University of Pennsylvania University of Pennsylvania

ScholarlyCommons ScholarlyCommons

Publicly Accessible Penn Dissertations

2011

Extracellular Leucine-Rich Repeat Protein Let-4 is Required to Extracellular Leucine-Rich Repeat Protein Let-4 is Required to

Organize the Extracellular Matrix and Maintain Junctions in C. Organize the Extracellular Matrix and Maintain Junctions in C.

Elegans Epithelia Elegans Epithelia

Vincent Pasquale Mancuso University of Pennsylvania, vincent.mancuso@gmail.com

Follow this and additional works at: https://repository.upenn.edu/edissertations

Part of the Cell Biology Commons, and the Developmental Biology Commons

Recommended Citation Recommended Citation Mancuso, Vincent Pasquale, "Extracellular Leucine-Rich Repeat Protein Let-4 is Required to Organize the Extracellular Matrix and Maintain Junctions in C. Elegans Epithelia" (2011). Publicly Accessible Penn Dissertations. 542. https://repository.upenn.edu/edissertations/542

This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/542 For more information, please contact repository@pobox.upenn.edu.

Extracellular Leucine-Rich Repeat Protein Let-4 is Required to Organize the Extracellular Leucine-Rich Repeat Protein Let-4 is Required to Organize the Extracellular Matrix and Maintain Junctions in C. Elegans Epithelia Extracellular Matrix and Maintain Junctions in C. Elegans Epithelia

Abstract Abstract Epithelial cells line the interior of many organs, therefore a better understanding of how these cells are maintained could offer insights into many human diseases. This work focuses on two aspects of epithelia: cell junctions and the apical Extracellular Matrix (ECM). Epithelial cell junctions consist of conserved junction proteins that connect cells to each other, serve as a barrier, and separate the apical and basal domains of the cells. The specialized apical ECM of epithelial cells serves to protect the cells and interact with the outside environment. The apical ECM is present in many epithelia, but is poorly studied.

I have characterized the apical domains of epithelial cells and their junctions in the Caenorhabditis elegans excretory system in order to develop the organ as a model for epithelial development and maintenance. With my colleagues, I studied the development of the epithelial cells of the excretory system, and described roles for Ras and Notch in a biased competition model of cell fate determination. I have characterized the localization of conserved proteins of the polarity PAR complex, and the junctional cadherin-catenin complex using molecular markers and immunohistochemistry. This has established that the excretory system shares common features with other epithelia, which supports the C. elegans excretory system as a good epithelial model system.

I have also shown that extracellular leucine-rich repeat protein LET-4 has a role in organization of the apical ECM, and junction maintenance in both the excretory system and epidermis of C. elegans. Characterization of the LET-4 protein has indicated that it localizes apically in epithelial cells, but is not enriched at junctions. I characterized the let-4 loss of function phenotype with molecular markers, electron microscopy, and genetic interaction experiments, and have detected no defect in initial formation of junctions. These data suggest that it is not initial junction formation, but junction integrity that is affected in let-4 mutants. The let-4 analysis suggests that epithelial junction maintenance requires an intact apical ECM. The continuation of this work will involve further characterization of the molecular components of the apical ECM and identification of LET-4 interacting proteins.

Degree Type Degree Type Dissertation

Degree Name Degree Name Doctor of Philosophy (PhD)

Graduate Group Graduate Group Cell & Molecular Biology

First Advisor First Advisor Meera V. Sundaram

Keywords Keywords C. elegans, Epithelial cells, Extracellular matrix

Subject Categories Subject Categories Cell Biology | Developmental Biology

This dissertation is available at ScholarlyCommons: https://repository.upenn.edu/edissertations/542

EXTRACELLULAR LEUCINE-RICH REPEAT PROTEIN LET-4 IS REQUIRED TO

ORGANIZE THE EXTRACELLULAR MATRIX AND MAINTAIN JUNCTIONS IN

C. ELEGANS EPITHELIA

Vincent Pasquale Mancuso

A DISSERTATION

in

Cell and Molecular Biology

Presented to the Faculties of the University of Pennsylvania

in

Partial Fulfillment of the Requirements for the

Degree of Doctor of Philosophy

2011

Supervisor of Dissertation

________________________ Meera V. Sundaram. Ph.D., Associate Professor of Genetics

Graduate Group Chairperson

__________________________ Daniel S. Kessler, Ph.D., Associate Professor of Cell and Developmental Biology

Dissertation Committee:

Douglas J. Epstein, Ph.D., Associate Professor of Genetics

Stephen DiNardo, Ph.D., Professor of Cell and Developmental Biology

Amin S. Ghabrial, Ph.D., Assistant Professor of Cell and Developmental Biology

S. Todd Lamitina, Ph.D., Assistant Professor of Physiology

ii

Acknowledgements

Thank you to my thesis advisor Meera Sundaram, for welcoming me into your

lab, and patiently guiding me through my graduate career and research. I’ve always been

impressed with your intellectual rigor, enthusiasm for research, and your willingness to

give students your time. Thanks for being so generous with your time and talent to help

me grow as a scientist, speaker, teacher, and writer.

Thank you to the members of my thesis committee, Doug Epstein, Steve

DiNardo, Amin Ghabrial and Todd Lamitina, for your time and valuable guidance.

Thank you to the Worm Group for your helpful suggestions and insights over the years.

Thank you to my friends here at Penn for your support and insights, and particularly

Kelly Howell, Balpreet Bhogal and Jean Parry for helping me have at least a little fun in

lab every day.

Thank you to my whole family, particularly my parents, sister, brother and Uncle

Tom for your ceaseless encouragement as I pursued my goal of becoming a scientist.

Finally, I’m especially thankful to my wife and daughter; your patience, support and love

will always inspire me.

iii

ABSTRACT

EXTRACELLULAR LEUCINE-RICH REPEAT PROTEIN LET-4 IS REQUIRED

TO ORGANIZE THE EXTRACELLULAR MATRIX AND MAINTAIN JUNCTIONS IN

C. ELEGANS EPITHELIA

Vincent Pasquale Mancuso

Meera V. Sundaram

Epithelial cells line the interior of many organs, therefore a better understanding

of how these cells are maintained could offer insights into many human diseases. This

work focuses on two aspects of epithelia: cell junctions and the apical Extracellular

Matrix (ECM). Epithelial cell junctions consist of conserved junction proteins that

connect cells to each other, serve as a barrier, and separate the apical and basal domains

of the cells. The specialized apical ECM of epithelial cells serves to protect the cells and

interact with the outside environment. The apical ECM is present in many epithelia, but

is poorly studied.

I have characterized the apical domains of epithelial cells and their junctions in

the Caenorhabditis elegans excretory system in order to develop the organ as a model for

epithelial development and maintenance. With my colleagues, I studied the development

of the epithelial cells of the excretory system, and described roles for Ras and Notch in a

biased competition model of cell fate determination. I have characterized the localization

of conserved proteins of the polarity PAR complex, and the junctional cadherin-catenin

iv

complex using molecular markers and immunohistochemistry. This has established that

the excretory system shares common features with other epithelia, which supports the C.

elegans excretory system as a good epithelial model system.

I have also shown that extracellular leucine-rich repeat protein LET-4 has a role

in organization of the apical ECM, and junction maintenance in both the excretory system

and epidermis of C. elegans. Characterization of the LET-4 protein has indicated that it

localizes apically in epithelial cells, but is not enriched at junctions. I characterized the

let-4 loss of function phenotype with molecular markers, electron microscopy, and

genetic interaction experiments, and have detected no defect in initial formation of

junctions. These data suggest that it is not initial junction formation, but junction

integrity that is affected in let-4 mutants. The let-4 analysis suggests that epithelial

junction maintenance requires an intact apical ECM. The continuation of this work will

involve further characterization of the molecular components of the apical ECM and

identification of LET-4 interacting proteins.

v

Table of Contents

Title Page……………………………………………………………………..………i

Acknowledgements……………………………………………………..……...…….ii

Abstract…………………………………………………………………………..….iii

Table of Contents………………………………………………………………….....v

List of Tables………………………………………….…………………………....vii

List of Illustrations………………………………………………………………...viii

Chapter 1: General Introduction: Epithelial cells, their junctions,

and the apical extracellular matrix ………………………………………………….1

Chapter 2: Extracellular leucine-rich repeat proteins are required to organize

the apical extracellular matrix and maintain epithelial junction integrity

in C. elegans. . . …………….....................................................................................16

Chapter 3: Notch and Ras promote sequential steps of excretory tube development

in C.elegans………………………………………………………………….…..….61

Chapter 4: Discussion: The role of LET-4 in the apical ECM and junctions,

and approaches to identify LET-4 interacting partners………………………….....104

Appendix 1: Characterization of apical and cytoskeletal markers

in the C. elegans excretory system…………………………………………...…….131

Appendix 2: let-4 expression in the excretory system……………….………..…....154

Appendix 3: TEM analysis of the C. elegans excretory system…………………....161

vi

Appendix 4: Detailed protocols…………………………………….………….……198

TEM section staining protocol………………………………….....….……..199

Larvae immunostaing protocol…………………………..……..…….….….201

Freeze-crack immunostaining protocol…………………..……….…....……204

Laser ablation protocol……………………………………..……...…..…….205

Bibliography……………………………………………..…………………….…….206

vii

List of Tables

Table 3.1 Physical or genetic removal of the canal cell reduces but does not prevent

duct fate specification……………….………………………...……………..…90

Table 4.1 let-4; lpr-1 double mutant phenotype……………………………………….125

Table 4.2 RNAi knockdown of worm lipocalins does not result in larval lethality ..…126

Table 4.3 let-4 and let-653 RNAi ……………………………………………………..127

Table Ap1.1 Excretory System markers appear normal in let-4 mutants…….……..…142

Table Ap3.1 Summary of 3-fold embryos analyzed by TEM …………………………170

viii

List of Illustrations

Figure 1.1 Epithelial cells have apical and basal sides; both can be surrounded by an

ECM………………………………………………………………………….15

Figure 2.1 The apical ECM differs between excretory tube types…………….……..53

Figure 2.2 let-4 and egg-6 encode related transmembrane proteins with extracellular

leucine-rich repeats…………………………………………………………..54

Figure 2.3 LET-4::GFP and EGG-6::GFP localize to the apical domains of the excretory

duct, pore and epidermal cells…………………………………………….….55

Figure 2.4 let-4 and egg-6 are each required to maintain junction integrity between the

excretory duct and pore………………………………………………..……..56

Figure 2.5 let-4 and sym-1 are redundantly required to maintain junction integrity in the

epidermis……………………………………………………………………..57

Figure 2.6 The cytoplasmic and transmembrane domains of LET-4 are dispensable

for function……………………………………………………..……….……58

Figure 2.7 let-4 and egg-6 are required for proper apical ECM organization….…….59

Figure 2.8. LET-4::GFP and EGG-6::GFP localize apically in epithelia………...…..60

Figure 3.1 Timeline of excretory system development………………………...…….96

Figure 3.2 let-60/Ras promotes the duct vs. G1 pore fate…………………….….…..97

Figure 3.3 lin-3/EGF, let-23/EGFR and lin-12/Notch reporter expression

in the excretory system…………………………………………..…….……..98

Figure 3.4 let-60/Ras hypomorphs reveal defects in cell competition and stacking....99

Figure 3.5 The canal cell is required for duct and G1 pore stacking and

tubulogenesis………………………………………………………………....100

Figure 3.6 sos-1 temperature shift experiments reveal continued requirements

during duct morphogenesis and differentiation………….……………..….…101

ix

Figure 3.7 G1 withdrawal and G2 entry can occur independently………..………….102

Figure 3.8 Transmission Electron Micrographs of ventral enclosure stage embryo….103

Figure 4.1 Three models for destabilization of the apical ECM leading to junction

breakage …………………………………………………………………....…129

Figure 4.2 Summary of let-4 genetic interaction data…………………………….…..130

Figure Ap1.1 The PAR complex proteins are present in the cells

of the excretory system…………………………………………..…...…...…..148

Figure Ap1.2 The C. elegans E-Cadherin homolog HMR-1 and associated protein

p120 catenin (JAC-1) are localized dynamically in the duct cell…….…..…...149

Figure Ap1.3 F-actin (Phalloidin) Staining in epidermal cells and the excretory

system…………………………………………………………………...….....150

Figure Ap1.4 Chitin and WGA epitope staining…………………..……………….....151

Figure Ap1.5 AJM-1 and IF staining in let-4 RNAi-treated embryos…….…..........…152

Figure Ap1.6 Further characterization of the let-4 phenotype……………….....……..153

Figure Ap2.1 Expression of let-4 in the excretory system……………………...……. 160

Figure Ap3.1 TEM images of the excretory system and detached

inner eggshell layer in 1.5-fold let-4 embryos……………………..….….…. .176

Figure Ap3.2 TEM images of the excretory system in wild-type 3-fold

embryos………………………………………………………………..…..…..178

Figure Ap3.3 TEM images of the excretory system in let-4 3-fold

embryos………………………………………………………………....….….180

Chapter 1

General Introduction: Epithelial cells, their junctions, and the apical extracellular

matrix

1

Defects in epithelial cells are responsible for a variety of human diseases

The interior of organs and the exterior surfaces of organisms are exposed to a

variety of environments, and therefore require specialized polarized epithelial cells. Two

major formations of epithelia are planar and tubular arrangements. In planar epithelia,

cells line up side by side, and the apical face of the epithelium faces the outside of the

organism. Tubular epithelia are joined together to form a tube shape to produce an apical

surface facing the interior lumen of internal tubular organs. Epithelial cells are

characterized by conserved junctions, which separate apical and basal sides of the cells.

Epithelial cells are surrounded by a specialized extracellular matrix (ECM), consisting of

proteins, lipids and polysaccharides (Fig. 1.1).

Because of the wide variety of epithelia, defects in epithelial development or

maintenance contribute to many human diseases. Maintenance of epithelial polarity is

required for adsorption and secretion in the kidney, and as a result, epithelial polarity

defects are associated a number of diseases, including Polycystic Kidney Disease

(Wilson, 2011). Polarity defects in skin cells results in blistering diseases (Niessen et al.,

2010). Epithelial barrier defects in the small intestine, which are associated with diseases

such as Crohn’s disease and ulcerative colitis, can be the result of failure of localization

of apical junctional proteins. (Marchiando et al., 2010). A deeper understanding of

epithelial maintenance could offer insight into treatment or prevention of many diseases.

Epithelial cell maintenance also has a key role in prevention of cancer. Epithelial-

to-mesenchymal transition (EMT), a required step for metastasis, is characterized by loss

of epithelial characteristics, such as cell-cell junctions and polarity, and acquisition of

2

motility and invasiveness. In EMT, epithelial cells lose their junctions with neighboring

cells, and break through the extra-cellular matrix (ECM), in order to colonize sites of

metastasis (Kalluri and Weinberg, 2009; Polyak and Weinberg, 2009). Given their role

in cancer progression, it is important to develop a better understanding of the mechanisms

by which epithelial junctions and the extracellular matrix are formed.

Epithelial junction proteins are conserved

Epithelial cells are characterized by specialized junctions which provide tissue

structure, form a permeability barrier, and separate the apical and basolateral surfaces of

epithelial cells (Knust and Bossinger, 2002; Shin et al., 2006; Giepmans and van

Ijzendoorn, 2009). Although epithelial cells are in a variety of tissue types in so many

organisms, the features of epithelial junctions are evolutionarily conserved. Cadherin-

based adherens junctions mediate cell-cell adhesion, and anchor actin to the membrane,

while claudin based junctions provide a permeability barrier, and separate the apical and

basal domains of the epithelial cells. Although these junctional domains are conserved,

the relative position of the junctions differs among organisms. In mammals, adherens

junctions are located basally to claudin-based tight junctions. In contrast, Drosophila

adherens junctions are apical to claudin-based septate junctions. In Caenorhabditis

elegans, adherens junctions and septate-junction-like domains are localized together

apically (Lynch and Hardin, 2009). In these diverse organisms, proper localization of

these junctional proteins requires conserved apical polarity regulators such as PAR

complex, Crumbs, and Scribble complex (Goldstein and Macara, 2007). PAR-6, PKC-3

and Crumbs localize to the most apical domain, PAR-3 localizes sub-apically to epithelial

3

junctions, and Scribble localizes basolaterally. As development proceeds, epithelial

junctions are disassembled or re-formed as tissues mature (Acloque et al., 2009; Baum

and Georgiou, 2011; St Johnston and Sanson, 2011). Although the precise mechanisms

are still being elucidated, interactions among polarity proteins, extracellular cues, the

protein trafficking machinery and the cytoskeleton all contribute to the initial

establishment of apico-basal polarity and appropriate placement of epithelial junctions.

The apical ECM is a dynamic structure with roles in pathogen protection, cell shape

determination, and signaling

Epithelial cells are surrounded by an extracellular matrix (ECM) with roles in

signaling, transmission of mechanical feedback to cells, and maintenance of cell structure

(Hynes et al, 2009). Epithelial cells have both basal and apical ECMs. Basal domains of

epithelia cells contain integrins, which link the cytoskeleton to the underlying ECM.

The basal ECM has a role in signaling, by binding and interacting with growth factors.

For example, the basal ECM regulates TGFβ-signaling (Hynes, 2009). TGFβ is bound in

inactive forms by basal ECM proteins, and is activated by the actions of other proteins in

the ECM. Also, structural abnormalities in basal ECM have been associated with a

number of disorders, including Polycystic Kidney Disease (Wilson et al., 2011).

Additionally, the basal ECM has been known to have roles in cell adhesion and migration

(Berrier and Yamada, 2007), but the understudied apical ECM may also have important

roles in these processes.

4

Because epithelial cells are exposed to a variety of environments as the border to

the outside of an organism, or the interior of an organ lumen, they require specialized

apical ECMs. Apical ECM is present in both planar and tubular epithelial cells. The

apical ECM has been demonstrated to have roles in epithelial cell shape, tube structure,

signaling, and pathogen defense. The function and molecular components of the apical

ECM varies widely in different tissues, but some features are common. Apical ECMs

contain both transmembrane and secreted proteins. They also commonly contain

collagen, glycoproteins, and polysaccharides. Apical ECMs are commonly modified

after components are placed, and are commonly re-formed during development. Below, I

will describe some model systems, and what is known about epithelial cells, apical ECM,

and junctions.

The apical ECM in Mammals

Mammals have apical ECM in a variety of tissues, such as the egg, eye, ear and

intestine. Surrounding the mouse oocyte, the zona pellucida consists of a meshwork of

three glycosylated proteins, ZP1, ZP2 and ZP3. These proteins are synthesized and

secreted by growing oocytes. In this context, the ECM serves to allow fertilization by

just one sperm (Wassarman and Litscher, 2009). The ZP domain, a common domain in

apical ECM proteins gets its name from the ZP proteins. In the mammalian inner ear,

apical ECM structure is called the tectoral membrane. It includes ZP domain

glycoproteins called tectorins, and aids in the transmission of sensory input (Goodyear

5

and Richardson, 2002). The apical ECM of the mammalian ocular surface contains

glycosylated mucins (Govindarajan and Gipson, 2010), which serve to protect the eye.

Endothelial blood vessels contain a glycocalax, a membrane associated matrix of protein

and sugars (Pries et al 2000). In vivo, capillaries contain a fibrillar material early in

development, which is later cleared from the lumen (Folkman,1980).

The mammalian gastrointestinal tract provides an example of an apical ECM with

a known role in pathogen protections. The apical ECM protects from pathogens by both

signaling and forming of a physical barrier between the lumen of the intestine and the

epithelial cells. The apical ECM of the gastrointestinal tract includes glycosylated

mucins, which block underlying epithelial cells from proteases, and obstruct colonization

by bacteria in the gastrointestinal tract. The apical ECM in the gastrointestinal tract also

prevents pathogen invasion through signaling. The apical ECM includes Toll-like

receptors (TRLs), Leucine-Rich Repeat domain proteins which detect pathogens and

trigger the innate immune response (Moncada et al., 2003). This apical ECM, therefore,

has pathogen protection and signaling roles.

In mammals, a link between ECM and epithelial junctions has been suggested.

MUC1 is a transmembrane mucin glycoprotein, associated with pancreatic ductal

carcinoma. In humans, overexpression or mislocalization of MUC1 or MUC4 are

associated with poor prognosis in breast, lung and pancreatic cancers (Kufe et al., 2009).

In mouse models, overexpression of MUC1 triggers the molecular steps of EMT,

including the repression of epithelial junction protein E-cadherin (Roy et al., 2001).

6

Correct regulation and localization of mucins seems to be required to maintain polarity

and junctional connections in epithelial cells (Kufe et al., 2009).

The apical ECM in Drosophila

Drosophila is a powerful model organism, and has therefore been a useful system

to study the apical ECM. The apical ECM initially surrounding the Drosophila embryo is

the eggshell, which functions to protect the egg from the outside environment. The

Drosophila eggshell components are secreted apically over the oocyte by the somatic

epithelial follicle cells. The eggshell consists of predicted chitin binding and mucin-like

proteins (Fakouri et al., 2006) in addition to other chorion proteins (Trougakos and

Margaritis, 1998). Genes that contribute to the eggshell are tightly regulated temporally,

and are localized to specific portions of the embryo. So called early, middle and late

chorion genes are expressed at distinct times between stages 9-14, producing a final

eggshell with five distinct layers (Margaritis et al., 1980). This tight regulation indicates

a carefully coordinated deposition of eggshell layers in the developing ECM (Cavalieri et

al., 2008; Tootle et al., 2011). Later in development, Drosophila produces a cuticle. The

Drosophila cuticle contains ZP (Uv and Moussian, 2010) proteins, chitin, and lipids

(Payre, 2004). The outer layer, called the epicuticle, contains lipids and glycoproteins.

Cuticle is secreted apically by epidermal cells. After initial deposition, the cuticle must

be modified, as evidenced by the requirement for modifying protein matrix

7

metalloprotease (Glasheen et al., 2010). Thus, the apical ECM surrounding the

Drosophila epidermis is re-formed and modified several times during development.

A link between ECM and cell shape has been noted in Drosophila epithelia. The

apical ECM affects the shape of epithelial cells that form trichomes (Fernandes et al.,

2010). Loss of ZP domain proteins results in the detachment of epidermal cells from the

cuticle (Fernandes et al., 2010). The proteins are required for epidermal adhesion to the

cuticle (Bokel et al., 2005), and have also been demonstrated to have a role in controlling

epithelial cell shape (Plaza et al., 2010).

A particularly well-studied apical ECM in an epithelial tube system is the

Drosophila trachea. The trachea is a complex structure consisting of both multicellular

and unicellular tubes (Lubarski and Krasnow, 2003; Schottenfeld et al., 2010).

Interactions between the cytoskeleton and basal ECM are necessary in the Drosophila

trachea. Mutations in talin and integrin, two proteins involved in linking the cytoskeleton

to the ECM, result in the lumen of branch cells becoming convoluted and breaking up in

larval stages (Levi et al., 2006). On the apical side of the trachea, chitin fibers are

secreted into the apical lumen in the early development of the trachea, and form a chitin

cable, which is required for proper expansion of the dorsal trunk lumen diameter (Devine

et al., 2005; Tonning et al., 2005). Once deposited, proper maintenance of this chitin

apical ECM is necessary; mutations in chitin modifying enzymes Serp and Verm result in

elongated lumen (Wang et al., 2006; Luschnig et al., 2006).

8

Links between ECM and junctional maintenance have been suggested in the

Drosophila trachea. Secretion of Serp and Verm into the lumen requires intact septate

junctions (Wang et al., 2006). Also, apically localized ZP proteins Piopio and Dumpy

contain transmembrane domains and are part of the apical ECM. In the absence of Piopio

and Dumpy, epithelial junctions are not maintained during the switch from intercellular

to autocellular junctions in tracheal cells (Jazwinska et al., 2003), suggesting a

connection between the apical ECM and junction stability. Despite these data, we still

have a limited understanding of how the apical ECM contributes to epithelial morphology

and junction dynamics. New models to study the connection between apical ECM and

junctions could shed light on these interactions.

Epithelial cells and apical ECM in Caenorhabditis elegans

Several convenient features of C. elegans can be exploited to study the conserved

junctions and the apical ECM of epithelial cells. The worm has a short generation time

and large brood size, and it therefore a powerful genetic system. Additionally, C. elegans

is amenable to transgenic arrays and RNAi, allowing genetic manipulation. The worm is

transparent, and many molecular markers are available, or can be generated, allowing

visualization of cells and proteins in the living organism. C. elegans is therefore a

potentially informative system to study epithelial junction and apical ECM formation and

maintenance. I will now review epithelial tissues in the worm, and what is known about

their junctions and apical ECMs.

9

The epidermis

The C. elegans epidermis consists of planar epithelial cells that surround the

worm. The basal side of the epithelial cells faces muscle or pseudoceolom; the apical

side faces the outside of the worm. The cells of the epidermis have conserved epithelial

junctions (Bossinger et al., 2001) and apically localized conserved PAR complex proteins

(Praitis et al., 2005). Also, ERM-1 and SMA-1/βH-spectrin cytoskeletal linkers, which

organize actin, are localized apically in these cells (van Furden et al., 2004; Gobel et al.,

2004; Praitis et al., 2005). Throughout the life of the worm, the apical ECM surrounding

the epidermis changes several times. At the 1.5-fold stage, the embryonic epidermis is

lined by a thin apical ECM, the embryonic sheath (Priess and Hirsh, 1986; Costa et al.,

1997). The sheath is visible by transmission electron microscopy (TEM), but the

molecular components of the sheath are unknown. Beyond the sheath, four additional

layers of ECM constitute the eggshell (Benenati et al., 2009; Rappleye et al., 1999). The

ECM layer closest to the sheath is the inner-eggshell layer, a sac-like structure that

surrounds the entire embryo. The inner-eggshell layer hugs the embryo closely, and is

therefore close to the sheath in most regions, but separates from the sheath where the

embryo bends inward. The components of the sheath, and the mechanism of the

connection between the sheath and inner eggshell layer are unknown.

In the 3-fold stage of development, epidermal cells produce a new apical ECM,

the cuticle. The cuticle serves to protect the worm, help the worm move, and control the

shape of the worm. The cuticle contains collagen and also is made of cuticlins, ZP

domain proteins that have a role in cuticle patterning (Sapio et al., 2005; Page and

10

Johnstone, 2007; Plaza et al., 2010). The cuticle is an apical ECM that is replaced four

times in the worm’s lifetime; a new cuticle is secreted with each larval molt. Mutations

in the cuticle proteins have revealed a role for this ECM in permeability, locomotion, and

worm shape (Page and Johnstone, 2007).

The alimentary tract

Several C. elegans organs contain tubular epithelia. The largest tubular organ

system in the worm is the alimentary tract, consisting of the pharynx, intestine, and rectal

cells. The intestinal epithelial cells, enterocytes, have actin protein ACT-5, ERM-1, and

SMA-1 (Gobel et al., 2004; Segbert et al., 2004; Praitis et al., 2005) localized apically,

and the intestine has conserved apical junction proteins like discs large complex and

cadherin/catenin complex, as well as PAR complex proteins (Bossinger et al., 2001). The

pharynx has an apical chitinous matrix, but the intestine is not lined by cuticle (Zhang et

al., 2005). Although many junctional and apical components are the same in the intestine

and epidermal cells, the striking difference between these tissues is in the extracellular

matrix. The epidermal apical ECM contains cuticle, and the intestine does not,

suggesting very different ECM components between these similar tissues.

11

The excretory system

Despite the progress made in multiple models, the relationship between conserved

epithelial junctions and apical ECM formation and maintenance needs to be better

understood in a simple system. The C. elegans excretory system is emerging as a useful

organ to study the basic properties of epithelial tube cells. This ‘primitive renal system’

forms a continuous lumen through three tandem unicellular tubes: the canal cell, the duct

cell, and the pore cell (Nelson et al., 1983; Nelson and Riddle, 1984). The advantage of

the excretory system is that it is a very simple system with multiple types of unicellular

epithelial tubes in adjacent cells. Two different processes of tube formation occur in the

excretory system. The duct and pore cells form by a wrapping around mechanism in

which the cells form autocellular junctions. In the duct cell, the cell fuses, and the

autocellular junctions dissolve (Stone et al., 2009). The canal cell lumen forms without

the formation of autocellular junctions (Buechner, 2002; Berry et al., 2003). At the 1.5-

fold stage of embryonic development, the unicellular tubes of the excretory system have

formed a continuous lumen connects through all three cells. The cells are tandemly

connected, and epithelial junctions are visible by TEM and with molecular markers

(Abdus-Saboor et al., 2011). After this initial stage of tube formation and junction

formation, the excretory system undergoes a process of elongation. Over the next several

hours, the cells undergo morphological changes, and need to maintain junctions as the

cells elongate until the 3-fold stage of embryonic development. Through these changes

the lumen diameter remains the same, but the lumen length increases. The taxing process

12

of elongation requires junctional maintenance and growth of the apical ECM, making the

excretory system an exciting system to study junctional and apical ECM dynamics.

The apical ECM of the excretory system is still mysterious, and varies among the

cells of the excretory system. At the 1.5-fold stage, a wispy apical ECM is visible by

TEM. Between the 1.5-fold and 3-fold stage, cuticle is deposited in the lumen of the duct

and pore. The canal cell, in contrast, does not have luminal cuticle. Proteins known to

have a role in luminal maintenance in the canal cell include ion channels (Berry et al.,

2003) and components of the cytoskeleton such as ERM-1 and SMA-1/β-H-spectrin

(Gobel et al., 2004; Buechner, 2002). Like the intestine, the canal cell is a tubular

epithelial structure with SMA-1 and ERM-1 apically localized, but the canal cell lumen is

formed by a single cell. The C. elegans excretory system has the potential to be a model

to study epithelial junctions and different types of apical ECM in a simple organ. For the

excretory system to be established as a model requires a better understanding of the duct

and pore cell, and many important questions need to be addressed. What proteins

contribute to the ECM? What is its role in luminal growth/maintenance? What is the

relationship of the ECM to junction dynamics? A better understanding of the role of the

ECM in the formation and maintenance of epithelial tubes in these tiny cells could

provide insight into the junctional dynamics and requirement of apical ECM in epithelial

cells.

13

Figure Legend

Figure 1.1. Epithelial cells have apical and basal sides; both can be surrounded by

an ECM. Planar (A) and tubular (B) epithelia are depicted. Cells are held together by

apical junctional proteins. The apical ECM consists of collagen, mucins and ZP proteins.

The basal ECM includes collagen, laminins, and intergrins.

14

Figure 1.1

junction proteins

Apical ECM

Basal ECM

Basal ECM

Apical ECM

junction proteins

A

B

15

Chapter 2

Extracellular leucine-rich repeat proteins are required to organize the apical

extracellular matrix and maintain epithelial junction integrity in C. elegans

This chapter has been submitted as a manuscript:

Mancuso, V.P., Parry, J.M., Storer, L., Poggioli, C., Nguyen, K.C.Q., Hall, D.H. and

Sundaram, M.V. Extracellular leucine-rich repeat proteins are required to organize

the apical extracellular matrix and maintain epithelial junction integrity in C.

elegans

16

Roles of Authors

Chapter 2, as presented here, with some modifications, is a submitted manuscript.

The bulk of the work of the chapter is my let-4 analysis. In parallel to my work on let-4,

other members of the lab characterized the gene egg-6. The allele egg-6(cs67) was

identified in a screen for rod-like larval lethality, a phenotype indicative of an excretory

system defect (Craig Stone Thesis, 2008). Analysis of egg-6 revealed that the mutant had

similar defects to let-4, and was also in the eLLRon protein family. In order to present

my let-4 work in the larger context of eLLRon proteins, we incorporated our lab‟s work

on egg-6 into this chapter.

I performed the genetic analysis, fluorescent marker analysis, transmission

electron microscopy, deletion construct analysis, RNAi, permeability assay and

immunostaining for the let-4 analysis. Meera Sundaram positionally cloned let-

4(mn105), and performed some of the let-4 RNAi and TEM analysis. Ken Nguyen and

David Hall performed the sectioning and assisted in the TEM analysis. Luke Storer and

Corey Poggioli helped to generate the LET-4 deletion constructs and performed some

RNAi experiments. Jean Parry, with the assistance of Luke Storer, performed the

cloning, phenotypic characterization, genetic analysis, and marker analysis of EGG-6.

The work in the Appendices 1-3 is my work which supplements the main body of

Chapter 2.

17

Abstract

The specialized junctions that hold epithelial cells together are essential for organ

integrity yet often must be remodeled or disassembled during normal morphogenesis and

tissue turnover. Loss of epithelial junction integrity during epithelial-to-mesenchymal

transition (EMT) is a key feature of tumor metastasis, the major cause of cancer

morbidity. The factors that control junction stability and dynamics are poorly

understood, but include both cell-intrinsic and environmental cues. We identified a set of

extracellular leucine-rich repeat only (eLRRon) proteins in C. elegans (LET-4 and EGG-

6) that are expressed on the apical surfaces of epidermal cells and some tubular epithelia,

including the excretory duct and pore. A previously characterized paralog, SYM-1, is

also expressed in epidermal cells and secreted into the apical extracellular matrix (ECM).

Mutants lacking one or more of these eLRRon proteins show multiple defects in apical

ECM organization. Furthermore, epithelial junctions initially form in the correct

locations but then break at the time of collagen matrix secretion and remodeling of cell-

matrix interactions. This work identifies eLRRon proteins as important components and

organizers of the pre-cuticular and cuticular apical ECM, and adds to the small but

growing body of evidence linking the apical ECM to epithelial junction stability. We

propose that eLRRon-dependent apical ECM organization contributes to cell-cell

adhesion and may modulate epithelial junction dynamics in both normal and disease

situations.

18

Introduction

Polarized epithelial cells organize together to form many of the surfaces in our

bodies, including the outer epidermis and the lining of many internal tubular organs such

as the kidney, lung and gastrointestinal tract. Consequently, defects in epithelial

development or maintenance underlie a variety of human diseases (Marchiando et al.,

2010; Chamcheu et al., 2011; Wilson, 2011). Loss of epithelial character during

epithelial-to-mesenchymal transition (EMT) is a key feature of tumor metastasis, the

major cause of cancer morbidity (Kalluri and Weinberg, 2009; Polyak and Weinberg,

2009). Thus, it is important to understand how epithelial structures are formed and

maintained.

Epithelial cells are linked by specialized junctions that hold the tissue together,

create a paracellular barrier, and separate the cells' apical and basolateral surfaces (Shin et

al., 2006; Giepmans and van Ijzendoorn, 2009). Many junction components are

evolutionarily conserved, although junction organization differs somewhat among

organisms. In mammals, cadherin-based adherens junctions, which mediate cell-cell

adhesion, are located basally to claudin-based tight junctions, which form the paracellular

barrier and demarcate the apical and basolateral membrane surfaces. In Drosophila,

adherens junctions are located apically to claudin-based septate junctions. In

Caenorhabditis elegans, a single electron-dense structure, termed the “apical junction”,

contains adjacent adherens junction and septate-junction-like domains (Lynch and

Hardin, 2009). Initial junction assembly depends on conserved polarity regulators such as

the PAR, Crumbs and Scribble complexes (Goldstein and Macara, 2007). Once

19

assembled, epithelial junctions are dynamic structures that must be frequently

disassembled or remodeled during morphogenesis and tissue turnover (Acloque et al.,

2009; Baum and Georgiou, 2011; St Johnston and Sanson, 2011). The mechanisms that

control junction stability and dynamics are still poorly understood.

The basal and apical surfaces of epithelia contain different types of proteins and

lipids, and each surface secretes and interacts with different factors in the extracellular

matrix (ECM). Basal surfaces face towards the basement membrane and neighboring

tissues. In simple planar epithelia, apical surfaces face towards the outside of the body,

and in tubular epithelia apical surfaces face towards the lumen. Basal domains typically

contain integrins, which link the actin cytoskeleton to basement membrane components

such as laminins and collagens (Hynes, 2009). Apical domains contain other types of

transmembrane proteins, such as zona-pellucida (ZP)-domain proteins and mucins that

interact with or contribute to the apical ECM (Bafna et al., 2010; Plaza et al., 2010). It

has long been appreciated that the basal ECM influences epithelial cell polarity, cell

shape and cell motility (Berrier and Yamada, 2007). The apical ECM, in contrast, has

generally been viewed as a more passive protective barrier against pathogens and other

environmental toxins. However, there is increasing evidence that the apical ECM also

helps to shape epithelial cell morphology and can influence junction dynamics. For

example, in the Drosophila trachea, a temporary chitinous apical ECM controls tube

length (Devine et al., 2005; Tonning et al., 2005) and the ZP-domain proteins Piopio and

Dumpy influence junction remodeling (Jazwinska et al., 2003). In humans,

overexpression of the mucin MUC1 is observed in >90% of metastatic pancreatic ductal

adenocarcinoma, and MUC1 can influence EMT in mouse models (Kufe, 2009; Roy et

20

al., 2011). However, we still have a limited understanding of how the apical ECM

contributes to epithelial morphology and junction dynamics.

We use the C. elegans excretory (renal-like) system as a simple model for

epithelial tube development. The excretory system consists of three tandem unicellular

tubes: the large canal cell, which extends along the entire length of the body, and the

smaller duct and pore tube cells, which connect the canal cell to the outside environment

to allow for fluid waste excretion (Nelson et al., 1983; Nelson and Riddle, 1984) (Fig.

2.1A). Each unicellular tube has an intracellular apical or lumenal domain and an

extracellular basal domain, and the three tubes are connected in tandem via apico-lateral

junctions. All three tubes develop from initially non-epithelial precursors, but they are

morphologically distinct and form lumens via different processes. The canal cell forms a

lumen intracellularly at the site of the duct-canal cell junction, presumably through a

vesicular trafficking mechanism (Buechner, 2002; Berry et al., 2003). The duct and pore

tubes form by a wrapping mechanism in which the cells form autocellular junctions and

create an internal lumen from a previously external surface. The duct cell then auto-fuses

to dissolve its autocellular junction and become a seamless toroid, while the pore cell

retains its autocellular junction (Stone et al., 2009). After these initial steps of

tubulogenesis, all three tube cells elongate and undergo morphological changes to adopt

their unique sizes and shapes. Later in larval development, the original pore cell (G1)

withdraws from the organ to become a neuroblast, and is replaced by a second pore cell

(G2), which also forms a tube via wrapping (Sulston et al., 1983; Stone et al., 2009;

Abdus-Saboor et al., 2011). Thus, the excretory system is a simple model for studying

21

lumen development and maintenance and the dynamic control of epithelial junctions.

When searching for mutants that affect excretory duct and pore morphology, we

identified two leucine-rich repeat transmembrane proteins, LET-4 and EGG-6, that

localize to the apical domains of the duct, pore and epidermis. Here we show that LET-4,

EGG-6 and a paralog SYM-1 are important both to organize the apical ECM and to

maintain epithelial junction integrity.

22

Results

The apical ECM of the excretory duct and pore is contiguous with that of the

epidermis

The apical ECM and cytoskeleton differ significantly between different tube types

in the excretory system. The excretory canal cell resembles the C. elegans gut in that it is

not lined by cuticle, but has a specialized apical cytoskeleton containing the FERM

domain protein ERM-1 (Gobel et al., 2004; van Furden et al., 2004) (Fig. 2.1 B,C). It

also requires a set of specialized "exc" gene products for its lumenal maintenance

(Buechner et al, 1999, Buechner 2002). In contrast, the duct and pore do not appear to

express ERM-1 or most exc genes, but the mature duct and pore lumens are lined by a

collagenous cuticle that is contiguous with that of the epidermis (Nelson et al., 1983)

(Fig. 2.1A-E). However, the bulk of cuticle secretion does not occur until the latter part

of embryogenesis (Costa et al., 1997; Johnstone and Barry, 1996), after the duct and pore

have taken their mature shapes.

To examine the pre-cuticular duct and pore ECM, we analyzed existing

transmission electron micrographs (TEMs) of 1.5-fold embryos (Fig. 2.1F-J). At this

stage, the embryonic epidermis is lined by a thin apical ECM termed the "embryonic

sheath" (Priess and Hirsh, 1986), which later becomes an outer layer of the L1 cuticle

(Costa et al., 1997). Outside of the sheath, four additional ECM layers were visible that

together constitute the eggshell and are secreted by the embryo soon after fertilization

(Benenati et al., 2009; Rappleye et al., 1999). The inner-most of these layers was a sac-

23

like structure that encased the entire embryo; it was closely apposed to the sheath in most

regions, but separated from the sheath at points where the embryo bends inward,

including at the excretory pore opening (Fig. 2.1I). Within the nascent excretory pore

and duct lumen, a very thin lining of gray material was visible that may correspond to a

sheath-like ECM. The remainder of the duct and pore lumenal space, as well as the lumen

of the canal cell, was filled with fibrous electron-dense material (Fig. 2.1I, J). This

fibrous ECM material disappeared from the duct and pore by 5-6 hours later, at which

time the cuticle lining of the duct and pore had been secreted (Fig. 2.1D,E). In summary,

TEM analysis revealed the presence of two apical ECM layers within the duct and pore

prior to cuticle secretion; both of these layers are morphologically distinct from the

innermost layers of the epidermal ECM with which they are in contact.

let-4 and egg-6 encode transmembrane proteins with extracellular leucine-rich

repeats.

To identify genes important for excretory duct and pore development or

maintenance, we searched for mutants with defects in these epithelial tubes. let-

4(mn105) mutants previously were reported to have a rod-like lethal phenotype indicative

of excretory system defects (Meneely and Herman, 1979; Buechner et al., 1999), making

let-4 a candidate of interest. We isolated egg-6(cs67) in an EMS mutagenesis screen for

rod-like lethal mutants (Materials and Methods); a second allele, egg-6(ok1506), was

obtained from the C. elegans gene knockout consortium (Moerman and Barstead, 2008).

In both let-4 and egg-6 mutants, excretory junction morphology appeared initially

24

normal, but the pore autocellular junction disappeared shortly before or after hatching,

implicating these genes in the maintenance of junction integrity (see below).

let-4(mn105) is a recessive, loss-of-function mutation and caused highly, but not

completely, penetrant lethality (Fig. 2.2A). The majority of mutants died as early L1

larvae with excretory defects. A smaller percentage of mutants died as embryos; this

embryonic lethal phenotype was temperature sensitive. Approximately 2% of mutants

were "escapers" that survived to adulthood and were fertile, but exhibited defects in

locomotion and egg-laying. The progeny of these escaper homozygotes had the same rate

of lethality as progeny from heterozygous mothers, indicating that there was no maternal

effect on lethality (Fig. 2.2A).

egg-6(cs67) and egg-6(ok1506) are also recessive loss-of-function mutations and

both caused recessive, fully penetrant L1 lethality due to excretory defects (Fig. 2.2A).

Animals rescued for this zygotic lethality by an egg-6(+) transgene (see below) gave

100% dead embryos in the next generation, revealing a maternal egg-6 requirement.

Embryos lacking maternal egg-6 arrested at the ~40 cell stage and had fragile eggshells,

as also observed after egg-6 RNAi (Sonnichsen et al., 2005).

We positionally cloned let-4 and found that it corresponded to the gene sym-

5/C44H4.2, which encodes a predicted type I transmembrane protein with 14

extracellular leucine-rich repeat (LRR) domains and a short cytoplasmic tail (Fig.

2.2B,C). let-4(mn105) mutants had a C to T nucleotide change in the fourth exon of

C44H4.2, introducing a stop codon into the 11th LRR. A 5.3kb genomic fragment

encompassing C44H4.2 and no other genes rescued mn105 lethality. RNAi against

25

C44H4.2 also recapitulated some aspects of the let-4 phenotype (see below). Although

C44H4.2 has been previously called sym-5 (synthetic lethal with mec-8) based on genetic

interactions with the mec-8 splicing factor observed in RNAi experiments (Davies et al.,

1999), the let-4 gene name pre-dates those studies. Therefore, we refer to C44H4.2 as

LET-4.

We positionally cloned cs67 and found that it corresponded to the gene egg-

6/K07A12.2, which also encodes a predicted type I transmembrane protein with 14

extracellular LRR domains and a short cytoplasmic tail (Fig. 2.2B,C). egg-6 was

independently identified and named based on its eggshell-defective RNAi phenotype

(Andrew Singson and Karen Oegema, personal communication). cs67 mutants had a C

to T nucleotide change in the eighth exon of egg-6/K07A12.2, introducing a stop codon

into the extracellular domain. cs67 failed to complement egg-6(ok1506), which deletes

1678 bp of the coding region, completely eliminating the LRR domain. A 10.5kb

genomic fragment encompassing K07A12.2 and no other genes rescued cs67 and ok1506

zygotic lethality. Thus, we conclude that cs67 is an allele of egg-6, and that let-4 and

egg-6 encode related transmembrane proteins.

LET-4 and EGG-6 belong to the large family of extracellular LRR (eLRR)

proteins, which includes many proteins involved in cell adhesion, ECM interactions and

signaling. LET-4 and EGG-6 specifically belong to the "eLRR only" or "eLRRon"

subgroup (Dolan et al., 2007), since they contain no other recognizable domains. Mice

have 52 eLRRon proteins, including LRRTM1-3, which are involved in synaptic junction

formation or stabilization (Brose, 2009; de Wit et al., 2009; Ko et al., 2009; Linhoff et al.,

2009; Siddiqui et al., 2010) and the small leucine-rich proteoglycans (SLRPs), which

26

modulate collagen matrix assembly (Kalamajski and Oldberg, 2010); many others remain

uncharacterized. In addition to LET-4 and EGG-6, C. elegans has 15 other members of

the eLRRon family, including SYM-1, a secreted epithelial eLRRon protein that

functions redundantly with LET-4 in the epidermis (Davies et al., 1999). The LRR

domain of LET-4 is more similar to that of SYM-1 (53%) than to that of EGG-6 (49%) or

any other eLRRon protein.

LET-4::GFP and EGG-6::GFP localize to the apical (luminal) side of the duct, pore

and other external epithelia

To visualize the localization of LET-4 and EGG-6, we generated fusion proteins

by inserting GFP at the LET-4 or EGG-6 C-terminus within our genomic rescue

fragments. Both the LET-4::GFP and EGG-6::GFP fusion proteins rescued lethality of

the corresponding mutants, indicating that all required regulatory elements were included

in the transgenes and that the tagged proteins were functional (Fig. 2.2A,B).

LET-4::GFP and EGG-6::GFP were expressed in a subset of epithelial cells,

including epidermal, vulval and rectal cells and the excretory duct and pore (Figs. 2.3,

2.8). EGG-6::GFP was also observed in some neurons (Fig. 2.8). Expression began

around the ventral enclosure stage of embryogenesis and continued through larval

development, but then decreased in adulthood. Expression was notably absent from other

internal epithelial tissues such as the gut and pharyngeal tubes (Fig. 2.3C-F). LET-

4::GFP was transiently expressed in the excretory canal cell at the 1.5-fold stage (Fig.

2.3C), but no longer visible in this cell by hatch. Notably, with the exception of the canal

27

cell, the epithelia that expressed LET-4 and EGG-6 were those that would eventually

become cuticle-lined.

In almost all epithelia where they were expressed, LET-4::GFP and EGG-6::GFP

appeared strongly apically enriched (Figs. 2.3, 2.8). In the excretory duct and pore, LET-

4::GFP and EGG-6::GFP lined the luminal membrane (Fig 2.3A-B). In the epidermis,

both fusions were distributed across the apical surfaces of most dorsal and ventral

epidermal cells but were observed more weakly or variably in the lateral (seam)

epidermis (Fig. 2.3G-H). Neither fusion was strongly enriched at apical junctions based

on co-visualization with DLG-1/Discs Large::mcherry (Fig. 2.3 B,D,F,G,H). Both fusions

partially overlapped with but did not strongly co-localize with transepidermal

intermediate filaments (IFs) at hemidesmosomes, based on co-staining with the IF

antibody MH4 (Fig. 2.8 and data not shown). Both fusions were present in many large

puncta, potentially representing a vesicular compartment trafficking to or from the

membrane. In summary, LET-4 and EGG-6 topology and apical localization suggest a

configuration in which the LRR domains extend into the apical ECM, but localization is

not limited to known sites of epidermal-apical ECM attachments.

Interestingly, the one exception to the apical localization of LET-4::GFP was the

excretory canal cell. At the 1.5-fold stage, when LET-4::GFP was transiently expressed

in the canal cell, LET-4::GFP localized uniformly around the plasma membrane and not

to the developing internal lumen (Fig. 2.3 C,C‟). While the significance of this

expression is unclear, we speculate that the unique localization pattern reflects molecular

28

differences in the apical domain of the canal cell vs. the apical domains of other LET-

4::GFP expressing cells.

let-4 and egg-6 are required to maintain junction and lumen integrity in the

excretory duct and pore

The majority of let-4(mn105) mutants and all egg-6(cs67) or egg-6(ok1506)

mutants arrested as L1 larvae with excretory defects (Fig. 2.2A). The overall morphology

and junctional pattern of the excretory system appeared initially normal in mutant 3-fold

embryos, but became detectably abnormal shortly prior to hatch (Fig. 2.4). The first

detectable abnormality was a swelling of the canal cell lumen in the region proximal to

the canal-duct junction (Fig. 2.4C-E). Subsequently, the duct and pore cells separated

from each other and the pore autocellular junction disappeared (Fig. 2.4F-H). Remants of

junction material sometimes remained at the separation points, suggesting junction

breakage. The duct-canal junction always remained intact, and the duct lumen often

swelled considerably. Canal lumen swelling was a secondary consequence of defects in

the duct and pore, since the excretory phenotype was rescued by lpr-1p-driven LET-4(+)

or EGG-6(+) transgenes expressed specifically in the duct, pore and epidermal cells but

not in the canal cell (Fig. 2.2A). Neither let-4 nor egg-6 was rescued by dpy-7p-driven

transgenes expressed in the pore and epidermal cells. Thus, let-4 and egg-6 are required

in the excretory duct and likely also in the pore, but not in the canal cell, a requirement

that fits with the expression patterns described above. Within the duct and pore, let-4 and

egg-6 are required for both luminal and junction maintenance.

29

To confirm these interpretations for let-4 mutants, and to visualize the narrow

lumen of the canal cell, duct cell and pore cell directly, we performed transmission

electron microscopy (TEM) of successive serial thin sections. We analyzed five let-4

embryos at the 1.5-fold stage, just after initial tubulogenesis, and confirmed that the

lumen had a generally normal shape and was continuous through all three cells (Fig. 2.4I

and Fig Ap3.1). Fibrous ECM material was visible in the lumen as in wild-type (Fig.

2.4I). We analyzed three wild-type and nine let-4 mutant embryos at the late 3-fold stage,

surrounding the window when the duct and pore have taken their mature shape and

defects first become visible by light microscopy (For details of these results, see

Appendix 3, Figures Ap3.2 and Ap3.3). In 5/9 let-4 3-fold embryos, all three tube cells

were still properly connected and the lumen was continuous as in wild-type, with no

apparent distortions. Intercellular apical junctions appeared normal, as did the cuticular

lining of the duct and pore (Fig. 2.4J). Because 97% of let-4 embryos eventually display

excretory defects, we infer that these embryos would have displayed defects shortly

thereafter, had they been allowed to mature. The absence of any detectable junction or

luminal defect in these embryos indicates that initial steps of junction formation, lumen

growth and cuticle secretion are fairly normal in let-4 mutants

In 4/9 let-4 3-fold embryos, the canal and duct tubes remained connected but the

duct and pore appeared to have separated, as we had also observed by confocal

microscopy. In one of these embryos, the existing duct lumen and the canal lumen

appeared normal. In another, the duct lumen appeared normal, but the canal lumen was

greatly enlarged. In the remaining two embryos, the duct lumen diameter was enlarged

30

proximal to the duct cell body, and the apical membrane in this region had separated from

the cuticle lining (Fig. 2.4K). Because the cuticle ring had a normal diameter in these

cases, we infer that lumen distortion occurred subsequent to cuticle secretion. In two

embryos, we were able to trace the duct lumen to its premature termination within the

duct process (Fig. 2.4L). We were unable to recognize the excretory pore cell in three of

these embryos, suggesting that the pore lacked its characteristic autocellular junction and

lumen. Our interpretation is that duct and pore separation leads to pore collapse and

lumen retraction, and that duct and canal cell lumen swelling behind the break is a

secondary consequence of excretory fluid backup. Thus the primary junctional defect in

let-4 mutants appears to be a failure to maintain the duct-pore intercellular junction.

Paralogs let-4 and sym-1 function redundantly to maintain epidermal junction

integrity during embryonic elongation

A small proportion of let-4 mutant or let-4 RNAi embryos ruptured during

embryonic elongation and failed to hatch (Figs. 2.2A, 2.5A). This phenotype reflected a

semi-redundant role of let-4 and its closest paralog, sym-1. Like LET-4, SYM-1 also is

expressed in epidermal cells, but unlike LET-4, SYM-1 lacks a transmembrane domain

and is secreted into the apical ECM (Davies et al., 1999). Whereas essentially all sym-1

embryos developed normally and hatched, ~100% of sym-1; let-4(RNAi) embryos

ruptured (Fig. 2.5A). The rare embryos that did not rupture swelled abnormally as they

approached hatch, suggesting a defect in osmotic integrity (Fig. 2.5B). Similar osmotic

defects were seen in mec-8; let-4(RNAi) embryos (Fig. 2.5A), the basis for the alternative

let-4 name sym-5 (Davies et al., 1999).

31

Epidermal rupture during embryonic elongation can be caused by excessive actin-

myosin contractile activity, which provides the force for elongation (Wissmann et al.,

1997; Wissmann et al., 1999; Piekny et al., 2000; Piekny et al., 2003), or by defects in

structural components of the epidermal junctions (Costa et al., 1998; Totong et al., 2007).

In sym-1; let-4(RNAi) embryos, AJM-1::GFP and HMR-1/cadherin::GFP both appeared

normally localized prior to significant elongation and rupture (Fig. 2.5E,K), suggesting

that junction organization had been established properly. Junctions did not appear

distorted during the early steps of elongation as in known mutants with increased

contractile activity (Diogon et al., 2007). Furthermore, in temporal analyses, most

embryos managed to elongate to the 3-fold stage before rupturing and retracting to a

shorter length (Fig. 2.5F-N). Thus, as for the excretory system, we found no evidence for

defects in junction establishment. Rather, LET-4 and SYM-1 are required to prevent

epidermal junction breaks during the latter part of embryogenesis. Notably, this is the

time frame when cuticle secretion begins and epidermal-ECM interactions must be

remodeled (Costa et al., 1997).

The LET-4 transmembrane and cytoplasmic domains are dispensable for function

Some eLRRon proteins, including SYM-1, lack a transmembrane domain, and are

secreted into the apical ECM (Davies et al., 1999). Furthermore, although EGG-6 has a

predicted transmembrane domain, some proportion of EGG-6::GFP was still secreted , as

it accumulated between the embryo and eggshell (Fig. 2.8). To ask if LET-4 must be

32

tethered to the membrane and to identify domains important for its function, we deleted

the transmembrane (TM), cytoplasmic (Cterm) or extracellular LRR domains in the

context of an lpr-1p::LET-4 transgene construct tagged with GFP to visualize localization

within the excretory duct (Fig. 2.6). LET-4(ΔLRR) failed to rescue let-4 lethality;

furthermore, the fusion protein was not enriched at the apical face of the excretory duct

and other epithelial cells (Fig. 2.6 B,D). In contrast, LET-4(ΔCterm) efficiently rescued

let-4 lethality and appeared properly localized (Fig. 2.6 C,D). LET-4(ΔTM) appeared

toxic to embryos and we were able to obtain only a few transgenic lines with very low,

undetectable levels of expression. LET-4(ΔTM) transgenes were apparently expressed,

however, since they partially rescued let-4 larval lethality (Fig. 2.6D). We conclude that

the LRR domains are required for proper LET-4 function and localization, whereas the

cytoplasmic domain is dispensable, and that tethering of LET-4 to the membrane is not

absolutely required for function.

let-4 and egg-6 are required for proper apical ECM organization

The above studies suggested that LET-4, SYM-1 and EGG-6 all might function

extracellularly as part of the apical ECM. Although the excretory duct and pore lumen

ECM appeared morphologically indistinguishable from wild-type in let-4 mutants,

several abnormalities in the epidermal apical ECM were observed in let-4 and egg-6

mutants. First, TEM analysis revealed that, although all apical ECM layers were present,

the inner eggshell layer was more widely separated from the epidermal embryonic sheath

33

layer in 5/5 let-4 embryos at the 1.5-fold stage (Fig. 2.7A), suggesting a problem within

one or both of these layers. Second, in most let-4 and egg-6 mutant 3-fold embryos,

many globular structures accumulated between the embryo and the eggshell (Fig. 2.7B-

D). These globules contained cytoplasm, since they were marked by GFP in transgenic

embryos expressing cytoplasmic GFP reporters (Fig. 2.7B). In let-4 TEMs, these

cytoplasts appeared to be membrane-bound and were positioned between the nascent

cuticle and the inner eggshell layer (Fig. 2.7D), indicating that cell fragments had been

shed prior to cuticle secretion. This again suggest a defect in the embryonic sheath.

Third, most let-4 and egg-6 mutant L1 larvae showed abnormal permeability to dye (Fig.

2.7E-J), indicating a defect in larval cuticle organization. This defect was also observed

in sym-1 mutants (Fig. 2.7I, J). A requirement for eLRRon proteins in apical ECM

organization is further supported by the eggshell defects observed after depletion of

maternal egg-6 (Sonnichsen et al., 2005) (A. Singson and K. Oegema, personal

communication). Together, these observations suggest that let-4, egg-6 and sym-1 are

required to organize the apical ECM. We propose that defects in apical ECM lead

secondarily to defects in epithelial junction maintenance.

34

Discussion

It has long been recognized that extracellular cues from contact with neighboring

cells and the ECM influence epithelial polarity, cell shape, and motility (Bryant and

Mostov, 2008). Epithelial cells also secrete their own ECM factors. While most studies

have focused on the importance of basal ECM factors, the work presented here suggests a

link between the apical ECM and maintenance of epithelial junction integrity in C.

elegans. This work also identifies extracellular LRR proteins as important components

and organizers of the pre-cuticular and cuticular apical ECM.

eLRRon proteins and the extracellular matrix

The eLRRon family of proteins includes 52 members in mice, 35 in Drosophila

and 17 in C. elegans (Dolan et al., 2007) several of which are involved in ECM

organization. In mammals, decorin and other secreted SLRPs bind directly to collagen

and modulate collagen fibril assembly (Kalamajski and Oldberg, 2010). Although many

SLRPs appear confined to stromal tissues, several are expressed in the kidney or other

epithelia (Ross et al., 2003; Shimizu-Hirota et al., 2004). SLRP knockout mice have

disorganized collagen fibrils and various tissue fragility phenotypes, and mutations in

certain SLRPs are associated with similar syndromic conditions in humans (Ameye and

Young, 2002; Schaefer and Iozzo, 2008). In Drosophila, the eLRRon protein Convoluted

is required for proper tracheal ECM organization and tube length (Swanson et al., 2009).

Several transmembrane eLRRon proteins, including mammalian LRRTM1-3 and

35

Drosophila Capricious and Tartan, are involved in neuronal cell adhesion and synaptic

junction formation or maintenance (Shishido et al., 1998; Taniguchi et al., 2000; Shinza-

Kameda et al., 2006; Kurusu et al., 2008); these junction phenotypes have not (thus far)

been linked to any additional ECM defect. We have shown here that transmembrane

eLRRon proteins LET-4 and EGG-6 and their secreted paralog SYM-1 are required for

both apical ECM organization and epithelial junction stability in the C. elegans epidermis

and excretory duct and pore tubes.

Like many other invertebrates, C. elegans has a tough outer exoskeleton or cuticle

that lines the epidermis and other exposed epithelia including the excretory duct and pore.

The mature cuticle consists primarily of collagens and ZP-domain proteins termed

cuticulins, and is coated by a lipid-rich epicuticle and a glycoprotein-rich surface coat

(Page and Johnstone, 2007). The mature cuticle forms relatively late in embryogenesis;

prior to that, the lipid- and glycoprotein-rich outer layers appear to comprise the early

embryonic sheath ECM and are in direct contact with the epidermis at microfilament-

based attachment sites (Priess and Hirsch, 1986; Costa et al., 1997). When the inner

cuticle layers are secreted, the earlier sheath layers detach from the epidermis and are

pushed outward, so the epidermis is subjected to a changing matrix environment. The

cuticle is subsequently shed and re-synthesized at each larval molt, so membrane-matrix

attachments must be constantly remodeled during development.

eLRRon proteins LET-4, SYM-1 and EGG-6 all localize to the apical domains of

epithelia that are or will eventually become cuticle-lined, and they are important for the

proper organization of both the pre-cuticular and cuticular apical ECM. eLRRon proteins

36

could play several possible roles in ECM organization. They could be functioning as

structural components of the ECM that contribute to the strength and impermeability of

the matrix. The ability of both LET-4 and SYM-1 to function in the absence of a

transmembrane domain is consistent with this possibility. eLRRon proteins could also

modify or modulate associations among other matrix components such as collagens, as

proposed for the mammalian SLRPs (Kalamajski and Oldberg 2010). Alternatively, or in

addition, eLRRon proteins could affect protein trafficking mechanisms that deliver other

ECM components to the apical surface. Although some pre-cuticular ECM material and

cuticle are still secreted in let-4 mutants as seen by TEM, we have limited knowledge of

the molecular constituents of the ECM and cannot exclude the possibility that some

specific constituents are missing.

Apical ECM organization and epithelial junction stability

A link between apical ECM organization and apical junction stability is suggested

by the concomitant presence of both types of defects in eLRRon mutants. eLRRon

proteins could play independent roles in both processes, or defects in one process may

lead secondarily to defects in the other. For example, in Drosophila, defects in septate

junctions prevent apical secretion of chitin modifying enzymes, disrupting apical ECM

organization (Wang et al., 2006; Luschnig et al., 2006). However, the initially normal

morphology of junctions in eLRRon mutants, the broad apical localization patterns of the

proteins, and the ability of LET-4 and SYM-1 to function in the absence of

37

transmembrane domains are difficult to reconcile with direct roles in junction

organization. Furthermore, egg-6 eggshell defects arise prior to formation of epithelial

junctions, and most let-4 and egg-6 single mutants have defects in epidermal ECM

organization that are not accompanied by defects in epidermal junction maintenance.

Finally, junction breaks in the epidermis (in sym-1 let-4 RNAi mutants) and in the

excretory system (in let-4 or egg-6 single mutants) occur relatively late, after ECM

defects are already apparent. Therefore, we favor a direct role for eLRRon proteins in

ECM organization, with secondary effects on junction integrity.

Mutations in other specific apical ECM components generally do not cause

excretory or epidermal junction phenotypes such as those described here, suggesting a

relatively specific role for eLRRon proteins in junction integrity. Instead, mutations in

individual cuticle collagen or cuticulin genes cause cuticle blistering or defects in body

shape or cuticle patterning (Johnstone, 2000; Page and Johnstone, 2007). Mutations in

glycosyltransferases that perturb the outer cuticle layer alter the susceptibility of larvae to

bacterial infection and only in some cases increase permeability (Partridge et al., 2008).

Nevertheless, there have been prior indications that the apical ECM influences junctional

size and stability. Embryos mutant for the cuticle collagen sqt-3 elongate initially and

then retract, revealing a requirement for cuticle to stabilize epidermal cell shape (Priess

and Hirsh, 1986). Several mutations that perturb molting also affect epidermal integrity

(Moribe et al., 2004; Fritz and Behm, 2009). Finally, sec-23 mutations that impair cuticle

secretion (and presumbably secretion of eLRRon proteins as well) cause embryonic

38

rupturing at the 2-3-fold stage as described here for sym-1; let-4(RNAi) embryos (Roberts

et al., 2003).

There are several mechanisms by which apical ECM organization might affect

junction integrity. Junction breakage in eLRRon mutants could result from increased

forces placed on those junctions. The interconnected nature of the apical ECM may help

bind together epithelial cells that share that ECM, reducing stress on individual junctions.

Indeed, the embryonic sheath originally was proposed to distribute circumferential actin-

myosin contractile forces across the embryo (Priess and Hirsh, 1986). Thus,

abnormalities in apical ECM organization may lead to uneven distribution of those

pulling forces, leading to junction breaks. Alternatively, junction breakage could reflect

inherent weaknesses in epithelial junctions. The interconnected nature of the apical ECM

may help bind together epithelial cells that share that ECM. The apical ECM also is in a

good position to interact with cadherins or with transmembrane apical polarity proteins

such as Crumbs, and could potentially influence polarity and junction maintenance

through such interactions. Finally, many ECM components, including SLRPs, affect

signaling pathways that could alter gene expression and/or cytoskeletal organization to

influence polarity and junction maintenance (Bulow and Hobert, 2006; Schaefer and

Iozzo, 2008). In the C. elegans excretory system, EGF-Ras signaling promotes multiple

aspects of duct development, including lumen and junction maintenance (Abdus-Saboor

et al., 2011); it will be interesting to test if LET-4 or EGG-6 influence EGF signaling.

This study adds to the growing body of evidence for links between eLRRon

proteins and ECM organization and for links between the apical ECM and epithelial

39

junction stability. We hypothesize that cell-type specific modulation of eLRRon

expression or activity could be a general strategy for junction remodeling during

development. The programmed EMT-like withdrawal of the excretory pore provides an

attractive model system for testing this idea.

40

Materials and Methods

Strains and alleles

Strains were grown at 20˚ C and maintained under standard conditions (Brenner,

1974) unless otherwise noted in this chapter, and all work in this thesis. Bristol strain N2

was used as wild-type. Alleles used were: I: mec-8(u218) (Chalfie and Au, 1989). X:

let-4(mn105) (Meneely and Herman, 1979), unc-3(e151) (Hodgkin, 1997), sym-1(mn601)

(Davies et al., 1999). egg-6(cs67) was obtained after standard EMS mutagenesis of N2

(Brenner, 1974). Transgenes used were: csEx146 (lin-48p:mCherry) (Abdus-Saboor et

al., 2011), fgEx11 (ERM-1::GFP) (Gobel et al, 2004), jcIs1 (AJM-1::GFP) (Koppen et

al., 2001), mcIs46 (DLG-1::RFP) (Diogon et al., 2007), qnEx59 (dct-5p::mCherry)

(Abdus-Saboor et al., 2011), saIs14 (lin-48p::GFP) (Johnson et al., 2001), xnIs96 (HMR-

1::GFP) (Achilleos et al., 2010), vha-1p::GFP (Oka et al., 1997).

Molecular analysis

let-4 had been previously mapped to the right arm of the X chromosome

(Meneely and Herman, 1979). cs67 was mapped to chromosome I by linkage analysis

and deficiency mapping (see Wormbase). Both genes were subsequently identified via

transgenic rescue experiments. Gene structures were confirmed by sequencing

41

C44H4.2/let-4 cDNA clones yk8g5, yk134h6, yk1661a04, yk1708a10 and

K07A12.2/egg-6 cDNA clones yk117f12 and yk4a1.

pVM3(LET-4 genomic region) was generated by inserting the let-4 genomic

region [NsiI-XbaI (chrX:14575767-14581099)] from fosmid WRM0620cC02 into a

pBlueScript vector.

To generate pVM4(LET-4::GFP), GFP obtained from pPD103.87 (Addgene) with

a BamHI digest was inserted into the native BamHI site in the final exon of LET-4 in the

pVM3 vector.

To generate pVM7(let-4p::GFP) (described in Appendix 2) required an

intermediate step to generate a fragment with the desired restriction sites. First, the 2.2kb

let-4 promoter region was cut out of a genomic fragment with HindIII and AccI. This

fragment contained the upstream region, and the first 6 amino acids of LET-4. This

fragment was then ligated into the HindIII and AccI sites of pBlueScript. In the

BlueScript vector, an XhoI site was immediately following the AccI site. The new vector

(called pVM6) was digested with HindIII and XhoI. This fragment contained the LET-4

upstream region, the first 6 amino acids of LET-4, including the AccI site, followed by a

cut XhoI site. The fragment was then ligated in-frame between the HindIII and SalI sites

of pPD121.89, which contains GFP. (Addgene)

To generate pVM9(dpy-7p::let-4cDNA), let-4 cDNA was cut out of pVM9 with

NheI and KpnI, and ligated into pKH11, which contains 216bp of the dpy-7 promoter.

42

dpy-7p drives expression in the pore cell and epidermis (Gilleard et al., 1997; Stone et al.,

2009).

To generate pVM16(lpr-1p::let-4cDNA), let-4 cDNA was cut out of pVM8

(which contains let-4 coding region from yk134h6) with NheI and KpnI, and ligated into

pBG12. lpr-1p drives expression in the duct cell, pore cell, and epidermis (Stone et al.,

2009).

To generate pVM20(lpr-1p::ssGFP::LET-4(ΔLRR)), a truncated form of let-

4cDNA was amplified off of pVM16 using primers which amplify the region of LET-4

after the LRR domain (amino acids 398-773). This fragment was then inserted into

pVM16 between the NheI and KpnI sites (This plasmid was called pVM19). PCR was

then performed to amplify ssGFP from pPD95.85 and insert NheI sites on either side.

This GFP fragment was then inserted into the NheI site of pVM19.

To generate pVM21(lpr-1p::LET-4(ΔC-term)::GFP), a truncated form of let-4

cDNA was amplified off of pVM16 using primers which amplify the region of LET-4

from the Start codon to 2 amino acids past the transmembrane domain (amino acids 1-

713). This fragment was then inserted into pVM16 between the NheI and KpnI sites

(This plasmid was called pVM18). PCR was then performed to amplify GFP from

pPD95.75 (Addgene) and insert KpnI sites on either side. The GFP fragment was then

inserted into the KpnI site of pVM18.

To generate pVM25(lpr-1p::LET-4(ΔTM)::GFP), a truncated form of let-4 cDNA

was amplififed off of pVM16 using primers which amplify the region of LET-4 from the

43

Start codon to just before the transmembrane domain (amino acids 1-688). This fragment

was then inserted into pVM16 between the NheI and KpnI sites (This plasmid was called

pVM17). PCR was then performed to amplify GFP from pPD95.75 (Addgene) and insert

KpnI sites on either side. The GFP fragment was then inserted nito the KpnI site of

pVM17.

The egg-6 genomic rescue fragment was cloned from fosmid WRM0617dE11.

GFP obtained from pPD103.87 (Addgene) was inserted into an engineered Nhe1 site to

generate EGG-6::GFP reporter pMS204. Transgenic lines were generated by co-

injecting each construct (2ng/ul) with pRF4 (98ng/uL).

For egg-6 tissue-specific promoter constructs, cDNAs obtained from yk117f12

was cloned into vectors pBG12 (lpr-1p), pKH11 (dpy-7p) or pHS4 (lin-48p), which are

all derivatives of pPD49.26 (Addgene). lin-48p drives expression in the duct cell

(Johnson et al., 2001). Transgenic lines were obtained by coinjecting each construct at 2-

10 ng/ul with either pHS4 (lin-48p::mCherry) at 2.5 ng/ul or pIM175 (unc-119::GFP) at

90ng/uL.

44

RNAi.

let-4 double stranded RNA (dsRNA) was synthesized using the Megascript RNAi Kit

(Ambion), using as template a fragment of the let-4 cDNA corresponding to exons 8-10

(Primers: oMS199

5‟GTAATACGACTCACTATAGGGCAGTCGTGAAGATGAGATTCGC3‟ and

oMS200

5‟GTAATACGACTCACTATAGGGCGCAATAACTGGATCCAGGATTG3‟). dsRNA

was injected into gravid hermaphrodites and embryos laid >16 hrs later were assessed for

phenotypes.

Immunostaining

L4 larvae were collected and fixed described in Appendix 4. Primary antibody

concentrations used were: MH4 (1:50) (Francis and Waterston, 1991); goat anti-GFP

(1:50) (Rockland Immunochemicals). Secondary antibodies: Cy3 donkey anti-mouse

(1:200); FITC donkey anti-goat (1:20) (Jackson Immunoresearch).

Microscopy

Images were captured by differential interference contract (DIC) and

epifluorescence using a Zeiss Axioskop (Jena, Germany) microscope with a Hamamatsu

Chilled CCD camera (Hamamatsu City, Japan). Confocal Mucroscopy was performed

45

with a Leica TCS CP (Wetzlar, Germany). All confocal images were analyzed with Leica

Confocal Software and ImageJ Software.

For TEM, 1.5-fold or late 3-fold embryos from wild-type or let-4(mn105) mothers

were fixed by high pressure freezing followed by freeze substitution (Weimer, 2006),

embedded in Eponate resin and cut into serial thin sections between 50 and 100 nm each.

Sections were observed on a Philips CM10 transmission electron microscope

(Amsterdam, The Netherlands) or a FEI-Tecnai T12. Serial section TEM images of a

similarly processed 1.5-fold embryo, N2E6B, were provided to the Center of C. elegans

Anatomy by Shai Shaham (Rockefeller Univ.).

Hoechst permeability assay

L1 larvae of each genotype were collected in M9 and incubated in 2μg/mL Hoescht dye

33258 (Sigma) for 15 minutes at room temperature, then washed twice with M9.

46

Acknowledgements

We thank the C. elegans knockout consortium, the Caenorhabditis Genetics Center

(University of Minnesota), Verena Gobel, Jeff Hardin, Michel Labouesse and Jeremy

Nance for providing strains, Shai Shaham for providing archival TEM images, Juan

Jimenez and Leslie Gunther for help in conducting HPF fixations, Amin Ghabrial and

Ishmail Abdus-Saboor for helpful comments on the manuscript, and Andrew Singson and

Karen Oegema for sharing results prior to publication. Electron microscopy was

performed in the EMRL at the University of Pennsylvania, supported in part by NIH

grant 5 P30 CA 016520. MH4 antibody was obtained from the Developmental Studies

Hybridoma Bank (University of Iowa) developed under the auspices of the NICHD. This

research was supported by NIHGM58540 to M.V.S. and NIHRR12596 to D.H.H.

V.P.M. was supported in part by T32 GM008216 and J.M.P. was supported in part by

T32 HD007516.

47

Figure Legends

Figure 2.1. The apical ECM differs between excretory tube types

(A,B) Schematics of the late 3-fold or early L1 excretory system. (A) Lateral view.

(B) Cross sections. Cuticle lines the duct and pore lumen. In all schematics, canal cell is

red, duct cell is yellow, and pore cell is blue. Green indicates the embryonic sheath,

which at this stage makes up the outer layer of the cuticle. Dark lines and circles indicate

apical junctions; arrowhead, duct-canal junction; bracket, duct cell body; arrow, pore

autocellular junction. (C) Excretory system of early L1 larva. ERM-1::GFP lines the

lumen of the canal cell (c), and is absent from the pore (p) and duct (d) cells (labeled with

dct-5p::mCherry). Anterior is to the left and ventral down in all figures unless otherwise

noted. (D-E) TEM of 3-fold embryo showing the duct cell lumen (lu) (D) and pore cell

lumen (E). In (E) the cuticle reaches from the outside of the worm into the lumen of the

pore cell. (F-H) Schematics of the 1.5-fold excretory system. (F) Whole embryo and

eggshell layers. (G) Lateral view. (H) Cross sections. The inner eggshell layer (orange)

surrounds the embryo. A thin sheath-like layer (green) lines the pore and duct lumen.

Cuticle has not yet been secreted, and the lumen of all three tube cells contains a fibrous

electron-dense material (ECM).

(I-J) TEM of 1.75-fold embryo, showing the inner eggshell layer (orange arrows) and

embryonic sheath layer (green arrows). Fibrous electron dense material (lines) is visible

in the duct and pore cells (Iiii) as well as the canal cell (J). Embryo “N2E6B” TEM (I-J)

kindly provided by Shai Shaham (Rockefeller U.).

48

Figure 2.2. let-4 and egg-6 encode related transmembrane proteins with

extracellular leucine-rich repeats.

(A) Genetic analyses and transgenic rescue experiments. For transgene rescue

experiments, progeny were collected from let-4(mn105) homozygotes carrying csEx173

(C44H4 cosmid +sur-5p::GFP) and a separately marked transgene of interest, or from

egg-6(ok1506)/hT2[qIs48] heterozygotes carrying a marked transgene of interest.

Rescue was determined by scoring each hatched worm for L1 lethality. (B) let-4 and egg-

6 genomic regions and rescue fragments. Note that paralog sym-1 is immediately

adjacent to let-4. (C) Predicted protein structures and mutant lesions. The LET-4 and

EGG-6 LRR domains share 49% similarity. Data contributed by VM, JP, MS and LS.

Figure 2.3. LET-4::GFP and EGG-6::GFP localize to the apical domains of the

excretory duct, pore and epidermal cells

(A,B) In L1 larvae, LET-4::GFP and EGG-6::GFP localize apically within the excretory

duct and pore. Symbols as in Fig. 1. (A) LET-4::GFP. (A‟) lin-48p::mCherry labels the

duct cell cytoplasm. (A'') Overlay. (B) EGG-6::GFP. (B‟) DLG-1::mCherry marks apical

junctions of the duct and pore cells. (B") Overlay. (C-H) In 1.5-fold (C,E,G,H) and 3-fold

(D,F) stage embryos, LET-4::GFP (C,D,G) and EGG-6::GFP (E,F,H) localize apically

within the epidermis. Apical junctions are marked with DLG-1::mCherry. (C-F) Mid-

plane. Note LET-4::GFP expression on the outer surface of the canal cell (asterisk in C).

(G-H) Surface view. Scale bars: 5μm. Data contributed by V.M. and J.P.

49

Figure 2.4. let-4 and egg-6 are each required to maintain junction integrity between

the excretory duct and pore

(A-H) Late 3-fold embryos (C,D) or early L1 larvae (A,F,G) expressing apical junction

marker AJM-1::GFP. L1 larvae also express duct and pore cell marker dct-5p::mCherry.

Arrowhead indicates canal-duct junction; arrow indicates pore autojunction. Dotted line

indicates pharynx, which is also labeled by AJM-1::GFP. B, E and H are schematic

interpretations. Junction morphology initially appears normal in let-4(mn105) (C) and

egg-6(ok1506) (D) mutants, but the canal cell lumen is beginning to swell (asterisk). In

older let-4 (F) and egg-6 (G) mutants, the duct and pore cells have separated, but contain

junction remnants (caret) and the pore autocellular junction has disappeared. Swelling of

the canal cell lumen is more pronounced (asterisk). (I-M) TEM images of the excretory

system. Canal cell is colored red; duct cell, yellow; pore cell, blue; lu indicates lumen;

cut, cuticle. At 1.5-fold (I), let-4 lumen morphology and lumen ECM (line) were

indistinguishable from wild-type (compare to Fig. 2.1I, J). At 3-fold (J-L), 5/9 let-4

embryos also appeared normal (J) (compare to wild-type, Fig 2.1D). In some let-4

embryos that lacked duct-pore connectivity, the duct lumen behind the break was swollen

and the apical membrane had separated from the cuticle lining (K). Panels L-L„‟‟ show

adjacent serial sections documenting duct lumen termination. A bolus of cuticle-like

material is present near the termination point (L). Scale bars in A-H:5μm; scale bars in I-

J:1μm. Data contributed by V.M. and J.P.

Figure 2.5. let-4 and sym-1 are redundantly required to maintain junction integrity

in the epidermis

50

(A) Quantification of embryonic lethality after let-4 RNAi. (B) Rare sym-1; let-4(RNAi)

embryos that do not rupture swell as they approach hatch. (C-H) AJM-1::GFP and (I-N)

HMR-1::GFP apical junction markers appear normal in sym-1 control embryos (C-D, I-J)

and sym-1; let-4(RNAi) embryos (E-F, K-L) at the 1.5 fold stage (C,E,I, K) and at the 3-

fold stage prior to rupture (D,F,J, L). (G,M) Most sym-1; let-4(RNAi) embryos begin to

extrude epidermal cells (asterisk) and rupture after elongating to the 3-fold stage. (H, N)

Terminal arrest phenotype. Scale bars: 5μm. Data contributed by V.M., M.S. and C.P.

Figure 2.6. The cytoplasmic and transmembrane domains of LET-4 are dispensable

for function

(A,B,C) L4 larvae expressing lpr-1p::LET-4 deletion constructs tagged with GFP. lin-

48p::mCherry labels the entire cytoplasm of the duct cell. (A) LET-4::GFP and (C) LET-

4(ΔC-term)::GFP localize along the lumen of the duct cell. (B) signalseqGFP::LET-

4(ΔLRR) is dispersed thoughout the duct cell cytoplasm. (D) let-4(mn105) rescue data.

At least two independent transgenic lines were scored per construct, and non-transgenic

siblings (grey) were scored as negative controls. low, injected at 2.5ng/uL; high, injected

at 5ng/uL. Scale bar: 5μm. LET-4(ΔLRR) contains LET-4 amino acids 398-773; LET-

4(ΔC-term) 1-713; LET-4(ΔTM) 1-688.

51

Figure. 2.7. let-4 and egg-6 are required for proper apical ECM organization

(A) TEM image of 1.5-fold let-4 mutant, adjacent to the pore opening. The distance

between the inner eggshell layer (orange arrows) and the embryonic sheath layer (green

arrows) is increased compared to wild-type, (Fig. 2.1I). (B-C) DIC image of extra-

embryonic cytoplasts in let-4(mn105)(B,B‟) and egg-6(ok1506) 3-fold embryos (C).

Cytoplasts are labeled with vha-1p::GFP in let-4 (B‟). (D) TEM image of extra-

embryonic cytoplasts in let-4 3-fold embryo. (E-J) Hoescht dye permeability assay. DIC

(E-I) and fluorescence (E‟-I‟) images of L1 larvae treated with Hoechst dye, 0.7 seconds

exposure time. (J) Quantification of dye permeability. Scale bars: 5μm. Data contributed

by V.M. and J.P.

Figure. 2.8. LET-4::GFP and EGG-6::GFP localize apically in epithelia

(A,C) LET-4::GFP and (B,D) EGG-6::GFP localize to the apical face of epithelial rectal

cells (A,B) and vulval cells (C,D) in L4 larvae. lin-48p::mCherry labels the cytoplasm of

rectal cells in A‟. (E) EGG-6::GFP is also visible in some neurons (arrows). (F) EGG-

6::GFP is secreted into the extra-embryonic space inside the eggshell in 3-fold embryos.

(G) LET-4::GFP is not enriched at intermediate filaments (G‟) at hemidesmosomes.

Overlay (G‟‟). L4 larva, ventral view. Bracket marks the region of the ventral epidermis

that does not contact body muscle and lacks hemidesmosomes. Scale bars: 5μm. Data

contributed by V.M. and J.P.

52

duct

cuticle

lumen

Figure 2.1

duct cell canal cell

G1pore D

A

ERM-1

canal

lumen

F

B G1 pore

autojunction

G

A

duct

ECM

lumen

ERM-1

canal

lumen

H G1 pore

autojunction

ii

iii

I

G1 pore

ductcell

canalcell

duct

sheath

inner eggshell

ECM

canal cell

G1 pore

cuticle

Jii iii

A

VD

A

cd

p

i

lECM

cuticle

G1 pore

luEC D lu

duct

cuticle

sheath

5μm 1μm 1μm

1μm 1μm1μm5μm

53

NsiI BamHI XbaI

LET-4::GFP rescuing fragment

LG X:

let-4/sym-5 (C44H4.2)C44H4.1 sym-1B

Figure 2.2

GFP

0 20 40 60 80 100egg-6(ok1506); lpr-1p::EGG-6(+)

egg-6(ok1506); dpy-7p::EGG-6(+)

egg-6(ok1506); ExEGG-6::GFP

egg-6(ok1506)/egg-6(cs67)

egg-6(ok1506)

egg-6(cs67)

let-4; lpr-1p::LET-4(+)

let-4; dpy-7p::LET-4(+)

let-4; ExLET-4::GFP

let-4

let-4 unc-3; ExC44H4.2

let-4 unc-3

egg-6(ok1506); ExEGG-6::GFP

+/egg-6(ok1506)

+/egg-6(cs67)

let-4 15°C

let-4 25°C

let-4

+/let-4

Zygotic Genotype

Maternal Genotype (n)

(n)

A

% embryonic lethal % L1 lethal

(242)(208)(72)

(124)(127)

(329)(many)

(84)

(53)(57)

(30)

(many)(many)

(many)(23)

(4)

(18)

(55)(30)

1kb

mn105: Q -> STOP

cs67: Q -> STOP

Signalseq Leucine-Rich Repeats

LET-4 (C44H4.2)

EGG-6 (K07A12.2)

ok1506 (-1678bp)

TM

C

XbaI XhoI

egg-6 (K07A12.2) K07A12.6K07A12.8

LG I:

GFP1kb

EGG-6::GFP rescuing fragment

54

A’A

C’

A’’

C

* *

Figure 2.3

B’B B’’

E E’

D

F

Overlay

Overlay

Overlay

LET-4

LET-4 LET-4

EGG-6

EGG-6

DLG-1

DLG-1

DLG-1

lin-48

EGG-6

G

H

G’

H’

G’’

H’’Overlay

Overlay

LET-4

EGG-6

DLG-1

DLG-1

LET-4

EGG-6

55

Figure 2.4wild-type

d

p

cB

*

**

egg-6let-4

DC

GF

E

H

duct cellcanal cellG1

pore DA

BA

let-4

I

**

*V

V

V

K

J

let-4

lu

dcut

cut

d lu

let-4

lu

d d dcut

lulu

let-4 let-4 let-4

L L’ L’’

5μm

1μm

56

% embryonic lethality

(n)GenotypeA

Figure 2.5

0 20 40 60 80 100

mec-8; let-4 RNAi

mec-8

sym-1; let-4 RNAi

sym-1

let-4 RNAi (64)

(66)

(57)

(91)

(63)

sym

-1;

let-

4isy

m-1

AJM-1::GFP HMR-1::GFP

B

C C’

D D’

E

F

E’

F’

G

H

G’

H’

I

K

I

J

L

M

N

K’

I’

J’

L’

M’

N’

* *

*

* *

* * *

57

A’A

LET-4 lin-48

A’’

Overlay

C’C C’’

B’B B’’

Figure 2.6

transgeneD

(n) (8)

(9)

(40) (19)

(57) (89)

(115)(35)

(35)(14)

0 20 40 60 80 100

(33)(21)

(28) (35)

LET-4(∆LRR) lin-48 Overlay

LET-4(∆C-term) lin-48 Overlay

LET-4(∆LRR)

LET-4(∆LRR)

LET-4(∆C-term)

LET-4(∆C-term)

LET-4(∆TM) (low)

LET-4(∆TM) (high)

LET-4(∆TM) (high)

%lethal0 20 40 60 80 100

transgenic non-transgenic

58

Figure 2.7

B

vv vv

let-4

egg-6

C

v

vv

DIC

egg-6 egg-6/hT2let-4 let-4; Ex LET-4(+)

Hoe

chst

B’

E

E’

F

F’

G

G’

H

H’

D

J

0 20 40 60 80 100

sym-1 (28)

egg-6/hT2 (23)

egg-6 (17)

let-4;Ex LET-4(+) (22)

let-4 (25)

(n)Genotype

% permeable to Hoechst

I

I’

sym-1

let-41μm5μm

1μm

5μm5μmG1 pore

ductA

1μm

59

LET-4

K’

FBK

U p

A A’

Figure 2.8

LET-4 LET-4

C C’

EGG-6 EGG-6

D D’

B B’

LET-4lin-48

EGG-6 EGG-6

EGG-6 EGG-6

E E’

EGG-6

F’

EGG-6

LET-4 MH4 Overlay

G G’ G’’

F

60

Chapter 3

Notch and Ras promote sequential steps of excretory tube development in C. elegans

This chapter was previously published:

Abdus-Saboor, I.*, Mancuso, V.P.*, Murray, J.I., Palozola, K., Norris, C., Hall,

D.H., Howell, K., Huang, K., and Sundaram, M.V. (2011) Notch and Ras promote

sequential steps of excretory tube development in C. elegans Development 138, 3545-

3555

*These authors contributed equally

61

Role of Authors

Chapter 3 has been published as presented here. This chapter was a collaborative

effort involving multiple authors, as documented below and in each individual Figure

legend. My work in this manuscript began as an investigation to explore the possibility

of cooperative interaction of Ras and Notch to specify the fate of the cells of the

excretory system.

Ras and Notch are two common signaling pathways, but, in different contexts,

they work sequentially, cooperatively or antagonistically (Sundaram, 2005). For

example, they antagonize each other in the C. elegans vulva. In this system, the anchor

cell produces the Ras pathway activating EGF ligand, which promotes the primary vulval

fate in a vulval precursor cell (Sternberg, 2005). The primary vulval fate is suppressed in

neighboring cells via activation of the Notch pathway. In contrast, in the Drosophila eye,

the Ras and Notch pathways work cooperatively to promote the R7 photoreceptor fate

(Voas and Rebay, 2004). In order to take the R7 fate, the cell must receive both EGF and

DSL, the Notch activating ligand. Ras and Notch are much more commonly in

antagonistic relationships, and further exploration of the two pathways working

cooperatively would be valuable.

Ras and Notch mutants each lack a duct (Lambie and Kimble, 1991; Yochem et

al., 1997), which suggests that Ras and Notch could be working cooperatively to promote

the duct cell fate in the C. elegans excretory system. I decided to explore the possibility

of Ras and Notch working cooperatively in this system, and began by asking basic

questions about the loss of Notch signaling, and removal of the canal cell.

62

I used molecular markers to assay the duct and canal cell fate in a variety of

Notch pathway mutants, and confirmed that the canonical Notch signaling pathway was

involved in duct fate specification. I also found that the duct cell phenotype was

variably and incompletely penetrant in Notch loss of function mutations and RNAi

experiments, suggesting perdurance, maternal effects, or the involvement of other

pathways on the phenotype.

I attempted to determine the source of the Ras pathway inductive signal required

for duct fate specification. In Notch mutants, in addition to the duct being absent, the

canal cell was also absent. We proposed that the duct cell’s absence could be explained

by the canal cell’s absence, because the canal cell expresses LIN-3/EGF. I tested this

model, and demonstrated that the duct cell took its fate even in the absence of the canal

cell through two lines of experimentation. First, in genetic experiments, Notch mutants

lacked a canal cell, but a significant percentage still expressed cell fate marker lin-

48p::GFP in the canal cell. Second, after laser ablating both the canal cell itself, and the

canal cell mother, the presumptive duct cell expressed duct fate marker lin-48::GFP.

The endurance of the duct cell even in the absence of the canal cell indicated that the

canal cell was not the sole source of the inductive signal, and LIN-3 signal from other

sources was sufficient to induce the duct cell fate.

Given the above experiments, evidence seemed to point to an indirect role for

Notch in the specification of the duct cell fate, and multiple sources of ligand for Ras

pathway activation in the duct. I then decided to focus my efforts on investigating let-4

(Chapter 2). We extended my Ras and Notch work, and incorporated new experiments

exploring the roles of these pathways in the development of the excretory system into the

63

manuscript presented here, which includes data from other members of the lab, and other

collaborators.

In the following Chapter, I performed Notch pathway experiments, laser ablation

experiments (Table 3.1, Fig. 3.5), and some LIN-12::GFP characterization (Fig. 3.3).

Ishmail Abdus-Saboor performed Ras pathway mutant phenotyping (Fig. 3.2), sos-1

experiments (Fig. 3.6) and immunostaining (Fig. 3.3). Meera Sundaram performed Ras

and Notch pathway mutant phenotyping (Fig. 3.4, Fig. 3.5, Fig.3.7). Carolyn Norris and

David Hall performed TEM analysis (Fig. 3.1 and Fig. 3.8). John Murray performed 4D

imaging. Katherine Palozola, Kelly Howell, Kai Huang performed Ras pathway loss-of-

function marker analysis (Fig. 3.2).

64

Abstract

Receptor Tyrosine Kinases and Notch are critical for tube formation and

branching morphogenesis in many systems, but the specific cellular processes that require

signaling are poorly understood. Here we describe sequential roles for Notch and

Epidermal Growth Factor (EGF)-Ras-ERK signaling in the development of epithelial tube

cells in the C. elegans excretory (renal-like) organ. This simple organ consists of three

tandemly connected unicellular tubes, the excretory canal cell, duct and G1 pore. lin-12

and glp-1/Notch are required to generate the canal cell, which is a source of LIN-3/EGF

ligand and physically attaches to the duct during de novo epithelialization and

tubulogenesis. Canal cell asymmetry and let-60/Ras signaling influence which of two

equivalent precursors will attach to the canal cell. Ras then specifies duct identity,

inducing auto-fusion and a permanent epithelial character; the remaining precursor

becomes the G1 pore, which eventually loses epithelial character and withdraws from the

organ to become a neuroblast. Ras continues to promote subsequent aspects of duct

morphogenesis and differentiation, and acts primarily through Raf-ERK and the

transcriptional effectors LIN-1/Ets and EOR-1. These results reveal multiple genetically-

separable roles for Ras signaling in tube development, as well as similarities to Ras-

mediated control of branching morphogenesis in more complex organs, including the

mammalian kidney. The relative simplicity of the excretory system makes it an attractive

model for addressing basic questions about how cells gain or lose epithelial character and

organize into tubular networks.

65

Introduction

Many organs, such as the mammalian kidney and the vasculature, consist of

complex networks of tubules that develop from clusters of initially unpolarized

mesenchymal cells (Hogan and Kolodziej, 2002; Lubarsky and Krasnow, 2003; Dressler,

2009). The processes by which these cells polarize, form epithelial or endothelial

junctions, and then organize into complex tubular shapes are only beginning to be

elucidated. In many cases, signaling pathways involving Receptor Tyrosine Kinases

(RTKs) and Ras are critical for formation and patterning of the tubular network. For

example, during branching morphogenesis of the ureteric bud in the kidney, signaling by

the Ret RTK promotes tip cell identity and specifies the location of new branches

(Shakya et al., 2005; Chi et al., 2009). Similarly, during sprouting angiogenesis,

signaling by vascular endothelial growth factor receptors promotes tip cell identity

(Gerhardt, 2008). Absence of RTK signaling results in renal or vascular agenesis.

Although the importance of RTK pathways in controlling tube development is clear, the

specific cellular behaviors that require signaling, and the downstream mechanisms that

control them, are not well understood.

Tubulogenesis can be reversible, as cells can withdraw from an existing tube and

give rise to different cell types. For example, venous endothelial cells in the mouse de-

differentiate and divide to give rise to new coronary arteries, capillaries and veins as part

of their normal developmental program (Red-Horse et al., 2010). Epithelial-to-

mesenchymal transition (EMT) or endothelial-to-mesenchymal transition (EndMT) are

central features of injury-induced fibrosis in the kidney and heart (Kalluri and Neilson,

66

2003; Zeisberg et al., 2007) and underlie the metastatic properties of many tumor cells

(Kalluri and Weinberg, 2009). Tubes that form by de novo polarization may be

particularly prone to EMT, but the mechanisms that promote or restrain such behaviors

remain poorly understood.

The C. elegans excretory system is a simple example of an epithelial tube

network. The excretory system is the worm’s renal-like system and is required for fluid

waste expulsion (Nelson et al., 1983; Nelson and Riddle, 1984; Buechner, 2002). It

consists of three tandemly arranged unicellular tubes: the large canal cell (which runs the

length of the body and appears to collect waste fluid), and the smaller duct and pore cells

(which connect the canal cell to the outside environment) (Fig. 3.1). While the canal cell

and duct tubes are permanent throughout the life of the animal, the G1 pore eventually

withdraws from the excretory system to become a neuroblast, at which time a

neighboring epidermal cell (G2) replaces G1 as the excretory pore tube (Sulston et al.,

1983; Stone et al., 2009). Thus the excretory system provides a simple, genetically

tractable system for studying the dynamic control of epithelial junctions, cell shape and

cell identity.

The progenitors of the excretory duct and G1 pore tubes are left/right lineal

homologs that appear to compete for the duct fate (Sulston et al., 1983). In wild-type

animals, the left cell always becomes the duct and adopts the most canal cell-proximal

position, while the right cell always becomes G1 and adopts a more distal position.

However, ablation of the mother of the presumptive duct causes the presumptive G1 to

adopt a duct-like position and morphology, showing that both cells have the capacity to

become a duct and suggesting some lateral inhibitory mechanism that prevents both from

67

doing so. Both let-60/Ras and lin-12 glp-1/Notch mutants lack an excretory duct,

implicating Ras and Notch in the duct vs. G1 pore fate decision or some other aspect of

duct development (Lambie and Kimble, 1991; Yochem et al., 1997).

Here we show that Notch and Epidermal Growth Factor (EGF)-Ras-ERK act

sequentially during excretory tube development. We identify multiple, genetically

separable requirements for signaling in controlling tube cell position, identity, shape and

function. Finally, we establish the excretory duct and G1 pore system as a model for

investigating many basic cell biological processes associated with tube development and

EMT-coupled cell fate plasticity.

68

Results

Excretory tube development involves de novo formation and remodeling of epithelial

junctions

Excretory tube development occurs in three broad phases

(migration/tubulogenesis, morphogenesis/differentiation, and G1 withdrawal/remodeling)

(Fig. 3.1A) (Sulston et al., 1983; Buechner, 2002; Berry et al., 2003; Stone et al., 2009).

To visualize the excretory duct and G1 pore during these phases, we used lineage-specific

markers in combination with epithelial apical junction markers AJM-1 (Koppen et al.,

2001) and DLG-1/Discs Large (Bossinger et al., 2001)(Fig. 3.1). GFP::MLS-2 marks all

ABpl/rpaaa descendants (including the duct and G1) plus additional lineages during

ventral enclosure (Yoshimura et al., 2008) (J.I.M., unpublished data) (Fig. 3.1B-C,E),

while dct-5p::mCherry marks the duct, G1 and some other epithelial cells during L1 (this

work, Fig. 3.1J-K). We also analyzed a ventral enclosure embryo by transmission

electron microscopy (TEM) of serial sections (Figs 3.1D, 3.8) and traced the canal, duct,

and G1 pore lineages through ventral enclosure from 3D confocal movies of eight

histone::mCherry-expressing embryos (Materials and Methods).

The canal cell, duct and G1 pore progenitors are born in disparate locations of the

embryo. During ventral enclosure (Fig. 3.1B-E), the duct (left) and G1 pore (right)

progenitors migrate toward the canal cell, which is located slightly left of the ventral

midline. The duct progenitor has a shorter distance to migrate, and it appears to reach the

69

canal cell first (Fig. 3.1C). TEM of an embryo at ventral enclosure shows the duct

progenitor and the canal cell closely apposed, while the G1 progenitor is excluded from

the canal cell by the duct and other intervening cell bodies (Fig. 3.1D). In 6/8 3D

confocal movies, the duct nucleus arrives adjacent to the canal cell about 5-10 minutes

before G1. At this time, 1-2 nuclei still separate the canal from G1; the most consistent

of these is RIS, a right-derived neuron whose left homolog is related to the canal cell and

undergoes programmed cell death. In 2/8 movies, the duct and G1 nuclei arrive near the

canal cell at approximately the same time, so it is not possible to determine which cell

contacts the canal cell first in the absence of a membrane or cytoplasmic label. After the

duct reaches the canal cell, they begin to ingress, while G1 moves to a ventral position

between the G2 and W epidermal cells (Fig. 3.1E). Together, these observations suggest

that asymmetry of the canal cell and its lineal relatives might contribute to asymmetry in

duct and G1 pore behavior.

The cells initially lack epithelial junctions (Fig. 3.1B, D), but after they contact

each other, they form epithelial junctions and undergo tubulogenesis (Fig. 3.1F). As

described previously (Stone et al., 2009), the duct and G1 pore cells wrap up into tube

shapes and form autocellular junctions. G1 retains this autocellular junction, but the duct

cell rapidly auto-fuses, becoming a seamless toroid. The canal cell forms lumen

intracellularly at the site of the duct-canal cell intercellular junction. By the 1.5 fold

stage, the canal cell, duct and pore form a simple block-like stack of tandemly connected

unicellular tubes with a continuous lumen and prominent epithelial junctions (Fig.

3.1A,F).

70

Further morphogenesis occurs during the latter part of embryogenesis, such that

by the first larval stage, the excretory duct (Fig. 3.1G-J) and canal cell (Fig. 3.1L) have

distinctive elongated shapes. The cells also begin expressing unique differentiation

markers, such as the lin-48/Ovo transcription factor in the duct (Fig. 3.1I) (Johnson et al.,

2001).

G1 withdrawal and G2 entry occur in the first larval stage, after the excretory

system has already begun to function. At this time, G1 migrates dorsally and loses its

epithelial junctions while a neighboring epidermal cell, G2, forms an autocellular

junction and replaces it as the pore (Fig. 3.1K) (Sulston et al., 1983; Stone et al., 2009).

G2 subsequently divides in L2 to generate a neuronal daughter (G2.a) and an epithelial

daughter (G2.p) that replaces it as the permanent pore tube (Sulston and Horvitz, 1977).

Throughout this time the duct process must remodel its ventral junction to connect to its

new partners.

let-60/Ras is both necessary and sufficient for duct vs. G1 pore fate specification

let-60/Ras is required cell autonomously within the excretory duct cell for proper

excretory system function and organismal viability and was previously proposed to

promote the duct vs. G1 pore fate (Yochem et al., 1997). To test this model, we used

AJM-1::GFP and lin-48p::GFP markers to examine let-60 ras mutants (Fig. 3.2).

Most let-60(sy101sy127lf) null mutants, obtained from heterozygous mothers,

have two pore-shaped cells with autocellular junctions and no lin-48p::GFP (Fig. 3.2B-

C,K-L), consistent with a duct-to-G1 pore cell fate transformation. Although the mutants

lack a duct-like cell, the overall arrangement of the excretory system resembles that of

71

wild-type animals: two cells are arranged in tandem, with one contacting the canal cell

and the other contacting the ventral epidermis. Thus, initial migration, stacking and

tubulogenesis appear normal, but auto-fusion does not occur and duct-specific

differentiation markers are not expressed.

let-60(sy101sy127lf) mutants die as late L1 larvae with a rigid, fluid-filled

appearance termed “rod-like lethality”. Fluid first accumulates near or within the two

pore-like tubes (Fig. 3.2C'). Notably, the timing of fluid accumulation in mid-L1

coincides with the normal timing of pore remodeling and is often associated with large

junctional rings or discontinuities (Fig. 3.2C). Since withdrawal from the excretory

system is a normal feature of G1 pore identity, withdrawal of both pore-like cells may

explain the inviability.

let-60(n1046gf) hypermorphic mutants have two duct-like nuclei expressing lin-

48p::GFP and no autocellular junctions (Fig. 3.2D,K-L), consistent with a G1 pore-to-

duct cell fate transformation. The two duct cells fuse to form a binucleate cell, as would

be predicted for two adjacent cells expressing the fusogen aff-1, which is required for

duct auto-fusion (Stone et al., 2009) and generally sufficient for fusion of adjacent cells

(Sapir et al., 2007). Removal of aff-1 in a let-60(gf) background restored both

intercellular and autocellular junctions (data not shown). The binucleate duct cell attaches

to the ventral epidermis, allowing for fluid excretion, and is permanent throughout the

life of the animal.

We conclude that Ras signaling is both necessary and sufficient to promote duct

vs. G1 pore identity, and that identity can be uncoupled from cell position. Notably,

however, some let-60 null mutants still possess a cell with at least partial duct-like

72

character (Fig. 3.2K-L). Evidence below suggests that this is due to maternally-provided

let-60 activity; maternal activity cannot be completely removed in our experiments

because of the requirements for let-60 and other pathway components in germline

development (Church et al., 1995).

let-60/Ras functions within the canonical EGF-Ras-ERK pathway to promote the

duct fate

Animals mutant for lin-3/EGF or various other components of the canonical EGF-

Ras-ERK pathway all display a rod-like lethal phenotype associated with excretory

system failure (Ferguson and Horvitz, 1985; Sundaram, 2006). We examined mutants for

lin-3/EGF and lin-1/Ets, which lie at the beginning and end of this pathway, respectively

(Hill and Sternberg, 1992; Beitel et al., 1995). lin-3(lf) and lin-1(gf) mutants appear

similar to let-60(lf) mutants, and lin-3 overexpression and lin-1(lf) mutants appear similar

to let-60(gf) mutants (Fig. 3.2E-H,K-L). Furthermore, a variety of other Ras pathway

mutants examined (including hypomorphic alleles of let-23/EGFR and lin-45/Raf) also

show evidence of duct-to-pore fate transformations (Fig. 3.2K-L). Finally, eor-1 and sur-

2 are nuclear factors that act redundantly downstream of MPK-1/ERK (Singh and Han,

1995; Tuck and Greenwald, 1995; Howard and Sundaram, 2002); eor-1 also appears to

act redundantly with a cryptic positive function of lin-1/Ets (Howard and Sundaram,

2002; Tiensuu et al., 2005). We found that eor-1; sur-2(RNAi) and lin-1 eor-1 double

mutants frequently have two pore-like cells (Fig. 3.2I-L). These data are consistent with

the entire canonical pathway promoting duct vs. G1 pore identity.

73

During this analysis, we noted that some mutants with reduced signaling had

paradoxical "0 G1"-like junction patterns, without concomitant duct fate duplication, or

had excretory failure despite apparently normal junction patterns and fates (Fig. 3.2K-L).

These observations suggested that Ras signaling plays roles beyond cell fate specification

(see below).

The excretory canal cell expresses lin-3/EGF

Since the mutant analyses above suggest that signaling by LIN-3/EGF through

LET-23/EGFR is responsible for LET-60/Ras activation in the duct, we asked where

these proteins are expressed. Consistent with the fact that both cells can respond to LIN-

3 to adopt the duct fate, a functional LET-23::GFP reporter, gaIs27 (Simske et al., 1996),

is expressed in both presumptive duct and G1 pore cells during ventral enclosure (Fig.

3.3A). To examine lin-3 expression, we used a lin-3 promoter::GFP reporter (syIs107)

that contains ~2.5 kb of upstream regulatory sequence as well as the first lin-3 intron

(Hwang and Sternberg, 2004). Most notably, lin-3p::GFP is strongly expressed in the

excretory canal cell, beginning soon after canal cell birth and continuing into early larval

development (Fig. 3.3B, D). lin-3p::GFP is also expressed in a variety of other cells that

are further away from the presumptive duct and G1 pore. These data suggested that the

canal cell might be a relevant source of the duct-inducing signal, a model that fits with

the observation that the left member of the equivalence group, which is closest to the

canal cell, is the cell that normally adopts the duct fate.

Ras signaling promotes cell stacking and a canal cell-proximal position

74

EGF-Ras signaling could promote duct vs. G1 pore cell fate specification

independently of cell stacking and tubulogenesis, or signaling could also control initial

cell positioning. The latter possibility was suggested by results of a prior mosaic

analysis, in which a let-60(+) presumptive G1 cell could outcompete a let-60(-)

presumptive duct cell for the more dorsal, canal cell-proximal position and take on the

duct fate (Yochem et al., 1997).

Consistent with a model in which both cells compete for the canal cell-proximal

position, animals homozygous for a partial loss-of-function allele, let-60(n2021), display

a variable phenotype in which the presumptive duct and G1 cells often adopt adjacent

positions rather than stacking on top of each other (Fig. 3.4C-D). In many of these cases,

a single duct-like cell reaches from the ventral epidermis to the canal cell, while the

second cell is mispositioned to the side and appears non-tubular, giving a "1 duct, 0 G1"

phenotype (Fig. 3.4G-H). In other cases, a single pore-like (un-induced) cell reaches from

the ventral epidermis to the canal cell, giving a “0 duct, 1 G1” phenotype (Fig. 3.4I-J).

Similar defects are seen in other hypomorphic mutants and in lin-1; eor-1 double mutants

(Fig. 3.2K and data not shown). We conclude that Ras signaling influences duct and G1

pore stacking.

Notably, the adjacent phenotype is observed only occasionally in let-60 or lin-3

null mutants obtained from heterozygous mothers (Fig. 3.2K, Fig. 3.4K). This is due in

part to maternal rescue, since most let-60(n2021rf) mutants obtained from heterozygous

mothers also have normal cell stacking, in contrast to those obtained from homozygous

mutant mothers (Fig. 4K). Nevertheless, progeny from let-60(sy101sy127lf)/let-

60(n2021rf) mothers have a lower frequency of adjacent cells than those from let-

75

60(n2021rf) mothers (Fig. 3.4K). Therefore, the adjacent phenotype may reflect

problems in resolving cell competition under circumstances where Ras signaling is sub-

optimal but not absent (see Discussion).

The canal cell is required for stacking and tubulogenesis of the duct and G1 pore

To test if LIN-3/EGF expression by the canal cell is required for duct fate

specification or cell stacking, we first removed the canal cell (or its mother) physically by

laser ablation. In the absence of the canal cell, most animals still had a lin-48p::GFP+

cell (Table 3.1), indicating that other sources of LIN-3 are sufficient to induce at least

some features of duct identity. However, duct morphology was abnormal and the G1

pore autocellular junction was missing (Fig. 3.5L-M), suggesting that stacking had been

disrupted.

We next examined the effects of removing the canal cell genetically using Notch

mutants. Mutants lacking both C. elegans Notch receptors, LIN-12 and GLP-1, the DSL

ligand LAG-2 or the CSL transcription factor LAG-1 have a constellation of defects

referred to as the “Lag” (lin-12 and glp-1) phenotype (Lambie and Kimble, 1991). lag

mutants lack an excretory canal cell due to a lineage transformation affecting the canal

cell’s great-grandmother ABplpapp (Lambie and Kimble, 1991; Moskowitz and

Rothman, 1996). As in canal cell-ablated animals, lag mutants often possess a

morphologically abnormal lin-48p::GFP+ cell, and lack a G1 pore autocellular junction

(Table 1, Fig. 3.5). A ventral perspective revealed that the presumptive duct and G1 pore

cells adopt adjacent ventral positions in the epidermis (Fig. 3.5B,C). Thus lag mutants

resemble let-60/Ras partial loss-of-function mutants.

76

Several lines of evidence suggest that the lag duct and G1 pore stacking defects

are a secondary consequence of canal cell absence. First, canal cell ablation in wild-type

embryos can phenocopy lag mutants. Second, a functional LIN-12::GFP reporter

(arIs41) is not detectably expressed in the duct or G1 pore progenitors during ventral

enclosure (Fig. 3.3E), nor is a LIN-12- and GLP-1-responsive reporter, ref-1p::GFP (data

not shown); thus Notch signaling is unlikely to impact directly on duct and G1 pore fate

specification or tubulogenesis. Third, lin-12 hypermorphic mutants, which have a single

canal cell, have normal duct and G1 pore morphology (Table 3.1, Fig. 3.5M). Finally,

examination of lin-12 null mutants or lag-2(q420) hypomorphic mutants, in which

absence of the canal cell is variable, revealed a strong correlation between absence of the

canal cell and failure of the duct and G1 pore to stack and undergo tubulogenesis (Fig.

3.5 D-E,G-H,M).

Together, the ablation and Notch mutant data support a model in which the canal

cell facilitates duct and G1 pore stacking and tubulogenesis. The canal cell likely

provides physical support to the duct and G1 pore as it adheres to the duct during these

processes. Stacking and tubulogenesis appear independent of canal cell-expressed lin-

3/EGF, since these processes are intact in lin-3 zygotic null mutants, despite defects in

cell fate specification (Fig. 3.2K-L). Duct fate specification also appears partially

independent of canal cell-expressed lin-3/EGF, stacking and tubulogenesis, since it is

only mildly affected by canal cell absence (Table 3.1). Nevertheless, since the canal cell

does express lin-3/EGF, and partial reduction of let-60/Ras can mimic canal cell absence,

localized LIN-3/EGF expression by the canal cell may help orient relative duct and G1

77

pore positions during stacking and bias which cell ultimately adopts the duct fate (see

Discussion).

Continued signaling through SOS-1 and Ras is required for duct morphogenesis

and differentiation

To test the temporal requirements for Ras signaling, we conducted temperature-

shift experiments with a sos-1 (Ras guanine nucleotide exchange factor) temperature

sensitive allele (Fig. 3.6). sos-1(cs41) mutants appear essentially normal at 20˚ C but

arrest with excretory system abnormalities when raised at 25˚ C (Rocheleau et al., 2002).

The cs41 lesion affects the CDC25-related Ras GEF domain of SOS-1, and importantly,

sos-1(cs41ts) lethality is almost completely suppressed by let-60(n1046gf) (Rocheleau et

al., 2002) or lin-1(e1275lf) mutations (Fig. 3.6A) , indicating that lethal defects are

caused by a failure in Ras-ERK-mediated signaling. Since let-60 ras is required only in

the duct cell (and not in the G1 or G2 pore or canal cell) for proper excretory function

and viability (Yochem et al., 1997), we further infer that any excretory abnormalities of

sos-1(ts) animals reflect requirements for Ras-ERK signaling in the developing duct cell.

In sos-1(ts) upshift experiments, upshifts prior to the 1.5-fold stage of

embryogenesis could recapitulate the let-60 ras zygotic null phenotype, in which the two

cells stacked properly but failed to undergo auto-fusion or to express the marker lin-

48p::GFP, suggesting both had adopted G1 pore-like fates (Fig. 3.6B,C). The earliest

maternal upshifts could occasionally generate adjacent cells as seen in let-60(n2021)

hypomorphs (data not shown). In sos-1(ts) downshift experiments, most animals were

normal for excretory morphology as long as they were moved to permissive temperature

78

by the bean stage of embryogenesis (Fig. 3.6C). These results are consistent with the

model that Ras signaling and cell fate specification occur as the presumptive duct and G1

pore cells approach the canal cell and undergo tubulogenesis.

Unexpectedly, the sos-1(ts) temperature-sensitive period for lethal excretory

defects extended from the bean stage into the L1 larval stage (Fig. 3.6D), revealing

continued requirements for signaling beyond initial cell fate specification. At least 70%

of animals upshifted at the 1.5-fold, 2-fold, 3-fold or early L1 stages (n>20 each)

accumulated fluid either within the excretory tubules or near the canal-duct junction,

despite an initially normal junction and lin-48p::GFP marker pattern (Fig. 3.6E, F),

suggesting other defects in organ architecture. While additional studies will be needed to

understand the cellular basis of these later defects, we conclude that SOS-1 and Ras, and

most likely the entire EGF-Ras-ERK pathway, play additional roles in duct

morphogenesis and differentiation.

G1 pore withdrawal can still occur in the absence of G2

When the G1 pore withdraws from the excretory system during L1, a neighboring

epidermal cell, G2, moves in to replace it as the pore (Sulston et al., 1983; Stone et al.,

2009) (Fig. 3.1J; Fig. 3.7A-C,M). By examining Ras and Notch pathway mutants, we

were able to address a basic question about the G1-G2 remodeling event: is

communication between G1 and G2 important to trigger G1’s withdrawal and/or G2’s

entry into the excretory system?

As described above, let-60(n1046gf) mutants invariably lack a G1 pore and have a

binucleate duct cell attached directly to the ventral epidermis. In 16% (11/67) of such

79

mutants, G2 still moves in and gives rise to a morphologically normal larval pore cell; in

the remainder, G2 (or G2p) wraps around the base of the duct but does not form a pore of

normal height (Fig. 3.7 D-F,M). Thus, G2 entry does not require a “come here” signal

from the G1 pore, but its morphogenesis and ability to insert between the duct and

epidermis may be facilitated by the act of G1 withdrawal.

To test the requirements for G2, we used lin-12/Notch single mutants, which

affect the G2 vs. W neuroblast cell fates (Greenwald et al., 1983). lin-12(d) hypermorphic

mutants have two G2 cells, and one of these forms a normal larval pore while the other

wraps around its ventral base (Fig. 3.7J-L,M). Conversely, lin-12(0) loss-of-function

mutants lack a G2 cell. In such mutants, G1 still withdraws from the excretory system

during mid-L1, and the duct then attaches directly to the ventral epidermis (Fig. 3.7G-

I,M). Thus, G1 withdrawal does not require a “go away” signal from G2.

80

Discussion

We have shown that Notch signaling and Ras signaling function sequentially to

control tube development in the C. elegans excretory system. Notch signaling is required

to generate the canal cell, which is a central organizer of duct and G1 pore development,

serving both as a source of LIN-3/EGF ligand (which contributes to Ras activation) and as

a physical attachment site for the duct (which is important for cell stacking and

tubulogenesis). Ras signaling influences cell positions, specifies duct vs. G1 pore

identity, and promotes subsequent aspects of duct morphogenesis and differentiation.

Below we propose a model for duct and G1 pore development and discuss similarities and

differences between development of the excretory system and development of more

complex tube networks.

A biased competition model for excretory duct vs. G1 pore fate specification

All excretory tubes are examples of left-right asymmetries in what is a mostly

bilaterally symmetric embryo (Sulston et al., 1983; Pohl and Bao, 2010). Notch signaling

on the left side of the embryo is required for the earliest of these asymmetries, generation

of the excretory canal cell (Lambie and Kimble, 1991; Moskowitz and Rothman, 1996).

We propose that Notch-dependent asymmetry of the canal cell leads to the Ras-dependent

asymmetry of the excretory duct and G1 pore.

According to this biased competition model, the presumptive duct and G1 pore

cells are initially equivalent. As these cells migrate toward the canal cell during ventral

enclosure, the left cell has an advantage due to the left-biased asymmetric position of the

81

canal cell; this bias may be strengthened by the presence of cells on the right side whose

left relatives undergo cell death. The left cell therefore reaches and adheres to the canal

cell first, and also receives earlier or quantitatively more LIN-3/EGF signal. LIN-3/EGF

signaling stimulates LET-60/Ras to promote duct identity and strengthen adhesion with

the canal cell. Signaling may also trigger production of an unknown lateral inhibitory

signal that prevents the presumptive G1 from also responding to LIN-3/EGF. Steric

hindrance or differences in relative Ras vs. inhibitory signaling levels cause the

presumptive G1 to take a more ventral position. Polarization and initial tubulogenesis

appear independent of Ras signaling; however, after both cells wrap up into tube shapes,

continued LIN-3/EGF signaling from the canal cell (and elsewhere) promotes duct vs. G1

pore identity and later aspects of duct morphogenesis and differentiation into a functional

tube.

Two aspects of this model can explain the stacking defects of let-60/Ras

hypomorphs, in which depletion of both maternal and zygotic let-60/Ras compromises

(but does not eliminate) the earliest steps of signaling. First, the presumptive duct, upon

reaching the canal cell, may not adhere to it strongly. Second, the presumptive duct may

not express the proposed inhibitory signal in a timely manner. Under conditions where

Ras signaling is reduced but not absent, this would allow the presumptive G1 pore to

respond to LIN-3/EGF and compete for a canal-cell proximal position. Failure of either

cell to adhere to the canal cell (as in lin-12 glp-1/Notch mutants), or failure to resolve

competition between the two cells such that both adhere, could lead to the observed

adjacent positions.

82

Lateral inhibition is a central feature of RTK-mediated branching morphogenesis

in several tubular organs (Ghabrial and Krasnow, 2006; Chi et al., 2009) and lateral

inhibition of Ras-dependent processes is frequently mediated by Notch signaling

(Sundaram, 2005). However, we find no evidence that Notch signaling directly influences

excretory duct vs. G1 pore cell fates. Differences in cell adhesion and steric hindrance

may be sufficient to explain the stacking process, but they are unlikely to explain how

only a single duct-like (lin-48p::GFP+) cell is specified from the two adjacent precursors

in a lin-12 glp-1/Notch mutant (Table 3.1). Therefore, an unknown signaling pathway

may be used to mediate lateral inhibition of the duct fate.

Downstream consequences of EGF-Ras-ERK signaling in the excretory duct

In addition to influencing cell positions, EGF-Ras-ERK signaling is both

necessary and sufficient for several aspects of duct vs. G1 pore identity, including duct-

specific patterns of gene expression, auto-fusion, and a permanent epithelial identity. This

latter difference in duct epithelial permanence vs. G1 withdrawal may ultimately explain

the lethality of the duct-to-G1 pore fate change in let-60 ras null mutants. G1 withdrawal

does not depend on cues from the replacement cell G2, but instead appears to be an

intrinsically programmed characteristic of the duct and G1 progenitors that is repressed

by Ras signaling. Ras may inhibit withdrawal in part by stimulating aff-1-dependent auto-

fusion to permanently remove the duct autocellular junction and prevent its later

unwrapping; however, Ras must have additional effects since the duct cell still remains

permanent in most aff-1 mutants despite a failure of auto-fusion (Stone et al., 2009).

83

sos-1(ts) temperature-shift experiments suggest that Ras signaling continues to be

required after initial fate specification for development of a fully functional duct tube.

After its auto-fusion to form a toroid, the duct elongates, changes shape, and elaborates a

complex lumen (Stone et al., 2009). The junctions between the duct and its neighboring

tubes must be maintained and may undergo further maturation to establish barrier

functions and prevent excretory fluid leakage. Finally, the duct-pore junction must be

remodeled as G1 withdraws and G2 enters. The continued requirement for sos-1 as these

events are occurring suggests that Ras signaling may directly promote such

morphogenetic and differentiation processes.

Most or all of the responses to Ras signaling in the excretory duct appear to be

transcriptionally-mediated. sos-1(ts) defects can be rescued by loss of the LIN-1/Ets

transcription factor, which is regulated by MPK-1 ERK phosphorylation (Jacobs et al.,

1998) and acts as a repressor of the duct fate. sos-1(ts) defects also can be mimicked by

combinatorial loss of LIN-1 and another downstream transcription factor, EOR-1 (a

BTB-zinc finger protein) (Howard and Sundaram, 2002; Howell et al., 2010), revealing a

second (but redundant) activity of LIN-1/Ets in promoting the duct fate. A challenge for

future work will be to connect these transcriptional effectors to downstream targets that

control the various cell biological processes of duct auto-fusion, morphogenesis, and

epithelial maintenance.

Similarities and differences between the excretory system and more complex tube

networks

84

C. elegans excretory tubes are topologically quite different from epithelial tubes

in other renal systems in that they are each only one cell in diameter. However, similar

unicellular tubes have been described in other organ systems, including the Drosophila

trachea (Ghabrial et al., 2003) and the mammalian microvasculature (Bar et al., 1984).

Furthermore, in vitro studies suggest that unicellular tubes may be developmental

precursors to some larger bore tubes in the vasculature (Folkman and Haudenschild, 1980;

Iruela-Arispe and Davis, 2009).

Despite their topological differences, C. elegans excretory tubes and larger

multicellular tubes must undergo many similar cell biological processes. For example,

initially unpolarized cells must transition to an epithelial state, define an appropriate apical

domain, form new junctions, and build a lumen; the difference is that excretory tubes

define an intracellular rather than an extracellular lumen. Furthermore, distinct tube types

must join to form a continuous conduit. The maturing tubes must be structurally strong to

withstand internal pressure from their contents, yet flexible enough to elongate and grow

as organismal size or physiological demands increase. Finally, some epithelial tube cells,

like the G1 pore, retain the developmental potential to adopt different fates (Jarriault et al.,

2008; Mani et al., 2008; Weaver and Krasnow, 2008; Kalluri and Weinberg, 2009; Red-

Horse et al., 2010). Given the simplicity of the C. elegans excretory system and its

amenability to genetic manipulations, further studies in this system should give insights

into basic cellular mechanisms involved in these common steps of tubular organ

development

85

Materials and Methods

Strains and alleles

N2 var. Bristol was the wild-type strain. Unless otherwise indicated, all strains were

grown at 20˚C under standard conditions (Brenner, 1974) and all mutant alleles are

described in (Riddle et al., 1997). I: lag-1(q385), lag-2(q411), lag-2(q420). II: let-

23(sy97). III: lin-12(n137), lin-12(n137n720), lin-12 (n941), glp-1(q46), glp-1(q231).

IV: eor-1(cs28) (Rocheleau et al., 2002), let-60(sy101sy127), let-60(n1046), let-

60(n2021), lin-1(e1275), lin-1(n304) (Beitel et al., 1995), lin-1(n1761) (Jacobs et al.,

1998), lin-3(n1059), lin-45(n2018). V: sos-1(cs41) (Rocheleau et al., 2002). X: lin-

15(n765), sem-5(n2019). Transgenes used are: arIs12 (lin-12 intra) (Struhl et al., 1993),

arIs41 (LIN-12::GFP) (Levitan and Greenwald, 1998), gaIs27 (LET-23::GFP) (Simske et

al., 1996), jcIs1 (AJM-1::GFP) (Koppen et al., 2001), saIs14 (lin-48p::GFP) (Johnson et

al., 2001), syIs107 (lin-3p::GFP) (Hwang and Sternberg, 2004), wIs78 (AJM-1::GFP)

(Koh and Rothman, 2001), xnIs17 (DLG-1::GFP) (Totong et al., 2007), vha-1p::GFP

(Oka et al., 1997), zuIs143 (ref-1p::GFP) (Neves and Priess, 2005). qnEx59 (dct-

5p::mcherry) was provided by Julia and David Raizen and contains 845 bp of the dct-5 5'

region. csIs55 (GFP::MLS-2) was generated from a pYJ59-containing array (Jiang et al.,

2005) by gamma-irradiation-induced integration. csEx146 (lin-48p::mcherry) contains

4.8 kb of the lin-48 5’ region and mcherry in vector pPD49.26 (Fire et al., 1990). lin-3

overexpression was achieved with an integrated lin-3p::LIN-3::GFP transgene provided

by Min Han.

86

Marker Analysis and Imaging

Images were captured by differential interference contrast (DIC) and epi-fluorescence

microscopy using a Zeiss Axioskop and Hamamatsu C5985 camera, or by confocal

microscopy using a Leica SP5. Images were processed for brightness and contrast using

Photoshop or ImageJ. Some AJM-1::GFP images were inverted for clarity.

For electron microscopy, embryos were mounted on an agarose pad and observed

under light microscopy to identify timepoints for fixation. A laser was used to place 3-4

holes in the eggshell, allowing the embryo to be aldehyde fixed while on the pad (see

more details at www.wormatlas.org/laserhole.htm). The fixed embryo was postfixed with

osmium tetroxide, potassium ferrocyanide, and tannic acid, and then post-stained with

uranyl acetate before embedding in plastic resin. Transverse serial thin sections were

collected on slot grids and photographed on a Philips CM10 electron microscope. The G1

and duct cells were identified within a series of 600 serial thin sections on the basis of

their positions relative to the canal cell and to the G2 and W epidermal cells (Fig. 3.8)

and by comparison to known nuclear positions in time-lapse confocal movies.

To visualize the duct and pore progenitor migration paths and timing, we

generated 3D confocal movies of strains UP2051 (pie-1::mCherry::HIS-58::pie-1utr; his-

72pro::HIS-24::mCherry::let-858utr; GFP::MLS-2) and RW10890 (pie-1::mCherry::HIS-

58::pie-1utr; his-72pro::HIS-24::mCherry::let-858utr; PAL-1::GFP) as previously

described (Murray et al., 2006) on a Leica TCS SP5 resonance-scanning confocal

microscope with 0.5 micron z slice spacing and 1.5 minute time point spacing.

Temperature was 22.5˚C. We used a hybrid blob-slice model and StarryNite (Bao et al.,

87

2006; Santella et al., 2010) for automated lineage tracing and curated the duct, pore and

canal lineages (ABplpaa and ABprpaa) through ventral enclosure (approx. 275 minutes)

with AceTree (Boyle et al., 2006).

Ablations

Laser ablations were performed with a Micropoint Laser Ablation system (Photonic

Instruments, St. Charles, IL) mounted to a Leica DM5500B or Zeiss Axiophot

microscope. The canal cell mother (ABplpappaa) was identified using zuIs143 (ref-

1p::GFP) (Neves and Priess, 2005). Successful ablation was confirmed by the absence

of the canal cell as assessed by DIC and either vha-1p::GFP or AJM-1::GFP patterns.

For more detailed description of ablation technique, see Appendix 4.

Immunostaining

Embryos were permeabilized by freeze-cracking and fixed in methanol as described in

Appendix 4 and incubated with primary antibodies overnight at 4C and with secondary

antibodies for 2hrs at room temperature. The following antibodies were used:

preadsorbed rat anti-MLS-2 (CUMCR6; 1:400) (Jiang et al., 2005) goat polyclonal anti-

GFP (Rockland; 1:50), rabbit polyclonal anti-DLG-1 (1:50 to 1:100) (Segbert et al.,

2004). All secondary antibodies were from Jackson ImmunoResearch Laboratories and

were used at a dilution of 1:50 to 1:200.

.

88

Acknowledgements

We thank Matthew Buechner, Helen Chamberlin, Iva Greenwald, Min Han, Jeff Hardin,

Jun Liu, Jim Priess, David Raizen, Paul Sternberg and the Caenorhabditis Genetics

Center (U. Minnesota) for providing strains, Craig Stone and Helin Shiah for generating

reporters, and Iva Greenwald and John Yochem for helpful discussion and comments on

the manuscript. TEM of embryo morphogenesis was originally done in collaboration with

Ed Hedgecock. This work was funded by NIH GM58540 to M.S. I.A. and V.M. were

supported in part by T32 GM008216.

89

Table 3.1. Physical or genetic removal of the canal cell reduces but does not prevent duct fate specification

*htiw slamina fo %

Genotype^ llec lanac (n)

duct cell (n)

+ 100 (32) 97 (31) +, canal cell ablated 0 (9) 100 (9) +, canal cell parent ablated 0 (8) 87 (8) lin-12(n941lf) glp-1(q46lf) m+z- 0 (30) 47 (30) lag-1(q385lf) m+z- 0 (32) 95 (40) lag-2(q411lf) m+z- 3 (34) 44 (25) lag-2(q420rf) + (31) 94 (31) lag-2(q420rf) - (34) 38 (34) lin-12(n137gf) + (15) 100 (69) arIs12 [lin-12(intra)] + (40) 97 (40)

*Presence of the canal cell or duct cell was assessed based on vha-1p::GFP or lin-48p::GFP reporter expression, respectively. + or - indicate that presence of canal cell was assessed based on nuclear morphology or AJM-1::GFP. ^m+z- indicates that larvae were obtained from heterozygous hT2[qIs48] balancer mothers. For canal cell parent ablation, strain contained ref-1p::GFP to aid in target identification. lf, loss-of-function. rf, reduced function. gf, gain-of-function.

90

Figure Legends

Figure 3.1: Timeline of excretory system development

(A) Schematics of excretory canal cell (red, ABplpappaap), duct (yellow, ABplpaaaapa),

G1 (blue, ABprpaaaapa), G2 (green, ABplapaapa) and W (green, ABprapaapa) at

different developmental stages, based on Sulston et al. (1983), prior electron microscopy

(Stone et al., 2009), and this work. Dark black lines indicate apical junctions. Dotted

line, duct auto-fusion. Arrow, pore autocellular junction. Arrowhead, duct-canal cell

intercellular junction. Bracket, duct cell body. Not shown are the non-essential excretory

gland cells, which also connect to the duct-canal junction (Nelson et al., 1983; Nelson

and Riddle, 1984). (B-E) Progressively older ventral enclosure stage embryos. (B-C, E)

Ventral views. GFP::MLS-2 marks the presumptive duct and G1 pore nuclei. DLG-

1::GFP marks epidermal cell junctions in B and E, which are confocal projections. (B)

The presumptive duct and G1 initially lack junctions. (C) The presumptive duct is closer

to the canal cell than is the presumptive G1. (D) Transmission electron micrograph of a

wild-type embryo at similar stage as C, with cells pseudo-colored as in A. Transverse

anterior view. The presumptive duct and G1 have met at the ventral midline. The duct

makes extensive contact with the canal cell, while G1 is excluded. No epithelial junctions

or lumen are detectable. (E) G1 moves ventrally. Asterisk indicates site of future G1

pore opening between G2 and W epidermal cells (see also Fig. S1). (F-L) Left lateral

views. (F) 1.5-fold stage embryo immunostained for DLG-1, showing newly formed

autocellular junctions (inset) just prior to duct auto-fusion. (G-J) L1 larvae. Box in G'

indicates region magnified in H. AJM-1::GFP marks junctions. The duct no longer has

91

an autocellular junction. (I) lin-48p::mcherry marks the duct. (J) dct-5p::mcherry marks

the duct and G1 pore in early L1 and (K) the duct and G1 in late L1 after G1 withdrawal

and G2 entry. (L) Adult canal cell marked with vha-1p::GFP. Note that canal cell

elongates extensively. Data contributed by all authors.

Figure 3.2: let-60/Ras promotes the duct vs. G1 pore fate

(A-J') AJM-1::GFP (left column) and lin-48p::GFP or (C') dct-5p::mCherry (middle

column) expression in L1 larvae of the indicated genotypes. Lateral views, with

schematic interpretations (right column) and symbols as in Fig. 1. Colors represent lineal

identity, not fate.

Mutants with reduced signaling usually have 2 pore-like cells with autocellular junctions,

but as fluid (carat) accumulates during L1 (C), large junctional rings (asterisk) are

common. In (C'), white arrows indicate two stacked pore-like cells. Mutants with

increased signaling have a seamless binucleate duct that connects to the ventral

epidermis. Scale bar 2 m. (K, L) Quantification of marker phenotypes. Note that some

mutants with “0 G1” have defects in cell stacking and tubulogenesis rather than in cell

fate specification (see Fig. 4). Data contributed by M.S., K.P., K Howell, K. Huang, and

I.A.

Figure 3.3. lin-3/EGF, let-23/EGFR and lin-12/Notch reporter expression in the

excretory system

(A, C) LET-23::GFP is expressed in the presumptive duct and G1 pore at ventral

enclosure (A) and in the duct (bracket) at 3-fold (C). (B, D) lin-3p::GFP is expressed in

92

the canal cell from ventral enclosure (B) through L1 (D). (E) LIN-12::GFP is expressed

in the presumptive G2 and W but not in the presumptive duct or pore at ventral enclosure.

In A, C and E, embryos were co-stained with anti-GFP and either anti-MLS-2 or anti-

AJM-1 to mark the duct and G1 pore (n > 10 each). Scale bars, 5 m. Data contributed

by V.M. and I.A.

Figure 3.4. let-60/Ras hypomorphs reveal defects in cell competition and stacking

(A-B, E-F) Wild-type. (C-D, G-L) let-60(n2021rf). (A, C) AJM-1::GFP in 3-fold

embryos, ventral view. Lines indicate ventral junctions between the presumptive G1 or

duct and the epidermis. (E, G, I, K) AJM-1::GFP and dct-5p::mCherry in early L1s,

lateral view. Asterisks indicate ventral cells with neither duct-like nor pore-like

morphology. In let-60(n2021rf) mutants, the presumptive duct and G1 adopt adjacent

positions in the epidermis (C-D) and one cell usually reaches from the ventral epidermis

to the canal cell (G-J). The lineal identity of this cell is unknown and may be variable.

(K) Quantification of adjacent defects in early L1 larvae from heterozygous vs.

homozygous mutant mothers. Animals with no G1 pore autocellular junction or with a

single autocellular junction that stretched from the ventral epidermis to the canal junction

were scored as "adjacent". Data contributed by M.S. and I.A.

Figure 3.5: The canal cell is required for duct and G1 pore stacking and

tubulogenesis

93

(A-I, L) AJM-1::GFP. D, G, H also contain lin-48p::GFP. Scale bars, 2 m. (J, K)

Schematic diagrams. (A-C) early 3-fold embryos, ventral view. (D-F) Early L1s, ventral

view. (G-L) Early L1s, lateral view. In wild-type (A), the G1 pore contacts G2 and W in

the ventral epidermis. In lag-1(RNAi) (B) or lin-12(n941) glp-1(q46) double mutants (C,

F, I), the presumptive duct and G1 pore (lines) both contact the epidermis and lack

autocellular junctions. In lag-2(q420rf) mutants (D, E, G, H), presence of a canal cell (D,

G) correlates with normal duct and G1 pore morphology. aff-1(tm2214) (E) has no

impact on the lag-2(q420rf) phenotype. (L) Ablation of the canal cell mother eliminates

the G1 pore autocellular junction. (M) Quantification of junction phenotypes in early L1

larvae. Animals with no G1 pore autocellular junction were scored as "adjacent". Data

contributed by V.M. and M.S.

Figure 3.6. sos-1 temperature shift experiments reveal continued requirements

during duct morphogenesis and differentiation.

(A) sos-1(cs41ts) lethality at 25˚ C is rescued by let-60(n1046gf) or lin-1(e1275lf). n>50

for each genotype. (B-D) sos-1(ts) animals bearing AJM-1::GFP or lin-48p::GFP markers

were up-shifted or down-shifted at the stages indicated. n>20 for each time point. sos-1

is required prior to the 1.5 fold stage to promote lin-48p::GFP duct marker expression (B)

or duct auto-fusion (C). (D) The sos-1(ts) temperature-sensitive period (TSP) for lethality

extends from the bean stage of embryogenesis to L2. The majority of animals upshifted

prior to L2 arrested with excretory abnormalities (see C,E,F). Animals upshifted during

L2 displayed a scrawny phenotype similar to that reported for egl-15/FGFR mutants

(DeVore et al., 1995; Roubin et al., 1999). (E',F') Fluid (carats) accumulated in or near

94

the duct in 3-fold upshifted sos-1(ts) animals, while AJM-1::GFP (E) and lin-48p::GFP

(F) patterns were unaffected in these same animals. Scale bar, 2 m. Data contributed by

I.A.

Figure 3.7: G1 withdrawal and G2 entry can occur independently

AJM-1::GFP in L4 larvae. (A, D, G, J) lateral views. (B, E, H, K) ventral views. (C, F, I,

L) Schematic diagrams. In wild-type (A-C), G2p forms the pore. In let-60(n1046gf)

mutants (D-F), G2p usually wraps around the base of the duct. In lin-12(n941lf) mutants

(G-I), the duct attaches directly to the ventral epidermis after G1 withdrawal. In lin-

12(n137gf) mutants (J-L), the extra G2p cell wraps around the ventral base of the pore.

Lines indicate ventral junctions with the epidermis. Scale bars, 2 m. (M) Quantification

of junction phenotypes. Data contributed by M.S.

Figure 3.8: Transmission Electron Micrographs of ventral enclosure stage embryo

Thin sections eighteen (A) and thirty-eight (B) sections posterior of the section shown in

Fig. 3.1D. The canal cell, duct, G1, G2 and W are pseudo-colored as in Fig. 3.1A. hyp7

cells ABpl/raapppa have already met at the ventral midline and fused, but G2 and W have

not yet met at the midline, leaving an open ventral cleft through which parts of the canal

cell, duct and G1 are exposed on the outside of the embryo. The canal cell and duct

remain in contact over more than forty sections in this embryo, but the canal cell and G1

never touch. Data contributed by D.H. and C.N.

95

ventralenclosure

1.5-fold 3-fold L1

hatch

A

Migration/Tubulogenesis

Morphogenesis and Differentiation G1 withdrawal/Remodeling

A

R

A

V

duct cell

G1

canal cell

G1pore

G2 poreD

AG2

H I ductG1

F

F F

canalcell

G12 μm

5 μm

B

5 μm

G G’

ductG1

duct FF

canacanananaanaallllllcellcelllcanal

L

JG1

duct

G2

JJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJJG1G11GGG1G1G11G1G111111G111111G11111G

ducdducducdddducducductductductducucuctdududucdddududucduucduducducduducdducducduucuctduddduudududucdduduuudududuuudduucucudduuuuddduuccddddddduuucdddducccddddudd ccdddduc

GGGGGGG2G22GGGGGGGGGGGGGGGGGGGGGGGGGGGGGG2G2G2G2G22GG

KductG1

G2

IIIIIIIIIIIIIIIIIIJ

G1

duct

C

G1 duct

canal

50 μm

A

R

ductG1

canal

E

D

R

D

W

1 hr at 20˚C

1 μm

D

A

D

R

G1

duct

G2

W

*

Figure 3.1

96

0% 20% 40% 60% 80% 100%

+

let-60(sy101sy127lf) m+z-

let-60(n1046gf)

let-60(n2021rf)

lin-15(n765lf)

lin-3(n1059lf) m+z-

lin-3(++)

let-23(sy97)

sem-5(n2019rf)

lin-45(n2018rf)

lin-1(n304lf)

lin-1(n1761gf)

eor-1(cs28lf)

sur-2(RNAi)

eor-1(cs28lf); sur-2(RNAi)

lin-1(n304lf) eor-1(cs28lf)

0 G1

1 G1

2 G1

0% 20% 40% 60% 80% 100%

+

let-60(sy101sy127lf) m-z-

let-60(n1046gf)

let-60(n2021rf)

lin-15(n765lf)

lin-3(n1059lf) m+z-

lin-3(++)

let-23(sy97)

lin-45(n2018rf)

lin-1(n304lf)

lin-1(n1761gf)

eor-1(cs28lf)

sur-2(RNAi)

eor-1(cs28lf); sur-2(RNAi)

lin-1(n304lf) eor-1(cs28lf)

2 duct

1 duct

0 duct

A A’

D”

B B’

D D’

WT

let-

60(l

f)le

t-60

(gf)

let-

60(l

f) C C’

2 duct0 G1

*

AJM-1::GFP

dct-5p::mCherry

^

A”

1 duct1 G1

G1

duct

B”

0 duct2 G1

C”

0 duct2 G1

*

lin-48p::GFP

lin-

3(lf

)

G

E’

lin-

1(lf

)li

n-1(

gf)

lin-

3(gf

)eo

r-1(

lf);

sur-

2(i)

E

F

H

I

’F

G’

H’

I’

lin-

1(lf

);eo

r-1(

lf) J

F”

2 duct0 G1

G”

2 duct0 G1

E”

0 duct2 G1

H”

0 duct2 G1

I”

0 duct2 G1

J”

0 duct2 G1

K

L n=

n=

58

36

39

72

25

25

25

34

23

18

51

20

31

34

17

22

20

21

21

21

20

16

20

45

20

27

35

40

34

55

J’20

Figure 3.2

97

A A’

C

B B’

LET-23::GFP LET-23::GFP lin-3p::GFPMLS-2

C’

D

D’

E

MLS-2LET-23::GFP LIN-12::GFPlin-3p::GFP

LET-23::GFPAJM-1

G2W

G1 ductcanal

G1

duct ductG1

canal

Figure 3.3

98

Stacked, 1 G1

Stacked, 2 G1

Adjacent

0% 20% 40% 60% 80% 100%

G1

W G2

AA

R

CB D

W G2

G1

G2WW G2

E E’ E’’G1

duct duct

G1G1

F

G G’ G’’ H

J

D

A

I’ I’’IG1

duct duct

G1

A

R

K

*

* *

*

G1

duct

*

duct

G1

*n=36

n=72

n=20

n=58

n=38

WT

let-

60(r

f)le

t-60

(rf)

let-60(n2021rf) mrfzrf

let-60(n2021rf) m+zrf

let-60(sy101sy127lf) m+z-

let-60(sy101sy127lf)/let-60(n2021rf) mothers

+

adj

adj

Figure 3.4

99

0% 20% 40% 60% 80% 100%

++

lin-12(lf) glp-1(lf) m+z-lag-1(RNAi)

lag-2(rf)lag-2(rf)

aff-1; lag-2(rf)lin-12(lf) m+z-lin-12(lf) m+z-glp-1(lf) m+z-

lin-12(gf)

adjacent stacked

G1

W G2

A B

G H

D

K

E I

I

F

J

C

L

WT lag

WT, canal-

G1

duct

D

A

A

R

D

A

A

R

M3652453134212182015

n

canal

+

+

+

-

+

-

-

-

-

+

-

canal+ canal- canal-

vent

ral

vent

ral

late

ral

late

ral

Figure 3.5

100

0

20

40

60

80

100

Mat

erna

l Pr

e-be

an

Bea

n 1.

5-fo

ld

2-fo

ld

No

shift

% 2

AJ

Stage sos-1(ts) shifted

20°C to 25°C

25°C to 20°C

C

0

20

40

60

80

100

Mat

erna

l Pr

e-be

an

Bea

n

1.5-

fold

2-fo

ld

% li

n-48

p::G

FP(-

)

B

Stage sos-1(ts) shifted 20°C to 25°C

0 20 40 60 80

100 so

s-1(

ts)

sos-

1(ts

) so

s-1(

ts);

let-6

0so

s-1(

ts);

lin-

1

% L

etha

lity

A

0 0

25°C

25°C25°C

20°C

0 20 40 60 80

100

Mat

erna

l Pr

e-B

ean

Bea

n 1.

5-fo

ld

2-fo

ld

3-fo

ld

Early

L1

L2

L3

L4

No

shift

% L

etha

lity

D

TSP

25°C to 20°C

20°C to 25°C

lin-48p::GFPlin-48p::GFP

F’E E’ F

AJM-1::GFP

^ ^^

Stage sos-1(ts) shifted

Figure 3.6

101

0 20 40 60 80 100

+

let-60(gf)

lin-12(lf)

lin-12(gf)

L1 (G1) L4 (G2p)

% pore AJ

n=31n=33

n=21

n=15n=26

n=39n=67

n=24

let-

60(g

f)li

n-12

(lf)

WT

lin-

12(g

f)1 duct1 G2

2 duct1 G2

1 duct0 G2

A B

D E

G H

J K

F

I

D

A

L

A

C

1 duct2 G2

L

duct

G2p

M

Figure 3.7

102

canal

ductG1

G2

W

canal

ductG1W

G2

hyp7

hyp7ventralcleft

B

A

1 μm

1 μm

D

R

Figure 3.8

103

Chapter 4

Discussion: The role of LET-4 in the apical ECM and junctions, and approaches to

identify LET-4 interacting partners.

104

Introduction

This work helps establish the excretory system as a new model to ask important

questions about epithelial tubes. With my colleagues, I have explored the role of Notch

and Ras in the excretory system, and proposed a biased competition model for duct cell

fate. I have characterized the pattern of conserved junctional proteins in the excretory

system, such as the PAR complex proteins and cadherin-catenin complex. This work has

demonstrated the presence of conserved proteins with roles common to many epithelia,

and therefore supports the excretory system as a good model for epithelial development,

luminal maintenance, and apical ECM formation and maintenance. I have also

demonstrated that loss of apical transmembrane protein LET-4 results in defects in both

apical ECM organization and junction integrity, suggesting an unexpected link in the

maintenance of these two epithelial cell structures.

Loss of LET-4 results in junctional and apical ECM defects

My let-4 analysis has characterized two classes of phenotypes: ECM phenotypes and

junctional phenotypes. The ECM defects are: (1) detached inner eggshell layer in 1.5-

fold embryos, (2) extra-embryonic cytoplasts in 3-fold let-4 embryos, (3) in the duct cell,

the cuticle becomes detached from the apical face of the cell in late in 3-fold, and (4)

increased L1 cuticle permeability. There are two epithelial junction phenotypes: (1) the

pore autojunction, and duct/pore connection break late in 3-fold, and (2) in let-4 RNAi-

105

treated sym-1 worms, epidermal junctions break late in 3-fold. My analysis has found no

evidence for defects in initial apical specification or junction formation in these cells.

Considering these phenotypes, I propose that LET-4 is required for proper apical ECM

organization in the excretory system and epithelial cells. In the absence of LET-4 in the

apical ECM, epithelial junctions cannot be maintained as a secondary consequence of

apical ECM disorganization. Based on this proposal, I have generated 3 models that

could explain LET-4‟s indirect role in jucntional maintenance (Fig. 4.1). First, a

disorganized apical ECM could result in the apical ECM failing to absorb force, causing

the junctions themselves to be exposed to more force (Fig 4.1A). Second, the apical

ECM may be playing a role in signaling pathway required for junctinal maintenance (Fig.

4.1B). Third, a still unknown component of the apical ECM could directly stabilize

junctional proteins (Fig. 4.1C).

While I cannot rule out the possibility that loss of LET-4 is affecting the junctions

independent of the extracellular matrix, we favor the model that the ECM is the primary

defect, and the junctions are affected because of ECM defects. The junction breakage

may be due to extra force sustained by the junctions in the absence of a wild-type apical

ECM. We favor this model for several reasons. First, LET-4::GFP reporter transgenes

are not enriched at the junctions like other junctional components are. Second, ECM

defects are more penetrant than junctional defects. The defects in the apical ECM such as

inner eggshell layer detachment, presence of extra-embryonic cytoplasts, and cuticle

permeability are highly penetrant, and junctional defects like embryonic rupture are rarer,

except in the sym-1 background. In the excretory system, though, detachment of the

106

cuticle and pore autojunction breakdown are both highly penetrant. Third, the defect in

the sheath occurs at 1.5-fold, before elongation, and before any junctional phentoypes are

apparent.

I have identified a system with a correlation between apical ECM components

and junctional defects, adding to the growing field of apical ECM studies. This is

different from the previously described connections related to MUC1 in mammals and

Piopio and Dpy in Drosophila (Discussed in Chapter 1). MUC1 is an apical ECM

protein, and mislocalization of it results in polarity defects, leading to EMT (Roy et al.,

2001; Kufe et al., 2009). The let-4 defect is distinct from this because in let-4, I‟ve

detected no defect in apical polarity. Also, MUC1 has been demonstrated to signal

through the cytoplasmic domain (Kufe et al., 2009), and I‟ve found that the LET-4

cytoplasmic domain is dispensable for function. The authors of the Piopio and Dumpy

study propose that the apical ECM serves as a structure to guide migrating cells as they

intercalate and form new autocellular junctions, and the absence of the normal ECM

results in failure of proper junction formation (Jazwinska et al., 2003). In let-4 mutants,

cells are not migrating relative to each other when I observe junctional phenotypes, and

no new junctions are forming. The tubes of the excretory system have already formed

and elongated by the time the defect is apparent. The junctions of this system may

require maintenance which does not occur due to the absence of LET-4 in the apical

ECM.

The let-4 excretory system defect, consisting of duct cell lumen collapse, duct

detachment from the pore, and loss of pore autojunction occurs late in embryogenesis,

107

after deposition of the cuticle (Chapter 2). The excretory system does not have a defect

prior to 3-fold, or at later larval molts, indicating that LET-4 acts at a very specific time

in the excretory system. Similarly, I have found no evidence for any defect in the

excretory system apical ECM until late in 3-fold stage. This suggests the maintenance of

the apical ECM is a regulated process, with requirements for specific proteins at specific

times. Because these excretory system defects are not apparent until 3-fold stage, this

could mean that LET-4 has a role in apical ECM at the cuticle stage.

In the excretory system, I see the specific junctions being affected, which argues

against let-4 mutants having a general junctional defect. If there were a general defect in

junctional integrity in let-4 mutants, I would expect to see detachment between the pore

and the outside, or the duct and canal cell. The duct/pore junction always becomes

disconnected, while the duct/canal cell junction stays intact. The data suggest that

specific junctional structures are sensitive to an abnormal ECM.

The epidermal rupture phenotype observed in let-4 RNAi treated sym-1 embryos

has revealed a different type of epidermal rupture phenotype than has been previously

described. The let-4 embryonic phenotype is reminiscent of other mutant phenotypes,

such as par-6 (Totong et al., 2007), hmr-1/e-cadherin (Costa et al., 1998), ajm-1 (Koppen

et al., 2001), ifb-1 (Woo et al., 2004) or spektraplakin locus genes vab-10A and vab-10B

(Bosher et al., 2003). These other mutants, however, have mutated junctions or

cytoskeletal components, and rupture early in elongation. I‟ve found that let-4 mutants

have an epidermal defect that is very different because the junctions and cytoskeletal

components appear to be patterned normal by TEM, markers, and

108

immunohistochemistry, until the junction breakage at 3-fold stage (Chapter 2, Appendix

2a).

Why does the excretory system phenotype present itself when it does? Perhaps

the junctions of the excretory system undergo a remodeling at the time of cuticle

secretion in 3-fold stage, making them vulnerable to breakage due to an incomplete ECM

at this stage. Although junctional proteins are known to be dynamic (Acloque et

al.,2009; Baum and Georgiou, 2011; St Johnston and Sanson, 2011), the replenishing of

junctions in the excretory system has not been described.

Many questions remain about the role of LET-4 and its relationship with the

apical extracellular matrix. The components of the embryonic sheath in the embryo and

the extracellular matrix in the lumen of the duct and pore cell still remains mysterious. A

deeper understanding of the molecular partners of let -4 will involve a closer

characterization of the extra-cellular matrix and identification of let-4 interacting

proteins. Below, I list more outstanding questions, describe experiments performed to

address these questions, and discuss my conclusions.

Why are there so many eLLRons?

The extra-cellular Leucine-Rich Repeat only (eLLRon) family is extensive.

There are 17 members in C. elegans, 35 in Drosophila, 52 in Mouse and 57 in human

(Dolan et al., 2007). This large number of members in such a specific protein category

suggests redundancy among these proteins. Redundancy is not unprecedented for

components of the C. elegans extracellular matrix.

109

There are about 170 collagens in the C. elegans genome (Page and Johnstone,

2007), but only a handful have been found to have mutant phenotypes. Often, those

phenotypes are only mild, such as missing alae, roller locomotion defects, or a shortened

body length, suggesting that worms can form a sufficient cuticle even without the most

important cuticular collagens.

A family of extracellular Leucine-Rich Repeat proteins which may provide

insight into how LET-4 may function in an ECM is the Small Leucine-Rich

Proteoglycans (SLRPs). SLRPs consist of LRR motifs in a protein core, and covalent

linkage to glycosaminoglycan side chains. SLRPs modulate collagen matrix assembly

(Kalamajski and Oldberg, 2010), and bind collagen with their LRR domains (Shimizu-

Hirota et al., 2004). SLRPs are ECM proteins that are required for collagen matrix

assembly. They are hypothesized to work as a type of scaffold in the apical ECM, to

regulate the formation of collagen structures. (Kalamajski and Oldberg, 2010). SLRPs,

therefore are not affecting the production of the ECM components, but the proper

ordering of the components. Perhaps LET-4 is performing a similar role, and affecting

the organization of some collagens in the cuticle.

Other eLLRons have been shown to have a role in cell-cell adhesion in neurons.

Although the let-4 defects described here are in epithelial cell junctions, it is intriguing

that eLLRons have been demonstrated to have roles at synaptic junctions. In mammals,

LRRTM1-3 are required for excitatory synapse formation, and bind neurexins (deWit et

al., 2009; Ko et al., 2009; Siddiqui et al., 2010). The Drosophila protein Capricious is

well characterized eLLRon known to have a role in neurons. Caps is required for

110

targeting of embryonic motor neurons to specific muscles, and for proper synaptic

formation; some of these roles require the cytoplasmic domain (Taniguchi et al., 2000,

Shinza-Kameda et al., 2006, Mao et al., 2008, Kohsaka and Nose 2009, Shishido et al.,

2009). Notably, Caps is also required in the trachea for branch outgrowth (Krause et al.,

2006). Although other eLLRons have roles in neurons, I‟ve found no evidence for

transcription or translation of let-4 in neurons.

Why are both LET-4 and EGG-6 required in the excretory system?

A better comparison of the phenotype of let-4 and egg-6 requires further

investigation of the egg-6 phenotype. Molecular characterization of additional junctional

components of the excretory system will be useful. Also, TEM of the egg-6 mutant

phenotype will reveal the state of the duct lumen and inner eggshell layer. The AJM-

1::GFP junctional phenotype and duct detachment phenotypes of let-4 and egg-6 are

similar, so the duct luminal phenotype and inner eggshell layer phenotype could be very

similar as well.

LET-4 and EGG-6 are similar proteins with similar phenotypes; are they

interchangeable? To investigate this, ongoing experiments are being performed to test for

rescue of the egg-6 phenotype with let-4 overexpression, and vice versa. A transgene

containing let-4cDNA driven by the lpr-1 promoter, which rescues the let-4 defect, failed

to rescue egg-6 larval lethality (J. Parry, personal communication). This suggests that the

two proteins, though similar, are serving non-redundant functions in the excretory

111

system. These data highlight the diversity of functions of the eLLRons, even in the same

tissue.

What ECM components could LET-4 be interacting with?

An initial candidate for a let-4-interacting protein was LPR-1, a secreted lipocalin.

Many aspects of the phenotype of lpr-1 are very similar to let-4. In addition to a phasmid

dye-filling defect, both mutants have a highly, but incompletely, penetrant L1 larval

lethal phenotype which results from a duct cell lumen connectivity defect (Stone et al.,

2009). The lumen connectivity defect in lpr-1 was observed with a TEM analysis

performed on the 3-fold stage lpr-1 mutants, therefore it is currently unknown if the

lumen is initially normal like in let-4 at the 1.5-fold stage. In the lpr-1 3-fold TEM

analysis, though the duct cell was still in contact with the pore cell, in contrast to the let-4

mutant, in which the two cells were no longer connected. As a secreted protein, lpr-1

may play a role in the secretory pathway. Alternatively, LPR-1 could be secreted, and

interact with the ECM of the duct cell. LPR-1 could even be a ligand of LET-4.

Leucine-rich repeats interact with a variety of targets, including secreted ligands (Kobe

and Deisenhofer, 1994, Bella et al., 2008, Kawai et al., 2011). To look for evidence of

let-4 and lpr-1 interaction, I analyzed the timing of fluid accumulation in lpr-1(cs73) I;

let-4(mn105) X double mutants. If let-4 and lpr-1 were involved in the same pathway, an

earlier defect may have occurred in these double mutants, but I found no enhancement of

the onset of the first visible distortion in the excretory system (Table 4.1). This was not

112

an exhaustive analysis, but I have determined that the lumen defects don‟t result in an

earlier phenotype. Given the common appearance of the first fluid distortion visible it in

the late 3-fold stage, it may be that this is the time at which the excretory system starts to

function, and thus the first time fluid passes through the excretory system. A better

comparison between the luminal defects will require further TEM of lpr-1 mutant

embryos.

Although the above experiments did not detect an interaction, lipocalins remain a

tempting candidate for LET-4 ligands. To further explore the potential of lipocalins to

have a role in excretory system development, RNAi knockdown of other C. elegans

lipocalin proteins was performed in wild-type and lpr-1 background. We used the

temperature sensitive allele of lpr-1(h276) for this analysis. We performed a feeding

RNAi experiment with lpr-2, lpr-3, lpr-4, lpr-5, lpr-6 and lpr-7. None of the lipocalins

produced significant embryonic or larval lethality in wild-type RNAi-treated worms, and

none of the lipocalins strongly enhanced the lpr-1 phenotype. (Table 4.2) This data is not

conclusive, however, because RNAi is known to have variable levels of efficacy, and

seems to be particularly weak in the excretory system based on experiments performed in

our lab.

To identify proteins and pathways interacting with let-4, I tested several genes for

a genetic interaction with let-4. The embryonic defect which results from let-4 RNAi in a

sym-1 background is similar to reported embryonic phenotypes for junctional and

cytoskeletal mutants (Costa et al., 1998, Koppen et al., 2001, Bosher et al., 2003, Woo et

al., 2004, Totong et al., 2007), therefore, I chose candidates for the genetic interactions

113

that were junctional and cytoskeletal components. Many of the alleles tested produce a

homozygous lethal phenotype. For this analysis, trans-heterozygotes of let-4 and a

candidate allele were generated, and the rate of embryonic plus larval lethality in the next

generation was measured. The expectation is if let-4 and the candidate had a strong

genetic interaction, the rate of lethality would be greater than the additive lethality of two

homozygous genes. If both genes were involved in the same pathway, decreasing the

levels of both genes in the trans-heterozygote could lead to increased lethality. For all the

candidates tested, no enhancement of let-4 embryonic and larval lethality was observed

(Fig. 4.2). However, no increased lethality was observed in sym-1 or mec-8 in the trans-

heterozygote experiment, even though it has been established that RNAi produces an

interaction between let-4 and these two genes (Davies et al., 1999). This suggests that the

trans-heterozygote genetic interaction is not a sensitive assay, or let-4 is not sensitive to

genetic reduction. Below, I list in more detail of the reasoning for choosing specific

candidates for genetic interaction experiments.

mec-8 and sym-1 were chosen because they were previously shown to have

genetic interactions with let-4 (Davies et al,1999, this work). Also, sym-1 is an eLLRon

protein. egg-6 was chosen because it, too is an eLLRon, and because of the similar

phenotype to let-4. We chose hmr-1, the worm homolog of E-cadherin because this

protein is a widely expressed epithelial junctional protein, and has a role in maintaining

epidermal integrity during embryonic elongation (Costa et al., 1998).

The worm‟s protective outer aECM, the cuticle, is made of collagen, and

therefore let-4 could be affecting the ECM by binding collagen. Choosing candidate

114

collagens is a difficult task, because there are about 170 predicted cuticle collagens in C.

elegans, and many are not well-studied (Page and Johnstone, 2007). For this analysis, I

choose to look for a genetic interaction between let-4 and cuticle collagen sqt-3. Of the

characterized collagens, many are known to only be expressed in later larval stages and

adulthood. SQT-3 is the collagen with the earliest reported expression, and earliest

reported phenotype: 2-fold arrest (Novelli et al., 2006).

Defects in the epidermal cells could be a result of a weakened cytoskeleton due to

actin disorganization. To explore genetic interactions between let-4 and actin

components, I performed genetic interaction experiments with act-5, rho-1 and arx-5. C.

elegans has five actin proteins; act-5::GFP has been found to be expressed in the

excretory system and the intestine. In the intestine, it has been reported to be apically

localized (MacQueen et al., 2005), therefore I chose it as a candidate. I chose arx-5

because it produces a necessary subunit of the Arp2/3 complex, which nucleates actin

branching. Depletion of some Arp-2/3 components by RNAi results in enlarged luminal

width, apical accumulation of junctional proteins, and decreased F-actin levels in the

intestine (Bernadskaya et al., 2011). Another gene chosen for this analysis, rho-1, is a

GTPase. It is ubiquitiously expressed, regulates Arp-2/3, and has been associated with

polarity protein localization and actin contractility defects (Schonegg and Hyman 2006;

Motegi and Sugimoto 2006).

I looked for a genetic interaction in two genes coding for proteins that anchor the

cytoskeleton to the apical face of epithelial cells: sma-1 and erm-1. sma-1 is the C.

elegans ortholog of Drosophila βHspectrin. βHspectrin is required for actin organization

115

and cell adhesion in Drosophila. SMA-1 localizes to the apical face of elongating

epithelial cells, and is responsible for actin organization. It is expressed in the canal cell

(McKeown et al.., 1998) and other epithelial cells (Praitis et al., 2005). In sma-1 mutants,

actin is not associated with the apical cell membrane. ERM-1 is an apical protein

affecting junction remodeling in epithelial cells, and is expressed in the canal cell. Ezrin-

radixin-moesin protiens are membrane-cytoskeletal linkers. Perturbation of erm-1 results

in disordered F-actin and then mislocalization of junctions (van Furden et al., 2004;

Gobel et al., 2004).

Epithelial cells are anchored to the basal ECM through transmembrane integrins,

which are anchored to laminins in the basement membrane (Hynes et al., 2009). The

LRR of PKD1 has been shown to interact with ECM components such as collagen,

fibronectin, and laminin in vitro (Malhas et al., 2002). Therefore, we chose intergins and

a laminin as candidates for genetic interaction. C. elegans genes pat-2 and pat-3 are

integrins. (Williams and Waterston, 1994) Depletion of pat-2 pat-3 and talin results in

muscle actin to be disorganized. (Gettner et al., 1995, Lee et al., 2001). The single

laminin-β gene is lam-1 (Kao et al., 2006). Each laminin molecule consists of a β-

subunit, therefore loss of LAM-1 should affect all laminin molecules. RNAi against lam-

1 results in some early embryonic arrest, some post-elongation arrest, and a weak loss of

function allele gives wild-type worms with „unc‟ movement defects.

Because of its roles in junctional maintenance, we chose to test the C. elegans

spektraplakin locus, VAB-10. VAB-10 codes for two isoforms: VAB-10A and VAB-

116

10B; loss of either results in elongation defects. VAB-10A localizes to the

hemidesmosomes, and is associated with intermediate filaments, while VAB-10B

associates with actin (Bosher et al., 2003). This was an enticing candidate for a LET-4-

interacting protein because it has roles in junctional maintenance, and a homolog has a

role in the lumen of unicellular tubes. The Drosophila spektraplakin, short stop, is

required for the proper formation of the lumen of the unicellular terminal cells in the

Drosophila trachea (B. Levi Thesis, 2006). Therefore, I pursued the possibility of an

interaction further, and injected let-4 RNAi into vab-10 mutants (Figure 4.2). However,

like the other genes listed above, there was no genetic interaction detected.

A gene that became interesting to our lab because of its similar phenotype to let- 4

is let-653. let-653 mutants have fluid accumulation in the excretory system, and die as

L1 larvae (Jones and Baille 1995, Buechner et al., 1999). LET-653 is a secreted mucin.

Mucins are glycosylated proteins that contribute to the apical extracellular matrix. LET-

653 is also a ZP-domain containing protein. In Drosophila ZP domain mutants, both

apical ECM attachment and microtubule organization are affected. (Bokel et al., 2005).

The let-653 loss of function phenotype, expression pattern and predicted localization

make it a candidate for a LET-4 interacting protein. To explore this possibility, we tested

LET-4 and LET-653 for a genetic interaction. We treated wild-type worms with let-653

and let-4 RNAi. We detected no enhancement of embryonic or larval lethality (Table

4.3). Surprisingly, we saw an egg-laying defect. The majority of let-653 and let-4

RNAi-treated worms that grow to adulthood die with the „bag-of-worms‟ defect. let-653

or let-4 RNAi treatment alone produced no bagged worms. This phenotype is similar to

117

the phenotype observed in let-4 mutants that survived to adulthood (discussed further

below). This result supports an interaction between these two proteins, although it was

not detected in the excretory system. Experiments in our lab have found repeatedly that

the excretory system may be resistant to RNAi, therefore this experiment hasn‟t ruled out

an interaction between these two proteins in the excretory system. The excretory system

defect and the fact that mucins are part of the apical ECM make let-653 a tempting

candidate for a let-4-interacting protein. The role of let-653 in the excretory system, its

localization, and its potential to interact with eLLRons is being investigated in our lab.

How is the ECM affected in let-4 mutants?

What is the molecular reason for the inner eggshell layer being detached? In let-4

mutants, I observed a detached inner eggshell at the 1.5-fold stage, and a detached cuticle

in the duct cell in the worms with a distorted lumen. Could these phenotypes be related?

In both cases, the ECM is too far removed from the apical surface of epithelial cells

which normally express LET-4. LET-4 may play a role in anchoring the ECM to the

apical face of epithelial cells, or LET-4 could provide stability to the structure of the

ECM. My structure/function analysis of LET-4 (Chapter 2) has determined that a form

of the protein without a transmembrane domain can partially rescue the let-4 defect,

favoring the model that LET-4 provides stability, and is not directly anchoring the ECM

to the membrane. Although these phenotypes are similar, the result of each is very

different. The excretory system phenotype is associated with a catastrophic failure of the

excretory system, while the detached inner eggshell layer phenotype does not result in

118

failure to elongate. In order to further explore this possibility, the actual role of LET-4 in

the ECM needs to be investigated by identifying proteins interacting with LET-4.

What is the significance of the let-4 escaper phenotypes?

A small percentage of let-4(mn105) mutants survive the embryonic and L1 larval

stage, and are referred to as „escapers.‟ These individuals were found to have a variety of

non-lethal phenotypes, including phasmid dye-filling defect, an egg-laying defect, and

mildly uncoordinated movement.

The phasmid is a sensory structure consisting of neurons and associated tubular

glial cells. A dye-filling defect suggests a problem with epithelial glial cells associated

with the neurons, the sheath and socket cells (Perens and Shaham, 2005; Inglis et al.,

2006; Stone et al., 2009). Intriguingly, the socket cells are unicellular tubes, like the

tubes of the excretory system. The nature of apical ECM in these cells is uninvestigated,

but is it possible that LET-4 is required for interaction between the socket and or sheath

cells and their apical extracellular matrix.

The let-4 egg laying defect results in adult worms which are unable to lay eggs

before they hatch. As a result, the eggs hatch while still in the mother. A classic cause of

this „bag-of-worms‟ phenotype is vulval defects (Horvitz and Sulston, 1980). The vulva

is a tubular epithelial structure, in which LET-4 and EGG-6 localize apically. To

investigate the bag-of-worms defect, I performed a closer analysis of the vulva in let-4

escaper worms. The general morphology of the vulva appeared normal through the “X-

mas tree stage” of the L4 larva. This analysis was performed with DIC microscopy. To

investigate the junctions of the vulva in let-4 mutants, I looked at AJM-1::GFP, and it

119

appeared normal (data not shown). The vulva, therefore, does not have major polarity or

junctional defects. This phenotype could also be the result of muscle defects, although

the LET-4::GFP localization was enriched where epithelial cells were not in contact with

muscles. The vulva is lined by cuticle; therefore LET-4 may have a role in the

organization of the epithelial cells of the vulva and the ECM, though no obvious defects

were observed. The cause of the egg-laying defect needs further investigation to be fully

understood.

Intriguingly, the let-4 escaper phenotypes described here could be the result of

neuronal defects. Phasmid dye-filling could be the result of phasmid neuron defects. An

egg-laying defect could be the result of defects in muscle defects, or neuronal defects.

Egg-laying is ceased with the ablation of some vulval muscles and egg-laying is

influenced by environmental cues, which are mediated by neurons (Schafer, 2006).

Uncoordinated movement, another escaper phenotype, is also often the result of neuronal

defects (Bastiani and Mendel, 2006). I have presented no evidence for expression or

function of LET-4 in C. elegans neurons, however, the fact that there are roles for other

eLLRon proteins in neurons (described above) and the indirect evidence in the let-4

escaper phenotypes hints at a role in neurons.

Why is the apical domain of the canal cell so different from the duct and pore cells?

There are several differences between the apical domain of the canal cell and the

duct and pore. The canal cell has different cytoskeletal components than the duct and

120

pore. Second, the cuticle lines the duct and pore, not the canal. Third, the duct and pore

form by wrapping around and forming an autojunction, while the canal cell has never

been observed to form autojunctions. Fourth, PKC-3 and PAR-6 line the entire lumen of

the duct and pore, but are more restricted in the canal cell. The canal cell localization of

PAR-6::GFP and PKC-3 is particularly interesting. At the 1.5-fold stage, when the lumen

of the canal cell is localized in the main cell body, both proteins were localized apically.

As the lumen of the canal cell extended as the worm progressed through 2-fold and into

3-fold, the area of PAR protein localization did not change (Appendix 1). The result is

that both proteins are localized apically, but only in the part of the canal cell lumen

immediately adjacent to the secretory junction. The PAR complex proteins may be

required to “seed” the apical surface of the canal cell, but are not required along the

apical luminal face as it expands during the maturation of the canal cell. Fifth, LET-

4::GFP lines the apical lumen of the duct and pore, but not the canal cell. LET-4::GFP

lines the basal side of the canal cell in 1.5-fold stage (Chapter 2 and Appendix 2). Sixth,

HMR-1::GFP/E-cadherin reporter is present in the duct and pore, not the canal (Appendix

1). Why are these two types of lumen so different? They are known to have a different

mechanism of formation; they also likely have different functions. The canal cell is a

specialized cell which collects fluid, as plays a role in the worm‟s osmoregulation

(Nelson and Riddle 1984, Buechner, 1999). The duct and pore may serve to simply

transport the fluid produced by the canal cell, and not have the same secretory functions

as the canal cell, so a very different extracellular matrix may be required in the duct and

pore. Regardless of the reason for the differences in apical surfaces and ECMs, the

121

differences in these types of lumen only enhances the value of careful dissection of the

steps of formation and maintenance of the excretory system.

In summary, identification of more components of the apical ECM will allow us

to better understand the role of LET-4. Closer investigation of LET-4 and the other

eLLRons will offer insights into the role of this poorly understood gene family.

122

Materials and Methods

Alleles used were:

I: mec-8(u218) (Chalfie and Au, 1989), egg-6(ok1506) (Moerman and Barstead, 2008),

hmr-1(zu248) (Costa et al, 1998), vab-10(ok817) (Moerman and Barstead, 2008), vab-

10A(e698) (Hodgkin, 1983), vab-10B(mc44) (Bosher et al, 2003), erm-1(tm677) (Gobel

et al 2004), lpr-1(cs73) (Stone et al, 2009).

III: act-5(ok1397) (Moerman and Barstead, 2008), arx-5(ok1990) (Moerman and

Barstead, 2008), pat-2(ok2148)(Moerman and Barstead, 2008), pat-3(st564) (Williams

and Waterston, 1994).

IV: rho-1(ok2418) (Moerman and Barstead, 2008), let-653(s1733) (Clark and Baille

1992), lam-1(ok3139) (Moerman and Barstead, 2008),

X: let-4(mn105) (Meneely and Herman, 1979), sym-1(mn601) (Davies, et al 1999)

V: sqt-3(sc63) (Cox et al, 1980), sma-1(e30) (Brenner, 1974)

Transgenes used were:

jcIs1 (AJM-1::GFP) (Koppen et al., 2001)

Microscopy

Microscopy for analysis of let-4 vulvas was performed as described in Chapter 2

Materials and Methods.

123

RNAi

For RNAi injection experiments, let-4 dsRNA was generated and injected into adults as

described in Chapter 2 Materials and Methods. F1 pulse lays were performed, and

lethality was quantitated. For feeding RNAi experiments, L4 adults were exposed to

RNAi-expressing clones. Pulse lays were performed on the first day of adulthood.

Percent survival was defined as the proportion of embryos that reached L4 stage. Percent

embryonic lethal was the proportion of embryos that never hatched. Percent larval

lethality was the proportion of embryos that died as L1s.

124

Table 4.1 – let-4; lpr-1 double mutant phenotype

% of embryos with fluid in canal

cell body

Genotype

comma +

4hrs (n)

comma +

5hrs (n)

comma

+6hrs (n)

lpr-1(cs73) I; let-4(mn105);unc-3(e151)

X 0% (9) 18% (11) 64% (11)

lpr-1(cs73) I; let-4(mn105); unc-3(e151)

X; C44H4 0% (23) 8% (12) 86% (7)

125

Table 4.2- RNAi knockdown of worm lipocalins does not result in larval lethality

Genotype RNAi

eggs

(n) embryonic lethal L1 lethal survival

N2 GFP 155 1% 0% 99%

N2 T12A7.5/lpr-2 59 0% 0% 100%

N2 W04G3.8/lpr-3 101 0% 0% 100%

N2 W04G3.3/lpr-4 86 3% 0% 97%

N2 W04G3.2/lpr-5 227 0% 0% 100%

N2 W04G3.1/lpr-6 92 1% 0% 99%

N2 T19D7.3/lpr-7 216 0% 0% 100%

lpr-1(h276) GFP 132 10% 64% 27%

lpr-1(h276) T12A7.5/lpr-2 82 0% 68% 32%

lpr-1(h276) W04G3.8/lpr-3 141 19% 43% 38%

lpr-1(h276) W04G3.3/lpr-4 144 24% 66% 10%

lpr-1(h276) W04G3.2/lpr-5 111 4% 72% 24%

lpr-1(h276) W04G3.1/ lpr-6 96 0% 76% 24%

lpr-1(h276) T19D7.3/lpr-7 219 10% 56% 35%

126

Table 4.3 – let-4 and let-653 RNAi

Gentoype RNAi* n

embryonic

lethal

L1

lethal

Survival

(L4)

% of adults

with bag-of-

worms

phenotype

+ let-653 169 5% 0% 95 0%

+ let-4 82 12% 0% 88 0%

+ let-653 + let-4 116 18% 1% 81 59%

*Worms were exposed to let-653 dsRNA by feeding, and let-4 dsRNA by injection

127

Figure Legends

Figure 4.1. Three models for destabilization of the apical ECM leading to junction

breakage. (A) In the absence of LET-4, the apical ECM is destabilized, and the junction

proteins (blue) are subjected to increased force (red arrows). (B) In the absence of LET-

4, the apical ECM does not function to assist in ligand binding for an unknown signaling

pathway, which weakens junctions. (C) In the absence of LET-4, components of the

apical ECM fail to localize correctly and stabilize junctional proteins.

Figure 4.2. Summary of let-4 genetic interaction data. For each gene, single

heterozygous worms and worms also heterozygous for let-4 were generated, and their

progeny were phenotyped. Combined embryonic and larval lethality in the F1 generation

is depicted. Worms heterozygous for let-4 alone gave 22% lethality in the F1s. No genes

had a strong interaction with let-4 in this experiment. let-4 dsRNA was injected into

wild-type, sym-1, mec-8 and vab-10A homozygotes, and vab-10B heterozygotes. RNAi

experiments were not performed in the other mutants. Red line indicates 44%, which is

expected lethality in the case of purely additive lethality.

128

A

B

C

wild-type let-4

wild-type let-4

wild-type let-4

Figure 4.1

129

0

20

40

60

80

100

let-4 RNAi

let-4 trans-heterozygote

heterozygote

vab-10/spectra

plakin

sma-1/β

-H sp

ectrin

erm-1/cyto

skeletal li

nker

hmr-1/ca

dherin

lam-1/laminin

pat-3/β

-integrin

pat-2/α

-integrin

arx-5/Arp

2/3 su

bunit

rho-1/R

ho GTPase

act-5/actin

sqt-3

/colla

gen

egg-6/LRR protein

let-653/m

ucin

vab-10B/spectra

plakin

vab-10A/spectra

plakin

mec-8/R

RM

sym-1/LRR pro

teinlet-4

wild-ty

pe

let-4 genetic interactions

%le

thal

ity

Figure 4.2

130

Appendix 1

Characterization of apical and cytoskeletal markers in the

C. elegans excretory system.

131

Introduction

Simple genetically tractable model organisms such as C. elegans and Drosophila

have been instrumental in defining factors important for apical vs. basal specification and

proper development and maintenance of epithelial tubes. We aim to exploit the C.

elegans excretory system to continue to investigate these processes.

The C. elegans excretory system is a simple tubular organ that consists of just

three tandem unicellular tubes: the canal cell, the duct cell, and the pore cell. These

three tubes are morphologically distinct and form lumen via different processes. The

duct and pore cells form by a wrapping around mechanism in which the cells form

autocellular junctions, and the inside face of the cell adopt apical characteristics. The

duct cell then auto-fuses to dissolve its autocellular junction, while in the pore cell, the

autocellular junction remains. The canal cell forms lumen intracellularly at the site of the

duct-canal cell junction, apparently through a vesicular trafficking mechanism, and does

not possess an autocellular junction. These initial steps of tubulogenesis are complete by

the 1.5-fold stage of embryogenesis. During the latter part of embryogenesis, all three

cells elongate and undergo morphological changes to adopt their unique sizes and shapes.

The excretory system, therefore, is a simple system to study lumen formation, growth and

maintenance.

As described in Chapter 1, many epithelia are characterized by apical localization

of PAR complex proteins and the cadherin/catenin complex. Thus far, little is known

about the molecular components required for the formation and maintenance of the

excretory system. In this appendix, I describe the characterization of some conserved

132

apical factors in the excretory system. After the initial characterization of these markers,

I studied many of these factors in let-4 mutants, to look for defects.

Results

PAR protein localization in the excretory system

PAR-3, PAR-6 and atypical Protein Kinase C (PKC) are key regulators of

epithelial polarity and junction assembly, and they typically localize to the most apical

regions of epithelial cells. I investigated the localization of these proteins in the 1.5-fold

and 3-fold excretory system (Fig. Ap1.1). In the excretory system, I found that PAR-3 co-

localized with the apical junction markers AJM-1 and DLG-1/Discs Large at intercellular

junctions between the canal, duct and pore cells and along the pore autocellular junction

(Fig. Ap1.1A,F). PKC-3 lined the entire lumen of the duct and pore, and extended only a

short distance into the canal cell body. At the 1.5-fold stage, PKC-3 appeared to be in the

lumen of the canal cell, but as seen in 3-fold stage, the canals of the canal cell were not

lined with PKC-3 (Fig Ap1.1 C,H). PAR-6::GFP showed a localization pattern similar

to PKC-3 (Fig. Ap1.1E,J) PKC-3 and PAR-6 were not enriched at the junctions between

the cells of the excretory system. Thus, the apical domains of the canal cell vs. the duct

and pore have different molecular constituents, likely reflecting different mechanisms of

lumen and apical ECM formation and maintenance.

In let-4(mn105) mutants, the localization of PAR-3 (Fig. Ap1.1B,G) and PKC-

3(Fig. Ap1.1D,I) did not change. PAR-6::GFP localization was not studied in the let-4

background.

133

E-Cadherin and p120 catenin localization in the excretory system

To characterize the localization of the C. elegans E-cadherin homolog in the

excretory system, we used HMR-1::GFP and JAC-1::GFP reporters. HMR-1 is the worm

homolog of E-cadherin and JAC-1 is the worm homolog of cadherin/catenin complex

regulator p120 catenin (Pettit et al., 2003). Both these reporters displayed a strong signal

in the duct in early 3-fold, which degrades over the course of 3-fold. (Fig. Ap1.2) To

quantify the fading signal, individuals at different developmental stages were phenotyped

and placed into one of three categories describing duct cell expression of the GFP fusion

protein: ‘Strong,’ ‘Faint,’ or ‘Absent.’ (Fig. Ap1.2) For both reporters, the largest

category was Strong at the beginning of 3-fold (1.5-fold + 4 hrs). At the end of 3-fold

stage (1.5-fold + 8hrs), most embryos were Faint, and a large proportion were Absent.

Almost all worms fell into the Absent category in late larval stages.

HMR-1::GFP expression categories are as follows: in Strong individuals, the

expression is even along the length of the pore and duct lumen. Based on the shape of

the GFP signal, the whole duct cell cytoplasm was not labeled, only the apical face of the

cell, lining the lumen. In the Faint category, the signal in the duct contained gaps.

Finally, in individuals labeled Absent, the signal in the pore and secretory (duct-canal)

junction was still strong, but the signal was absent from the duct.

For JAC-1::GFP expression, ‘Strong’ individuals had the GFP signal in the duct

cell, and the signal was enriched at junctions. ‘Faint’ individuals had much more faint

expression in the duct, and ‘Absent’ individuals had no GFP in the duct. JAC-1::GFP

134

expression was not significantly affected in let-4(mn105) individuals. (In let-4, 30%

strong, 70% faint, n=20)

Cytoskeletal and Extracellular Matrix markers in the excretory system

I performed some preliminary studies of F-actin in the excretory system in 1.5-

fold and 3-fold wild-type embryos (Fig. Ap1.3E-H). In 4/4 1.5-fold embryos analyzed,

F-actin was visible in the canal cell and pore. In the duct cell, the F-actin was strong in

2/4 embryos, in one it was very faint in the duct, and in one it appeared broken up and

faint. Based on the pattern, the lumen of the canal cell had F-actin at the 1.5-fold stage.

Later in development, F-actin staining only appeared at junctions in the excretory system

in 3-fold and L1 worms (Fig. Ap1.3I,J). These data may suggest that F-actin is present at

the initial formation of the lumen, but is absent by the time the excretory system has

matured. Alternatively, phalloidin staining may not be efficient in these cells at the 3-

fold stage. To better analyze the timing of the F-actin pattern in the excretory system,

further experiments should be performed.

Proper Drosophila trachea development requires a temporary chitin scaffold

(Devine et al., 2005; Moussian et al., 2006). Could the excretory system have a similar

structure? To investigate this possibility, we stained for chitin, which had previously

been reported to be in the eggshell and adult pharynx (Zhang et al., 2005). To visualize

chitin, we stained embryos with Chitin Binding Protein (CBP) and MH27 (Fig. Ap1.4.i).

MH27 (anti-AJM-1) was used to mark the junctions of the excretory system. We

135

observed chitin staining in the eggshell, but no staining anywhere else in the embryo,

including the excretory system, in both 1.5-fold and 3-fold embryos (Fig. Ap1.4.i).

RNAi knockdown of a chitin sythaase results in L1 arrest, suggesting that chitin is

important in the pharynx early in development (Zhang et al., 2005). Because chitin was

not detected, either chitin is not present until after 3-fold, or it is, and this reagent is not

staining chitin in the pharynx at this early stage.

After finding no CBP staining in the excretory system, we tried a less stringent

reagent, Wheat Germ Agglutinin (WGA). WGA is a carbohydrate-binding protein that

binds some sugar residues found on cell membranes. In C. elegans, it has been reported

to stain the canal cell in adults (Hedgecock et al., 1990). We stained 1.5-fold and 3-fold

stage embryos to look for WGA-epitope staining in the cells of the excretory system. To

visualize the cells of the excretory system, we co-stained with MH27 to label the

junctions of the excretory system. In both 1.5-fold, and 3-fold embryos, WGA stained

the pharynx, but did not appear enriched at the junctions of the excretory system, or in the

duct and pore lumens, although non-specific staining was observed throughout the

embryo (Fig Ap1.4.ii).

Apical junction, intermediate filament (IF) and F-actin organization in the

epidermis

To further analyze the junctions of the epithelial cells in let-4 RNAi-treated sym-

1(mn601) embryos, MH27 (anti-AJM-1) and MH4 (anti-IF) staining were performed

136

(Fig. Ap1.5). At the 1.5-fold stage, MH27 and MH4 patterns are not affected in the

hypodermis in let-4 mutants, indicating that the elongation defect is not the results of the

failure of localization of these junctional components. (Fig. Ap1.5.i A,B and Fig. Ap1.5.ii

A,B). At the 3-fold stage, MH27 staining looked normal, but the intermediate filaments

are mildly disorganized, and the region to where IFs are localized is expanded (Fig.

Ap1.5.i A,B and Fig. Ap1.5.ii A,B). Because these embryos are ruptured in late 3-fold,

the IF effects may be a secondary consequence of the rupture. Also, the MH4 antibody

recognizes only a subset of intermediate filaments (Francis and Waterston, 1991),

therefore some IFs may be affected in these mutant embryos.

let-4 RNAi treatment of sym-1(mn601) embryos produced embryonic elongation

defects, as described in Chapter 2 (Fig. 2.5). To further investigate this phenotype, we

used phalloidin to stain for F-actin in the epidermal cells (Fig. Ap1.3A-D). The pattern

doesn’t appear to change in the 1.5-fold epidermal cells in the treated v. untreated sym-

1(mn601) embryos. In 3-fold epidermal cells, there are gaps in the circumferential

filament bundles (CFB) in let-4 RNAi-treated embryos (Fig. Ap1.3 D). These gaps

appear after rupture of these embryos, so the gaps may be a secondary consequence of the

rupture.

Cell type specific markers in the excretory system

To confirm correct fate specification and positioning of the cells of the excretory

system, several molecular markers were analyzed. Canal, duct, and pore markers appear

137

wild-type in let-4 mutants (Fig. Ap1.6, Table Ap1.1). vha-1::GFP, which labels the canal

cell is expressed normally in let-4 mutants (Fig. Ap1.6B-C), and allowed visualization of

the excretory canals, which revealed that the canals extend normally before massive fluid

accumulation distorts the canals. HMP-1/α-catenin::GFP, which labels the duct and pore

cells, were both unaffected in let-4(mn105) mutants, indicating that the cells were the

correct shape, and positioned correctly. (Fig. Ap1.6D-E).

let-4 mutants have a phasmid dye-filling defect

Because of the defects observed in the duct cell of let-4 mutants, we investigated

the possibility of defects in other tubular epithelia. Another duct lumen connectivity

mutant, lpr-1, has been demonstrated to have a phasmid dye-filling defect (Stone et al,

2009). Phasmid dye-filling defect could indicate defects in the tubular socket or sheath

cells surrounding the phasmid neurons (Perens and Shaham, 2005). To investigate

phasmid dye uptake in let-4 mutants, rare L4 let-4(mn105) escaper worms were exposed

to DiO. let-4 mutants were found to have a dye-filling defect, suggesting a defect in the

phasmid neurons themselves, or in the tubular glial cells surrounding the neurons (Fig.

Ap1.6 A).

Discussion

The tubular cells of the excretory system share apical characteristics of other

epithelial cells. These data have illustrated that the cells of the excretory system contain

138

the PAR proteins, indicative of conserved apical character. For further discussion of the

apical character of the duct, pore, and canal cell, see Chapter 4.

These experiments have demonstrated that in let-4 mutants, these apical markers

and junctions are unaffected at the resolution of this analysis. Thus, let-4 is not

responsible for fate specification or apical specification of the epithelial cells of the

excretory system or hypodermis.

Materials and Methods

Alleles used were: X: let-4(mn105), sym-1(mn601).

Transgenes used were: csEx146 (lin-48p:mCherry) (Abdus-Saboor et al., 2011), fgEx11

(ERM-1::GFP) (Gobel et al, 2004), jcIs1 (AJM-1::GFP) (Koppen et al., 2001), mcIs46

(DLG-1::RFP) (Diogon et al., 2007), qnEx59 (dct-5p::mCherry) (Abdus-Saboor et al.,

2011), saIs14 (lin-48p::GFP) (Johnson et al., 2001), xnIs96 (HMR-1::GFP) (Achilleos et

al., 2010), vha-1p::GFP (Oka et al., 1997), jcIs25(jac-1::GFP) Pettitt et al 2003, HMP-

1::GFP (Hardin Lab), xnIs3[par-6p::PAR-6::GFP; unc-119(+)] (Anderson et al, 2008)

Microscopy

Microscopy was performed as described in Chapter 2 Materials and Methods

Phasmid dye uptake assay

139

L4 let-4(mn105) worms were placed in 2mg/mL DiO (1:200 in M9) for 2 hours, then

allowed to recover on NGM plates for one hour before being mounted to a slide for

microscopy.

Immunostaining

Embryos were collected by bleaching gravid adult worms. The recovered

embryos were then allowed to incubate at room temperature to allow the eggs to reach

the desired developmental stage. The embryos were permeabilized by freeze-cracking

and fixed in methanol as described in Leung et al 1999 and Appendix 4. Primary

antibody concentrations used were: P4A1 (mouse anti-PAR-3) (1:25) (Obtained from the

DSHB); goat anti-GFP (1:50) (Rockland Immunochemicals), rat anti-PKC-3 (1:150)

(Tabuse et al 1998), mouse anti-IF (MH4) (1:50) (Francis and Waterston, 1991, Obtained

from the DSHB), mouse anti-AJM-1 (MH27) (1:100) (Obtained from the DSHB).

Secondary antibodies: Cy3 donkey anti-mouse (1:200); FITC donkey anti-goat (1:50)

(Jackson Immunoresearch) Cy3 donkey anti-rabbit (Jackson Immunoresearch) Cy3

donkey anti-rat (PKC-3) (1:200), FITC goat a-mouse (1:20). For Chitin staining, NEB

Chitin Binding Protein (NEB P5211S) (1:500 dilution) was used, and for WGA staining

WGA Texas-Red-conj (Molecular Probes W21405) (100mg/µL). No secondary antibody

was required for CBP and WGA staining.

140

Phalloidin Staining

Gravid adults were bleached, the embryos were collected and incubated in M9 for 5 hrs

to enrich for 3-fold stage. Freeze crack permeabilization was performed as described in

Appendix 4. Embryos were fixed [75%methanol, 3.7% paraformaldehyde, 1:200

phalloidin stock solution (1mg/mL of AlexaFluor 488 or 546 (Molecular Probes)in PBS)

for 30 minutes at -20°C, followed by 2x10min PBS-T(PBS + 0.1% Tween 20) wash, then

phalloidin stain (1:200) 1hr at room temperature, another 2x10min PBS-T wash, then

mounted on slides for visualization. (Protocol modified from van Furden, et al 2004.)

Acknowledgements

Thank you to Bossinger Lab for providing rabbit anti-DLG-1, the Kemphues Lab for

providing rat anti-PKC-3. The P4A1(PAR-3), MH27 and MH4 supernatants developed

by Francis and Waterston and were obtained from the Developmental Studies Hybridoma

Bank developed under the auspices of the NICHD and maintained by The University of

Iowa, Department of Biology, Iowa City, IA 52242.

141

Table Ap1.1 Excretory System markers appear normal in let-4 mutants

Marker Features Labeled by Marker Stage

% let-4(mn105) animals with wild-type marker pattern (n) let-4 marker comments

vha-1::GFP canal cell L1 100% (22)

Canal processes are fully extended in 3-fold, but are truncated and cystic in L1

ERM-1::GFP canal cell Late 3-fold 100% (40)

Canal processes are fully extended in 3-fold, but are truncated and cystic in L1

lin-48 duct cell L1 100% (30)

Duct cell expressing lin-48::GFP is present, with normal morphology

AJM-1::GFP

pore juncitons, duct/canal junction

Early 3-fold 100% (24)

Junctions between cells appear normal

HMP-1::GFP duct cell, pore cell Early 3-fold 100% (16)

Duct process extends to pore cell, shape and position of pore is normal

*All let-4 mutants were non-transgenics from let-4(mn105); csEx173[C44H4; sur-5::GFP] mothers

142

Figure Legends

Figure Ap1.1. The PAR complex proteins are present in the cells of the excretory

system.

PAR-3 overlaps with DLG-1 staining in wild type at 1.5-fold (A) and 3-fold (F); pattern

is unaffected in let-4(mn105) mutants at both 1.5-fold(B) and 3-fold(G).

PKC-3 staining extends through the pore, duct, and into the canal cell lumen in both the

1.5-fold (C) and 3-fold (H) excretory system; the pattern is unaffected in let-4 mutants at

1.5-fold (D) and 3-fold (I) stage. n numbers = ( number of embryos with the illustrated

pattern)/(number of embryos analyzed).

PAR-6::GFP is present in the cells of the excretory system. Overlay (E,J) and GFP

(E’,J’) of 1.5-fold (E) and 3-fold (J) wild-type embryos expressing PAR-6::GFP. Regions

in dotted boxes in (E’, J’) are magnified in (E’’J’’). Arrow indicates estimated position

of the secretory junction, bracket indicated the duct, and arrow marks the pore cell. PAR-

6::GFP localization was not measured in let-4 mutants. n numbers indicate numbers of

embryos with the described pattern/number of embryos analyzed. Scale bars: 5µm.

Figure Ap1.2. The C. elegans E-Cadherin homolog HMR-1 and associated protein

p120 catenin (JAC-1) are localized dynamically in the duct cell.

Confocal images of GFP (A-H) and overlay with DIC (A’-H’) of the excretory system in

wild-type 3-fold embryos expressing HMR-1::GFP (A,D,G) or JAC-1::GFP (B,E,H) and

143

let-4(mn105) embryos expressing JAC-1::GFP (C,F). Dotted lines indicate canal cell

body. Scale bar: 5µm.

Throughout 3-fold, expression levels remained the same at apical junctions, while

expression of both reporters along the duct lumen was reduced (I,J). Expression of

HMR-1::GFP and JAC-1::GFP was categorized into three phenotypes: Strong, Faint, or

Absent in the duct.

HMR-1::GFP expression categories: Strong- expression is even throughout the duct

lumen (A). Faint- expression is uneven with breaks (D). Absent- GFP is visible at

apical junctions, but not along the duct cell (G).

JAC-1::GFP expression categories: Strong- expression is enriched at the junctions, but

even along the length of the duct (B). Faint- expression is faint in the duct (E). Absent-

GFP is visible in pore and secretory junction, but not the duct cell (H).

(C,F) JAC-1::GFP expression patterns were unaffected in let-4(mn105) mutants.

(I) Quantification of HMR-1::GFP in the duct cell during development

(J) Quantification of JAC-1::GFP in the duct cell during development.

Figure Ap1.3. F-actin (Phalloidin) Staining in epidermal cells and the excretory

system.

144

(A-D) F-actin is initially ordered, but later mildly disordered in the epidermis of let-

4 RNAi treated sym-1(mn601) worms. Phalloidin stains epidermal junctions, muscle

bands, and circumferential filament bundles (CFBs) of actin. Region in dotted box in

A,B,C and D are magnified in A’, B’, C’ and D’, respectively. In both untreated sym-1

(A, A’), and let-4 RNAi treated sym-1 (B, B’) pre- elongation embryos, CFBs are evenly

spaced. In B, most of the embryo is out of the plane of focus. Later, CFBs are evenly

spaced in untreated embryos (C,C’), but contain gaps in the let-4 RNAi-treated animals

(D,D’) Asterisk marks a gap between filaments.

(E-H) F-actin is present in the cells of the excretory system in wild-type 1.5-fold

embryos. E’F’G’H’ are magnified insets of E,F,G, H. Arrowhead marks estimated

position of secretory junction; bracket, duct cell; arrow, pore cell. Of the 4 embryos

stained for this analysis, phalloidin staining is strong and even in the duct in 2 (F,G) and

broken up or faint in 2 (E,H).

(I-J) F-actin is visible only in the junctions of the excretory system in wild-type 3-

fold and L1 embryos. F-actin (I,J) and AJM-1::GFP (I’,J’) of the excretory system in

the 3-fold embryo (I) and L1 larva (J). Arrowhead indicates secretory junction; bracket,

duct; arrow, pore autojunction. F-actin is stained with phalloidin, AJM-1::GFP is

visualized with anti-goat GFP. In the excretory system, phalloidin staining overlaps with

AJM-1::GFP. Scale bar: 5µm

Figure Ap1.4. Chitin and WGA epitope staining.

145

i.Chitin is only present in the eggshell at 1.5-fold and 3-fold stages. Chitin Binding

Protein (A,D) and MH27 immunostaining (B,E) in 1.5-fold (A-C) and 3-fold (D-F).

Regions in dotted boxes in (A-F) are magnified in (A’-F’). Arrowhead indicates

secretory junction, bracket duct, arrow pore autojunction. Scale bar 5µM.

ii.WGA is not enriched in the excretory system. WGA staining (A) and MH27

immunostaining (B) in 1.5-fold embryos (A-C) and L1 larvae (D-F). Regions in dotted

box in A-C are magnified in A’-C.’ Arrowhead indicates secretory junction; bracket,

duct; arrow, pore autojunction. Scale bar 5µM.

Figure AP1.5. AJM-1 and IF staining in let-4 RNAi-treated embryos

i. AJM-1, a discs large complex component, is unaffected in let-4 RNAi treated sym-

1(mn601) worms. MH27 (anti-AJM-1, green) stains a double band at the junctions of

epithelial cells. The double band results from a single band on the apical face of each of

two neighboring cells. Region in dotted box in A,B,C and D are magnified in A’, B’, C’

and D’, respectively. In both untreated (A,A’), and let-4 RNAi treated (B,B’) pre-

elongation embryos, AJM-1 is present at the apical face of adjacent cells, and localized

tightly at the apical face. AJM-1 is localized correctly at the apical face of adjacent cells

in later embryos (C,C’), also in let-4 RNAi treated embryos with epidermal lesions

(D,D’). Notice also in D, the epidermal cells outlined by AJM-1 are misshapen, not

regular and rectangular as wild-type. Scale bar =10µM.

146

ii. Intermediate Filaments (IFs) are initially ordered, but later mildly disordered in

let-4 RNAi treated sym-1(mn601) worms. MH4 (anti-IF, red in A, green in B-D) stains

epidermal cells where muscle will attach. The staining pattern is the same in both

untreated (A), and let-4 RNAi treated (B) pre- elongation embryos. Arrows indicate

staining of epithelial cells in A and B. Later, CFBs are tightly packed and evenly spaced

in wild-type (C) but are wider (brackets) and contain gaps (arrowheads) in the let-4

RNAi-treated animals (D). Scale bar =10µM

Figure Ap1.6. Further characterization of the let-4 phenotype.

(A) let-4(mn105) mutants have a dye-filling defect. Worms were exposed to DiO, and

assayed for dye uptake into phasmids. 100% of wild-type worms uptake dye into all 4

phasmids. let-4(mn105) worms show a reduced ability to uptake dye. Rate of defect is

similar to level seen for another duct cell lumen mutant, lpr-1(cs73) (lpr-1 data from

Craig Stone).

(B-E) The cells of the excretory system are present and positioned correctly in let-

4(mn105) mutants. (B-C) vha-1::GFP marks the canal cell, which initially extends canals

normally, although the cell becomes distorted in let-4 mutants (C). (D-E) HMP-1::GFP

labels the duct and pore cells. Arrow indicates estimated position of the secretory

junction, bracket indicates the duct, and arrow marks the pore cell. Pattern is unaffected

in let-4 mutants (E). Scale bar: 5µm.

147

DLG-1

DLG-1

PAR-3

PKC-3

1.5

fold

3-fo

ld

E

J

E’

J’

E’’

J’’

n=36/36

n=11/12*

C

PAR-6::GFP

PAR-6::GFP

PKC-3 DLG-1

PAR-3 DLG-1

wild-type let-4

DLG-1PAR-3

DLG-1PKC-3

PKC-3 DLG-1

PAR-3 DLG-1

A A’ A’’ B B’ B’’

C C’ C’’ D D’ D’’

G G’ G’’F F’ F’’

H H’ H’’ I I’ I’’

n=15/16 n=6/7

n=10/11 n=12/12

n=5/5

n=2/2n=12/12

n=13/13

Figure Ap1.1

148

0%

20%

40%

60%

80%

100%

1.5+4hrs (n=23) 1.5+6hrs (n=17) 1.5+8hrs (n=17) L4 (n=22)

HMR-1::GFP expression in duct cell

Absent

Faint

intermediate

Strong

0%

20%

40%

60%

80%

100%

1.5+4hrs (n=20) 1.5+6hrs (n=8) 1.5+8hrs (n=12) L4 (n=12)

JAC-1::GFP expression in duct cell

Absent

Faint

intermediate

Strong

AJ

stro

ngfa

int

abse

nt

HMR-1::GFP JAC-1::GFP

Figure Ap1.2

wild-type wild-type

wild-type

wild-typewild-type

wild-type

let-4

let-4

I

A B C

D E F

G H

A’ B’ C’

D’ E’ F’

G’ H’

149

AJM-1::GFP

AJM-1::GFP

F-actin

F-actin

Overlay

Overlay

n=5

n=9

3-fo

ldL1

~1.5

-fold

A

A’

B

B’

C

C’

D

D’sym-1(mn601) sym-1(mn601)sym-1(mn601) +let-4 RNAi sym-1(mn601) +let-4 RNAin=2 n=2 n=8 n=6

E F G H

E’ F’ G’ H’

I I’ I’’

J J’ J’’

*

F-actin

F-actin

Figure Ap1.3

150

L1

~1.5

-fold

B

B’

A

A’

C

C’

ED F

MH27

MH27

MH27WGA

WGA

WGA Overlay

Overlay

Overlay

i.

A

A’

B

B’

C

C’

D

D’

E

E’

F

F’

ii.

Overlay

Overlay

Overlay

Overlay

Chitin MH27

Chitin MH27

Chitin MH27

Chitin MH27

3-fo

ld~1

.5-fo

ld n=2

n=9 n=20

n=2

Figure Ap1.4

151

A

A’

B

B’

C

C’

D

D’

Pre

-elo

ngat

ion

Elo

ngat

ed

i

n=6 n=6

n=9 n=15

sym-1(mn601)

sym-1(mn601)

sym-1(mn601) +let-4 RNAi

sym-1(mn601) +let-4 RNAi

MH27 MH4

A B

C D

ii

n=3 n=2

n=8 n=4

Pre

-elo

ngat

ion

Elo

ngat

ed

Figure Ap1.5

152

0%

20%

40%

60%

80%

100%

0 phasmids

2 phasmids

4 phasmids

lpr-1(cs73)(n=17)

let-4(mn105)(n=28)

N2(n=22)

let-4 mutants have a phasmid dye-filling defect

Figure Ap1.6

A

HMP-1::GFP HMP-1::GFP

D E

wild-type let-4

vha-1::GFP vha-1::GFP

B C

153

Appendix 2

let-4 expression in the excretory system

154

Introduction

To understand the expression and localization of LET-4, I generated

transcriptional and translational reporters, summarized in Chapter 2. The let-4p::GFP

and LET-4::GFP transgenes revealed dynamic expression patterns in the excretory

system. This appendix includes a detailed analysis of the expression pattern of the

transcriptional and translational let-4 reporters.

Results

let-4 is transcribed dynamically in the excretory system. (Fig. Ap2.1) At the 1.5-

fold stage, when the lumen has first formed in all three cells of the excretory system, let-

4p::GFP was expressed in all 3 cells of the excretory system. Over the course of 3-fold

stage, expression was reduced in the canal cell, but GFP expression was still present in

the duct and pore cell (Fig. Ap2.1 B). This expression pattern is mirrored by the

expression of LET-4::GFP in the excretory system (Fig. Ap2.1 C). LET-4::GFP was

present in the duct, pore and canal cell at 1.5-fold stage. The GFP signal remained in the

duct and pore through the L4 larval stage, while expression in the canal cell was not

visible by hatch.

To determine the relative localization of LET-4::GFP, we co-immunostained GFP

and DLG-1. The junctional DLG-1 protein localized to the pore connection to the

outside, pore autojunction, and duct-pore connection (Fig. Ap2.1F-H). At the 1.5-fold

155

stage, in the excretory system, even with DLG-1 labelled, it is difficult to resolve the

localization of LET-4 because the duct and pore cell themselves are so narrow. A ventral

view of the pore opening in a 1.5-fold embryo shows LET-4::GFP in the pore cell, but it

is difficult to resolve LET-4::GFP is enriched apical to DLG-1 (Fig. Ap2.1G). By the 3-

fold stage, when the cells are larger and have taken their distinct shapes (Refer to Fig. 2.4

A,B), LET-4::GFP was clearly localized to the lumen of the duct and pore cells, and did

not fill the entire cytoplasm of the cells (FigAp2.1H). Localization of LET-4::GFP is not

exclusively to the apical face of cells; it is dispersed in the cytoplasm and enriched at the

apical face.

Discussion

The let-4 promoter drives expression in the duct and pore beginning at 1.5-fold,

which may indicate a role for let-4 at this early stage. However by TEM and marker

analysis (Chapter 2, Appendix 3), the duct and pore lumen and junctions appear wild type

during 1.5-fold, and well into 3-fold. It is possible that LET-4 may first be serving a role

in 1.5-fold, and the deficiency doesn’t cause a phenotype until late in 3-fold, when the

excretory system begins to function. To determine the timing of let-4 requirement, a

transgene was generated driving LET-4 under the control of a heat-shock inducible

promoter, but this construct was too toxic to be useful (data not shown). Most rescue

experiments have indicated that worms are very sensitive to overexpression of LET-4.

156

Why is the let-4 promoter driving expression earlier in the canal cell than the duct

and pore? One possibility could be an early role for let-4 in canal cell lumen

development. However, based on the TEM analysis (see Appendix 3) the canal cell

lumen appears unaffected in let-4 mutants. Also, expression of let-4 in the duct and pore,

but not the canal cell, is sufficient to rescue let-4(mn105) (Fig. 2.2). Therefore any role

of LET-4 in the canal cell is dispensable. Given the redundancy of LET-4 and SYM-1 in

the epidermal elongation, perhaps LET-4 functions redundantly with other eLLRons in

the canal cell.

157

Materials and Methods

Transgenes used were:

csEx203 [10ng/uL pVM7(let-4p::GFP) + 100ng/uL pRF4[rol-6(su1006)] and csEx210

[2ng/µLpVM4(LET-4::GFP) +98ng/µLpRF4(rol-6(su1006)]. For further description of

these transgenes, see Chapter 2 Materials and Methods.

Microscopy

Microscopy was performed as described in Chapter 2 Materials and Methods

Immunostaining

Freeze-crack of LET-4::GFP embryos was performed as described in Appendix 4.

Primary antibodies: goat anti-GFP (1:50) (Rockland Immunochemicals); rabbit anti-

DLG-1 (1:400) (Segbert et al 2004) Secondary antibodies: FITC donkey anti-goat (1:20)

and Cy3 anti-rabbit (1:200) (Jackson Immunoresearch)

Acknowledgements

I thank Olaf Bossinger for kindly providing the rabbit anti-DLG-1 antibody.

158

Figure Legend

Figure Ap2.1. Expression of let-4 in the excretory system.

(A-B) let-4p::GFP is dynamically expressed in the excretory system. The boxed regions

in A and B are magnified in A’and B’. At 1.5-fold stage (A), let-4p::GFP is expressed in

the canal cell (c) duct cell(d) and pore cell(p) nucleus; in the canal cell, expression

decreases during 3-fold (B,C). The individual shown in (B) is also carrying AJM-1::GFP

for easy identification of the cells of the excretory system. (C) Quantification of presence

of let-4p::GFP in the canal cell from 1.5-fold to late 3-fold. (Hatch normally occurs ~1.5-

fold + 8hrs.) (D-E) LET-4::GFP is dynamically expressed in the excretory system. LET-

4::GFP is localized to the basal membrane of the canal cell and to the lumen of duct and

pore cell in 1.5-fold (D) and 3-fold (E). (F-H) Immunostaining of GFP (F,G,H) and

DLG-1(F’,G’,H’) in LET-4::GFP. DLG-1 labels the pore connection to the outside, pore

autojunction and the duct-pore connection. (F) 1.5-fold excretory system. (G) Ventral

view of the 1.5-fold excretory system. (H) 3-fold excretory system. LET-4::GFP is

localized to the basal membrane of the canal cell and to the lumen of duct and pore cell in

1.5-fold (F) and 3-fold (H). Arrow indicates estimated position of duct-canal junction;

bracket indicates duct, and arrow marks pore cell. Scale bars: 5µm.

159

Figure Ap2.1

0 20 40 60 80 100

1.5-fold + 6hrs

1.5-fold + 5hrs

1.5-fold + 4hrs

1.5-fold + 3hrs

2-fold

1.5-fold

ventral enclosure

age

% GFP in canal cell

(n)

(5)

(16)

(2)

(13)

(18)

(11)

(11)

d

p

c

cp

d

A A’

B B’

D D’

E E’

C

let-4p::GFPAJM-1::GFP

let-4p::GFP

D’’ F

G

H

F’

G’

H’

F’’

G’’

H’’

160

Appendix 3

TEM analysis of the C. elegans excretory system

161

Introduction

The C. elegans excretory system is a tiny structure; the lumen of the duct, pore

and canal cells can be more narrow than 1 µm, making visualization of the lumen

difficult with molecular markers and confocal microscopy. For a more detailed imaging

of the lumen on junctions in both wild-type and let-4 mutants, we performed

Transmission Electron Microscopy (TEM). TEM has been successful before in

visualizing excretory system luminal defects (Stone et al, 2009). This analysis provides

serial sections, allowing us to trace the entire lumen through the three cells of the

excretory system. Additionally, TEM allows closer examination of the apical extra-

cellular matrix (ECM) in the excretory system, and outside the embryo. The resolution of

TEM analysis allows us to address some specific questions that could not be addressed

with confocal microscopy: Does the lumen form normally? Is the lumen maintained

through late stages of embryonic development? Are there visible junctional defects in

let-4 mutants? Are there apical ECM defects in let-4 mutants?

We chose to perform the analysis on both 1.5-fold and 3-fold stage let-4(mn105)

mutants. 1.5-fold stage is just after the initial formation of the junctions and lumen of the

excretory system. By investigating this stage, we could determine if the junctions and

lumen initially form correctly in let-4 mutants. After initial formation in 1.5-fold stage,

the excretory system matures until 3-fold stage. We chose to perform the 3-fold stage

analysis as late as possible in development before the excretory system phenotype was

observed with confocal microscopy. This time point was chosen to visualize the matured

162

excretory system before the system was damaged by secondary effects caused by fluid

accumulation. A brief summary of the TEM results, as well as my conclusions were

presented in Chapter 2. Here, I present more detailed description of the analysis. At the

end of this appendix, I’ve included a summary datasheet for each embryo analyzed.

Results

TEM analysis revealed no excretory system defect in 1.5-fold stage let-4 mutants.

(Fig. Ap3.1). We sectioned through the excretory system of five embryos. The lumen

does not have any obvious lumen enlargement relative to available images of archived

wild-type embryos (Archived in the Hall Lab). The lumen was clearly continuous in 4/5

embryos. In a fifth embryo, let-4-1, a key serial section through the lumen was missing,

however, there is no indication of a luminal defect.

Although no excretory system defect was observed, TEM analysis revealed an

inner eggshell layer defect in 1.5-fold let-4 mutants. In available embryos fixed by HPF,

the inner eggshell layer is close to the embryo, and reaches across the pore cell opening

(See Chapter 2). In all five of the 1.5-fold let-4 mutants analyzed here, the inner eggshell

layer is pulled away from the surface of the embryo (Fig. Ap3.1), suggesting

compromised apical ECM integrity.

We sectioned through three wild-type 3-fold embryos to serve as a control for the

let-4 3-fold analysis. Key images from these embryos highlighting features of the

excretory system are presented in Figure Ap3.2.

163

We sectioned through nine let-4 3-fold embryos (Fig. Ap3.3). For a summary of

the 3-fold TEM analysis, see Table Ap3.1. Four of the nine had luminal defects. In two

of these embryos, let-4-8-1 (Fig. Ap3.3A) and let-4-9-2 (Fig. Ap3.3B), the duct cell

lumen connected to the canal cell, but terminated in the duct cell.

Of the four let-4 3-fold embryos with luminal defects, I did not observe duct/pore

cell connectivity in any of them. In let-4-8-1, let-4-9-2 and let-4-7-1 (Fig. Ap3.3C), the

pore cell could not be identified. In the TEM analysis pore cell features such as the

autojunction and lumen are the distinguishing characteristic. These features are lost in

let-4 mutants (as observed with Confocal microscopy), prohibiting pore identification. In

let-4-7-2, the pore cell was observed to still have an autojunction, and connect to the

outside of the worm, but connectivity to the duct could not be assessed, due to section

damage (Fig. Ap3.3D). This embryo is the most ambiguous of the 3-fold analyzed. The

lumen may be distorted in some sections, and the pore may hae no cuticle lining,

although the lumen can’t be followed all the way through, because sections are missing.

In the embryos with an enlarged lumen (Fig. Ap3.3.C, D, J), the cuticle inside the duct

lumen was observed to be pulled away from the surface of the duct lumen.

Based on confocal and TEM analysis, the duct/pore connection is lost late in 3-

fold stage in let-4 mutants (Fig. 2.4, Ap3.3). Therefore, it could be possible there are

defects in this junction before the phenotype is apparent. However, in the 5 let-4 3-fold

mutants that did not yet have duct lumen defects, the junction between the duct and pore

was not observed to be different than wild-type (Fig. 3.3E-I). Based on TEM analysis,

the dark, electron dense junctions were present, and appeared wild-type in these let-4 3-

164

fold mutants. Sections highlighting these junctions are presented in Figure Ap3.3.

(Compare to wild-type duct/pore junctions, Fig. Ap3.2). Therefore, at the resolution of

this analysis, the duct/pore junction, which destabilizes late in 3-fold, is normal into the

3-fold stage.

In addition to the nine let-4 3-fold embryos described above, partial analysis was

performed on two other embryos. In these two let-4 3-fold embryos, many sections were

lost and shuffled during the sectioning process. Thus the full analysis of the excretory

system could not be performed, although some data could be collected from these

embryos. In the embryo let-4-10-1, sections near the secretory junction were recovered

and analyzed (Fig. Ap3.3J). These sections revealed an enlarged duct cell lumen, a

detached cuticle inside the duct cell, and a mildly enlarged canal cell lumen. In let-4-10-

6, sections posterior to the terminal bulb of the pharynx contained what appears to be

accumulation of fluid (Fig. Ap3.3K). Although the origin of this fluid could not be traced

due to damage to more anterior sections, the accumulation looks similar to the fluid

visible in the embryo let-4-8-1, which was distorted significantly.

Discussion

In let-4 mutants, which phenotype occurs first: enlarged lumen, or detached

lumen? In all embryos with a luminal phenotype except one, the lumens are both

enlarged and detached. In let-4-9-2, the duct cell lumen is truncated, but the lumen of

neither the duct nor canal cell is enlarged. This suggests that the lumen detachment

occurs before the lumen becomes enlarged, leading to the following model: let-4 mutants

165

develop normally until late 3-fold, at which time the junction between the duct and pore

destabilizes due to the absence of a destabilized apical extracellular matrix. The loss of

junctional integrity then results in several events. The duct cell becomes detached from

the pore cell, the duct cell lumen collapses, and the pore cell autojunction falls apart. As

fluid is collected by the excretory system with a collapsed duct lumen, it backs up into

the duct and canal cell lumens leading to swelling. These events occur rapidly, and with

the current data the order of the junction destabilization cannot be determined. To

evaluate this model, and determine the order of the events, more TEM analysis is

required.

Based on confocal and TEM analysis, let-4 mutants lose the pore autojunction and

the junctions between the duct and the pore. However, the connection between the canal

cell and duct cell, the secretory junction, was unobstructed and looked normal in all let-4

1.5-fold and 3-fold mutants (Except for let-4-2-5, which was damaged during HPF).

Why isn’t this junction affected? Based on tissue-specific rescue (Fig. 2.2), let-4 is not

required in the canal cell. The apical character of the canal cell and its ECM is different

than the duct and pore, and perhaps other proteins at the secretory junction maintain the

junction even in the absence of LET-4.

The cuticle, as visualized by TEM, was pulled away from the apical face of the

duct cells in let-4 mutants with enlarged lumen. However, despite the swelling of the

lumen in some let-4 mutants, the cuticle inside the duct cell stays intact. In all embryos,

the cuticle was continuous through all sections containing a lumen, and maintained a

normal diameter even as the lumen of the duct cell was enlarged (Fig. Ap3.3D.i-iii,

166

Fig.Ap3.3J.i,ii). This indicates that LET-4 is not required for the cuticle to maintain its

shape, but LET-4 may be required to anchor the cuticle to the apical surface of the duct

cell. The most significant change observed in the cuticle structure was in let-4-7-1,

where cuticle appears distorted in the duct cell body (Fig. Ap3.3C.ii). (Also, the cuticle

terminated in a bolus when the lumen terminated in let-4-8.) The apical ECM, inside the

duct cell, which includes the cuticle, likely contains components that are not visible using

the fixation and staining procedures used here, and loss of LET-4 likely has an effect on a

part of the luminal ECM which is not preserved during this fixation.

Detachment of inner eggshell layer in 1.5-fold let-4 mutants could be the result of

destabilized interactions of the embryonic sheath with the eggshell layer. This de-

stabilization is not catastrophic for the embryo, though, because this defect was observed

in 5/5 embryos, and most let-4 embryos progress beyond the 1.5-fold stage and elongate

normally. It is only in the sym-1 let-4 double loss-of-function embryos that embryonic

elongation defects are observed at a high rate (Fig. 2.5). The connection of a de-

stabilized inner-eggshell layer and the elongation defect is still unknown, and little is

known about the molecular components of the inner eggshell layer. For further

exploration, see Chapter 4.

167

Materials and Methods

Alleles used were: let-4(mn105) X, progeny from let-4(mn105) mothers.

For TEM analysis, non-green let-4 escaper worms were picked from the strain UP1787

[let-4(mn105); C44H4] and maintained as a stock. 1.5-fold embryos from this escaper

line were picked for 1.5-fold stage analysis. For the 3-fold stage analysis, embryos from

this let-4 escaper line and the wild-type N2 line were picked as 1.5-fold embryos, and

incubated for 6 hours at 20°C before performing HPF. During sectioning, TEM sections

were laid out on grids. The position of the sections on the grid was recorded by the

sectioning technician. Occasionally, sections could fall on the grid on top of each other,

or sections could curl up, leading to individual sections being lost, damaged, or out of

order.

For TEM fixation and staining procedures, see Chapter 2 materials and methods and

Appendix 4. Images were processed and colored with Adobe Photoshop and ImageJ.

Acknowledgements

I thank David Hall, Ken Nguyen, Juan Jimenez and Leslie Gunther for help in conducting

HPF fixations. Ken Nguyen sectioned the fixed embryos. David Hall provided expertise

in analysis. I thank Shai Shaham, John Suslton, Jonathan Hodgkin, Richard Fetter and

Cornelia Bargman for providing archival TEM images. I performed the electron

168

microscopy in the EMRL at the University of Pennsylvania, supported in part by NIH

grant 5 P30 CA 016520.

169

Table Ap3.1 Summary of 3-fold embryos analyzed by TEM

Name Genotype lumen diameter** lumen connectivity

N635B wild-type Normal Continuous

N636 wild-type Normal Continuous

N638A wild-type Normal Continuous

let-4-8-1 let-4 enlarged discontinuous lumen within duct, no pore detected

let-4-9-2 let-4 Normal discontinuous lumen

let-4-7-1 let-4 enlarged unknown , no pore detected (missing sections)

let-4-7-2 let-4 enlarged unknown, normal pore (missing sections)

let-4-10-3 let-4 Normal Continuous

let-4-10-5 let-4 Normal Continuous

let-4-10-7 let-4 Normal Continuous

let-4-10-8 let-4 Normal Continuous

let-4-10-9 let-4 Normal Continuous

let-4-10-1* let-4 enlarged unknown (missing sections)

let-4-10-6* let-4 unknown unknown (missing sections)

*These embryos were missing many sections **‘Lumen diameter’ is an estimation, not a quantitative measurement.

170

Figure Legends

Figure Ap3.1. TEM images of the excretory system and detached inner eggshell

layer in 1.5-fold let-4 embryos. In all panels, canal cell (c) is labeled red; duct cell (d),

yellow; pore cell (p), blue and gland cell, purple.

A.let-4-1. Orientation is nearly transverse, sections go posteriorly as numbers increase

(i-iii)TEM images of the excretory system. (i) lumen is visible in canal call, duct and

pore. Part of the duct cell lumen is in other sections. (ii) whispy EC material is visible in

canal cell. (iv) TEM image illustrating detached inner eggshell layer(orange arrows).

Luminal ECM (line) is visible in (ii). Green arrows indicate embryonic sheath. This

embryo was missing a key section such that lumen connectivity could not be assessed.

B. let-4-2-3. Orientation is longitudinal, sections go ventral as numbers increase.

(i-vi) TEM of the excretory system. (i) canal cell lumen, excretory gland cell is visible.

(ii) duct cell luminal ECM (lines) is visible in (ii-iii). (iii) pore cell; ECM is visible. (iv)

pore cell opening. (v) TEM image illustrating detached inner eggshell layer (orange

arrow). Green arrows mark embryonic sheath.

C. let-4-2-5. Orientation is transverse, but tilted posterior. (Dorsal part of the section is

more posterior than the ventral part). Sections go posterior as numbers increase. (i-iv)

TEM of the excretory system. (i,ii) canal cell and pore cell lumen. (iii) duct cell lumen.

(iv) pore cell lumen and opening to outside of worm. Excretory gland cell is visible in

(iii-iv). (v) TEM image illustrating detached inner eggshell layer (orange arrow). This

embryo was slightly damaged during high pressure freezing.

171

D. let-4-3. Orientation is nearly transverse; sections go posterior as numbers increase. (i-

v)TEM images of excretory system. (i) canal cell lumen. (ii) duct cell lumen and

autojunction is visible. (iii,iv) duct cell lumen. (v) duct and pore lumen. Part of the

excretory gland cell is visible in (i). ECM (lines) is visible in (iii-v). (vi) TEM of

detached inner eggshell layer (orange arrows).

E. let-4-4. Orientation is nearly transverse; sections go anterior as numbers increase. (i-

iii)TEM images of the excretory system. Pore opening is visible in (i). ECM (lines) is

visible in lumen in (ii) and (iii). (iv) TEM image illustrating detached inner eggshell layer

(orange arrow).

Figure Ap3.2. TEM images of the excretory system in wild-type 3-fold embryos. In

all panels, canal cell (c) is colored red; duct cell (d), yellow; pore cell (p) is colored blue.

A. N635B. Wild-type. The embryo is oriented so that generally, the dorsal side of the

worm is facing the top of the image. As section numbers increase, they move posterior.

(i) Secretory junction (ii) duct cell extension (iii,iv)pore cell lumen, (v) pore cell opening.

(vi-ix) Serial sections showing the duct/pore connection. Arrows indicate electron dense

junctions between the duct and pore cells.

B. N636. Wild-type. The embryo is oriented so the dorsal is facing the top of the image.

A section numbers increase, they move posterior. (i) duct cell body (ii) pore cell lumen,

and connection to the outside (iii) duct cell extension and pore cell lumen. (iv-viii) Serial

172

sections showing the duct/pore junction. Arrows indicate electron dense junctions

between the duct and pore cells.

C. N638A. Wild-type. The embryo is oriented so dorsal is facing the top of the image.

As section numbers increase, they move posterior. (i) duct cell body (ii-iii) secretory

junction (iv) canal cell body. (v-x) Serial sections showing the duct.pore connection.

Arrows indicate electron dense junctions between the duct and pore cells.

Figure Ap3.3. TEM images of the excretory system in let-4 3-fold embryos. In all

panels, canal cell (c) is colored red; duct cell (d), yellow; pore cell (p) blue.

A. let-4-8. Embryo with discontinuous duct lumen and swollen canal lumen. The embryo

is oriented so the dorsal side is generally facing the top of the image. As the sections

numbers increase, the sections are more posterior. (i) The canal cell is greatly distorted.

(ii) The lumen of the duct cell is continuous with the canal cell lumen. (iv-vii) Serial

sections showing the terminating duct cell lumen. The cuticle terminates in a bolus (iv).

B. let-4-9-2. Embryo with discontinuous duct lumen, no lumen swelling. The embryo is

oriented so the segment of the worm containing the excretory system is toward the top of

the image. In this segment, the dorsal portion is generally toward the top of the image.

As section numbers increase, the sections are more posterior. (i,ii) The secretory junction

and duct cell body. (iii,iv) The duct cell extension. Canals of the canal cell are also

visible.

173

C. let-4-7-1. Embryo with unknown connectivity, swollen duct and canal lumen. The

sections are oriented so that dorsal is generally facing up, as section numbers increase,

the sections move posterior. (i) Duct cell extension (ii) The secretory junction. The

lumen of the duct and canal cells is enlarged. (iii)The canal cell lumen is enlarged.

D. let-4-7-2. Embryo with unknown connectivity, swollen duct and canal lumen. Sections

are oriented so that the dorsal side of the worm is facing the top of the image. As section

numbers increase, the sections are more posterior. (i,ii,iii) duct cell lumen is enlarged;

pore lumen, autojunction, and pore opening (ii) is visible. Canals are also visible. (iv)

Canal cell lumen is enlarged. (v-vii) Serial sections showing the secretory junction.

From this orientation, sections are moving straight down the lumen from the duct cell

into the canal cell, making it difficult to know which section is the last duct section, and

which is the first canal cell section. Arrows indicate electron dense junctions.

E. let-4-10-3. Embryo with normal connectivity and lumen. The embryo is oriented so

the dorsal side is generally toward the top of the image. As section numbers increase, the

sections are more anterior. (i) Canal cell and duct cell bodies. (ii) secretory junction. (iii)

pore cell lumen (iv) pore cell opening. (v-viii) Sections adjacent to the duct.pore

connection. Sections 2131-2136, which contain part of the connection between the duct

and pore, were damaged.

F. let-4-10-9. Embryo with normal connectivity and lumen. The embryo is oriented

awkwardly because the cells of the excretory system are close to the end of the egg. As

section numbers increase, the sections are more ventral. (i,ii) Duct cell body and

174

extension (c) secretory junction. (iv) pore cell. (v-xii) Sections showing the duct cell-pore

cell connection. Arrows indicate electron dense junctions between the cells.

G. let-4-10-5. Embryo with normal connectivity and lumen. The embryo is oriented so

the dorsal side is facing the top of the image. As section numbers increase, the sections

are more anterior. (i) canal cell and duct cell bodies. (ii) secretory junction. (iii) duct cell

extension and pore cell. (iv) pore cell opening. (v) duct/pore cell connection. (vi-xii)

Serial sections showing the pore/duct connection.

H. let-4-10-7. Embryo with normal connectivity and lumen. The embryo is oriented so

the dorsal portion is toward the top of the image. As section numbers increase, the

sections are more anterior. (i) Secretory junction. (ii) Canal and duct cell bodies. (iii)

Duct cell extensions and pore cell opening. (iv-viii) Serial sections showing the

duct/pore connection.

I. let-4-10-8. Embryo with normal connectivity and lumen. The embryo is oriented

awkwardly because the cells of the excretory system are close to a fold in the embryo.

As section numbers increase, the sections are generally more posterior. (i-vi) Secretory

junction and pore cell lumen. (vii-xiii) Serial sections showing the pore/duct cell

connection. Arrows indicate electron dense junctions between the cells.

J. let-4-10-1 (i-ii) Duct cell lumen is enlarged, canal cell lumen is slightly enlarged.

Section numbers are unknown.

K. let-4-10-6 (i,ii) Excess fluid (orange asterisks) is present in the area of the terminal

pharyngeal bulb; more anterior sections are damaged.

175

c

d p

c

d p

c

dp

c d

p p

c

d

p

c

d

p

c

d

p

c

dp

let-

4-1

iv

2μm

d

p

i ii iii

sec280 sec284 sec285 sec280

sec740 sec719

sec706 sec703

sec1223 sec1224 sec1228 sec1232

i ii

iii iv

i ii iii iv

2μm

2μm

2μmsec1216

c

d

p

v

2μm

let-

4-2-

5

sec709

let-

4-2-

3

2μm

v

A.

B.

C.

Figure Ap3.1

176

sec396

c

d

p

c

d

p

c

d

p

cd

p

c

dp

cd

p

c

dp

c

d

p

sec388 sec396 sec398

sec400 sec401

sec453 sec454 sec455

let-

4-4

i ii iii

iv

i ii iii

v

2μm

2μm

sec4432μm

iv

vi

sec363

let-

4-3

c

dp

D.

E.

2μm

Figure Ap3.1, continued

177

N635B

sec465 sec466 sec468sec467p

d

2μm

i ii

iii iv v

vi vii viii ix

A.

2μm

Figure Ap3.2

178

N636

sec 199 sec 200 sec 201 sec 202 sec 203

2μm

ii iii

iv v vi vii viii

i

B.

2μm

N638A

sec 437 sec 438 sec 439 sec 442sec 441sec 440

2μm

p

d

i ii iii iv

v vi vii viii ix x

C.

2μm

Figure Ap3.2, continued

179

A. let-4-8

d

d dcuticle

lulu

sec062 sec084sec074

sec086sec085sec084

i ii iii

iv v vi

1μm

B. let-4-9-2

sec398

sec378 sec375

sec390i ii

iii iv

2μm

2μm 2μm 2μm

Figure Ap3.3

180

C. let-4-7-1

sec462sec489 sec506

2μm

i ii iii ivsec476

2um

D. let-4-7-2

sec496 sec497 sec498v vi vii

2μm

sec489sec480sec476

sec506ii ivi iii

2μm

Figure Ap3.3, continued

181

E. let-4-10-3

sec 2139 sec 2140sec 2138sec 2137

v vi vii viii

sec2155sec2140

sec2086sec2078i ii iii iv

2um

2um

F. let-4-10-9

sec2755 sec2756 sec2757 sec2758 sec2759 sec2761 sec2763 sec2765

v vi vii viii ix x xi xii

2um

i ii iii ivsec2746

sec2758 sec2755 sec2793

2um

Figure Ap3.3, continued

182

G. let-4-10-5

i ii iii

iv v

vi vii viii ix

x xi xii

sec2417 sec2418 sec2419 sec2420

sec2421 sec2422 sec2423

sec2362 sec2370 sec2417

sec2408 sec2420

2μm

2μm

Figure Ap3.3, continued

183

H. let-4-10-7

iv v vi vii viii

sec1673 sec1674 sec1675 sec1676 sec1677

i ii iiisec1631 sec1624 sec1661

2μm

2μm

2μm

i ii iii

iv v vi

vii viii ix x xi xii xiii

sec1723 sec1724 sec1725

sec1726 sec1727 sec1728

sec1723 sec1724 sec1725 sec1726 sec1727 sec1728 sec17292μm

I. let-4-10-8

Figure Ap3.3, continued

184

J. let-4-10-1

K. let-4-10-6

2μm

2μm

i ii

sec2709 sec2712i ii

** *

*

Figure Ap3.3, continued

185

N635B – wild type

N2 Age: 1.5-fold + 6hrs HPF: 12/1/09 Sectioned: 1/20/10 Scoped: 6/10

The embryo is oriented so that generally, the dorsal side of the worm is facing the top of the

image. As section numbers increase, they move posterior.

Key Sections:

Section#466 - pore/duct junction (pretty hard to make out) Sections #467-489- pore lumen Section# 489 – pore opening Sections#467-521 – duct cell 467-489- duct cell extension; cuticle visible in lumen in many sections 496-521- duct cell body 503- three passes of lumen through section. Sections# 503-511 – secretory junction Section#500-521- canal cell body lumen Sections#497-521- canal cell body, nucleus Cuticle visible in lumen in: Duct cell body: sec518 (also in most of the cell body) Duct cell extension: sec465-467 Pore cell lumen: sec468-478 Closest to sec junc: sec500

Updated 7/12/10

186

N636 – wild type

N2 Age: 1.5-fold + 6hrs HPF: 12/1/09 Sectioned: 1/24/10 Scoped: 6/10

As of 7/10/10: I don’t have the canal cell lumen. I’ve scoped Excretory System sections #199-

248

The embryo is oriented so the portion containing the ExSys is toward the top of the image.

Dorsal is facing the top of the image. A section numbers increase, they move posterior.

Key Sections: Sections #199-204- pore cell nucleus Sections #199-207- pore cell lumen Sections #204-207- pore cell opening Sections # 207-213- pore cell autojunction Sections #199-215- duct cell lumen, with cuticle, is visible throughout these sections Sections #190-230 – duct cell extension Sections #230 -248*- duct cell body Sections #199-201- duct/pore junction Sections #244-248* – secretory junction *Section#248 is the highest section number I’ve looked at.

Missing pieces: The rest of the secretory junction, and the canal cell are in higher section

numbers

Cuticle visible in lumen in:

Duct cell body: sec239-247 (scaffold not visible in 248) Duct cell extension, along the entire length of the extension. Pore lumen: sec200,201,207 Cuticle closest to sec. junc: sec247

187

N638A – wild type

N2 Age: 1.5-fold + 6hrs HPF: 12/1/09 Sectioned: 1/28/10 Scoped: 6/10

The embryo is oriented so the portion containing the ExSys is toward the top of the image.

Dorsal is facing the top of the image. As section numbers increase, they move posterior.

Key Sections: Section #450- end of pore cell nucleus Section #470- pore cell opening Sections #440-470- pore cell lumen Sections #437-439- pore/duct junction Sections #448-464- duct cell nucleus Sections# 432-442 –duct cell extension Sections #432- ~468- duct cell lumen

#450-454- duct cell lumen cuticle is visible Sections #466-475- secretory junction Sections #472-493- canal cell nucleus Sections#469-480- canal cell body lumen Cuticle visible inside lumen in: Duct cell body: sec# 451-454 Duct cell extension: sec# 438-439 Pore cell lumen: sec# 463-470 Closest to sec. junc: sec461

188

let-4-8 – duct lumen ends without connecting to pore; severe

fluid damage

UP1787(without GFP-marked rescuing transgene): let-4(mn105) Age: 1.5-fold + 6hrs HPF : 12/1/09 Sectioned: 1/3/10

Scoped: mostly 4/10 Result: lumen does not extend all the way through the duct. This embryo has a lot of fluid accumulation. The fluid can be traced back to the EC (excretory canal cell) lumen, which connects to the duct lumen, which extends into the duct, but doesn’t go all the way through the duct. I can’t identify the pore cell due to all the damage done to the embryo by the fluid accumulation. The worm is in one piece in the sections containing the canal cell and duct cells. These sections begin near the very beginning of the embryo. The embryo is oriented so the dorsal side is generally facing the top of the image. As the sections numbers increase, the sections are more posterior.

Key Sections: Section #035 Canal cell lumen is already in view, part of the canal cell lumen is in view in all the sections I’ve looked at. Section #050 Excretory canal cell (red), appears to contain the pocket of fluid. The cell just below the canal cell in this image is the cell that will form junctions with the canal cell, likely the gland cell. Sections #056-070 I see the series of bubbles which look like they’re in a cell, but the membrane containing them doesn’t seem to connect to any of the cells I’m interested in, or a nucleus anywhere. Sections #059-074 Secretory junction.

Section#062 Junctions are visible between the excretory canal cell (red) and another cell, probably the gland cell (purple). The duct cell (yellow) is next to the excretory cell, and its lumen is visible. Section#074 is the section with the best view of what’s left of the damaged duct/canal cell junction. The lumen of the duct cell (yellow), the lumen of the excretory cell (red), and the pocket of fluid are continuous. The duct cell and gland cell come in contact, although dark junctional material isn’t apparent.

Sections #058-089 - duct cell body Sections #060-076 Duct cell lumen In following these sections, it’s apparent that the duct cell lumen is continuous with the canal cell lumen which is continuous with the large pocket of accumulated fluid. Sections #064-085 Duct cell nucleus. Cuticle visible in lumen in: Duct cell body: sec63-85, (only sec062 looks like it’s not detached) Duct cell extension: N/A Pore cell: N/A Detachment closest to sec. junc:sec75 (it’s difficult to tell, with all the damage)

189

let-4-9-2 – duct lumen ends without connecting to pore; no fluid accumulation

UP1787(without GFP-marked rescuing transgene): let-4(mn105)

Age: 1.5-fold + 6hrs HPF : 12/1/09 Sectioned: 1/4/10 Scoped: mostly 5/10

Result: The duct lumen just seems to stop in grid C3. The excretory canal cell (EC) looks normal;

the secretory junction is present; I can’t identify the pore, even though I’ve gone up to section

#262, ~90 sections anterior of where the duct cell lumen ends.

The embryo is oriented so the segment of the worm containing the excretory system is toward the top of the image. In this segment, the dorsal portion is generally toward the top of the image. As section numbers increase, the sections are more posterior.

I’m missing sections #371-373. I think the thing I was calling lumen before #371 may just be a

random vacuole, and I’m losing track of the lumen in this tiny gap.

Key Sections: Sections#354-417 duct cell lumen

#354- this is the first bit of duct lumen I can find; I believe it’s the anterior end of the duct cell lumen. When I trace the duct lumen from the opposite direction, this is as far as I can follow it. #374-387 duct cell nucleus (below the lumen) #375-386 cuticle is obvious #417- last bit of duct lumen in this direction, it winds back toward the anterior end #376-417 duct cell body #354-374 duct cell extension (it’s hard to tell exactly where the body/extension

boundary is in this orientation, so I made my best guess) Sections# 391-396 secretory junction, #391 is the best view of the sec. junc. Sections# 392-403 canal cell lumen Section# 420- canal cell nucleus first becomes visible

Cuticle visible in lumen in:

Duct cell body: in all lumen sec376-417 Duct cell extension: cuticle isn’t visible in the duct in sections lower than sec#375 Pore cell: N/A Cuticle closest to sec. junc: sec398 190

let-4-7-1 – Fluid in duct and canal cell; gaps/missing

sections

UP1787(without GFP-marked rescuing transgene): let-4(mn105)

Age: 1.5-fold + 6hrs HPF : 12/1/09 Sectioned: 12/22/09 Scoped: mostly 3/10 Result: The duct lumen is connected to the EC lumen, but I can’t find it ever reaching a pore. I

lose the lumen in the gap between sections 454 and 458; I am missing some crucial sections

around this area that are damaged and folded over; the pore is likely located in these sections.

Conclusions I can make from this embryo:

The duct cell is present, has a lumen, and the lumen connects with the EC lumen

EC is present, with a lumen, and a few bubbles of fluid accumulation.

The sections are oriented to that the dorsal part of the segment of the worm containing the

excretory system is generally facing up. The embryo is in two large segments in the lower

sections numbers, and the sections continue to the end of the embryo.

Key images: Sections #462-463- Duct cell extension Sections #475-485- duct cell body Sections #458-489- Duct cell lumen

Section#463 Narrow part of duct lumen; I don’t ever get to see where this lumen leads to, due to damaged sections. From the opposite direction, I can follow the lumen from the cell body (with some gaps) but I don’t know what happens at the anterior end of the lumen. Notice dark ring of cuticle inside duct cell lumen Section #476 Lumen is continuous through duct (yellow) and EC(red), some of the secretory junction is visible; duct nucleus is visible. The duct lumen and EC lumen each pass through this section twice. (I don’t have the sections where the two pieces of duct lumen connect, but I am missing #464-474 and #477-479.) Cuticle is still present in the duct cell lumen.

Sections #475-480 –secretory junction Sections #475-509- Canal Cell body lumen

#481-496- There are clearly a few bubbles of fluid accumulation in the EC lumen. Why are these bubbles right next to each other; what gives them their shape? Also, notice the dark shading inside the EC lumen.

Cuticle is visible in the lumen in: Duct cell body: sec475,476; but not in sec480-496. Duct cell extension: cuticle is visible in all the sections I have: sec458,461,462,463 Pore cell: N/A; Cuticle closest to sec. junc: sec475 (there is a gap next to this section) 191

let-4-7-2 - fluid in duct and canal cell; gaps/missing sections UP1787(without GFP-marked rescuing transgene): let-4(mn105)

Age: 1.5-fold + 6hrs ;HPF : 12/1/09; Sectioned: 12/22/09; Scoped: mostly 3/10 Result: Grids C1 and C2, which contain crucial sections, had a lot of folded and damaged

sections, so I can’t be sure of ExSys lumen continuity. What I can be sure of is:

Pore cell is present with autocellular junctions, a lumen, and a pore opening.

Duct lumen is connected to EC lumen, and at least partially present.

EC is present, with a lumen and fluid accumulation

Sections are oriented so that the portion of the worm which contains the excretory system

is the top segment, and the dorsal side of this segment is toward the top of the image. The

pharynx is visible throughout these sections, and the cells of the excretory system appear

ventral (below) the pharynx. Section numbers increase as we move posterior.

Key sections:

Sections #475-483 Pore lumen; autocellular junction. Section#s 469-474 and 477-479 are torn/damaged, so I can’t see if the pore lumen connects to the duct lumen, but the pore autojunction is still intact, so it’s probably attached to the duct cell. In the colorized image of section #480, the duct cell is yellow, and the pore cell is blue. 475-476; 480-482: pore lumen

480-482: pore opening Sections #457-490 Duct cell lumen. I can follow it to the secretory junction in the posterior direction, but I can’t see where it ends, or where it connects in the anterior direction. I lose track of the lumen in the gap between #454 and 457. I’m also missing 445-453. 458-496: duct cell body Sections #496-498 Secretory junction; we’re transitioning from the duct cell part of the lumen to the excretory cell. The lumen is swollen on both sides of the junction, and at the junction. The excretory cell nucleus is coming in to view Sections #501-519 Canal Cell main body lumen (canal lumen is visible in all these sections) (Dark shading is visible inside lumen in #501-507) Are the two large pockets of fluid ventral to the EC nucleus continuous? Section #506 Excretory cell nucleus and two pockets of fluid. This embryo has two adjacent pockets of fluid; what is keeping them separate? Section# 507 This is the one section where the two adjacent pockets of fluid seem to connect, but it almost looks like the tissue between the two pockets of fluid was damaged, maybe during freezing. Cuticle visible in the lumen in: Duct cell body: visible in the whole lumen from sec458-496 Duct cell extension: N/A Pore cell: cuticle is visible in sec480,481,482 (not visible in sec475,476) Cuticle closest to sec junc:490 (there is a gap between this section and the sec junc.)

192

let-4-10-3 – no fluid accumulation; lumen is continuous

UP1787(without GFP-marked rescuing transgene): let-4(mn105)

Age: 1.5-fold + 6hrs HPF : 12/1/09 Sectioned: 1/5/10 Scoped: mostly 6/10 Result: The lumen is present, and appears continuous through the excretory canal cell (EC),

duct, and pore (although it’s very hard to follow the duct-pore connection around section

#2109-2127

The embryo is oriented so the segment of the worm containing the excretory system is toward the top of the image. In this segment, the dorsal portion is generally toward the top of the image. As section numbers increase, the sections are more anterior. The excretory system is cut through in cross sections. As Section #s increase, we move from the EC nucleus and lumen, to the duct lumen, then the pore lumen. Key Sections: Sections#2059-2086: canal cell nucleus; canal cell body lumen is visible from 2056-2122. Sections#2064-2098- canal cell body lumen Sections #2086-2095: secretory junction, and lumen on both sides of the junction Sections #2065-2138: duct lumen- contains cuticle 2064-2096- duct cell body

2098-2138- duct cell extension 2068- duct lumen passes through section once 2069 duct lumen passes through section twice 2086-2091 duct lumen is connected to canal cell lumen 2100-2126 sections are damaged, but duct lumen is still there. 2127-2138 duct lumen reaches across the plane of the section, toward the pore, the lumen is really tiny here. 2132-2136 are missing. I think this was a section numbering error. Based on the sections, I’m not missing much between #2131 and #2137, and there weren’t any more sections on the grids. Section#2137- duct/pore junction Sections# 2139- 2156 pore lumen; pore auto junction visible; cuticle present in pore lumen (is pore lumen narrow?) 2137-2160- pore nucleus

2139-2157- pore lumen 2157 pore opening

Cuticle visible in lumen in: Duct cell body: anywhere from sec2064-2096 Duct cell extension: clearest in sec2182 Pore: anywhere from 2139-2157 Cuticle closest to sec junc: sec2086

193

let-4-10-9 – no fluid accumulation; lumen is continuous

UP1787(without GFP-marked rescuing transgene): let-4(mn105)

Age: 1.5-fold + 6hrs HPF : 12/1/09 Sectioned: 1/7/10 Scoped: 7/10 Result: The lumen is present, and appears continuous through the canal cell, duct, and pore;

there is no excess fluid accumulation in the lumen or canals.

The embryo is oriented awkwardly because the cells of the excretory system are close to the end of the egg. As section numbers increase, the sections are more ventral.

Sections lower than 2738 may have a little duct cell cytoplasm, but I can’t visualize them

because the grid was damaged.

The duct cell lumen begins at the secretory junction in sections #2757-2772, then winds through

the body, then moves into the duct cell extension, moving toward the top of the image, as

section numbers increase, then the lumen connects to the pore cell, and continues through

lower section numbers. The duct/pore junction is at 2758, then the pore cell is narrow for some

sections, before the pore cell nucleus comes into view at about section #2781.

Key Sections:

Sections #2759-2772: canal cell lumen Sections #2757-2772: secretory junction 2759, 2761: lumen on both sides of junction Sections #2738-2758: duct cell lumen

2738-2765- duct cell body 2740-2758- duct cell extension

Sections #2758 pore/duct junction Sections #2758-2798: pore cell 2758-2798: pore autojunction/lumen 2781-2798: pore cell nucleus 2810: as far as I can go toward the pore opening Cuticle is visible inside the lumen in: Duct cell body : sec# 2757-2755 Duct cell extension: sec#2743,2744 Pore cell lumen: sec# 2761-2765; 2775 Closest to secretory junction: sec# 2757 194

let-4-10-5 – no fluid accumulation; lumen is continuous

UP1787(without GFP-marked rescuing transgene): let-4(mn105)

Age: 1.5-fold + 6hrs HPF : 12/1/09 Sectioned: 1/7/10 Scoped: 6/10

Result: The lumen is present, and appears continuous through the canal cell, duct, and pore;

there is only a little excess fluid accumulation in the canal cell, and maybe some swelling in the

duct.

The embryo is oriented so the segment of the worm containing the excretory system is toward the top of the image. In this segment, the dorsal portion is generally toward the top of the image. As section numbers increase, the sections are more anterior. The duct lumen is a little confusing; the duct cell process is up against the pharynx and goes in the anterior direction, anterior of the pore, up to section 2433, where it bends ventrally, then moves posterior to connect with the pore at section 2421

Key Sections: Sections #2349-2372 excretory canal cell lumen (posterior part of lumen is in lower section numbers) #2349-2367 canal cell nucleus Sections #2367-2373 Secretory junction 2367-2371: lumen on both sides of the junction Sections #2351 -2433 Duct cell 2355-2373: duct cell nucleus 2349-2382: duct cell body 2383-2433, then winding back to 2420: duct cell extension (with lumen) Section #2420 – duct/pore junction Sections #2404-2433 Pore cell #2404-2406 pore autojunction #2406-2408 pore opening #2409-2420 pore lumen

#2412-2433- pore cell nucleus Cuticle visible in lumen in: Duct cell body: basically visible in all lumen, especially from sec2360-2373 Duct cell extension: all the way through the extension: sec2383-2433 Pore cell: sec2417,2418,2419; sec2406,2407,2408 Cuticle closest to sec junc: sec 2370

195

let-4-10-7 – no fluid accumulation; lumen is continuous

UP1787(without GFP-marked rescuing transgene): let-4(mn105)

Age: 1.5-fold + 6hrs HPF : 12/1/09 Sectioned: 1/5/10 Scoped: 6/10

Result: The lumen is present, and appears continuous through the canal cell, duct, and pore;

there is no excess fluid accumulation in the lumen or canals.

The embryo is oriented so the segment of the worm containing the excretory system is toward the top of the image. In this segment, the dorsal portion is generally toward the top of the image. As section numbers increase, the sections are more anterior.

Sections 1587-1595 are damaged. These sections contain the canal cell nucleus, and some of

the canal cell lumen.

Key Sections: Sections #1596-1624: canal cell lumen #1603-1624- canal cell lumen is unusually narrow #1627-1630- lumen connects to duct cell lumen Sections #1624-1630: secretory junction Sections #1618-1675: duct cell lumen

1610-1639- duct cell body 1641-1676- duct cell extension

Sections #1673-1677 pore/duct junction 1675: pore/duct junction, with lumen on both sides Sections #1659-1677: pore cell 1659-1661: pore autojunction 1660-1664: pore opening 1660-1675: pore lumen- some parts are hard to follow, use autojunction as a guide

Cuticle in lumen visible in:

Duct cell body: visible in all the cell body lumen, especially 1621-1631 Duct cell extension: all the way through, sec1641-1676 Pore cell: the whole lumen: sec1660-1664 Cuticle closest to sec junc: sec1633 196

let-4-10-8 – no fluid accumulation; lumen is continuous

UP1787(without GFP-marked rescuing transgene): let-4(mn105)

Age: 1.5-fold + 6hrs HPF : 12/1/09 Sectioned: 1/6/10 Scoped: mostly 8/10

Result: The lumen is present, and appears continuous through the canal cell, duct, and pore;

there is no excess fluid accumulation in the lumen or canals. It’s very difficult to see the cuticle

inside the lumen in this animal.

The embryo is oriented awkwardly because the cells of the excretory system are close to a fold in the embryo. As section numbers increase, the sections are generally more posterior.

Key Sections: Sections #1720-1733: canal cell lumen Sections #1724-1729: secretory junction 1725,1726: lumen on both sides of junction Sections #1724->1744->1726: duct cell lumen

1723-1742- duct cell body 1738->1744->1726 - duct cell extension (it reaches toward higher section numbers, then turns back at section #1744)

Sections #1725-1726: pore/duct junction Sections #: pore cell (I’m missing a few sections in the pore lumen) 1700-1725: pore autojunction/lumen 1718-1732: pore cell nucleus 1700: pore cell opening Cuticle inside lumen visible in: Duct cell body: sec1738 Closest to sec. junction: 1727 Pore cell: sec1701

197

Appendix 4

Detailed Protocols

198

TEM Grid Staining Protocol – From the Hall Lab and Electron Microscopy

Sciences Protocol.

I. Filter solutions:

1) Attach filter to syringe, pull plunger all the way out

2) Decant solution into syringe

3) Press plunger in until *snap*

4) Pull plunger back

II. Stain Grids:

1) Create two staining chambers with plates or petri dishes with a piece of filter

paper in each. Label one UrAc and the other lead citrate.

2) Fill 4 small beakers with CO2-free H2O.

3) Apply 1M NaOH to filter paper in each chamber, just enough for the paper to

be saturated.

4) Place parafilm on top of wet filter paper. Place several NaOH pellets in the

lead citrate petri dish.

5) Using the filtered syringe, place one drop of each staining solution on the

parafilm. You will need a different drop of solution for each grid to be

stained.

6) Using forceps, take out the grid to be stained. Place the grid face down on the

drop of UrAc, and leave it for 4 minutes. (In the Hall lab, grid boxes are

prepared so the top face of the grid is facing to the left.)

7) Take the grid off the UrAc, and dip it into the first beaker of H2O 5 times,

submerging it for 10 seconds each time. Then, dip the grid into the next

beaker of H2O the same way 5 times.

8) Place the grid face down in the drop of lead citrate, and leave it for 2 minutes.

9) Take the grid off the lead citrate, then dip it into the 3rd beaker 5 times, then

4th

beaker 5 times.

10) Allow the grid to air dry in the forceps, then return the grid to the grid box.

Solutions:

I. CO2-free H2O

Boil mQH2O for 1 minute, and store it immediately in tightly-capped containers.

Let the water cool completely before using it for staining. Open the containers

immediately before use; there should be a hissing sound when the cap is opened.

199

II. 2% Uranyl Acetate in H2O. – UrAc will go into solution best if H2O is 60°C.

III. Lead Staining Stock Solution (Reynold’s)

1) In a 50 ml flask add: Lead Nitrate Pb(NO3)2 1.33 g Sodium Citrate

Na3(C6H5O7).2H2O 1.76 g Boiled, cooled, CO2 free dist. water 30 mL

2) Cover the flask, shake vigorously for at least one minute.

3) Add 8 ml of 1N NaOH (in CO2 free H2O)

4) Mix until clear.

5) Check the pH. It should be 12.0 ±0.1. If the pH is low add more NaOH to the

clear solution. If the pH is above 12.1 start over this time adding a smaller

amount of NaOH.

6) Add CO2-free water to bring the solution to a final volume of 50 mL.

7) Let stand several hours before use.

8) Filter stock solution, then store it (protected from light) at 4°C for 2 days

before use.

9) Use a 1:100 dilution of this stock to stain grids.

200

Antibody Staining Protocol –Modified from Finney and Ruvkin 1990 and Anne

Marie McKnight

I.Fixation:

1) Wash worms from ~4 crowded plates with M9 into 15mL conical tube, spun

down 1.5krpms, for 1 min.

2) Wash worms with M9 3 times, spinning down and removing supernatant after

each wash.

3) Wash worms with mQH2O

4) Resuspend pellet in mQH2O to a total of 900µL

5) In hood- add 1mL 2XRFB and 110uL Formaldehyde (37%)

6) Mix gently, parafilm tube

7) Freeze in dry ice/ethanol mix (still in 15mL conical), then store the frozen worms

at -80°C (Worms can stay like this overnight)

8) Remove tube from -80°C. Thaw under warm water,; place on ice/water bath for 3

hrs, gently shaking every half hour.

9) Spin at 1krpm for 1 min.

10) Wash 2x with 2mL TTE

11) After second wash, add 2 mLs of TTE +1% β-mercaptoethanol.

12) Incubate worms in 37°C water bath for 3 hrs, mixing gently every half hour.

13) Spin 1000rpm for 1 min.

14) Remove supernatant (in hood)

15) Wash with 2mLs 1xBO3 buffer +10mM DTT. Remove Super.

16) Add 2mLs 1xBO3 Buffer

17) Incubate for 15mins at 37°C

18) Spin, remove super, wash with 2mLs 1XBO3.

19) Add 2mL 1xBO3 + 0.3% H2O2. Incubate for 15mins at 37°C.

20) Spin down and remove super. Wash with 2mL 1xBO3, remove super.

21) Add 3mL PTC. Rock at RT for 30min.

22) Spin down and remove super. Add 2 mL PTB.

23) Store worms at 4°C.

II.Staining:

1) Transfer 40uL packed fixed worms to a microcentrifuge tube.

2) Add primary antibodies and PTB, up to 200uL

3) Rock overnight at 4°C.

4) Spin down 1500RPM for 1 min.

201

5) Remove super and wash with 1mL PTC

6) Spin, remove super, resuspend in 1mL PTC

7) Shake/rock 1 hr.

8) Repeat 2 more times

9) Final wash with PTB

10) After last wash, add PTB to 40uL.

11) Add secondary antibodies in PTB up to 200uL

12) Rock for 2.5hrs at room temperature.

13) Immediate and 1 hr PTB wash

14) Resuspend in 200uL PTC, and rock overnight.

15) Quick wash and 1 hr wash with PTC.

16) Store at 4°C in 200uL PTC. Worms are ready to mount.

Solutions for antibody staining:

1) 5xPBS pH 7.0-7.2

7.31g NaCl

2.36g Na2HPO4

1.31g NaH2PO4*2H2O

Add dH2O up to 1L

2) 2XMRWB (2XRFB)

5mL 0.2M EGTS

5mL 0.3M PIPES

8mL 1.0 M KCl

2mL 1.0M KCl

0.5mL 1.0M spermadine

pH to 7.4 with HCl

add dH2O to 25mLs (~4.5mL)

add 25mLs Methanol

3) TTB (TTE)

10mL 1M Tris *Cl pH7.4

200uL 0.5M EDTA

1mL Triton X-100

Add dH2O to 100mL (~89mL)

4) 100xBO3 (Borate) Buffer

1M H3BO3, pH9.2

5) PTB ( aka AbA)

48.72mL 1xPBS

0.5g BSA

100uL 0.5M EDTA

202

0.781mL 1M NaN3

250µL Triton X-100

6) PTC ( aka AbB)

194.9 mL 1xPBS

0.2g BSA

1.0 mL 1.5M EDTA

3.1 mL 1M NaN3

1.0mL Triton X-100

203

Freeze-Crack Staining Protocol

Adapted from the Priess lab (Leung et al 1999).

Freeze embryos by placing them in a drop of M9 on a poly-L-lysine coated slide (from

4degC incubator) and dropping a coverslip on top, leaving some overhang, for easy

removal of the coverslip. Use as small a drop of M9 as possible, so the embryos don’t

get washed away when you drop on the coverslip. Place the slide on a metal plate on dry

ice. (The metal plate should be pre-cooled on the dry ice for at least an hour before

placing the slide on it)

Crack coverslip off of slide after at least 1 hr on cold metal plate, then immediately

proceeded with the following steps:

15 min in -20degC Methanol – after methanol wash, let the slide air dry for 30 sec-1min.

30 min PBS-T wash (PBS + 0.1% Tween-20) x2

30 min Block step (PBS + 1% BSA)

Overnight room temperature incubation of Primary antibody

30 min PBS-T wash (PBS + 0.1% Tween-20) x2

4hr room temperature incubation with Secondary antibody

Rinse with PBS.

Mount embryos with ~50% PBS and 50% mounting media.

204

General C. elegans embryo ablation protocol

I. Prepare laser:

1) Place a slide with a coverslip (and no crucial samples) onto the microscope.

Focus on coverslip of the slide.

2) Beginning with the attenuator on a very low setting, fire at the coverslip. Step

up attenuator (and therefore laser power) one notch at a time, until one shot of

the laser can crack the coverslip.

3) Shift the attenuator back down one step, and use this attenuator setting for

ablations.

II. Mount embryos:

The key is minimizing the amount of time the embryo spends on a slide.

1) Pick a few embryos at a time onto a slide with a 4% Noble Agar pad.

2) If the embryo is not the desired stage, fire at the surface off the eggshell to

destroy the embryo so it will not be recovered from the slide.

3) Focus on the nucleus of the target cell, and fire. Record the number of

“clicks” of the laser. The number of clicks required, as well as the best

attenuator setting will depend on the target cell, and the age of the dye in the

laser. Perform the ablations quickly, then remove the slide from the scope.

III. Recover embryos:

1) Pop off the coverslip. To generate a useful tool for this, use a razor to sharpen

one edge of a pipette tip, then wedge the tip between the glass slide and the

overhang of the coverslip. Use the modified pipette like a lever to pop off the

coverslip.

2) Recover the ablated embryos (off of the agar pad, or the coverslip) using a

pick covered with a lot of bacteria.

205

Bibliography

Abdus-Saboor, I., Mancuso, V. P., Murray, J. I., Palozola, K., Norris, C., Hall, D. H.,

Howell, K., Huang, K., Sundaram, M. V., 2011. Notch and Ras promote

sequential steps of excretory tube development in C. elegans. Development. 138,

3545-55.

Achilleos, A., Wehman, A. M., Nance, J., 2010. PAR-3 mediates the initial clustering and

apical localization of junction and polarity proteins during C. elegans intestinal

epithelial cell polarization. Development. 137, 1833-42.

Acloque, H., Adams, M. S., Fishwick, K., Bronner-Fraser, M., Nieto, M. A., 2009.

Epithelial-mesenchymal transitions: the importance of changing cell state in

development and disease. J Clin Invest. 119, 1438-49.

Ameye, L., Young, M. F., 2002. Mice deficient in small leucine-rich proteoglycans:

novel in vivo models for osteoporosis, osteoarthritis, Ehlers-Danlos syndrome,

muscular dystrophy, and corneal diseases. Glycobiology. 12, 107R-16R.

Anderson, D. C., Gill, J. S., Cinalli, R. M., Nance, J., 2008. Polarization of the C. elegans

embryo by RhoGAP-mediated exclusion of PAR-6 from cell contacts. Science.

320, 1771-4.

Bafna, S., Kaur, S., Batra, S. K., 2010. Membrane-bound mucins: the mechanistic basis

for alterations in the growth and survival of cancer cells. Oncogene. 29, 2893-904.

Bao, Z., Murray, J. I., Boyle, T., Ooi, S. L., Sandel, M. J., Waterston, R. H., 2006.

Automated cell lineage tracing in Caenorhabditis elegans. Proc Natl Acad Sci U S

A. 103, 2707-12.

Bar, T., Guldner, F. H., Wolff, J. R., 1984. "Seamless" endothelial cells of blood

capillaries. Cell Tissue Res. 235, 99-106.

Bastiani, C., Mendel, J., 2006. Heterotrimeric G proteins in C. elegans. WormBook. 1-

25.

Baum, B., Georgiou, M., 2011. Dynamics of adherens junctions in epithelial

establishment, maintenance, and remodeling. J Cell Biol. 192, 907-17.

Beitel, G. J., Tuck, S., Greenwald, I., Horvitz, H. R., 1995. The Caenorhabditis elegans

gene lin-1 encodes an ETS-domain protein and defines a branch of the vulval

induction pathway. Genes Dev. 9, 3149-62.

Benenati, G., Penkov, S., Muller-Reichert, T., Entchev, E. V., Kurzchalia, T. V., 2009.

Two cytochrome P450s in Caenorhabditis elegans are essential for the

organization of eggshell, correct execution of meiosis and the polarization of

embryo. Mech Dev. 126, 382-93.

Bernadskaya, Y. Y., Patel, F. B., Hsu, H. T., Soto, M. C., 2011. Arp2/3 promotes junction

formation and maintenance in the Caenorhabditis elegans intestine by regulating

membrane association of apical proteins. Mol Biol Cell. 22, 2886-99.

Bernadskaya, Y. Y., Patel, F. B., Hsu, H. T., Soto, M. C., 2011. Arp2/3 promotes junction

formation and maintenance in the Caenorhabditis elegans intestine by regulating

membrane association of apical proteins. Mol Biol Cell. 22, 2886-99.

Berrier, A. L., Yamada, K. M., 2007. Cell-matrix adhesion. J Cell Physiol. 213, 565-73.

Berry, K. L., Bulow, H. E., Hall, D. H., Hobert, O., 2003. A C. elegans CLIC-like protein

206

required for intracellular tube formation and maintenance. Science. 302, 2134-7.

Bokel, C., Prokop, A., Brown, N. H., 2005. Papillote and Piopio: Drosophila ZP-domain

proteins required for cell adhesion to the apical extracellular matrix and

microtubule organization. J Cell Sci. 118, 633-42.

Bosher, J. M., Hahn, B. S., Legouis, R., Sookhareea, S., Weimer, R. M., Gansmuller, A.,

Chisholm, A. D., Rose, A. M., Bessereau, J. L., Labouesse, M., 2003. The

Caenorhabditis elegans vab-10 spectraplakin isoforms protect the epidermis

against internal and external forces. J Cell Biol. 161, 757-68.

Bossinger, O., Fukushige, T., Claeys, M., Borgonie, G., McGhee, J. D., 2004. The apical

disposition of the Caenorhabditis elegans intestinal terminal web is maintained by

LET-413. Dev Biol. 268, 448-56.

Bossinger, O., Klebes, A., Segbert, C., Theres, C., Knust, E., 2001. Zonula adherens

formation in Caenorhabditis elegans requires dlg-1, the homologue of the

Drosophila gene discs large. Dev Biol. 230, 29-42.

Boyle, T. J., Bao, Z., Murray, J. I., Araya, C. L., Waterston, R. H., 2006. AceTree: a tool

for visual analysis of Caenorhabditis elegans embryogenesis. BMC

Bioinformatics. 7, 275.

Brenner, S., 1974. The genetics of Caenorhabditis elegans. Genetics. 77, 71-94.

Broadie, K., Baumgartner, S., Prokop, A., 2011. Extracellular matrix and its receptors in

Drosophila neural development. Dev Neurobiol.

Brose, N., 2009. Synaptogenic proteins and synaptic organizers: "many hands make light

work". Neuron. 61, 650-2.

Bryant, D. M., Mostov, K. E., 2008. From cells to organs: building polarized tissue. Nat

Rev Mol Cell Biol. 9, 887-901.

Buechner, M., 2002. Tubes and the single C. elegans excretory cell. Trends Cell Biol. 12,

479-84.

Buechner, M., Hall, D. H., Bhatt, H., Hedgecock, E. M., 1999. Cystic canal mutants in

Caenorhabditis elegans are defective in the apical membrane domain of the renal

(excretory) cell. Dev Biol. 214, 227-41.

Bulow, H. E., Hobert, O., 2006. The molecular diversity of glycosaminoglycans shapes

animal development. Annu Rev Cell Dev Biol. 22, 375-407.

Cavaliere, V., Bernardi, F., Romani, P., Duchi, S., Gargiulo, G., 2008. Building up the

Drosophila eggshell: first of all the eggshell genes must be transcribed. Dev Dyn.

237, 2061-72.

Chalfie, M., Au, M., 1989. Genetic control of differentiation of the Caenorhabditis

elegans touch receptor neurons. Science. 243, 1027-33.

Chalfie, M., Thomson, J. N., Sulston, J. E., 1983. Induction of neuronal branching in

Caenorhabditis elegans. Science. 221, 61-3.

Chamcheu, J. C., Siddiqui, I. A., Syed, D. N., Adhami, V. M., Liovic, M., Mukhtar, H.,

2011. Keratin gene mutations in disorders of human skin and its appendages.

Arch Biochem Biophys. 508, 123-37.

Chi, X., Michos, O., Shakya, R., Riccio, P., Enomoto, H., Licht, J. D., Asai, N.,

Takahashi, M., Ohgami, N., Kato, M., Mendelsohn, C., Costantini, F., 2009. Ret-

dependent cell rearrangements in the Wolffian duct epithelium initiate ureteric

bud morphogenesis. Dev Cell. 17, 199-209.

207

Church, D. L., Guan, K. L., Lambie, E. J., 1995. Three genes of the MAP kinase cascade,

mek-2, mpk-1/sur-1 and let-60 ras, are required for meiotic cell cycle progression

in Caenorhabditis elegans. Development. 121, 2525-35.

Clark, D. V., Baillie, D. L., 1992. Genetic analysis and complementation by germ-line

transformation of lethal mutations in the unc-22 IV region of Caenorhabditis

elegans. Mol Gen Genet. 232, 97-105.

Costa, M., Draper, B. W., Priess, J. R., 1997. The role of actin filaments in patterning the

Caenorhabditis elegans cuticle. Dev Biol. 184, 373-84.

Costa, M., Raich, W., Agbunag, C., Leung, B., Hardin, J., Priess, J. R., 1998. A putative

catenin-cadherin system mediates morphogenesis of the Caenorhabditis elegans

embryo. J Cell Biol. 141, 297-308.

Cox, E. A., Hardin, J., 2004. Sticky worms: adhesion complexes in C. elegans. J Cell Sci.

117, 1885-97.

Cox, G. N., Laufer, J. S., Kusch, M., Edgar, R. S., 1980. Genetic and Phenotypic

Characterization of Roller Mutants of CAENORHABDITIS ELEGANS.

Genetics. 95, 317-39.

Davies, A. G., Spike, C. A., Shaw, J. E., Herman, R. K., 1999. Functional overlap

between the mec-8 gene and five sym genes in Caenorhabditis elegans. Genetics.

153, 117-34.

de Wit, J., Sylwestrak, E., O'Sullivan, M. L., Otto, S., Tiglio, K., Savas, J. N., Yates, J.

R., 3rd, Comoletti, D., Taylor, P., Ghosh, A., 2009. LRRTM2 interacts with

Neurexin1 and regulates excitatory synapse formation. Neuron. 64, 799-806.

Devine, W. P., Lubarsky, B., Shaw, K., Luschnig, S., Messina, L., Krasnow, M. A., 2005.

Requirement for chitin biosynthesis in epithelial tube morphogenesis. Proc Natl

Acad Sci U S A. 102, 17014-9.

DeVore, D. L., Horvitz, H. R., Stern, M. J., 1995. An FGF receptor signaling pathway is

required for the normal cell migrations of the sex myoblasts in C. elegans

hermaphrodites. Cell. 83, 611-20.

Ding, M., Woo, W. M., Chisholm, A. D., 2004. The cytoskeleton and epidermal

morphogenesis in C. elegans. Exp Cell Res. 301, 84-90.

Diogon, M., Wissler, F., Quintin, S., Nagamatsu, Y., Sookhareea, S., Landmann, F.,

Hutter, H., Vitale, N., Labouesse, M., 2007. The RhoGAP RGA-2 and LET-

502/ROCK achieve a balance of actomyosin-dependent forces in C. elegans

epidermis to control morphogenesis. Development. 134, 2469-79.

Dityatev, A., Seidenbecher, C. I., Schachner, M., 2010. Compartmentalization from the

outside: the extracellular matrix and functional microdomains in the brain. Trends

Neurosci. 33, 503-12.

Dolan, J., Walshe, K., Alsbury, S., Hokamp, K., O'Keeffe, S., Okafuji, T., Miller, S. F.,

Tear, G., Mitchell, K. J., 2007. The extracellular leucine-rich repeat superfamily;

a comparative survey and analysis of evolutionary relationships and expression

patterns. BMC Genomics. 8, 320.

Dressler, G. R., 2009. Advances in early kidney specification, development and

patterning. Development. 136, 3863-74.

Duerr, J. S., Frisby, D. L., Gaskin, J., Duke, A., Asermely, K., Huddleston, D., Eiden, L.

E., Rand, J. B., 1999. The cat-1 gene of Caenorhabditis elegans encodes a

208

vesicular monoamine transporter required for specific monoamine-dependent

behaviors. J Neurosci. 19, 72-84.

Fakhouri, M., Elalayli, M., Sherling, D., Hall, J. D., Miller, E., Sun, X., Wells, L.,

LeMosy, E. K., 2006. Minor proteins and enzymes of the Drosophila eggshell

matrix. Dev Biol. 293, 127-41.

Ferguson, E. L., Horvitz, H. R., 1985. Identification and characterization of 22 genes that

affect the vulval cell lineages of the nematode Caenorhabditis elegans. Genetics.

110, 17-72.

Fernandes, I., Chanut-Delalande, H., Ferrer, P., Latapie, Y., Waltzer, L., Affolter, M.,

Payre, F., Plaza, S., 2010. Zona pellucida domain proteins remodel the apical

compartment for localized cell shape changes. Dev Cell. 18, 64-76.

Finney, M., Ruvkun, G., 1990. The unc-86 gene product couples cell lineage and cell

identity in C. elegans. Cell. 63, 895-905.

Fire, A., Kondo, K., Waterston, R., 1990. Vectors for low copy transformation of C.

elegans. Nucleic Acids Res. 18, 4269-70.

Folkman, J., Haudenschild, C., 1980. Angiogenesis in vitro. Nature. 288, 551-6.

Francis, R., Waterston, R. H., 1991. Muscle cell attachment in Caenorhabditis elegans. J

Cell Biol. 114, 465-79.

Fritz, J. A., Behm, C. A., 2009. CUTI-1: A novel tetraspan protein involved in C. elegans

CUTicle formation and epithelial integrity. PLoS One. 4, e5117.

Gendler, S. J., Spicer, A. P., 1995. Epithelial mucin genes. Annu Rev Physiol. 57, 607-

34.

Gerhardt, H., 2008. VEGF and endothelial guidance in angiogenic sprouting.

Organogenesis. 4, 241-6.

Gettner, S. N., Kenyon, C., Reichardt, L. F., 1995. Characterization of beta pat-3

heterodimers, a family of essential integrin receptors in C. elegans. J Cell Biol.

129, 1127-41.

Ghabrial, A., Luschnig, S., Metzstein, M. M., Krasnow, M. A., 2003. Branching

morphogenesis of the Drosophila tracheal system. Annu Rev Cell Dev Biol. 19,

623-47.

Ghabrial, A. S., Krasnow, M. A., 2006. Social interactions among epithelial cells during

tracheal branching morphogenesis. Nature. 441, 746-9.

Giepmans, B. N., van Ijzendoorn, S. C., 2009. Epithelial cell-cell junctions and plasma

membrane domains. Biochim Biophys Acta. 1788, 820-31.

Gilleard, J. S., Barry, J. D., Johnstone, I. L., 1997. cis regulatory requirements for

hypodermal cell-specific expression of the Caenorhabditis elegans cuticle

collagen gene dpy-7. Mol Cell Biol. 17, 2301-11.

Glasheen, B. M., Robbins, R. M., Piette, C., Beitel, G. J., Page-McCaw, A., 2010. A

matrix metalloproteinase mediates airway remodeling in Drosophila. Dev Biol.

344, 772-83.

Gobel, V., Barrett, P. L., Hall, D. H., Fleming, J. T., 2004. Lumen morphogenesis in C.

elegans requires the membrane-cytoskeleton linker erm-1. Dev Cell. 6, 865-73.

Goldstein, B., Macara, I. G., 2007. The PAR proteins: fundamental players in animal cell

polarization. Dev Cell. 13, 609-22.

Goodyear, R. J., Richardson, G. P., 2002. Extracellular matrices associated with the

209

apical surfaces of sensory epithelia in the inner ear: molecular and structural

diversity. J Neurobiol. 53, 212-27.

Govindarajan, B., Gipson, I. K., 2010. Membrane-tethered mucins have multiple

functions on the ocular surface. Exp Eye Res. 90, 655-63.

Greenwald, I. S., Sternberg, P. W., Horvitz, H. R., 1983. The lin-12 locus specifies cell

fates in Caenorhabditis elegans. Cell. 34, 435-44.

Hedgecock, E. M., Culotti, J. G., Hall, D. H., 1990. The unc-5, unc-6, and unc-40 genes

guide circumferential migrations of pioneer axons and mesodermal cells on the

epidermis in C. elegans. Neuron. 4, 61-85.

Hedgecock, E. M., Sulston, J. E., Thomson, J. N., 1983. Mutations affecting programmed

cell deaths in the nematode Caenorhabditis elegans. Science. 220, 1277-9.

Herman, R. K., 1978. Crossover suppressors and balanced recessive lethals in

Caenorhabditis elegans. Genetics. 88, 49-65.

Hill, R. J., Sternberg, P. W., 1992. The gene lin-3 encodes an inductive signal for vulval

development in C. elegans. Nature. 358, 470-6.

Hodgkin, J., 1983. Male Phenotypes and Mating Efficiency in CAENORHABDITIS

ELEGANS. Genetics. 103, 43-64.

Hodgkin, J., Genetics. In: T. B. D.L. Riddle, B.J. Meyer, and J.R. Priess, (Ed.), C.

elegans II. Cold Spring Harbor Laboratory Press, Plainview, N.Y., 1997, pp. 881-

1047.

Hogan, B. L., Kolodziej, P. A., 2002. Organogenesis: molecular mechanisms of

tubulogenesis. Nat Rev Genet. 3, 513-23.

Hollingsworth, M. A., Swanson, B. J., 2004. Mucins in cancer: protection and control of

the cell surface. Nat Rev Cancer. 4, 45-60.

Horvitz, H. R., Sulston, J. E., 1980. Isolation and genetic characterization of cell-lineage

mutants of the nematode Caenorhabditis elegans. Genetics. 96, 435-54.

Howard, R. M., Sundaram, M. V., 2002. C. elegans EOR-1/PLZF and EOR-2 positively

regulate Ras and Wnt signaling and function redundantly with LIN-25 and the

SUR-2 Mediator component. Genes Dev. 16, 1815-27.

Howell, K., Arur, S., Schedl, T., Sundaram, M. V., 2010. EOR-2 is an obligate binding

partner of the BTB-zinc finger protein EOR-1 in Caenorhabditis elegans.

Genetics. 184, 899-913.

Hudson, M. J., Stamp, G. W., Chaudhary, K. S., Hewitt, R., Stubbs, A. P., Abel, P. D.,

Lalani, E. N., 2001. Human MUC1 mucin: a potent glandular morphogen. J

Pathol. 194, 373-83.

Hwang, B. J., Sternberg, P. W., 2004. A cell-specific enhancer that specifies lin-3

expression in the C. elegans anchor cell for vulval development. Development.

131, 143-51.

Hynes, R. O., 2009. The extracellular matrix: not just pretty fibrils. Science. 326, 1216-9.

Inglis, P. N., Boroevich, K. A., Leroux, M. R., 2006. Piecing together a ciliome. Trends

Genet. 22, 491-500.

Iruela-Arispe, M. L., Davis, G. E., 2009. Cellular and molecular mechanisms of vascular

lumen formation. Dev Cell. 16, 222-31.

Jacobs, D., Beitel, G. J., Clark, S. G., Horvitz, H. R., Kornfeld, K., 1998. Gain-of-

function mutations in the Caenorhabditis elegans lin-1 ETS gene identify a C-

210

terminal regulatory domain phosphorylated by ERK MAP kinase. Genetics. 149,

1809-22.

Jarriault, S., Schwab, Y., Greenwald, I., 2008. A Caenorhabditis elegans model for

epithelial-neuronal transdifferentiation. Proc Natl Acad Sci U S A. 105, 3790-5.

Jazwinska, A., Affolter, M., 2004. A family of genes encoding zona pellucida (ZP)

domain proteins is expressed in various epithelial tissues during Drosophila

embryogenesis. Gene Expr Patterns. 4, 413-21.

Jazwinska, A., Ribeiro, C., Affolter, M., 2003. Epithelial tube morphogenesis during

Drosophila tracheal development requires Piopio, a luminal ZP protein. Nat Cell

Biol. 5, 895-901.

Jiang, Y., Horner, V., Liu, J., 2005. The HMX homeodomain protein MLS-2 regulates

cleavage orientation, cell proliferation and cell fate specification in the C. elegans

postembryonic mesoderm. Development. 132, 4119-30.

Johnson, A. D., Fitzsimmons, D., Hagman, J., Chamberlin, H. M., 2001. EGL-38 Pax

regulates the ovo-related gene lin-48 during Caenorhabditis elegans organ

development. Development. 128, 2857-65.

Johnson, C. D., Duckett, J. G., Culotti, J. G., Herman, R. K., Meneely, P. M., Russell, R.

L., 1981. An acetylcholinesterase-deficient mutant of the nematode

Caenorhabditis elegans. Genetics. 97, 261-79.

Johnstone, I. L., 2000. Cuticle collagen genes. Expression in Caenorhabditis elegans.

Trends Genet. 16, 21-7.

Johnstone, I. L., Barry, J. D., 1996. Temporal reiteration of a precise gene expression

pattern during nematode development. EMBO J. 15, 3633-9.

Jones, S. J., Baillie, D. L., 1995. Characterization of the let-653 gene in Caenorhabditis

elegans. Mol Gen Genet. 248, 719-26.

Kalamajski, S., Oldberg, A., 2010. The role of small leucine-rich proteoglycans in

collagen fibrillogenesis. Matrix Biol. 29, 248-53.

Kalluri, R., Neilson, E. G., 2003. Epithelial-mesenchymal transition and its implications

for fibrosis. J Clin Invest. 112, 1776-84.

Kalluri, R., Weinberg, R. A., 2009. The basics of epithelial-mesenchymal transition. J

Clin Invest. 119, 1420-8.

Kao, G., Huang, C. C., Hedgecock, E. M., Hall, D. H., Wadsworth, W. G., 2006. The role

of the laminin beta subunit in laminin heterotrimer assembly and basement

membrane function and development in C. elegans. Dev Biol. 290, 211-9.

Kawai, T., Akira, S., 2010. The role of pattern-recognition receptors in innate immunity:

update on Toll-like receptors. Nat Immunol. 11, 373-84.

Knust, E., Bossinger, O., 2002. Composition and formation of intercellular junctions in

epithelial cells. Science. 298, 1955-9.

Ko, J., Fuccillo, M. V., Malenka, R. C., Sudhof, T. C., 2009. LRRTM2 functions as a

neurexin ligand in promoting excitatory synapse formation. Neuron. 64, 791-8.

Kobe, B., Deisenhofer, J., 1994. The leucine-rich repeat: a versatile binding motif. Trends

Biochem Sci. 19, 415-21.

Koh, K., Rothman, J. H., 2001. ELT-5 and ELT-6 are required continuously to regulate

epidermal seam cell differentiation and cell fusion in C. elegans. Development.

128, 2867-80.

211

Kohsaka, H., Nose, A., 2009. Target recognition at the tips of postsynaptic filopodia:

accumulation and function of Capricious. Development. 136, 1127-35.

Kondo, M., Kanemoto, N., Taniguchi, Y., Iwanaga, T., Arita, N., Nose, M., Tanigami,

A., 2000. Atypical hyperplasia of choledocho-pancreatic duct epithelium in an

Otsuka Long Evans Tokushima Fatty strain of rats. Pathol Int. 50, 126-35.

Koppen, M., Simske, J. S., Sims, P. A., Firestein, B. L., Hall, D. H., Radice, A. D.,

Rongo, C., Hardin, J. D., 2001. Cooperative regulation of AJM-1 controls

junctional integrity in Caenorhabditis elegans epithelia. Nat Cell Biol. 3, 983-91.

Kramer, J. M., Extracellular Matrix. In: T. B. D.L. Riddle, B.J. Meyer, and J.R. Priess,

(Ed.), C. elegans II. Cold Spring Harbor Laboratory Press, Plainview, N.Y., 1997,

pp. 471-500.

Krause, C., Wolf, C., Hemphala, J., Samakovlis, C., Schuh, R., 2006. Distinct functions

of the leucine-rich repeat transmembrane proteins capricious and tartan in the

Drosophila tracheal morphogenesis. Dev Biol. 296, 253-64.

Kufe, D. W., 2009. Mucins in cancer: function, prognosis and therapy. Nat Rev Cancer.

9, 874-85.

Kurusu, M., Cording, A., Taniguchi, M., Menon, K., Suzuki, E., Zinn, K., 2008. A screen

of cell-surface molecules identifies leucine-rich repeat proteins as key mediators

of synaptic target selection. Neuron. 59, 972-85.

Labouesse, M., 2006. Epithelial junctions and attachments. WormBook. 1-21.

Lambie, E. J., Kimble, J., 1991. Two homologous regulatory genes, lin-12 and glp-1,

have overlapping functions. Development. 112, 231-40.

Lee, M., Cram, E. J., Shen, B., Schwarzbauer, J. E., 2001. Roles for beta(pat-3) integrins

in development and function of Caenorhabditis elegans muscles and gonads. J

Biol Chem. 276, 36404-10.

Legouis, R., Gansmuller, A., Sookhareea, S., Bosher, J. M., Baillie, D. L., Labouesse, M.,

2000. LET-413 is a basolateral protein required for the assembly of adherens

junctions in Caenorhabditis elegans. Nat Cell Biol. 2, 415-22.

Leung, B., Hermann, G. J., Priess, J. R., 1999. Organogenesis of the Caenorhabditis

elegans intestine. Dev Biol. 216, 114-34.

Levi, B. P., Genetic control of tube formation and maintenance in Drosophila treacheal

terminal cells. Stanford University, 2006.

Levi, B. P., Ghabrial, A. S., Krasnow, M. A., 2006. Drosophila talin and integrin genes

are required for maintenance of tracheal terminal branches and luminal

organization. Development. 133, 2383-93.

Levitan, D., Greenwald, I., 1998. LIN-12 protein expression and localization during

vulval development in C. elegans. Development. 125, 3101-9.

Linhoff, M. W., Lauren, J., Cassidy, R. M., Dobie, F. A., Takahashi, H., Nygaard, H. B.,

Airaksinen, M. S., Strittmatter, S. M., Craig, A. M., 2009. An unbiased expression

screen for synaptogenic proteins identifies the LRRTM protein family as synaptic

organizers. Neuron. 61, 734-49.

Litscher, E. S., Williams, Z., Wassarman, P. M., 2009. Zona pellucida glycoprotein ZP3

and fertilization in mammals. Mol Reprod Dev. 76, 933-41.

Lubarsky, B., Krasnow, M. A., 2003. Tube morphogenesis: making and shaping

biological tubes. Cell. 112, 19-28.

212

Luschnig, S., Batz, T., Armbruster, K., Krasnow, M. A., 2006. serpentine and vermiform

encode matrix proteins with chitin binding and deacetylation domains that limit

tracheal tube length in Drosophila. Curr Biol. 16, 186-94.

Lynch, A. M., Hardin, J., 2009. The assembly and maintenance of epithelial junctions in

C. elegans. Front Biosci. 14, 1414-32.

MacQueen, A. J., Baggett, J. J., Perumov, N., Bauer, R. A., Januszewski, T., Schriefer,

L., Waddle, J. A., 2005. ACT-5 is an essential Caenorhabditis elegans actin

required for intestinal microvilli formation. Mol Biol Cell. 16, 3247-59.

Malhas, A. N., Abuknesha, R. A., Price, R. G., 2002. Interaction of the leucine-rich

repeats of polycystin-1 with extracellular matrix proteins: possible role in cell

proliferation. J Am Soc Nephrol. 13, 19-26.

Mani, S. A., Guo, W., Liao, M. J., Eaton, E. N., Ayyanan, A., Zhou, A. Y., Brooks, M.,

Reinhard, F., Zhang, C. C., Shipitsin, M., Campbell, L. L., Polyak, K., Brisken,

C., Yang, J., Weinberg, R. A., 2008. The epithelial-mesenchymal transition

generates cells with properties of stem cells. Cell. 133, 704-15.

Mao, Y., Kerr, M., Freeman, M., 2008. Modulation of Drosophila retinal epithelial

integrity by the adhesion proteins capricious and tartan. PLoS One. 3, e1827.

Marchiando, A. M., Graham, W. V., Turner, J. R., 2010. Epithelial barriers in

homeostasis and disease. Annu Rev Pathol. 5, 119-44.

Margaritis, L. H., Kafatos, F. C., Petri, W. H., 1980. The eggshell of Drosophila

melanogaster. I. Fine structure of the layers and regions of the wild-type eggshell.

J Cell Sci. 43, 1-35.

McCaffrey, L. M., Macara, I. G., 2011. Epithelial organization, cell polarity, and

tumorigenesis. Trends Cell Biol.

McKeown, C., Praitis, V., Austin, J., 1998. sma-1 encodes a betaH-spectrin homolog

required for Caenorhabditis elegans morphogenesis. Development. 125, 2087-98.

McMahon, L., Legouis, R., Vonesch, J. L., Labouesse, M., 2001. Assembly of C. elegans

apical junctions involves positioning and compaction by LET-413 and protein

aggregation by the MAGUK protein DLG-1. J Cell Sci. 114, 2265-77.

Meneely, P. M., Herman, R. K., 1979. Lethals, steriles and deficiencies in a region of the

X chromosome of Caenorhabditis elegans. Genetics. 92, 99-115.

Meneely, P. M., Herman, R. K., 1981. Suppression and function of X-linked lethal and

sterile mutations in Caenorhabditis elegans. Genetics. 97, 65-84.

Moerman, D. G., Barstead, R. J., 2008. Towards a mutation in every gene in

Caenorhabditis elegans. Brief Funct Genomic Proteomic. 7, 195-204.

Moncada, D. M., Kammanadiminti, S. J., Chadee, K., 2003. Mucin and Toll-like

receptors in host defense against intestinal parasites. Trends Parasitol. 19, 305-11.

Moribe, H., Yochem, J., Yamada, H., Tabuse, Y., Fujimoto, T., Mekada, E., 2004.

Tetraspanin protein (TSP-15) is required for epidermal integrity in Caenorhabditis

elegans. J Cell Sci. 117, 5209-20.

Moskowitz, I. P., Rothman, J. H., 1996. lin-12 and glp-1 are required zygotically for

early embryonic cellular interactions and are regulated by maternal GLP-1

signaling in Caenorhabditis elegans. Development. 122, 4105-17.

Motegi, F., Sugimoto, A., 2006. Sequential functioning of the ECT-2 RhoGEF, RHO-1

and CDC-42 establishes cell polarity in Caenorhabditis elegans embryos. Nat Cell

213

Biol. 8, 978-85.

Moussian, B., Tang, E., Tonning, A., Helms, S., Schwarz, H., Nusslein-Volhard, C., Uv,

A. E., 2006. Drosophila Knickkopf and Retroactive are needed for epithelial tube

growth and cuticle differentiation through their specific requirement for chitin

filament organization. Development. 133, 163-71.

Murray, J. I., Bao, Z., Boyle, T. J., Waterston, R. H., 2006. The lineaging of

fluorescently-labeled Caenorhabditis elegans embryos with StarryNite and

AceTree. Nat Protoc. 1, 1468-76.

Nelson, C. M., Bissell, M. J., 2006. Of extracellular matrix, scaffolds, and signaling:

tissue architecture regulates development, homeostasis, and cancer. Annu Rev

Cell Dev Biol. 22, 287-309.

Nelson, F. K., Albert, P. S., Riddle, D. L., 1983. Fine structure of the Caenorhabditis

elegans secretory-excretory system. J Ultrastruct Res. 82, 156-71.

Nelson, F. K., Riddle, D. L., 1984. Functional study of the Caenorhabditis elegans

secretory-excretory system using laser microsurgery. J Exp Zool. 231, 45-56.

Neves, A., Priess, J. R., 2005. The REF-1 family of bHLH transcription factors pattern C.

elegans embryos through Notch-dependent and Notch-independent pathways. Dev

Cell. 8, 867-79.

Novelli, J., Page, A. P., Hodgkin, J., 2006. The C terminus of collagen SQT-3 has

complex and essential functions in nematode collagen assembly. Genetics. 172,

2253-67.

Oka, T., Yamamoto, R., Futai, M., 1997. Three vha genes encode proteolipids of

Caenorhabditis elegans vacuolar-type ATPase. Gene structures and preferential

expression in an H-shaped excretory cell and rectal cells. J Biol Chem. 272,

24387-92.

Page, A. P., Johnstone, I. L., 2007. The cuticle. WormBook. 1-15.

Partridge, F. A., Tearle, A. W., Gravato-Nobre, M. J., Schafer, W. R., Hodgkin, J., 2008.

The C. elegans glycosyltransferase BUS-8 has two distinct and essential roles in

epidermal morphogenesis. Dev Biol. 317, 549-59.

Payre, F., 2004. Genetic control of epidermis differentiation in Drosophila. Int J Dev

Biol. 48, 207-15.

Perens, E. A., Shaham, S., 2005. C. elegans daf-6 encodes a patched-related protein

required for lumen formation. Dev Cell. 8, 893-906.

Pettitt, J., Cox, E. A., Broadbent, I. D., Flett, A., Hardin, J., 2003. The Caenorhabditis

elegans p120 catenin homologue, JAC-1, modulates cadherin-catenin function

during epidermal morphogenesis. J Cell Biol. 162, 15-22.

Piekny, A. J., Johnson, J. L., Cham, G. D., Mains, P. E., 2003. The Caenorhabditis

elegans nonmuscle myosin genes nmy-1 and nmy-2 function as redundant

components of the let-502/Rho-binding kinase and mel-11/myosin phosphatase

pathway during embryonic morphogenesis. Development. 130, 5695-704.

Piekny, A. J., Wissmann, A., Mains, P. E., 2000. Embryonic morphogenesis in

Caenorhabditis elegans integrates the activity of LET-502 Rho-binding kinase,

MEL-11 myosin phosphatase, DAF-2 insulin receptor and FEM-2 PP2c

phosphatase. Genetics. 156, 1671-89.

Plaza, S., Chanut-Delalande, H., Fernandes, I., Wassarman, P. M., Payre, F., 2010. From

214

A to Z: apical structures and zona pellucida-domain proteins. Trends Cell Biol.

20, 524-32.

Pohl, C., Bao, Z., 2010. Chiral forces organize left-right patterning in C. elegans by

uncoupling midline and anteroposterior axis. Dev Cell. 19, 402-12.

Polyak, K., Weinberg, R. A., 2009. Transitions between epithelial and mesenchymal

states: acquisition of malignant and stem cell traits. Nat Rev Cancer. 9, 265-73.

Praitis, V., Ciccone, E., Austin, J., 2005. SMA-1 spectrin has essential roles in epithelial

cell sheet morphogenesis in C. elegans. Dev Biol. 283, 157-70.

Pries, A. R., Secomb, T. W., Gaehtgens, P., 2000. The endothelial surface layer. Pflugers

Arch. 440, 653-66.

Priess, J. R., Hirsh, D. I., 1986. Caenorhabditis elegans morphogenesis: the role of the

cytoskeleton in elongation of the embryo. Dev Biol. 117, 156-73.

Rappleye, C. A., Paredez, A. R., Smith, C. W., McDonald, K. L., Aroian, R. V., 1999.

The coronin-like protein POD-1 is required for anterior-posterior axis formation

and cellular architecture in the nematode caenorhabditis elegans. Genes Dev. 13,

2838-51.

Red-Horse, K., Ueno, H., Weissman, I. L., Krasnow, M. A., 2010. Coronary arteries form

by developmental reprogramming of venous cells. Nature. 464, 549-53.

Riddle, D. L., Blumenthal, T., Meyer, B. J., Priess, J. R., 1997. Introduction to C.

elegans.

Roberts, B., Clucas, C., Johnstone, I. L., 2003. Loss of SEC-23 in Caenorhabditis elegans

causes defects in oogenesis, morphogenesis, and extracellular matrix secretion.

Mol Biol Cell. 14, 4414-26.

Rocheleau, C. E., Howard, R. M., Goldman, A. P., Volk, M. L., Girard, L. J., Sundaram,

M. V., 2002. A lin-45 raf enhancer screen identifies eor-1, eor-2 and unusual

alleles of Ras pathway genes in Caenorhabditis elegans. Genetics. 161, 121-31.

Ross, M. D., Bruggeman, L. A., Hanss, B., Sunamoto, M., Marras, D., Klotman, M. E.,

Klotman, P. E., 2003. Podocan, a novel small leucine-rich repeat protein

expressed in the sclerotic glomerular lesion of experimental HIV-associated

nephropathy. J Biol Chem. 278, 33248-55.

Roubin, R., Naert, K., Popovici, C., Vatcher, G., Coulier, F., Thierry-Mieg, J., Pontarotti,

P., Birnbaum, D., Baillie, D., Thierry-Mieg, D., 1999. let-756, a C. elegans fgf

essential for worm development. Oncogene. 18, 6741-7.

Roy, L. D., Sahraei, M., Subramani, D. B., Besmer, D., Nath, S., Tinder, T. L., Bajaj, E.,

Shanmugam, K., Lee, Y. Y., Hwang, S. I., Gendler, S. J., Mukherjee, P., 2011.

MUC1 enhances invasiveness of pancreatic cancer cells by inducing epithelial to

mesenchymal transition. Oncogene. 30, 1449-59.

Santella, A., Du, Z., Nowotschin, S., Hadjantonakis, A. K., Bao, Z., 2010. A hybrid blob-

slice model for accurate and efficient detection of fluorescence labeled nuclei in

3D. BMC Bioinformatics. 11, 580.

Sapio, M. R., Hilliard, M. A., Cermola, M., Favre, R., Bazzicalupo, P., 2005. The Zona

Pellucida domain containing proteins, CUT-1, CUT-3 and CUT-5, play essential

roles in the development of the larval alae in Caenorhabditis elegans. Dev Biol.

282, 231-45.

Sapir, A., Choi, J., Leikina, E., Avinoam, O., Valansi, C., Chernomordik, L. V.,

215

Newman, A. P., Podbilewicz, B., 2007. AFF-1, a FOS-1-regulated fusogen,

mediates fusion of the anchor cell in C. elegans. Dev Cell. 12, 683-98.

Schaefer, L., 2011. Small leucine-rich proteoglycans in kidney disease. J Am Soc

Nephrol. 22, 1200-7.

Schaefer, L., Iozzo, R. V., 2008. Biological functions of the small leucine-rich

proteoglycans: from genetics to signal transduction. J Biol Chem. 283, 21305-9.

Schafer, W. F., 2006. Genetics of egg-laying in worms. Annu Rev Genet. 40, 487-509.

Schonegg, S., Hyman, A. A., 2006. CDC-42 and RHO-1 coordinate acto-myosin

contractility and PAR protein localization during polarity establishment in C.

elegans embryos. Development. 133, 3507-16.

Schottenfeld, J., Song, Y., Ghabrial, A. S., 2010. Tube continued: morphogenesis of the

Drosophila tracheal system. Curr Opin Cell Biol. 22, 633-9.

Segbert, C., Johnson, K., Theres, C., van Furden, D., Bossinger, O., 2004. Molecular and

functional analysis of apical junction formation in the gut epithelium of

Caenorhabditis elegans. Dev Biol. 266, 17-26.

Shakya, R., Watanabe, T., Costantini, F., 2005. The role of GDNF/Ret signaling in

ureteric bud cell fate and branching morphogenesis. Dev Cell. 8, 65-74.

Shimizu-Hirota, R., Sasamura, H., Kuroda, M., Kobayashi, E., Saruta, T., 2004.

Functional characterization of podocan, a member of a new class in the small

leucine-rich repeat protein family. FEBS Lett. 563, 69-74.

Shin, K., Fogg, V. C., Margolis, B., 2006. Tight junctions and cell polarity. Annu Rev

Cell Dev Biol. 22, 207-35.

Shinza-Kameda, M., Takasu, E., Sakurai, K., Hayashi, S., Nose, A., 2006. Regulation of

layer-specific targeting by reciprocal expression of a cell adhesion molecule,

capricious. Neuron. 49, 205-13.

Shishido, E., Takeichi, M., Nose, A., 1998. Drosophila synapse formation: regulation by

transmembrane protein with Leu-rich repeats, CAPRICIOUS. Science. 280, 2118-

21.

Siddiqui, T. J., Pancaroglu, R., Kang, Y., Rooyakkers, A., Craig, A. M., 2010. LRRTMs

and neuroligins bind neurexins with a differential code to cooperate in glutamate

synapse development. J Neurosci. 30, 7495-506.

Simske, J. S., Hardin, J., 2011. Claudin family proteins in Caenorhabditis elegans.

Methods Mol Biol. 762, 147-69.

Simske, J. S., Kaech, S. M., Harp, S. A., Kim, S. K., 1996. LET-23 receptor localization

by the cell junction protein LIN-7 during C. elegans vulval induction. Cell. 85,

195-204.

Singh, N., Han, M., 1995. sur-2, a novel gene, functions late in the let-60 ras-mediated

signaling pathway during Caenorhabditis elegans vulval induction. Genes Dev. 9,

2251-65.

Sonnichsen, B., Koski, L. B., Walsh, A., Marschall, P., Neumann, B., Brehm, M.,

Alleaume, A. M., Artelt, J., Bettencourt, P., Cassin, E., Hewitson, M., Holz, C.,

Khan, M., Lazik, S., Martin, C., Nitzsche, B., Ruer, M., Stamford, J., Winzi, M.,

Heinkel, R., Roder, M., Finell, J., Hantsch, H., Jones, S. J., Jones, M., Piano, F.,

Gunsalus, K. C., Oegema, K., Gonczy, P., Coulson, A., Hyman, A. A., Echeverri,

C. J., 2005. Full-genome RNAi profiling of early embryogenesis in

216

Caenorhabditis elegans. Nature. 434, 462-9.

St Johnston, D., Sanson, B., 2011. Epithelial polarity and morphogenesis. Curr Opin Cell

Biol.

Sternberg, P. W., 2005. Vulval development. WormBook. 1-28.

Stone, C. E., Hall, D. H., Sundaram, M. V., 2009. Lipocalin signaling controls unicellular

tube development in the Caenorhabditis elegans excretory system. Dev Biol. 329,

201-11.

Struhl, G., Fitzgerald, K., Greenwald, I., 1993. Intrinsic activity of the Lin-12 and Notch

intracellular domains in vivo. Cell. 74, 331-45.

Sulston, J. E., Horvitz, H. R., 1977. Post-embryonic cell lineages of the nematode,

Caenorhabditis elegans. Dev Biol. 56, 110-56.

Sulston, J. E., Schierenberg, E., White, J. G., Thomson, J. N., 1983. The embryonic cell

lineage of the nematode Caenorhabditis elegans. Dev Biol. 100, 64-119.

Sundaram, M. V., 2005. The love-hate relationship between Ras and Notch. Genes Dev.

19, 1825-39.

Sundaram, M. V., 2006. RTK/Ras/MAPK signaling. WormBook. 1-19.

Swanson, L. E., Yu, M., Nelson, K. S., Laprise, P., Tepass, U., Beitel, G. J., 2009.

Drosophila convoluted/dALS is an essential gene required for tracheal tube

morphogenesis and apical matrix organization. Genetics. 181, 1281-90.

Tabuse, Y., Izumi, Y., Piano, F., Kemphues, K. J., Miwa, J., Ohno, S., 1998. Atypical

protein kinase C cooperates with PAR-3 to establish embryonic polarity in

Caenorhabditis elegans. Development. 125, 3607-14.

Taniguchi, H., Shishido, E., Takeichi, M., Nose, A., 2000. Functional dissection of

drosophila capricious: its novel roles in neuronal pathfinding and selective

synapse formation. J Neurobiol. 42, 104-16.

Tervonen, T. A., Partanen, J. I., Saarikoski, S. T., Myllynen, M., Marques, E., Paasonen,

K., Moilanen, A., Wohlfahrt, G., Kovanen, P. E., Klefstrom, J., 2011. Faulty

epithelial polarity genes and cancer. Adv Cancer Res. 111, 97-161.

Thornton, D. J., Rousseau, K., McGuckin, M. A., 2008. Structure and function of the

polymeric mucins in airways mucus. Annu Rev Physiol. 70, 459-86.

Tiensuu, T., Larsen, M. K., Vernersson, E., Tuck, S., 2005. lin-1 has both positive and

negative functions in specifying multiple cell fates induced by Ras/MAP kinase

signaling in C. elegans. Dev Biol. 286, 338-51.

Tonning, A., Hemphala, J., Tang, E., Nannmark, U., Samakovlis, C., Uv, A., 2005. A

transient luminal chitinous matrix is required to model epithelial tube diameter in

the Drosophila trachea. Dev Cell. 9, 423-30.

Tootle, T. L., Williams, D., Hubb, A., Frederick, R., Spradling, A., 2011. Drosophila

eggshell production: identification of new genes and coordination by Pxt. PLoS

One. 6, e19943.

Totong, R., Achilleos, A., Nance, J., 2007. PAR-6 is required for junction formation but

not apicobasal polarization in C. elegans embryonic epithelial cells. Development.

134, 1259-68.

Trougakos, I. P., Margaritis, L. H., 1998. Immunolocalization of the temporally "early"

secreted major structural chorion proteins, Dvs38 and Dvs36, in the eggshell

layers and regions of Drosophila virilis. J Struct Biol. 123, 111-23.

217

Tsarouhas, V., Senti, K. A., Jayaram, S. A., Tiklova, K., Hemphala, J., Adler, J.,

Samakovlis, C., 2007. Sequential pulses of apical epithelial secretion and

endocytosis drive airway maturation in Drosophila. Dev Cell. 13, 214-25.

Tuck, S., Greenwald, I., 1995. lin-25, a gene required for vulval induction in

Caenorhabditis elegans. Genes Dev. 9, 341-57.

Uv, A., Moussian, B., 2010. The apical plasma membrane of Drosophila embryonic

epithelia. Eur J Cell Biol. 89, 208-11.

Van Furden, D., Johnson, K., Segbert, C., Bossinger, O., 2004. The C. elegans ezrin-

radixin-moesin protein ERM-1 is necessary for apical junction remodelling and

tubulogenesis in the intestine. Dev Biol. 272, 262-76.

Voas, M. G., Rebay, I., 2004. Signal integration during development: insights from the

Drosophila eye. Dev Dyn. 229, 162-75.

Wang, S., Jayaram, S. A., Hemphala, J., Senti, K. A., Tsarouhas, V., Jin, H., Samakovlis,

C., 2006. Septate-junction-dependent luminal deposition of chitin deacetylases

restricts tube elongation in the Drosophila trachea. Curr Biol. 16, 180-5.

Wassarman, P. M., Litscher, E. S., 2009. The multifunctional zona pellucida and

mammalian fertilization. J Reprod Immunol. 83, 45-9.

Weaver, M., Krasnow, M. A., 2008. Dual origin of tissue-specific progenitor cells in

Drosophila tracheal remodeling. Science. 321, 1496-9.

Weimer, R. M., 2006. Preservation of C. elegans tissue via high-pressure freezing and

freeze-substitution for ultrastructural analysis and immunocytochemistry.

Methods Mol Biol. 351, 203-21.

Williams, B. D., Waterston, R. H., 1994. Genes critical for muscle development and

function in Caenorhabditis elegans identified through lethal mutations. J Cell

Biol. 124, 475-90.

Wilson, P. D., 2011. Apico-basal polarity in polycystic kidney disease epithelia. Biochim

Biophys Acta. 1812, 1239-48.

Wissmann, A., Ingles, J., Mains, P. E., 1999. The Caenorhabditis elegans mel-11 myosin

phosphatase regulatory subunit affects tissue contraction in the somatic gonad and

the embryonic epidermis and genetically interacts with the Rac signaling

pathway. Dev Biol. 209, 111-27.

Wissmann, A., Ingles, J., McGhee, J. D., Mains, P. E., 1997. Caenorhabditis elegans

LET-502 is related to Rho-binding kinases and human myotonic dystrophy kinase

and interacts genetically with a homolog of the regulatory subunit of smooth

muscle myosin phosphatase to affect cell shape. Genes Dev. 11, 409-22.

Woo, W. M., Goncharov, A., Jin, Y., Chisholm, A. D., 2004. Intermediate filaments are

required for C. elegans epidermal elongation. Dev Biol. 267, 216-29.

Yochem, J., Sundaram, M., Han, M., 1997. Ras is required for a limited number of cell

fates and not for general proliferation in Caenorhabditis elegans. Mol Cell Biol.

17, 2716-22.

Yoshimura, S., Murray, J. I., Lu, Y., Waterston, R. H., Shaham, S., 2008. mls-2 and vab-

3 Control glia development, hlh-17/Olig expression and glia-dependent neurite

extension in C. elegans. Development. 135, 2263-75.

Young, M. F., Bi, Y., Ameye, L., Chen, X. D., 2002. Biglycan knockout mice: new

models for musculoskeletal diseases. Glycoconj J. 19, 257-62.

218

Zeisberg, E. M., Tarnavski, O., Zeisberg, M., Dorfman, A. L., McMullen, J. R.,

Gustafsson, E., Chandraker, A., Yuan, X., Pu, W. T., Roberts, A. B., Neilson, E.

G., Sayegh, M. H., Izumo, S., Kalluri, R., 2007. Endothelial-to-mesenchymal

transition contributes to cardiac fibrosis. Nat Med. 13, 952-61.

Zhang, Y., Foster, J. M., Nelson, L. S., Ma, D., Carlow, C. K., 2005. The chitin synthase

genes chs-1 and chs-2 are essential for C. elegans development and responsible

for chitin deposition in the eggshell and pharynx, respectively. Dev Biol. 285,

330-9.

219