proteinsSTRUCTURE O FUNCTION O BIOINFORMATICS

Huntingtin interacting protein HYPK isintrinsically unstructuredSwasti Raychaudhuri,1 Pritha Majumder,1 Somosree Sarkar,1 Kalyan Giri,2

Debashis Mukhopadhyay,3 and Nitai P. Bhattacharyya1*1 Crystallography and Molecular Biology Division, Saha Institute of Nuclear Physics, 1/AF Bidhan Nagar,

Kolkata 700 064, India

2 Chemical Sciences Division, Saha Institute of Nuclear Physics, 1/AF Bidhan Nagar, Kolkata 700 064, India

3 Structural Genomics Section, Saha Institute of Nuclear Physics, 1/AF Bidhan Nagar, Kolkata 700 064, India

INTRODUCTION

Huntington’s disease (HD), an autosomal dominant neurodegenera-

tive disorder, is characterized by loss of striatal neurons and caused by

the expansion of normally polymorphic CAG repeats in the exon1 of

the gene huntingtin (htt) beyond 36. htt codes for a �350 kDa protein

with unknown function.1 Expansion of glutamine (Q) repeats in the

pathogenic range in Htt protein results in conformational changes lead-

ing to aggregate formation in the cytoplasm and nucleus of HD patients’

brain. Similar aggregation has also been observed in cellular and animal

models of HD. Such aggregation is thought to result in increased neuro-

nal death as observed in HD.2–5 However, it is not yet clear whether

these aggregates are the cause or the consequence of the pathogenic pro-

cess.6–7 It is also reported that loss of normal Htt function may also

lead to HD pathogenesis.8–10

To date, it is known that Htt interacts with more than 200 proteins,

most of which have been identified by yeast two-hybrid (Y2H) assays,

coimmunoprecipitation studies or by analysis of proteins associated with

Htt-aggregates and yielded information about the function of Htt.11–14

These interactors are involved in vesicular transport, cytoskeletal organi-

zation, postsynaptic signaling, transcription, and anti-apoptotic proc-

esses.11–14 A comprehensive analysis of 46 experimentally characterized

Htt-interacting partners reveals that about 44% of them are involved in

transcription, 18% in trafficking and endocytosis, 26% in signaling, and

11% in metabolic processes.11 Identification and characterization of

these Htt-interacting proteins and their biological roles are expected to

throw light on the pathogenesis of HD.15,16 In view of the possible im-

portance of Htt interactors in the disease pathology, characterization of

these interactors is necessary.

In an Y2H study, thirteen proteins have been identified as Htt interac-

tor, using amino terminal portion of Htt (coded by the exon1 of the

gene htt) as the bait and are named as huntingtin yeast-two hybrid pro-

The Supplementary Material referred to in this article can be found online at http://www.interscience.

wiley.com/jpages/0887-3585/suppmat/

*Correspondence to: Nitai P. Bhattacharyya, Crystallography and Molecular Biology Division, Saha

Institute of Nuclear Physics, 1/AF Bidhan Nagar, Kolkata 700 064, India. E-mail: nitai_sinp@yahoo.com or

nitaipada.bhattacharya@saha.ac.in

Received 3 July 2007; Revised 1 October 2007; Accepted 9 October 2007

Published online 12 December 2007 in Wiley InterScience (www.interscience.wiley.com).

DOI: 10.1002/prot.21856

ABSTRACT

To characterize HYPK, originally identified as

a novel huntingtin (Htt) interacting partner

by yeast two hybrid assay, we used various

biophysical and biochemical techniques. The

molecular weight of the protein, determined

by gel electrophoresis, was found to be about

1.3-folds (�22 kDa) higher than that ob-

tained from mass spectrometric analysis (16.9

kDa). In size exclusion chromatography

experiment, HYPK was eluted in three frac-

tions, the hydrodynamic radii for which were

calculated to be �1.5-folds (23.06 A) higher

than that expected for globular proteins of

equivalent mass (17.3 A). The protein exhib-

ited predominantly (63%) random coil char-

acteristics in circular dichroism spectroscopy

and was highly sensitive to limited proteolysis

by trypsin and papain, indicating absence of

any specific domain. Experimental evidences

with theoretical analyses of amino acids com-

position of HYPK and comparison with avail-

able published data predicts that HYPK is an

intrinsically unstructured protein (IUP) with

premolten globule like conformation. In pres-

ence of increasing concentration of Ca21,

HYPK showed conformational alterations as

well as concomitant reduction of hydrody-

namic radius. Even though any link between

the natively unfolded nature of HYPK, its

conformational sensitivity towards Ca21 and

interaction with Htt is yet to be established,

its possible involvement in Huntington’s dis-

ease pathogenesis is discussed.

Proteins 2008; 71:1686–1698.VVC 2007 Wiley-Liss, Inc.

Key words: Huntington’s disease; protein

interaction; pre-molten globule; HYPK; IUP.

1686 PROTEINS VVC 2007 WILEY-LISS, INC.

teins (HYP).17 Among these, HYPG is involved in pro-

tein turnover, HYPJ and HYPF have roles in protein traf-

ficking and degradation, HYPA and HYPI are involved in

mRNA splicing and tight junction function respec-

tively17,18; HYPB acts as a DNA-binding factor,19 HYPC

is a putative splicosome protein,20 HYPL is involved in cel-

lular morphogenesis, membrane trafficking, and vesicular

trafficking,18 HYPH is a palmitoyl transferase involved in

palmitoylation and trafficking of multiple neuronal pro-

teins,21 and remaining four members, namely HYPK,

HYPD, HYPE, and HYPM, are not yet characterized.

HYPK, neither shares any sequence homology with any

protein of known sequence/structure in the databases,

nor shows any functional similarity, indicating that it is a

novel ‘‘hypothetical protein.’’ In this present communica-

tion, we provided experimental evidences that HYPK is a

new member of the family of intrinsically unstructured

proteins (IUP). In view of recent reports of involvement

of increasing number of IUP’s in complex disorders,22,23

the possible role of this protein in HD pathology is

discussed.

MATERIALS AND METHODS

Cloning, expression, and purification ofHYPK

Gene specific primers (Forward: 50 ACGCGTCGAC

GTCGTGGTGAAATAGATATG 30 and the Reverse: 50

CGGGATCCCGTCAGTTGGTTAGGGCAATAA 30) for

HYPK with adaptors (underlined) for the restriction

enzymes (RE) SalI and BamH1 were synthesized

(MWG Biotech). These primers amplify the cDNA

(NM_016400). Total RNA was isolated from leukemic

cell line P3HR1 using standard methods. The first

strand cDNA was synthesized using oligo dT primers

and reverse transcriptase (Ivitrogen) and amplified

using the above primers. RT-PCR product (380 bp)

was purified from 1.5% agarose gel, digested with SalI

and BamH1 (Promega) and ligated with pPROTETC2

vector (BD Biosciences) containing 6HN tag digested

with the same REs, and then transformed into compe-

tent Escherichia coli strain DH5a. Plasmid DNA was

isolated from colonies and the inserted DNA was con-

firmed both by DNA sequencing and RE digestion. The

gene was further subcloned from pPROTET C2 to PET

28a1 vector (Novagen) using REs NcoI and NotI

(Promega) to obtain better expression. During this pro-

cess the 6HN tag from pPROTETC2 was kept intact

but 6His tag of PET 28a1 was removed. Both DNA

sequencing and restriction enzyme digestion of the

plasmid further confirmed the inserted DNA.

The PET 28a1 construct was transformed into bacte-

rial strain BL21DE3. Single colony was picked and trans-

ferred into 100 mL Luria Broth (LB) and grown for over-

night. One percent inoculum was seeded to 1 L LB broth

from the previous culture and grown at 378C until the

O.D600 reaches 0.6, when protein expression was induced

with 1 mM IPTG (Promega). Three hours after induc-

tion, cells were centrifuged at 10,000 rpm for 20 min.

Pellet was stored at 2808C. Next day the cell pellet was

thawed on ice and suspended in 25 mL ice-cold lysis

buffer (50 mM Tris-Cl pH 8, 300 mM NaCl, 1 mM

PMSF, 2 mM b-mercaptoethanol) and lysed by sonica-

tion on ice. Cell lysate was then centrifuged at 14,000

rpm for 30 min at 48C. The supernatant was collected

and the tagged HYPK was affinity purified through Ni-

NTA column (Qiagen), eluted with 250 mM imidazole

(Sigma Chemicals) and separated on a 15% SDS PAGE

to check the purity. To remove the affinity tag, affinity

purified protein was incubated with 1 unit of EKMax

(Invitrogen) on ice for 60 min and passed through Ni-

NTA column.

Mass spectrometry

Mass spectra of purified native HYPK was obtained by

using a MALDI-TOF-TOF mass spectrometer (ABI 4700,

Applied Biosystems). The m/z scale was calibrated using

a mixture of known protein samples as follows: Angio-

tensin (12.96 kDa), Glu-1-Fibrinopeptide (15.70 kDa),

ACTH(1–17) (20.93 kDa), ACTH(18–39) (24.65 kDa),

ACTH (7–38) (36.57 kDa) and DES-Arg-1-Bradykinin

(9.04 kDa) (Applied Biosystems). Samples were mixed

with a saturated solution of 2, 4, 6 trihydroxy acetophe-

none (THAP, Sigma Chemicals) in 50% acetonitrile con-

taining 0.1%(w/v) trifluoroacetic acid, spotted on the

mass plate, air-dried, and placed inside the instrument.

Spectra arising from 2500 laser shots were averaged with

a laser intensity of 4000. Appropriate baseline subtraction

and noise reduction was performed on the spectra.

Size-exclusion chromatography

The purified protein was loaded on a Superdex-200

20/300 GL column (Amersham Biosciences) and run on

AKTA purifier HPLC system (Amersham Biosciences)

with a flow rate 0.2 mL/min and eluted with elution

buffer (50 mM Tris-Cl pH 8, 300 mM NaCl, 1 mM

PMSF, 2 mM b-mercaptoethanol). In three separate

experiments 10 mg/mL (�600 lM), 13 mg/mL (�750

lM) and 28 mg/mL (�1600 lM) of protein was loaded

on the columns. The purity of the samples was analyzed

by SDS PAGE and Coomassie staining. The protein

standards used for the calibration of the Superdex col-

umns were ribonuclease A (13.7 kDa), chymotrypsinogen

A (25 kDa), ovalbumin (43 kDa), albumin (BSA, 67

kDa), and catalase (232 kDa).

Dynamic light scattering

Measurements were made with a DynaPro-MS/X (Pro-

tein Solutions) at 208C using �11 lL of 600 lM HYPK

HYPK is an Intrinsically Unstructured Protein

PROTEINS 1687

in gel filtration buffer. Relatively higher concentration of

the protein was used to avoid noise in data collection.

All samples were filtered with a 0.02 lm filter (Millipore)

prior to the measurements and the concentration of the

protein used for analysis was also prior optimized by

plotting SOS values measured against the corresponding

concentrations. The diffusion coefficients were obtained

from the analysis of the decay of the scattered intensity

auto correlated function. The hydrodynamic radius could

be deduced from the diffusion coefficient using the

Stoke’s-Einstein equation. Huge radii corresponding to

aggregate or instrumental noise were avoided for practi-

cal purposes. All calculations were performed using the

software Dynamics V6 provided by the manufacturer.

CD spectroscopy

Purified HYPK was dialyzed against 20 mM Tris-Cl pH

7.5 and CD spectra in the far-UV (190–250 nm) and

near-UV (230–350 nm) region were recorded on a Jasco

J-720 spectropolarimeter using cylindrical quartz cuvettes

of path length 1 and 10 mm respectively. �70 lM of

protein was used for each experiment. Each spectrum

represents the average of five successive scans performed

at a scan speed of 20 nm/min. Appropriate baseline sub-

traction and noise reduction analysis were performed.

Results are presented as molar ellipticity (Y):

H ¼ uobs=ð10 3 c 3 lÞ

where yobs is the measuredellipticity in millidegrees, c the

molar concentration of the protein, and l the path length

of the cells expressed in cm.

Fluorescence spectroscopy

Steady-state fluorescence measurements of purified

HYPK (dialyzed against 20 mM Tris-Cl pH 7.5) were

performed with SPEX FluoroMax-3 spectrofluorometer

(Horiba Jobin Yvon) using 10-mm path length quartz

cuvettes. Excitation and emission slits with a nominal

band pass of 5 nm were used for all measurements. Back-

ground intensities of the buffer were subtracted from

each sample spectrum to cancel out any contribution due

to the solvent Raman peak and other scattering artifacts.

Approximately 70 lM of protein was used for each

experiment.

Limited proteolysis

Limited proteolysis of purified HYPK was performed

with Trypsin (Promega, mass spectrometry grade) and

papain (Sigma). Ten microgram of purified HYPK was

digested with 50 ng of Trypsin and Papain for 5, 15, 30,

45, and 60 min respectively. Both the digestions were

performed at 378C. Digested samples were run on SDS

PAGE and stained with Coomassie blue. For Trypsin

digestion, bands were excised from the gel with a clean

scalpel, taken in a 0.6 mL tube and treated with the in-

gel tryptic digestion kit (Pierce) according to manufac-

turer’s protocol. The digestion mixture was then trans-

ferred to a new tube and vacuum dried in a vacuum

concentrator (DNA plus, Heto-Holten). The dried pepti-

des were redissolved in 50% acetonitrile containing 0.1%

(w/v) trifluoroacetic acid. Saturated solution of CHCA

(a-cyano-4-hydroxycinamic acid, Sigma) in 50% acetoni-

trile containing 0.1% (w/v) trifluoroacetic acid was used

as matrix. The samples were spotted on a MALDI plate,

air-dried, and inserted into the instrument. Spectra aris-

ing from 125 laser shots were averaged with a laser inten-

sity of 2000.

In vitro cross-linking of HYPK

Purified HYPK (�5 lg) was incubated with 0.5, 1, 2,

3, 4, 5, and 10 mM BS3 (Bis[sulfosuccinimidyl] suberate,

Pierce) at 378C for 60 min. Both denaturing and nonde-

naturing PAGE were run with the samples and silver

stained to visualize.

Native gel electrophoresis

Native PAGE with purified HYPK (�5 lg) was run at

48C with electrophoresis buffer containing 5 mM Tris base

and 38.4 mM Glycine, pH 8.3. Purified HYPK incubated

with 0.5, 1, 2, 3, 4, 5, and 6M guanidine hydrochloride for

1 h, 0.5, 1, 2, 3, 4, 5, and 10 mM CaCl2 for 1 h and 0.5, 1,

2, 3, 4, 5, and 10 mM BS3 for 1 h, were run.

Estimation of mean net charge (R) and meanhydrophobicity (H)

The mean net charge (R) of a protein is determined as

the absolute value of the difference between the numbers

of positively and negatively charged residues divided by

the total numbers of amino acid residues.24 The R-value

of HYPK was calculated using the program ‘‘ProtParam’’

at the ‘‘EXPASY’’ server (www.expasy.org/tools).25 The

mean hydrophobicity (H) is the sum of normalized hy-

drophobicity of individual residues divided by the total

number of amino acid residues minus four residues

(to take into account the fringe effects in the calculation of

hydrophobicity) and was determined using the ‘‘Protscale’’

program at the ‘‘EXPASY’’ server,25 selecting the option

‘‘Hphob/Kyte and Doolittle,’’ a window size of 5, and a

normalized scale from 0 to 1. HBoundary (Hb) was computed

as described by Uversky26 using the following formula

Hb ¼ R þ 1:15

2:785

Analysis of amino acid sequence of HYPK

Protein sequence of HYPK (NP_057484) was submit-

ted to the PONDR server (www.pondr.com) and analyses

S. Raychaudhuri et al.

1688 PROTEINS

were performed using the neural network predictor VL-

XT and CDF.27–29 (Access to PONDR1 was provided by

Molecular Kinetics, 6201 La Pas Trail-Ste 160, Indianapo-

lis, IN 46268; 317-280-8737; E-mail: main@molecularki-

netics.com). We also performed the sequence analysis

with FoldIndex30 and Composition Profiler.31

Effect of Ca21 concentration on HYPKconformation

To check any effect of Ca21 concentration on HYPK

conformation, �600 lM of HYPK was incubated with

0.5, 1, 2, 3, 4, 5, and 10 mM of CaCl2 over night at

room temperature. Next day the samples were centri-

fuged at 15,500 rpm for 30 min at room temperature

and the supernatants were thrown off. SDS PAGE load-

ing buffer was added to the tubes and were boiled at

808C for 20 min. Treated samples were run in a 15%

SDS PAGE and silver stained. DLS, CD, and fluores-

cence spectroscopic studies of HYPK (�600 lM for

DLS, �70 lM for CD and fluorescence studies) in pres-

ence of similar Ca21 concentrations were also done, as

described previously. Raleigh scattering of purified

HYPK (�70 lM) was also measured at similar Ca21

concentrations using 10-mm path length quartz cuv-

ettes in SPEX FluoroMax-3 spectrofluorometer. Samples

were excited at 500 nm and scattering data were

recorded at 503 nm. In case of fluorometric measure-

ment and scattering studies appropriate EGTA titration

was also performed.

RESULTS

Unusual movement of HYPK on SDSpolyacrylamide gel

Using the methods described in materials and meth-

ods, HYPK was cloned, expressed in the bacterial sys-

tem, and purified to homogeneity as shown in the Fig-

ure 1(A). The estimated molecular weights from SDS-

PAGE with the tag (6XHN) and after removal of the

tag were �22 and �20 kDa respectively [Fig. 1(A)].

However, the theoretical MW/pI was found to be

17056.72 Da/5.13 and 14665.4 Da/4.90 with and with-

out tags, respectively (http://www.expasy.org/cgi-bin/

protparam). To resolve the ambiguity of �1.3 times

higher estimated mass of HYPK in SDS PAGE with

respect to theoretical calculation, the MW of the puri-

fied HYPK with the tag was determined with MALDI

TOF mass spectrometry and was observed to be 16.9

kDa, which matches with the theoretically calculated

value [Supplementary Fig. 1(A)].

Figure 1Unusual behavior of HYPK in SDS PAGE and size-exclusion chromatographic column. (A) lane 1: HYPK with tag moves at �22 kDa (theoretical Mw. 16.9 kDa); lane 2

and 3: HYPK without tag (lower band) moves at �20 kDa (theoretical Mw. 14.6 kDa), where tag was removed by enterokinase digestion for 30 min and 60 min,

respectively. (B) Gel filtration profile of native (solid line, initial loading concentration 10 mg/mL) and guanidine hydrochloride denatured HYPK (dashed line). Native

HYPK elutes in three fractions (peaks 1, 2, and 3). Inset (i) shows corresponding SDS PAGE runs; lanes 1, 2, and 3 correspond to the three peak fractions, M is affinity

purified HYPK. Denatured HYPK elutes as single fraction (peak 4). Inset (ii) shows corresponding SDS PAGE runs, lane 4 being the peak 4 fraction, M as above. (C)

Dependence of hydrodynamic radii, RS, on protein molecular mass, MW; molten globule (hollow stars), pre-molten globule (hollow circles) and natively unfolded

random-coil rich proteins (black squares) are marked. The plot depicts that gel filtration separated fractions of HYPK (filled star and open star) fall in the pre-molten

globule like or molten globule like regions.

HYPK is an Intrinsically Unstructured Protein

PROTEINS 1689

Size exclusion chromatography

In view of its abnormal mobility in SDS-PAGE, size

exclusion chromatography was used to analyze the mo-

lecular nature of purified HYPK. In three separate experi-

ments purified protein at 10 mg/mL (�600 lM), 13 mg/

mL (�750 lM) and 28 mg/mL (�1600 lM) loading

concentrations were used. The chromatographic profile

of purified HYPK (10 mg/mL initial loading concentra-

tion) and SDS-PAGE profile of each fraction is shown in

the Figure 1(B). It was evident that HYPK had eluted in

three fractions in Superdex-200 20/300 GL column. How-

ever, SDS-PAGE analysis of each fraction exhibited the

same molecular size. Using standard proteins like ribonu-

clease A, ovalbumin, albumin (BSA), aldolase, and cata-

lase, the Stoke’s radius of HYPK was then determined.

The elution volume (Ve) was monitored by absorbance at

280 nm. Ve for a particular molecular species was then

converted to Kav by the following equation:

Kav ¼ Ve � V0

Vt � V0

where V0 is the exclusion volume, taken as the elution

volume of Dextran blue, and Vt is the total bed volume.

Stokes radius (RS) of HYPK was estimated according to

the method of Laurent and Killander32,33 using a linear

calibration plot of RS versus (2log Kav)1/2 obtained with

aforementioned standard globular proteins. Three values

of Stokes’ radii calculated for the three fractions are sum-

marized in Table 1. All the three values were higher than

those expected from globular proteins of similar masses.

This nonglobular nature of HYPK is commensurate with

the observation from SDS-PAGE analysis. The gel filtra-

tion profile suggested that HYPK might exist either in

three different oligomeric forms or alternative conforma-

tions in solution, the largest one being some kind of

soluble aggregate34 with an abnormally high RS and

MW. To test these possibilities, purified HYPK was incu-

bated with 6M guanidine hydrochloride for 6 h to dena-

ture the protein completely and the sample was passed

through the same column. Interestingly, in the denatured

condition, the protein was eluted predominantly as a sin-

gle fraction [Fig. 1(B)] with RS value of 36.7 A. A small

peak corresponding to the aggregate was also evident.

Notably, treatment of HYPK with increasing guanidine

hydrochloride concentrations, and separation through

native PAGE consistently showed three similar bands

with increasing mobility [Supplementary Fig. 2(A)].

While in SDS PAGE the electrophoretic mobility of pro-

teins depends primarily on their molecular mass, in

native PAGE the mobility is a function of the protein’s

charge and hydrodynamic size. In presence of increasing

concentration of BS3, a cross-linker, the same three

bands were present in native PAGE without there being

any oligomer formation as verified by SDS PAGE [Sup-

plementary Fig. 2(B,C)]. These observations preclude the

possibility of oligomerization of HYPK and suggest that

the different fractions obtained in the gel filtration chro-

matography were plausibly different conformers of the

protein of molten globule or premolten globule nature

[Fig. 1(C)]. When we increased the initial loading con-

centrations of protein for gel filtration experiments, the

elution pattern remains almost similar indicating non-

globular conformation of HYPK with large soluble aggre-

gates. Details of the results are shown in Supplementary

Table 1.

Conformational studies of HYPK withvarious spectroscopic techniques

Dynamic light scattering

The unfolding of a protein molecule results in an

essential increase in its hydrodynamic volume and can

also be investigated by DLS. Hydrodynamic radii of

HYPK from DLS analysis is shown in the Figure 2(B). It

is evident that there were two populations having differ-

ent conformations. The diffusion coefficients were calcu-

lated using the Stoke’s-Einstein equation and the hydro-

dynamic radii of HYPK were 11.8 nm (118 A) and 56.02

nm (560 A) respectively, indicating the presence of two

conformers with much larger hydrodynamic volume than

any globular proteins of similar mass [Fig. 2(B)].

Circular dichroism

The CD spectra of HYPK showed negative minima at

203 nm, indicating unorganized regions or random coils.

Also a slight negative ellipticity around 222 nm indicated

low contribution from a-helical regions [Fig. 2(A)]. The

relative fractions of three different types of secondary

structures (a-helix, b- sheet, and random coil) present in

the far-UV CD spectra of HYPK were calculated using an

in-house program that minimizes the mean-squared

deviation (i.e., v2) between each measured spectrum and

a linear combination of standard spectra representing the

three different secondary structures35,36 and yielded

20.5% a-helical, 16.2% b-sheet, and 63.3% random coil

distribution for HYPK. The near-UV CD spectra of

HYPK (data not shown) showed inconsistent behavior

from batch to batch and sometimes showed a small char-

Table IStoke’s Radii (RS) for the Three Fractions of HYPK, Eluted from Gel Filtration

Column, Were Estimated According to the Method of Laurent and Killander,

Using a Linear Calibration Plot of RS versus (2log Kav)½, Obtained with

Ribonuclease A, Ovalbumin, Albumin (BSA), Aldolase, and Catalase, as

Standards

Fraction Elution volume (mL) Stoke's radii (�)

1 15.725 23.062 14.5 30.023 8.904 103.4

S. Raychaudhuri et al.

1690 PROTEINS

acteristic maximum at �270 nm. There being no trypto-

phan present in HYPK, the spectral region between 260

and 285 nm can be attributed to tyrosine transitions.

Considering that the molar ellipticity maximum was not

too distinctive to correspond to a rigid domain, but as it

indicates the presence of the tyrosine residue in relatively

asymmetric environment, the spectral maximum might

represent some local association among secondary struc-

tural elements circumscribing the single tyrosine residue

present in HYPK. This is another indirect evidence of a

lack of tertiary structure. This kind of residual structure

in IUPs is not uncommon and it has been reported

in case of recombinant EWS-FLI1 Oncoprotein and

Caldesmon.37,38

Limited proteolysis

Proteins with less ordered structures are more suscepti-

ble to protease digestion than globular proteins. The

degree of globularity, which reflects the presence or ab-

sence of any ordered structure in a protein, can be moni-

tored by limited proteolysis.39 To test the sensitivity of

HYPK to proteolytic cleavages, HYPK was digested with

trypsin and papain in different timescales and separated

on SDS-PAGE. The result of a typical experiment is

shown in the Figure 3(A,B). It was observed that HYPK

was highly cleavable with both Trypsin and papain at

very low enzyme substrate ratio (1:200, by weight). With

increasing time of incubation, both the enzymes cleaved

the protein to their capacity, yielding the smallest frag-

ments possible with the respective enzymes. With trypsin,

the tryptic digestion resulted into a consistent band of

smaller size, which appeared to be a domain. The exact

mass of the fragment determined by MALDI TOF was

3621.3 Da [Supplementary Fig. 1(B)]. However, in silico

Trypsin digested products of HYPK by freely available

Figure 2Circular dichroism (CD) and DLS profile of native HYPK. (A) Far-UV CD spectrum shows intense negative minima at �203 nm indicating predominant contribution

from random coil components. (B) Calculated hydrodynamic radii of native HYPK from DLS studies represented by bars in terms of percentage mass. Two species with

radii 56.02 � 0.9 nm and 11.8 � 0.4 nm comprise of �60% mass fractions with the rest contributed by insoluble aggregates and system noise.

Figure 3Limited proteolysis of native HYPK. (A) HYPK cleaved with 50 ng Trypsin for

5, 15, 30, 45, and 60 min (lane 1, 2, 3, 4, and 5, respectively; lane 6 is the

uncut control) at 378C. (B) HYPK cleaved with 50 ng papain for 5, 15, 30, 45,

and 60 min (lane 2, 3, 4, 5, and 6, respectively; lane 1 is the uncut control) at

378C. Both the reactions were stopped by adding SDS-PAGE sample buffer

followed by 5 min boiling. No enzyme was added to the control tubes, but it

was also incubated for 60 min at 378C.

HYPK is an Intrinsically Unstructured Protein

PROTEINS 1691

software (Protein Prospector: http://prospector.ucsf.edu/

ucsfbin4.0/msdigest.cgi) revealed that this fragment was

actually a larger digested fragment with two missed clea-

vages at the N terminus and possibly was not any intact

domain of the protein that the protease could not pene-

trate.

Theoretical analysis of HYPK sequence

HYPK (NP_057484) shares no significant sequence

homology to previously reported genes/proteins. Analysis

was done by Expasy proteomics server (see Materials and

methods section). Several secondary structure prediction

tools also failed to yield any functional domains or

motifs for HYPK, despite some special features at the

primary structure level. The primary structure of HYPK

was found to have low mean scaled hydropathy (0.3933),

an endoplasmic reticulum (ER) retention (ER) signal

(92–95th residues), and high net charge at neutral pH

(absolute mean net charge 0.0698) and amino acid com-

position typical of an IUP [Fig. 4(A,B)].40 The protein

is significantly enriched in glutamate (15.89%), lysine

(6.62%), arginine (8.61%), and other charged amino

acids, and depleted in tryptophan, phenylalanine, and

cysteine like hydrophobic or order promoting residues

[Fig. 4(A)]. Both VL-XT and CDF (Cumulative distribu-

tion Function) analyses of PONDR (Predictors of natural

disordered regions) also confirmed a grossly unfolded na-

ture of HYPK [Fig. 4(C,D)] with about �15.5% of

folded region with two disordered regions (1st to 88th

Figure 4In silico analysis of HYPK sequence. (A) Distribution of order- and disorder-promoting amino acids. Amino acids corresponding to the left parenthesis are order

promoting residues, those under right parenthesis are disorder promoting residues and amino acids without any parenthesis (in the middle) are neutral. Distribution

shows deviation in amino acid composition of HYPK from the average values in the Swiss-Prot data base (as obtained from the World Wide Web at http://

www.expasy.org/sprot/relnotes/relstat.html). (B) Charge-hydrophobicity phase space separation between natively folded (solid square) and natively unfolded (open circle)

Proteins. HYPK (marked with a solid star) falls within natively unfolded space. (C) PONDR prediction of unstructured regions in HYPK with use of the VL-XT

predictor. The prediction score is plotted against residue number. The threshold is 0.5; residues with a higher score are considered disordered. (D) PONDR prediction of

unstructured regions in HYPK with use of the CDF predictor. CDF prediction of HYPK falls below the optimum boundary indicating unstructuredness. (E) Amino acid

sequence of HYPK (NP_057484). Amino acids in larger fonts are order promoting or neutral, amino acids in small fonts are disorder promoting. Amino acids

corresponding to endoplasmic reticulum retention signal are in italics and underlined.

S. Raychaudhuri et al.

1692 PROTEINS

and 97th to 117th amino acid residues). FoldIndex pre-

diction was also commensurate with PONDR VL-XT pre-

diction. According to FoldIndex, 1st to 98th amino acid

residues were predicted to be unstructured which in-

cluded 75.9% of the amino acid residues of the protein.

HYPK, being predicted to be disordered by both charge-

hydropathy and PONDR analyses, is likely to be in the

extended disorder class of IUPs.40 From the analysis of

amino acid composition of HYPK by Composition Pro-

filer, we found that the sequence is significantly enriched

with disorder promoting amino acids for example,

charged polar residues like Arg and Glu, exposed and

flexible residues and with those having high solvation

potential, frequently seen in a-helices. In addition, exten-

sive motif search revealed a putative nascent polypeptide

binding motif at the c-terminal (data not shown).

Effect of Ca21 on HYPK conformation

In HYPK an ER retention signal KEDL [Fig. 4(E)] is

seen near the C-terminus. Even though this kind of motif

is seen in many non-ER proteins, there is a weak hint

that HYPK may get localized in the ER at times. This

prompted us to study the effect of Ca21 on HYPK, in

case it gets localized in the ER, as the intra compartmen-

tal Ca21 concentration in ER is known to be vital for

several cellular processes, specifically in signaling.41,42

Additionally, in case of IUPs, similar metal induced con-

formational variations are known to be functionally im-

portant.43

HYPK was incubated over-night with different concen-

trations of CaCl2 followed by centrifugation at 15,500

rpm and the precipitates were analyzed by denaturing

gel electrophoresis and visualized by silver staining

[Fig. 5(G)]. Amounts of precipitates increased signifi-

cantly beyond 4 mM CaCl2. When native PAGE was run

with similarly treated samples except centrifugation, a

likewise increase in intensity of a high molecular weight

band was observed [Fig. 5(F)] indicative of soluble aggre-

gates. Similar effects could not be observed by other cati-

ons like Mg11 or K1. In the analyzed data of DLS stud-

ies, �3 and �1.5-fold decrease in RS with increasing con-

centration of Ca21 for the two conformers were observed

[Fig. 5(A)] and the protein precipitated around 4 mM

Ca21 as observed before. Likewise, in CD spectroscopy, a

reduction in both negative minima and ellipticity was

observed with increasing Ca21 concentration indicating a

loss of signal most possibly because of soluble aggregate

formation [Fig. 5(B)]. Additionally, analysis of CD spec-

tra revealed that there were conformational adjustments

by HYPK among different molten globule/premolten

globule forms in presence of different Ca21 concentra-

tions [Fig. 5(C)].26 Since HYPK is a Class A protein

(tryptophan free)44 with a single tyrosine, using the

intrinsic fluorescence as probe for conformational

changes, an initial structural induction at low Ca21 con-

centration was observed which eventually decreased at

higher Ca21 concentration along with visible aggregate

formation [Fig. 5(D)]. On the other hand, with Rayleigh

scattering Ca21 induced aggregate formation was

observed with increased concentration [Fig. 5(E)]. In

both the cases the formed aggregates could not be

reverted back to soluble state even with the addition of

high concentration of EGTA (10 mM) (data not shown).

DISCUSSION

The basic premise of this report is to characterize the

protein HYPK biophysically. All the apparently unusual

characteristics of HYPK indicate a natively unfolded na-

ture of the protein.

There could be multiple possible explanations for the

unusual movement of a protein in SDS-PAGE, as ob-

served in case of HYPK [Fig. 1(A)]. It could be either

due to strong oligomerization which could not be disso-

ciated even by boiling with SDS, or because of high con-

tent of negatively charged amino acids that reduces the

chance of binding of the detergent resulting in a reduc-

tion of overall negative charge. The most probable rea-

son, however, could be a nonglobular conformation of

the protein that does not resemble the fate of a globular

one in SDS-PAGE. The unusual movement could also be

because of a combination of all the three possibilities

mentioned above. In case of HYPK, the presence of

oligomers is ruled out because the single band at �22

kDa in SDS PAGE does not correspond to an integral

multiple of 16.9 kDa, the monomer MW determined

experimentally by mass spectrometry as well as theoreti-

cally from the amino acid constituents. Interestingly a

native PAGE with the same sample revealed somewhat

diffused but discrete, closely spread (within 2 kDa) single

bands. [Fig. 5(G)]. Even in the presence of different con-

centrations of the cross-linker BS3, no high molecular

weight band appeared in the nondenaturing PAGE. These

observations suggest that oligomerization may not be the

cause behind the unusual movement in SDS-PAGE,

rather the protein may comprise of coexisting extended

conformers that show different charge and mobility in a

native gel. Incidentally it has been reported45 that a 1.2–

1.8 times higher apparent MW in SDS-PAGE is common

for IUPs due to their unusually high content of charged

amino acids with low complexity distribution [Fig.

4(A,E)], which often bind less SDS to assume an unusual

nonglobular structure.

Size-exclusion chromatography gives a rough idea

about the hydrodynamic volume of a protein on a com-

parative scale. For HYPK, the chromatogram [Fig. 1(B)]

showed three peaks with apparent radii (RS) of �23.06,

�30.02, and �103.4 A. The theoretically predicted RS of

HYPK should be 20.2 A, if it is a globular protein with

molecular weight �17 kDa.46 The size ambiguity can,

HYPK is an Intrinsically Unstructured Protein

PROTEINS 1693

however, be explained by the model by Uversky,46 where

a standard plot of log RS versus log MW of known pro-

teins clubs HYPK with a group of proteins having either

molten globule like or premolten globule like conforma-

tions [Fig. 1(C)]. Hence, if we consider the protein con-

formation as molten globule, these three peaks corre-

sponds to molecular weights (MW) of �24.5, �51.3, and

�1638 kDa, respectively.46 Again, the theoretical Stoke’s

radius of a protein of �17 kDa at monomeric molten

globule, premolten globule or fully unfolded states can

be estimated according to the equations described by

Uversky46 and these values are 22.9, 29.2, and 34.3 A

respectively. It is to be noted that the hydrodynamic radii

estimated for molten globule (22.9 A) and premolten

globule (29.2 A) conformations are in good agreement

with the experimentally determined values for HYPK

(23.06 and 30.02 A respectively). Variable and large

hydrodynamic radii of HYPK observed in different exper-

Figure 5Effect of Ca21 concentrations on HYPK conformation. (A) �3 and �1.5-fold decrease in RS with increasing concentrations of Ca21 for the two conformers with

hydrodynamic radii of 11.8 and 56.02 nm were observed respectively by dynamic light scattering studies. Beyond a concentration of 4 mM CaCl2, data could not be

collected because of soluble aggregate formation. (B) In far-UV CD spectroscopy, a reduction in both negative minima and ellipticity was observed with increasing Ca21

concentrations indicating a loss of signal most possibly due to soluble aggregate formation. CD spectra derived from HYPK incubated with different Ca21 concentrations

are indicated as: olive; incubated with no Ca21, green; with 0.5 mM Ca21, black; with 1 mM Ca21, red; with 2 mM Ca21, yellow; with 3 mM Ca21, sky; with 4 mM

Ca21, magenta; with 5 m Ca21, navy; with 10 mM Ca21. (C) Conformational adjustments by HYPK among different molten globule/premolten globule like forms in

presence of different Ca21 concentrations as revealed by the analysis of the respective CD spectra. Data for random coil like (black circles) and pre-molten globule like

(gray squares) standards are taken from Uversky et al.26 Colored stars correspond to HYPK incubated with different Ca21 concentrations; with a coloring scheme as in B.

(D) Tyrosinate fluorescence intensities of HYPK at 340 nm decreases at higher Ca21 concentration with an initial increase. (E) Raleigh scattering intensity at 503 nm

increases when HYPK is incubated with increasing Ca21 concentration. (F) The precipitates formed by over-night incubation of HYPK with increasing concentrations

(marked on top of the gel) of CaCl2 followed by high-speed centrifugation as visualized by silver staining after SDS PAGE. Amounts of precipitates increased significantly

beyond 4 mM CaCl2. Lane 1, 2, 3, 4, 5, 6, 7, and 8 corresponds to precipitates formed by HYPK after incubation with 0, 0.5, 1, 2, 3, 4, 5, and 10 mM of CaCl2,

respectively. (G) Native PAGE with similarly treated samples except centrifugation revealed a likewise increase in intensity of a high molecular weight band. Lanes

correspond to similarly treated samples as in F.

S. Raychaudhuri et al.

1694 PROTEINS

imental conditions are one of the characteristics of

IUPs.47 When we plotted Stoke’s radii (Rs) versus pro-

tein concentration data from several gel filtration experi-

ments (Supplementary Figs. 3 and 4), we found that the

Rs hardly changed for low MW peaks whereas for the

high MW fraction, there was distinct concentration de-

pendence. This implies that this peak corresponded to a

conformer with high propensity of aggregation. The pro-

file of the peaks corresponding to the fractions with

highest RS are quite broad (elution volume 5 8.56 �0.35 mL) and presumably contain highly dynamic ensem-

bles of soluble aggregates with a wide range of RS

(156.8–101.63 A, calculated on the basis of the range of

the elution profiles).34 In absence of an oligomerization

event, as established by the gel electrophoresis data, the

other two fractions therefore comprise of two or more

different conformations (molten globule and premolten

globule) of HYPK, as explained. A larger hydrodynamic

radius of 11.8 nm (118 A) notwithstanding, DLS studies

also supports this kind of unstructuredness of HYPK

[Fig. 2(B)]. However, the hydrodynamic radius of the

protein obtained in DLS is comparable with the largest

Stoke’s radius (118.2 A) obtained in size exclusion chro-

matography with higher concentration of the protein

load (13 mg/mL; supplementary Table 1). With even fur-

ther higher concentrations of protein load (28 mg/mL,

�1600 lM), the largest Stoke’s radius shifted to 128.5 A

(supplementary Table 1). We speculate that similar solu-

ble aggregates of the protein were predominantly

observed in DLS where high protein concentration was

used (600 lM). The same species eluted differentially in

gel filtration studies with different loading concentrations

of protein because of lack of resolution (or peak broad-

ening) at initial stages of elution. Also, with higher pro-

tein load, the intermediate peaks were shifted to the

Stoke’s radii of 41.01 and 38.4 A (Supplementary Table

1), in close agreement with an intrinsically unstructured

17 kDa protein with random coil conformation (41.2

A).46 When guanidium hydrochloride denatured protein

was used for gel filtration experiments, the Stoke’s radius

calculated from the major elution peak was found to cor-

respond to 36.7 A, again with agreement to the theoreti-

cally calculated one (37.5 A).46 These changes in RS

observed with different protein load only signify a popu-

lation shift. Using different biophysical techniques, a sim-

ilar variation in the RS value is observed in other IUPs47

too and it only indicates a poor control over the behav-

ior of this kind of system under varied experimental pa-

rameters. This would lead to formation of multiple epi-

topes of HYPK, which conforms to earlier observation of

Otto et al. that it was very difficult to raise good quality

primary antibody against purified HYPK.48 Additionally

HYPK is found to be thermostable (data not shown) like

many other natively unfolded proteins.49

A protein in its molten globule or premolten globule

conformation may also contain secondary structures. In

case of HYPK, the far-UV CD spectrum showed 63.3%

of random coils with about 20.5% of a-helical and

16.2% of b-sheet contents [Fig. 2(A)]. In a comparative

plot of [y]200 (deg cm2 dmol21) against [y]220 (deg cm2

dmol21) for various proteins,26 it was observed that

HYPK belongs to a family of proteins with premolten

globule like structure [Fig. 5(C)].

There are evidences that in vitro disordered regions in

proteins are subject to proteolytic attacks at a faster

rate.43 This is generally because the specific structure of

the polypeptide substrate, at the cognate protease’s cata-

lytic site, is substantially stabilized by local unfolding at

that region, that is, intrinsic disorder increases the sus-

ceptibility of a protein to a protease. HYPK is found to

be highly sensitive to trypsin and papain at a very low

enzyme to substrate ratio [Fig. 3(A,B)] and the reaction

nears to completion within fifteen minutes. This high

sensitivity to proteases could be easily equated to the

unstructured nature of HYPK provided there would be

protection from proteases when the protein is functional.

This can be achieved through conformational transition

or by association, both self and nonself.

IUPs, because of the prevalence of charged amino acids

in their primary structures, are often sensitive to various

ionic species, both structurally and functionally.43,50

HYPK contains an ER retention signal indicating its pos-

sible cellular location and has already been reported to

be a putative member of a ribosome associated com-

plex.48 These information lead to the idea of a possible

effect of Ca21 on the conformation and function of the

protein. In the backdrop of this information, DLS results

indicate a reduction in the hydrodynamic radius of

HYPK with increasing Ca21 concentration, as opposed to

any significant change in presence of Mg11 or K1 (data

not shown), suggesting a preferential conformational

choice in the population in a specific ionic ambience

[Fig. 5(A)]. Fluorescence spectroscopic data also indicates

an initial structure induction with increasing Ca21 con-

centration [Fig. 5(D)]. However, the accessibility of the

fluorescent species to neutral quencher acrylamide is not

affected in presence of Ca21 (data not shown). Acrylam-

ide being a known quencher of tyrosine, it indicates

therefore that variation in Ca21 concentration does not

affect the environment of the tyrosine grossly, but prob-

ably help in switching between different premolten glob-

ule states so that the solvent accessibility of the tyrosine

remains effectively unchanged. This is further substanti-

ated by the CD data where different premolten globule

like conformational states is adapted by HYPK with

altered Ca21 concentrations [Fig. 5(C)].26 It has been

previously reported that in several IUPs this type of con-

formational adaptation among different unfolded forms

are important prerequisite for their function,43,50 and

the same for HYPK in various Ca21 concentrations may

not be an exception. Further, from both SDS-PAGE and

native PAGE experiments, propensity to aggregation with

HYPK is an Intrinsically Unstructured Protein

PROTEINS 1695

increasing Ca21 concentration is observed [Fig. 5(F,G)]

which is in corroboration with a reduction in the fluores-

cence intensity at higher Ca21 concentration due to

loss of signal of soluble proteins with aggregation. In

DLS, the possibilities to observe insoluble aggregates

were ruled out because of prior filtration of the sample

through 0.02 lM filter. It is difficult to speculate at this

point whether this compaction and aggregation in HYPK

in presence of Ca21 is indicative of its functional require-

ment or not.

It is hypothesized that HD pathology may be triggered

by an altered interaction of mutated Htt, either through a

change in its association with normal binding partners or

by an abnormal binding with some novel partners.17

Considering the innumerable number of mild folding var-

iants51 possible in the conformers arising out of different

poly Q mutations, the N terminus should be extremely

flexible as to attain as many different functional structures

as possible, to bind to a plethora of binding partners or

alternatively, there should be some protein(s) that would

be able to interact with Htt N terminii with different fold

variants and could in that way elicit the same downstream

pathways towards neuronal degeneration. Accordingly

these proteins should be able to do ‘‘moonlighting.’’52

Interestingly, among the 222 proteins found to be

involved in HD pathogenesis,12 when checked by disorder

prediction tools, about 70.7% of the proteins were found

to contain a disordered region, which is significantly

higher compared to a set of proteins having defined struc-

ture (30%) (data not shown).

IUPs, owing to the flexibility of their conformation,

have been reported to participate in several important

cellular processes.53 Some of these IUPs also play pivotal

roles in neurodegenerative diseases viz., Tau protein,

involved in Alzheimer’s disease pathogenesis,26,54–59 a-synuclein, the major causative agent of Parkinson’s dis-

ease60–65 and the stretched poly-Q repeats in the N-ter-

minus (exon 1) of Htt. It is reported that Htt N-termi-

nus (12180 residues) is locally unfolded although the

full-length protein is a-helical.66 On the other hand,

70.7% of the Htt interacting proteins were found to have

large unstructured regions, emphasizing on the flexibility

of the Htt interactome again (data not shown). HYPK,

as an IUP, may also adopt different conformations, which

is a crucial attribute for an interactor of Htt.

It is interesting to note that an intrinsically disordered

protein, or region of a protein, folds into an ordered

structure concomitant with binding to its target. This

kind of ‘‘Coupled folding and binding’’ has been shown

to be a process regulating life activity by providing

advantages through flexibility of interactions.53,54 Re-

cently reports indicating the involvement of IUPs in

human complex disorders have been published. In those

studies around 79% of cancer associated and 57% cardio-

vascular disease proteins were found to contain �30

amino residues unstructured.22,23,67

On the basis of these experimental observations and

in silico predictions (PONDR, FoldIndex, Composition

profiler), we have established that HYPK is a new mem-

ber of the IUP family with a predominant premolten

globule like structure. Its conformational flexibility with

different Ca21 concentrations manifests importance to its

Ca21 dependent structural alteration and possible func-

tion. Whether a Ca21 rich micro-environment of the ER

influences the HYPK: Htt interaction or not, is yet to be

deciphered.

HYPK has previously been reported by Faber et al.17

as one of the putative Htt interactors in a Y2H study. We

have confirmed the direct evidence of HYPK interaction

with the N-terminal region of Htt coded by the exon1 of

the gene, both in vitro and in vivo (data communicated).

We observed that HYPK exhibited, in vitro and in vivo,

chaperone like activity, reduced Htt aggregates, altered

the state and kinetics of aggregation and protected cells

from apoptotic death in a HD cell model (data commu-

nicated). Thus the importance of HYPK in modulating

HD pathogenesis is immanent. Chaperones are known to

reduce aggregates and toxicity induced by mutated

Htt.68–71 Interestingly, many of these chaperones are

known to have long intrinsically unstructured regions.72

In conclusion, as a novel intrinsically unstructured chap-

erone, HYPK demands more attention to further eluci-

date the role of chaperones and IUPs in neurodegenera-

tive diseases.

ACKNOWLEDGMENTS

The authors are grateful to Prof. J. K. Dattagupta, for

encouragement and support throughout the work. Prof.

S. Basak, Chemical Sciences Division, Saha Institute of

Nuclear Physics is acknowledged for helping with CD

spectroscopy. Ms Sucharita Dey of WBUT has helped us

in Bioinformatics analyses.

REFERENCES

1. The Huntington’s Disease Collaborative Research Group. A novel

gene containing a trinucleotide repeat that is expanded and unsta-

ble on Huntington’s disease chromosomes. Cell 1993;72:971–983.

2. DiFiglia M, Sapp E, Chase KO, Davies SW, Bates GP, Vonsattel JP,

Aronin N. Aggregation of Huntingtin in neuronal intranuclear

inclusions and dystrophic neurites in brain. Science 1997;277:1990–

1993.

3. Hickey MA, Chesselet MF. Apoptosis in Huntington’s disease. Prog

Neuro-Psychopharmacol Biol Psychiatry 2003;27:255–265.

4. Lipinski MM, Yuan J. Mechanisms of cell death in polyglutamine

expansion diseases. Curr Opin Pharmacol 2004;4:85–90.

5. Ross CA. Intranuclear neuronal inclusions: a common pathogenic

mechanism for glutamine-repeat neurodegenerative diseases? Neu-

ron 1997;19:1147–1150.

6. Duyao MP, Auerbach AB, Ryan A, Persichetti F, Barnes GT, McNeil

SM, Ge P, Vonsattel JP, Gusella JF, Joyner AL. Inactivation of the

mouse Huntington’s disease gene homolog Hdh. Science 1995;269:

407–410.

7. Nasir J, Floresco SB, OKusky JR, Diewert VM, Richman JM, Zeisler

J, Borowski A, Marth JD, Phillips AG, Hayden MR. Targeted dis-

S. Raychaudhuri et al.

1696 PROTEINS

ruption of the Huntington’s disease gene results in embryonic

lethality and behavioral and morphological changes in heterozy-

gotes. Cell 1995;81:811–823.

8. White JK, Auerbach W, Duyao MP, Vonsattel JP, Gusella JF, Joyner

AL, MacDonald ME. Huntingtin is required for neurogenesis and is

not impaired by the Huntington’s disease CAG expansion. Nature

Genet 1997;17:404–410.

9. Waldmeier PC, Tatton WG. Interrupting apoptosis in neurodege-

nerative disease: potential for effective therapy? Drug Discov Today

2004;9:210–218.

10. Cattaneo E, Rigamonti D, Goffredo D, Zuccato C, Squitieri F,

Sipione S. Loss of normal huntingtin function: new developments

in Huntington’s disease research. Trends Neurosci 2001;24:182–188.

11. Goehler H, Lalowski M, Stelzl U, Waelter S, Stroedicke M, Worm

U, Droege A, Lindenberg KS, Knoblich M, Haenig C, Herbst M,

Suopanki J, Scherzinger E, Abraham C, Bauer B, Hasenbank R,

Fritzsche A, Ludewig AH, Buessow K, Coleman SH, Gutekunst C,

Landwehrmeyer BG, Lehrach H, Wanker EE. A Protein Interaction

Network Links GIT1, an Enhancer of Huntingtin Aggregation, to

Huntington’s Disease. Mol Cell 2004;15:853–865.

12. Kaltenbach LS, Romero E, Becklin RR, Chettier R, Bell R, Phansal-

kar A, Strand A, Torcassi C, Savage J, Hurlburt A, Cha GH, Ukani

L, Chepanoske CL, Zhen Y, Sahasrabudhe S, Olson J, Kurschner C,

Ellerby LM, Peltier JM, Botas J, Hughes RE. Huntingtin interacting

proteins are genetic modifiers of neurodegeneration. PLoS Genetics

2007;3:e82(doi:10.1371/journal).

13. Li SH, Li XJ. Huntingtin-protein interactions and the pathogenesis

of Huntington’s disease. Trends Genet 2004;20:146–154.

14. Mitsui K, Nakayama H, Akagi T, Nekooki M, Ohtawa K, Takio K,

Hashikawa T, Nukina N. Purification of polyglutamine aggregates

and identification of elongation factor-1a and heat shock protein

84 as aggregate-interacting proteins. J Neurosci 2002;22:9267–9277.

15. Gervais FG, Singaraja R, Xanthoudakis S, Gutekunst C, Leavitt BR,

Metzler M, Hackam AS, Tam J, Vaillancourt JP, Houtzager V,

Rasper M, Roy S, Hayden MR, Nicholson DW. Recruitment and

activation of caspase-8 by the Huntingtin-interacting protein Hip-1

and a novel partner Hippi. Nat Cell Biol 2002;4:95–105.

16. Hattula K, Peranen J. FIP-2, a coiled-coil protein, links Huntingtin

to Rab8 and modulates cellular morphogenesis. Curr Biol 2000;10:

1603–1606.

17. Faber WP, Barnes TG, Srinidhi J, Chen J, Gusella FJ, MacDonald

ME. Huntingtin interacts with a family of WW domain proteins.

Hum Mol Genet 1998;7:1463–1474.

18. Passani AL, Bedford TM, Faber WP, McGinnis MK, Sharp HA,

Gusella FJ, Vonsattel J, MacDonald ME. Huntingtin’s WW domain

partners in Huntington’s disease post-mortem brain fulfill genetic

criteria for direct involvement in Huntington’s disease pathogenesis.

Hum Mol Genet 2000;9:2175–2182.

19. Rega S, Stiewe T, Chang D, Pollmeier B, Esche H, Bardenheuer W,

Marquitan G, MPutzer B. Identification of the full-length Hunting-

tin-interacting protein p231HBP/HYPB as a DNA-binding factor.

Mol Cell Neurosci 2001;18:68–79.

20. Anborgh PH, Godin C, Pampillo M, Dhami KG, Dale BL, Cregan

PS, Truant R, Ferguson SGS. Inhibition of metabotropic glutamate

receptor signaling by the huntingtin-binding protein optineurin.

J Biol Chem 2005;280:34840–34848.

21. Huang K, Yanai A, Kang R, Arstikaitis P, Singaraja RR, Metzler M,

Mullard A, Haigh B, Gauthier-Campbell C. Huntingtin-interacting

protein HIP14 is a palmitoyl transferase involved in palmitoylation

and trafficking of multiple neuronal proteins. Neuron 2004;44:977–

986.

22. Cheng Y, LeGall T, Oldfield CJ, Dunker AK, Uversky VN. Abun-

dance of intrinsic disorder in protein associated with cardiovascular

disease. Biochemistry 2006;45:10448–10460.

23. Iakoucheva LM, Brown CJ, Lawson JD, Obradovic Z, Dunker AK.

Intrinsic disorder in cell-signaling and cancer-associated proteins.

J Mol Biol 2002;323:573–584.

24. Batra-Safferling R, Abarca-Heidemann K, Korschen HG, Tziatzios

C, Stoldt M, Budyak I, Willbold D, Schwalbe H, Klein-Seetharaman

J, Kaupp UB. Glutamic acid-rich proteins of rod photoreceptors are

natively unfolded. J Biol Chem 2006;281:1449–1460.

25. Gasteiger E, Hoogland C, Gattiker A, Duvaud S, Wilkins MR, Appel

RD, Bairoch A. Protein identification and analysis tools on the

ExPASy server. In: Walker JM, editors. The proteomics protocols

handbook. Totowa, NJ: Humana Press Inc.; 2005. pp 571–607.

26. Uversky VN. Natively unfolded proteins: a point where biology

waits for physics. Protein Sci 2002;11:739–756.

27. Li X, Romero P, Rani M, Dunker AK, Obradovic Z. Predicting pro-

tein disorder for N��, C��, and internal regions. Genome Inform

1999;10:30–40.

28. Romero P, Obradovic Z, Li X, Garner E, Brown C, Dunker AK.

Sequence complexity of disordered protein. Prot Struct Funct Genet

2001;42:38–48.

29. Romero P, Obradovic Z, Dunker AK. Sequence data analysis for

long disordered regions prediction in the calcineurin family.

Genome Inform 1997;8:110–124.

30. Prilusky J, Felder CE, Zeev-Ben-Mordehai T, Rydberg EH, Man O,

Beckmann JS, Silman I, Sussman JL. FoldIndex�: a simple tool to

predict whether a given protein sequence is intrinsically unfolded.

Bioinformatics 2005;21:3435–3438.

31. Vacic V, Uversky VN, Dunker AK, Lonardi S. Composition profiler:

a tool for discovery and visualization of amino acid composition

differences. BMC Bioinform 2007;8:211. (doi:10.1186/1471-2105-8-211).

32. Siegel LM, Monty KJ. Determination of molecular weights and fric-

tional ratios of proteins in impure systems by use of gel filtration

and density gradient centrifugation: application to crude prepara-

tions of sulfite and hydroxylamine reductases. Biochim Biophys

Acta 1966;112:346–362.

33. Zeev-Ben-Mordehai T, Rydberg EH, Solomon A, Toker L, Auld VJ,

Silman I, Botti S, Sussman JL. The intracellular domain of the Dro-

sophila cholinesterase-like neural adhesion protein, gliotactin, is

natively unfolded. Prot Struct Funct Genet 2003;53:758–767.

34. Chakraborty A, Das I, Datta R, Sen B, Bhattacharyya D, Mandal C,

Datta AK. A single-domain cyclophilin from Leishmania donovani

reactivates soluble aggregates of adenosine kinase by isomerase-

independent chaperone function. J Biol Chem 2002;277:47451–47460.

35. Bevington P. Data reduction and error analysis in physical sciences.

New York: McGraw Hill; 1983.

36. Bhattacharyya K, Basak S. Somatostatin in a water-restricted envi-

ronment: fluorescence and circular dichroism study in AOT reverse

micelles. Photochem Photobiol 1995;62:17–23.

37. Uren A, Tcherkasskaya O, Toretsky JA. Recombinant EWS-FLI1

oncoprotein activates transcription. Biochemistry 2004;43:13579–

13589.

38. Permyakov SE, Millett IS, Doniach S, Permyakov EA, Uversky VN.

Natively unfolded C-terminal domain of caldesmon remains sub-

stantially unstructured after the effective binding to calmodulin.

Prot Struct Funct Genet 2003;53:855–862.

39. Fontana A, Zambonin M, Laureto PP, Filippis V, Clementi A, Scara-

mella E. Probing the conformational state of apomyoglobin by lim-

ited proteolysis. J Mol Biol 1997;266:223–230.

40. Oldfield CJ, Cheng Y, Cortese MS, Brown CJ, Uversky VN, Dunker

AK. Comparing and combining predictors of mostly disordered

proteins. Biochemistry 2005;44:1989–2000.

41. Lee RJ, Oliver JM. Roles for Ca21 stores release and two Ca21

influx pathways in the Fc epsilon R1-activated Ca21 responses of

RBL-2H3 mast cells. Mol Biol Cell 1995;6:825–839.

42. Lemmens R, Larsson O, Berggren P, Islam S. Ca21-induced Ca21

release from the endoplasmic reticulum amplifies the Ca21 signal

mediated by activation of voltage-gated L-type Ca21 channels in

pancreatic beta-cells. J Biol Chem 2001;276:9971–9977.

43. Dunker AK, Lawson JD, Brown CJ, Williams RM, Romero P, Oh

JS, Oldfield CJ, Campen AM, Ratliff CM, Hipps KW, Ausio J, Nissen

MS, Reeves R, Kang CH, Kissinger CR, Bailey RW, Griswold MD,

HYPK is an Intrinsically Unstructured Protein

PROTEINS 1697

Chiu W, Garner EC, Obradovic Z. Intrinsically disordered protein.

J Mol Graph Model 2001;19:26–59.

44. Pundak S, Roche RS. Tyrosine and tyrosinate fluorescence of bovine

testes calmodulin: calcium and pH dependence. Biochemistry 1984;

23:1549–1555.

45. Tompa P. Intrinsically unstructured proteins. Trends Biochem Sci

2002;27:527–533.

46. Uversky VN. What does it mean to be natively unfolded? Eur J Bio-

chem 2002;269:2–12.

47. Uversky VN, Yamin G, Munishkin LA, Karymovc MA, Millettd IS,

Doniachd S, Lyubchenkoc YL, Fink AL. Effects of nitration on the

structure and aggregation of a-synuclein. Mol Brain Res 2005;134:

84–102.

48. Otto H, Conz C, Maier P, Wolfle T, Suzuki CK, Jeno P, Rucknagel

P, Stahl J, Rospert S. The chaperones MPP11 and Hsp70L1 form

the mammalian ribosome-associated complex. Proc Natl Acad Sci

2005;102:10064–10069.

49. Carvalho AF, Costa-Rodrigues J, Correia I, Pessoa JC, Faria TQ,

Martins CL, Fransen M, Sa-Miranda C, Azevedo JE. The N-termi-

nal half of the peroxisomal cycling receptor Pex5p is a natively

unfolded domain. J Mol Biol 2006;356:864–875.

50. Dyson HJ, Wright PE. Intrinsically unstructured proteins and their

functions. Nat Rev Mol Cell Biol 2005;6:197–208.

51. Bates GP. One misfolded protein allows others to sneak by. Science

2006;311:1385–1386.

52. Tompa P, Szasz C, Buday L. Structural disorder throws new light

on moonlighting. Trends Biochem Sci 2005;30:484–489.

53. Uversky VN, Gillespie JR, Fink AL. Why are ‘‘natively unfolded’’

proteins unstructured under physiologic conditions? Prot Struct

Funct Genet 2000;41:415–427.

54. Dyson HJ, Wright PE. Intrinsically unstructured proteins: re-assess-

ing the protein structure-function paradigm. J Mol Biol 1999;293:

321–323.

55. Mukrasch MD, Markwick P, Biernat J, von Bergen M, Bernado P,

Griesinger C, Mandelkow E, Zweckstetter M, Blackledge M. Highly

populated turn conformations in natively unfolded tau protein

identified from residual dipolar couplings and molecular simula-

tion. J Am Chem Soc 2007;129:5235–5243.

56. Lippens G, Sillen A, Smet C, Wieruszeski JM, Leroy A, Buee L,

Landrieu I. Studying the natively unfolded neuronal Tau protein by

solution NMR spectroscopy. Protein Pept Lett 2006;13:235–246.

57. Brandt R, Hundelt M, Shahani N. Tau alteration and neuronal

degeneration in tauopathies: mechanisms and models. Biochim Bio-

phys Acta 2005;1739:331–354.

58. Syme CD, Blanch EW, Holt C, Jakes R, Goedert M, Hecht L, Bar-

ron LD. A Raman optical activity study of rheomorphism in

caseins, synucleins and Tau. Eur J Biochem 2002;269:148–156.

59. Schweers O, Schonbrunn-Hanebeck E, Marx A, Mandelkow E.

Structural studies of Tau protein and Alzheimer paired helical fila-

ments show no evidence for b-structure. J Biol Chem 1994;269:

24290–24297.

60. Uversky VN, Li J, Fink AL. Evidence for a partially folded interme-

diate in a-synuclein fibril formation. J Biol Chem 2001;276:10737–

10744.

61. Weinreb PH, Zhen W, Poon AW, Conway KA, Lansbury PT. NACP.

A protein implicated in Alzheimer’s disease and learning is natively

unfolded. Biochemistry 1996;35:13709–13715.

62. Bussell R, Eliezer D. Residual structure and dynamics in Parkinson’s

disease-associated mutants of a-synuclein. J Biol Chem 2001;276:

45996–46003.

63. Bussell R, Eliezer D. Effects of parkinson’s disease-linked mutations

on the structure of lipid-associated a-synuclein Biochemistry

2004;43:4810–4818.

64. Eliezer D, Kutluay E, Bussell R, Browne G. Conformational proper-

ties of a-synuclein in its free and lipid-associated states. J Mol Biol

2001;307:1061–1073.

65. Uversky VN. A Protein-chameleon: conformational plasticity of a-synuclein, a disordered protein involved in neurodegenerative disor-

ders. J Biomol Struct Dyn 2003;21:211–234.

66. Chen YW. Local protein unfolding and pathogenesis of polyglut-

amine-expansion diseases. Prot Struct Funct Genet 2003;51:68–73.

67. Cheng Y, LeGall T, Oldfield CJ, Mueller JP, Van YJ, Romero P, Cor-

tese MS, Uversky VN, Dunker AK. Rational drug design via in-

trinsically disordered protein. Trends Biotech 2006;24:435–442.

68. Kim WY, Fayazi Z, Bao X, Higgins D, Kazemi-Esfarjani P. Evidence

for sequestration of polyglutamine inclusions by Drosophila mye-

loid leukemia factor. Mol Cell Neurosci 2005;29:536–544.

69. Kazemi-Esfarjani P, Benzer S. Suppression of polyglutamine toxicity

by a Drosophila homolog of myeloid leukemia factor 1. Hum Mol

Genet 2002;11:2657–72.

70. Hay DG, Sathasivam K, Tobaben S, Stahl B, Marber M, Mestril R,

Mahal A, Smith DL, Woodman B, Bates GP. Progressive decrease in

chaperone protein levels in a mouse model of Huntington’s disease

and induction of stress proteins as a therapeutic approach. Hum

Mol Genet 2004;13:1389–1405.

71. Sakahira H, Breuer P, Hayer-Hart MK, Hart FU. Molecular chaper-

ones as modulators of polyglutamine protein aggregation and toxic-

ity. Proc Natl Acad Sci USA 2002;99:16412–16418.

72. Sickmeier M, Hamilton JA, LeGall T, Vacic V, Cortese MS, Tantos

A, Szabo B, Tompa P, Chen J, Uversky VN, Obradovic Z, Dunker

AK. DisProt: the database of disordered proteins. Nucleic Acids Res

2007;35:D786–D793.

S. Raychaudhuri et al.

1698 PROTEINS