www.elsevier.com/locate/yexcr

Experimental Cell Research 297 (2004) 521–532

Human poly(ADP-ribose) glycohydrolase is expressed in alternative splice

variants yielding isoforms that localize to different cell compartments

Mirella L. Meyer-Ficca,1 Ralph G. Meyer,1 Donna L. Coyle,Elaine L. Jacobson, and Myron K. Jacobson*

Department of Pharmacology and Toxicology, College of Pharmacy, Arizona Cancer Center, University of Arizona, Tucson, AZ 85724, USA

Received 12 February 2004, revised version received form 22 March 2004

Available online 27 April 2004

Abstract

Poly(ADP-ribose) glycohydrolase (PARG) is the only protein known to catalyze hydrolysis of ADP-ribose (ADPR) polymers to free

ADP-ribose. While numerous genes encode different poly(ADP-ribose) polymerases (PARPs) that all synthesize ADP-ribose polymer, only a

single gene coding for PARG has been detected in mammalian cells. Here, we describe two splice variants of human PARG mRNA, which

lead to expression of PARG isoforms of 102 kDa (hPARG102) and 99 kDa (hPARG99) in addition to the full-length PARG protein

(hPARG111). These splice variants differ from hPARG111 by the lack of exon 1 (hPARG102) or exons 1 and 2 (hPARG99). They are

generated by the utilization of ambiguous splice donor sites in the PARG gene 5V untranslated region. The hPARG111 isoform localizes to the

nucleus, whereas hPARG102 and hPARG99 are cytoplasmic proteins. The nuclear targeting of hPARG111 is due to a nuclear localization

signal (NLS) in exon 1 that was mapped to the amino acids (aa) 10CTKRPRW16. Immunocytochemistry, immunoblotting, and PARG enzyme

activity measurements show that the cytoplasmic isoforms of PARG account for most of the PARG activity in cells in the absence and

presence of genotoxic stress. The predominantly cytoplasmic location of cellular PARG is intriguing as most known cellular PARPs have a

nuclear localization.

D 2004 Elsevier Inc. All rights reserved.

Keywords: PARG; Poly(ADP-ribosyl)ation; PARP; Splice variants; Nuclear localization signal

Introduction ribose) glycohydrolase (PARG) [6,10]. Nuclear ADPR

The synthesis and rapid turnover of ADP-ribose

(ADPR) polymers are immediate responses of cells to

DNA damage [1–3]. This unique biopolymer is synthe-

sized by members of the poly(ADP-ribose) polymerase

(PARP) family as a posttranslational protein modification

and consists of up to 200 ADP-ribose residues covalently

bound to acceptor proteins [4–8]. PARP-1 is the major

activity that catalyzes polymer synthesis in response to

DNA strand breaks, and polymer levels can increase more

than 100-fold in minutes [6,9]. Once synthesized, ADPR

polymers are rapidly degraded by the action of poly(ADP-

0014-4827/$ - see front matter D 2004 Elsevier Inc. All rights reserved.

doi:10.1016/j.yexcr.2004.03.050

* Corresponding author. College of Pharmacy, University of Arizona,

Room 3985 Arizona Cancer Center, 1515 North Campbell Avenue, Tucson,

AZ 85724. Fax: +1-520-626-8657.

E-mail address: mjacobson@pharmacy.arizona.edu (M.K. Jacobson).1 The first two authors contributed equally to this work.

polymer metabolism modulates cellular responses to gen-

otoxic stress including stimulation of DNA repair [11], and

thus it is an important factor for maintenance of genomic

integrity [6,12–14]. In addition to PARP-1, the first

discovered and most abundant PARP, a family of proteins

located throughout the cell, has been shown to have PARP

activity [15]. Most known PARPs are located in the

nucleus. PARP-1 [16] and PARP-2 [17] are located

throughout the nucleus, tankyrase-1 is associated with

telomeres [18], PARP-2 with centromeres in mitotic chro-

mosomes [19], and several PARPs are associated with

centrosomes [20,21]. Extranuclear PARPs include VPARP,

which is associated with vaults, large ribonucleoprotein

complexes with unknown function [22], and tankyrase-2

which interacts with proteins located in the Golgi complex

[23] and endosomes [24].

In contrast to many genes that encode PARPs, thus far,

only a single gene has been found to code for PARG in

M.L. Meyer-Ficca et al. / Experimental Cell Research 297 (2004) 521–532522

mammals, suggesting that products of this single gene are

needed to complete ADP-ribose polymer cycles. Although

the cDNAs coding for the human [25,26], bovine [27],

murine [28], and rat PARG [29] have been cloned, the

subcellular localization of PARG and the mechanisms by

which PARG is targeted to different subcellular compart-

ments are poorly understood. There are reports of putative

nuclear localization signal (NLS) [27] and nuclear export

signals (NES) [29] in PARG. A nuclear localization of an

overexpressed PARG-GFP fusion protein [25] has been

observed, while other studies have indicated a cytosolic

location of overexpressed PARG [30,31]. Here, we dem-

onstrate three splice variants of human PARG, which are

expressed from a single gene and give rise to PARG

isoforms targeted to the nuclear and cytoplasmic compart-

ments of the cell. Our results demonstrate that alternative

splicing provides a mechanism by which a single PARG

gene can generate a family of different PARG proteins that

can complete ADP-ribose polymer cycles in multiple

cellular locations. Our results show that, in contrast to

the known PARPs, most of the cellular PARG activity is

present in the cytoplasmic rather than nuclear compartment

of the cell.

Materials and methods

Cloning of human PARG cDNA by 5VRACE and

construction of expression vectors

Human total RNA was isolated from cultured CF3

normal skin fibroblasts as described earlier [26]. Briefly,

CF3 cells were cultured in DMEM (Sigma, St. Louis, MO)

with 10% calf serum (Hyclone) under standard cell culture

conditions (5% CO2, 37jC). Cells were removed from the

dish by treatment with trypsin, and total RNA was isolated

from 106 cells using a kit (Qiagen). Additionally, com-

mercially available total human skin RNA (Stratagene) was

reversely transcribed and processed to ensure reproduction

of the results from a different RNA source. One micro-

gram of total RNA each was subjected to reverse tran-

scription using a RACE kit (Clontech) which utilizes

SMARTk cDNA technology and Powerscriptk moloney

murine leukemia virus (MoMuLV) reverse transcriptase

from Clontech. After first-strand synthesis, PCR amplifi-

cation was directly performed using a proofreading DNA

polymerase mix (Expand, Roche) in a ‘‘touch-down PCR’’

protocol which omits a separate annealing step in favor

of higher amplification specificity. A universal primer

mix (UPM, Clontech) was used for forward priming

in the 5VRACE reaction in combination with a

specific reverse primer that binds in exon 3 (hPARG-

exon3 rev; 5 V-CCGTAGTTCTGCTTTGCATTTG-

CAAGCTTTACAGTTGT-3V) or exon 6 (hPARG-exon6-

rev: 5V-GTGCAGTCTGAATGAGCTCCCACCGGCTC-3V)to amplify the 5V untranslated region of the PARG gene.

Full-length cDNA clones were generated by using the

UPM primer in combination with a primer hPARG-

exon18rev which specifically binds at the end of the

coding region in exon 18 (5V-GGACCGGTCCTCAGGT-CCCTGTCCTTTGCCCTGAATG-3V) including the trans-

lation stop codon. As an alternative to UPM, either a

forward primer which binds in the distal portion of the

PARG 5V-UTR (hPARG-UTRfor: 5V-CGGAATTCGG-

GAAAGTGAACGAATCCCGAATCAAAGCGGCGC-3V)or a forward primer specific for exon 1 of PARG (hPARG-

exon1fo r : 5 V-GCGAATTCCCAGCATGAATGC-

GGGCCCCGGC-3V) was used with primer hPARG-exon6-

rev or with hPARG-exon18rev. PCR products were

purified by agarose gel electrophoresis, and the bands

were excised. Purified fragments were cloned into

pcDNA3.1/V5-His-TOPO using a topoisomerase TA clon-

ing kit (Invitrogen). After transformation of TOP10 bacte-

ria (Invitrogen), resulting pcDNA-PARG clones were

analyzed by complete sequencing of the inserts (both

strands). A representative DNA fragment generated with

primers UPM and hPARGrev1 coding for the human

PARG 5V end and N-terminal untranslated region isolated

from reversely translated CF3 RNA was subcloned into

pcDNA-hPARG [26] using restriction enzymes AflII and

BstX1. The resulting plasmid pcDNA-hPARG102 was

sequenced to ensure ORF integrity and used for transfec-

tion studies. By cloning a complete 5VRACE product

encoding hPARG99 amplified with primers UPM and

hPARG-exon18rev into pcDNA3.1 using the TOPO TA

kit, pcDNA-hPARG99 was generated.

Computational sequence analyses

Sequence alignments were performed by comparing

PARG cDNA to the NCBI database using the BLAST

[32] program which is accessible via the World Wide Web

(http://www.ncbi.nlm.nih.gov/BLAST). Cloned cDNA 5Vends that were identified to contain PARG sequences were

further analyzed for the presence of the 5VUTR and for the

correct sequence of the predicted splicing products of the

gene. The human EST database was searched for examples

of 102-kDa and 99-kDa hPARG splice variant clones using

the same program. The PARG protein sequence or frag-

ments of it were analyzed using the computer program

PSORTII (http://psort.nibb.ac.jp).

In vitro expression and immunoblot analyses of human

PARG

Coupled in vitro transcription and translation analyses

were carried out using a rabbit reticulocyte-based TNT

expression kit (Promega) according to the protocol supplied

by the manufacturer. As templates, 2 Ag of each pcDNA-

hPARG111, pcDNA-hPARG102 or pcDNA-hPARG99, lin-

earized with ScaI, or pT7luc control DNA (Promega), was

used per reaction. Samples of the positive control reactions

Fig. 1. Specific PCR amplification of PARG cDNA products. Using primers

in the 5VUTR (UTRfor) upstream of the newly identified splice donor sites

and at the end of the ORF in exon 18 (Exon18rev, lane a), two bands (i and

ii) were produced corresponding to hPARG111 (band i, with an expected

size of 3193 bp) and hPARG102 (band ii, 2761–2794 bp) respectively. The

latter included hPARG99 (band ii, 2694 or 2698 bp, depending on the

splice donor sites used in the individual cDNA). When a primer specific for

exon 1 (Exon1for) was used instead of UTRfor (lane b), only one band with

the expected size of 2954 bp (band iii) encoding the hPARG111 ORF was

obtained. Similarly, using the UTRfor primer in combination with a reverse

primer located in exon 6 (Exon6rev, lane c), two bands, representing

hPARG111 (band iv, 1880 bp) and hPARG102 (band v, 1448–1481 bp), as

well as hPARG99 (band v, 1385 or 1381 bp) were observed. If primer

Exon1for was used instead of UTRfor (lane d), a single band marked the

expected 1641-bp fragment of the hPARG111 ORF (band vi). All bands (i –

vi) were reproducibly obtained, cloned, and sequenced from CF3 fibroblast

RNA and from commercially available human skin total RNA (Stratagene).

M.L. Meyer-Ficca et al. / Experimental Cell Research 297 (2004) 521–532 523

were subjected to luciferase activity assays to ensure func-

tionality of the in vitro transcription and translation proce-

dure. Total cell extracts of HeLa cells (ATCC) were

prepared according to standard procedures [33]. Western

blot analyses of in vitro translated protein and total

cell lysates were performed using a standard SDS–PAGE

method with 8% polyacrylamide gels. After electrotransfer

to PVDF membranes (Millipore), PARG protein was

detected using a polyclonal rabbit antiserum raised against

peptide KNSCQDSEADEETSP in the N-terminal region of

PARG and a secondary goat anti rabbit antibody coupled to

horseradish peroxidase (Jackson Laboratories) with an en-

hanced chemoluminescence (ECL) reaction.

Construction of a GFL reporter gene fusion with human

PARG exon 1

A DNA fragment coding for human PARG exon 1 was

generated by PCR using Expand PCR polymerase (Roche)

and oligonucleotide primers designated PGEXFOR (5VCGACTCACTATAGGGAGACCCAAGCTGGCTAGC G

3V, containing an additionalNheI recognition site, underlined)and PGEXREV (5V CCTTTAGTGTCCATGG AACTGG-

TAATAGTCTTTTGTTGTTTGAAAACAAGC 3V which

has an additional NcoI site; underlined). The PCR product

was subcloned into plasmid pGFL [34] using restriction sites

NcoI and NheI, yielding plasmid pEx1-GFL. In frame fusion

of the ORF of the PCR product to the reporter gene was

verified by sequencing. The NheI/BglII fragment of pEx1-

GFL which contained the exon 1 reporter gene fusion was

subcloned into vector pcDNA3.1 (precut with NheI and

BamHI) leading to the expression plasmid pCMV-Ex1-GFL.

Site-directed mutagenesis

To define the amino acids (aa) that are essential for NLS

function, a PCR-based site-directed mutagenesis was per-

formed using the Quikchange Site-directed Mutagenesis Kit

(Stratagene) according to the manufacturer’s instruction. The

two candidate NLS sequences that had been identified by the

PSORTII program in exon 1 were altered sequentially with

two specific primer pairs using plasmid pEx1-GFL as a

template. For mutation of putative NLS1, primers NLS1MF

(5V-GCTGTGAACCCTGCACCGCCGGCCCCCGCTGG-GGCGCCGC-3V) and NLS1MR (5V-GCGGCGCCCCAGC-GGGGGCCGGCGGTGCAGGGTTCACAGC-3V) were

used. For alteration of putative NLS2, primers NLS2MF

(5V-GTCCTTGGGGTCGAGGACGGCGCCCTGCCTGC-TGGGAAAGC-3V and NLS2MR 5VGCTTTCCCAGCAGG-CAGGGCGCCGTCCTCGACCCCAAGGAC-3V) were

used.

Fusion of the putative bipartite NLS region to GFL

Sequence analyses published previously had indicated

the presence of a putative bipartite NLS in the central

region of the protein, between amino acids 422 and 439

of human PARG [27]. To determine if this peptide

sequence also mediates nuclear localization, a PCR frag-

ment coding for this region was amplified using primer

pair NLSfor EcoRI (5 VGTGAATTCATGAGAC-

ATGAGACTGCCCAAAGCAGAGGAC3V, additional

EcoRI site underlined) and NLSrevNcoI (5VCTG-

CCATGGCCTTCCTTTCTGTTCTTTGATGTTTGGTTT-

CCCA3V; additional NcoI site underlined). The PCR

product was digested with EcoRI and NcoI and subcloned

into plasmid pGFL, fusing the PARG peptide ORF in

frame to the 5V terminus of the GFL reporter gene. The

complete open reading frame consisting the PARG pep-

tide and the GFL reporter was then placed into plasmid

pcDNA3.1 using the restriction endonucleases NheI,

BamHI and BglII. The resulting expression plasmid

pCMV-bpNLS-GFL was used for transfection and over-

expression of the fusion protein.

Culture, transfection, and treatment of cells

HeLa cells and the human embryonal kidney cell line

HEK293 were obtained from ATCC and cultured in

DMEM (Sigma) supplemented with 10% fetal bovine

serum (Hyclone). For overexpression of human PARG

M.L. Meyer-Ficca et al. / Experimental Cell Research 297 (2004) 521–532524

protein or reporter protein, HEK293 cells were seeded at

a density of 5 � 105 cells/well into six-well plates which

contained one sterile coverslip per well. After 24 h, cells

were transfected with 1 Ag plasmid per well using

FuGene6 transfection reagent (Roche) according to the

manufacturer’s protocol. The treatment with N-methyl-N V-nitro-N-nitrosoguanidine (MNNG), an alkylating agent

that induces base excision repair and PARP-1 and

PARP-2 activation, was performed on HEK293 cells in

T75 flasks in culture medium with a final concentration

of 500 AM. After 15 min of treatment, cells were

harvested and assayed as described below.

Microscopic preparations and immunofluorescence staining

One day after transfection, cells were washed with

PBS twice, then fixed for 10 min at room temperature

Fig. 2. Mechanism of hPARG 5V splicing and expression of 111 kDa, 102 kDa, an

mRNA that leads to the expression of hPARG111. Here, intron 1 is removed t

downstream of exon 1, with the splice acceptor site 1 (SA1). The optional splice d

case. In contrast, expression of hPARG102 (panel B) requires an alternative splic

results in the skipping of exon 1. Because the 5V region upstream of the employed s

optional exon (exon 1a) of variable length. Interaction of all three optional splice d

of exon 1a to exon 3 is achieved by interaction of SD1a–c with SA2 (panel C), giv

PARG gene are located in the first three exons. The structure of the hPARG 5VUTRof primer UTRfor which was used for amplification and cloning of several variant

sites within the splice donor motives which are in good agreement with the cons

using 5% formaldehyde in PBS and washed with PBS

again. Cells expressing green fluorescent fusion proteins

were immediately embedded in Vectashield mounting

medium (Vector Laboratories) which contained 1 Ag/ml

DAPI as a DNA counterstain. For indirect immunofluo-

rescence staining, fixed coverslips were incubated in 100

mM glycine in PBS for 1 min, washed with PBS,

permeabilized in 0.4% Triton X-100 in PBS for 3 min,

washed, and blocked in 5% bovine serum albumin in

PBS for 30 min at room temperature. Immunostaining

was performed using two different rabbit antisera recog-

nizing the N-terminus [26] or the C-terminus of PARG

[35] as first antibodies and a fluorescein-coupled goat

antirabbit antiserum as a secondary antibody (Jackson

Immuno Laboratories). Visualization of endogenous PARG

was performed using HeLa cells due to their larger size

and better adherence to the glass coverslips.

d 99 kDa proteins. Panel A depicts the expected splicing pattern of PARG

hrough the interaction of the splice donor site 1 (SD1), which is located

onor sites SD1a, SD1b, and SD1c are not used for RNA processing in this

ing step involving either SD1a, SD1b, or SD1c in concert with SA1 which

plice donor site is directly spliced to exon 2, this region can be considered an

onor sites SD1a–c with SA1 has been observed in isolated clones. Splicing

ing rise to hPARG99. The first three available translation starts in the human

with the location of the optional splice donor sites SD1a–c and the position

cDNAs are shown in panel D. The arrows indicate the individual cleavage

ensus sequence (G/C)AGjG(T/C)NNGT.

Table 1

Characteristics of human PARG cDNA variants cloned from total RNA

derived from human fibroblasts (CF3), skin (Stratagene), or placentaa

(P, Clontech)

PARG

variant

Prot. size

kDa (aa)

Length

of cDNA

[bp]

Cloned from

(Pa/CF3/skin)

EST evid.

(GenBank)

GenBank

acc. #

hPARG111 111.1

(976)

3193 Pa,

CF3,

skin

BQ220449.1

BQ232736.1

BG714165.1

and others

AY258587

AF005043

hPARG102 102.3

(894)

2761

(SD1a)

CF3,

skin

BG719380 AY575848

2765

(SD1b)

2794

(SD1c)

hPARG99 99.3

(867)

2698

(SD1b)

CF3 AY575849

The accession numbers of the cloned cDNAs and EST clones with

similarity to them are indicated.a See reference [26].

M.L. Meyer-Ficca et al. / Experimental Cell Research 297 (2004) 521–532 525

Determination of PARG activity in nuclear and cytosolic

fractions

Nuclear and cytosolic fractions were isolated from

HEK293 and HeLa cells using the NucleiPURE Prep Nuclei

Isolation Kit (Sigma, St. Louis, MO) according to the

manufacturer’s instructions. The protein content of each

fraction was determined using the BCA Protein Assay

(Pierce Biotechnology, Inc., Rockford, IL). PARG activity

was measured in each fraction following sonication (3 � 10

s; on ice) as described by Menard and Poirier [36].

Fig. 3. Coupled T7RNA polymerase-dependent in vitro transcription/

translation of hPARG expression plasmids encoding the 111-kDa (a), 102-

kDa (b), and 99-kDa (c) forms of hPARG. In this experiment, expression of

the 111-kDa variant always showed three bands (arrows), presumably due

to usage of two additional downstream translation start codons in exon 2

(M83) and 3 (M110). Accordingly, the hPARG102 cDNA is translated in two

forms, corresponding to the 102-kDa and the 99-kDa protein variants. The

hPARG99 plasmid led to the formation of one band only (c). A firefly

luciferase plasmid (pT7-luc, Promega) was used as a control (d).

Results

Human PARG is expressed as multiple splice variants

To search for possible splice variants of PARG mRNA,

two separate strategies were used. First, a 5’RACE-PCR

amplification of hPARG cDNA was completed using a

universal primer mix in combination with a specific reverse

primer in exons 6 or 18 to search for splice variants with

differences in the 5’ region of PARG mRNA. This system

resulted in the generation of PCR products of at least two

distinct sizes in both CF3 and total skin RNA. Second, based

on sequence analyses of the PCR products, a forward primer

located in the 5’UTR of the PARG gene (UTRfor) was

designed for subsequent PCR experiments. Fig. 1 shows

examples using the UTRfor primer where agarose gel

electrophoresis revealed that the size of the major PCR

product derived from CF3 fibroblasts (Fig. 1, bands i and

iv) corresponded to the 111-kDa PARG mRNA described

previously [26]. However, bands of reduced intensity (Fig. 1,

bands ii and v) were also observed. Control PCR reactions

with a primer specific for exon 1 and reverse primers in exon

6 (Fig. 1, band vi) or exon 18 (Fig. 1, band iii) yielded

only a single band containing the sequences predicted for

hPARG111. Sequence analyses of the cloned fragments

isolated from band ii showed that it contained two alterna-

tively spliced mRNA species of PARG that encode proteins

of calculated molecular masses of 102 kDa and 99 kDa that

were designated hPARG102 and hPARG99, respectively.

The newly identified hPARG splice variants do not contain

exon 1

Recently, we have reported the structure of the human

PARG gene [26], (NCBI GenBank Accession Number

AY258587) with its intron/exon organization and its

complete 5V upstream sequence (GenBank Accession

Number AY258588). Comparing the cDNA sequences

of the hPARG102 and hPARG99 splice variants to this

published cDNA revealed that hPARG102 does not con-

tain exon 1 and that hPARG99 does not contain either

exon 1 or exon 2, although both splice variants share the

first 51 or 55 nucleotides of the 5’UTR of the full-length

PARG cDNA, depending upon which splice donor site is

used as described below. In addition, a second hPARG102

splice variant was detected, which shares the first 74 bp

of the 5VUTR of hPARG111. Three putative splice donor

sites were identified in the 5VUTR of the PARG gene,

each of which is consistent with a consensus splice donor

sequence (G/C)AGjG(T/C)NNGT. These splice donor sites

have been designated SD1a (GAGjGCAGGT), SD1b,

M.L. Meyer-Ficca et al. / Experimental C526

which partially overlaps with SD1a (CAGjGTGGGGT,with the overlapping sequences given in italics) and

SD1c (CAGjGCGAGT) (Fig. 2, panel D). The structures

of hPARG102 and hPARG99 are consistent with the

absence of exon 1 or both exons 1 and 2, respectively,

due to these alternative splice donor sites. A schematic

model of the splicing process leading to the different

splice variants is shown in Fig. 2, panels A, B, and C for

hPARG111, hPARG102, and hPARG99, respectively. Ad-

ditional information concerning these splice variants and

EST evidence obtained through the NCBI BLAST pro-

gram supporting the occurrence of these splice variants is

presented in Table 1.

Fig. 4. hPARG111 is a nuclear protein; hPARG102 and hPARG99 are localized

HEK293 cells overexpressing different PARG isoforms (plasmids pcDNA-hPAR

antibodies recognizing the PARG N-terminal portion (a, c, e) and the PARG C-term

m). PARG fluorescence signals in cells overexpressing hPARG111 were observed i

seen in the cytoplasm (c, d, i, k; e, f, l, m). Human PARG111 protein corresponds

portion coded for by exon1 and hPARG99 lacks the region coded for by exons

putative PARG protein domains [26,46].

In vitro transcription and translation of human PARG cDNA

variants yielded proteins of different sizes

In vitro transcription and translation of the hPARG111

cDNA yielded three distinct bands of protein in an immuno-

blot analysis (Fig. 3, lane a) as observed previously [26]. The

largest product is expected to represent the 976-amino acid,

111-kDa isoform of PARG, and the two smaller bands most

likely represent alternative translation start codon usage that

results in smaller products. In vitro expression of hPARG102

yielded two detectable bands (Fig. 3, lane b), and expression

of hPARG99 resulted in detection of only a single band (Fig.

3, lane c). In contrast to hPARG111, hPARG102 does not

ell Research 297 (2004) 521–532

in the cytoplasm. Immunofluorescence staining of transiently transfected

G111, pcDNA-hPARG102, and pcDNA-hPARG99) was performed using

inal portion (g, i, l), and DNAwas counterstained using DAPI (b, d, f, h, k,

n the nucleus (a, b, g, h), while both hPARG102 and hPARG99 signals were

to the full-length cDNA, while splice isoform hPARG102 lacks the protein

1 and 2 (see scheme below images). Bold letters A, B, C, D designate the

M.L. Meyer-Ficca et al. / Experimental Cell Research 297 (2004) 521–532 527

contain the 72-amino acid segment encoded by exon 1, and

omission of exon 1 results in a transcript in which an ORF is

dependent on a translation initiation codon (ATG) which is

located further downstream in the cDNA. Translation is

predicted to start in exon 2 at amino acid 83 (M83) as the

first available methionine encoded in frame, giving rise to a

(893 aa) 102-kDa protein. At this site, the coding sequence

TGGATGG does not represent a perfect Kozak consensus

sequence (ANNATGG, [37], with the underlined nucleotides

being preferably A or G). The next available translation start

is located in exon 3 at M109 (TCCATGA) or, more likely,

M110 (ATGATGA), which would give rise to a protein of 99

kDa (hPARG99). Therefore, the observed double band of

hPARG102 likely corresponds to the 102-kDa and the 99-

kDa forms, with the latter being the predominant product

Fig. 5. PARG exon 1 contains a nuclear localization signal. Transiently transfecte

region to a GFL reporter protein. The fusion protein (plasmid pCMV-Ex1-GFL) w

EGFPnuc, Clontech; (c, d), while the unfused reporter protein (pRSV-GFL) was

contains two motives with putative NLS function (NLS #1 and NLS #2). Site-dire

n), while mutagenesis of NLS #2 had no effect on nuclear localization (i, k, n). A

been described of having homology to the PARP-1 bipartite nuclear localization s

panel o).

under the conditions of the experiment. Translation of

hPARG99 resulted in a single detectable product, which

was expected as M109 or M110 are the first available

translation initiation sites in this splice variant. In conclu-

sion, the three products of hPARG111 expression would

correspond to translation of the 111-kDa, 102-kDa, and 99-

kDa ORFs; the two products of hPARG102 expression

would correspond to the 102-kDa and 99-kDa ORFs; and

hPARG99 expression would correspond to the 99-kDa ORF.

Overexpressed hPARG111 localizes predominantly to the

nucleus, while hPARG102 and hPARG99 are cytoplasmic

To determine if the three PARG splice variants encode

proteins targeted to different subcellular compartments,

d HEK293 cells overexpress a fusion protein of the PARG exon 1 encoded

as targeted to the nucleus (a, b) as observed with a positive control (pEF1-

preferentially cytoplasmic (e, f). The peptide sequence encoded by exon 1

cted mutagenesis of NLS#1 completely abolished nuclear localization (g, h,

fusion protein of the GFL reporter with a PARG region that has previously

ignal [27] was only observed to be cytoplasmic (l, m; pCMV-bpNLS-GFL,

Fig. 6. Endogenous PARG is detectable mainly as an extranuclear isoform.

Panel a shows an immunofluorescence staining of HeLa cells using an

antiserum specific for the C-terminal portion of PARG; in panel b, DNA

was counterstained with DAPI (Magnification �400). The overall cellular

PARG amount is very low, and long exposures were necessary for the

images shown. PARG signals could be observed predominantly in the

cytoplasmic region of the cells. However, some weaker signals could be

seen in the nucleus as well. Comparable results were also obtained using an

antiserum specific for the N-terminal portion of the PARG protein (not

shown). Panel c shows a Western blot analysis of endogenous PARG using

an antiserum specific for the N-terminal portion of PARG. HeLa cells were

found to express all three described PARG isoforms (hPARG111,

hPARG102, and hPARG99, see arrows). We found the shorter isoforms,

especially PARG102, to be the main endogenously expressed forms (middle

arrow), while only little amounts of hPARG111 could be detected (upper

arrow).

M.L. Meyer-Ficca et al. / Experimental Cell Research 297 (2004) 521–532528

hPARG111, hPARG102, and hPARG99 (Fig. 4, lower

panel) were transiently overexpressed in HEK293 cells

and detected by immunofluorescence staining with antisera

that recognize either the C-terminal or the N-terminal

regions of the PARG protein. The N-terminus-specific

polyclonal antibody recognizes epitopes throughout the

amino-terminal half of the full-length PARG allowing for

detection of all three PARG proteins including PARG99

[26]. Overexpression of hPARG111 showed a distinct

nuclear localization (Figs. 4a, b, g, h), while overexpressed

hPARG102 (Figs. 4c, d, i, k) and hPARG99 (Figs. 4e, f, l,

m) demonstrated primarily a cytoplasmic localization. These

results indicate that exon 1 of PARG codes for amino acid

sequences responsible for targeting hPARG111 to the nu-

cleus while the hPARG102 and hPARG99 isoforms are

targeted to cytoplasmic locations.

Exon 1 of the human PARG gene encodes a nuclear

localization signal (NLS)

The results shown in Fig. 4 indicate the presence of one

or more NLS in amino acids encoded by exon 1. Addi-

tionally, previous studies had revealed the presence of a

putative bipartite NLS sequence in PARG that was located

in a central region of PARG [27]. Computational analyses

of the amino acid sequences using the PSORTII program

(http://psort.nibb.ac.jp) revealed two candidate NLS

sequences in exon 1, namely, 10CTKRPRW16 (putative

NLS #1) and 32PSRQRRV38 (putative NLS #2). To deter-

mine if these sequences encoded an NLS, the cDNA

sequence of exon 1 was amplified by PCR from plasmid

pcDNA-hPARG [26]; the product was ligated in frame to

the 5V end of the GFL reporter gene [34] and subcloned

into an expression vector pCMV-Ex1-GFL (Fig. 5, panel

n). Transfection of pCMV-Ex1-GFL into HEK293 cells

resulted in nuclear fluorescence in the transfected cells

(Figs. 5a, b), while cells transfected with the control

plasmid pRSV-GFL (without PARG exon 1) showed

cytoplasmic fluorescence (Figs. 5e, f). This demonstrates

the ability of the region of PARG encoded by exon 1 to

achieve nuclear targeting. To determine if either or both of

the putative NLS sequences were essential for the observed

nuclear targeting of PARG, site-directed mutagenesis was

used. For both putative NLS sequences, two presumably

essential basic amino acids were mutated. For putative

NLS #1, a K12A, R13G mutant was generated and for

putative NLS #2, a R36A, R37G mutant was generated.

Transfection of the mutated reporter plasmids into

HEK293 cells revealed that alteration of the peptide

sequence 10CTKRPRW16 abolished nuclear targeting of

the reporter fusion protein (Figs. 5g, h), while alteration

of the peptide sequence 32PSPQRRV38 had no effect on

the nuclear targeting of the reporter fusion protein (Figs.

5i, k). The peptide sequence 10CTKRPRW16 was therefore

identified as an NLS in the exon 1 encoded region of

hPARG111. The possibility that the previously reported

putative bipartite NLS is involved in targeting PARG to

the nucleus also was examined (Fig. 5o). As shown in Fig.

5 (panels l and m), no preferential nuclear localization of

the reporter fusion protein containing the putative bipartite

NLS was observed.

Endogenous PARG is mainly cytoplasmic

The results described above indicate that splice var-

iants of PARG gene transcription are involved in targeting

PARG proteins to different subcellular compartments. We

next addressed the question of the subcellular distribution

of endogenous PARG. This question was difficult to

address, because the endogenous levels of PARG are

very low, near the limit of detection by immunofluores-

cence as judged by the low background in the HEK293

cells transfected with PARG expression plasmids (e.g.,

Fig. 4). However, it was possible to detect PARG

fluorescence in HeLa cells as shown in Fig. 6. When

M.L. Meyer-Ficca et al. / Experimental Cell Research 297 (2004) 521–532 529

the PARG C-terminus-specific antiserum was used, which

should detect all PARG variants equally well, endogenous

PARG was observed throughout the cell, although cyto-

plasmic fluorescence was more intense than nuclear

fluorescence. This result predicts that the cytoplasmic

isoforms of PARG should be more prevalent than nuclear

isoforms. This prediction was confirmed by a Western

blot analysis of HeLa cell lysates. Fig. 6, panel C,

compares the detection of PARG isoforms derived from

in vitro translation of hPARG111 (lane b), hPARG 102

(lane c), and hPARG 99 (lane d) with endogenous PARG

(lane a). Note that the detection of the multiple bands of

hPARG111 and hPARG102 is not as well resolved as

shown in Fig. 3 as the immunoblot had to be over-

exposed to detect the endogenous PARG. To further

examine the subcellular distribution of PARG, HEK293

and HeLa cell extracts were fractionated into nuclear and

cytosolic fractions and assayed for PARG activity. The

purity of the isolated fractions was verified by immuno-

blotting using an antihistone antibody (results not shown).

Table 2 shows that, although the specific activity of

PARG was higher in HeLa cells than in HEK293 cells,

the majority of total PARG activity was associated with

the cytosolic fraction for both cell types. In untreated cells,

the nuclear fraction accounted for only 19% and 8% of

total PARG activity for HEK293 and HeLa cells, respec-

tively. For HEK293 cells, the distribution of PARG activity

in cells treated for 15 min with 500 AM MNNG was

compared to untreated cells. The MNNG treatment resulted

in a decrease in activity in the nuclear fraction and an

increase in the cytosolic fraction. Taken together, the

results of Fig. 6 and Table 1 provide a consistent picture,

indicating that the majority of PARG has a cytoplasmic

location due to the predominance of the PARG102 and

PARG 99 isoforms.

Table 2

PARG activity in nuclear and cytoplasmic fractions of HEK293 and HeLa

cells

Cell line and condition Poly(ADP-ribose) glycohydrolase activity

Specific activity Total activity

Nuclear Cytosolic Nuclear Cytosolic

pmol/

min/

mg

pmol/

min/

mg

Total

units

%

Total

Total

units

%

Total

HEK293

untreated

366

(F38)

111

(F4)

553

(F57)

19 2330

(F84)

80

HEK293

MNNG

treated

248

(F15)

145

(F13)

393

(F24)

10 3402

(F305)

90

HeLa

untreated

550

(F70)

512

(F30)

780

(F99)

8 8850

(F520)

92

Nuclear and cytosolic fractions were isolated and assayed for PARG

activity as described in Materials and methods. PARG activities shown

represent the mean and SEM of duplicate analyses. Values shown are from

a representative experiment.

Discussion

We have observed that the gene encoding human PARG

is transcribed and processed into splice variants that encode

at least three different protein isoforms with different

molecular weight, namely, 111 kDa, 102 kDa and 99 kDa.

While the 111-kDa PARG is located in the nucleus, the other

two proteins appear to be cytoplasmic. Our results demon-

strate that the amino acids encoded by exon 1, specifically

residues 10CTKRPRW16, represent an NLS for targeting

PARG to the nucleus (Figs. 4 and 5). This sequence is

highly conserved among all known PARG proteins of

mammalian species, and it is in good agreement with the

consensus sequence proposed for monopartite nuclear lo-

calization signals (K/R) RX (K/R) [38]. Subcellular target-

ing of a protein is a result of the influence of signaling

sequences present within the protein and potentially the

interactions with other proteins. Although we have shown

the presence of an active NLS in the N-terminal region of

PARG encoded by exon 1, we cannot exclude that this

region could also be capable of mediating nuclear targeting

by other mechanisms, such as the mediation of protein–

protein interactions between hPARG111 and other NLS-

containing proteins.

Previously, we have reported that PARG contains an

evolutionary conserved region (amino acids 414–450)

showing close analogy to the bipartite NLS in PARP-1

[27]. However, this amino acid sequence does not target a

reporter protein to the nucleus (Figs. 5l, m), and thus it does

not appear to code for a NLS. This region of PARG

probably serves as a hinge region between the putative

regulatory domain A (Fig. 4, lower panel) and the catalytic

domain (B, C, D). This view is supported by the observation

that isolated PARG protein is highly sensitive to protease

cleavage in this region [27,30]. However, our results indi-

cate that nuclear hPARG111 is not cleaved to a great extent

as antibodies directed against both amino terminal (Figs. 4a,

b) and carboxyl terminal regions (Figs. 4g, h) of PARG

indicate a primarily nuclear localization for hPARG111,

although some faint cytoplasmic localization is observed.

A putative nuclear export signal (NES) has been described

in amino acids 126–134 of PARG [29], which might

explain the preferential cytoplasmic localization of the

PARG isoforms lacking exon 1. However, the significance

of this NES is still not entirely clear, as PARG fragments of

74 kDa and 85 kDa, lacking the NES, have also been shown

to reside in the cytoplasm [39]. The presence of other not

yet identified NES sequences or an interaction between

PARG and another NES-containing protein therefore still

needs to be investigated.

Our results provide an explanation of previous studies

that have observed different subcellular localizations of

PARG. In other reports of bovine PARG overexpression

[30,31] that resulted in a perinuclear localization of the

protein, a cDNA that lacked the first 74 amino acids present

in PARG111 was used and thus did not contain the NLS

M.L. Meyer-Ficca et al. / Experimental Cell Research 297 (2004) 521–532530

identified in the study reported here. A recent report

suggested that the previously expressed bovine PARG

protein was indeed an alternatively spliced PARG isoform

as the cDNA used in that study lacked PARG exon 1 [39].

This isoform, therefore, corresponds to the human

PARG102 isoform described here. Another recent study

has reported that fusion of GFP to the amino terminus of

a full-length human PARG cDNA targets GFP to the

nucleus during interphase and to the cytoplasm during

mitosis [25]. This result is consistent with our finding that

the NLS of PARG is present in the GFP-PARG fusion

protein used in that study.

By virtue of the lack of amino acids encoded by exon 1,

hPARG102 and hPARG99 are targeted to a cytoplasmic

location within the cell. Further studies will be needed to

determine the significance of two different extranuclear iso-

forms of PARG. While our studies demonstrate that alterna-

tive splicing of PARG transcripts can achieve both nuclear

and cytoplasmic targeting, results presented here also suggest

another possibility for achieving different PARG isoforms.

As shown in Figs. 3 and 6c (lane b), in vitro transcription and

translation of hPARG111 resulted in the presence of several

PARG isoforms. They likely arise via alternative sites of

translation initiation, because their size corresponds to the

sizes of the splice variants, which use the respective start

codons, but could theoretically also be proteolytic cleavage

products. However, our results suggest that alternative splic-

ing rather than alternative translation initiation of hPARG111

is the primary mechanism for generation of PARG isoforms

in vivo. This conclusion is based on the observation that

overexpression of hPARG111 from a cDNA construct in

transfected cells (Figs. 4a, b) led to an increase in nuclear

PARG with only minor expression of cytoplasmic PARG.

Our results indicating that the cytoplasmic isoforms of

PARG predominate within the cell (Fig. 6, Table 1) are

somewhat surprising as most PARPs identified to date are

nuclear enzymes. A similar finding describing the majority

of PARG in the soluble fractions of HeLa S3 cells [39],

which correspond to a cytoplasmic localization, is also in

line with our report. It is not clear at present whether the

presence of most PARG in the cytoplasmic cell compart-

ment(s) indicates the presence of as yet undetected PARPs

located outside of the nucleus or as yet undiscovered roles

for PARG. Hanai et al. [40] have shown that a cytoplasmic

accumulation of poly(ADP-ribose) observed in Drosophila

melanogaster PARG loss-of-function mutants resulted in

severe neurodegeneration. Therefore, the presence of PARG

in the cytoplasm might be essential for proper DNA damage

or cell death signaling.

A PARG nuclear-shuttling mechanism has been proposed

[25,41,42] by which cytoplasmic PARG can translocate to

the nucleus under conditions of genotoxic stress, although

our results shown in Table 1 do not support such a

mechanism as the PARG activity in isolated nuclear frac-

tions decreased in MNNG-treated cells compared to un-

treated cells. However, our experiments could not rule out

a mechanism by which PARG would be lost from the

nucleus in MNNG-treated cells.

It has been proposed that 35–60% of all human genes

show alternative splicing [43], leading to more than one

gene product. The mechanism of alternative splicing lead-

ing to expression of proteins targeted to different locations

within the cell has been observed for other proteins. This

mechanism has been described for the uracil-DNA glyco-

sylases UNG1 (mitochondrial) and UNG2 (nuclear), which

rely on alternative splicing in the 5Vregion of the UNG

gene to generate isoforms targeted to the mitochondrial

and nuclear compartments of the cell [44]. These variants

have an additional noncoding exon 1a, as also found in the

PARG gene (see Fig. 2), but in addition, there is also a

second transcription start that is created by another up-

stream promoter. Intriguingly, the uracil-DNA glycosylases

are important participants in the base excision repair

pathway, in which PARP-1 and PARG are also involved

[11]. Another pair of enzymes, the dUTPases DUT-N

(nuclear) and DUT-M (mitochondrial), is spliced alterna-

tively at their 5V end to form two different isoforms [45] by

a mechanism that closely resembles the one reported here

for PARG.

Taken together, the discovery of the PARG protein family

reported here resolves some of the dilemmas raised by the

presence of a PARP enzyme family with more than seven

members that localize in many different cellular compart-

ments, while only a single gene encodes poly(ADP-ribose)

glycohydrolase. On the other hand, the presence of the

majority of PARG activity in the cytoplasmic compartment

of the cell raises interesting new questions concerning the

function of PARG.

Acknowledgments

This work was supported by research grants from the

NIH (CA-43894) and Niadyne, Inc. MKJ and ELJ are

principals in Niadyne Inc., whose sponsored research is

managed in accordance with University of Arizona conflict-

of-interest policies. RGM was supported by NIH training

grant CA-09213. DNA sequence analyses were performed

by the University of Arizona Genetic Analysis and

Technology Core Service Facility.

References

[1] S. Shall, G. de Murcia, Poly(ADP-ribose) polymerase-1: what have we

learned from the deficient mousemodel?Mutat. Res. 460 (2000) 1–15.

[2] Z. Herceg, Z.Q. Wang, Functions of poly(ADP-ribose) polymerase

(PARP) in DNA repair, genomic integrity and cell death, Mutat. Res.

477 (2001) 97–110.

[3] S. Smith, The world according to PARP, Trends Biochem. Sci. 26

(2001) 174–179.

[4] K. Ueda, O. Hayaishi, ADP-ribosylation, Annu. Rev. Biochem. 54

(1985) 73–100.

M.L. Meyer-Ficca et al. / Experimental Cell Research 297 (2004) 521–532 531

[5] F.R. Althaus, C. Richter, ADP-ribosylation of proteins. Enzymology

and biological significance, Mol. Biol. Biochem. Biophys. 37 (1987)

1–237.

[6] D. D’Amours, S. Desnoyers, I. D’Silva, G.G. Poirier, Poly(ADP-

ribosyl)ation reactions in the regulation of nuclear functions, Bio-

chem. J. 342 (Pt. 2) (1999) 249–268.

[7] G. de Murcia, J. Menissier de Murcia, Poly(ADP-ribose) polymer-

ase: a molecular nick-sensor, Trends Biochem. Sci. 19 (1994)

172–176.

[8] M.K. Jacobson, E.L. Jacobson, Discovering new ADP-ribose poly-

mer cycles: protecting the genome and more, Trends Biochem.

Sci. 24 (1999) 415–417.

[9] A.A. Pieper, A. Verma, J. Zhang, S.H. Snyder, Poly (ADP-ribose)

polymerase, nitric oxide and cell death, Trends Pharmacol. Sci. 20

(1999) 171–181.

[10] J.C. Ame, E.L. Jacobson, M.K. Jacobson, ADP-ribose polymer me-

tabolism, in: G. de Murcia, S. Shall (Eds.), From DNA Damage and

Stress Signalling to Cell Death: Poly ADP-Ribosylation Reactions,

2000, pp. 1–34.

[11] A. Burkle, Poly(ADP-ribosyl)ation: a posttranslational protein modi-

fication linked with genome protection and mammalian longevity,

Biogerontology 1 (2000) 41–46.

[12] L. Van Gool, R. Meyer, E. Tobiasch, C. Cziepluch, J.C. Jauniaux,

A. Mincheva, P. Lichter, G.G. Poirier, A. Burkle, J.H. Kupper,

Overexpression of human poly(ADP-ribose) polymerase in trans-

fected hamster cells leads to increased poly(ADP-ribosyl)ation and

cellular sensitization to gamma irradiation, Eur. J. Biochem. 244

(1997) 15–20.

[13] R. Meyer, M. Muller, S. Beneke, J.H. Kupper, A. Burkle, Negative

regulation of alkylation-induced sister-chromatid exchange by po-

ly(ADP-ribose) polymerase-1 activity, Int. J. Cancer 88 (2000)

351–355.

[14] A. Burkle, PARP-1: a regulator of genomic stability linked with

mammalian longevity, Chembiochemistry 2 (2001) 725–728.

[15] J.P. Gagne, R.G. Shah, G.G. Poirier, Analysis of ADP-ribose

polymer sizes in intact cells, Mol. Cell. Biochem. 224 (2001)

183–185.

[16] K. Ikai, K. Ueda, Immunohistochemical demonstration of poly(ade-

nosine diphosphate-ribose) synthetase in bovine tissues, J. Histochem.

Cytochem. 31 (1983) 1261–1264.

[17] J.C. Ame, V. Rolli, V. Schreiber, C. Niedergang, F. Apiou, P. Decker,

S. Muller, T. Hoger, J. Menissier-de Murcia, G. de Murcia, PARP-2, a

novel mammalian DNA damage-dependent poly(ADP-ribose) poly-

merase, J. Biol. Chem. 274 (1999) 17860–17868.

[18] S. Smith, I. Giriat, A. Schmitt, T. de Lange, Tankyrase, a poly

(ADP-ribose) polymerase at human telomeres, Science 282 (1998)

1484–1487.

[19] A. Saxena, L.H. Wong, P. Kalitsis, E. Earle, L.G. Shaffer, K.H. Choo,

Poly(ADP-ribose) polymerase 2 localizes to mammalian active cen-

tromeres and interacts with PARP-1, Cenpa, Cenpb and Bub3, but not

Cenpc, Hum. Mol. Genet. 11 (2002) 2319–2329.

[20] M. Kanai, W.M. Tong, E. Sugihara, Z.Q. Wang, K. Fukasawa, M.

Miwa, Involvement of poly(ADP-ribose) polymerase 1 and poly

(ADP-ribosyl)ation in regulation of centrosome function, Mol. Cell.

Biol. 23 (2003) 2451–2462.

[21] A. Augustin, C. Spenlehauer, H. Dumond, J. Menissier-De Murcia,

M. Piel, A.C. Schmit, F. Apiou, J.L. Vonesch, M. Kock, M. Bornens,

G. De Murcia, PARP-3 localizes preferentially to the daughter centri-

ole and interferes with the G1/S cell cycle progression, J. Cell Sci. 116

(2003) 1551–1562.

[22] V.A. Kickhoefer, A.C. Siva, N.L. Kedersha, E.M. Inman, C.

Ruland, M. Streuli, L.H. Rome, The 193-kD vault protein, VPARP,

is a novel poly(ADP-ribose) polymerase, J. Cell Biol. 146 (1999)

917–928.

[23] N.W. Chi, H.F. Lodish, Tankyrase is a Golgi-associated mitogen-

activated protein kinase substrate that interacts with IRAP in

GLUT4 vesicles, J. Biol. Chem. 275 (2000) 38437–38444.

[24] R.J. Lyons, R. Deane, D.K. Lynch, Z.S. Ye, G.M. Sanderson, H.J.

Eyre, G.R. Sutherland, R.J. Daly, Identification of a novel human

tankyrase through its interaction with the adaptor protein Grb14,

J. Biol. Chem. 276 (2001) 17172–17180.

[25] S. Ohashi, M. Kanai, S. Hanai, F. Uchiumi, H. Maruta, S. Tanuma, M.

Miwa, Subcellular localization of poly(ADP-ribose) glycohydrolase

in mammalian cells, Biochem. Biophys. Res. Commun. 307 (2003)

915–921.

[26] R.G. Meyer, M.L. Meyer-Ficca, E.L. Jacobson, M.K. Jacobson, Hu-

man poly(ADP-ribose) glycohydrolase (PARG) gene and the common

promoter sequence it shares with inner mitochondrial membrane

translocase 23 (TIM23), Gene 314 (2003) 181–190.

[27] W. Lin, J.C. Ame, N. Aboul-Ela, E.L. Jacobson, M.K. Jacobson, Iso-

lation and characterization of the cDNA encoding bovine poly(ADP-

ribose) glycohydrolase, J. Biol. Chem. 272 (1997) 11895–11901.

[28] J.C. Ame, F. Apiou, E.L. Jacobson, M.K. Jacobson, Assignment of

the poly(ADP-ribose) glycohydrolase gene (PARG) to human chro-

mosome 10q11.23 and mouse chromosome 14B by in situ hybridiza-

tion, Cytogenet. Cell Genet. 85 (1999) 269–270.

[29] T. Shimokawa, M. Masutani, S. Nagasawa, T. Nozaki, N. Ikota, Y.

Aoki, H. Nakagama, T. Sugimura, Isolation and cloning of rat po-

ly(ADP-ribose) glycohydrolase: presence of a potential nuclear ex-

port signal conserved in mammalian orthologs, J. Biochem. (Tokyo)

126 (1999) 748–755.

[30] E. Winstall, E.B. Affar, R. Shah, S. Bourassa, A.I. Scovassi, G.G.

Poirier, Poly(ADP-ribose) glycohydrolase is present and active in

mammalian cells as a 110-kDa protein, Exp. Cell Res. 246 (1999)

395–398.

[31] E. Winstall, E.B. Affar, R. Shah, S. Bourassa, I.A. Scovassi, G.G.

Poirier, Preferential perinuclear localization of poly(ADP-ribose) gly-

cohydrolase, Exp. Cell Res. 251 (1999) 372–378.

[32] S.F. Altschul, T.L. Madden, A.A. Schaffer, J. Zhang, Z. Zhang, W.

Miller, D.J. Lipman, Gapped BLAST and PSI-BLAST: a new gen-

eration of protein database search programs, Nucleic Acids Res. 25

(1997) 3389–3402.

[33] F.M. Ausubel, R. Brent, R.E. Kingston, D.D. Moore, J.G. Seid-

man, J.A. Smith, K. Struhl, Current Protocols in Molecular Biology,

Wiley-Interscience, New York, 1998.

[34] R.G. Meyer, J.H. Kupper, R. Kandolf, H.P. Rodemann, Early growth

response-1 gene (Egr-1) promoter induction by ionizing radiation in

U87 malignant glioma cells in vitro, Eur. J. Biochem. 269 (2002)

337–346.

[35] J.C. Ame, E.L. Jacobson, M.K. Jacobson, Molecular heterogeneity

and regulation of poly(ADP-ribose) glycohydrolase, Mol. Cell. Bio-

chem. 193 (1999) 75–81.

[36] L. Menard, G.G. Poirier, Rapid assay of poly(ADP-ribose) glycohy-

drolase, Biochem. Cell Biol. 65 (1987) 668–673.

[37] M. Kozak, Compilation and analysis of sequences upstream from the

translational start site in eukaryotic mRNAs, Nucleic Acids Res. 12

(1984) 857–872.

[38] M.R. Hodel, A.H. Corbett, A.E. Hodel, Dissection of a nuclear local-

ization signal, J. Biol. Chem. 276 (2001) 1317–1325.

[39] M.E. Bonicalzi, M. Vodenicharov, M. Coulombe, J.P. Gagne, G.G.

Poirier, Alteration of poly(ADP-ribose) glycohydrolase nucleocyto-

plasmic shuttling characteristics upon cleavage by apoptotic pro-

teases, Biol. Cell 95 (2003) 635–644.

[40] S. Hanai, M. Kanai, S. Ohashi, K. Okamoto, M. Yamada, H. Takaha-

shi, M. Miwa, Loss of poly(ADP-ribose) glycohydrolase causes pro-

gressive neurodegeneration in Drosophila melanogaster, Proc. Natl.

Acad. Sci. U. S. A. 101 (2004) 82–86.

[41] E.B. Affar, M. Germain, E. Winstall, M. Vodenicharov, R.G. Shah,

G.S. Salvesen, G.G. Poirier, Caspase-3-mediated processing of poly

(ADP-ribose) glycohydrolase during apoptosis, J. Biol. Chem. 276

(2001) 2935–2942.

[42] L. Davidovic, M. Vodenicharov, E.B. Affar, G.G. Poirier, Importance

of poly(ADP-ribose) glycohydrolase in the control of poly(ADP-

ribose) metabolism, Exp. Cell Res. 268 (2001) 7–13.

M.L. Meyer-Ficca et al. / Experimental Cell Research 297 (2004) 521–532532

[43] B. Modrek, C. Lee, A genomic view of alternative splicing, Nat.

Genet. 30 (2002) 13–19.

[44] H. Nilsen, M. Otterlei, T. Haug, K. Solum, T.A. Nagelhus, F. Skor-

pen, H.E. Krokan, Nuclear and mitochondrial uracil-DNA glycosy-

lases are generated by alternative splicing and transcription from

different positions in the UNG gene, Nucleic Acids Res. 25

(1997) 750–755.

[45] R.D. Ladner, S.J. Caradonna, The human dUTPase gene encodes both

nuclear and mitochondrial isoforms. Differential expression of the iso-

forms and characterization of a cDNA encoding the mitochondrial

species, J. Biol. Chem. 272 (1997) 19072–19080.

[46] M.A. Oliveira, D. Koh, C.N. Patel, M.K. Jacobson, Structure-

based characterization of a novel anticancer target poly(ADP-ribose)

glycohydrolase (PARG): evidence for the presence of an ADP-ribo-

syl-transferase (ADPRT) fold, Proc. Am. Assoc. Cancer Res. 42

(2001) 832.