similar to that of HB9. Both werehighly expressed under RA plus SHH treatment, but Isl1 was notcompletely blocked by cyclopamine. Dox induction only slightlyupregulated Isl1 and Lhx3 expression (Fig. 3A).

SHH and its downstream effectors are crucial to the inductionof Olig2 (Lu et al., 2000). The expression of SHH downstreameffector Gli2 was stable throughout the differentiation process in allconditions. Induced expression of Olig2 did not change theexpression pattern of another SHH downstream effector Gli3 withthe exception that the expression of Gli3 was slightly lower underthe induced condition than uninduced condition. In both condi-tions, the expression of Gli3 was completely repressed only whenthe cells were treated with RA and SHH (Fig. 3B). Therefore,induced expression of Olig2 does not change the overall pattern ofgene expression of SHH signaling pathways.

One of the effects of SHH is to pattern the pMN domain byinducing the expression of Olig2, Pax6 and Nkx6.1, but repressing

Fig. 3. RT-PCR analysis of candidate genes involved in motoneuron differentiation. (A, B) RNA samples were collected from cell aggregates at Day 6 underdifferent conditions. PCR cycles are indicated in the parentheses. (C) The fold changes of the expression of Irx3, Dbx1 and Ngn2 were quantified by real-timePCR.

374 Z.-W. Du et al. / Mol. Cell. Neurosci. 33 (2006) 371–380

or excluding Nkx2.2, Irx3 and Dbx1 in the progenitors. SHHinduced the expression of Nkx6.1 and Nkx2.2 but did not affectPax6 expression in both uninduced and induced ES-Olig2 cells,and cyclopamine completely blocked the SHH-induced expressionof Nkx2.2 and Nkx6.1. Dox induction treatment had no effect onthe expression of these transcription factors (Fig. 3B), which isconsistent with the view that Nkx6.1, Pax6 and Nkx2.2 lieupstream of Olig2 (Fu et al., 2002; Liu et al., 2003). Irx3 and Dbx1are two class I transcription factors expressed dorsally to the pMNdomain, which are usually repressed by Olig2 in misexpressionstudies in chick embryos (Mizuguchi et al., 2001, Novitch et al.,2001). When treated with RA, induced expression of Olig2 down-regulated expression of Irx3 and Dbx1. Together with SHH treat-ment, induced expression of Olig2 completely abolished theexpression of these two factors, and this effect was reversed bycyclopamine (Fig. 3B). The changes in Irx3 and Dbx1 expressionwere confirmed by quantitative PCR (Fig. 3C).

Neurogenin2 (Ngn2) is a proneural gene, which is required tocooperate with Olig2 in motoneuron generation (Mizuguchi et al.,2001; Novitch et al., 2001). Surprisingly, induced expression ofOlig2 downregulated the expression of Ngn2 induced by RAtreatment. SHH induced Ngn2 expression in both uninduced andinduced conditions and this effect was blocked by cyclopamine(Fig. 3B). This expression change was confirmed by real-time PCR

(Fig. 3C). Another proneural gene Mash1 was also partly repressedby induced expression of Olig2 but was not completely blocked bycyclopamine.

Together, induced expression of Olig2 does not affect theoverall expression pattern of proneural and dorsal–ventraltranscriptional factors as well as the SHH signaling pathway. Theexpression of HB9 is still dependent upon the presence of RA andSHH and the induced expression of Olig2 does not replace theSHH signaling in establishing the dorsal–ventral transcriptionalcode.

Induced expression of Olig2 obviates the requirement of SHH inoligodendrocyte specification

Olig2 is critical for oligodendrocyte specification at a laterdevelopmental stage (Rowitch, 2004). RA-induced progenitorswere expanded in FGF2 for 6 days and then dissociated anddifferentiated to oligodendroglial progenitors (OPCs) in a modifiedBottenstein-Sato medium in the presence of PDGF-AA (10 ng/ml),T3 (40 ng/ml) and NT3 (5 ng/ml). Under uninduced condition, ES-Olig2 cells gave rise to mainly βØ tubulin+ (about 50%) neuronswith about 10% of NG2+ OPCs (Figs. 4A, E), and about 10% ofthe cells were GFAP+ astrocytes at Day 18. In contrast, under Doxinduction, ES-Olig2 cells generated more than 40% NG2+ OPCs,

Fig. 4. Oligodendrocyte differentiation fromOlig2 over-expressing ES cells. ES cell aggregates were dissociated at Day 12 to differentiate into oligodendrocytes.ES-Olig2 cells predominantly differentiated into βIII-tubulin+ neurons and few NG2+ (A) and PDGFRα+ (C) OPCs without Dox induction. ES-Olig2 cells gaverise to about 40% OPCs and only 10% neurons under Dox induced condition (B, D). (E) Quantification of different neural cell types under RA and RA+Doxcondition. Gal-C+ and MBP+ mature oligodendrocytes were produced after further 1-week culture (F, G). Scale bar=50 μm. Blue represent Hoechst stainednuclei. (H) Quantification of OPCs under different conditions.

375Z.-W. Du et al. / Mol. Cell. Neurosci. 33 (2006) 371–380

about 5–10% neurons (Figs. 4B, E) and very few GFAP+ astrocytes(less than 2%). Immunostaining with an antibody againstPDGFRα, another OPC marker, showed a similar pattern of celldifferentiation (Figs. 4C, D). This suggests that induced expressionof Olig2 promotes the oligodendrocyte differentiation. In a longerterm culture, more Gal-C+ and MBP+ (Figs. 4F, G) matureoligodendrocytes were observed under Dox treatment, suggestingthat induced expression of Olig2 does not interfere with thematuration of OPCs.

To investigate whether the effect of SHH on oligodendrocytespecification is transduced through Olig2, we added SHH andcyclopamine into the differentiation culture system. Addition ofSHH significantly increased the population of NG2 or PDGFRα+

OPCs under uninduced condition, but not under induced condition(Fig. 4H). Cyclopamine largely blocked oligodendrocyte differ-entiation under uninduced condition, but had no obvious effectunder induced condition (Fig. 4H). Thus, induced expression ofOlig2 mediates and obviates the effect of SHH in oligodendrocytespecification.

Olig2 downregulates neuronal transcription factors and activatesglial transcription factors in oligodendrocyte specification

The switch from neurogenesis to gliogenesis is preceded bydownregulation of proneural genes and upregulation of gliogenicgenes. Neurogenic transcription factors such as Ngn2 and Pax6

were expressed under uninduced condition at Day 12, whereastheir expression was either significantly lower (Pax6) orcompletely absent (Ngn2) under the induced condition (Figs.5A, B). The expression of Mash1 was however not significantlyaffected by Olig2 expression (Fig. 5A). Notch signaling ispostulated as a mechanism of maintaining a proportion of Olig2precursors until the gliogenesis stage (Rowitch, 2004). No obviouschange in the expression of Notch1, Hes1 and Id2 was observedunder both conditions (data not shown). A few Sox familymembers are recently proposed to be pro-glial genes. Theexpression of Sox9 was expressed in all the groups, although itwas unregulated by Dox induction, which is consistent with thereport that Sox9 is expressed early in neural precursor cells,whereas Sox10 was elevated by induced expression of Olig2(Figs. 5A, B). The expression pattern of Olig1 was similar toOlig2 and Sox10. Nkx2.2 was detected only in the SHH treatmentgroup and Olig2 expression did not alter the pattern of Nkx2.2expression. Thus, Olig2 appears to repress proneural genes andinduce some glial transcription factors thus permitting oligoden-drocyte differentiation.

Olig2 cannot override CNTF effect to repress astrocytedifferentiation

Induced expression of wild type Olig2 is not sustained in theastrocyte during glial differentiation (Fig. 1F). Astrocyte promoting

Fig. 5. RT-PCR analysis of candidate genes involved in oligodendrocyte differentiation. (A) RNA samples were collected from cell aggregates at Day 12 underdifferent conditions. PCR cycles are indicated in the parentheses. (B) The fold changes of the Ngn2 and Sox10 gene expressions were quantified by real-timePCR.

376 Z.-W. Du et al. / Mol. Cell. Neurosci. 33 (2006) 371–380

factors, CNTF (ciliary neurotropic factor) and BMP (bonemorphogenetic protein), were reported to export the Olig2 fromthe nucleus into the cytoplasm (Setoguchi and Kondo, 2004;Samanta and Kessler, 2004). To overcome this problem, Olig2 wasmutated to remove the nuclear export signal as described(Setoguchi and Kondo, 2004). Mutant Olig2 inducible ES cellline was established and named ES-muOlig2. In ES-muOlig2 celldifferentiation culture, less than 2% were GFAP+ astrocytes underinduced condition as compared to about 10% under uninducedcondition (Figs. 6A, B). However, with the treatment of CNTF, theastrocyte population became comparable at about 40% under bothconditions (Figs. 6C, D). Under the Dox induction condition,induced expression of Olig2 was clearly detected in the nuclei ofGFAP+ astrocytes, but the GFAP staining is slightly weaker and theGFAP+ cells showed more immature morphology comparing touninduced condition. These results suggest that Olig2 can repressthe astrocyte differentiation to some extent but cannot completelyoverride the CNTF effect.

Discussion

Analyses of Olig2 transgenic and null mutations suggest thatOlig2 is necessary and may also be sufficient for the generation ofmotoneurons and oligodendrocytes. However, an understanding ofhow Olig2 exerts its role is complicated by its intricateinteractions with other cell intrinsic molecules and extrinsicmorphogens during in vivo development. Using induced expres-sion of Olig2 in ES cells, in which the stage of neuraldevelopment and exposure of Olig2-expressing cells to extrinsicmorphogens can be precisely controlled, we have shown that

Olig2 alone is not sufficient for specifying the motoneuron fate. Itrequires cooperation with RA and SHH to induce neurogenic geneNgn2 and repress dorsal transcription factors Irx3 and Dbx1.Olig2 is sufficient for oligodendrocyte specification duringgliogenesis, but cannot completely override CNTF effect torepress astrocyte differentiation.

The reason for insufficiency of Olig2 alone to specify the HB9-expressing motoneurons may be two folds. Olig2 is not sufficientto repress dorsal class I transcription factors Irx3 and Dbx1 toestablish the pMN domain boundary. In Olig2−/− mutant embryos,the expression of Irx3 is derepressed and expands into the pMNdomain. Consequently, motoneurons fail to develop (Zhou andAnderson, 2002), suggesting the necessity of repression of Irx3 inmotoneuron specification. Misexpression of Olig2 in areas dorsalto the pMN domain inhibits the expression of Irx3 and Dbx1 andresults in ectopic differentiation of motoneurons (Mizuguchi et al.,2001; Novitch et al., 2001), implying that Olig2 may also besufficient for repressing Irx3 and Dbx1. The fact that inducedexpression of Olig2 alone cannot effectively repress the expressionof Irx3 and Dbx1 in our study may thus appear contradictory to theaforementioned misexpression studies. Interestingly, in the mis-expression experiments, the efficacy of Olig2 in repressing Dbx1and Irx3 appears to gradually decrease in more dorsal domains ofthe spinal cord (Novitch et al., 2001), suggesting that in vivo,Olig2 needs to cooperate with another signal(s) in effectivelyrepressing dorsal class I transcription factors. This additional signalis likely SHH as we show here that only in the presence of SHH,Olig2 completely abolishes the transcription of Irx3 and Dbx1whereas Olig2 alone has little effect in repressing their expression(Fig. 3).

Fig. 6. Astrocyte differentiation fromOlig2 over-expressing ES cells. ES cell aggregates were dissociated at Day 12 to differentiate into astrocytes. Fewer GFAP+

astrocytes were generated from ES-muOlig2 cells under Dox induced condition (B) than under uninduced condition (A). After treatment with CNTF, ES-muOlig2 cells generated similar GFAP+ astrocytes (C, D). Scale bar=50 μm. Blue=Hoechst stained nuclei. (E) Quantification of astrocytes under differentconditions.

377Z.-W. Du et al. / Mol. Cell. Neurosci. 33 (2006) 371–380

Another reason is the inability of Olig2 alone to induce theexpression of proneural gene Ngn2 during neurogenesis. Theexpression of Ngn2 is a prerequisite step for neural precursors tobe specified to motoneurons. Olig2 is reported to promote theexpression of Ngn2 and act cooperatively to direct cell cycle exit andmotoneuron gene expression (Novitch et al., 2001). We have foundhere that induced expression of Olig2 does not directly result inNgn2 transcription. On the contrary, Olig2 expression down-regulates Ngn2 expression induced by RA (Fig. 3B). Thedependence of Ngn2 on SHH is further demonstrated by the findingthat cyclopamine almost completely blocks the expression of Ngn2in both conditions. These observations suggest that Olig2 needs tocooperate with Ngn2, which are both induced by SHH and/or RA, inorder for theOlig2+ precursor cells to be specified into motoneurons.Additionally, we noticed the co-expression of Olig2 and HB9 in theOlig2 induced group at Day6 (Fig. 2B), which may interfere withpostmitotic motoneuron differentiation. Lee et al. have reported thatthe overexpression of Olig2 interferes with the proper generation ofHB9+ postmitotic motoneurons in pMN domain, whereas inducesmotor neurons ectopically in the V2 domain (Lee et al., 2005). It ispossible that induced expression of Olig2 in our system promotes thegeneration of some HB9+ motoneurons but at the same timerepresses the generation of others, as most of the HB9+ cells lost the

expression of Olig2 when culturing further two days (data notshown). Together, our in vitro observations provide direct evidencethat Olig2 needs the continuous presence of SHH to repress class Igene transcription to establish the pMN domain and to promoteneurogenic gene expression for progression to the neurogenic state,thus extending previous in vivo findings.

The continued presence of SHH has been suggested to sustainthe Olig2-expressing progenitors to the oligodendrogenesis stage(Pringle et al., 1996), and inhibition of SHH signalling can inhibitoligodendrogenesis both in vivo and in vitro (Orentas et al., 1999;Alberta et al., 2001). Consistent with this, induced expression ofOlig2 promotes the induction of oligodendrocyte progenitors at thegliogenesis stage. Addition of cyclopamine does not inhibit thegeneration of oligodendrocyte progenitors with Dox treatment inES-Olig2 cells, indicating that induced expression of Olig2bypasses the requirement of SHH for oligodendrocyte specifica-tion. This suggests that the main role of SHH signalling is tomaintain Olig2 expression in progenitors until the oligodendrogen-esis stage and Olig2 progenitors can then autonomously differ-entiate into oligodendrocyte progenitors at a later stage withoutSHH signalling. This is further supported by the observation thatcontinued presence of SHH results in similar level of oligoden-drocyte production under both uninduced and induced condition.

378 Z.-W. Du et al. / Mol. Cell. Neurosci. 33 (2006) 371–380

Our interpretation however does not exclude the possibility thatFGF2 might play a role in maintaining Olig2 progenitors, as FGF2is required to support the survival and proliferation of neuralprogenitors in our serum-free cultures. Recent studies show that theoligodendrogenesis can occur in the dorsal spinal cord in vivo (Caiet al., 2005; Vallstedt et al., 2005) or through FGF signaling invitro (Gabay et al., 2003; Chandran et al., 2003; Kessaris et al.,2004), via induction of Olig2 but independent of SHH signalling.Nevertheless, the same FGF2 treatment under uninduced conditiondoes not lead to a significant population of oligodendrocyte.

The increase in oligodendrocyte differentiation by Olig2 expres-sion is partly attributed to the inhibition of astrocyte by Olig2 sinceGFAP+ astrocytes are largely wiped out under Dox induced conditionin ES-Olig2 cell cultures. The few astrocytes that are present in thedifferentiation cultures do not possess Olig2, indicating the mutualexclusion ofOlig2 and astrocyte specification. Treatment with CNTFresults in astrocyte differentiation with the concomitant exclusion ofOlig2 from the nuclei. This finding coincides with a recent report thatCNTF may export Olig2 from the nucleus into the cytoplasm, thusabolishing the function of Olig2 and promoting astrocyte differentia-tion (Setoguchi andKondo, 2004). CNTF activates STAT3 and allowsit to form a complex with p300, which is essential for GFAPexpression and astrocyte differentiation. Olig2 can compete withSTAT3 for binding to p300 (Fukuda et al., 2004). Thus, thedetermination between oligodendrocytes and astrocytes is dependenton the balance of Olig2 and STAT3. Under oligodendrocytedifferentiation condition, Olig2 overrides the STAT3 to repressastrocytes. On the contrary, STAT3 overrides Olig2 to promote theGFAP expression and astrocyte differentiation with CNTF treatment.Our present study indicates that a simple increase in Olig2 cannotoverride the effect of CNTF in astrocyte differentiation as even themutantOlig2, which loses the nuclear export signal andwas sustainedin the nucleic of astrocyte, cannot block the effect of CNTF.

The present study indicates that most of the molecular events inearly neural cell lineage specification, learned from the classical invivo embryo models, can be faithfully replicated in our in vitro stemcell differentiation model. More importantly, this in vitro modeloffers a controllable as well as simple and reproducible environmentto dissect out cause–effect interactions between extrinsic factors and

Table 1List of primers used in the RT-PCR

Gene name Primer sequence

GAPDH ACCACAGTCCATGCCATCAC TCCACCOlig2 TCATCTTCCTCCAGCACCTC CCGTAGHb9 GTACCTGTCTCGACCCAAGC TCAGCIsl1 GACTGAGAGAGGGTCTCCAGCTC AGLhx3 AGGCTCTGGACCGACATTGG TCTCGSHH GGAACTCACCCCCAATTACA GAAGGGli2 GCCTGAGCCTTTGCCTTCAC ATGTTGGli3 TGTCCGTGGCACCAAATGAG GATGGPax6 AGTTCTTCGCAACCTGGCTA TGAAGCNkx6.1 ACACGGCATCAACGACATCC TCTCCANkx2.2 CTCTTCTCCAAAGCGCAGAC AACAAIrx3 CCCCGCCTTCTACCCCTATG TGTCCTDbx1 TTTGGGGTGAATGCCATGC GTGGGANgn2 AGAAGACCCGCAGGCTCAAG CGTGGMash1 CGTCCTCTCCGGAACTGAT TCCTGCTSox9 TGACCAATACTTGCCACCCAAC TCCGSox10 GCTGCTGCTATTCAGGCTCACTAC GTOlig1 AAGGAGGACATTTCCAGACTTC GCT

transcription factors that lead to cellular outcomes, thus comple-menting the traditional in vivo models. In some cases such as inhumans, in vitro model will be the primary tool. We have recentlyshown that fundamental cellular and molecular events of neuroec-toderm and neuronal subtype specification can be replicated usinghuman ES cells although we do find unique aspects relating tohuman primates (Zhang, 2006; Li et al., 2005; Yan et al., 2005).These in vitro stem cell models will likely play an increasing role inour understanding of molecular events during development. Thesemodels will in turn facilitate the production of functional cell typesfor biotechnological and possibly clinical applications.

Experimental methods

ES cell culture and transfection

The Ainv15 ES cell line (SCRC-1029, ATCC, Manassas, VA) wasmaintained in an undifferentiated state on 0.1% gelatin-coated flasks in theES cell growth medium that consisted of DMEM/F12, 15% knockout serumreplacement, 1× non-essential amino acids, sodium pyruvate (1 mM), sodiumbicarbonate (0.075%), L-glutamine (292 mg/ml), 2-mercaptoethanol(0.1 mM) and human recombinant leukemia inhibitory factor (LIF, 1000units/ml) (all reagents from Gibco, Rockville, MD). Mouse Olig2 wasmutated to lose nuclear export signal as described (Setoguchi and Kondo,2004). Wild type and mutant Olig2 cDNA were inserted into Tet-inducibleplasmid pLox (Fig. 1A), and were co-transfected with pSALK-Cre into EScell line Ainv15 by electroporation (800 v, 3 μF) withGene Pulser Xcell (Bio-rad, Hercules, CA). Stable transfectants were isolated by selection withneomycin (G418, 250 μg/ml) and were confirmed for the integration by PCRwith primer LoxinF 5′-cta gat ctc gaa gga tct gga g-3′, LoxinR 5′-ata ctt tct cggcag gag ca-3′.

Neural differentiation from ES cells

Exponentially growing ES cells were trypsinized and 1×106 cells wereplated onto 10-cm Petri dishes (Fisher, Hampton, NH) in suspension culturein a neural differentiation medium containing DMEM/F12, 1× N2supplement, L-glutamine (292 mg/ml), 2-mercaptoethanol (0.1 mM) and10% knockout serum replacement. Under this condition for 2 days, ES cellsformed small cell aggregates. Retinoic acid (RA, 0.5 μM, Sigma, St. Louis,MO) was then added to the culture to promote neural differentiation and tocaudalize neural precursor cells. For motoneuron differentiation, the cell

Product size (bp)

ACCCTGTTGCTGTA 450ATCTCGCTCACCAG 305TCCTCTTCCGTCTTC 426CAAGAACGACTTCGTGATG 187CTGCTTGGCTGTTTC 322TGAGGAAGTAGCTGT 502CTGATGCCCGCAG 237CTGGCTGCTGTTGTC 235TGCTGCTGATAGGA 500GGGCGAAGATTTGC 213CCGTGGTAAGGATCG 194CCTCCTCTCCCTGC 378AGGGTCTGCTCTCG 443AGTTGGAGGATGACG 399TCCAAAGTCCATT 482TCTTGATGTGCGTTCG 312TGGACATTACCTCGTGGCTG 267CTAAACAGGTGGGATTCATC 154

Table 2List of primers used in the real-time PCR

Gene name Primer sequence Product size (bp)

GAPDH ATGACATCAAGAAGGTGGTG CATACCAGGAAATGAGCTTG 177Ngn2 AACTCCACGTCCCCATACAG GAGGCGCATAACGATGCTTCT 103Irx3 AATTCCCCGCTTGGACCAAC TACAGCGATCTGTTCCACTCT 186Dbx1 CTATTTCCCAGCTTCCTCCA GCTTCTGGAACGTCTTCTCC 149Sox10 ACACCTTGGGACACGGTTTTC TAGGTCTTGTTCCTCGGCCAT 165

379Z.-W. Du et al. / Mol. Cell. Neurosci. 33 (2006) 371–380

aggregates were cultured in the presence of RA for 4 days. In some groups,recombinant SHH-N (1 μg/ml, R&D systems, Minneapolis, MN) orcyclopamine (5 μM, BIOMOL, Plymouth Meeting, PA) was added togetherwith RA. For oligodendrocyte and astrocyte differentiation, the aggregateswere cultured in suspension in the neural differentiation medium withoutknockout serum replacement but with FGF2 (20 ng/ml, R&D systems) andheparin (2 μg/ml, Sigma) for another 6 days. The cell aggregates weremechanically dissociated into small aggregates with a Pasteur pipette whennecessary. On Day 12, the differentiated aggregates were dissociated withtrypsin, and 2×104 cells were plated onto poly-ornithine (10 μg/ml; Sigma)and laminin-coated (10 μg/ml; Sigma) glass coverslips in a modifiedBottenstein-Sato medium. The modified Bottenstein-Sato medium containedinsulin (10 μg/ml), human transferin (100 μg/ml), BSA (100 μg/ml),progesterone (60 ng/ml), sodium selenite (40 ng/ml), N-acetyl-cysteine(60 μg/ml), putrescine (16 μg/ml), biotin (10 ng/ml) and cAMP (5 μM) (allreagents from Sigma). PDGF-AA (10 ng/ml, R&D systems), T3 (40 ng/ml,Sigma) andNT3 (5 ng/ml, Peprotech, RockyHill, NJ) were added to promotethe differentiation of oligodendrocytes. The coverslip cultures were fed everyother day for 6 days. In some groups, recombinant SHH-N (300 ng/ml, R&Dsystems) or cyclopamine (5 μM, BIOMOL) was added during suspensionculture, and CNTF (25 ng/ml, R&D systems) was added to promote astrocytedifferentiation. To induce the ectopic expression of Olig2, Doxycycline(Dox, 2 μg/ml, Clontech) was added to the medium.

Immunocytochemistry

Coverslip cultures were fixed in 4% paraformaldehyde in PBS for15 min at room temperature. For staining of NG2 and O4, living cells werestained with the primary antibodies for 15 min before fixation. For stainingof PDGFRα, cells were fixed in methanol at −20°C. For staining ofmotoneurons in cell aggregates, aggregates were fixed in 4% paraformal-dehyde in PBS for 2 h. Cryostat sections of 10-μm thickness were cut andmounted on superfrost plus microscope slides (Fisher). After washing withPBS, cells were incubated for 30 min in 10% normal goat serum to blocknon-specific antibody binding. They were then incubated for 1 h in theprimary antibody, washed in PBS and incubated for 1 h in Alexa Fluor 488or Alexa Fluor 594 second antibodies (1:1000, Molecular Probes, Eugene,OR) and for 5 min in bisbenzamide (5 ng/ml; Hoescht No. 33342; Sigma).Coverslips were mounted in GelTol aqueous mounting medium (Immuno-tech, Marseille, France) and examined with a Nikon Eclipse E600fluorescence microscope (Nikon, Tokyo, Japan). The following primaryantibodies were used: anti-nestin (mIgG 1:200, Chemicon, Temecula, CA),anti-Olig2 (rabbit IgG 1:4000, gift from Prof. M. Nakafuku or goat IgG1:300, Santa Cruz Biotechnology, Santa Cruz, CA), anti-βIII-tubulin (TuJ1,mIgG 1:500, Sigma), anti-GFAP (mIgG 1:500, Chemicon), anti-NG2(rabbit IgG 1:400, Chemicon), anti-HB9 (mIgG 1:50, DSHB, Iowa City,IA) and anti-PDGFRα (rat IgG 1:200, BD Biosciences, San Jose, CA).

Quantification of neural cell types was performed by averaging countsfrom three random fields per coverslip usingMetamorph software (UniversalImaging Corporation, Downingtown, PA). At least three coverslips werecounted for every group. The experiments were repeated three times.

RT-PCR and real-time PCR analysis

Cells were harvested at different differentiation stages. Total RNA wasextracted using Trizol reagent (Invitrogen, Carlsbad, CA) and treated with

DNA-free® (Ambion, Austin, TX) to remove potential contamination ofgenomic DNA. cDNAs were synthesized using random hexamer and firststrand cDNA synthesis kit (Invitrogen) according the supplier’s protocoland were used as templates for the PCR reaction. PCR was carried out in a12-μl reaction mixture by using 2× PCR mix (Promega, Madison, WI). Theconcentration of the cDNA was adjusted to the same level among samplesby amplifying a housekeeping gene G3PDH as a control. Table 1 lists thesequences of all the PCR primers and the sizes of PCR products used in theexperiments.

Real-time PCR was performed on the Bio-Rad MyiQ real-time PCRdetection system. The reaction was conducted under the followingcondition: 95°C hold for 3 min, and 40 cycles of 95°C for 15 s and 55°Chold for 30 s and 72°C hold for 30 s. The PCR efficiency and specificitywere validated with every pair of gene primers. Relative quantification ofgene expression between multiple samples was achieved by normalizationagainst G3PDH gene using the ΔΔCT method of quantification. Foldchanges were calculated as 2−ΔΔCT, and the RA only treatment without Doxinduced condition was set as control (fold change=1). Primers used in real-time PCR are listed in the Table 2. G3PDH primer was designed byTeresa His at Harvard Center for Neurodegeneration and Repair, Irx3,Ngn2 and Dbx1 primers were designed by PrimerBank (Wang and Seed,2003).

Acknowledgments

We thank Prof. Masato Nakafuku for mouse Olig2 cDNA andantibody, Prof. Michael Kyba for tet-inducible plasmids pLox andpSALK-Cre. This study is supported by the Myelin Project, NIH/NINDS (R01 NS45926), National Multiple Sclerosis Societyand partly by a core grant to the Waisman Center from theNational Institute of Child Health and Human Development(P30 HD03352).

References

Alberta, J.A., Park, S.K., Mora, J., Yuk, D.I., Pawlitzky, I., Iannarelli, P.,Vartanian, T., Stiles, C.D., Rowitch, D.H., 2001. Sonic hedgehog isrequired during an early phase of oligodendrocyte development inmammalian brain. Mol. Cell. Neurosci. 18, 434–441.

Anderson, D.J., Choi, G., Zhou, Q., 2002. Olig genes and the geneticlogic of CNS neural cell fate determination. Clin. Neurosci. Res. 2,17–28.

Bain, G., Kitchens, D., Yao, M., Huettner, J.E., Gottlieb, D.I., 1995.Embryonic stem-cells express neuronal properties in-vitro. Dev. Biol.168, 342–357.

Billon, N., Jolicoeur, C., Ying, Q.L., Smith, A., Raff, M., 2002. Normaltiming of oligodendrocyte development from genetically engineered,lineage-selectable mouse ES cells. J. Cell Sci. 115, 3657–3665.

Briscoe, J., Pierani, A., Jessell, T.M., Ericson, J., 2000. A homeodomainprotein code specifies progenitor cell identity and neuronal fate in theventral neural tube. Cell 101, 435–445.

Cai, J., Qi, Y., Hu, X., Tan, M., Liu, Z., Zhang, J., Li, Q., Sander, M., Qiu,M., 2005. Generation of oligodendrocyte precursor cells from mouse

380 Z.-W. Du et al. / Mol. Cell. Neurosci. 33 (2006) 371–380

dorsal spinal cord independent of nkx6 regulation and shh signaling.Neuron 45, 41–53.

Chandran, S., Kato, H., Gerreli, D., Compston, A., Svendsen, C.N., Allen,N.D., 2003. FGF-dependent generation of oligodendrocytes by ahedgehog-independent pathway. Development 130, 6599–6609.

Edlund, T., Jessell, T.M., 1999. Progression from extrinsic to intrinsicsignaling in cell fate specification: a view from the nervous system. Cell96, 211–224.

Ericson, J., Morton, S., Kawakami, A., Roelink, H., Jessell, T.M., 1996. Twocritical periods of Sonic Hedgehog signaling required for the speci-fication of motor neuron identify. Cell 87, 661–673.

Fu, H., Qi, Y.C., Tan, M., Cai, J., Takebayashi, H., Nakafuku, M.,Richardson, W., Qiu, M.S., 2002. Dual origin of spinal oligodendrocyteprogenitors and evidence for the cooperative role of Olig2 and Nkx2.2 inthe control of oligodendrocyte differentiation. Development 129,681–693.

Fukuda, S., Kondo, T., Takebayashi, H., Taga, T., 2004. Negative regulatoryeffect of an oligodendrocytic bHLH factor OLIG2 on the astrocyticdifferentiation pathway. Cell Death Differ. 11, 196–202.

Gabay, L., Lowell, S., Rubin, L.L., Anderson, D.J., 2003. Deregulation ofdorsoventral patterning by FGF confers trilineage differentiation capa-city on CNS stem cells in vitro. Neuron 40, 485–499.

Gage, F.H., 1998. Discussion point-Stem cells of the central nervous system.Curr. Opin. Neurobiol. 8, 671–676.

Jessell, T.M., 2000. Neuronal specification in the spinal cord: Inductivesignals and transcriptional codes. Nat. Rev., Genet. 1, 20–29.

Kessaris, N., Jamen, F., Rubin, L.L., Richardson, W.D., 2004. Cooperationbetween sonic hedgehog and fibroblast growth factor/MAPKsignalling pathways in neocortical precursors. Development 131,1289–1298.

Kyba, M., Perlingeiro, R.C.R., Daley, G.Q., 2002. HoxB4 confers definitivelymphoid-myeloid engraftment potential on embryonic stem cell andyolk sac hematopoietic progenitors. Cell 109, 29–37.

Lee, S.K., Lee, B., Ruiz, E.C., Pfaff, S.L., 2005. Olig2 and Ngn2 function inopposition to modulate gene expression in motor neuron progenitorcells. Genes Dev. 19, 282–294.

Li, X.J., Du, Z.W., Zarnowska, E.D., Pankratz, M., Hansen, L.O., Pearce,R.A., Zhang, S.C., 2005. Specification of motoneurons from humanembryonic stem cells. Nat. Biotechnol. 23, 215–221.

Liu, R.G., Cai, J., Hu, X.M., Tan, M., Qi, Y.C., German, M., Rubenstein, J.,Sander, M., Qiu, M.S., 2003. Region-specific and stage-dependentregulation of Olig gene expression and oligodendrogenesis by Nkx6.1homeodomain transcription factor. Development 130, 6221–6231.

Lu, Q.R., Yuk, D.I., Alberta, J.A., Zhu, Z.M., Pawlitzky, I., Chan, J.,McMahon, A.P., Stiles, C.D., Rowitch, D.H., 2000. Sonic hedgehog-regulated oligodendrocyte lineage genes encoding bHLH proteins in themammalian central nervous system. Neuron 25, 317–329.

Lu, Q.R., Sun, T., Zhu, Z.M., Ma, N., Garcia, M., Stiles, C.D., Rowitch,D.H., 2002. Common developmental requirement for Olig func-tion indicates a motor neuron/oligodendrocyte connection. Cell 109,75–86.

Mizuguchi, R., Sugimori, M., Takebayashi, H., Kosako, H., Nagao, M.,Yoshida, S., Nabeshima, Y., Shimamura, K., Nakafuku, M., 2001.

Combinatorial roles of Olig2 and Neurogenin2 in the coordinatedinduction of pan-neuronal and subtype-specific properties of motoneur-ons. Neuron 31, 757–771.

Novitch, B.G., Chen, A.I., Jessell, T.M., 2001. Coordinate regulation ofmotor neuron subtype identity and pan-neuronal properties by the bHLHrepressor Olig2. Neuron 31, 773–789.

Orentas, D.M., Hayes, J.E., Dyer, K.L., Miller, R.H., 1999. Sonic hedgehogsignaling is required during the appearance of spinal cord oligodendro-cyte precursors. Development 126, 2419–2429.

Pringle, N.P., Yu, W.P., Guthrie, S., Roelink, H., Lumsden, A., Peterson,A.C., Richardson, W.D., 1996. Determination of neuroepithelial cellfate: induction of the oligodendrocyte lineage by ventral midline cellsand sonic hedgehog. Dev. Biol. 177, 30–42.

Rowitch, D.H., 2004. Glial specification in the vertebrate neural tube. Nat.Rev., Neurosci. 5, 409–419.

Samanta, J., Kessler, J.A., 2004. Interactions between ID and OLIG proteinsmediate the inhibitory effects of BMP4 on oligodendroglial differenti-ation. Development 131, 4131–4142.

Setoguchi, T., Kondo, T., 2004. Nuclear export of OLIG2 in neural stemcells is essential for ciliary neurotrophic factor-induced astrocytedifferentiation. J. Cell Biol. 166, 963–968.

Takebayashi, H., Yoshida, S., Sugimori, M., Kosako, H., Kominami, R.,Nakafuku, M., Nabeshima, Y., 2000. Dynamic expression of basichelix–loop–helix Olig family members: implication of Olig2 in neuronand oligodendrocyte differentiation and identification of a new member,Olig3. Mech. Dev. 99, 143–148.

Takebayashi, H., Nabeshima, Y., Yoshida, S., Chisaka, O., Ikenaka, K.,Nabeshima, Y., 2002. The basic helix–loop–helix factor Olig2 isessential for the development of motoneuron and oligodendrocytelineages. Curr. Biol. 12, 1157–1163.

Vallstedt, A., Klos, J.M., Ericson, J., 2005. Multiple dorsoventral origins ofoligodendrocyte generation in the spinal cord and hindbrain. Neuron 45,55–67.

Wang, X.W., Seed, B., 2003. A PCR primer bank for quantitative geneexpression analysis. Nucleic Acids 31.

Wichterle, H., Lieberam, I., Porter, J.A., Jessell, T.M., 2002. Directeddifferentiation of embryonic stem cells into motor neurons. Cell 110,385–397.

Yan, Y.P., Yang, D.L., Zarnowska, E.D., Du, Z.W., Werbel, B., Valliere, C.,Pearce, R.A., Thomson, J.A., Zhang, S.C., 2005. Directed differentiationof dopaminergic neuronal subtypes from human embryonic stem cells.Stem Cells 23, 781–790.

Zhang, S.C., 2006. Neural subtype specification from embryonic stem cells.Brain Pathol. 16, 132–142.

Zhou, Q., Anderson, D.J., 2002. The bHLH transcription factors OLIG2 andOLIG1 couple neuronal and glial subtype specification. Cell 109,61–73.

Zhou, Q., Wang, S.L., Anderson, D.J., 2000. Identification of a novel familyof oligodendrocyte lineage-specific basic helix–loop–helix transcriptionfactors. Neuron 25, 331–343.

Zhou, Q., Choi, G., Anderson, D.J., 2001. The bHLH transcription factorOlig2 promotes oligodendrocyte differentiation in collaboration withNkx2.2. Neuron 31, 791–807.