Dopamine D2-like antagonists induce chromatin remodeling instriatal neurons through cyclic AMP-protein kinase A and NMDAreceptor signaling

Jianhong Li,* Yin Guo,* Frederick A. Schroeder,� Rachael M. Youngs,§ Thomas W. Schmidt,*Craig Ferris,� Christine Konradi§ and Schahram Akbarian*

*Department of Psychiatry, Brudnick Neuropsychiatric Research Institute, �Graduate School of Biomedical Sciences and

�Center for Comparative Neuroimaging, University of Massachusetts Medical School, Worcester, Massachusetts, USA

§Laboratory of Neuroplasticity, McLean Hospital and Harvard Medical School, Belmont, Massachusetts, USA

Abstract

Antipsychotic drugs regulate gene transcription in striatal

neurons by blocking dopamine D2-like receptors. Little is

known about the underlying changes in chromatin structure,

including covalent modifications at histone N-terminal tails that

are epigenetic regulators of gene expression. We show that

treatment with D2-like antagonists rapidly induces the phos-

phorylation of histone H3 at serine 10 and the acetylation of

H3-lysine 14 in bulk chromatin from striatum and in nuclei of

striatal neurons. We find that, in vivo, D2-like antagonist-

induced H3 phospho-acetylation is inhibited by the NMDA

receptor antagonist MK-801 and by the protein kinase A

(PKA) inhibitor Rp-adenosine 3c¢,5c¢-cyclic monophosphoro-

thioate triethylammonium salt but increased by the PKA acti-

vator Sp-adenosine 3c¢,5c¢-cyclic monophosphorothioate

triethylammonium salt. Furthermore, in dissociated striatal

cultures which lack midbrain and cortical pre-synaptic inputs,

H3 phospho-acetylation was induced by glutamate, L-type

Ca2+ channel agonists and activators of cAMP-dependent

PKA but inhibited by NMDA receptor antagonists or PKA

antagonists. The dual modification, H3pS10-acK14, was

enriched at genomic sites with active transcription and

showed the kinetics of the early response. Together, these

results suggest that histone modifications and chromatin

structure in striatal neurons are dynamically regulated by

dopaminergic and glutamatergic inputs converging on the

cellular level. Blockade of D2-like receptors induces H3 phos-

pho-acetylation, H3pS10-acK14, through cAMP-dependent

PKA, and post-synaptic NMDA receptor signaling.

Keywords: basal ganglia, caudate-putamen, histone acetyl-

transferase, nucleosome, psychosis, schizophrenia.

J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

Striatal dopamine receptors are an important target ofantipsychotic drugs that directly interact with dopamineD2-like receptors. The molecular cascades linking blockadeof D2-like receptors to reduction of psychosis are unknownbut transcriptional mechanisms appear to be involved(Robertson et al. 1992; Gunther et al. 2003). Upon inhibitionof D2-like signaling, striatal and pallidal gene expression isaltered in an orchestrated and sequential fashion, startingwith the transient expression of early response genes(Dragunow et al. 1990; Robertson et al. 1991; Nguyenet al. 1992; Deutch et al. 1996) followed by increasedtranscription of neuropeptides, second and third messengermolecules, receptors, ion channels and other neurotransmis-sion-related molecules (Merchant and Dorsa 1993; Fox et al.1994; Delfs et al. 1995; Fitzgerald et al. 1995; Laprade and

Soghomonian 1995; Schoots et al. 1995; Doucet et al. 1996;Moratalla et al. 1996; Eastwood et al. 1997; Healy andMeador-Woodruff 1997; Mijnster et al. 1998; Atkins et al.

Received March 9, 2004; revised manuscript received April 20, 2004;accepted April 21, 2004.Address correspondence and reprint requests to Schahram Akbarian,

Department of Psychiatry, Brudnick Neuropsychiatric Research Institute,303 Belmont Street, University of Massachusetts Medical School,Worcester, MA 01604, USA.E-mail: schahram.akbarian@umassmed.eduAbbreviations used: cAMP-PKA, cAMP-dependent protein kinase A;

Rp-cAMPs, Rp-Adenosine 3c¢,5c¢-cyclic monophosphorothioate tri-ethylammonium salt; Sp-cAMPs, Sp-Adenosine 3c¢,5c¢-cyclic mono-phosphorothioate triethylammonium salt.

Journal of Neurochemistry, 2004 doi:10.1111/j.1471-4159.2004.02569.x

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x 1

1999; Nakahara et al. 2001; Chong et al. 2002; Lau et al.2003; Lipska et al. 2003; McCullumsmith et al. 2003).

The magnitude of antipsychotic drug-induced gene expres-sion is likely to require profound molecular adaptations innuclei of striatal neurons. In eukaryotes, the rate-limitingbiochemical response that leads to activation of gene expres-sion involves alterations in chromatin structure (Felsenfeld andGroudine 2003). Dynamic changes in chromatin structure andaccessibility of transcription factors are mediated by thechemical modification of residues located at the amino-terminal tails of the histones. Specifically, a set of covalentmodifications of specific arginine, lysine and serine residues atthe histone N-terminal tails defines a ‘histone code’ that isdifferentially regulated in chromatin at sites of active geneexpression, in comparison to inactive and silenced chromatin(Jenuwein and Allis 2001; Turner 2002).

At present, nothing is known about the regulation ofstriatal chromatin. To examine chromatin and histone–DNAinteractions in striatum in the context of pharmacologicalmanipulation of D2-like receptors, we monitored dynamicchanges in acetylation, methylation and phosphorylation ofspecific tail residues of two core histones, H3 and H4, andused chromatin-immunoprecipitation assays (Kuo and Allis1999) to study three aspects of antipsychotic drug-inducedchromatin changes: (i) the type(s) of covalent histonemodifications regulated by D2-like signaling, including theunderlying kinetics; (ii) the genomic sites targeted byhistone-modifying enzymes and (iii) the signal transductionpathways that link blockade of D2-like receptors to thehistone modification machinery in the nucleus.

We report here for the first time that, in vivo, treatmentwith D2-like receptor antagonists and antipsychotics inducesthe phospho-acetylation of histone H3 in striatal chromatinboth on a global level and at defined genomic sequences.Moreover, we show that both dopaminergic and glutamater-gic input converge at a cellular level to regulate chromatinstructure in striatal neurons and that antipsychotic drug-induced H3 phospho-acetylation is mediated through cAMP-protein kinase A (PKA) and NMDA receptor pathways.

Materials and methods

In vivo experiments

All animal experiments were approved by the University of

Massachusetts animal care committee.

MiceFor each experiment, 5–10-week-old male and female outbred mice

(predominantly 129/SvJ) were used. Mice received i.p. injections of

vehicle (saline) (0.1 mL/10 g body weight) with or without: (i) the

D2-like agonist quinpirole (2 mg/kg); (ii) the D2-like antagonist

S(–)-raclopride tartrate (10 mg/kg) (drugs purchased from Sigma-

RBI, St Louis, MO, USA); (iii) the D2-like antagonist and

antipsychotic haloperidol lactate (1 mg/kg) (Ortho-McNeil, Fort

Washington, PA, USA); (iv) the atypical antipsychotic, risperidone

hydrochloride (Janssen Pharmaceuticals, Beerse Belgium) or (v) the

NMDA receptor antagonist, MK-801 (Sigma-RBI) (1 mg/kg). Each

drug-treated animal was processed together with a saline-treated

littermate control of the same gender. For each group, the

male : female ratio was 1 : 1 and the minimum n was 6.

Survival times. Mice treated with quinpirole, raclopride or risperi-

done were killed 120 min after a single injection and haloperidol-

treated mice were killed at various timepoints (15, 30, 120 and

480 min) after a single injection or 120 min after a 1-, 3-, 5- or 10-day

course of twice daily injections at 08:00 and 16:00 h. Animals that

were treated for 5 days with haloperidol received the last injection at a

higher dose (4 mg/kg), otherwise the haloperidol dose for each

treatment was 1 mg/kg. Mice that received a single dose of MK-801

were treated 15 min after the MK-801 dose with haloperidol or saline

and were killed 30 min after the second treatment. Mice were either

decapitated and the striatum dissected or, under deep anesthesia,

perfusion-fixed with 4% phosphate-buffered paraformaldehyde.

RatsAdult Sprague-Dawley rats (350–450 g) were used. Animals were

anesthesized by 4% isoflurane inhalation, placed into a stereotaxic

frame and then one of the following drugs was infused over a period

of 5 min in a total volume of 1 lL into the center of the left

striatum: (i) phosphate-buffered saline (0.1 mol/L, pH 6.9) as

vehicle or the cAMP analogs (ii) Rp-adenosine 3c¢,5c¢-cyclicmonophosphorothioate triethylammonium salt (100 nmol) or

(iii) Sp-adenosine 3c¢,5c¢-cyclic monophosphorothioate triethylam-

monium salt (100 nmol) (both drugs from Sigma-RBI). Animals

were allowed to recover and 30 min after the intrastriatal injection

animals received a systemic dose of either haloperidol (1.5 mg/kg)

or saline. At 30 min after haloperidol or saline, animals were then

killed and the striata were dissected and further processed for

immunoblotting as described below. Additional series of animals

were treated with a systemic dose of MK-801 (1 mg/kg) or saline

followed after 15 min by a systemic dose of haloperidol (1.5 mg/kg)

or saline and animals were killed 30 min after the second treatment.

For each treatment group, the minimum n was 5.

In vitro experiments

Primary striatal cultures were prepared as described previously, with

minor modifications (Konradi et al. 1996; Rajadhyaksha et al. 1998).Striata from 18-day-old Sprague Dawley rat fetuses were dissected

and resuspended in defined medium [50% F12/Dulbecco’s modified

Eagle’s medium and 50% Dulbecco’s modified Eagle’s medium

(Gibco-Invitrogen, Grand Island, NY, USA) with the following

supplements/L of medium: 4 g of dextrose, 1 · B27, 10 mL of

penicillin-streptomycin liquid (Gibco-Invitrogen) and 25 mM

HEPES]. Cells were resuspended in defined medium to

1.2 · 106 cells/mL and plated in 12-well plates (Costar, Cambridge,

MA, USA) at 2 · 106 cells/well. Plates were pre-treated with 1 mL

of a 1 : 500-diluted sterile solution of polyethylenimine in water for

18 h, washed twice with sterile water, coated with 2.5% serum-

containing phosphate-buffered saline solution for at least 4 h and

aspirated just before plating. All experiments were performed in

triplicate with cells that were in culture for 6 days and repeated at

least once in an independent dissection. As determined by HPLC

2 J. Li et al.

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

analysis, glutamate levels in the medium on the day of the

experiments ranged from 1 to 5 lM. The neuron : astroglia ratio

was below 25 : 1, as established by immunocytochemical staining

with the glial fibrillary acid protein (Dako, Carpinteria, CA, USA)

and counterstaining with 1% cresyl violet.

All drugs used for the in vitro experiments were purchased from

Sigma. On the day of the experiment, cells were pre-treated with

2 lM tetrodotoxin citrate for a period of 120 min before harvest to

suppress transneuronal activity. At 60 min before harvest cells were

treated with one of the following drugs (Treatment 1): (1.1) vehicle

(10 lL dimethylsulfoxide); (1.2) the PKA inhibitor N-[2-(p-bro-mocinnamylamino)ethyl]-5-isoquinolinesulfonamide dihydrochlo-

ride (H89; 20 lM) or (1.3) the NMDA receptor antagonist

[(+)MK-801 hydrogen maleate; MK-801; 2 lM]. At 30 min before

harvest, cells were treated with one of the following drugs

(Treatment 2): (2.1) vehicle (10 lL dimethylsulfoxide); (2.2)

glutamate (50 lM); (2.3) the adenylyl cyclase-activating drug

forskolin (1 and 10 lM) or (2.4) the L-type Ca2+ channel agonist,

2,5-dimethyl-4-[2-(phenylmethyl)benzoyl]-1H-pyrrole-3-carboxylic

acid methylester (FPL 64176; 20 lM).

Anti-histone antibodies

To profile the pattern of histone acetylation, methylation and

phosphorylation, we used a panel of nine antibodies selectively

recognizing modifications at specific amino acids of the N-terminal

tail of histones H3 and H4. The following antibodies (Upstate,

Charlottesville, VA, USA) were used (with the working dilution for

immunoblotting experiments in parentheses): anti-acetyl-histone H3

(Lys14), H3acK14 (1 : 250); anti-acetyl-histone H3 (Lys 9 and 14),

H3acK9/14 (1 : 2000); anti-acetyl-histone H4 (Lys 8), H4acK8

(1 : 5000); anti-acetyl-histone H4 (Lys 12), H4acK12 (1 : 2000);

anti-dimethyl-histone H3 (Lys4), H3meK4 (1 : 1000); anti-dimeth-

yl-histone H3 (Lys9), H3meK9 (1 : 500); anti-dimethyl-histone H3

(Arg17), H3meR17 (1 : 250); anti-phospho-histone H3 (Ser 10),

H3pS10 (1 : 1000); an antibody that recognizes phospho-acetylated

H3, defined by phospho (Ser10) in conjunction with acetyl (Lys14),

H3pS10-acK14 (1 : 500).

To control for the specificity of the antibody recognizing the dual

modification, H3pS10-acK14, blots were processed in the presence

of 1.5 lg/mL of a synthetic peptide containing the sequence of 21

residues at the N-terminal tail of H3 and the epitope defined by the

dual modification, phospho-serine 10 plus acetyl-lysine 14. When

this peptide was added to the primary antibody incubation medium,

immunoreactivity was completely abolished (Fig. 1a). In contrast,

the addition of synthetic peptides containing the same sequence and

epitopes defined by the single modifications, phospho-serine 10 or

acetyl-lysine 14, did not inhibit H3pS10-acK14 immunoreactivity

(Fig. 1a). The specificity of the anti-H3pS10-acK14 antibody was

maintained in paraformaldehyde-fixed tissue processed for immuno-

histochemistry (Figs 1b–d). In addition to the experiments shown

in Fig. 1, blocking experiments with synthetic peptides were

conducted to confirm the specificity of the following antibodies:

anti-H3pS10, anti-H3acK14, anti-H3acK9/14, anti-H3meK4, anti-

H3meK9, anti-H4acK8 and anti-H4acK12 (data not shown).

Immunoblots

Striata were dounced in 0.2 N H2SO4 to extract basic proteins

including histones. Acid-soluble proteins were precipitated with

trichloroacetic acid (final concentration 33%), washed in 100%

acetone/0.05 M HCl and 100% acetone and resuspended in H2O.

Samples were then eluted in 1 · Laemmli buffer and 20 lg/sample were run on 10–20% polyacrylamide gradient Tris.HCl

gels and immunoblotted on polyvinylidene difluoride membranes

(Bio-Rad Laboratories, Hercules, CA, USA). Tissue culture

samples were directly dissolved in 1 · Laemmli buffer without

prior acid extraction. The membranes were incubated for 4–8 h

with site-specific anti-histone antibodies, washed and further

processed with horseradish peroxidase-conjugated secondary

antibodies to reveal immunocomplexes by enhanced chemilumi-

nescence (Pierce, Rockford, IL, USA). Quantity One software

(Bio-Rad Laboratories) was used for densitometry of film

autoradiograms, including custom-made standards. Furthermore,

membranes were processed for H3 and H4 immunoreactivity

allowing direct comparison of H3- and H4-immunoreactive bands

(Fig. 1a). Equal loading of the samples was also checked by gel

Coomassie blue stain revealing the characteristic histone banding

patterns (Wan et al. 2001).

Fig. 1 Specificity of anti-histone antibodies. (a) Film autoradiograms

from immunoblots on mouse cerebral cortex probed with anti-H3pS10-

acK14 antibody, and then with anti-H4acK12 antibody as loading

control. Membranes (i-v) were incubated with primary antibody in

presence or absence of synthetic peptides (1.5 lg/ml) containing the

first 21 residues of histone H3 and a site-specific modification: (i) no

peptide; (ii) H3(1-21)pS10-acK14; (iii) H3(1-21) pS10; (iv) H3(1-

21)acK14; (v) H3(1-20) without a covalent modification. Notice the

selective loss of H3pS10-acK14 immunoreactivity in (ii), due to addi-

tion of H3(1-21)pS10-acK14 peptide to primary antibody incubation

solution. Antibody working dilutions: anti-H3pS10-acK14, 1:500; anti-

H4acK12, 1:4000. (b-d) Digitized images from DAB/immunoperoxi-

dase-stained sections from adult piriform cortex were incubated with

(b,c) or without (d) anti-H3pS10-acK14 antibody. Peptides containing

a single modification (H3(1-21)pS10) did not block immunoreactivity

when added to the primary antibody solution (b), in contrast to com-

petitor peptides containing the dual modification, H3(1-21)pS10-acK14

(c). Notice selective complete loss of immunoreactivity in (c) due to

competitor antigen, similar to negative control (d) that was processed

without primary antibody. Images in (b–d) taken at 20x10 magnifica-

tion.

Chromatin remodeling in striatum 3

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

Immunohistochemistry

Coronal sections (18 lm), cut from blocks containing striatum and

adjacent cerebral cortex, were processed free-floating for immunop-

eroxidase-based staining and immunofluorescence using standard

protocols (Akbarian et al. 2002), the anti-H3pS10-acK14 anti-

body (1 : 250) and an anti-NeuN antibody (1 : 300; Chemicon,

Temecula, CA, USA) to label neurons. Sections were examined with

an Axiovert microscope (Carl Zeiss MicroImaging, Inc. Thornwood,

NJ, USA) and digitized images were obtained with OpenLab software

(Improvision, Lexington, MA, USA). Quantification of immunolabe-

led nuclei in 3¢3-diaminobenzidine tetrahydrochloride (DAB)-stained

sections from dorso-lateral striatum was done with the · 20 objectiveand with a 7 · background threshold for the software to count

intensely labeled nuclei for each digitized image covering an area of

0.14 mm2. Data were expressed as percentage of total nuclei/image.

Chromatin immunoprecipitation

For each chromatin immunoprecipitation experiment, bilateral striata

from three mice were pooled. Nuclei from dissected striata were

isolated in ice-cold 10 mM Tris.HCl (pH 7.5)/10 mM NaCl/3 mM

MgCl2/0.1%NP-40, washed and resuspended in 2 mL ice-cold buffer

EB [20 mM HEPES, pH 7.5, 100 mM NaCl, 1 mM dithiothreitol,

1 mM EDTA, 5% glycerol, 0.05% Triton X-100, 5 mM sodium

butyrate, one tablet of protease inhibitor cocktail; Roche, Mannheim,

Germany and 500 lL phosphatase inhibitor cocktail (Upstate)/50 mL

buffer]. The nuclei were cross-linked with 1% formaldehyde for

10 min at room temperature on a rotator. Cross-linking was stopped

with 1 mM glycine and, after repeated washings, chromatin was

sonicated in 400 lL EB buffer to an average of 500 bp (Branson,

Danbury, CT, USA). From each sonicated sample, 10% was used as

the input control for immunoprecipitated fragments at a DNA

concentration of approximately 0.5 mg/mL. The remaining 90% of

each sonicated sample was incubated overnight in a total volume of

600 lLEBbuffer containing 4 lLof anti-H3pS10-acK14 antibody or

rabbit IgG as control. Antibody complexes were bound to

G-sepharose (Amersham, Piscataway, NJ, USA), washed and then

eluted in 50 mM sodium bicarbonate/1% sodium dodecyl sulfate at

room temperature for 30 min under constant vortexing and then

incubated in proteinaseK (100 lg/mL). From each striatal sample, the

DNA from immunoprecipitated chromatin and the input DNA (see

above) were purified (phenol/chloroform), ethanol precipitated and

resuspended in 10 lL H2O. Samples were amplified in duplicate and

at two different final dilutions (1 : 25 and 1 : 50) by low cycle PCR

(25 cycles) using the following primer pairs [gene/accession no./bp

amplified fragment upstream of 5¢UTR/forward primer/backward

primer: c-fos/NW_000053.1/(-380)-(-63)/ACACAGGATGTCCATA

TTA/TGGAGTAGTAGGCGCCTCAGC; GluR2/AF250875/(-569)-(-382)/ TTTGGGAGTTGTCCCTTCAG/GGAAGCCGAACTGCT

AATTG; GFAP/NT_039521/(-396)-(-203)/ GTGAGAGCCAGGAAGTCTGC/GGAACCCCCTTTCTGGTAAA; b-globin locus control

region/AF071080, bp 61551–61767/ACTGCATCTGCAAGCCTT

TT/GTGCCTGATTCCGGGTACTA]. The specificity of PCR prod-

ucts from each experiment was controlled by 1.8% agarose gel

electrophoresis and Southern blot using sequence-verified subclones

labeled with psoralen-biotin (Ambion, Austin, TX, USA) for

hybridization, in conjunction with chemiluminescence (BrightStar;

Ambion) and film autoradiography. Quantification of film auto-

radiograms of PCR experiments with no yield in negative controls

(minus DNA) was done by densitometry and Quantity One software

(Bio-Rad).

Quantitative RT-PCR

Striata from three mice were pooled and RNAwas extracted with the

TRIzol reagent (Invitrogen, Carlsbad, CA, USA). For each sample,

5 lg of total RNA were reverse transcribed with AMV-reverse

transcriptase and amplified by PCR using the c-fos relative RT-PCRkit (Ambion) (c-fos primers containing the sequences forward

primer, AGAGCGCAGAGCATCGGCAG and reverse primer,

CCCTAGAACGTCCGTCCAGC) with amplified 18s rRNA tran-

scripts as loading control and a 1 : 4 ratio of 18s primer/competimer

to adjust for the abundance of 18s rRNA, according to the

manufacturer’s instructions. The specificity of PCR products was

examined by Southern blotting with sequence-verified c-fos and 18scDNA probes. Real-time PCR was then used to quantify c-fos and18s transcripts from reverse-transcribed RNA (iQ SYBR Green

Supermix and MyiQ Single Color Detection System; Bio-Rad).

Statistical analyses

As the data are compiled from many different cell counts, Southern

blots and real-time RT-PCR experiments, all data are normalized to

untreated, internal controls. Data are, therefore, semiquantitative and

not based on absolute numbers. Data were analysed with one-way

ANOVAs and two-tailed t-tests using Statview software (SAS

Institute, Cary, NC, USA).

Results

Blockade of D2-like receptors induces global H3

phospho-acetylation in striatum

In dividing cells, histone modifications are highly regulatedboth on a global level and at defined genomic regions. Globalchanges occur when a particular histone modification isaltered in a coordinated manner across a large number ofgenomic sites. Once a certain threshold from baseline isreached, these changes then become apparent in bulkchromatin. Examples include the phosphorylation of histoneH3 at serine 10 across entire chromosomes of dividing cellsin prophase that is then followed by global dephosphoryla-tion upon exit from mitosis (Prigent and Dimitrov 2003).Furthermore, a dual modification at the N-terminal tail of H3,defined by phospho-serine 10 and acetyl-lysine 14 (H3pS10-acK14) is rapidly induced on a global level in cultured cellstreated with hormones, growth factors or toxins. Thedimodified H3 molecules, H3pS10-acK14, are associatedwith transcriptional activation (Cheung et al. 2000; Claytonet al. 2000; Salvador et al. 2001; Li et al. 2002).

To examine global histone modification changes in thestriatum in vivo, we treated adult mice with a single dose ofthe D2-like antagonist and conventional antipsychotic,haloperidol (1 mg/kg, i.p.). Littermates received saline ascontrol. Mice were killed 120 min after treatment and histonemodification patterns of striatal nuclei were profiled by

4 J. Li et al.

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

immunoblotting with a panel of nine antibodies recognizingsite-specific modifications at the N-terminal tails of histonesH3 and H4. Each epitope was defined by acetylation,

methylation or phosphorylation of specific residues (Fig. 2a).Each of these histone modifications has been studiedextensively in cultured, non-neuronal cells and is part of acombinatorial set of histone modifications differentiatingbetween open chromatin at sites of actual or potentialtranscription (upward arrow in Fig. 2a) and inactive, silencedand condensed chromatin (downward arrow in Fig. 2a)(Jenuwein and Allis 2001; Turner 2002).

The H3 epitope defined by the dual modification,phospho-serine 10 in conjunction with acetyl-lysine 14(H3pS10-acK14), was consistently and on average 2.2-foldincreased in the haloperidol-treated animals (Figs 2b topand c). None of the other eight epitopes/histone modifica-tions that we examined were differentially regulated on aglobal level in haloperidol-treated animals in comparison tocontrols (Figs 2b and c). These included two H3 epitopesdefined by lysine acetylation (H3acK9/14 and H3acK14),two H4 epitopes defined by lysine acetylation (H4-acK8and H4-acK12, Figs 2a–c), three H3 epitopes defined bymethylated lysine and arginine residues (H3meK4,H3meK9 and H3meR17, Figs 2a–c) and one H3 epitopedefined by serine phosphorylation (H3Sp10) (Figs 2a–c).Notably, H3pS10 and H3acK14 comprise together, whenresiding on the same H3 tail, phospho-acetylated H3,H3pS10-acK14. Therefore, our experiments demonstratethat, in bulk chromatin from striatum, H3pS10-acK14 isup-regulated in haloperidol-treated animals but, when H3-phospho-serine 10 and H3-acetyl-lysine 14 are analysedseparately, no changes are detectable when bulk chromatinis assayed. This result was not unexpected becausedifferential regulation of the dimodified H3 epitope and

Fig. 2 The conventional anti-psychotic, haloperidol, increases H3

phospho-acetylation in bulk chromatin. (a) The nine site-specific

modifications at N-terminal tails of histone H3 and H4 that were

examined in the present study. Ac, acetylation; me, methylation; p,

phosphorylation. Single letter code: K, lysine; R, arginine; S, serine.

Upward arrows mark association with open chromatin and the tran-

scriptional state, downward arrows mark assocation with silenced and

inactive chromatin, combined arrows mark more generalized function

independent of transcription (Jenuwein and Allis, 2001). (b) Repre-

sentative immunoblots from acid extracted proteins from striatum of

mice killed 120 min after a single dose of haloperidol or saline,

showing immunoreactivities for the total of nine site- and modification-

specific histone epitopes shown in (a). Notice increased H3 phospho-

acetylation (H3pS10-acK14) in striatum of haloperidol-treated animals

(top), but no differences to controls for H3 acetylation (H3acK9/14 and

H3acK14), methylation (H3meK4, H3meK9, H3meR17) and phos-

phorylation (H3pS10) and for H4 acetylation, (H4acK8, H4acK12).

(c) Levels of immunoreactivity (mean ± S.E.M.) for each of the nine

histone epitopes in striatum of mice 120 min after a single dose of

haloperidol. Levels are normalized to saline-treated littermate controls.

Notice 2-fold increase in H3pS10-acK14 in striatum of haloperidol-

treated animals, but no difference to controls for the remaining eight

H3/H4 epitopes.

Chromatin remodeling in striatum 5

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

the two monomodified H3 epitopes in bulk chromatin hasbeen previously observed in non-neuronal cell culture(Cheung et al. 2000; Salvador et al. 2001; Li et al. 2002)and in hippocampal neurons in vivo (Crosio et al. 2003).As H3 molecules with dimodified tails, H3pS10-acK14,comprise only a minor fraction of the total H3 pool, achange in H3pS10-acK14 immunoreactivity, as observed inthis study, may not be accompanied by similar alterationsin immunoblots for H3pS10 and H3acK14 if H3 tailsharboring these modifications separately comprise a muchlarger fraction of the total H3 in bulk chromatin (Cheunget al. 2000; Clayton et al. 2000; Salvador et al. 2001;Thomson et al. 2001). To confirm that the increase instriatal H3pS10-acK14 after treatment with haloperidol iscaused by blockade of D2-like signaling, we treated micewith another D2-like antagonist, raclopride (10 mg/kg).Levels of H3pS10-acK14 in raclopride-treated animals wereincreased consistently and, on average, 1.8-fold abovebaseline (p < 0.05) (Figs 3a and b). Another group of micewas treated with the atypical antipsychotic risperidone, anantagonist to dopamine D2-like receptors and to serotonin5-HT2 receptors. A single dose (1 mg/kg) resulted in arobust and, on average, twofold increase in phospho-acetylated H3 in striatum 120 min after treatment(p < 0.05) (Fig. 3b).

To examine if stimulation of D2-like receptors differen-tially affects striatal H3pS10-acK14, mice were treated with asingle dose of the D2-like agonist quinpirole (2 mg/kg) andno changes from baseline were observed (Figs 3a and b). Weconclude that the increase in H3pS10-acK14 in bulkchromatin of striatum is specific for drugs acting as D2-likeantagonists.

Drug-induced striatal H3 phospho-acetylation shows the

kinetics of the early response and desensitization after

repeated treatment

To monitor the dynamic regulation of H3 phospho-acety-lation after blockade of D2-like signaling, we killed animalsat 15, 30, 120 and 480 min after a single dose of haloperidol(1 mg/kg) or saline.

There was a significant, approximately twofold increasein H3pS10-acK14 within the first 15 min after haloperidoltreatment and these levels were maintained for at least120 min (p < 0.01–0.05) (Figs 4a and b). In striatum ofanimals killed 480 min after treatment, levels of phospho-acetylated H3 had returned to baseline (Figs 4a and b).Therefore, the kinetics of the haloperidol-inducedup-regulation of striatal H3pS10-acK14 bears a resem-blance to the immediate-early gene response becauseimmediate-early gene proteins, including fos and other

Fig. 4 Blockade of D2-like signaling induces H3 phospho-acetylation

in striatum with kinetics that are characteristic of the early response.

(a) Representative immunoblots from striatum of haloperidol-treated

mice at 15, 30 and 480 min after a single dose (1mg/kg), and after

regular treatments twice daily (1mg/kg) for a period of 10 days. Notice

increased levels of H3pS10-acK14 in striatum at 15 and 30 min after

acute haloperidol treatment. (b) Kinetics of H3 phospho-acetylation in

striatum of haloperidol-treated mice. Data are normalized to levels of

saline-treated controls and expressed as mean ± S.E.M. (*p < 0.05,

ANOVA with Fisher’s paired least significant difference (PLSD) correc-

ted for multiple comparisons). There is a significant increase in striatal

H3pS10-acK14 at 15, 30 and 120 min after a single dose, and return to

baseline levels at 480 min. Notice normal levels of phospho-acetylated

H3 in striatum of animals subject to repeated haloperidol treatment for

1, 3, 5 or 10 days. Animals that were subject to repeated treatments

were killed 120 min after the last treatment.

Fig. 3 Striatal H3 phospho-acetylation is selectively induced by

D2-like antagonists. (a) Striatal immunoblots from mice killed 120 min

after a single dose of D2-like agonist (quinpirole) or D2-like antagonist

(raclopride) or saline. Blots were processed first for H3pS10-acK14

and then for H4acK12 immunoreactivity. Corresponding gel coomas-

sie-blue stains for loading control show characteristic banding pattern

of the four core histones, including H3, approximately 14.5 kDa, and

H4, approximately 10.5 kDa. Notice increase in H3pS10-acK14, but

not H4acK12 immunoreactivity in raclopride-treated animals. Notice

that H3pS10-acK14 is unchanged in quinpirole-treated animals, in

comparison to saline-treated littermates. (b) Levels of striatal H3pS10-

acK14 immunoreactivity (mean ± S.E.M.) in D2-agonist (quinpirole)-

treated animals, and in animals treated with raclopride or the atypical

anti-psychotic risperidone. Levels are normalized to saline-treated

littermate controls. There is an increase in striatal H3pS10-acK14

in raclopride- and risperidone-, but not in quinpirole-treated animals (*p

< 0.05).

6 J. Li et al.

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

AP-1 transcription factors, characteristically peak 60–120 min after acute haloperidol treatment in striatum(Dragunow et al. 1990).

After regular and repeated exposure to dopaminergicdrugs and antipsychotics, the transcriptional activation ofimmediate-early genes is subject to desensitization (Atkinset al. 1999 and references therein). To examine if striatalH3 phospho-acetylation is subject to desensitization in thecontext of extended haloperidol treatment, we injectedmice twice daily at 08:00 and 16:00 h with haloperidol(1 mg/kg) for a period of 1, 3 or 10 days and then killedthe animals 120 min after the final treatment. For each ofthese treatment groups, levels of phospho-acetylated H3 instriatum were not different from saline-treated controls(Fig. 4b). To examine the possibility that this lack ofH3pS10-acK14 induction was the result of a shift in thehaloperidol dose–response curve, mice were treated for4 days with 1 mg/kg haloperidol twice daily and on thefifth day with a much higher dose of 4 mg/kg. In striatumof these mice, levels of H3pS10-acK14 remained unalteredfrom controls (Fig. 4b). Therefore, H3 phospho-acetylationis up-regulated in response to acute blockade of D2-likesignaling but this mechanism is subject to desensitizationwhen the duration of treatment is extended.

D2-like antagonists up-regulate striatal H3pS10-acK14

through activation of the cyclic AMP-protein kinase A

pathway

Blockade of D2-like receptors removes the D2-mediatedinhibition of adenylyl cyclases in striatum (Sibley 1995).The resulting activation of cAMP-dependent PKA (cAMP-PKA) is essential for transcriptional activation aftertreatment with antipsychotics blocking D2-like receptors(Adams et al. 1997; Brandon et al. 1998). To determinewhether the cAMP-PKA pathway is involved in D2-likeantagonist-induced chromatin remodeling, including theup-regulation of striatal H3pS10-acK14, we conductedin vivo experiments. We injected cAMP-analog drugs intothe striatum of adult rats and monitored the resultingchanges in H3pS10-acK14. We first examined the effect ofRp-adenosine 3c¢,5c¢-cyclic monophosphorothioate triethyl-ammonium salt, a cAMP analog that inhibits PKA. Ratsreceived Rp-adenosine 3c¢,5c¢-cyclic monophosphorothio-ate triethylammonium salt (100 nmol) into the left stria-tum, followed after 30 min by a systemic dose ofhaloperidol (1.5 mg/kg, i.p.). After an additional periodof 30 min, animals were then killed and striatal histoneswere profiled by immunoblotting. Levels of H3pS10-acK14 in the left striatum were consistently and, onaverage, 30% decreased in comparison to levels in the(untreated) right striatum (Figs 5a and d). This differencewas significant (p < 0.05). In contrast, animals thatreceived vehicle (phosphate-buffered saline) into the leftstriatum showed, after haloperidol treatment, a robust

increase in H3pS10-acK14 in striatum bilaterally (Figs 5aand d). We conclude that haloperidol-induced H3 phospho-acetylation in striatum is significantly inhibited whencAMP-PKA is blocked.

Next, we examined changes in striatal H3pS10-acK14after activation of cAMP-PKA. Rats received the cAMPanalog and PKA activator drug Sp-adenosine 3c¢,5c¢-cyclicmonophosphorothioate triethylammonium salt (100 nmol)into the left striatum and, after a period of 60 min, striatalhistones were extracted for immunoblotting. When comparedwith vehicle-treated animals, Sp-adenosine 3c¢,5c¢-cyclicmonophosphorothioate triethylammonium salt induced asignificant, approximately 2.5-fold increase in H3pS10-acK14 in the left striatum (Figs 5b and d). Furthermore,levels in H3pS10-acK14 in the left striata treated with Sp-adenosine 3c¢,5c¢-cyclic monophosphorothioate triethylam-monium salt were approximately twofold increased, incomparison to the right striata of the same animals (Figs 5band d). These differences were significant (p < 0.05).Therefore, in vivo activation of cAMP-PKA induces thephospho-acetylation of H3 in striatum.

To confirm that cAMP-PKA signaling in striatal neurons isessential for H3 phospho-acetylation and to exclude thepossibility that in vivo effects of the cAMP analog drugs aredue to altered synaptic transmission and other variables, wemonitored H3 phospho-acetylation after pharmacologicalmanipulation of the cAMP-PKA pathway in vitro, usingdissociated striatal cultures which lack midbrain and corticalpre-synaptic inputs. Neuronal transmission was blocked withtetrodotoxin citrate (2 lM) starting 120 min prior to cellharvest. Treatment of striatal cultures with forskolin (1 lM), adrug that activates adenylyl cyclases, induced a 2.4-foldincrease in H3pS10-acK14 within 30 min (p < 0.05)(Figs 5c and e). Next, we treated striatal cultures with thePKA inhibitor drug H89 (20 lM) for a period of 30 minbefore adding forskolin (1 lM) for another 30 min. Weobserved that H89 completely suppressed forskolin-inducedH3 phospho-acetylation (Figs 5c and e). This effect wassignificant (p < 0.05). Additional cultures were treated witha higher forskolin dose (10 lM) and results were indistin-guishable when compared with cultures treated with thelower dose (1 lM) (data not shown). We conclude from thesestudies that activation of adenylyl cyclase and cAMP-PKA instriatal neurons induces H3 phospho-acetylation.

Post-synaptic NMDA receptors modulate D2-like

antagonist-induced H3 phospho-acetylation in striatal

neurons

Previous studies demonstrated that blockade of D2-likereceptors in striatal neurons induces gene expression throughsynergistic interaction of cAMP-PKA signaling and gluta-matergic input emanating from the cerebral cortex andsubcortical areas (Boegman and Vincent 1996; Konradi et al.1996; Chesselet et al. 1998; de Souza and Meredith 1999;

Chromatin remodeling in striatum 7

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

Hussain et al. 2001). It is thought that glutamatergic signalingactivates NMDA receptors that, in turn, regulate voltage-operated Ca2+ channels (Rajadhyaksha et al. 1999). Ca2+-dependent enzymes then mediate the phospho-activation ofthe transcription factor cAMP response element-bindingprotein (Rajadhyaksha et al. 1999). To examine whetherNMDA receptor activity is required for D2-like antagonist-induced histone modification changes in striatum, we treatedmice and rats with a systemic dose of the NMDA receptorantagonist MK-801 (1 mg/kg) or saline as control, followedafter 15 min by a systemic dose of haloperidol (mice, 1 mg/kg; rats, 1.5 mg/kg, i.p.) or saline. After an additional 30 min,striata were then dissected and histones profiled by immuno-blotting. Animals that were treated first with saline and thenwith haloperidol showed a twofold increase in striatalH3pS10-acK14 (Figs 6a–c). In contrast, animals that receivedMK-801 and then haloperidol showed an attenuated responseand levels of striatal H3pS10-acK14 were decreased by30–40% in comparison to animals treated first with saline andthen with haloperidol (Figs 6b and c). These differences weresignificant (p < 0.05). We conclude that, after NMDAreceptor blockade, the D2-like antagonist-induced H3 phos-pho-acetylation in striatum is partially inhibited.

This partial inhibition of haloperidol-induced chromatinchanges by MK-801 in vivo suggests that glutamatergic inputand dopaminergic transmission converge to induce H3

phospho-acetylation in striatal neurons. We further testedthis hypothesis in dissociated striatal cultures pre-treated withtetrodotoxin citrate to suppress trans-synaptic signaling. Wefirst examined the effects of glutamate treatment (50 lM) onH3pS10-acK14 and observed, at 30 min after treatment, atwofold increase from baseline (p < 0.05) (Figs 6d and f). Incontrast, cultures that were treated with MK-801 (2 lM) for aperiod of 30 min prior to the addition of glutamate did notshow a significant change from baseline (Figs 6d and f). Weconclude that glutamate induces H3 phospho-acetylation instriatal neurons through post-synaptic NMDA receptors.Previous studies have shown that L-type Ca2+ channels areessential for NMDA receptor-mediated gene transcription instriatum (Rajadhyaksha et al. 1999). Furthermore, L-typeCa2+ channel currents are suppressed after activation ofD2-like receptors in striatal neurons (Hernandez-Lopez et al.2000). Therefore, we asked whether L-type Ca2+ channelactivity induces changes in striatal H3 phospho-acetylation.To address this question, we treated striatal cultures with theL-type Ca2+ channel agonist FPL 64176 (20 lM) for 30 minand observed a 2.3-fold increase in H3pS10-acK14 frombaseline (p < 0.01) (Figs 6e and f). We conclude from theseexperiments that D2-like antagonist-induced H3 phospho-acetylation in striatal neurons depends on post-synapticNMDA receptors that then activate Ca2+-dependent signalingpathways.

Fig. 5 D2-like antagonists induce striatal H3 phospho-acetylation by

activating cAMP-dependent PKA. (a, b) Immunoblots from left (L) and

right (R) striatum of rats showing H3pS10-acK14 and H4acK12

immunoreactivity, and gel coomassie blue stain as additional loading

control. Animals shown in (a) received PBS or Rp-cAMPs into the left

striatum, followed 30 min later by a systemic dose of haloperidol or

saline. Blots show striatal histones at 30 min after the systemic

treatment. Notice robust increase in H3pS10-acK14 in left and right

striatum of haloperidol-treated animals that received PBS into the left

striatum. Notice attenuated response in left striatum of haloperidol-

treated animals that received Rp-cAMPs into the left striatum.

(b) Striatal immunoblots from animals 60 min after an infusion of PBS

or Sp-cAMPs into the left striatum. There is a robust increase in

H3pS10-acK14 in left striatum of Sp-cAMPs treated animals. (c) Blots

from primary striatal cultures, treated with vehicle, forskolin or H89

followed by forskolin. Note increased levels of H3pS10-acK14 in

forskolin-treated cultures that is completely blocked by H89. The cul-

tures were treated with forskolin for a period of 30 min with or without

pre-treatment with H89 for 30 min; pre-treatment with H89 was for 30

minutes. (d) Levels of H3pS10-acK14 immunoreactivity (mean ±

S.E.M.) of in vivo experiments with cAMP analogue drugs. Gray bar,

left striatum; checkered bar, right striatum. Notice that Rp-cAMPs in-

duced a significant decrease in left striatum of haloperidol-treated

animals, while Sp-cAMPs induced a significant increase from baseline.

*¼ p < 0.05. (e) Graph summarizing levels of H3pS10-acK14 immu-

noreactivity (mean ± S.E.M.) of in vitro experiments, notice significant

increase from baseline in forskolin-treated cultures and significance

decrease from baseline when cultures were pre-treated with H89.

8 J. Li et al.

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

D2-like antagonists induce H3 phospho-acetylation in

neuronal nuclei

To determine if D2-like blockade changes histone modifica-tion patterns in nuclei of striatal neurons, we examined thecellular distribution of H3pS10-acK14 by immunohisto-chemistry. Coronal, 18-lm thick sections cut through thecaudate-putamen of mice killed 120 min after a single doseof haloperidol, risperidone or saline were examined. Stainingfor H3pS10-acK14 was confined to nuclei and, in DAB/immunoperoxidase-stained sections, was visibly much moreintense in the risperidone- and haloperidol-treated animals(Figs 7a, c and e) compared with saline-treated controls(Figs 7b, d and f). The overall distribution, shape and size ofthe immunostained nuclei were consistent with a neuronaldistribution pattern (Figs 7a–f). We used a semiquantitativeapproach to measure the haloperidol-induced increase inH3pS10-acK14 immunoreactivity in striatal nuclei usingdigitized images and OpenLab software. We comparedsections from drug- and saline-treated animals that wereprocessed in parallel. Sections from drug-treated animalsshowed a significant 70% increase in dark, DAB-stainedimmunopositive nuclei, operationally defined by an arbitrarythreshold of 7 · background in digitized images (Fig. 7l).This finding is in agreement with the immunoblottingexperiments described above.

To further confirm that the haloperidol-induced increase instriatal H3pS10-acK14 includes neuronal nuclei, we doublelabeled sections for immunofluorescence for phospho-acet-ylated H3 and NeuN, a neuron-specific nuclear protein(Muller et al. 1992). A subset of NeuN + nuclei showedintense H3pS10-acK14 immunofluorescence (Fig. 7g–i). Toestimate the difference between drug- and saline-treatedanimals, we determined the fraction of NeuN + nuclei withH3pS10-acK14 immunofluorescence exceeding the arbitrarythreshold of 7 · background in digitized images. There was asignificant, threefold increase in immunofluorescence in thehaloperidol-treated animals in comparison to controls(Fig. 7m). Together, the results of our immunohistochemicalexperiments demonstrate that treatment with antipsychoticsand D2-like antagonists induces the phospho-acetylation ofH3 in nuclei of striatal neurons.

Notably, the distribution of H3pS10-acK14 within eachneuronal nucleus was not uniform and, when the labelingpattern of H3pS10-acK14 was compared with the stainingpattern of the nucleophilic dye 4,6,-diamidino-2-phenylin-dole dihydrochloride (DAPI), it was apparent that H3pS10-acK14 is enriched in nuclear areas comprised of lesscondensed and loose chromatin but absent from nuclearregions comprised of condensed (hetero-)chromatin (Figs 7jand k). Therefore, the enrichment of H3pS10-acK14 in

Fig. 6 NMDA receptor- and Ca2+-dependent signaling pathways are

required for D2-like antagonist-induced striatal H3 phospho-acetyla-

tion. (a) Immunoblots showing levels of H3pS10-acK14 and H4acK12

in striatum of rats treated first with saline or the NMDA receptor

antagonist MK-801, followed after 15 min by a single dose of ha-

loperidol or saline. Animals were sacrificed 30 min after the second

injection. Notice that pre-treatment with MK-801 blocks the haloper-

idol-induced increase in H3pS10-acK14. (b, c) Bar graphs summar-

izing levels of H3pS10-acK14 (mean ± S.E.M.) in (b) mice and

(c) rats treated first with MK801 or saline followed by haloperidol or

saline. (d) Representative immunoblots of primary striatal cultures

treated with vehicle or glutamate for 30 min, with or without pre-

treatment with MK-801 for 30 minutes. Notice that glutamate treat-

ment increases levels of H3pS10-acK14, and notice that this effect is

blocked by MK801. (e) Representative immunoblot of dissociated

striatal culture treated with vehicle or the L-type Ca2+ channel agonist

FPL 64176. (f) Levels of H3pS10-acK14 immunoreactivity in striatal

cultures after treatment with vehicle, glutamate (±pre-treatment with

MK-801) and FPL 64176. Notice that glutamate treatment upregu-

lates H3pS10-acK14, and this is blocked by pre-treatment with

MK-801. Notice further that the L-type Ca2+ channel agonist FPL

64176 upregulates H3pS10-acK14.

Chromatin remodeling in striatum 9

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

nuclear subregions defined by a low content of condensedchromatin provides further evidence that this histone modi-fication is in striatal neurons associated with open chromatin,as has been previously reported for non-neuronal cellsin vitro (Cheung et al. 2000; Clayton et al. 2000) and forhippocampal neurons in vivo (Crosio et al. 2003).

H3 phospho-acetylation is dynamically regulated at the

c-fos promoter

To examine the dynamics of H3 phospho-acetylation atregulatory sequences of early reponse genes in comparison toother genes, we used chromatin immunoprecipitation assaysto measure H3 phospho-acetylation at defined genomic sitesdistinguished by different levels of transcriptional activity.We focused on chromatin around the promoters of thefollowing genes: (i) c-fos, an early response gene that, instriatum, shows several-fold induction from baseline afterblockade of D2-like signaling (Dragunow et al. 1990;Nguyen et al. 1992); (ii) GluR2, an a-amino-3-hydroxy-5-methylisoxazole-4-propionate receptor subunit expressed athigh levels in adult forebrain neurons, including striatum

(Brene et al. 1998); (iii) GFAP, a phenotypic marker for asubset of astrocytes and (iv) the locus control region of theerythroid-specific b-globin genes, which are silenced andheterochromatic in brain (Tolhuis et al. 2002).

Using the anti-H3pS10-acK14 antibody or rabbit IgG ascontrol, we immunoprecipitated striatal chromatin of micekilled 15 or 120 min after a single dose of haloperidol (1 mg/kg) or saline. We quantified the abundance of the regulatorysequences of the four genomic regions of interest inchromatin immunoprecipitation fractions by quantitativePCR in conjunction with Southern blot in order to ensurethe specificity of the reaction product (Fig. 8a). We foundthat, 120 min after haloperidol treatment, phospho-acetylatedH3 in chromatin around the c-fos promoter was increased2.7-fold in comparison to chromatin from saline-treatedlittermates (p < 0.05) (Fig. 8b). When striatal chromatin wasexamined at 15 min after haloperidol treatment, levels ofH3pS10-acK14 at the site of the c-fos promoter differed lessthan 30% in comparison to saline-treated controls. Thisdifference was not significant (Fig. 8b). In chromatin atGluR2, GFAP and b-globin regulatory sequences, levels

Fig. 7 Anti-psychotic drugs induce H3 phospho-acetylation in the

nuclei of striatal neurons. (a–f) Coronal sections through dorsolateral

striatum and adjacent cerebral cortex (a,b) were processed for

H3pS10-acK14 immunoreactivity and stained with immunoperoxidase/

diaminobenzidine. Sections from an animal killed 120 min after a

single dose of risperidone (a) or haloperidol (c,e) (1mg/kg). (b,d,f)

Show sections from saline-treated controls. Notice increased numbers

of dark stained nuclei in striatum (ST), but not cerebral cortex (CC) in

risperidone-treated animal (a). Notice increased numbers of dark

stained nuclei in striatum after haloperidol treatment (c,e). (g–i) Show

digitized images from immunofluorescence-stained sections through

dorsolateral striatum at 120 min after drug administration. Sections are

triple-labeled, (g) shows NeuN immunopositive neuronal nuclei, (h)

shows H3pS10-acK14 immunoreactivity and (i) 4,6,-diamidino-2-

phenylindole dihydrochloride (DAPI) counterstain in order to identify

nuclei. Arrows mark identical nuclei in corresponding images. Notice

high levels of phospho-acetylated H3 in a subset of neuronal nuclei.

(j, k) show higher resolution photomicrograph of neuronal nucleus.

(j) DAPI stain, (k) H3pS10-acK14 immunolabeling. Notice compart-

mentalized distribution of H3pS10-acK14 in neuronal nucleus (k), with

sparing of condensed chromatin (arrows) as defined by DAPI stain (j).

Images taken at magnification (a,b) 4x10, 10x10 (c,d), 60x10 (e–i),

100x10 (j,k). Bar graph in (l) shows percentage of DAB/immunoper-

oxidase-stained nuclei (mean ± S.E.M.) expressing high H3pS10-

acK14 immunoreactivity (operationally defined as > 7- fold increase

above background) in dorso-lateral striatum of haloperidol-treated

mice at 120 min after drug injection, in comparison to saline-treated

controls. (m) Shows fraction of NeuN+ positive nuclei expressing high

H3pS10-acK14 immunofluorescence >7x background. *p < 0.05.

Notice significant increase in H3pS10-acK14 immunoreactivity in

neuronal nuclei of haloperidol-treated animals.

10 J. Li et al.

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

of phospho-acetylated H3 did not differ significantlybetween haloperidol- and saline-injected animals at 15 or120 min after treatment (Fig. 8b). Therefore, the newlyphospho-acetylated H3 molecules are not randomly distri-buted in striatal chromatin but enriched in chromatin around

a subset of genes, including the early response gene, c-fos.Next, we compared the kinetics of H3 phospho-acetylation instriatal nucleosomes located at the c-fos promoter withcorresponding changes in c-fos mRNA levels. In striatum ofhaloperidol-treated mice, levels of H3pS10-acK14 wereincreased at 30 min, peaked at 120 min and returned tobaseline 480 min after treatment (Fig. 8c). In contrast, c-fostranscript was increased within 15 min, peaked at 30 minand then declined towards baseline levels at 120 min aftertreatment (Fig. 8c), which is consistent with previous studies(Merchant and Dorsa 1993; Adams et al. 1997). Weconclude that there is a rapid and transient increase in H3phospho-acetylation at the c-fos promoter, consistent with thekinetics of the early response. Notably, our results suggestthat a substantial portion of H3 molecules in chromatin at thec-fos promoter becomes phospho-acetylated sequential to theincrease in striatal c-fos transcripts (Fig. 8c).

To determine if haloperidol treatment induces additionalhistone modifications at the c-fos promoter, we conductedchromatin immunoprecipitation experiments with an anti-H4acK8 antibody (Fig. 8d). The acetylation of H4-lysine 8is, like the phospho-acetylation of H3, H3pS10-acK14,associated with open chromatin and actual transcription(Jenuwein and Allis 2001; Turner 2002). When striatalchromatin was examined 30 min after haloperidol treatment,levels of H4acK8 at the c-fos promoter were increasedtwofold in comparison to saline-treated littermates (Fig. 8d).This difference was significant (p < 0.05). Levels of H4acK8at the GluR2, GFAP and b-globin regulatory sequences weresimilar in haloperidol- and saline-treated animals (Fig. 8d).We conclude that acute blockade of D2-like signaling inducesboth H3 phospho-acetylation and H4 acetylation in chroma-tin surrrounding c-fos. Furthermore, we observed that levelsof both H3pS10-acK14 and H4acK8 are high in chromatinaround regulatory sequences of GluR2 and GFAP but verylow at the b-globin locus control region (Figs 8a and d). Thisfinding is in agreement with the observation that H3pS10-acK14 and H4acK8 are associated with open chromatinbecause the GluR2 and GFAP genes are expressed at highlevels in striatum, while chromatin of the entire b-globinlocus, including the locus control region, is silenced (Tolhuiset al. 2002) and subject to histone hypoacetylation in brain(Forsberg et al. 2000).

Discussion

We report that D2-like antagonists and antipsychotic drugsinduce chromatin modifications in nuclei of striatal neurons.Blockade of D2-like receptors induced a rapid increase indually modified N-terminal tails of histone H3, defined byphospho-serine 10 in conjunction with acetyl-lysine 14(H3pS10-acK14). These changes from baseline were ofsufficient magnitude to become detectable in immunochem-ical stainings of bulk chromatin and neuronal nuclei, which

Fig. 8 Drug-induced H3 phospho-acetylation of striatal chromatin is

differentially regulated at defined genomic sequences. (a) Represen-

tative Southern blots from PCR-amplified soluble striatal chromatin

immunoprecipitated with the anti-H3pS10-acK14 antibody or rabbit

IgG as control. Blots show amplification products for 5¢ regulatory

sequences of c-fos, GluR2, GFAP and b-globin genes. S-in, input

saline-treated controls; H-in, input haloperidol-treated animals; S-ch,

immunoprecipitated chromatin (ChIP) from saline-treated mice; H-ch,

ChIP from haloperidol-treated mice. Blots are from mice killed 15 min

(left) or 120 min (right) after a single dose of haloperidol (1mg/kg).

Notice low levels of c-fos and b-globin DNA, and high levels of GluR2

and GFAP DNA in chromatin immunoprecipitated with anti-H3pS10-

acK14 antibody. Notice increased levels of c-fos DNA in ChIP from

animals killed 120 min after haloperidol treatment. (b) Bar graphs

show, for chromatin of each of the 4 genes, levels of phospho-acet-

ylated H3, expressed as ChIP-to-input ratio (mean ± S.E.M.) in ha-

loperidol-treated animals. Data were normalized to saline-treated

littermates. Notice significant increase in c-fos DNA in ChIP at 120 min

after haloperidol treatment (p<0.05). (c) Line graph shows dynamic

changes in H3 phospho-acetylation at c-fos promoter (filled dots) and

c-fos transcript (open triangles) 15-480 min after a single dose of

haloperidol. Data are normalized to controls and expressed as mean ±

S.E.M. The drug-induced increase both in c-fos promoter H3 phospho-

acetylation and c-fos gene expression is transient. In addition, the

kinetics of H3 phospho-acetylation appear to be slower, in comparison

to the more rapid change in transcript levels. (d) Southern blots of anti-

H4acK8 ChIP from striata of mice killed 30 min after haloperidol or

saline treatment. Notice increased levels of c-fos DNA in ChIP from

drug-treated animals.

Chromatin remodeling in striatum 11

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

suggests that drug-induced H3 phospho-acetylation affectschromatin across a considerable portion of the genome.Furthermore, we demonstrated, in a series of experimentsconducted in vivo and in vitro, that H3 phospho-acetylationin striatal neurons in response to D2-like receptor blockaderequires the activation of cAMP-PKA and NMDA receptorpathways. The phospho-acetylation of H3 in striatal chro-matin after D2-like receptor blockade showed the kinetics ofthe early response and repeated treatment resulted indesensitization. Consistent with this observation, chroma-tin-immunoprecipitation assays on striatal extracts showed arapid but transient increase in H3 phospho-acetylation andH4 acetylation in chromatin around regulatory sequences ofthe immediate-early gene c-fos. Together, these resultssuggest that dopaminergic and glutamatergic transmissiondynamically regulate chromatin structure in striatal neurons.By blocking D2-like signaling, antipsychotic drugs induceH3 phospho-acetylation, H3pS10-acK14, a dual H3 modifi-cation that is associated with transcriptional activation andepigenetic regulation of gene expression (Turner 2002).

Chromatin modification — a molecular mechanism

mediating antipsychotic drug-induced growth and

plasticity in striatum?

Our experiments show that treatment in vivo with D2-likeantagonists and antipsychotic drugs induces, within the first15 min, an increase in phospho-acetylated H3, H3pS10-acK14, in nuclei of striatal neurons that is then sustainedin bulk chromatin for several hours. A rapid and transientincrease in H3pS10-acK14 was previously reported fordividing cells exposed in vitro to stimuli with a dramaticeffect on cell growth and differentiation, such as mito-genic growth factors and hormones (Cheung et al. 2000;Salvador et al. 2001; Thomson et al. 2001). By analogy,increased H3 phospho-acetylation in the nucleosomes ofstriatal neurons could reflect an early adaptation thatultimately leads to profound changes in neuronal function.Notably, D2-like antagonists and antipsychotic drugs, suchas haloperidol, have a remarkable growth-promoting effecton adult striatum, as shown by the increased size ofneuronal somata, dendrite calibers and axon terminals(Benes et al. 1985; Uranova et al. 1991), proliferativechanges in post-synaptic densities (Kerns et al. 1992;Meshul et al. 1992), increased spine densities (Meredithet al. 2000) and altered functional connectivity (Onn andGrace 1995). These adaptations are of sufficient magnitudeto result in gross morphological alterations of the basalganglia, as shown by the increase in striatal volume ofpatients and animals chronically treated with antipsychotics(Heckers et al. 1991; Jernigan et al. 1991; Chakos et al.1998; Gur et al. 1998). Importantly, our study providesevidence that striatal chromatin is remodeled after acutetreatment. However, it remains to be determined if long-term treatment with antipsychotics induces lasting adapta-

tions of striatal chromatin, including changes in H3phospho-acetylation at genes that are expressed atincreased levels after chronic treatment (Konradi andHeckers 2001).

Co-regulation of H3 phospho-acetylation and early

response genes

The kinetics of striatal H3 phospho-acetylation bears resem-blance to the surge of early response proteins after activationof D1 or blockade of D2-like receptors (Dragunow et al.1990; Graybiel et al. 1990; Robertson et al. 1992; Deutchet al. 1996; Gerfen et al. 1998; Missale et al. 1998).Considering that the dual histone modification, H3pS10-acK14, defines open chromatin and activation of geneexpression in yeast, mammals and Drosophila (Cheunget al. 2000; Clayton et al. 2000; Lo et al. 2000; Thomsonet al. 2001), its coordinated regulation in concert withimmediate-early transcription factors, including fos (Curranand Morgan 1995), makes biological sense; levels of c-fosprotein in striatum and global levels of H3pS10-acK14 instriatal chromatin are transiently increased after acutetreatment and may operate synergistically to enhance tran-scription of selected genes.

Furthermore, our results suggest that dynamic changes inH3pS10-acK14 at the c-fos promoter are involved in theregulation of c-fos transcription. According to our results, theincrease in H3pS10-acK14 in chromatin around the c-fospromoter becomes detectable shortly after the rise in striatalc-fos transcripts after D2-like antagonist treatment. However,we cannot rule out the possibility that our chromatin-immunoprecipitation assays lack the sensitivity to detect asubtle increase in H3 phospho-acetylation at c-fos chromatinthat may have occurred in parallel with or even prior to theincrease in c-fos transcription. Alternatively, the early phaseof transcriptional activation at the c-fos promoter may beassociated with histone modifications other than H3 phos-pho-acetylation. Thus, while the present study providesevidence for drug-induced H3 phospho-acetylation and H4acetylation in chromatin at the c-fos promoter, the functionalsignificance of these histone modifications in relation to c-fostranscription remains to be clarified.

Our observation that the up-regulation of striatal H3phospho-acetylation after acute blockade of D2-like receptorsis detectable in immunoblots on bulk chromatin indicates thatchromatin is affected at multiple sites of the genome. Throughthese multiple chromatin imprints, D2-like receptor blockadecould modulate the expression of a large number of genes withonly a small pool of transcription factors. Furthermore, bycoupling D2-like receptor blockade to histone modificationsinvolved in the epigenetic regulation of gene expression,including H3pS10-acK14 (Turner 2002), striatal neuronscould stabilize striatal transcription, making it less dependenton rapidly fluctuating changes in neurotransmission andintracellular Ca2+ or cAMP levels (Liu and Graybiel 1996).

12 J. Li et al.

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

Cyclic AMP and NMDA receptor pathways: cellular

transducers linking dopaminergic signaling to chromatin-

remodeling and histone-modifying enzymes

Drugs blocking D2-like receptors regulate striatal geneexpression through the cAMP and NMDA receptor path-ways. cAMP-PKA is critical to activation of gene expressionby D2-like antagonists because PKA-deficient mice fail toup-regulate gene expression in response to D2-like blockade(Adams et al. 1997; Brandon et al. 1998). Therefore, onewould predict that cAMP-PKA is required for D2-likeantagonist-induced striatal H3 phospho-acetylation, whichis, indeed, in line with our observations. Furthermore, studiesin striatal cultures, which lack the in vivo circuitry, haveshown that an intraneuronal interaction between cAMPpathways and NMDA receptor-mediated signal transductionpathways is required to induce the phospho-activation of thetranscription factor, cAMP response element-binding protein,and early response gene expression after D2-like receptorblockade (Rajadhyaksha et al. 1999; Leveque et al. 2000).Therefore, one would predict that glutamatergic input andNMDA receptor pathways regulate H3 phospho-acetylationin striatum not only in vivo but also in dissociated striatalculture in vitro, as observed in this study. Thus, two cellularsignaling pathways induce chromatin changes in striatalneurons in response to blockade of D2-like receptors. Onepathway involves adenylyl cyclases and cAMP-PKA and theother involves glutamatergic input and NMDA receptor-regulated, Ca2+-dependent signal transduction. By usingthese two partially interdependent signaling pathways(Rajadhyaksha et al. 1999; Leveque et al. 2000) and addi-tional molecular messengers (Fienberg et al. 1998; Bibbet al. 1999; Hernandez-Lopez et al. 2000; Miyakawa et al.2003; Moghaddam 2004) in variable combinations andintensities, striatal neurons and their dopaminergic andglutamatergic afferents could adjust and fine-tune the activityof chromatin-remodeling complexes and histone-modifyingenzymes, which may greatly increase the response repertoireof the brain when it is exposed to D2-like antagonists andother antipsychotic drugs.

Acknowledgements

This work was supported by National Institutes of Health grants

K08 DA00479 (SA) and R01 DA007134 (CK), the Janssen

Research Foundation and the Rett Syndrome Research Foundation.

References

Adams M. R., Brandon E. P., Chartoff E. H., Idzerda R. L., Dorsa D. M.and McKnight G. S. (1997) Loss of haloperidol induced geneexpression and catalepsy in protein kinase A-deficient mice. Proc.Natl Acad. Sci. USA 94, 12157–12161.

Akbarian S., Rios M., Liu R. J. et al. (2002) Brain-derived neurotrophicfactor is essential for opiate-induced plasticity of noradrenergicneurons. J. Neurosci. 22, 4153–4162.

Atkins J. B., Chlan-Fourney J., Nye H. E., Hiroi N., Carlezon W. A. Jrand Nestler E. J. (1999) Region-specific induction of deltaFosB byrepeated administration of typical versus atypical antipsychoticdrugs. Synapse 33, 118–128.

Benes F. M., Paskevich P. A., Davidson J. and Domesick V. B. (1985)The effects of haloperidol on synaptic patterns in the rat striatum.Brain Res. 329, 265–273.

Bibb J. A., Snyder G. L., Nishi A. et al. (1999) Phosphorylation ofDARPP-32 by Cdk5 modulates dopamine signalling in neurons.Nature 402, 669–671.

Boegman R. J. and Vincent S. R. (1996) Involvement of adenosine andglutamate receptors in the induction of c-fos in the striatum byhaloperidol. Synapse 22, 70–77.

Brandon E. P., Logue S. F., Adams M. R., Qi M., Sullivan S. P.,Matsumoto A. M., Dorsa D. M., Wehner J. M., McKnight G. S.and Idzerda R. L. (1998) Defective motor behavior and neural geneexpression in RIIbeta-protein kinase A mutant mice. J. Neurosci.18, 3639–3649.

Brene S., Messer C. and Nestler E. J. (1998) Expression of messengerRNAs encoding ionotropic glutamate receptors in rat brain: regu-lation by haloperidol. Neuroscience 84, 813–823.

Chakos M. H., Shirakawa O., Lieberman J., Lee H., Bilder R. andTamminga C. A. (1998) Striatal enlargement in rats chronicallytreated with neuroleptic. Biol. Psychiat. 44, 675–684.

Chesselet M. F., Delfs J. M. and Mackenzie L. (1998) Dopamine controlof gene expression in basal ganglia nuclei: striatal and nonstriatalmechanisms. Adv. Pharmacol. 42, 674–677.

Cheung P., Tanner K. G., Cheung W. L., Sassone-Corsi P., Denu J. M.and Allis C. D. (2000) Synergistic coupling of histone H3 phos-phorylation and acetylation in response to epidermal growth factorstimulation. Mol. Cell. 5, 905–915.

Chong V. Z., Young L. T. and Mishra R. K. (2002) cDNA array revealsdifferential gene expression following chronic neuroleptic admin-istration: implications of synapsin II in haloperidol treatment.J. Neurochem. 82, 1533–1539.

Clayton A. L., Rose S., Barratt M. J. and Mahadevan L. C. (2000)Phosphorylation of histone H3 on c-fos- and c-jun associatednucleosomes upon gene activation. EMBO J. 19, 3714–3726.

Crosio C., Heitz E., Allis C. D., Borrelli E. and Sassone-Corsi P.(2003) Chromatin remodeling and neuronal response: multiplesignaling pathways induce specific histone H3 modifications andearly gene expression in hippocampal neurons. J. Cell Sci. 116,4905–4914.

Curran T. and Morgan J. I. (1995) Fos: an immediate-early transcriptionfactor in neurons. J. Neurobiol. 26, 403–412.

Delfs J. M., Anegawa N. J. and Chesselet M. F. (1995) Glutamatedecarboxylase messenger RNA in rat pallidum: comparison of theeffects of haloperidol, clozapine and combined haloperidol-scopolamine treatments. Neuroscience 66, 67–80.

Deutch A. Y., Lewis D. A., Whitehead R. E., Elsworth J. D., Iadarola M.J., Redmond D. E. Jr and Roth R. H. (1996) Effects of D2 dop-amine receptor antagonists on Fos protein expression in the striatalcomplex and entorhinal cortex of the nonhuman primate. Synapse23, 182–191.

Doucet J. P., Nakabeppu Y., Bedard P. J. et al. (1996) Chronic alterationsin dopaminergic neurotransmission produce a persistent elevationof deltaFosB-like protein(s) in both the rodent and primate stria-tum. Eur. J. Neurosci. 8, 365–381.

DragunowM., RobertsonG. S., Faull R. L., RobertsonH.A. and JansenK.(1990) D2 dopamine receptor antagonists induce fos and relatedproteins in rat striatal neurons. Neuroscience 37, 287–294.

Eastwood S. L., Heffernan J. and Harrison P. J. (1997) Chronic halop-eridol treatment differentially affects the expression of synaptic andneuronal plasticity-associated genes. Mol. Psychiat. 2, 322–329.

Chromatin remodeling in striatum 13

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

Felsenfeld G. and Groudine M. (2003) Controlling the double helix.Nature 421, 448–453.

Fienberg A. A., Hiroi N., Mermelstein P. G. et al. (1998) DARPP-32:regulator of the efficacy of dopaminergic neurotransmission. Sci-ence 281, 838–842.

Fitzgerald L. W., Deutch A. Y., Gasic G., Heinemann S. F. and NestlerE. J. (1995) Regulation of cortical and subcortical glutamatereceptor subunit expression by antipsychotic drugs. J. Neurosci.15, 2453–2461.

Forsberg E. C., Downs K. M., Christensen H. M., Im H., Nuzzi P. A. andBresnick E. H. (2000) Developmentally dynamic histone acetyla-tion pattern of a tissue-specific chromatin domain. Proc. Natl Acad.Sci. USA 97, 14494–14499.

Fox C. A., Mansour A. and Watson S. J. Jr (1994) The effects of ha-loperidol on dopamine receptor gene expression. Exp. Neurol. 130,288–303.

Gerfen C. R., Keefe K. A. and Steiner H. (1998) Dopamine-mediatedgene regulation in striatum. Adv. Pharmacol. 42, 670–673.

Graybiel A. M., Moratalla R. and Robertson H. A. (1990) Amphetamineand cocaine induce drug-specific activation of the c-fos gene instriosome-matrix compartments and limbic subdivisions of thestriatum. Proc. Natl Acad. Sci. USA 87, 6912–6916.

Gunther E. C., Stone D. J., Gerwien R. W., Bento P. and Heyes M. P.(2003) Prediction of clinical drug efficacy by classification of drug-induced genomic expression profiles in vitro. Proc. Natl Acad. Sci.USA 100, 9608–9613.

Gur R. E., Maany V., Mozley P. D., Swanson C., Bilker W. and GurR. C. (1998) Subcortical MRI volumes in neuroleptic-naı̈ve andtreated patients with schizophrenia. Am. J. Psychiat. 155, 1711–1717.

Healy D. J. and Meador-Woodruff J. H. (1997) Clozapine and haloper-idol differentially affect AMPA and kainate receptor subunitmRNA levels in rat cortex and striatum. Mol. Brain Res. 47, 331–338.

Heckers S., Heinsen H., Heinsen Y. and Beckmann J. (1991) Cortex,white matter and basal ganglia in schizophrenia: a volumetricpostmortem study. Biol. Psychiat. 29, 556–566.

Hernandez-Lopez S., Tkatch T., Perez-Garci E., Galarraga E., Bargas J.,Hamm H. and Surmeier D. J. (2000) D2 dopamine receptors instriatal medium spiny neurons reduce L-type Ca2+ currents andexcitability via a novel PLC[beta]1-IP3-calcineurin-signaling cas-cade. J. Neurosci. 20, 8987–8995.

Hussain N., Flumerfelt B. A. and Rajakumar N. (2001) Glutamatergicregulation of haloperidol-induced c-fos expression in the rat stri-atum and nucleus accumbens. Neuroscience 102, 391–399.

Jenuwein T. and Allis C. D. (2001) Translating the histone code. Science293, 1074–1080.

Jernigan T. L., Zisook S., Heaton R. K., Moranville J. T., Hesselink J. R.and Braff D. L. (1991) Magnetic resonance imaging abnormalitiesin lenticular nuclei and cerebral cortex in schizophrenia. Arch. Gen.Psychiat. 48, 881–890.

Kerns J. M., Sierens D. K., Kao L. C., Klawans H. L. and Carvey P. M.(1992) Synaptic plasticity in the rat striatum following chronichaloperidol treatment. Clin. Neuropharmacol. 15, 488–500.

Konradi C. and Heckers S. (2001) Antipsychotic drugs and neuroplas-ticity: insights into the treatment and neurobiology of schizophre-nia. Biol. Psychiat. 50, 729–742.

Konradi C., Leveque J. C. and Hyman S. E. (1996) Amphetamine anddopamine-induced immediate early gene expression in striatalneurons depends upon postsynaptic NMDA receptors and calcium.J. Neurosci. 16, 4231–4239.

Kuo M. H. and Allis C. D. (1999) In vivo cross-linking and immuno-precipitation for studying dynamic Protein:DNA associations in achromatin environment. Methods 19, 425–433.

Laprade N. and Soghomonian J. J. (1995) Differential regulation ofmRNA levels encoding for the two isoforms of glutamate de-carboxylase (GAD65 and GAD67) by dopamine receptors in therat striatum. Mol. Brain Res. 34, 65–74.

Lau Y. S., Petroske E., Meredith G. E. and Wang J. Q. (2003) Elevatedneuronal nitric oxide synthase expression in chronic haloperidol-treated rats. Neuropharmacology Dec. 45(7), 986–994.

Leveque J.-C., Macı́as W., Rajadhyaksha A. et al. (2000) Intracellularmodulation of NMDA receptor function by antipsychotic drugs.J. Neurosci. 20, 4011–4020.

Li J., Chen P., Sinogeeva N., Gorospe M., Wersto R. P., Chrest F. J.,Barnes J. and Liu Y. (2002) Arsenic trioxide promotes histone H3phosphoacetylation at the chromatin of CASPASE-10 in acutepromyelocytic leukemia cells. J. Biol. Chem. 277, 49504–49510.

Lipska B. K., Lerman D. N., Khaing Z. Z., Weickert C. S. and Wein-berger D. R. (2003) Gene expression in dopamine and GABAsystems in an animal model of schizophrenia: effects of antipsy-chotic drugs. Eur. J. Neurosci. 18, 391–402.

Liu F. C. and Graybiel A. M. (1996) Spatiotemporal dynamics of CREBphosphorylation: transient versus sustained phosphorylation in thedeveloping striatum. Neuron 17, 1133–1144.

Lo W. S., Trievel R. C., Rojas J. R., Duggan L., Hsu J. Y., Allis C. D.,Marmorstein R. and Berger S. L. (2000) Phosphorylation of serine10 in histone H3 is functionally linked in vitro and in vivo to Gcn5-mediated acetylation at lysine 14. Mol. Cell 5, 917–926.

McCullumsmith R. E., Stincic T. L., Agrawal S. M. and Meador-Woodruff J. H. (2003) Differential effects of antipsychotics onhaloperidol-induced vacuous chewing movements and subcorticalgene expression in the rat. Eur. J. Pharmacol. 477, 101–112.

Merchant K. M. and Dorsa D. M. (1993) Differential induction ofneurotensin and c-fos gene expression by typical and atypicalantipsychotics. Proc. Natl Acad. Sci. USA 90, 3447–3451.

Meredith G. E., De Souza I. E., Hyde T. M., Tipper G., Wong M. L.and Egan M. F. (2000) Persistent alterations in dendrites, spines,and dynorphinergic synapses in the nucleus accumbens shell ofrats with neuroleptic-induced dyskinesias. J. Neurosci. 20, 7798–7806.

Meshul C. K., Janowsky A., Casey R. K., Stallbaumer R. K. and Taylor B.(1992) Effect of haloperidol and clozapine on the density of ‘per-forated’ synapses in caudate, nucleus accumbens and medial pre-frontal cortex. Psychopharmacology 106, 45–52.

Mijnster M. J., Schotte A., Docter G. J. and Voorn P. (1998) Effects ofrisperidone and haloperidol on tachykinin and opioid precursorpeptide mRNA levels in the caudate-putamen and nucleusaccumbens of the rat. Synapse 28, 302–312.

Missale C., Nash S. R., Robinson S. W., Jaber M. and Caron M. G.(1998) Dopamine receptors: from structure to function. Physiol.Rev. 78, 189–225.

Miyakawa T., Leiter L. M., Gerber D. J., Gainetdinov R. R., SotnikovaT. D., Zeng H., Caron M. G. and Tonegawa S. (2003) Conditionalcalcineurin knockout mice exhibit multiple abnormal behaviorsrelated to schizophrenia.Proc. Natl Acad. Sci. USA 100, 8987–8992.

Moghaddam B. (2003) Bringing order to the glutamate chaos in schi-zophrenia. Neuron 40, 881–884.

Moratalla R., Xu M., Tonegawa S. and Graybiel A. M. (1996) Cellularresponses to psychomotor stimulant and neuroleptic drugs areabnormal in mice lacking the D1 dopamine receptor. Proc. NatlAcad. Sci. USA 93, 14 928–14933.

Muller R. J., Buck C. R. and Smith A. M. (1992) NeuN, a neuronalspecific nuclear protein in vertebrates. Development 116, 201–211.

Nakahara T., Gotoh L., Motomura K., Kawanami N., Ohta E., Hirano M.and Uchimura H. (2001) Acute and chronic haloperidol treatmentsincrease parkin mRNA levels in the rat brain. Neurosci. Lett. 306,93–96.

14 J. Li et al.

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x

NguyenT.V., KosofskyB. E., BirnbaumR., CohenB.M. andHymanS. E.(1992)Differential expression of c-fos and zif268 in rat striatum afterhaloperidol, clozapine, and amphetamine. Proc. Natl Acad. Sci. USA89, 4270–4274.

Onn S. P. and Grace A. A. (1995) Repeated treatment with haloperidoland clozapine exerts differential effects on dye coupling betweenneurons in subregions of striatum and nucleus accumbens.J. Neurosci. 15, 7024–7036.

Prigent C. and Dimitrov S. (2003) Phosphorylation of serine 10 in his-tone H3, what for? J. Cell Sci. 116, 3677–3685.

Rajadhyaksha A., Leveque J., Macias W., Barczak A. and Konradi C.(1998) Molecular components of striatal plasticity: the variousroutes of cyclic AMP pathways. Dev. Neurosci. 20, 204–215.

Rajadhyaksha A., Barczak A., Macias W., Leveque J. C., Lewis S. E.and Konradi C. (1999) L-Type Ca(2+) channels are essential forglutamate-mediated CREB phosphorylation and c-fos geneexpression in striatal neurons. J. Neurosci. 19, 6348–6359.

Robertson G. S., Vincent S. R. and Fibiger H. C. (1992) D1 and D2dopamine receptors differentially regulate c-fos expression instriatonigral and striatopallidal neurons. Neuroscience 49, 285–296.

Robertson H. A., Paul M. L., Moratalla R. and Graybiel A. M. (1991)Expression of the immediate early gene c-fos in basal ganglia:induction by dopaminergic drugs. Can. J. Neurol. Sci. 18, 380–383.

Salvador L. M., Park Y., Cottom J. et al. (2001) Follicle-stimulatinghormone stimulates protein kinase A-mediated histone H3 phos-

phorylation and acetylation leading to select gene activation inovarian granulosa cells. J. Biol. Chem. 276, 40146–40155.

Schoots O., Seeman P., Guan H. C., Paterson A. D. and Van Tol H. H.(1995) Long-term haloperidol elevates dopamine D4 receptors by2-fold in rats. Eur. J. Pharmacol. 289, 67–72.

Sibley D. R. (1995) Molecular biology of dopamine receptors, inMolecular and Cellular Mechanisms of Neostriatal Function(Ariano M. A. and Surmeier D. J., eds), pp. 255–272. Landes,Austin, TX.

de Souza I. E. and Meredith G. E. (1999) NMDA receptor blockadeattenuates the haloperidol induction of Fos protein in the dorsal butnot the ventral striatum. Synapse 32, 243–253.

Thomson S., Clayton A. L. and Mahadevan L. C. (2001) Independentdynamic regulation of histone phosphorylation and acetylationduring immediate-early gene induction. Mol. Cell 8, 1231–1241.

Tolhuis B., Palstra R. J., Splinter E., Grosveld F. and de Laat W. (2002)Looping and interaction between hypersensitive sites in the activebeta-globin locus. Mol. Cell 10, 1453–1465.

Turner B. M. (2002) Cellular memory and the histone code. Cell 111,285–291.

Uranova N. A., Orlovskaya D. D., Apel K., Klintsova A. J., Haselhorst U.and SchenkH. (1991)Morphometric study of synaptic patterns in therat caudate nucleus and hippocampus under haloperidol treatment.Synapse 7, 253–259.

Wan M., Zhao K. and Francke U. (2001) MECP2 truncating mutationscause histone H4 hyperacetylation in Rett syndrome. Hum. Mol.Genet. 10, 1085–1092.

Chromatin remodeling in striatum 15

� 2004 International Society for Neurochemistry, J. Neurochem. (2004) 10.1111/j.1471-4159.2004.02569.x