ENVIRONMENTAL BIOTECHNOLOGY

Effect of nutrient and selective inhibitor amendmentson methane oxidation, nitrous oxide production, and key genepresence and expression in landfill cover soils: characterizationof the role of methanotrophs, nitrifiers, and denitrifiers

Sung-Woo Lee & Jeongdae Im & Alan A. DiSpirito &

Levente Bodrossy & Michael J. Barcelona &

Jeremy D. Semrau

Received: 23 April 2009 /Revised: 4 August 2009 /Accepted: 2 September 2009 /Published online: 29 September 2009# Springer-Verlag 2009

Abstract Methane and nitrous oxide are both potent green-house gasses, with global warming potentials approximately25 and 298 times that of carbon dioxide. A matrix of soilmicrocosmswas constructed with landfill cover soils collectedfrom the King Highway Landfill in Kalamazoo,Michigan andexposed to geochemical parameters known to affect methaneconsumption by methanotrophs while also examining their

impact on biogenic nitrous oxide production. It was found thatrelatively dry soils (5% moisture content) along with 15 mgNH4

+ (kg soil)−1 and 0.1 mg phenylacetylene∙(kg soil)−1

provided the greatest stimulation of methane oxidation whileminimizing nitrous oxide production. Microarray analyses ofpmoA showed that the methanotrophic community structurewas dominated by Type II organisms, but Type I genera weremore evident with the addition of ammonia. When phenyl-acetylene was added in conjunction with ammonia, themethanotrophic community structure was more similar tothat observed in the presence of no amendments. PCRanalyses showed the presence of amoA from both ammonia-oxidizing bacteria and archaea, and that the presence of keygenes associated with these cells was reduced with theaddition of phenylacetylene. Messenger RNA analyses foundtranscripts of pmoA, but not of mmoX, nirK, norB, or amoAfrom either ammonia-oxidizing bacteria or archaea. Pureculture analyses showed that methanotrophs could producesignificant amounts of nitrous oxide, particularly whenexpressing the particulate methane monooxygenase(pMMO). Collectively, these data suggest that methano-trophs expressing pMMO played a role in nitrous oxideproduction in these microcosms.

Keywords Methanotroph . Landfill . Nitrous oxide .

Methane . Ammonia oxidizers

Introduction

One of the most significant environmental problems facingthe United States is the emission of greenhouse gasseswhich can lead to global warming, causing substantial

S.-W. Lee : J. Im : J. D. Semrau (*)Department of Civil and Environmental Engineering,The University of Michigan,1351 Beal Avenue,Ann Arbor, MI 48109-2125, USAe-mail: jsemrau@umich.edu

A. A. DiSpiritoDepartment of Biochemistry, Biophysics and Molecular Biology,Iowa State University,Ames, IA 50011-3211, USA

L. BodrossyDepartment of Biotechnology, ARC Seibersdorf Research GmbH,A-2444 Seibersdorf, Austria

M. J. BarcelonaDepartment of Chemistry, Western Michigan University,1903 W. Michigan,Kalamazoo, MI 49008-5413, USA

Present Address:S.-W. LeeOregon Graduate Institute, Department of Environmental andBiomolecular Systems, Oregon Health and Sciences University,20000 NW Walker Road,Beaverton, OR 97006, USA

Appl Microbiol Biotechnol (2009) 85:389–403DOI 10.1007/s00253-009-2238-7

ecosystem and climatic shifts. It is well-known that carbondioxide is the single largest contributor to the anthropo-genic greenhouse effect, accounting for ∼77% of theglobal annual emission of anthropogenic greenhouse gases(a total of ∼4.9•1016g of CO2 equivalents/year), butmethane and nitrous oxide are also very important,contributing ∼14% and 8%, respectively (IPCC 2007). Itis also well-known that methane and nitrous oxide haveglobal warming potentials approximately 25 and 298 timesthat of carbon dioxide over a 100 year time horizon,respectively, and that both methane and nitrous oxideconcentrations have exhibited substantial growth due toanthropogenic activity since 1998 (IPCC 2007). Therefore,substantial reduction in the net emission of methane andnitrous oxide can have profound impacts on reducing netglobal warming potential.

In particular, landfills are a major source of methane dueto methanogenic activity deep within the refuse, globallyreleasing between 3 and 7×1013g of methane/year (Reay etal. 2007), or 10–20% of the total global annual anthropo-genic emission of methane (IPCC 2007). Much more isproduced than ultimately released to the atmosphere due tomethanotrophic activity in the landfill cover soil. It isestimated that due to methanotrophic activity, between 10–90% of methane produced is typically removed (DeVisscher et al. 2007), Occasionally, landfill cover soilshave even been found to act as net methane sinks, i.e., insitu methanotrophic activity exceeds methanogenic activityresulting in the consumption of atmospheric methane aswell as that generated in the landfill (Boeckx et al. 1996;Bogner et al. 1997; Barlaz et al. 2004).

Currently, large landfills in the United States requireactive methane extraction systems to control methaneemissions (US EPA 1996). Despite these systems, landfillsin the USA are estimated to release∼4.2×1012g methane/year, or∼24% of all anthropogenic methane emissions inthe USA (Energy Information Administration 2008). Suchemissions can be prevented if in situ methanotrophicactivity can be stimulated. Current estimates of methaneremoval rates in cover soils through biological activityrange from 35 g×(m2×day)−1 to over 166 g×(m2×day)−1

(Whalen et al. 1990; Kightley et al. 1995; Stralis-Pavese etal. 2004). In some environments, methanotrophic activitycan be stimulated by nitrogen availability (Bodelier et al.2000). Additions of nitrogenous fertilizers, however, haveresulted in increased nitrous oxide emission rates (Amaraland Knowles 1995; Boeckx and Van Cleemput 1996; Houet al. 2000; Majumdar 2003; Nishimura et al. 2004).Landfills typically have N2O generation rates one to twoorders of magnitude greater than that observed in agricul-tural and forest soils, and it is estimated that in the USA,landfills emit ∼5.7×109g of nitrous oxide/year (Rinne et al.2005). It is unclear what the relative contributions of

different microbes are to N2O production in these soils,e.g., processes include nitrification by methanotrophs,ammonia-oxidizing bacteria or archaea, as well as denitri-fication, including denitrification by ammonia-oxidizingbacteria or archaea, or how to minimize such production.Therefore, effective strategies that combine both physicaland biological approaches to enhance methane removal insitu while preventing the inadvertent production of nitrousoxide should be developed. Specifically, if methane andnitrous oxide emissions from landfills in the USA could becompletely prevented, ∼1.06×1014g of CO2 equivalents/year would not enter the atmosphere, or ∼10% of the globalwarming potential associated with the annual anthropogenicemissions of methane and nitrous oxide in the USA(Energy Information Administration 2008).

To determine how best to stimulate methanotrophicactivity while minimizing nitrous oxide production, severalfactors known to affect methanotrophic activity, e.g., watercontent, copper, and nitrogen availability were examinedboth individually and in combination using soil microcosmscomposed of landfill cover soils from a recently closed andsoil capped landfill in Kalamazoo, Michigan. To character-ize the microorganisms responsible for nitrous oxideproduction, selective inhibitors of methanotrophs,ammonia-oxidizing bacteria, and denitrifiers, (phenylacety-lene and chlorate) were added to some microcosms.Phenylacetylene is a differential inhibitor of the ammoniamonooxygenase (AMO), soluble methane monooxygenase(sMMO), and membrane-associated methane monooxyge-nase (pMMO; Lontoh et al. 2000). Chlorate is an inhibitorof nitrate reductase (Kucera 2006). Using PCT and RT-PCR, the presence and expression of the functional genesinvolved in methane oxidation by methanotrophs, ammoniaoxidation by ammonia oxidizing bacteria and archaea, andnitrite reduction by denitrifiers, were examined. Finally, theresponse of the methanotrophic community structure tothese amendments was examined using microarrays basedon pmoA, a functional gene found in all methanotrophswith the exception of Methylocella sp. (Dedysh et al. 2000)and also commonly used to construct phylogenetic trees.

Methods and materials

Soil collection, preparation, and analyses Landfill coversoil at a depth between 40 and 60 cm below land surfacewas collected from King Highway Landfill (Kalamazoo,MI, USA) in 28 February 2006. The soil was air-dried,sieved to exclude soil particles less than 2 mm, and well-mixed by passing through a sample splitter (SoilTest,Evanston, IL, USA) 30 times to ensure all microcosmsreceived soil samples of identical composition, and storedat 4°C in the dark. The pH of the soil was measured after

390 Appl Microbiol Biotechnol (2009) 85:389–403

mixing 5 g of air-dried soil with 10 ml 0.01 M CaCl2 andshaking at 220 rpm for 30 min. Moisture content of the soilwas measured gravimetrically by measuring the weightbefore and after placing the soil in 120°C oven overnight.Inorganic N, i.e., NH4

+-N and (NO3−+NO2

−)-N wasextracted using 30 g of air-dried soil mixed with 60 mLof 2 M KCl. The solution was shaken on an orbital shaker(220 rpm) for 20 min and then passed through Whatman#42 filter paper. The filtrate was collected for measurementof inorganic N. NH4

+ and NO3−+NO2

− were measuredcolorimetrically from the filtrate using a rapid flow analyzer(OI Analytical, College Station, TX, USA). Bioavailablecopper was measured by using a “hot extract” methoddeveloped elsewhere (McBride et al. 2004). Briefly, 5 g ofair-dried soil was mixed with 12.5 mL of 0.01 M CaCl2.The solution was then heated at 90°C for 30 min. Theresulting solutions were filtered with #42 Whatman filterpaper and 10 μl nitric acid (Fisher Scientific Co., FairLawn, NJ, USA Trace metal grade) added. To measure thetotal copper associated with the soils, 0.5 g air-dried soilswere digested in 12 ml Aqua regia (1:3 ratio of 70% nitricacid (trace metal grade) and 35% hydrochloric acid (tracemetal grade)) at 110°C for 3 h. The resulting solution washeated at 60°C for∼3 h. Nitric acid (2% vol∙vol−1) was thenadded to adjust the total volume to 20 ml and filtered using#42 Whatman filter paper (Chen and Ma 2001). Copperwas then measured using inductively coupled plasma massspectrometry (ELAN DRC-e, PerkinElmer Sciex). 63Cuwas used for measurement of copper. 71Ga was added as aninternal standard. Bioavailable copper was measured byadding different amounts of copper sulfate to 20 g soilaliquots in 160 ml glass serum bottles. The moisturecontent was then adjusted to 15% (w/w) with distilleddeionized water and vials capped with Teflon-coated rubberbutyl stoppers (National Scientific Co., Duluth, GA, USA).After mixing thoroughly by shaking by hand for 5 min, thesoil samples were incubated for 7 days at 25°C, andbioavailable copper determined using the hot extractmethod described above.

Soil microcosms For microcosm studies, 160 ml serumbottles were soaked in 2N nitric acid bath for at least2 days, rinsed with MilliQ water at least five times, andautoclaved prior to use. Soils were stored at 25°C for 24 himmediately prior to soil microcosm study, and then 5 g ofair-dried soil added to individual serum bottles along withvarious amendments. Amendments tested to investigate theeffects on methane oxidation and nitrous oxide productionwere: (1) moisture content added as MilliQ water withresistivity above 18 mΩ to provide values between 5–30%;(2) copper added as CuSO4∙5H2O (JT Baker Chemical Co.,Phillipsburg, NJ,USA, Baker Analyzed)) to increase coppercontent to 5–500 mg Cu∙(kg soil)−1 above background

levels and; (3) ammonium added as NH4Cl (Sigma-Aldrich,St. Louis, MO, USA) to increase ammonia associatednitrogen levels 25–100 mg-N NH4

+∙(kg soil)−1 abovebackground levels, and (4) organic carbon added as humicacids (Sigma-Aldrich, St. Louis, MO, USA) to increaseorganic carbon content to 20–200 mg organic carbon(kg soil)−1 above background levels. To examine thepossibility of selectively inhibiting nitrous oxide productionby denitrifiers, chlorate was added to some microcosms.Chlorate was added as KClO3 (Sigma-Aldrich, St.Louis,MO, USA ACS reagent) to give final concentrations of1–10 mg chlorate∙(kg soil)−1. After amendments wereadded, the vials were then capped with Teflon coated butylrubber septum (National Scientific, Rockwood, TN, USA)and crimp sealed with aluminum caps. These parameterswere chosen as they have been shown to affect methaneoxidation and/or nitrous oxide production in either purecultures, soils, or soil slurry microcosms.

To ensure consistent initial amounts of methane andoxygen in all microcosms, predetermined amounts of CH4

and oxygen was added via a custom made apparatus toflush the sealed bottles in order to achieve the desiredconcentrations of CH4 and O2. Briefly, predeterminedmixing ratios of air (Metro Welding Supply Corp., Detroit,MI, USA Dry grade), methane (Airgas, Inc., Radnor, PA,USA>99.999%), and nitrogen (Metro Welding SupplyCorp., Detroit, MI, USA Pre-Purified) were generated bymixing using a series of three way valves to control theflow of the air, methane, and nitrogen. The entire vialheadspace was flushed for 3 min at a flow rate ofapproximately 300 ml∙min−1 to achieve the desired head-space composition.

For initial soil microcosm experiments, the impact ofindividual geochemical parameters on methane consump-tion and nitrous oxide production was examined. For thesesoil microcosms, 15% moisture content and 20% CH4, and10% O2 were used as baseline conditions. For subsequentsoil microcosm experiments, possible synergistic or antag-onistic effects of multiple geochemical parameters wereconsidered using 5% moisture content and 20% CH4, and10% O2 as baseline conditions as the initial round ofexperiments found maximal methane consumption ratesand minimal nitrous oxide production rates at this moisturecontent. Phenylacetylene was added at a concentration of0.1 g phenylacetylene (kg soil)−1 to a subset of microcosmsas this has been shown to selectively inhibit someammonia-oxidizing bacteria (Lontoh et al. 2000). For allmicrocosms, the vials were stored at 25 C in the darkduring the course of each experiment, which lasted∼150–170 h depending on the amendments applied. The initialrates of methane consumption and nitrous oxide productionwere measured using a 60-h time period from the onset ofeither methane oxidation or nitrous oxide production, which

Appl Microbiol Biotechnol (2009) 85:389–403 391

occurred within 50 h of inoculation. All conditions wereprepared in triplicate.

Methane and nitrous oxide measurements CH4 was mea-sured using an HP 6890 series equipped with a GS-Molesieve column (0.53 mm I.D. x 30 m) and a flameionization detector. 100 µl of vial headspace were manuallyinjected using a PressureLok® gas-tight syringe (BatonRouge, LA, USA). Temperature settings were: oven 75°C;inlet temperature 185°C, and detector temperature 250°Cwith gas flow rate of 25 ml∙min−1. H2 was used as carriergas while air and H2 was introduced into the detector. N2Owas measured using an HP 5890 series II equipped with aPoraplot-Q column (0.53 mm I.D.×25 m) and an electroncapture detector. 400 µl of headspace were manuallyinjected using a PressureLok® gas-tight syringe (BatonRouge, LA, USA). Temperature settings were: oven −10°C,inlet temperature 125°C; and detector temperature 275°Cwith gas flow rate of 56 ml min−1. N2 was used as bothcarrier and makeup gas. The oven temperature wasmaintained at such a low value by injecting liquid nitrogeninto the oven chamber using an automated cryogenic valve.

N2O production by methanotrophs To estimate the contri-bution of methanotrophic activity to N2O production from theoxidation of ammonia, Methylosinus trichosporium OB3b(NCIMB 11131) was grown in either 0.1× or 1× ammoniamineral salt media (AMS) media (Whittenbury et al. 1970).Copper, as CuSO4·5H2O (JT Baker Chemical Co., Phillips-burg, NJ, USA Baker analyzed) was added at a concentrationof 20 µM for pMMO expression, while separate systemswith no added copper were prepared for sMMO expression.Cells were first grown to the late exponential phase (opticaldensity at 600 nm [OD600] of 0.7–0.8) in either 0.1× or 1×AMS with or without copper to induce either sMMO orpMMO expression, respectively. Methane was provided asthe growth substrate. Cells were then diluted to an OD600 of0.07∼0.09 with the same prewarmed media. Five-milliliteraliquots of the diluted culture were then aseptically trans-ferred into specially constructed 32.5 serum vials (Lee et al.2006). The vials were capped with Teflon-coated butylrubber stoppers (National Scientific Co., Duluth, GA, USA)and crimp-sealed with aluminum caps. Methane and air wasadded to the vials in a 1:2 ratio using the custom-designedgassing apparatus described for soil microcosm experiments.The vials were incubated at 30°C with shaking at 250 rpm.All conditions were performed in duplicate. Growth and N2Oproduction was monitored until the stationary phase wasreached. MMO expression was monitored using the naph-thalene assay selective for sMMO activity (Brusseau et al.1990). Cell growth was monitored by measuring OD600,while N2O production was measured using GC-ECD asdescribed earlier.

DNA extraction and PCR assays DNA extraction wasperformed using UltraClean Soil DNA kit (MoBio Inc.,Solana, CA, USA) following the manufacturer’s instruc-tions. PCR amplification was performed using specificprimers for pmoA, mmoX, Bacterial amoA, Archaeal amoA,nirK and, norB, as shown in Table 1. PCR amplificationswere performed in 50 µl of mixtures using BiometraTPersonal thermal cycler system (Labrepco Inc., Horsham,PA, USA). Each mixture consisted of 5 µl 10× PCR buffer(Invitrogen Co., Carlsbad, CA, USA), 1.5 µl 50 mM MgCl2(Invitrogen), 1 µl 10 mM dNTP mixture (Invitrogen), 20pmoles of each primer, 2.5 units Taq DNA polymerase(Invitrogen), and 25 ng of DNA template. To reduce theinhibition of DNA polymerase, 1 µl of 20 mg/ml bovineserum albumin (BSA) was also added. (Kreader, 1996). ForpmoA, mmoX, and bacterial amoA gene amplification, theamplification program was: denaturation at 94°C for 5 min;36 cycles of 94°C for 1 min, 60°C for 1.5 min, 72°C for1.5 min; and a final extension at 72°C for 10 min. Forarchaeal amoA, the amplification program was: denatur-ation at 95°C for 5 min; 30 cycles consisting of 94°C for45 s, 53°C for 60 s, and 72°C for 60 s; and a finalextension at 72°C for 15 min. For nirK amplification usingthe primer set F1aCu-R3Cu, the amplification programwas: denaturation at 94°C for 3 min; 35 cycles of 94°C for30 s, 54°C for 1 min, 72°C for 1 min; and a final extensionat 72°C for 7 min. Amplification of the same gene with thenirK1-nirK5 primer set was performed using touchdownPCR. The amplification program was: denaturation at 95°Cfor 5 min; 35 cycles of 95°C for 40 s, 45°C for 40 s, 72°Cfor 40 s; and a final extension at 72°C. During the first tencycles, the annealing temperature was decreased by 0.5°Cevery cycle, starting at 45°C until it reached touchdown at40°C. The additional 25 cycles were performed at anannealing temperature of 43°C. For the amplification ofnorB with norB1F-norB8r primer set, the amplificationprogram was: denaturation at 94°C for 4 min, 35 cycles at94°C for 30 s, 54°C for 45 s, 72°C for 45 s; and a finalextension at 72°C for 7 min. For positive controls,Methylosinus trichosporium OB3b was used for pmoAand mmoX, Nitrosomonas europaea (NCIMB 11850) foramoA from AOBs, an amoA amplicon collected fromactivated sludge (provided by Craig Criddle of StanfordUniversity) for amoA from AOAs, and Achromobactercyclostates (ATCC 21921) for nirK and norB.

mRNA extraction and reverse transcription-polymerasechain reaction assays RNA was extracted following previ-ously developed methods with minor modifications (Hanand Semrau, 2004). Briefly, 0.5 g of soil (wet weight) wasadded to 1.0 ml extraction buffer containing 0.2% cetyltrimethyl ammonium bromide, 1 mM 1,4-dithio-DL-threitol,0.2 M sodium phosphate buffer (pH 8.0), 0.1 M NaCl,

392 Appl Microbiol Biotechnol (2009) 85:389–403

50 mM EDTA (Chen et al. 2007), with 1 g of 0.1 mm silicaglass beads and 1% β-mercaptoethanol into the 2-ml screwcap microcentrifuge tubes. Six 30 s bead beating procedurewas performed to lyse the cells using Mini-Beadbeater™(BioSpec Products, Bartlesville, OK, USA) while put on icefor 1 min in between. The bottom of the microcentrifugetubes was then pierced using a sterile 22 gauge needle and asterile collection tube was placed on the bottom of themicrocentrifuge tube. Tubes were then centrifuged at2,500 rpm for 5 min using a swinging bucket centrifugeIEC Centra CL2 (International Equipment Co., NeedhamHeights, MA, USA). The flow-through was then mixedwith one volume of 70% ethanol. The resulting mixture wasthen passed through an RNeasy column (Qiagen, Valencia,CA, USA) via centrifugation at 4,000 rpm for 1 min using abenchtop centrifuge (Eppendorf). Afterwards, 700 μl RW1and then 500 μl RPE solutions were added to the RNeasycolumn and was centrifuged at 4,000 rpm for 1 min each.RNA was eluted using 100 μl DEPC-treated water and wastreated with RNase-free DNase I (Promega, Madison, WI,USA) to remove any DNA contamination. DNase treatedRNA was then purified using the RNeasy Mini Kitfollowing the manufacturer’s instructions (Qiagen, Vanlen-cia, CA, USA). To check for any DNA contamination, PCRwas performed with the extracted RNA as a template. Afterconfirming the complete removal of DNA from RNAsamples, RNAwas then reverse-transcribed to obtain cDNAby using Superscript II Reverse Transcriptase (Invitrogen,Carlsbad, CA, USA) following the manufacturer’s instruc-tions and stored at −20°C until further PCR amplification.To target pmoA, mmoX, amoA (from both ammonia-oxidizing bacteria and archaea), nirK, and norB, the primersets shown in Table 1 were used. PCR was carried out with1x PCR buffer, 1.5 mM MgCl2, 20 μg of bovine serumalbum (Kreader 1996), 15 pmole of each primer, 200 μMdNTPs, 2.5 U Taq DNA polymerase, and 20 ng of cDNA.

PCR conditions were as described above for DNAamplification. Positive controls were created by extractingmRNA from different cells and growth conditions, i.e.,Methylosinus trichosporium OB3b in NMS medium with10 μM copper (pmoA), M. trichosporium OB3b in NMSmedium with no added copper (mmoX), N. europaea inminimal medium with (NH4)2SO4 (amoA from AOBs), andA. cyclostates in tryptic soy broth under anaerobicconditions (nirK and norB; Coyne and Tiedje 1990). Nopositive controls were available for amoA expression fromAOAs due to the unavailability of pure AOA cultures.

Microarray sample preparation Samples for microarrayanalysis were prepared following previously describedmethods (Stralis-Pavese et al. 2004). Briefly, DNA collect-ed from soils was amplified using the primer set targetingpmoA using pmoA189-mb661 with the T7 promoter siteattached to the 5′ end of primer mb661. The T7 promotersite allowed the in vitro transcription of the PCR productsvia T7 RNA polymerase. Each PCR reaction was per-formed on triplicate samples with 25 μl of 2×MasterAmpPCR Premixture F (EpiCentre Technologies, Madison, WI,USA), 15 pmol of each primers pmoA189-mb661, 1 ngenvironmental DNA, and 1 U Taq polymerase (Invitrogen,Carlsbad, CA, USA). PCR conditions were 95°C for 5 minbefore the addition of template, 32 cycles consisting of95°C for 1 min, annealing temperature at 58°C for 1 min,72°C for 1 min, with final elongation at 72°C for 10 min.Triplicates of PCR reactions were then pooled and purifiedusing Qiagen PCR Purification Kit (Qiagen, Valencia, CA,USA). Methods used for in vitro transcription and hybrid-ization as described previously were used (Bodrossy et al.2003; Stralis-Pavese et al. 2004).

Microarray analyses Visualization of microarray resultswas performed using GeneSpring GX 7.3.1 (Agilent

Gene Primers Sequence (5′–3′) Reference

pmoA pmoA-A189 GGNGACTGGGACTTCTGG Costello and Lidstrom (1999)pmoA-mb661 CCGGMGCAACGTCYTTACC

mmoX mmoX206f ATCGCBAARGAATAYGCSCG Hutchens et al. (2004)mmoX886r ACCCANGGCTCGACYTTGAA

Bacterial amoA amoA-1F GGGGTTTCTACTGGTGGT Rotthauwe et al. (1997)amoA-2R CCCCTCKGSAAAGCCTTCTTC

Archaeal amoA Arch-amoAF STAATGGTCTGGCTTAGACG Francis et al. (2005)Arch-amoAR GCGGCCATCCATCTGTATGT

nirK nirK1F GGRATGGTYCCSTGGCA Braker et al. (1998)nirK5R GCCTCGATCAGRTTRTGG

nirK F1aCu ATCATGGTSCTGCCGCG Hallin and Lindgren (1999)R3Cu GCCTCGATCAGRTTGTGGTT

norB norB1f CGNGARTTYCTSGARCARCC Casciotti and Ward (2005)norB8r CRTADGCVCCRWAGAAVGC

Table 1 Primers used for PCRamplification of pmoA (particu-late methane monooxygenase),mmoX (soluble methane mono-oxygenase), bacterial amoA(bacterial ammonia monooxy-genase), archaeal amoA (archaelammonia monooxygenase), nirK(nitrite reductase), and norB(nitric oxide reductases)

Appl Microbiol Biotechnol (2009) 85:389–403 393

Technologies, Palo Alto, CA, USA) Methanotrophic com-munity structure was visualized using a color-codedpresentation of abundance. Probe signal intensities werenormalized to positive controls on the same array andexpressed in relation to the individual hybridizationpotential of each probe as assessed during validation ofthe array with pure cultures and clones (Stralis-Pavese et al.2004).

Results

Soil characteristics The composition of the landfill coversoil was determined to be 93% sand with the remainderbeing a mixture of silt and clay, and was classified as sandbased on standard USDA soil texture classification analyses(Soil Survey Division Staff 1993). Soil pH was found to be7.1 (±0.1) and moisture content of the soil at the time ofsampling (February 2006) was 9.3±0.5%.Inorganic N, i.e.,NH4

+ and NO3−+NO2

− was 16.0±0.2 and 7.5±0.1 mg-N∙(kg soil)−1, respectively. Bioavailable and total copper wasmeasured to be 0.2±0.01 and 6.6±0.3 mg (kg soil)−1,respectively.

Effect of ammonia on methane oxidation and nitrous oxideproduction As shown in Fig. 1a, methane oxidation ratesincreased~60% above baseline conditions with the addition100 mg-N NH4

+∙(kg soil)−1 (i.e., an increase from 16±3 to26±4 μg∙(hr gram soil)−1, p<0.05%). Nitrous oxideproduction rates, however, increased over fivefold withthe addition of 25 mg-N∙(kg soil)−1 of ammonium (Fig. 1b),and increased over 16-fold with the addition of 100 mg-N∙(kg soil)−1 of ammonium.

Effect of moisture content on methane oxidation and nitrousoxide production The highest methane oxidation rates wereobserved at 5% moisture content, with methane oxidationrates decreasing as moisture content increased (Fig. 1c).Interestingly, nitrous oxide production rates increased withincreasing moisture content up to 20% but then decreasedslightly when the moisture content was increased to 30%(Fig. 1d).

Effect of copper on methane oxidation and nitrous oxideproduction The addition of copper had little stimulatoryeffect on methane oxidation and in fact inhibited methaneoxidation in soils amended with 250 mg∙(kg soil)−1 ofcopper (Fig. 1e) Increasing the amount of added copper didnot result in any further decrease of measured methaneoxidation rates. Nitrous oxide production rates were notaffected when as much as 250 mg copper∙(kg soil)−1 wasadded (Fig. 1f). At 500 mg, copper∙(kg soil)−1 nitrous oxide

production rates did decrease to∼60% of the rates observedwhen no copper was added (i.e., a drop to 0.016±0.0008from 0.03±0.008 μg∙(hr gram soil)−1, p<0.05).

Effect of organic carbon on methane oxidation and nitrousoxide production The addition of organic carbon hadneither a stimulatory or inhibitory effect on the rate ofmethane oxidation (Fig. 1g), but did significantly stimulatethe rate of nitrous oxide production when as little as 50 mgorganic carbon∙(kg soil)−1 was added (Fig. 1h), i.e., anincrease from 0.28 μg∙(hr gram soil)−1 in the absence of anyadded organic carbon to 0.13 μg∙(hr gram soil)−1 when50 mg organic carbon∙(kg soil)−1 was added, p<0.05.

Effect of chlorate on methane oxidation and nitrous oxideproduction Chlorate, a selective inhibitor of nitrate reduc-tase (Kucera 2006), had no effect on either nitrous oxideproduction or methane oxidation (data not shown).

Effect of multiple geochemical parameters on methaneoxidation and nitrous oxide production To examine thecollective effect of multiple amendments, conditions thatstimulated methane oxidation, i.e., 5% moisture content andammonium were combined in a second microcosm array.The addition of ammonia in soils with reduced moisturecontent caused the rates of both methane oxidation ratesand nitrous oxide production to increase with increasingamounts of ammonium (Fig. 2a and b). The addition of25 mg-N NH4

+∙(kg soil)−1 with 5% moisture did notsignificantly increase methane oxidation rates as comparedto the addition of this amount of ammonium with 15%moisture content (17±1 μg∙(hr∙gram soil)−1and 18±3 μg∙(hr gram soil)−1, respectively). Nitrous oxide productionrates, however, were reduced compared to those found withthe addition of ammonium with 15% moisture content.When 25 mg-NH4

+∙(kg soil)−1 was added in conjunctionwith 5% moisture, the nitrous oxide production rate was0.05±0.002 μg∙(hr gram soil)−1, significantly less than therate found with the combination of 25 mg-N NH4

+∙(kgsoil)−1 with 15% moisture (0.1±0.02 μg∙(hr gram soil)−1).

When 0.1 mg phenylacetylene∙(kg soil)−1 was addedsimultaneously with ammonium and 5% moisture content,methane oxidation rates were not reduced as compared tothe absence of phenylacetylene when up to 15 mg N NH4

+∙(kg soil)−1 as ammonium was added, but decreased whenammonium concentrations were further increased to 25 mgNH4

+∙(kg soil)−1 (Fig. 2a). Nitrous oxide production rates,however, were reduced ∼60–70% in the presence ofphenylacetylene at all ammonium levels tested as comparedto the absence of phenylacetylene (Fig. 2b).

Nitrous oxide production by pure cultures of methanotrophs Toexamine the ability of methanotrophs to produce N2O from

394 Appl Microbiol Biotechnol (2009) 85:389–403

10

15

20

25

30

35

40

0 20 40 60 80 100 120

Amount of Added Nitrogen (mg-N·(kg soil)-1)

Met

han

e o

xid

atio

n r

ate

(µg

·hr-1

·(g

so

il)-1

)A

0

0.05

0.1

0.15

0.2

0.25

0.3

0.35

0.4

0.45

0 20 40 60 80 100

Amount of Added Nitrogen (mg-N·(kg soil)-1)

Nit

rou

s o

xid

e p

rod

uct

ion

rat

e (µ

g·h

r-1·(

g s

oil

)-1)

5

10

15

20

25

0 5 10 15 20 25 30 35

Moisture Content (%)

Met

han

e o

xid

atio

n r

ate

(µg

·hr-1

·(g

so

il)-1

)

C

0

0.025

0.05

0.075

0.1

0 5 10 15 20 25 30 35

Moisture Content (%)N

itro

us

oxi

de

pro

du

ctio

n r

ate

(µg

·hr-1

·(g

so

il)-1

)

0

5

10

15

20

0 100 200 300 400 500 600

Amount of Added Copper (mg·(kg soil)-1)

Met

han

e o

xid

atio

n r

ate

(µg

·hr-1

·(g

so

il)-1

)

E

0

0.01

0.02

0.03

0.04

0.05

0 100 200 300 400 500 600

Amount of Added Copper (mg·(kg soil)-1)

Nit

rou

s o

xid

e p

rod

uct

ion

rat

e (µ

g·h

r-1·(

g s

oil

)-1)

0

5

10

15

20

0 50 100 150 200 250

Amount of Added Org. C (mg·(kg soil)-1)

Met

han

e o

xid

atio

n r

ate

(µg

·hr-1

·(g

so

il)-1

)

G

B

D

F

H

0

0.05

0.1

0.15

0.2

0 50 100 150 200 250

Amount of Added Org. C (mg·(kg soil)-1)

Nit

rou

s o

xid

e p

rod

uct

ion

rat

e (µ

g·h

r-1·(

g s

oil

)-1)

Fig. 1 Effect of individual geochemical parameters on the rates ofmethane consumption and nitrous oxide production in soil micro-cosms. For all situations, initial baseline conditions of 15% moisturecontent with 20% methane and 10% oxygen in the headspace wereused. a Effect of ammonium on the rate of methane consumption; beffect of ammonium on the rate of nitrous oxide production; c effect of

moisture content on the rate of methane consumption; d effect ofmoisture content on the rate of nitrous oxide production; e effect ofcopper on the rate of methane consumption; f effect of copper on therate of nitrous oxide production; g effect of organic carbon on the rateof methane oxidation; h effect of organic carbon on the rate of nitrousoxide production

Appl Microbiol Biotechnol (2009) 85:389–403 395

ammonia, Methylosinus trichosporium OB3b was examinedin pure culture under both sMMO- and pMMO-expressingconditions (as determined using the naphthalene assay[Brusseau et al. 1990]). M. trichosporium OB3b couldproduce N2O from ammonia, but that the extent of suchproduction was dependent on growth conditions (Table 2).No nitrous oxide formation was found in 0.1× AMS, but wasfound in 1× AMS. Cells expressing pMMO produced ∼2.7×more nitrous oxide than the same cell expressing sMMO in1X AMS, but growth was inhibited for both pMMO- andsMMO-expressing cells in this medium, most likely due toinhibition of methane oxidation.

Microarray analyses To examine the effect of selectedamendments on the methanotrophic community structureDNA microarray analyses were performed. DNA wascollected from three different soil microcosms, i.e.,(1)20% CH4, 10% O2, 5% moisture content, (2) 20% CH4,10% O2, 5% moisture content with 15 mg-N NH4

+∙(kgsoil)−1, and (3) 20% CH4, 10% O2, 5% moisture content,15 mg-N NH4

+∙(kg soil)−1 with 0.1 mg phenylacetylene∙(kg

soil)−1. Relative signals equal to or above 0.05 were definedas positive signals.

As shown in Fig. 3, Type II methanotrophs dominatedthe methanotrophic community in untreated soils, partic-ularly the genera Methylocystis (Mcy233, Mcy522,Mcy264, Mcy270, and Mcy459), consistent with earlierfindings from landfill cover soils in Europe (Bodrossy etal. 2003; Stralis-Pavese et al. 2004; Cebron et al. 2007).Probes targeting Type Ia methanotrophs produced positivesignals from probes Mb_SL#3-300 (Methylobacter),Mb460 (Methylobacter), Mm531 (Methylomonas),Mm451 (Methylomonas), and Mm275 (Methylomonas)with probes targeting general Type Ia methanotrophsIa193 and Ia575 yielding relatively strong signals com-pared to other probes that target Type Ia methanotrophs.Probes targeting Type Ib methanotrophs (Methylococcus,Methylothermus, Methylocaldum, and related genera)showed no signals except from probe JRC2-447 (sequen-ces closely related to Japanese Rice Cluster #2) and Ib453(general Type Ib methanotrophs). No positive results wereretrieved from probes targeting Methylocapsa relatedmethanotrophs.

With the addition of 15 mg-N NH4+∙(kg soil)−1, an increase

in probe intensity compared to that observed in soils with notreatment, i.e., an increase in relative intensity by at least 50%,was found from probes Mm275 (Methylomonas) and Mm451(Methylomonas). Signals from Mb282 (Methylobacter), Mb271(Methylobacter), and Mm_M430 (Methylomonas), which werebelow detection limit (<0.05) in soils with no treatment, werepositively detected in soils amended with 15 mg-N NH4

+∙(kgsoil)−1. Signals from Mm531 (Methylomonas) and Ia193(general Type I) and Msi423 (Methylosinus) showed a decreasein intensity, i.e., a reduction in relative signal intensity greaterthan 50% compared to that observed in soils with no treatment.

With the addition of 15 mg-N NH4+∙(kg soil)−1 and

0.1 mg phenylacetylene∙(kg soil)−1, the pattern of probesignals was similar to the untreated soils. Specifically, an

5

10

15

20

25

0 5 10 15 20 25 30

Amount of Added Ammonium (mg-N·(kg soil)-1) + 5 % moisture content

Met

han

e o

xid

atio

n r

ate

(µg

·hr-1

·(g

so

il)-1

) A

0.000

0.025

0.050

0.075

0.100

0 5 10 15 20 25 30

Amount of Added Ammonium (mg-N·(kg soil)-1) + 5 % moisture content

Nit

rou

s o

xid

e p

rod

uct

ion

rat

e(µ

g·h

r-1·(

g s

oil

)-1)

B

Fig. 2 Effect of combined geochemical parameters on the rates ofmethane consumption and nitrous oxide production in soil micro-cosms. For all situations, initial baseline conditions of 5% moisturecontent with 20% methane and 10% oxygen in the headspace wereused. a Effect of ammonium and 5% moisture content with (filled

squares) and without (squares) 0.1 mg phenylacetylene∙(kg soil)−1 onmethane oxidation. b Effect of ammonium and 5% moisture contentwith (filled squares) and without (squares) 0.1 mg phenylacetylene∙(kg soil)−1 on nitrous oxide production (circles)

Table 2 Growth and N2O production by Methylosinus trichosporiumOB3b in varying compositions of ammonia mineral salts medium andcopper

Media Cu (μM) Grow ratea (hr−1) Max N2Ob (ppmv)

0.1X AMS 0 0.087 (0.002) NDc

20 0.078 (0.005) ND

AMS 0 0.042 (0.001) 120 (10)

20 0.053 (0.006) 330 (45)

ND no detectablea Values in parenthesis indicate standard deviation of measured valuesb Values in parenthesis indicate range of duplicate samplesc No detectable N2O

396 Appl Microbiol Biotechnol (2009) 85:389–403

increase in signal intensities was detected from only twoprobes compared to signals from soils with no treatment,JRC2-447 (Japanese rice cluster) and Mb271 (Methylo-bacter). The signal intensity from probes Mb_SL#3-300(Methylobacter), Mm531 (Methylomonas), and Mm451(Methylomonas) showed a decrease as compared to soilswith no treatment.

DNA analyses of the presence of methanotrophs, nitrifiers,and denitrifiers PCR amplification of genes known to beinvolved in the oxidation of methane and nitrous oxideproduction were extracted from the soils used for micro-array analyses. pmoA (encoding for the α-subunit of the

particulate methane monooxygenase) was observed in alltreatments (Fig. 4a), as was mmoX (encoding for the α-subunit of the sMMO hydroxylase—Fig. 4b). As can beseen in Fig. 4c and d, evidence of both bacterial andarchaeal ammonia oxidizers was found from PCR amplifi-cation of amoA (encoding for the α-subunit of the ammoniamonooxygenase). Quantitative analyses are not possiblewith these amplifications, although stronger bands wereobserved from amoA amplification from bacterial ammoniaoxidizers in microcosms incubated in the presence ofammonia as compared to no amendments (Fig. 4c, lanes 1and 2). The combined addition of phenylacetylene andammonia reduced, but did not eliminate the band intensity

None +NH4+

+C8H6 +NH4+

Type Ia

Type Ib

Type II

LP21

RA14

M.capsa

Universal 0

0.1

1

Fig. 3 DNA microarray hybrid-izations of pmoA PCR productsprepared using primer setpmoA189-A682. Relative signalintensities are shown as colorspectrum with 1 being the max-imum achievable signal for eachprobe. Lane 1—20% CH4, 10%O2, 15 mg-N NH4

+∙(kg soil)-1with 0.1 mg C8H6∙(kg soil)−1;lane 2—20% CH4, 10% O2, 5%moisture content, 15 mg-NNH4

+∙(kg soil)−1; lane 3—20%CH4, 10% O2, 5% moisturecontent

Appl Microbiol Biotechnol (2009) 85:389–403 397

of the amoA PCR product from ammonia-oxidizing bacteria(Fig. 4c, lane 3). Similarly, while amoA from ammonia-oxidizing archaea was easily amplified from microcosmseither with no amendments, or with the addition ofammonium, no amplification of archaeal amoA was foundwhen phenylacetylene was also added (Fig. 4d, lane 3). NoPCR products from the amplification of nirK, encoding forthe copper-containing nitrite reductase, were found usingtwo different primer sets, one for general amplification ofnirK from environmental samples, NirK1F and NirK5R(Braker and Tiedje 2003) and another found to be morespecific for ammonia-oxidizing bacteria, F1aCu and R3Cu(Hallin and Lindgren 1999; data not shown). Finally, noPCR products were observed from the amplification ofnorB, encoding for nitric oxide reductase (data not shown).

mRNA analyses To examine the expression of functionalgenes, mRNA was extracted from soils incubated underconditions used for microarray analyses. Transcripts ofpmoA were detected in all conditions but not mmoX (datanot shown). No transcripts of amoA of either ammonia-oxidizing bacteria or archaea were detected under anyconditions, nor were any transcripts of nirK or norB (datanot shown).

Discussion

From the data presented, it is evident that methaneoxidation rates in these landfill soil microcosms arestrongly affected by ammonium and moisture content. Suchfindings are similar to that reported by others for landfillcover soils (Bender and Conrad 1995; Hilger et al. 2000;De Visscher and Van Cleemput 2003), with the increase ofmethane oxidation rates probably due to relief of nitrogenlimitation. Also, high moisture contents have been shownto limit methanotrophic activity, most likely due to limiteddiffusion of methane and air (Whalen and Reeburgh 1990;Jones and Nedwell 1993; Czepiel et al. 1996; Seghers et al.2005). Copper was observed to have little effect onmethane consumption up to 100 mg Cu∙(kg soil)−1. Sucha finding may be surprising as copper is well-known tostrongly regulate the expression and activity of the methanemonooxygenase, especially the particulate methane mono-oxygenase, with increasing copper concentrations increas-ing both the expression and whole cell activity of thisenzyme (Lontoh and Semrau 1998; Choi et al. 2003, Lee etal. 2006). Methanotrophs, however, can express a uniquehigh affinity copper acquisition system similar to thesiderophore based iron acquisition systems which may beresponsible for this unexpected observation (Balasubrama-nian and Rosenzweig 2008; Choi et al. 2005, 2006; Knapp

et al. 2007; Kulczycki et al. 2007). It is also known thatexcessive bioavailable Cu inhibits whole cell pMMOactivity (Choi et al. 2003, 2005; Zahn and DiSpirito1996), and is probably responsible for the inhibitionobserved at higher amended copper concentration. Copperhas also been shown to inhibit both the expression andactivity of the soluble methane monooxygenase (Prior andDalton 1985; Stanley and Dalton 1983). However, tran-scripts for the sMMO (mmoX) were not detected in any ofthe soil samples. Taken together, the results suggest thatbioavailable Cu was not a limiting factor in these soilsystems. As the focus of this research was to identifyconditions that enhanced methane consumption whilereducing nitrous oxide production, this finding was notpursued here, but is worthy of future analysis.

Nitrous oxide production rates were also affected byammonium and moisture content. Nitrous oxide increasedwith increasing ammonium additions, ultimately increasingan order of magnitude when 100 mg ammonium∙(kg soil)−1

was added (Fig. 1b). Maximal nitrous oxide production wasobserved with 20% moisture, with rates lower both belowand above this level. If denitrification was responsible forthe observed nitrous oxide production, such activity wouldmost likely be stimulated with increasing moisture contentas this would increase the possibility of oxygen limitationdue to reduced diffusion rates. To further investigate thepossibility that denitrification was responsible for theobserved production of nitrous oxide, chlorate was addedto some microcosms as it is known to inhibit cells utilizingthe membrane-bound nitrate reductase (Rusmana andNedwell 2004), as well as the periplasmic nitrate reductase,Nap (Kucera 2006). No effect on nitrous oxide productionwas observed. Finally, neither PCR nor RT-PCR productsof either nirK or norB were found under any testedcondition, suggesting that denitrification was not responsi-ble for nitrous oxide production in these microcosms.

As was found for methane oxidation, copper had littleeffect on nitrous oxide production at low levels, but didinhibit nitrous oxide production at the highest levelexamined, 500 mg copper∙(kg soil)−1. As mentioned above,methanotrophs can express high-affinity copper uptakesystems, thus it appears that bioavailable Cu was not alimiting factor in these soil systems.

When combinations of parameters were considered, itwas found that providing relatively dry soils (5% moisturecontent) with 15 mg NH4

+∙(kg soil)−1 and 0.1 mg phenyl-acetylene∙(kg soil)−1 provided the greatest stimulation ofmethane oxidation while minimizing nitrous oxide produc-tion. Methane oxidation rates increased by ∼28% in theseconditions as compared to microcosms with 5% moistureand no added ammonium or phenylacetylene, while nitrousoxide production rates did not increase. As such, it appearsthat the combination of ammonium, phenylacetylene, and

398 Appl Microbiol Biotechnol (2009) 85:389–403

drier soils are the most appropriate of the combinationstested for manipulation of the microbial community presentin the landfill cover soils at this site for mitigation ofgreenhouse gas emissions.

The use of phenylacetylene as an additive for preventionof nitrous oxide production in landfills is attractive as it isliquid at room temperature, has a moderate solubility inwater, 4.46 mM, as well as low volatility having adimensionless Henry’s constant of 0.0244 (Lontoh et al.2000), and thus can be easily applied. It is estimated usingpublished costs of phenylacetylene (Sigma Aldrich), that

one application of phenylacetylene at a concentration of0.1 mg per kg cover soil would cost approximately $0.2 /m3 of cover soil. It is possible that these expenses could becovered through increased tipping fees charged for dispos-ing waste in landfills. Given that tipping fees can be as highas $120/ton of unsorted waste (Dantata et al. 2005), anyincreases needed to cover the costs associated withminimizing methane and nitrous oxide emissions could berelatively small.

Also, although moisture content can be difficult to control,its effect on methane oxidation and nitrous oxide production

A. pmoA (473 bp) B. mmoX (681 bp)

C. amoA from AOBS (491 bp) D. amoA from AOAs (635 bp)

Fig. 4 PCR amplification of fragments of: a pmoA(473 bp); b mmoX(681 bp); c amoA of ammonia oxidizing bacteria (491 bp), and damoA of ammonia-oxidizing archaea (635 bp). Lane 1—microcosmsincubated with 20% CH4, 10% O2, and 5% moisture content; lane 2—microcosms incubated with 20% CH4, 10% O2, 5% moisture content,and 15 mg-N NH4

+∙(kg soil)−1; lane 3—microcosms incubated with20% CH4, 10% O2, 5% moisture content, 15 mg-N NH4

+∙(kg soil)−1,

and 0.1 mg phenylacetylene∙(kg soil)−1. Lane 4—positive controlusing either chromosomal DNA of M. trichosporium OB3b (4A and4B); chromosomal DNA of N. europaea (4C), or; archaeal amoAclone from activated sludge; (4D). Lane 5—negative control (water).Sizes of molecular standards (in kbp) are indicated to the left of eachfigure

Appl Microbiol Biotechnol (2009) 85:389–403 399

must be kept in mind, and future landfill design shouldconsider how to maintain more optimal moisture contents insitu, including incorporating hydrologic analyses whendesigning the slope and contour of landfill cover soil caps. Itshould be stressed, however, that a thorough economicanalysis would need to be performed on a case by case basisto determine the feasibility of adding phenylacetylene and/ormodifying landfill cover soil topography.

As the addition of ammonium showed the greatest effect onincreasing both methane oxidation and nitrous oxide produc-tion, while the simultaneous addition of phenylacetylenesignificantly reduced nitrous oxide production while main-taining high rates of methane, microarray analyses wereperformed to determine what effect these amendments had onthe methanotrophic community. The microarray analyses ofmethanotrophic community showed that regardless of amend-ment the soils were dominated by Type II methanotrophs,particularly the genusMethylocystis. These strains have beencommonly found in large numbers in other landfills(Bodrossy et al. 2003; Stralis-Pavese et al. 2004; Cebron etal. 2007). The addition of 15 mg-N NH4

+∙(kg soil)−1 led toincreased signals of Type I methanotrophs. These cells arebelieved to be more competitive in nutrient-rich environ-ments, and thus it is not surprising the addition ofammonium stimulated their growth (Cebron et al. 2007).When 0.1 mg phenylacetylene∙(kg soil)−1 was added inconjunction with 15 mg-N NH4

+∙(kg soil)−1 the distributionof signal intensities resembled that of the soils with noamendments, i.e., the signal intensities for several Type Imethanotrophs reduced, suggesting that these cells may besensitive to phenylacetylene.

Collectively, given the results that showed: (1) methano-trophs can produce nitrous oxide under both sMMO- andpMMO-expressing conditions, with greater production bypMMO-expressing cells; (2) the addition of ammoniumincreased bothmethane oxidation (~50% increase) and nitrousoxide production (~16-fold increase) while also enhancing thepresence of Type I methanotrophs; (3) the addition ofammonium and phenylacetylene increased methane oxidationwhile reducing nitrous oxide production and the presence ofType I methanotrophs; and (4) no expression of mmoX wasfound under any condition; it is possible that methanotrophicnitrification by Type I methanotrophs expressing pMMOwas responsible for the observed nitrous oxide production inthe microcosms composed of the sandy cover soil of KingHighway Landfill.

It has been known for some time that methanotrophs canproduce nitrous oxide from ammonia and hydroxylamine(Yoshinari 1985; Krämer et al. 1990; Ren et al. 2000; Sutkaet al. 2003, 2006), and based on isotopomer analyses, it issuspected that the contribution of methanotrophic nitrifica-tion in nitrous oxide production may be undervalued (Sutkaet al. 2003). Other possibilities exist, however, that must be

considered before any firm conclusions can be made,including the activity of ammonia oxidizing bacteria, and/or ammonia-oxidizing archaea.

Ammonia-oxidizing bacteria are known to produce nitrousoxide from both ammonia oxidation and nitrifier denitrifica-tion (Ritchie and Nicholas 1972; Hooper and Terry 1979;Poth and Focht 1985; Jiang and Bakken 1999; Sutka et al.2003; Shaw et al. 2006), and such production is dependenton the availability of oxygen. Although ammonia oxidizingarchaea typically greatly outnumber ammonia-oxidizingbacteria in many different soils (Leininger et al. 2006) todate, no evidence of nitrous oxide production by ammonia-oxidizing archaea has been reported.

The possibility that either or both AOAs or AOBs wereresponsible for a portion of the measured nitrous oxideproduction was raised through PCR amplification of amoA.Ammonia-oxidizing bacteria were present in all testedconditions for the conditions used in microarray analyses(Fig. 4c), and it is interesting that qualitatively, the bandintensity of the bacterial amoA product increased with theaddition of ammonium, but was reduced when phenyl-acetylene was simultaneously added. Similarly, amoA fromammonia-oxidizing archaea was successfully amplifiedboth in the unamended soils and in soils amended withammonium, but no products were found in the presence ofboth ammonium and phenylacetylene (Fig. 4d). Transcriptsof amoA from both ammonia oxidizing bacteria andarchaea, however, were not found under any conditions(data not shown). It may be that a large proportion of thesecells were inactive in these microcosms, the reversetranscription step was generally ineffective, the originalamount of amoA transcripts was too low for successfulamplification, and/or the half-life of these transcripts wasshort. Given the variability of band intensity of the PCRproducts under different conditions, particularly the pres-ence of archaeal amoA DNA in unamended soils and soilsamended with ammonium, but the absence of any detect-able product in the presence of ammonium and phenyl-acetylene, it appears that ammonia-oxidizers were presentand affected by different amendments. It is also unlikelythat the reverse transcription step was ineffective given thefinding of pmoA transcripts in all tested conditions (data notshown), thus it is possible that the original transcript levelsof amoA were either too low for successful amplificationand/or that the transcript half-life was short.

From the combined microarray, pure culture, and geneexpression data, it is difficult to conclusively determinewhich cell(s) was primarily responsible for the observednitrous oxide production. It was earlier believed thatphenylacetylene could serve as a selective inhibitor todistinguish between the activity of the ammonia monoox-ygenase, particulate methane monooxygenase and solublemethane monooxygenase (Lontoh et al. 2000). In this initial

400 Appl Microbiol Biotechnol (2009) 85:389–403

study, it was observed that low amounts of phenylacetyleneaffected ammonia monooxygenase activity in Nitrosomonaseuropaea, but not ammonia monooxygenase activity in themarine strain, Nitrosococcus oceanus or particulate meth-ane monooxygenase activity in seven methanotrophs. Itwas known at that time the DNA-derived protein sequenceof N. oceanus ammonia monooxygenase is more similar tothe particulate methane monooxygenase than to theammonia monooxgenase of N. europaea (Holmes et al.1995). Subsequent analysis of the particulate methanemonooxygenase suggests that its active site is composedof a di-iron site coordinated by a combination of histidineand acidic amino acids (Martinho et al. 2007), althoughsome believe that this same site may be occupied by copper(Chan and Yu 2008; Hakemian et al. 2008; Leiberman andRosenzweig 2005). It should be noted, however, thatpMMO purifications with iron have two to three orders ofmagnitude activity than preparations with little, if any, iron.Regardless of what metal is used in the active site ofpMMO and AMO, of these residues, all but two, Asp 168and Glu 176, are conserved in all known pmoC andbacterial amoC sequences. These residues are found in allknown pmoC sequences as well as in the amoC sequence ofN. oceanus. Asp 168 is replaced by serine in all otherknown amoC sequences, while Glu 176 is replaced byvaline in most known sequences, and by methionine in onecopy of amoC in N. europaea. It is possible that one or bothof these residues control the substrate range of the ammoniamonooxygenase and the particulate methane monooxyge-nase, and that cells possessing ammonia monooxygenasewith Ser 168 and/or Val/Met 176 are able to bind phenyl-acetylene more readily, and thus be inhibited. It is alsopossible that pmoC of some uncultured methanotrophs mayalso have these residues, making them susceptible toinhibition by phenylacetylene. Finally, from the datacollected here, it appears that ammonia-oxidizing archaeamay be sensitive to phenylacetylene, but that cannot beconclusively proven at this time, largely due to the smallnumber of pure isolates.

In summary, in the sandy cover soil examined here, methaneoxidation was enhanced while nitrous oxide production wasminimized inmicrocosms at 5%moisture content and amendedwith ammonium and phenylacetylene. Given the increasedconcern over greenhouse gas emissions, it is proposed thatfurther work be performed, specifically: (1) consideration ofother factors that may be important, e.g., alternative sources ofnitrogen such as nitrate and/or urea, as well as other synergisticor antagonistic effects between different amendments; (2)construction of similar data sets from landfill cover soils ofdifferent composition to determine how general these findingsare, and (3) consideration of the fate and transport of phenyl-acetylene when applied to landfills over the typical time frameof active methane generation (~8–40 years (Qian et al. 2002))

For the last issue, the effects of chronic exposure to phenyl-acetylene is largely unknown, although early studies showedthat it is slowly converted to phenaceturic acid in mammaliansystems (El Masri et al. 1958).

In conclusion, it may be possible that with the adoptionof more active management strategies that optimize in situmicrobial activity, the contribution of landfills to theemissions of methane and nitrous oxide can be minimizedwithout ancillary negative consequences, but more exten-sive, long-term field work is needed to determine whatmagnitudes of reduction of methane and nitrous oxideemissions are achieved when ammonium and phenyl-acetylene are applied at an actual landfill, as well as howlandfill cover soil topography can be optimized to bettermaintain appropriate moisture contents in situ.

Acknowledgements We thank George Wells and Craig Criddle forproviding an amoA amplicon from ammonia-oxidizing archaea.Support from the Department of Energy (DE-FC26-05NT42431) toJDS is also gratefully acknowledged.

References

Amaral JA, Knowles R (1995) Growth of methanotrophs in methane andoxygen counter gradients. FEMS Microbiol Lett 126:215–220

Balasubramanian R, Rosenzweig AA (2008) Copper methanobactin: amolecule whose time has come. Curr Opin Chem Biol 12:1–5

Barlaz MA, Green RB, Chanton JP, Goldsmith CD, Hater GR (2004)Evaluation of a biologically active cover for mitigation of landfillgas emissions. Environ Sci Technol 38:4891–4899

Bender M, Conrad R (1995) Effect of CH4 concentrations and soilconditions on the induction of CH4 oxidation activity. Soil BiolBiochem 27:1517–1527

Bodelier PLE, Roslev P, Henckel T, Frenzel P (2000) Stimulation byammonium-based fertilizers of methane oxidation in soil aroundrice plants. Nature 403:421–424

Bodrossy L, Stralis-Pavese N, Murrell JC, Radajewski S, WeilharterA, Sessitsch A (2003) Development and validation of adiagnostic microbial microarray for methanotrophs. EnvironMicrobiol 5:566–582

Boeckx P, Van Cleemput O (1996) Methane oxidation in a neutralcover soil: influence of moisture content, temperature, andnitrogen-turnover. J Environ Qual 25:178–183

Boeckx P, Van Cleemput O, Villaralvo I (1996) Methane emissionfrom a landfill and the methane oxidising capacity of its coversoil. Soil Biol Biochem 28:1397–1405

Bogner JE, Spokas KA, Burton EA (1997) Kinetics of methaneoxidation in cover soil: temporal variations, a whole-landfilloxidation experiment, and modeling of net CH4 emissions.Environ Sci Technol 31:2504–2514

Braker G, Tiedje JM (2003) Nitric oxide reductases (norB) genes frompure cultures and environmental samples. Appl Environ Micro-biol 69:3476–3483

Braker G, Fesefeldt A, Witzel K-P (1998) Development of PCRprimer systems for amplification of nitrite reductases genes (nirKand nirS) to detect denitrifying bacteria in environmentalsamples. Appl Environ Microbiol 64:3769–3775

Brusseau GA, Tsien H-C, Hanson RS, Wackett LP (1990) Optimiza-tion of trichloroethylene oxidation by methanotrophs and the use

Appl Microbiol Biotechnol (2009) 85:389–403 401

of a colorimetric assay to detect soluble methane monooxygenaseactivity. Biodeg 1:19–29

Casciotti KL, Ward BB (2005) Phylogenetic analysis of nitric oxidereductases gene homologues from aerobic ammonia-oxidizingbacteria. FEMS Microb Ecol 52:197–205

Cebron A, Bodrossy L, Chen Y, Singer AC, Thompson IP, Prosser JI,Murrell JC (2007) Identity of active methanotrophs in landfillcover soil as revealed by DNA-stable isotope probing. FEMSMicrobiol Ecol 62:12–23

Chan SI, Yu SSF (2008) Controlled oxidation of hydrocarbons by themembrane-bound methane monooxygenase: a case for a tricop-per cluster. Acc Chem Res 41:969–979

Chen M, Ma LQ (2001) Comparison of three aqua regia digestionmethods for twenty Florida soils. Soil Sci Soc Am J 65:491–499

Chen Y, Dumont MG, Cebron A, Murrell JC (2007) Identification ofactive methanotrophs in a landfill cover soil through detection ofexpression of 16S rRNA and functional genes. Environ Micro-biol 9:2855–2869

Choi D-W, Kunz RC, Boyd ES, Semrau JD, Antholine WA, HanJ-I et al (2003) The membrane-associated methane monoox-ygenase (pMMO) and pMMO-NADH:quinone oxidoreductasefrom Methylococcus capsulatus Bath. J Bacteriol 185:5755–5764

Choi D-W, Antholine WE, Do YS, Semrau JD, Kisting CJ, Kunz RCet al (2005) Effect of methanobactin on activity and electronparamagnetic resonance spectra of the methane oxidation by themembrane-associated methane monooxygenase in Methylococcuscapsulatus Bath. Microbiology 151:3417–3426

Choi D-W, Zea CJ, Do YS, Semrau JD, Antholine WA, Hargrove MSet al (2006) Spectral, kinetic and thermodynamic properties of Cu(I)- and Cu(II)-binding by methanobactin from Methylosinustrichosporium OB3b. Biochemistry 45:1142–1153

Costello AM, Lidstrom ME (1999) Molecular characterization offunctional and phylogenetic genes from natural populations ofmethanotrophs in lake sediments. Appl Environ Microbiol65:5066–5074

Coyne MS, Tiedje JM (1990) Induction of denitrifying enzymes inoxygen-limited Achromobacter cyclolastes continuous culture.FEMS Microbiol Ecol 73:263–270

Czepiel PM, Mosher B, Crill PM, Hariss RC (1996) Quantifying theeffect of oxidation on landfill emissions. J Geophys Res101:16721–16729

Dantata N, Touran A, Wang J (2005) An analysis of cost and durationfor deconstruction and demolition of residential buildings inMassachusetts. Resour Conserv Recycl 44:1–15

De Visscher A, Van Cleemput O (2003) Induction of enhanced CH4

oxidation in soils: NH4+ inhibition patterns. Soil Biol Biochem

35:907–913Dedysh SN, Liesack W, Khmelenina VN, Suzina NE, Trotsenko YA,

Semrau JD, Bares AM, Panikov NS, Tiedje JM (2000)Methylocella palustris gen. nov., sp. nov., a new methane-oxidizing acidophilic bacterium from peat bogs, representing anovel subtype of serine-pathway methanotrophs. Intl J Syst EvolMicrobiol 50:955–969

DeVisscher A, Boeckx P, van Cleemput O (2007) Artificial methanesinks. In: Reay DS, Hewitt CN, Grace J (eds) Greenhouse gassinks. Wallingford, Oxfordshire, pp 184–200

El Masri AM, Smith JN, Williams RT (1958) Studies in detoxication,73. The metabolism of alkylbenzenes: phenylacetylene andphenylethylene (styrene). Biochem J 68:199–204

Energy Information Administration (2008) Emission of greenhousegases in the United States 2007. Office of Integrated Analysisand Forecasting, US Department of Energy, Washington DC20585. Available at http://www.eia.doe.gov/oiaf/1605/ggrpt/pdf/0573(2007).pdf

Francis CA, Roberts KJ, Beman JM, Santoro AE, Oakley BB (2005)Ubiquity and diversity of ammonia-oxidizing archaea in watercolumns and sediments of the ocean. Proc Nat Acad Sci102:14683–14688

Hakemian AS, Kondapalli KC, Tesler J, Hoffman BM, Stemmler TL,Rosenzweig AC (2008) The metal centers of particulate methanemonooxygenase from Methylosinus trichosporium OB3b. Bio-chemistry 47:6793–6801

Hallin S, Lindgren P-E (1999) PCR detection of genes encodingnitrite reductases in denitrifying bacteria. Appl Environ Micro-biol 65:1652–1657

Han JI, Semrau JD (2004) Quantification of gene expression inmethanotrophs by competitive reverse transcription-polymerasechain reaction. Environ Microbiol 6:388–399

Hilger H, Barlaz M, Wollum A (2000) Landfill CH4 oxidation:response to vegetation, fertilization and liming. J Environ Qual29:324–334

Holmes AJ, Costello A, Lidstrom ME, Murrell JC (1995) Evidencethat particulate methane monooxygenase and ammonia mono-oxygenase may be evolutionary related. FEMS Microbiol Lett132:203–208

Hooper AB, Terry KR (1979) Hydroxylamine oxidoreductase ofNitrosomonas production of nitric oxide from hydroxylamine.Biochim Biophys Acta 571:12–20

Hou AX, Chen GX, Wang ZP, Van Cleemput O, Patrick WH (2000)Methane and nitrous oxide emissions from a rice field in relationto soil redox and microbiological processes. Soil Sci Am J64:2180–2186

Hutchens E, Radajewski S, Dumont MG, McDonald IR, Murrell JC(2004) Analysis of methanotrophic bacteria in Movile Cave bystable isotope probing. Environ Microbiol 6:111–120

IPCC (2007) Climate change 2007: synthesis report. CambridgeUniversity Press, Cambridge

Jiang Q-Q, Bakken LR (1999) Nitrous oxide production and methaneoxidation by different ammonia-oxidizing bacteria. Appl EnvironMicrobiol 65:2679–2684

Jones HA, Nedwell DB (1993) Methane emission and methaneoxidation in land-fill cover soil. FEMS Microbiol Ecol102:185–195

Kightley D, Nedwell DB, Cooper M (1995) Capacity for methaneoxidation in landfill cover soils measured in laboratory-scale soilmicrocosms. Appl Environ Microbiol 61:592–601

Knapp WC, Fowle DA, Kulcycki E, Roberts JA, Graham DW (2007)Methane monooxygenase gene expression mediated by meth-anobactin in the presence of mineral copper sources. Proc NatlAcad Sci USA 104:12040–12045

Krämer M, Baumgartner M, Bender M, Conrad R (1990) Consump-tion of NO by methanotrophic bacteria in pure culture and in soil.FEMS Microbiol Ecol 73:345–350

Kreader CA (1996) Relief of amplification inhibition in PCR withbovine serum albumin or T4 gene 32 protein. Appl EnvironMicrobiol 62:1102–1106

Kucera I (2006) Interference of chlorate and chlorite with nitratereduction in resting cells of Paracoccus denitrificans. Microbiol-SGM 152:3529–3534

Kulczycki E, Fowle DA, Knapp C, Graham DW, Roberts JA (2007)Methanobactin-promoted dissolution of Cu-substituted borsili-cate glass. Geobiology 5:251–263

Lee S-W, Keeney DR, Lim D-H, DiSpirito AA, Semrau JD (2006)Mixed pollutant degradation by Methylosinus trichosporiumOB3b expressing either soluble or particulate methane mono-oxygenase: can the tortoise beat the hare? Appl Environ Micro-biol 72:7503–7509

Leiberman RL, Rosenzweig AC (2005) Crystal structure of amembrane-bound metalloenzyme that catalyzes the biologicaloxidation of methane. Nature 434:177–182

402 Appl Microbiol Biotechnol (2009) 85:389–403

Leininger S, Urich T, Schloter M, Schwark L, Qi J, Nicol GW et al(2006) Archaea predominate among ammonia-oxidizing prokar-yotes in soils. Nature 442:806–809

Lontoh S, Semrau JD (1998) Trichloroethylene and methane oxidationby the particulate methane monooxygenase of Methylosinustrichosporium OB3b. Appl Environ Microbiol 64:1106–1114

Lontoh S, DiSpirito AA, Krema CL, Whittaker MR, Hooper AB,Semrau JD (2000) Differential inhibition in vivo of ammoniamonooxygenase, soluble methane monooxygenase andmembrane-associated methane monooxygenase by phenylacety-lene. Environ Microbiol 2:485–494

Majumdar D (2003) Methane and nitrous oxide emission fromirrigated rice fields: proposed mitigation strategies. Curr Sci84:1317–1326

Martinho M, Choi DW, DiSpirito AA, Antholine WE, Semrau JD,Münck (2007) Mössbauer studies of the membrane-associatedmethane monooxygenase from Methylococcus capsulatus Bath:evidence or a diiron center. J Am Chem Soc 129:15783–15785

McBride MB, Richards BK, Steenhuis T (2004) Bioavailability andcrop uptake of trace elements in soil columns amended withsewage sludge products. Plant Soil 262:71–84

Nishimura S, Sawamoto T, Akiyama H, Sudo S, Yagi K (2004)Methane and nitrous oxide emissions from a paddy field withJapanese conventional water management and fertilizer applica-tion. Global Biogeochem Cycles 18:2207–2216

Poth M, Focht DD (1985) 15N kinetic analysis of N2O production byNitrosomonas europaea: an examination of nitrifier denitrifica-tion. Appl Environ Microbiol 49:1134–1141

Prior SD, Dalton H (1985) The effect of copper ions on the membranecontent and methane monooxygenase activity in methanol growncells of Methylococcus capsulatus (Bath). J Gen Microbiol131:155–163

Qian X, Koerner RM, Gray DH (2002) Geotechnical aspects oflandfill design and construction. Prentice-Hall, Inc, Upper SaddleRiver

Reay DS, Smith KA, Hewitt CN (2007) Methane: importance, sourceand sinks. In: Reay DS, Hewitt CN, Grace J (eds) Greenhousegas sinks. Wallingford, Oxfordshire, pp 143–151

Ren T, Roy R, Knowles R (2000) Production and consumption ofnitric oxide by three methanotrophic bacteria. Appl EnvironMicrobiol 66:3891–3897

Rinne J, Pihlatie M, Lohila A, Thum T, Aurela M, Tuovinen J-P,Laurila T, Vesala T (2005) Nitrous oxide emissions from amunicipal landfill. Env Sci Technol 39:7790–7793

Ritchie GA, Nicholas DJD (1972) Identification of the sources ofnitrous oxide produced by oxidative and reductive processes inNitrosomonas europaea. Biochem J 126:1181–1191

Rotthauwe JH, Witzel KP, Liesack W (1997) The ammonia mono-oxygenase structural gene amoA as a functional marker,

molecular fine scale analysis of natural ammonia oxidizingpopulations. Appl Environ Microbiol 63:4704–4712

Rusmana I, Nedwell DB (2004) Use of chlorate as a selective inhibitorto distinguish membrane-bound nitrate reductases (Nar) andperiplasmic nitrate reductases (Nap of dissimilative nitratereducing bacteria in sediment. FEMS Micobiol Ecol 48:379–386

Seghers D, Siciliano SD, Top EM, Verstraete W (2005) Combinedeffect of fertilizer and herbicide applications on the abundance,community structure and performance of the soil methanotrophiccommunity. Soil Biol Biochem 37:187–193

Shaw LJ, Nicol GW, Smith Z, Fear J, Prosser JI, Baggs EM (2006)Nitrosospira spp. can produce nitrous oxide via a nitrifierdenitrification pathway. Environ Microbiol 8:214–222

Soil Survey Division Staff (1993) Soil survey manual. U.S. Depart-ment of Agriculture Handbook 18. U.S. Government PrintingOffice, Washington DC

Stanley SH, Dalton H (1983) Copper stress underlies the fundamentalchange in intracellular location of methane mono-oxygenase inmethane utilizing organisms: studies in batch and continuouscultures. Biotechnol Lett 5:487–492

Stralis-Pavese N, Sessitsch S, Weilharter A, Reichenauer T, Riesing J,Csontos J et al (2004) Optimization of diagnostic microarray forapplication in analysing landfill methanotrophic communitiesunder different plant covers. Environ Microbiol 6:347–363

Sutka RL, Ostrom NE, Ostrom PH, Gandhi H, Breznak JA (2003)Nitrogen isotopomer site preference of N2O produced by Nitro-somonas europaea and Methylococcus capsulatus Bath. RapidCommun Mass Spectrom 17:738–745

Sutka RL, Ostrom NE, Ostrom PH, Breznak JA, Gandhi H, Pitt AJ, LiF (2006) Distinguishing nitrous oxide production from nitrifica-tion and denitrification on the basis of isotopomer abundances.Appl Environ Microbiol 72:638–644

US EPA (1996) Standards of performance for new stationary sourcesand guidelines for control of existing sources: municipal solidwaste landfills. Code of Federal Regulations, Title 40, Sections 9,51, 52, and 60; Fed Regist 61 (49)

Whalen SC, Reeburgh WS (1990) Consumption of atmosphericmethane by tundra soils. Nature 346:160–162

Whalen SC, Reeburgh WS, Sandbeck KA (1990) Rapid methaneoxidation in a landfill cover soil. Appl Environ Microbiol56:3405–3411

Whittenbury RK, Philips KD, Wilkinson JF (1970) Enrichment,isolation, and characterization of methane-utilizing bacteria. JGen Microbiol 61:205–218

Yoshinari T (1985) Nitrite and nitrous oxide production by Methyl-osinus trichosporium. Can J Microbiol 31:139–144

Zahn JA, DiSpirito AA (1996) Membrane-associated methane mono-oxygenase from Methylococcus capsulatus Bath. J Bacteriol178:1018–1029

Appl Microbiol Biotechnol (2009) 85:389–403 403