Human Clostridium difficile infection: inhibition of NHE3 and microbiota profile

Human Clostridium difficile infection: inhibition of NHE3 and microbiotaprofile

Melinda A. Engevik,1 Kristen A. Engevik,1 Mary Beth Yacyshyn,3 Jiang Wang,4 Daniel J. Hassett,2

Benjamin Darien,5 Bruce R. Yacyshyn,3,6 and Roger T. Worrell1,6

1Department of Molecular and Cellular Physiology, University of Cincinnati College of Medicine, Cincinnati, Ohio;2Department of Molecular Genetics, Biochemistry and Microbiology, University of Cincinnati College of Medicine,Cincinnati, Ohio; 3Department of Medicine Division of Digestive Diseases, University of Cincinnati Collegeof Medicine, Cincinnati, Ohio; 4Department of Pathology and Laboratory Medicine, University of Cincinnati College ofMedicine, Cincinnati, Ohio; 5Department of Animal Health and Biomedical Sciences, University Wisconsin, Madison,Wisconsin; and 6Digestive Health Center of Cincinnati Children’s Hospital, Cincinnati, Ohio

Submitted 11 March 2014; accepted in final form 23 December 2014

Engevik MA, Engevik KA, Yacyshyn MB, Wang J, Hassett DJ,Darien B, Yacyshyn BR, Worrell RT. Human Clostridium difficileinfection: inhibition of NHE3 and microbiota profile. Am J PhysiolGastrointest Liver Physiol 308: G497–G509, 2015. First publishedDecember 31, 2014; doi:10.1152/ajpgi.00090.2014.—Clostridiumdifficile infection (CDI) is principally responsible for hospital ac-quired, antibiotic-induced diarrhea and colitis and represents a signif-icant financial burden on our healthcare system. Little is known aboutC. difficile proliferation requirements, and a better understanding ofthese parameters is critical for development of new therapeutic tar-gets. In cell lines, C. difficile toxin B has been shown to inhibitNa�/H� exchanger 3 (NHE3) and loss of NHE3 in mice results in analtered intestinal environment coupled with a transformed gut micro-biota composition. However, this has yet to be established in vivo inhumans. We hypothesize that C. difficile toxin inhibits NHE3, result-ing in alteration of the intestinal environment and gut microbiota. Ourresults demonstrate that CDI patient biopsy specimens have decreasedNHE3 expression and CDI stool has elevated Na� and is morealkaline compared with stool from healthy individuals. CDI stoolmicrobiota have increased Bacteroidetes and Proteobacteria and de-creased Firmicutes phyla compared with healthy subjects. In vitro, C.difficile grows optimally in the presence of elevated Na� and alkalinepH, conditions that correlate to changes observed in CDI patients. Toconfirm that inhibition of NHE3 was specific to C. difficile, humanintestinal organoids (HIOs) were injected with C. difficile or healthyand CDI stool supernatant. Injection of C. difficile and CDI stooldecreased NHE3 mRNA and protein expression compared withhealthy stool and control HIOs. Together these data demonstrate thatC. difficile inhibits NHE3 in vivo, which creates an altered environ-ment favored by C. difficile.

C. difficile; diarrhea; gut microbiota; intestinal organoids; NHE3

CLOSTRIDIUM DIFFICILE IS A Gram-positive anaerobic bacteriumfrom the phylum Firmicutes that is responsible for the majorityof antibiotic-associated diarrhea (17). C. difficile infection(CDI) affects thousands of patients each year and treatmentcosts of over 1 billion dollars in the United States (11, 18, 49,59). Furthermore, C. difficile-related deaths have been steadilyrising since 1999 (54) and will likely remain a problem,especially in the face of current antibiotic regimens. CDI hasbeen associated with a spectrum of symptoms ranging frommild to watery diarrhea and abdominal pain to life-threatening

pseudomembranous colitis and toxic megacolon (8). Althoughmost of the symptoms of CDI have been linked to C. difficiletoxin production (31, 37, 41), the mechanism of C. difficilecolonization is still unclear. Thus a better understanding of C.difficile pathogenesis is critical for developing new therapeu-tics.

C. difficile pathogenesis has been hypothesized to be athree-step process: 1) antibiotic disruption of the normal gutmicrobiota provides a potential niche for growth from itsnormal gut spore form; 2) the colonization phase, whichincludes bacterial-host interaction and adhesion; and 3) multi-plication that maintains high numbers of vegetative C. difficileand toxin production, both of which exacerbate the infectiousprocess (15, 34). Antibiotic use has been shown to decrease thedominant gut microbiota bacterial phyla Bacteroidetes andFirmicutes (40) and increase Proteobacteria (1, 14, 16, 30, 35,43, 62), resulting in increased gut susceptibility to C. difficileinfection (2, 5, 36, 52, 55, 67, 78). Once C. difficile binds to thegastrointestinal (GI) mucus layer (15, 69), the bacterium candeliver two exotoxins, toxin A (TcdA) and toxin B (TcdB) (17,32, 74). The Tcd toxins bind to uncharacterized host receptorsand are then internalized into the enterocyte cytoplasm, wherethey become enzymatically active and glycosylate the Rhofamily of GTPases (19, 29). Inhibition of such GTPases hasbeen shown to have several effects including 1) disorganizationof the host actin cytoskeleton, 2) loss of cellular tight junctions,3) disruption of signaling cascades, and 4) arrest of cell cycleprogression (3, 15, 19, 33). In addition, toxin B inhibition ofRho GTPase in cell lines leads to the internalization of theNa�/H� exchanger isoform 3 (NHE3) (29), but this has yet tobe established in vivo in animals or in humans. Inhibition ofNHE3 in mice results in chronic diarrhea (25, 60), elevatedNa� and alkaline luminal fluid, and an altered microbiotacomposition with decreased members of Firmicutes and in-creased Bacteroidetes (20). It has been suggested that thediarrhea associated with CDI is a result of damage to the hostepithelium or a response designed to “flush out” the pathogen.However, we hypothesize that C. difficile toxin productioninhibits NHE3, creating an altered intestinal microenvironmentand gut microbiota composition, which favor C. difficile pro-liferation and colonization of the mucosal lining. In this study,we demonstrate that biopsy specimens from patients with CDIhave decreased NHE3 with increased Bacteroidetes and de-creased Firmicutes phyla in their stool. In vitro, C. difficilegrowth depends on the high Na� concentration ([Na�]) and a

Address for reprint requests and other correspondence: R. T. Worrell, Dept.of Molecular and Cellular Physiology, Univ. of Cincinnati College of Medi-cine, Cincinnati, OH 45267 (e-mail: [email protected]).

Am J Physiol Gastrointest Liver Physiol 308: G497–G509, 2015.First published December 31, 2014; doi:10.1152/ajpgi.00090.2014.

0193-1857/15 Copyright © 2015 the American Physiological Societyhttp://www.ajpgi.org G497

mailto:[email protected]

more alkaline environment, which can be caused by downregu-lation of NHE3. This study is the first to demonstrate down-regulation of NHE3 and an altered luminal environment inpatients with CDI.

METHODS

Patient information. All patients and healthy volunteers at theUniversity of Cincinnati Medical Center Hospital, Cincinnati, OH,provided informed consent approved by the University of CincinnatiInstitutional Review Board. Samples were evaluated from patientswith recurrent CDI. Initial CDI cases, defined as only one C. difficile-positive laboratory test with no prior history of CDI, were notincluded in this study. Recurrent CDI was defined as onset of newdiarrhea after a symptom-free period of �3 days, more than one C.difficile-positive laboratory test, and completion of at least one roundof antibiotic treatment. C. difficile infection (CDI) was defined as anew onset of diarrhea (�3 loose stools/day for �24 h) and at least onepositive C. difficile laboratory test. Diagnosis of CDI was determinedby at least one ELISA-positive toxin test or a positive lysosome-associated membrane protein (LAMP) test. Over the course of fecalcollections, two types of toxin tests were used. From November 2010to August 2011, the enzyme immunoassay for toxins A and B wasused. After August 2011, the Meridian Illumigene LAMP test wasused. This shift in toxin testing represents a switch to in-house testing,lowering the cost, and an upgrade to a more sensitive method.

Fecal samples were collected from 12 recurrent CDI patients withan average age of 56, age range of 32–76. This group included eightfemales and four males. Selected patients did not have history ofinflammatory bowel disease, small bowel obstruction, diverticulosis,colostomy, or cancer. Fecal samples were also collected from 12healthy volunteers with an average age of 41, age range of 28–61.This group included seven females and five males. To address anti-biotic use and stool composition, fecal samples were collected fromeight patients with diarrhea, no antibiotics (age range: 34–67; meanage: 49; female: 3; male: 5), five patients with normal stool andantibiotics (vancoymcin/clindamycin) but without CDI infection (agerange: 29–56; mean age: 39; female: 4; male: 1), and seven patientswith diarrhea and antibiotics (vancoymcin/clindamycin) but withoutCDI infection (age range: 38–70; mean age: 52; female: 4; male: 3).Healthy volunteers and patients with diarrhea and/or antibiotics werewithout previous or current GI symptoms and history of chronicdisease or cancer. All stool samples were processed for total DNA, ionconcentration, and pH and stored at �20°C.

Colon biopsy specimens collected from five healthy volunteerswere obtained by consent and fixed in neutral buffered formalin andparaffin embedded. Healthy subjects had an average age of 52 andpatient age range of 45–63 and included three females and two males.Healthy volunteers were without previous or current GI symptomsand history of chronic disease or cancer. Paraffin sections of biopsiesand colon resections were obtained from five de-identified patientswith a current CDI diagnosis (C. difficile-positive toxin test) and noother known morbidity/disorder. The average patient age 44 andpatient age range of 28–65 and included two females and three males.Selected patients did not have history of inflammatory bowel diseasesmall bowel obstruction, diverticulosis, colostomy, or cancer. Confir-mation of C. difficile infection was performed by tissue staining withC. difficile-specific antibody as described below.

Histology. Healthy and CDI biopsy and surgical resections wereobtained from the transverse colon and fixed overnight at 4°C inneutral-buffered formalin and embedded in paraffin. Serial 6- to7-�m-thick sections were applied to glass slides, and intestinal archi-tecture was examined by hematoxylin and eosin staining. Expressionof NHE3 was examined with rabbit anti-human NHE3 antibody(dilution 1:100, NBP1-82574; Novus Biologicals, Littleton, CO), andC. difficile binding was examined with rabbit anti-C. difficile cellsurface protein antibody (dilution 1:100, ab93728; Abcam, Cam-

bridge, MA). Briefly, sections were removed of paraffin and incubatedfor 40 min at 97°C with Tris-EDTA-SDS buffer as previously de-scribed (68). Sections were then blocked with PBS containing 10%serum and stained with primary antibody overnight at 4°C. Sectionswere then washed three times in PBS, incubated with goat-anti-rabbitIgG Alexa Fluor secondary antibody (dilution 1:100; Life Technolo-gies, Grand Island, NY) for 1 h at room temperature, and counter-stained with Hoechst (0.1 �g/ml; Fisher Scientific). Sections wereanalyzed by confocal laser scanning microscopy (Zeiss LSM Confo-cal 710; Carl Zeiss). Digital images of slides were evaluated bytabulating mean pixel intensity of the respective color channel on eachimage using ImageJ software (National Institutes of Health) andreported as relative fluorescence. Five regions of interest per image,four images per slide, and n � 5 healthy and CDI patients were usedfor semiquantification of stain intensity normalized to healthy subjectsand referred to as relative fluorescence.

Human intestinal organoids and microinjection. Organoids resem-bling human proximal colon, hereafter referred to as human intestinalorganoids (HIOs), were generated by the Cincinnati Children’s Hos-pital Medical Center (CCHMC) Pluripotent Stem Cell Facilitythrough directed differentiation of human pluripotent stem cells(hPSC). Differentiation of hPSCs from a single subject was obtainedby culturing hPSCs for 3 days in ActivinA, followed by fibroblastgrowth factor 4 (FGF4) and Wnt3a. HIOs achieved 3-day dimensionalgrowth in Matrigel with epidermal growth factor (EGF), R-spondin,and Noggin as previously described (77). HIOs were obtained inMatrigel from the CCHMC Puripotent Stem Cell core. These or-ganoids have been previously shown to contain all major intestinalepithelial cell types: enterocytes (villin), goblet cells (mucin), panethcells (lysozyme), and enteroendocrine cells (chromogranin A) (77).The luminal compartment of HIOs was microinjected with bacteriaand stool supernatant to analyze host-microbe interactions as previ-ously described (20). Injection needles were pulled on a horizontalbed puller (Sutter Instruments), and the tip was cut to a tip diameterof �10–15 �m. HIOs were injected with C. difficile ATTC 1870 orstool from healthy or CDI patients. C. difficile ATTC 1870 was grownin tryptone yeast TY broth as previously described (22). For stool, 0.5g of healthy or CDI stool were added to 4.5 ml tryptic soy broth (TSB;Fisher Scientific) in an anaerobic hood. Samples were vortexed andcentrifuged at 150 g for 10 min to pellet solid materials. Stoolsupernatant, C. difficile, or C. butryicum cultures or TSB broth wasinjected into HIOs using a Nanoject microinjector (Drummon Scien-tific, Broomall, PA). To minimize stretch effects on epithelial cells,injection volumes of �10% or less of the organoid luminal volumewere used. Under these conditions, no leakage of cultures from theHIOs was observed. HIOs were processed either for RNA or immu-nostaining. For RNA, organoids were homogenized in Trizol andextracted with chloroform according the manufacturer’s instructions(Invitrogen). For staining, HIOs were incubated overnight after mi-croinjection and fixed with 4% paraformaldehyde for 30 min at roomtemperature. HIOs were washed in PBS and transferred to sucrose(30% in PBS) and incubated overnight at 4°C. The next day, HIOswere placed in optimal cutting temperature (OCT) embedding me-dium and frozen at �80°C for 1 day. Seven-micrometer sections werecut on a cryostat. Slides were stained with rabbit anti-human NHE3antibody (dilution 1:100, NBP1-82574; Novus Biologicals) and ana-lyzed by confocal laser scanning microscopy (Zeiss LSM Confocal710; Carl Zeiss).

Bacterial strains and culture conditions. C. difficile ATTC BAA-1870 and Blautia producta ATCC 27340D were purchased fromAmerican Type Culture Collection (ATCC, Manassas, VA). Micro-coccus luteus, Staphylococcus aureus, Escherichia coli, Burkholderiacepacia, and Faecalibacterium prausnitzii were locally available(Hassett Laboratory). Bacteroidetes thetaiotaomicron ATCC 29741was purchased from Fisher Scientific (Thermo Fisher Scientific,Waltham, MA). Lactobacillus acidophilus, Rhizobium legumino-sarum, and C. butryicum were purchased from Carolina Biological

G498 C. DIFFICILE: INHIBITION OF NHE3

AJP-Gastrointest Liver Physiol • doi:10.1152/ajpgi.00090.2014 • www.ajpgi.org

Supply (Burlington, NC). S. aureus, M. luteus, L. acidophilus, B.thetaiotaomicron, E. coli, B. cepacia, and R. legaminosarum wereused to generate quantitative (q)PCR standard curves as previouslydescribed (20). E. coli, S. aureus, M. luteus, B. cepacia, L. acidophi-lus, and R. legaminosarum were grown in Luria-Burtani (LB; ThermoFisher Scientific) broth at 37°C in a shaking incubator. B. thetaiotao-micron was grown in TSB (Fisher Scientific), and C. difficile wasgrown in tryptone-yeast extract-glucose broth (TYG; Thermo FisherScientific) at 37°C in a Coy Systems, dual-port anaerobic chamber(Coy Laboratory Products, Grass Lake, MI).

To determine the optimal [Na�] for growth, C. difficile (ClusterX1), C. butryicum (Cluster I), Blautia producta ATCC 27340D (C.coccoides Cluster XIVa), and Faecalibacterium prausnitzii (C. leptumCluster IV) were grown in media where sodium chloride (NaCl) waseither removed or replaced with cesium chloride (CsCl) or potassiumchloride (KCl) as previously described (9, 10, 20). Briefly, low Na�

media was mixed with normal media at various ratios to obtainvarying concentrations of Na� for bacterial growth measurements.Actual Na� and K� concentrations ([Na�] and [K�]) were confirmedby flame photometry (Single-Channel Digital Flame PhotometerModel 02655-10; Cole-Parmer Instrument, Vernon Hills, IL), and Cl�

concentration ([Cl�]) was measured by chloridometry (Digital Chlo-ridometer Model 4425100; Labconco, Kansas City, MO). Bacteriawere grown under anaerobic conditions at 37°C to early stationaryphase in normal TYG media [12 h, optical density at 560 nm(OD560nm): �1] and used to inoculate media containing varying[Na�]. Growth was measured as the optical density (OD560nm) withan Amersham Biosciences Ultospec 3100 Spectrophotometer (GEHealthcare Life Sciences, Pittsburgh, PA). Clostridial titers weredetermined by bacterial cell counts using a Petroff-Hauser chamber(Hausser Scientific; Horsham, PA) and also by colony-forming units(CFU) (9, 10). No differences in growth patterns were observedbetween 4 (early exponential phase)-, 12 (early stationary phase)-,24-, or 48 (stationary phase)-h time points (data not shown). As aresult, all data are represented as the OD560nm and CFU at the 24-htime point. To determine the optimal pH for growth, C. difficile, C.butryicum, Blautia producta ATCC 27340D (C. coccoides), andFaecalibacterium prausnitzii (C. leptum) were grown in TYG mediacontaining either normal media or low Na� media adjusted to pHvalues ranging from 5.5 to 7.0 as determined electrochemically usinga pH meter (Orion Model 720A; Thermo Fisher Scientific).

Quantitative real time-PCR amplification of 16S sequences.QIAamp DNA Stool kit (Qiagen, Valencia, CA) was used to isolatetotal DNA from stool of healthy subjects or patients with recurrentCDI. To improve bacterial cell lysis, the temperature was increased to95°C and incubation with lysozyme (10 mg/ml, 37°C for 30 min) wasused as previously described (12, 20, 24, 48, 56, 57). qPCR was usedto access the abundance of total bacteria and specific intestinalbacterial phyla using a Step One Real Time PCR machine [AppliedBiosystems (ABI) Life Technologies] with SYBR Green PCR mastermix (ABI) and bacteria-specific primers (Table 1) in a 20-�l finalvolume. Cycle of threshold values (CT) were correlated to the calcu-

lated bacteria number using standard curves from the pure bacterialcultures as previously described (4, 20, 51, 56). Total bacteria werecalculated using a universal bacterial primer that recognizes all bac-terial groups and represents the total stool microbiota.

Quantitative real time-PCR amplification of mRNA. To examineNHE3 mRNA level, total RNA was extracted from HIOs with Trizolreagent (Invitrogen, Life Technologies) according to the manufacturer’sinstructions. Briefly, the Matrigel surrounding the HIOs was removed bythe addition of ice-cold PBS and 400 �l of Trizol were added to the HIOsand homogenized. RNA was extracted by the addition of chloroform andreverse transcription was performed using 50 �g/ml oligo(dT) 20 primerand SuperScript reverse transcriptase (Invitrogen) according to the man-ufacturer’s instructions. Amplification reactions of NHE3 mRNA wereperformed using SYBR Green PCR master mix (ABI) on a Step OneReal Time PCR Machine (ABI). The following gene specific qRT-PCRprimers derived from previous literature were used: human NHE3 for-ward 5=-GAGCTGAACCTGAAGGATGC-3=, NHE3 reverse 5=-AGCTTGGTCGACTTGAAGGA-3=, human GAPDH forward 5=-TGC-ACCACCAACTGCTTAGC-3=, and GAPDH reverse 5=-GGCATG-GACTGTGGTCATGAG-3= (53). Data are reported as the ��CT

using GAPDH as the standard. Differences in mRNA expression weredetermined by qRT-PCR and expressed as the ��CT relative folddifference.

Ion and pH measurements. Stool fluid ion composition was ana-lyzed by flame photometry and chloridometry. Briefly, 0.3 g of humanstool/liquid were added to tubes and 300 �l of double deionized-waterwere added and vortexed thoroughly. The samples were centrifuged at3,000 rpm for 10 min at 4°C to pellet solids, and the supernatant Na�

and K� concentrations were determined using a digital Flame pho-tometer (Single-Channel Digital Flame Photometer Model 02655–10;Cole-Parmer Instrument). Cl� ion concentrations were determined bya digital Chloridometer (Model 4425100; Labconco). All values werenormalized to weight. pH measurements were performed electro-chemically via a pH meter (Orion Model 720A; Thermo FisherScientific).

Statistics. Data are presented as means SE. Comparisons be-tween groups were made with either one- or two-way ANOVA, andthe Holm-Sidak post hoc (parametric) test was used to determinesignificance between pairwise comparisons using SigmaPlot (SystatSoftware, San Jose, CA). A P 0.05 value was considered significantwhile n is the number of experiments performed.

RESULTS

NHE3 has been shown to be essential for intestinal absorp-tion of Na� and, therefore, water (25, 60). Work in cell lines(LLC-PK1: pig kidney; OK: opossum kidney; and BeWo:human placenta) has demonstrated that C. difficile toxin Binhibits NHE3 by dephosphorylation and redistribution ofezrin, which normally anchors NHE3 to the cytoskeleton,resulting in the loss of NHE3 from the apical membrane (29).

Table 1. Quantitative PCR primer sequences for of total bacteria, bacterial phyla, and C. difficile

Type Bacteria Forward Reverse Reference

Total Universal (total bacteria) ACTCCTACGGGAGGCAGCAG ATTACCGCGGCTGCTGG (4, 23, 26)Phyla Bacteriodetes GGCGACCGGCGCACGGG GRCCTTCCTCTCAGAACCC (26)Phyla Firmicutes GGAGYATGTGGTTTAATTCGAAGCA AGCTGACGACAACCATGCAC (23)Phyla Actinobacteria CGCGGCCTATCAGCTTGTTG ATTACCGCGGCTGCTGG (23)Phyla �-Proteobacteria ACTCCTACGGGAGGCAGCAG TCTACGRATTTCACCYCTAC (23)Phyla �-Proteobacteria CCGCACAGTTGGCGAGATGA CGACAGTTATGACGCCCTCC (23)Phyla y-Proteobacteria GAGTTTGATCATGGCTCA GTATTACCGCGGCTGCTG (39)Class Clostridium coccoides cluster XIVa ACTCCTACGGGAGGCAGC GCTTCTTAGTCAGGTACCGTCAT (57)Class Clostridium leptum cluster IV GTTGACAAAACGGAGGAAGG GACGGGCGGTGTGTACAA (57)Species Clostridium difficile TTGAGCGATTTACTTCGGTAAAGA CCATCCTGTACTGGCTCACCT (65)

G499C. DIFFICILE: INHIBITION OF NHE3


To determine if NHE3 was inhibited in CDI patients, intestinalarchitecture was examined by hematoxylin and eosin staining(Fig. 1A) and NHE3 expression was examined by immunoflu-orescence (Fig. 1B). Colonic biopsy specimens demonstratenormal healthy crypts in healthy subjects (Fig. 1A). Consistentwith CDI pathology, colon segments demonstrated pronouncedthickening of the colonic wall (black arrows) and pseudomem-branes (grey arrows) as previously described (73). To confirmthe presence of C. difficile in patients with CDI, slides werestained with an anti-C. difficile antibody. As expected, healthycolonic tissue and adjacent areas did not contain any C.difficile. In patients with CDI, C. difficile was found primarilyin the expelled mucus layer (89 3%) and occasionally in thecrypts close to the host epithelium (11 2%; n � 5; Fig. 1A).

In healthy subjects, NHE3 is located along the apical mem-brane of absorptive enterocytes (Fig. 1B). In contrast, CDIpatient biopsy specimens demonstrated varying levels ofNHE3. In CDI biopsy and surgical resections, there are areaswith intact NHE3 and areas with decreased or no NHE3;together CDI samples demonstrate a 48% decrease in NHE3compared with healthy colon samples (Fig. 1C). ImageJ anal-ysis of C. difficile and NHE3 immunofluorescence revealeddecreased NHE3 expression correlated with C. difficile pres-ence (P � 0.042). This is the first study that demonstrates thatNHE3 is inhibited in patients infected with C. difficile.

Mice lacking NHE3 have increased intestinal [Na�] and analkaline pH (20, 25, 60). We predicted that loss of NHE3 activityin patients would likewise result in increased [Na�] and analtered intestinal pH. To determine if CDI patients had analtered ion composition, stool from healthy subjects with orwithout diarrhea and antibiotics and CDI patients were exam-ined by flame photometry and chloridometry (Fig. 2, A–D).Patients with CDI had higher [Na�] (P � 0.005) (Fig. 2A), and[Cl�] (P 0.001; Fig. 2C) with no change in [K�] (P � 0.106;Fig. 2B) (two-way ANOVA; Fig. 2). To account for differ-ences in stool composition and antibiotic use, patients withnormal stool and diarrhea with or without antibiotics wereincluded for analysis. For [Na�], an interaction existed be-tween the presence of diarrhea and antibiotics (P � 0.045; Fig.2A). A significant difference was found between healthy anddiarrhea patients without antibiotics (P 0.001) and withantibiotics (P � 0.039). An interaction was also observed for[Cl�] (P � 0.002) between healthy and diarrhea patientswithout antibiotics (P � 0.025) and with antibiotics (P �0.015; Fig. 2C). Interestingly a difference was observed in[K�] between patients with or without antibiotics (P � 0.027;Fig. 2B).

Non-Cl anion gap calculations ([Na�] � [K�] � [Cl�])demonstrated an increase in bulk non-Cl� anions (Fig. 2D) forbetween patients with or with antibiotics (P � 0.012), patientswith and without diarrhea (P � 0.032), and patients with andwithout CDI (P 0.001). This suggests increase in bicarbon-ate or short chain fatty acids. In addition, CDI patients had amore alkaline stool (pH 6.9 0.3) compared with healthysubjects (pH 6.0 0.1) (P � 0.003; Fig. 2E). Differences inpH were also found between patients with and without antibi-otics (P � 0.026). These data indicate that changes in ioncomposition and pH occur with antibiotic use, but infectionwith C. difficile alters these parameters further.

The altered intestinal environment observed in recurrentCDI patients (increased [Na�] and more alkaline pH) is similar

to our observations in NHE3 null mice and may promote thegrowth of a different subset of gut microbiota. Mice lackingNHE3 exhibit an altered gut microbiota with increased Bacte-roidetes and decreased Firmicutes phyla (20). To addresswhether patients with recurrent CDI exhibit a similar profile,stool microbiota extracted from nine healthy and nine CDIpatients were examined by qPCR. Total stool bacteria densityremained unchanged between the groups (Fig. 3A). In CDIpatients C. difficile represented 2% of total bacteria (data notshown). In healthy subjects, the gut bacterial phylum Firmic-utes constituted the most abundant group, followed by Bacte-roidetes (Fig. 3B), consistent with other reports (13). In con-trast, patients with CDI had increased Bacteroidetes and de-creased Firmicutes (P 0.001, two-way ANOVA; Fig. 3C).CDI patients also had increased �� -Proteobacteria (P � 0.02)that may result from antibiotic use, since antibiotics have beenshown to increase Proteobacteria titers (1, 14, 16, 30, 35, 43,62). To determine if resident Clostridial groups (Firmicutesphylum) were changed in CDI, C. coccoides Cluster XIVa andC. leptum Cluster IV titers were examined (Fig. 3D) and bothwere decreased compared with healthy subjects. In a healthypatient, C. coccoides and C. leptum account in total for �50%of the total stool bacteria (28, 38, 63) and decreases in thesegroups represent a significant decrease in the Firmicutes phy-lum. These observations point to the proclivity of C. difficile ingenerating an altered intestinal environment.

To address whether C. difficile prefers the environmentalconditions mediated by inhibition of NHE3, C. difficile ATTCBAA-1870 was grown in vitro anaerobically in TYG mediacontaining various [Na�] (8–106 mM Na�). Growth wasexamined by OD560nm and CFU enumeration at 4 (early expo-nential phase)-, 12 (early stationary phase)-, 24-, or 48 (sta-tionary phase)-h time points as previously described (75).Growth patterns were found to be the same for all time points,and the data are represented as CFU at the 24-h time point. C.difficile was found to grow optimally at �16 mM [Na�](media pH 6.0), conditions observed in stool of CDI patients(Fig. 4A). This experiment was repeated using KCl or CsClreplacement, and C. difficile again was noted to grow moreefficiently at higher [Na�] (data not shown). C. difficile wasalso grown in vitro at [Na�] and pH values designed to mimichuman stool (healthy: Na� 8 mM, pH 6.0; CDI: Na� 75 mMpH 7.0, refer to Fig. 2). As shown in Fig. 4B, C. difficile alsogrew better at pH 7.0 vs. pH 6.0 (P � 0.003) at both [Na�],indicating that C. difficile is also influenced by pH. Theresident Clostridial members C. butryicum (Cluster I), Blautiaproducta (C. coccoides Cluster XIVa), and Faecalibacteriumprausnitzii (C. leptum Cluster IV) were also grown in TYGmedia in high and low Na� at pH 6.0 and 7.0 to determine ifall Clostridial groups preferred the similar environment con-ditions as C. difficile (Fig. 5). C. butyricum is a residentbacteria that has been used as a probiotic (58, 61) and has beenshown to prevent experimental colitis via an IL-10-dependentmechanism (27). C. butyricum grew well at lower [Na�], butproliferation significantly dropped at high [Na�] (Fig. 5A). B.productus and F. prausnitzii had similar growth preferences toC. butryicum with decreased growth at high [Na�] (Fig. 5, Band C). These data demonstrate that C. difficile is distinct in itspreference for a high [Na�], alkaline pH environment, addingcredence to the hypothesis that C. difficile prefers an alteredintestinal environment that may be caused by the loss of NHE3



A Healthy CDI

nucleiC. difficile

NHE3nucleiB

ealth

yH

CD

I

C nce

1.2

Fluo

resc

en

0.8

1.0

*

3 R

elat

ive

F

0.4

0.6*

NH

E3

0.0

0.2

Healthy Patient CDI PatientHealthy Patient CDI Patient

Fig. 1. Clostridium difficile infection (CDI) specimensexhibit altered intestinal structure and decreased apicalNa�/H� exchanger 3 (NHE3) expression. A: hematox-ylin and eosin stains of healthy and CDI patient biop-sies or surgical resections demonstrate that these CDIpatients have regions of pseudomembranes (composedof inflammatory cells, necrotic epithelium, and mucus)(grey arrows) and areas of thickened intestine wall(black arrows). Scale bar � 500 �M. The presence ofC. difficile was confirmed with an anti-C. difficile anti-body (purple). Healthy tissue contained no C. difficilestain, while CDI specimens contained C. difficile at thelevel of the mucus (89 3%) and epithelium (11 2%) (n � 5). B: confocal images from healthy and CDIpatient biopsies or surgical resections depicting NHE3(red) and nuclei (blue) stained with Hoechst. Scale bar � 100�M. Representative micrographs of observations fromn � 5 healthy and CDI patient specimens. NHE3 wasfound to varying degrees in CDI patients, representinga 48% decrease in NHE3 expression compared withhealthy colon (arrows). C: semiquantitative analysis ofsurface NHE3 expression in healthy colon, CDI biopsynondiseased adjacent tissue, and CDI biopsy diseasedtissue. Data presented as relative fluorescence normal-ized healthy NHE3 expression. *P 0.005, two-wayANOVA; n � 5.



100

120 ***100

120BA

Na+ m

M

40

60

80

*

**

K+ m

M

40

60

80 *

0

20

40

Normal Diarrhea RecurrentDiarrheaNormal

0

20

Normal Stool

tnerruceRaehrraiDCDI

DiarrheaNormalStool

120 120

***

NormalStool

Diarrhea RecurrentCDI

No Antibiotics

Diarrhea

Antibiotics

NormalStool

Stool CDI

No Antibiotics Antibiotics

Stool

mM

80

100

***

nion

gap

80

100 ***

C D

Cl-

m

20

40

60

*

**

Non

-Cl- A

n

20

40

60

0

NormalStool


No Antibiotics

Diarrhea

Antibiotics

NormalStool

0

NormalStool


No Antibiotics

Diarrhea

Antibiotics

NormalStool

E 9

8

9

**

pH 7

*

6

5

NormalStool


DiarrheaNormalStool

No Antibiotics Antibiotics



function. Of note, at low [Na�], C. butyricum proliferated tomuch higher levels compared with C. difficile, even at the high[Na�]. This suggests that under healthy conditions, C. butyri-cum would be able to outcompete C. difficile for a given niche.

Although CDI patients demonstrate decreased NHE3 ex-pression, it could be argued that a number of different bacterialgroups could be responsible for changes in NHE3 levels. Wehave previously used intestinal organoids to address microbial-host interaction (20). To determine if C. difficile alone wassufficient to decrease NHE3, HIOs were used. HIOs have beenshown to mimic native tissue: the cellular diversity and archi-tecture are similar to tissue; HIOs contain all the intestine celllineages; secretory and absorptive functions are present; andHIOs also contain a significant degree of epithelial and mes-enchymal complexity and secrete mucus (77). To confirm thatdecreases in NHE3 were C. difficile specific, HIOs wereinjected with C. difficile, C butryicum, and stool supernatantfrom healthy and CDI patients. mRNA levels of NHE3 (Fig.6A) demonstrate that C. butryicum and healthy stool does notinhibit NHE3 expression. However, injection of C. difficile andCDI stool supernatant resulted in a substantial decrease in

NHE3 mRNA compared with broth-injected (control) or-ganoids. This inhibition was also observed at the protein level(Fig. 6, B and C), demonstrating that C. difficile is sufficient forNHE3 inhibition in patients with CDI. Taken together, thesedata indicate that C. difficile is capable of decreasing NHE3expression in vivo and in vitro. Stool from patients with CDIexhibit increased Na� and Cl� and are more alkaline in pHcompared with healthy subjects and patients on antibiotics.Stool gut microbiota from patients with CDI are higher inBacteroidetes and lower in Firmicutes compared with healthysubjects, with decreased resident Clostridial members C. coc-coides and C. leptum. In vitro high Na� and pH conditionsresults in C. difficile proliferation and the suppression ofresident Clostridial members. Injection of C. difficile into HIOsconfirms that C. difficile alone is capable of eliciting changes inNHE3 at the level of protein and mRNA.

DISCUSSION

C. difficile represents an ever increasing public concern asthe major cause of antibiotic-induced diarrhea and colitis. The

Fig. 2. Stool from CDI patients has increased Na� and a more alkaline pH compared with healthy subjects with or without antibiotics. Sodium concentration([Na�]) and potassium concentration ([K�]) as determined by flame photometry for patients with normal stool (n � 12) and diarrhea without antibiotics (n �8), for patients with normal stool on antibiotics (n � 5) and diarrhea on antibiotics (n � 7), and for patients with recurrent CDI (n � 12). A: Na� was significantlyincreased in CDI compared with healthy patient stool (***P � 0.005). Na� was also increased in patients with diarrhea (*P 0.001) compared with normalstool, between patients on antibiotics vs. no antibiotics (**P � 0.010). B: no changes were observed in [K�] between CDI patients and healthy subjects, butdifferences were observed between patients with or without antibiotics (*P � 0.027). C: chloride concentration ([Cl�]) as determined by chloridometry wassignificantly increased in CDI compared with healthy patient stool samples (***P 0.001). Differences were also observed between healthy and diarrhea patientswithout antibiotics (*P � 0.025) and with antibiotics (**P � 0.015). D: non-Cl anion gap was calculated with the following equation: [Na�] � [K�] � [Cl�].Differences were between patients with or with antibiotics (**P � 0.012), patients with and without diarrhea (*P � 0.032), and patients with and without CDI(***P 0.001). E: stool pH was determine electrochemically and CDI patient stool was more alkaline compared with all other groups (**P � 0.003). Differencesin pH were also found between patients with and without antibiotics (*P � 0.026). *P 0.05, two-way ANOVA, Holm-Sidak.

A B

1011

1012 1010

**

109

1010

CFU

8

109

*

unt)

otal

Bac

teria

ulat

ed c

ell c

ouTo

(cal

cu

106

107

108

107

10

tes es ria ia

Firmicu

tes

Bacter

oidetes

Actinobac

teria

Proteo

bacter

ia

C40

30

10

20

*

% C

lost

ridia

l gro

up/

tota

l bac

teria

0ides tum

*

C. cocc

oide

C. leptu

Fig. 3. CDI patients have an altered gut mi-crobiota compared with healthy subjects.quantitative PCR was performed with totalbacteria and bacterial phyla specific primers.A: no differences are observed in total bacte-ria between patients with healthy subjects(black bar) and CDI patients (white bar). B:healthy and CDI stool microbiota bacterialphyla alterations in Firmicutes, Bacteroidetes,and Proteobacteria. C: CDI patients also havedecreased resident Firmicutes members C.coccoides (� 21%) and C. leptum (� 19%)levels. CFU, colony-forming units. *P 0.05, one-way ANOVA, Holm-Sidak; n � 9.



incidence of CDI has increased in the last decade, and, with theemergence of more virulent strains, C. difficile will likelypersist as a major health concern. Herein, we have demon-strated several novel aspects of CDI including 1) CDI patientsexhibit decreased NHE3 expression in the apical membrane ofintestinal enterocytes and higher [Na�] and alkaline stool pHcompared with healthy subjects. The altered gut intestinalenvironment correlates with changes in the dominant bacterialphyla, Firmicutes and Bacteroidetes, with decreased C. coc-coides and C. leptum; 2) C. difficile has increased proliferationat Na� concentrations �16 mM and at more alkaline pH level

in vitro, a pattern of proliferation that is not observed inresident C. butryicum, B. producta, or F. prausnitzii; and 3) C.difficile alone and in combination with a complex microbiota(CDI stool) are capable of decreasing NHE3 expression inHIOs. These new findings shed light on several novel aspectsof the C. difficile colonization phase. This study represents thefirst in vivo analysis of NHE3 inhibition in response to C.difficile infection. Targeted disruption of the normal intestinalenvironment via regulation of ion transport may help explainboth the diarrhea phenotype and how C. difficile maintains acompetitive advantage.

A B

1.0e+9

1.1e+9

* * ** * 1.2e+9

1.4e+9 *A B 8mM Na+

75mM Na+

8.0e+8

9.0e+8 *8.0e+8

1.0e+9di

ffici

le C

FUC

.d

5.0e+8

6.0e+8

7.0e+8

Healthy CDI

diffi

cile

CFU

C.d

2.0e+8

4.0e+8

6.0e+8

Healthy CDI

Na+ mM0 20 40 60 80 100 120

pH5.4 5.6 5.8 6.0 6.2 6.4 6.6 6.8 7.0 7.2

Fig. 4. In vitro growth of C. difficile ATTC BAA-1870 in varying Na� and pH conditions. [Na�] ranges for healthy and CDI stool are displayed as bars alongthe x-axis. A: growth (CFU) of C. difficile in tryptone-yeast extract-glucose (TYG) broth at varying [Na�], which mimics those seen in vivo for healthy and CDIstool at 24 h. C. difficile grew optimally �16 mM Na� (pH 6.0), which is above the in vivo concentration of 3 mM Na� for healthy patient stool. B: growthof C. difficile in TYG broth at varying pH, which mimics that seen in vivo for healthy and CDI stool. Growth was determined at 8 mM Na� (�) mimicking healthystool and 75 mM Na� (Œ) mimicking CDI stool. Significant difference between 8 mM Na� and 75 mM Na� at pH 5.5 (P � 0.001), 6.0 (P 0.001), and 6.3(P � 0.001). In addition, there is a significant difference between growth at pH 5.5 vs. 6.0–6.5 (P 0.001) and pH 6.0–6.5 and pH 7.0 (P 0.001) for both8 mM Na� and 75 mM Na�. *P 0.05, two-way ANOVA, Holm-Sidak.

1.4e+9

1.6e+9

*** * * *1.2e+9

1.4e+9

*** **

BA

1.0e+9

1.2e+9

8.0e+8

1.0e+9 *

prod

ucta

CFU

B. p

4.0e+8

6.0e+8

8.0e+8

Healthy CDI

0 20 40 60 80 100 120

Ura

usni

tzii

CFU

F. p

r

4.0e+8

6.0e+8

Healthy CDI

1.6e+9

Na+ mM0 20 40 60 80 100 120

Na+ mM

0 20 40 60 80 100 120

1.2e+9

1.4e+9 ******

CpH 6.0pH 7.0

um C

FUC

. but

yric

u

6.0e+8

8.0e+8

1.0e+9

Na+ mM0 20 40 60 80 100 120

4.0e+8Healthy CDI

Fig. 5. In vitro growth of Clostridial membersin a range of Na� and pH conditions. Growth(CFU) of Blautia producta (C. coccoidesCluster XIVa; A), Faecalibacterium praus-nitzii (C. leptum Cluster IV; B), and C. butryi-cum (Cluster I; C) in TYG broth at varying[Na�], which mimics that seen in vivo forhealthy (pH 6, �) and CDI stool (pH 7, Œ) at24 h. All Clostridial groups grew optimallyfrom 7–40 mM Na� (pH 6.0 and 7.0) *P 0.05, two-way ANOVA, Holm-Sidak.



We propose that in healthy individuals the luminal andmucosa-associated gut microbiota compete for a C. difficileniche (see model in Fig. 7). In an antibiotic microbiota-depleted environment, C. difficile spores germinate and vege-

tative C. difficile likely use intestinal nutrients (such as cleavedmucus oligosaccharides) to enter a colonization phase. After acolonization phase, C. difficile enters a virulence phase andproduces toxins that inhibit NHE3. C. difficile toxin inhibition

A1 2

1.4

RN

A re

nce

0 8

1.0

1.2

NH

E3 m

Rfo

ld d

iffer

0.4

0.6

0.8

*

0.0

0.2

ol ol ileol m

**

Control

Health

y Stool

C. diffi

cile

CDI Stool

C. butry

icum

NHE3nucleiB

NHE3nuclei

Control Healthy Stool C. butryicum

CDI S l C diffi ilCDI Stool C. difficile

C1 2

1.4

0 8

1.0

1.2

0.4

0.6

0.8

**

resc

ence

ativ

e Fl

uor

Rel

0.0

0.2

ol ol ileol m

Control

Health

y Stool

C. diffi

cile

CDI Stool

C. butry

icum

**

*

*

*

*

Fig. 6. Human intestinal organoids (HIOs)grown in 3-dimensional culture microinjectedwith bacterial or stool supernatant. A: NHE3mRNA levels indicate decreased expression inHIOs injected with CDI stool and C. difficile.No changes were observed between healthystool or C. butryicum culture. Left: organoidculture in Matrigel with injection needle. B:NHE3 protein expression as determined byimmunofluorescence is decreased in HIOs in-jected with CDI stool and C. difficile com-pared with control, healthy, and C. butryicuminfected HIOs (white asterisk designates lu-men). Left: depicts widefield view of HIOinjection. C: semiquantitative analysis ofNHE3 florescence. *P 0.05, two-WayANOVA, Holm-Sidak; n � 6–9 organoids.



of NHE3 alters the intestinal environment producing a high[Na�], and a more alkaline fluid, which enhances C. difficileproliferation and inhibits competitive Clostridial groups pro-liferation. This altered intestinal environment further shapesthe reemerging gut microbiota (which is restructuring afterantibiotic use), perhaps so that noninhibitory Bacteroidetesmembers proliferate. Altered gut microbiota may also play arole in further shaping the intestinal environment, making itmore favorable for C. difficile colonization. C. difficile toxin Binhibition of NHE3 was demonstrated in cells lines (29), butthis is the first study that has demonstrated that inhibition ofNHE3 occurs in infected human patients. Loss of NHE3 inmice appears to mimic the effects of C. difficile toxin produc-tion in humans as NHE3�/� mice have higher [Na�], alkalineintestinal fluid, and a distal colon microbiota that are higher inBacteroidetes and lower in Firmicutes (20). It should be notedthat NHE3�/� mice have higher Bacteroidetes and lowerFirmicutes in both the luminal and mucosa-associated bacterialpopulations, with the mucosa-associated bacterial populationbeing more dramatic than the luminal population. If the mu-cosa-associated bacteria of CDI patients likewise reflects theluminal bacterial composition, this indicates that this alteredcomposition represents a noncompetitive population to C.difficile.

NHE3�/� mice also exhibited increased [Na�], alkalinefluid, and Bacteroidetes in the small intestine (terminal ileum)in addition to changes in the colon. This suggests that thealtered intestinal environment, due in part to the loss of NHE3,may occur upstream as well as in the colon. Although C.difficile studies have focused on the colon, C. difficile infectionhas also been reported in the small intestine (47, 70, 76) andcan cause small bowel disease (66, 71, 72). These studiessuggest that C. difficile infection is not localized solely to thecolon and may provide keys areas for the initial pathogenesis

of C. difficile. Knowledge of C. difficile colonizing in theintestine (either small or large intestine) is critical for devel-oping better therapies against CDI.

It has been speculated by some that the diarrhea observed inCDI patients is the direct result of epithelial integrity orsecretory diarrhea by the host to remove the pathogen. Ourwork has demonstrated that patients with CDI have a dramaticincrease in stool [Na�] and a moderate increase in [Cl�]. Thissuggests that loss of Na� absorption, and concomitant waterabsorption, in combination with increased [Cl�], may contrib-ute to in the diarrhea observed in CDI patients. A caveat tosuch as study is the fact that it is unfeasible to collect samplesbefore patients become infected with C. difficile, so it remainsto be determined the extent of alterations in ion compositionand pH in each patient before the acquisition of CDI. However,these data demonstrate that [Na�] and [Cl�] in CDI patientsare significantly different from those of patients with or with-out diarrhea on antibiotics, indicating that the large alterationsin Na� and Cl� content in CDI patients are likely due to thepresence of C. difficile.

Hayashi et al. (29) demonstrated in placental and renal celllines that exposure to C. difficile toxin B resulted in decreasedexpression of NHE3 at the apical membrane and translocationto a subapical endosome. This redistribution in NHE3 locationwas suggested to contribute to loss of NHE3 activity. However,our work with the HIOs has shown that injection with toxin-producing C. difficile decreased NHE3 expression at the levelof the protein and mRNA. This indicates that a dual mecha-nism of NHE3 inhibition may be occurring in patients withCDI. In renal cell lines, NHE3 activity has also been shown tobe diminished at the level of apical protein and mRNA byparathyroid hormone (PTH) (6). PTH addition correlated witha significant decrease in promoter �152/�55 activity. Thispromoter segment contains putative binding sites for Sp1, AP2,

Fig. 7. Working model of C. difficile inhibition of NHE3. Under normal conditions, Firmicutes is the dominant member of the human colon at the level of theluminal (our data) and mucosa-associated bacterial populations (17). Antibiotic use alters the gut microbiota and allows for the germination of C. difficile spores.Vegetative C. difficile use fuel sources to proliferate and once in virulence phase produces toxins that inhibit NHE3. Loss of functional NHE3 results in a highin Na� and more alkaline pH luminal environment, which shapes the gut microbiota to be increased in Bacteroidetes and decreased in Firmicutes. It remainsunknown what changes are occurring in the mucosa-associated bacteria under these conditions. High Na� and more alkaline pH favors C. difficile proliferationand prevents resident Clostridial groups from outcompeting C. difficile.



and NF-Y, which seem to be essential for NHE3 gene tran-scription (42). C. difficile toxin, similar to PTH, may also leadto decreased NHE3 promoter activity and thus transcription,but this remains to be determined. C. difficile toxin productionhas been demonstrated to disrupt intestinal actin cytoskeleton,which is thought to lead to cell death (44). Loss of cell integritycould also contribute to decreased NHE3 in diseased segmentsof the intestine of CDI patients. However, decreased NHE3mRNA may point to a selective inhibition of NHE3 to ensurea more favorable environment and reemerging bacterial com-position for C. difficile growth.

In vitro C. difficile has optimal growth at higher sodium andmore alkaline pH compared with healthy subjects. This mightrepresent a biphasic event where C. difficile is capable of using[Na�] until a more alkaline pH is obtained. Patients on anti-biotics (either with or without diarrhea) have elevated [Na�]compared with patients not on antibiotics (Fig. 2). Sincepatients who are on antibiotics and have diarrhea have a lowerpH compared with CDI patients, C. difficile may use [Na�]until the pH becomes more alkaline. Once the pH is alkaline,in vitro data suggest that C. difficile is insensitive to [Na�].Additional experiments are likely needed to identify the exactconditions that stimulate C. difficile growth in vivo.

Ion transport now represents a new route for combating CDI.For example, were NHE3 to be upregulated, this may providea means to reestablish the normal intestinal environment andthus shift the microbiota toward one that is considered normal.The effects of normal commensal microbiota on NHE3 expres-sion and function may prove valuable in this regard. Lactoba-cillus has been used as a probiotic treatment for CDI (7, 45, 50)and Lactobacillus acidophilus has been shown to upregulateNHE3 (64). In addition, Lactobacillus has been shown toproduce lactic acid that inhibits C. difficile growth (46). Sincenormal gut microbiota have been shown to out compete andinhibit C. difficile growth, control of ion transport can providea novel therapeutic for CDI.

ACKNOWLEDGMENTS

We thank Lindsey Ferreira and Stacy Huang for technical assistance withthis project. This work was in partial fulfillment of the Ph.D. degree for M. A.Engevik.

GRANTS

This work was supported in part by National Institute of Diabetes andDigestive and Kidney Diseases Grant DK-079979 (to R. T. Worrell).

DISCLOSURES

No conflicts of interest, financial or otherwise, are declared by the author(s).

AUTHOR CONTRIBUTIONS

Author contributions: M.A.E. and R.T.W. conception and design of re-search; M.A.E., K.A.E., M.B.Y., and B.R.Y. performed experiments; M.A.E.,K.A.E., M.B.Y., J.W., and R.T.W. analyzed data; M.A.E., M.B.Y., J.W., B.D.,B.R.Y., and R.T.W. interpreted results of experiments; M.A.E. and R.T.W.prepared figures; M.A.E. and R.T.W. drafted manuscript; M.A.E., M.B.Y.,J.W., D.J.H., B.D., B.R.Y., and R.T.W. edited and revised manuscript.

REFERENCES

1. Antonopoulos DA, Huse SM, Morrison HG, Schmidt TM, Sogin ML,Young VB. Reproducible community dynamics of the gastrointestinalmicrobiota following antibiotic perturbation. Infect Immun 77: 2367–2375, 2009.

2. Badger VO, Ledeboer NA, Graham MB, Edmiston CE Jr. Clostridiumdifficile: epidemiology, pathogenesis, management, and prevention of arecalcitrant healthcare-associated pathogen. JPEN J Parenter Enteral Nutr36: 645–662, 2012.

3. Barbieri JT, Riese MJ, Aktories K. Bacterial toxins that modify the actincytoskeleton. Annu Rev Cell Dev Biol 18: 315–344, 2002.

4. Barman M, Unold D, Shifley K, Amir E, Hung K, Bos N, Salzman N.Enteric salmonellosis disrupts the microbial ecology of the murine gas-trointestinal tract. Infect Immun 76: 907–915, 2008.

5. Bauer MP, van Dissel JT. Alternative strategies for Clostridium difficileinfection. Int J Antimicrob Agents 33, Suppl 1: S51–56, 2009.

6. Bezerra CN, Girardi AC, Carraro-Lacroix LR, Reboucas NA. Mech-anisms underlying the long-term regulation of NHE3 by parathyroidhormone. Am J Physiol Renal Physiol 294: F1232–F1237, 2008.

7. Biller JA, Katz AJ, Flores AF, Buie TM, Gorbach SL. Treatment ofrecurrent Clostridium difficile colitis with Lactobacillus GG. J PediatrGastroenterol Nutr 21: 224–226, 1995.

8. Borriello SP. Pathogenesis of Clostridium difficile infection. J AntimicrobChemother 41, Suppl C: 13–19, 1998.

9. Caldwell DR, Arcand C. Inorganic and metal-organic growth require-ments of the genus Bacteroides. J Bacteriol 120: 322–333, 1974.

10. Caldwell DR, Keeney M, Barton JS, Kelley JF. Sodium and otherinorganic growth requirements of bacteroides amylophilus. J Bacteriol114: 782–789, 1973.

11. Campbell RJ, Giljahn L, Machesky K, Cibulskas-White K, Lane LM,Porter K, Paulson JO, Smith FW, McDonald LC. Clostridium difficileinfection in Ohio hospitals and nursing homes during 2006. Infect ControlHosp Epidemiol 30: 526–533, 2009.

12. Castillo M, Martin-Orue SM, Manzanilla EG, Badiola I, Martin M,Gasa J. Quantification of total bacteria, enterobacteria and lactobacillipopulations in pig digesta by real-time PCR. Vet Microbiol 114: 165–170,2006.

13. Chang JY, Antonopoulos DA, Kalra A, Tonelli A, Khalife WT,Schmidt TM, Young VB. Decreased diversity of the fecal Microbiome inrecurrent Clostridium difficile-associated diarrhea. J Infect Dis 197: 435–438, 2008.

14. Croswell A, Amir E, Teggatz P, Barman M, Salzman NH. Prolongedimpact of antibiotics on intestinal microbial ecology and susceptibility toenteric Salmonella infection. Infect Immun 77: 2741–2753, 2009.

15. Deneve C, Janoir C, Poilane I, Fantinato C, Collignon A. New trendsin Clostridium difficile virulence and pathogenesis. Int J AntimicrobAgents 33, Suppl 1: S24–28, 2009.

16. Dethlefsen L, Huse S, Sogin ML, Relman DA. The pervasive effects ofan antibiotic on the human gut microbiota, as revealed by deep 16S rRNAsequencing. PLoS Biol 6: e280, 2008.

17. Dingle T, Mulvey GL, Humphries RM, Armstrong GD. A real-timequantitative PCR assay for evaluating Clostridium difficile adherence todifferentiated intestinal Caco-2 cells. J Med Microbiol 59: 920–924, 2010.

18. Dubberke ER, Butler AM, Reske KA, Agniel D, Olsen MA, D’AngeloG, McDonald LC, Fraser VJ. Attributable outcomes of endemic Clos-tridium difficile-associated disease in nonsurgical patients. Emerg InfectDis 14: 1031–1038, 2008.

19. Dubberke ER, Haslam DB, Lanzas C, Bobo LD, Burnham CA, GrohnYT, Tarr PI. The ecology and pathobiology of Clostridium difficileinfections: an interdisciplinary challenge. Zoonoses Public Health 58:4–20, 2011.

20. Engevik MA, Aihara E, Montrose MH, Shull GE, Hassett DJ, WorrellRT. Loss of NHE3 alters gut microbiota composition and influencesBacteroides thetaiotaomicron growth. Am J Physiol Gastrointest LiverPhysiol 305: G697–G711, 2013.

22. Fang A, Gerson DF, Demain AL. Production of Clostridium difficiletoxin in a medium totally free of both animal and dairy proteins or digests.Proc Natl Acad Sci USA 106: 13225–13229, 2009.

23. Fierer N, Jackson JA, Vilgalys R, Jackson RB. Assessment of soilmicrobial community structure by use of taxon-specific quantitative PCRassays. Appl Environ Microbiol 71: 4117–4120, 2005.

24. Fite A, Macfarlane GT, Cummings JH, Hopkins MJ, Kong SC, FurrieE, Macfarlane S. Identification and quantitation of mucosal and faecaldesulfovibrios using real time polymerase chain reaction. Gut 53: 523–529, 2004.

25. Gawenis LR, Stien X, Shull GE, Schultheis PJ, Woo AL, Walker NM,Clarke LL. Intestinal NaCl transport in NHE2 and NHE3 knockout mice.Am J Physiol Gastrointest Liver Physiol 282: G776–G784, 2002.



26. Guo X, Xia X, Tang R, Zhou J, Zhao H, Wang K. Development of areal-time PCR method for Firmicutes and Bacteroidetes in faeces and itsapplication to quantify intestinal population of obese and lean pigs. LettAppl Microbiol 47: 367–373, 2008.

27. Hayashi A, Sato T, Kamada N, Mikami Y, Matsuoka K, Hisamatsu T,Hibi T, Roers A, Yagita H, Ohteki T, Yoshimura A, Kanai T. A singlestrain of Clostridium butyricum induces intestinal IL-10-producing mac-rophages to suppress acute experimental colitis in mice. Cell Host Microbe13: 711–722, 2013.

28. Hayashi H, Sakamoto M, Kitahara M, Benno Y. Diversity of theClostridium coccoides group in human fecal microbiota as determined by16S rRNA gene library. FEMS Microbiol Lett 257: 202–207, 2006.

29. Hayashi H, Szaszi K, Coady-Osberg N, Furuya W, Bretscher AP,Orlowski J, Grinstein S. Inhibition and redistribution of NHE3, theapical Na�/H� exchanger, by Clostridium difficile toxin B. J Gen Physiol123: 491–504, 2004.

30. Hazenberg MP, Van de Boom M, Bakker M, Van de Merwe JP. Effectof antibiotics on the human intestinal flora in mice. Antonie Van Leeu-wenhoek 49: 97–109, 1983.

31. Jafari NV, Kuehne SA, Bryant CE, Elawad M, Wren BW, Minton NP,Allan E, Bajaj-Elliott M. Clostridium difficile modulates host innateimmunity via toxin-independent and dependent mechanism(s). PLoS One8: e69846, 2013.

32. Jank T, Aktories K. Structure and mode of action of clostridial gluco-sylating toxins: the ABCD model. Trends Microbiol 16: 222–229, 2008.

33. Jank T, Giesemann T, Aktories K. Rho-glucosylating Clostridiumdifficile toxins A and B: new insights into structure and function. Glyco-biology 17: 15R–22R, 2007.

34. Janoir C, Deneve C, Bouttier S, Barbut F, Hoys S, Caleechum L,Chapeton-Montes D, Pereira FC, Henriques AO, Collignon A, MonotM, Dupuy B. Adaptive strategies and pathogenesis of Clostridium difficilefrom in vivo transcriptomics. Infect Immun 81: 3757–3769, 2013.

35. Jernberg C, Lofmark S, Edlund C, Jansson JK. Long-term impacts ofantibiotic exposure on the human intestinal microbiota. Microbiology 156:3216–3223, 2010.

36. Kelly CP, Pothoulakis C, LaMont JT. Clostridium difficile colitis. NEngl J Med 330: 257–262, 1994.

37. Kuehne SA, Cartman ST, Heap JT, Kelly ML, Cockayne A, MintonNP. The role of toxin A and toxin B in Clostridium difficile infection.Nature 467: 711–713, 2010.

38. Lay C, Rigottier-Gois L, Holmstrom K, Rajilic M, Vaughan EE, deVos WM, Collins MD, Thiel R, Namsolleck P, Blaut M, Dore J.Colonic microbiota signatures across five northern European countries.Appl Environ Microbiol 71: 4153–4155, 2005.

39. Lee J, Kim S, Jung J, Oh BS, Kim IS, Hong SK. Analysis of totalbacteria, enteric members of -proteobacteria and microbial communitiesin seawater as indirect indicators for quantifying biofouling. Environ EngRes 14: 19–25, 2009.

40. Ley RE, Lozupone CA, Hamady M, Knight R, Gordon JI. Worldswithin worlds: evolution of the vertebrate gut microbiota. Nat Rev Micro-biol 6: 776–788, 2008.

41. Lyras D, O’Connor JR, Howarth PM, Sambol SP, Carter GP, Phu-moonna T, Poon R, Adams V, Vedantam G, Johnson S, Gerding DN,Rood JI. Toxin B is essential for virulence of Clostridium difficile. Nature458: 1176–1179, 2009.

42. Malakooti J, Sandoval R, Amin MR, Clark J, Dudeja PK, Ramas-wamy K. Transcriptional stimulation of the human NHE3 promoteractivity by PMA: PKC independence and involvement of the transcriptionfactor EGR-1. Biochem J 396: 327–336, 2006.

43. Manichanh C, Reeder J, Gibert P, Varela E, Llopis M, Antolin M,Guigo R, Knight R, Guarner F. Reshaping the gut microbiome withbacterial transplantation and antibiotic intake. Genome Res 20: 1411–1419, 2010.

44. Mitchell MJ, Laughon BE, Lin S. Biochemical studies on the effect ofClostridium difficile toxin B on actin in vivo and in vitro. Infect Immun 55:1610–1615, 1987.

45. Naaber P, Mikelsaar RH, Salminen S, Mikelsaar M. Bacterial translo-cation, intestinal microflora and morphological changes of intestinal mu-cosa in experimental models of Clostridium difficile infection. J MedMicrobiol 47: 591–598, 1998.

46. Naaber P, Smidt I, Stsepetova J, Brilene T, Annuk H, Mikelsaar M.Inhibition of Clostridium difficile strains by intestinal Lactobacillus spe-cies. J Med Microbiol 53: 551–554, 2004.

47. Navaneethan U, Giannella RA. Thinking beyond the colon-small bowelinvolvement in clostridium difficile infection. Gut Pathog 1: 7, 2009.

48. Norkina O, Burnett TG, De Lisle RC. Bacterial overgrowth in the cysticfibrosis transmembrane conductance regulator null mouse small intestine.Infect Immun 72: 6040–6049, 2004.

49. O’Brien JA, Lahue BJ, Caro JJ, Davidson DM. The emerging infec-tious challenge of clostridium difficile-associated disease in Massachusettshospitals: clinical and economic consequences. Infect Control Hosp Epi-demiol 28: 1219–1227, 2007.

50. Orrhage K, Nord CE. Bifidobacteria and lactobacilli in human health.Drugs Exp Clin Res 26: 95–111, 2000.

51. Ott SJ, Musfeldt M, Ullmann U, Hampe J, Schreiber S. Quantificationof intestinal bacterial populations by real-time PCR with a universalprimer set and minor groove binder probes: a global approach to theenteric flora. J Clin Microbiol 42: 2566–2572, 2004.

52. Owens RC Jr, Donskey CJ, Gaynes RP, Loo VG, Muto CA. Antimi-crobial-associated risk factors for Clostridium difficile infection. ClinInfect Dis 46, Suppl 1: S19–31, 2008.

53. Quinkler M, Bujalska IJ, Kaur K, Onyimba CU, Buhner S, Allolio B,Hughes SV, Hewison M, Stewart PM. Androgen receptor-mediatedregulation of the alpha-subunit of the epithelial sodium channel in humankidney. Hypertension 46: 787–798, 2005.

54. Redelings MD, Sorvillo F, Mascola L. Increase in Clostridium difficile-related mortality rates, United States, 1999–2004. Emerg Infect Dis 13:1417–1419, 2007.

55. Rolfe RD, Helebian S, Finegold SM. Bacterial interference betweenClostridium difficile and normal fecal flora. J Infect Dis 143: 470–475,1981.

56. Salzman NH, de Jong H, Paterson Y, Harmsen HJ, Welling GW, BosNA. Analysis of 16S libraries of mouse gastrointestinal microflora revealsa large new group of mouse intestinal bacteria. Microbiology 148: 3651–3660, 2002.

57. Salzman NH, Hung K, Haribhai D, Chu H, Karlsson-Sjoberg J, AmirE, Teggatz P, Barman M, Hayward M, Eastwood D, Stoel M, Zhou Y,Sodergren E, Weinstock GM, Bevins CL, Williams CB, Bos NA.Enteric defensins are essential regulators of intestinal microbial ecology.Nat Immunol 11: 76–83, 2010.

58. Sato R, Tanaka M. Intestinal distribution and intraluminal localization oforally administered Clostridium butyricum in rats. Microbiol Immunol 41:665–671, 1997.

59. Savidge TC, Pan WH, Newman P, O’Brien M, Anton PM, PothoulakisC. Clostridium difficile toxin B is an inflammatory enterotoxin in humanintestine. Gastroenterology 125: 413–420, 2003.

60. Schultheis PJ, Clarke LL, Meneton P, Miller ML, Soleimani M,Gawenis LR, Riddle TM, Duffy JJ, Doetschman T, Wang T, GiebischG, Aronson PS, Lorenz JN, Shull GE. Renal and intestinal absorptivedefects in mice lacking the NHE3 Na�/H� exchanger. Nat Genet 19:282–285, 1998.

61. Seki H, Shiohara M, Matsumura T, Miyagawa N, Tanaka M,Komiyama A, Kurata S. Prevention of antibiotic-associated diarrhea inchildren by Clostridium butyricum MIYAIRI. Pediatr Int 45: 86–90,2003.

62. Sekirov I, Tam NM, Jogova M, Robertson ML, Li Y, Lupp C, FinlayBB. Antibiotic-induced perturbations of the intestinal microbiota alter hostsusceptibility to enteric infection. Infect Immun 76: 4726–4736, 2008.

63. Sghir A, Gramet G, Suau A, Rochet V, Pochart P, Dore J. Quantifi-cation of bacterial groups within human fecal flora by oligonucleotideprobe hybridization. Appl Environ Microbiol 66: 2263–2266, 2000.

64. Singh V, Raheja G, Borthakur A, Kumar A, Gill RK, Alakkam A,Malakooti J, Dudeja PK. Lactobacillus acidophilus upregulates intesti-nal NHE3 expression and function. Am J Physiol Gastrointest LiverPhysiol 303: G1393–G1401, 2012.

65. Sjogren YM, Jenmalm MC, Bottcher MF, Bjorksten B, Sverremark-Ekstrom E. Altered early infant gut microbiota in children developingallergy up to 5 years of age. Clin Exp Allergy 39: 518–526, 2009.

66. Smith JA, Cooke DL, Hyde S, Borriello SP, Long RG. Clostridiumdifficile toxin A binding to human intestinal epithelial cells. J MedMicrobiol 46: 953–958, 1997.

67. Stecher B, Hardt WD. The role of microbiota in infectious disease.Trends Microbiol 16: 107–114, 2008.

68. Syrbu SI, Cohen MB. An enhanced antigen-retrieval protocol for immu-nohistochemical staining of formalin-fixed, paraffin-embedded tissues.Methods Mol Biol 717: 101–110, 2011.



69. Tasteyre A, Barc MC, Collignon A, Boureau H, Karjalainen T. Roleof FliC and FliD flagellar proteins of Clostridium difficile in adherenceand gut colonization. Infect Immun 69: 7937–7940, 2001.

70. Taylor RH, Borriello SP, Taylor AJ. Isolation of Clostridium difficilefrom the small bowel. Br Med J 283: 412, 1981.

71. Testore GP, Nardi F, Babudieri S, Giuliano M, Di Rosa R, Panichi G.Isolation of Clostridium difficile from human jejunum: identification of areservoir for disease? J Clin Pathol 39: 861–862, 1986.

72. Tsutaoka B, Hansen J, Johnson D, Holodniy M. Antibiotic-associatedpseudomembranous enteritis due to Clostridium difficile. Clin Infect Dis18: 982–984, 1994.

73. Valiquette L, Pepin J, Do XV, Nault V, Beaulieu AA, Bedard J,Schmutz G. Prediction of complicated Clostridium difficile infection bypleural effusion and increased wall thickness on computed tomography.Clin Infect Dis 49: 554–560, 2009.

74. Voth DE, Ballard JD. Clostridium difficile toxins: mechanism of actionand role in disease. Clin Microbiol Rev 18: 247–263, 2005.

75. Waligora AJ, Barc MC, Bourlioux P, Collignon A, Karjalainen T.Clostridium difficile cell attachment is modified by environmental factors.Appl Environ Microbiol 65: 4234–4238, 1999.

76. Wee B, Poels JA, McCafferty IJ, Taniere P, Olliff J. A descriptionof CT features of Clostridium difficile infection of the small bowelin four patients and a review of literature. Br J Radiol 82: 890 –895,2009.

77. Wells JM, Brugman S. Building additional complexity to in vitro-derivedintestinal tissues. Stem Cell Res Ther 4: S1, 2013.

78. Wilson KH, Sheagren JN, Freter R, Weatherbee L, Lyerly D. Gnoto-biotic models for study of the microbial ecology of Clostridium difficileand Escherichia coli. J Infect Dis 153: 547–551, 1986.



Human Clostridium difficile infection: inhibition of NHE3 and microbiota profile

Documents

Transcript of Human Clostridium difficile infection: inhibition of NHE3 and microbiota profile