Dlx-2 homeobox gene controls neuronal differentiation in primary cultures of developing basal...

Journal of Molecular Neuroscience Copyright © 1997 Humana Press Inc. All rights of any nature whatsoever reserved. ISSN0895-8696/97/8:93-113/$13.25

Dlx-2 Homeobox Gene Controls Neuronal Differentiation in Primary Cultures of Developing Basal Ganglia

Min Dingz I Laurence Robel, 1,~ Alaina J. James, 1,~÷ David D. Eisenstat, 2 James F. Leckman, 1 John L. R. Rubenstein, 2 and Flora M. Vaccarino .1

1Child Study Center, Yale University, 230 South Frontage Road, New Haven, CT 06520; and 2Nina Ireland Laboratory of Developmental Biology, Center for Neurobiology and Psychiatry,

Department of Psychiatry, University of California, San Francisco, CA 94143-0984

Received October 25, 1996; Accepted December 17, 1996

Abstract

Homeodomain-containing genes of the Dlx family are expressed in the developing basal ganglia. To investigate the role of Dlx genes during development, we studied their cellular localization in primary cultures of embryonic basal telencephalon, and examined the changes in cellular phenotypes resulting from blockade of Dlx-2 expression. Cells containing Dlx-1, Dlx-2, and Dlx-5 mRNAs are immature cells of the neuronal lineage expressing the microtubule-associated proteins (MAPs) MAPIB and MAP2, but not glial fibrillary acidic protein (GFAP). Treatment of these cells with antisense oligonucleotides targeted to Dlx-2 caused a specific decrease of Dlx-2 mRNA and protein. This decrease in the Dlx-2 gene product was associated with a decrease in the expression of MAP2, a protein localized in neuronal dendrites, along with a smaller decrease in the 200-kDa neurofilament subunit (NF-H). Proteins expressed preferentially in axons were unchanged. This reduction in MAP2 expression was associated with a decrease in dendrite outgrowth and an increased level of celt proliferation. None of these changes were elicited by antisense oligonucleotides targeted to Dlx-1. We suggest that the Dlx-2 gene product regulates two interrelated aspects of neuronal differentiation: the exit from the mitotic cycle and the capability to grow MAP2-positive dendrites. As such, this gene product may be important for the establishment of neuronal polarity, setting the stage for affer- ent synaptic connectivity.

Index Entries: Dlx-2; homeobox; microtubule associated proteins; differentiation; neurite outgrowth; cell culture.

*Author to whom all correspondence and reprint requests should be addressed. tPresent address: Department of Pedopsychiatry, Robert Debre Hospital, Paris, France. t~Present address: Department of Cell Biology, Rm M510, 1 Baylor Plaza, Baylor College of Medicine, Houston, TX 77030.

Journal of Molecular Neuroscience 93 Volume 8, 1997

94 Ding et al.

Introduction Homeobox genes are DNA-binding transcrip-

tional regulators that play an important role in morphogenesis. This class of selector genes is acti- vated at discrete stages of development in specific regions of the embryo and presumably controls regional and cellular identities by regulating the expression of cascades of target genes. Down- stream genes are likely to include genes that regulate cell differentiation, cytoarchitecture, adhesion, migration, and survival. The identification of downstream genes is fundamental to understand how homeobox genes regulate cellular identity. Since few of the downstream target genes have been identified, the mechanism whereby homeobox genes control morphogenesis remains obscure. Most of the target genes so far identified are other homeobox genes, which suggests complex arrays of interregulatory interactions. Others include growth factors and extracellular proteins (Immer- gluck et al., 1990; Reuter et al., 1990), including cell adhesion molecules (CAMs) (Edelman and Jones, 1993), suggesting that homeoproteins may regulate cell-to-cell communication.

Distal-less (DII) is a homeobox gene expressed by restricted portions of Drosophila's imaginal disks and is required for the organization of the proximodistal axis of legs, antennae, and other appendages (Cohen et al., 1989; Cohen, 1990). Six vertebrate homologs of DII are known, including Dlx-1 (Price et al., 1991), Dlx-2 (Porteus et al., 1991; Robinson et al., 1991; Selski et al., 1993), Dlx-3 and Dlx-4 (Ekker et al., 1992; Papalopulu and Kintner, 1993; Akimenko et al., 1994; Robinson and Mahon, 1994), Dlx-5 and Dlx-6 (Simeone et al., 1994; Zhao et al., 1994). Within the central nervous system (CNS), these genes are expressed in the basal telencephalon and part of the ventral diencephalon, with a similar time-course and regional distribution (Bulfone et al., 1993). Although some aspects of their function may be partially or totally redun- dant (Qiu et al., 1995), it is possible that each Dlx family member has a distinct role in the development of these regions of the CNS.

Genes of the Dlx family are expressed in the basal ganglia anlage during neurogenesis (E12.5 to the end of gestation), which suggests that these genes may have a role in the neuronal development of this region. The Dlx-2 gene product is

localized in the ventricular and subventricular zones and in a transition area between proliferative and nonproliferative cells, where its expression is progressively downregulated as neurons migrate into the basal ganglia (Porteus et al., 1994). Based on this localization pattern, it has been suggested that the DLX-2 protein may have a role in neuronal differentiation (Porteus et al., 1994). However, the proportion of Dlx-2-positive cells that are proliferative or postmitot ic over the course of this developmental period has not yet been determined and the mechanism whereby cell differentiation may be controlled by Dlx-2 is not known.

To gain insight into the role of Dlx genes in the development of the basal ganglia, we used a primary culture system (Vaccarino et al., 1995) that reproduces and maintains the regional pattern of expression of different homeobox genes, including Dlx genes, in the dorsal or basal telencephalon. We focused on the study of Dlx-2, since the availability of a specific antibody (Porteus et al., 1994) makes it possible to investigate Dlx-2 expression both at the mRNA and at the protein level. We show that, in primary cultures of cells prepared from E13.5 basal te lencephalon, Dlx-2 mRNA is primarily expressed by immature neuronal cells of the basal telencephalon, but not by glia. To investigate whether the Dlx-2 gene product is involved in neuronal differentiation, we blocked the expression of Dlx-2 by means of antisense ol igonucleotides. We then assayed the effects of Dlx-2 inhibition on neurite outgrowth, as well as on the expression of several markers of neuronal differentiation and maturation. Our results suggest that Dlx-2 may be involved in specific aspects of neuronal differentiation at this stage of development.

Materials and Methods Reagents

Reagents were obtained from Sigma (St. Louis, MO), unless otherwise indicated.

Animals Rat embryos were ob ta ined f rom t imed-

pregnant rats (Charles River, Raleigh, NC). The morning after a vaginal plug was detected was considered as embryonic d 0.5 (E0.5).

Journal of Molecular Neuroscience Volume 8, 1997

DIx-2 Controls Neuronal Differentiation in Primary Culture 95

Primary Cultures Primary dissociated cultures were prepared, as

previously described, from the neuroepithelium of the dorsal or the basal telencephalon of embryonic d 13.5 (E13.5) rats (Vaccarino et al., 1995). Cells were plated on polyornithine (15 ~tg/mL)- and laminin (2 pg/cm2)-pretreated wells, at a density of 1.2-1.6 x 105 cells/cm 2. After an overnight incubation in medium supplemented with 10% fetal bovine serum (FBS), cells were maintained in serum free medium (SFM), containing 50% DMEM/50% F-12, 50 IU/mL of penicillin, 50 ~tg/mL streptomycin, 2 mM glutamine (all from Gibco- BRL, Gaithersburg, MD), 0.110 mg/mL sodium pyruvate, 25 mM HEPES, 100 ~g/mL transferrin, 5 ~tg/mL insulin, 20 nM progesterone, 30 nM sodium selenite, and 60 pM putrescine. In experiments involving antisense-oligonucleotides (AS- ODNs), the medium was further enriched with 10 ng/mL human recombinant FGF2 (bFGF) (R&D Systems, Minneapolis, MN).

6% denaturing polyacrylamide gel. RNase protection assays were carried out, as described (Robel et al., 1995), using 20 pg of total RNA and 100,000 cpm of each probe in a 10 ~tL hybridization volume. Protected hybrids were analyzed by 6% polyacrylamide-urea gels and visualized on autoradiograms after an overnight exposure. Quantifi- cation of all bands was carried out, as described, by scanning the autoradiograms with a densi- tometer (Visage 2000, Bioimage, Ann Arbor, MI) (Robel et al., 1995).

5-Bromo-2'-Deoxyuridine (BrdU) Labeling Cell monolayers were treated for 24 h at 37°C

with a solution containing BrdU and fluorode- oxyuridine (Cell Labeling reagent, Amersham, 1:5000) and fixed with 4% paraformaldehyde at the end of BrdU incorporation. Cultures were then processed for BrdU immunocytochemistry (see next section), using an anti-BrdU monoclonal antibody (MAb) (Amersham).

Antibodies MAP2 (clone AP20, specific for the high-mol-wt

forms of MAP2, 1:5000), tubulin (1:100), and tau-1 (1:2000) were from Boehringer Mannheim (Indi- anapolis, IN); MAPIB (clone AA6, 1:400), Neuro- filament 200 K, nonphosphorylated form (1:200), and GFAP (1:800) were from Sigma; GABA (1:2000) was from Eugene Tech (Ridgefield Park, NJ); anti- sera against synapsin I (1:100) and synaptophysin (1:100) were a gift of Pietro De Camilli, Yale Uni- versity; DLX-2 was used at 1:50 (Porteus et al., 1994).

Ribonuclease (RNase) Protection Assay The partial cDNAs of rat Dlx-1, Dlx-2, Dlx-5,

Otxl, Otx2, and Emxl, used in RNase protection assay and in situ hybridization, have already been described (Robel et al., 1995). High specific activity (2-5 x 10 s cpm/~g of RNA) antisense RNA probes were obtained from linearized cDNA templates by SP6- or T7-primed transcription, using limiting concentration (8 pM) of [32plUTP (Amersham, Arlington Heights, IL). The glyceral- dehyde-phosphate-dehydrogenase (GAPDH) rat cDNA (pTRI-GAPDH, Ambion, Austin, TX) was transcribed at a low specific activity (1-3 x 107 cpm/~tg of RNA). The probes were purified on a

In Situ Hybridization Coupled with Immunocytochemistry In situ hybridization was carried out as descri-

bed (Robel et al., 1995), using digoxigenin-labeled RNA probes. Probes (10 ng/~tL) were hybridized overnight at 45°C to cell monolayers and washed to a final stringency of 0.1X SSC at room temperature for 10 min. Samples were then processed for immunocytochemistry (Robel et al., 1995) using a biotinylated secondary antibody (1:200, Vector) and Avidin-FITC (2.5 mg/mL, Vector). After immunocytochemistry, slides were incubated overnight at 4°C with an alkaline phosphatase-coupled antidigoxigenin antibody (1:500, Boehringer Mannheim). Probes were detected by incubation with the substrates 4-nitrobluetetrazolium chlo- ride and 5-bromo-4-chloro-3 indolyl phosphate (Boehringer) for 6-24 h.

Data Analysis for Immunocytochemistry and In Situ Hybridization Experiments Cells considered positive by in situ hybridiza-

tion showed an intense, homogenous purple staining of the cytosol under bright field. Immu- noreactive cells showed intense fluorescence in the cytoplasm and processes, or, in the case of DLX-2


96 Ding et al.

and BrdU, in the nucleus. Unstained cells were coun ted u n d e r Nomarsk i optics. Ten r a n d o m fields per culture were counted using a calibrated microscope reticle at a magnificat ion of x40 or xl00. Averages from three to six cultures were subjected to statistical analysis. Analysis of the reliability of bl inded cell counts between investi- gators yielded <10% variation.

Oligonucleotides Oligonucleotides (ODNs) were synthesized by

s tandard phosphoramida t e chemistry us ing an ABI 380B DNA synthesizer at the Nucleic Acid Chemis t ry Facility at Yale University. They all contained phosphorothioate substitutions within the phosphod ies t e r internucleoside linkages, a modi f ica t ion that has been shown to increase ODN half-life in cell cultures and biological fluids (Bielinska et al., 1990; Chiang et al., 1991; Bennett et al., 1992). Two AS-ODNs complementary to the ATG codon of the mouse Dlx-2 mRNA (AS-Dlx2-1 and AS-Dlx2-2), and one AS-ODN complementary to the same region of the mouse Dlx-1 mRNA (AS-Dlx-1), have been used in our studies. Control ODNs include random sequence ODNs (rn), com- posed entirely of a r andom sequence of bases in the same proportion, and an ODN containing the same bases as AS-Dlx2-2, but in scrambled order (shuffled or sh). The sequence of all oligos except for rn is as follows (the codon corresponding to the translation initiation site is underlined).

AS-Dh2-1: 5' CTCCAGTCATCCTGACCCGGGAC3 '

AS-DIx2-2: 5' ACTGTCAAAGACTCCAG~2ATCC3 '

Shuffled (sh): 5' GACTCTAACGCTTCAGAACACTC3 '

AS-Dlxl: 5' TCATGGTCATCTCTTCTCGCGGG3 '

ODNs were resuspended in water, precipitated twice with 2.5M a m m o n i u m acetate and 8 vol of ethanol, and resuspended in sterile water at a concentration of 10 m g / m L .

Antisense Oligonucleotide Treatment Cell monolayers (700,000 cells in I mL of tissue

culture medium) were treated with 10 ng FGF2 before each ODN addition. ODNs (9 ~tg, final concentration, 1.2 ~M of DNA) were mixed wi th 8 ~g of cationic l iposomes (DOTAP, Boehr inger Mannheim) in 20 I~L sterile HEPES-buffered saline, incubated for 10 rain at room temperature, and added to each well. Treatments were at 1, 3, and 5 d in vitro, wi thout m e d i u m change. On d 7 in vitro, cells were fixed directly on the dish and subjected to in situ hybr id iza t ion and immunocy - tochemist ry . In other exper iments , cells were collected after treatment (2 min, 37°C) with 0.1% t ryps in and 0.05% EDTA and r e s u s p e n d e d in phosphate-buffered saline (PBS) containing 0.2% soybean trypsin inhibitor (Vaccarino et al., 1995). Al iquots of each cell s u s p e n s i o n were e i ther extracted to recover total RNA (to be used in RNase protection assays), or extracted for proteins (to be used in Western blots, see next section) or fixed to perform immunocytochemistry (see next section).

Gel electrophoresis of cell-associated DNA was used to assess the stability of ODNs by determin- ing the size and amounts of ODNs incorporated by cells over time. At different t ime-points after ODN addition to the cultures, the m e d i u m was collected and the cell monolayers were washed with 0.2M glycine (pH 3.0), to remove surface- bound ODNs (Loke et al., 1989). The DNA was extracted from the cells or the m e d i u m with phe- nol-chloroform, precipi ta ted wi th ethanol, and analyzed on a 15% denaturing polyacrylamide gel. This experiment demonstrated that the cells contained a band identical in size to the synthetic ODN, even after 6 d of incubation (the longest t ime tested), whereas no band was visible in the med ium (Fig. 1A). Thus, the bulk of ODNs was associated with the cells, where it was quite stable over the time-course of treatment.

Fig. 1. (opposite page) Uptake, stability, and antisense activity of oligodeoxynucleotides (ODNs) in primary cultures of cells from the embryonic basal telencephalon. (A) Gel electrophoresis of DNA extracts from ODN- treated cultures. Treatment was at d 0, with random ODNs (rn) coupled with liposomes (DOTAP), as described in Methods. At different times afterward the DNA was extracted from the cells or from 20% of the medium of each culture and run on a 15% denaturing polyacrylamide gel stained with ethidium bromide. Lane 1, medium, and lane 2, cell extracts, prepared at d 1 ; lane 3, medium, and lane 4, cell extracts, ofd 2; lane 5, medium, and lane 6, cell extracts, of d 6. Lane 7 is the synthetic ODN used for treatment. The arrowhead indicates the position of the ODN; the bands near the top of the gel are from genomic DNA. (B) Visualization of ODNs inside cells. Cultures were treated with 1.2 p.M rn tagged with biotin (rn-biotin), together with 10 ~M DOTAP for 19 h, and processed with

Iournal of Molecular Neuroscience Volume 8, 1997

Dlx-2 Controls Neuronal Differentiation in Primary Culture 97

1 2 3 4 5 6 7

I

A B

!~i!!?iiiii

C D

Z D o ~

¢g

I ¢ B

,~o

u)

t,,,t

5 0 -

4 0 .

3 0 '

2 0 ¸

1o

o . o 0:1 o:2 I

0 .3

I,)

I X

E,, 6 N ~

a

ISO"

100

5 0 -

0 L0

A S - D I x 2 - 1 • A S - D I x Z - Z

I I I

O.Z 0 . 4 0 . 6

ODNs/DOTAP ODNs/DOTAP

avidin-horseradish peroxidase (HRP). Cells incorporating the ODNs contain HRP reaction product in their cytoplasm (arrows). (C) Quantification of cellular uptake of ODNs. Cultures were treated as in (B), with different concentrations of m-biotin coupled to a fixed concentration of DOTAP (10 I~M), trypsinized to achieve a single cell suspension, and stained with avidin-HRP within agarose slices (see Methods). Stained and unstained cells were counted with a calibrated microscope reticle. (D) Antisense activity of ODNs. Cultures were treated with different concentrations of rn or AS-DIx20DNs, coupled to a fixed concentration of DOTAP (10 #M); DIx-2 mRNA was measured by RNase protection assay. Densitometric values for the DIx-2 band were first normalized by the corresponding values for GAPDH, a ubiquitously expressed gene, and then data for AS-treated cultures were expressed as a percent of control (m-treated) cultures.


98 Ding et al.

To de te rmine the opt imal DNA:lipid ratio, ODNs were visualized inside cells as follows. A biotinylated random sequence ODN (rn-biotin) was synthesized using the biotin-CPG 3'-labeling- polymer-support (Peninsula, Belmont, CA) and standard cyanoethylphosphoroamidate chemistry. Cell monolayers were treated with rn-biotin at concentrations ranging between 0.002 and 2.5 ~Vl, coupled to 8 ~g/mL (10 p2~d) DOTAP. After a 16- 24 h incubation, monolayers were washed with glycine buffer at p H 3.0 to remove surface- at tached ODNs, fixed wi th 4% paraformaldehyde/0.2% glutaraldehyde, and reacted with the avidin-biotin HRP complex (Vectastain Elite, Vec- tor). ODNs were visible inside cells as cytoplas- mic inclusions filled with HRP reaction product (Fig. 1B) and the cells positive and negative for ODNs were counted.

Immunocytochemistry in Cell Suspensions Embedded in Agarose

Cell monolayers were dissociated into single cell suspensions by trypsin/EDTA (Vaccarino et al., 1995) and fixed with 4% paraformaldehyde, with or without 0.2% glutaraldehyde. Cells were centrifuged and resuspended in 1.8% low-melt- ing-point agarose at 60°C, at a cell density of 1 x 106 cells/mL. The agarose suspension was formed into 0.15 mm-thick-slices, which were processed free-floating for immunocytochemistry (Vaccarino et al., 1995).

For quantification, stained and unstained cells were blindly counted in random fields of agarose slices, using a calibrated microscope reticle, at a magnification of x40. Raw counts from 10 random fields were averaged and the ratio of stained to unstained cells was calculated. Mean and standard error were der ived from three to six different experiments involving different cell preparations.

Measurement of Neurite Outgrowth

Cell monolayers were treated, as above, with ODNs. On d 7 in vitro, monolayers were detached from the dish with 0.1% EDTA and replated at the densi ty of 30,000/cm 2 in the presence of 20 n g / m L FGF2 and ODNs. Cells were fixed at 4, 10, and 24 h after plating and immunostained for MAP2 or tubulin. Photographs of 16-32 random

fields were taken for each culture at x40 magnification. All processes and their branches were traced with the aid of an ARTZII tablet with a four-button puck (Wacom, Vancouver, WA). The analysis was performed using the public domain NIH Image pro- gram on a Power Macintosh 2500 computer.

Assessment of Cell Viability

Cell viability was est imated, as previous ly described (Jones and Senft, 1985; Alho et al., 1988), by staining cell suspensions obtained after tryp- sinization of adherent cultures (see Antisense Oli- gonucleotide Treatment) with fluorescein diacetate (FDA) and propidium iodide (PI), simultaneously. With this technique, the viable cells emit bright green fluorescence and nonviable cells emit bright red. Cells were incubated with FDA/PI solution for 5 min at room temperature in the proportion of 2 ~g FDA/0.6 I~g PI/500,000 cells/0.3 mL of PBS. After incubation, cells were centrifuged and resuspended in PBS. A drop of the suspension was then placed between a glass slide and a coverslip and the per- centage of green (viable) and red (nonviable) cells was calculated from four different fields.

Western Blot Cell pellets were treated with 2% sodium dodecyl

sulfate (SDS), 10% glycerol, 0.0625M Tris-HC1, pH 6.8, at 100°C for 4 min. After centrifugation, aliquots of the supernatants containing equal amounts of proteins were added 2-mercaptoethanol to a final concentration of 2% and directly loaded on a standard 10% polyacrylamide gel. Gels were soaked in 0.125M Tris, pH 6.8, 0.1% SDS, 1 mM EDTA, 10 mM 2-mercaptoethanol for 20 min, and were electroblotted to nitrocellulose sheets (Amersham) in 0.0125M Tris, pH 8.5, 0.096M glycine, 0.01% SDS, 10 mM 2-mercaptoethanol. The transfer was performed for 20-24 h at 4°C at constant current of 1.0 A. Following transfer, blots were blocked in 50 mM Tris-buffered saline, pH 8.0, 0.1% Tween-20 (TBST), containing 5% dry powdered milk (TBSTM), and reacted with the primary antibody in TBSTM overnight at 4°C. After three washes in TBST, blots were treated with peroxidase-linked secondary antibodies (Amersham) in TBST, washed three times, and developed with the enhanced chemiluminescence (ECL) subs~ate (Amersham).



Results

The Regional Distribution of DIx Genes Is Maintained in Primary Culture

At the beginning of neurogenesis, members of the Dlx family are expressed in the basal, but not in the dorsal telencephalon (Porteus et al., 1991; Price et al., 1991; Simeone et al., 1994) whereas the expression of Emxl is restricted to the dorsal telencephalon (Simeone et al., 1992). The levels of expression of Dlx (Dlx-1, Dlx-2, Dlx-5, Dlx-6) and Emx (Emx-1) genes were compared in primary cultures of basal and dorsal telencephalon at 3-7 d in vitro, and in tissue from rat embryos of corresponding ages (E16.5-E20.5). As shown in Fig. 2A, the mRNA for the Dlx genes was highly enriched in cultures of basal telencephalon, since only trace amounts were detected in cultures of dorsal telencephalon. Identical patterns were observed between 3 and 12 d in vitro. Similar results were obtained by in situ hybridization using a Dlx-2 probe. Many of the cells in cultures of basal telencephalon were darkly stained, but cells in cultures of dorsal te lencephalon exhibited background staining, and few cells had a low level of staining (Fig. 2B). Thus, the pattern of expression of these homeobox genes is maintained for several days in vitro in these dissociated cultures.

Pattern of Expression of DIx Genes Among Different Cells

To investigate the cellular pattern of expression of different Dlx genes, in situ hybridization for Dlx-1, Dlx-2, and Dlx-5 was combined with immunocytochemistry to identify different cell types. The incorporation of BrdU, an S-phase marker, for 24 h was used to label the whole population of proliferative cells, as well as early postmitotic cells. Dlx-l-, Dlx-2-, and Dlx-5-expressing cells are small and process-bearing, which is typical of a neuronal morphology (Figs. 3-5). Quantif ication of the number of stained cells revealed that 86% of Dlx- 1-, 76% of Dlx-2-, but only 49% of Dlx-5-expressing cells were positive for MAPIB, a marker for immature neurons (Table 1; Figs. 3-5). Approxi- mately 40% of Dlx-1- and Dlx-2-positive cells, and 31% of Dlx-5-expressing cells, incorporated BrdU

(Table 1, Figs. 3-5). An antibody specific for the high molecular forms of MAP2, a protein expressed by mature, postmitotic neurons, labeled 30-34% of Dlx-l-, Dlx-2-, and Dlx-5-positive cells (Table 1, Figs. 3-5). Astrocytes, labeled by glial fibrillary acid protein (GFAP)(Figs. 3 and 5), were consis- tently and uniformly negative for Dlx mRNA. The cellular distribution of Dlx genes, encompassing both MAPIB- and MAP2-positive cells, and their developmental time-course in vivo, suggest the possibility that Dlx genes have a role in controlling neuronal differentiation within the basal ganglia.

AS-ODNs Specifically Decrease DIx2 Gene Expression

To determine whether the Dlx-2 gene is involved with cell differentiation, we treated the cultures with AS-ODNs targeted to Dlx-2 (AS-DIx2-1 and AS-Dlx2-2). Several control ODNs were used, including rn, a randomly sequenced ODN; sh, an ODN constructed by shuffling the sequence of AS-Dlx2-2; and AS-Dlxl, a ODN complementary to the start site of Dlxl. These ODNs were coupled to cationic liposomes to facilitate their entry into the cells. At the optimal D N A / l i p o s o m e molar ratio of 0.12 (1.2 ~M of DNA/10 ~ liposomes), the number of cells incorporating DNA approached 50% of the total cell number (Fig. 1C). This ratio of 0.12 also produced the largest decrease in Dlx-2 mRNA for both AS-Dlx2-1 and AS-Dlx2-2 (Fig. 1D), suggesting that cellular uptake of ODNs was correlated with their antisense activity. Either decreasing or increasing this DNA:liposome ratio resulted in a lower cellular uptake of ODNs and in a corresponding decrease in their antisense activity toward Dlx-2 mRNA (Fig. 1 C,D). Treatment with AS-Dlx2-1 or with AS-Dlx2-2, at the optimal DNA/l iposome ratio of 0.12, resulted in average Dlx-2 mRNA levels of, respectively, 19.2% (N = 4, SEM = 10.6) and 20.6% (N = 4, SEM = 7.2) respective r andom ODNs. These decreases in Dlx-2 mRNA were specific, since these ODNs did not decrease the levels of Dlx-5 mRNA (data not shown). By in situ hybridization, AS ODNs targeted to Dlx-2 decreased the number of cells positive for Dlx-2 mRNA and the amount of Dlx-2 mRNA per cell, compared to either the random ODN or to untreated controls (data not shown).


I00 Ding et al.

A cells tissue cells tissue

B D B D B D B D

! Emx 1 --~

DIx5 --~- Otx2 - -~

DIxZ - - ~

DIx6 - - ~ Dlx l --~

GAPDH'~ ~ ~ GAPDH'-'~" w, ~

- Q

B

I I

Fig. 2. Genes of the D/x family are expressed in primary cultures of basal, but not of dorsal, telencephalon. (A) RNase protection assay gel showing the distribution of mRNA levels for several homeobox genes in cultured cells at 5 d in vitro, and tissue from basal and dorsal telencephalon at E18.5 (B and D, respectively). Corresponding levels of GAPDH are shown as a control for total RNA loaded on the gel. (B) In situ hybridization for DIx-2 in cultures from dorsal (D) and basal (B) telencephalon at 4 d in vitro. Note the low level of hybridization in D compared to B. In (B) the arrowhead indicates a fibrous-type astrocyte that is negative for DIx-2 mRNA. Bar = 50 p.M.

To assess whether this decrease in Dlx-2 mRNA resul ted in a cor responding decrease of DLX-2 protein, we used a polyclonal antibody that has been previously shown to react with the Dlx-2 gene p roduc t in t issue sections (Porteus et al.,

1994). Treatment with AS-Dlx20DNs resulted in a smaller number of DLX-2-positive cells and a much decreased intensity of staining, compared to t reatment with either the control r andom ODN or AS-Dlxl (Table 2). Thus, mRNA and protein


D Ix-2 Controls Neuronal Differentiation in Primary Culture 101

Fig. 3. DIx-2 mRNA is expressed by neuronal cells. In situ hybridization for DIx-2 (B, D, F, H) coupled to immunocytochemistry for MAP1B (A), MAP2 (C), BrdU (F), or GFAP (G) in primary cultures of basal telencepha- Ion at 4-5 d in vitro. In (E,F), BrdU was added to the culture medium at 2 d in vitro and cells were fixed 24 h later. (A,B), (C,D), (E,F), and (G,H) are identical fields in which the antibody reaction was visualized under fluorescence and mRNA levels under bright field; arrows point to corresponding cells. The arrowheads in (B) and (D) point to flat-type cells that are negative for DIx-2 mRNA. Note that DIx-2-positive cells are small neurite-bearing cells, subsets of which express MAP1 B, MAP2, or BrdU, but no DIx-2-positive cell expresses GFAP. Bar = 50 I~M.

analysis showed that AS-ODNs targeting Dlx-2 mRNA were capable of causing a specific decrease in Dlx-2 gene expression in these primary cultures.

Effect of AS-DIx2 0DNs on Cell Phenotype

We first investigated whether the decrease in Dlx-2 expression correlated with changes in the expression of cell-specific markers. Cultures treated with AS-Dlx2-1 or AS-Dlx2-2 showed, respectively, a 44 or a 49% decrease in the number of cells positive for MAP2, compared to control rn ODNs (Fig. 6A). Western blots confirmed that the amount of MAP2 protein was decreased in cultures treated with AS-Dlx2-1 or AS-Dlx2-2 (Fig. 6B). This decrease was caused by a decrease in Dlx-2 gene expression and not to secondary effects, as demonstrated by the following observations. First, cultures treated with sh, a scrambled-sequence ODN, and cultures treated wi th AS-Dlxl, showed no decrease in

MAP2 immunoreactivity (Fig. 6A). Second, AS- Dlx20DNs did not affect MAP2 levels in cultures prepared from the hindbrain, a region that does not express the Dlx-2 gene, either by Western analysis (Fig. 6B) or by immunocytochemistry. MAP2-positive cells in AS-Dlx2-1 treated hindbrain cells were 102% of control (N = 3, SEM = 5.8).

The decrease in MAP2 immunoreactivity produced by AS-Dlx20DNs was also not caused by a decrease in the number of viable cells. The propor- tions of viable cells in cell suspensions prepared from cultures treated with the rn control, with AS- Dlxl, or with AS-Dlx2-1, were not very different from one another (55.6, 54, and 61.3% of the total number of cells, respectively).

In conclusion, the blockade of Dlx-2 expression specifically decreased the cellular content of MAP2, a protein contained in mature neurons. These results could reflect a change in cell phenotype from neurons to nonneurona l cells. However ,


102 Ding et al.

Fig. 4. The cellular distribution of DIx-I is similar to that of D/x-2. In situ hybridization for DIx-I (B,D), coupled to immunocytochemistry for either MAP1B (A) or BrdU (C) in primary cultures of basal telencephalon at 3-5 d in vitro. In (C-D), BrdU was added to the culture medium for 24 h. (A-B) and (C-D) are identical fields; arrows point to corresponding cells. The arrowhead in (D) points to a flat-type cell that is negative for DIx-I mRNA. Bar = 50 pM.

GFAP immunoreac t iv i ty did not change after AS-Dlx treatment, as determined by Western blot (Fig. 6B) or by counting GFAP-immunoreactive cells. The number of GFAP-positive cells after AS-Dlx2-1 treatment was 97.5% (+7.7) of control, and after AS-DIx2, 99.7% (+7.1) of control (average + SEM of 4-5 experiments).

To investigate whether the decrease in MAP2 expression was caused by a delay in neuronal differentiation, other markers of differentiated neurons were assayed in control and AS-Dlx2-treated cells. The results show that AS-Dlx20DNs caused

a 40% decrease in MAP2 and DLX-2, but other markers of neuronal differentiation, including GABA immunoreactivity, were unchanged (Table 2).

Effect of AS-DIx2 0DNs on Cell Proliferation

Since MAP2 is expressed by postmitotic neurons and is incompatible with mitosis (Lewis et al., 1989), the observation that AS-Dlx2-treated cultures contained a smaller number of MAP2-positive neurons suggested that proliferation might be



Fig. 5. The phenotype of D/x-5-positive cells is different from that of DIx-1 and DIx-2. In situ hybridization for DIx-5 (B, D, F, H), coupled to immunocytochemistry for MAP1B (A), BrdU (C), MAP2 (E), or GFAP (G) in primary cultures of basal telencephalon at 3-4 d in vitro. In C-D, BrdU was added to the culture medium for 24 h. (A,B), (C,D), (E,F), and (G,H) are identical fields; arrows point to corresponding cells. The arrowheads in (B) point to flat-type cells that are negative for DIx-5 mRNA. Note that, comparative to DIx-2 and DIx-1, fewer of the DIx-5- positive cells are positive for MAP1B. Bar = 50 pM.

increased. To estimate the number of proliferative cells, we quantified the incorporation of BrdU over 24 h in cultures previously treated with control and AS-Dlx20DNs . Our results show that AS- Dlx2 treatment resulted in a significantly increased (>50%) number of proliferative cells, compared to controls. BrdU-positive cells in AS-Dlx2-1-treated cells were 48.9% (+4.1), compared to 31.3% (+4.9) in the rn control (N = 6; p = 0.006, Student 's t-test). Similarly to the decrease in MAP2, this increase in BrdU incorporation appeared to be caused by a decrease in the Dlx-2 gene product in AS ODN- treated cells. In fact, no increase in BrdU incorporation was apparent in similarly treated cultures from the dorsal telencephalon, where the Dlx-2 gene is only minimally expressed.

Effect of AS-DIx2 0DN$ on Neurite Outgrowth

MAP2 is selectively expressed in neuronal dendrites, but not in axons (De Camilli et al., 1984; Caceres et al., 1986). Thus, it was of interest to de termine whe the r proteins enr iched in axons were also decreased in AS Dlx2-treated cells. Table 2 shows that in contrast to MAP2, tau, another MAP distr ibuted in developing axons, was not modif ied by Dlx2 antisense treatment. Further- more, synapt ic vesicle pro te ins preferent ia l ly expressed by axons (Fletcher et al., 1991), such as synapsin I (Table 2) or synaptophysin (data not shown), were not changed by the AS-DIx2 treatment. NF-H, an in te rmedia te f i lament pro te in


104

Table 1 Phenotypes of Dlx-Expressing Cells in Primary

Cultures of Embryonic Basal Telencephalon a

Number of immunoreactive cells

% of Dlx-1 % of Dlx-2 % of Dlx-5

BrdU 39.3 (2.1) 41.6 (7.4) 31.1 (3.8) MAPIB 85.9 (2.4) 76.1 (4.0) 49.1 (1.1) MAP2 33.1 (5.6) 30.0 (8.8) 34.3 (7.0)

aPrimary cultures of basal telencephalon from E13.5 rat embryos fixed at 4 d in vitro were subjected to in situ hybridization using RNA probes for Dlx-1, Dlx-2, or Dlx-5, and then to immunocytochemistry with either of the indicated antibodies. Some wells were previously treated, when appropriate, with BrdU for 24 h. Ten random fields of cultures were examined under a calibrated microscope reticule and the number of single- and double-stained cells were counted. Values represent the mean of 3-4 experiments using separate cell preparations; standard error is in parenthesis.

expressed by both dendri tes and axons, showed a small but consistent decrease in AS-Dlx2-treated cells (Table 2).

The decreased MAP2 expression caused by the AS-Dlx2 t rea tment could reflect a structural alteration of the developing dendrit ic domain because of a block or a delay in dendr i te maturation. To address this possibility, we measured neurite out- g rowth after chronic Dlx-2 blockade, comparing neuri tes labeled by MAP2 with those labeled by tubulin, a general structural component present in all cell compartments . Dense cultures were treated for 7 d wi th AS-Dlx2-1 or wi th control (rn) ODNs and replated at low densi ty in the presence of the respective ODNs and FGF2 (20 ng /mL) . Tubulin immunos ta in ing of these cultures showed that, by 24 h in vitro, most neurons had acquired a polar- ized morphology, wi th one neurite, presumably the axon, cons ide rab ly longer than the o thers (Dotti et al., 1987; Craig and Banker, 1994). Com- pared to the controls, neurons treated wi th AS- Dlx2 showed a decrease in the average length of tubul in -pos i t ive neur i t e s by 24 h after pla t ing (Fig. 7). Similarly to tubulin, the length of MAP2- positive neuri tes was decreased by AS-Dlx2 treat- men t (Fig. 7, Table 3). In addition, the number of MAP2-positive neurites per cell was also decreased (Table 3). As a result of this decrease in neuri te

Ding et al.

Table 2 Decrease in Dlx-2 Protein Is Associated With

a Decrease in Dendrite, but not Axonal Markers a

Number of immunoreactive cells (% of total cell number)

DLX-2 MAP2 NF-H Syn Tau GABA

rn 33.7 32.1 74.9 69.3 20.9 41.0 (5.0) (1.3) (1.0) (4.1) (3.6) (3.3)

AS-Dlx2-1 19.9 19.3 60.3 69.9 26.5 38.6 (4.1) c (2.7) c (2.0) b (1.9) (7.0) (3.3)

AS-Dlx2-2 24.2 14.5 68.4 67.8 29.4 48.2 (3.7) b (1.0) d (1.9) b (1.3) (3.1) (3.3)

AS-Dlxl 34.4 33.6 73.0 71.1 21.9 42.0 (3.4) (1.9) (2.2) (2.0) (5.7) (4.4)

aPrimary cultures were treated with control (rn = random) or AS-ODNs, as indicated in the first column, for 7 d in vitro. The number of cells immunoreactive for the Dlx-2 gene product (DLX-2), for dendrite markers (MAP2), axonal markers (tau; syn = synapsin), for markers of both axons and dendrites (NF-H = neurofilament 200 kDa subunit), and for neurotransmit- ters (GABA) was measured in parallel in cell suspensions embedded in agarose. The number of stained and unstained cells was counted in 10 fields under a calibrated microscope reticule. Data are the average of 3--4 separate experiments; standard error is in parenthesis. Comparisons (Student's t-test) were made between each AS-ODN treatment and the rn control.

bp < 0.05. ~p< 0.01.

< 0.001.

number , the total length of MAP2-posit ive neurites per cell decreased to a larger extent than the average neuri te length after AS-Dlx-2 t reatment (Table 3). Cell survival was not affected by the AS- ODN treatment: The number of cells in 16 r andomly selected fields was, respectively, 36.5 (+3.5) and 34.7 (+5.2) in the rn and AS-Dlx2-1 conditions.

Discussion

To gain insight into the developmenta l role of Dlx genes, a family of homeobox genes, we studied their cellular localization in p r imary cultures of cells f rom the basal telencephalon. We show that Dlx genes are expressed by cells of the neuronal l ineage, par t i cu la r ly by MAPIB-pos i t ive immature neurons, but not by astroglia. A decrease


DIx-2 Controls Neuronal Differentiation in Primary Culture

A

105

_=

o

"to (n

c •

E ~- E o

N ~ O

E .,.,I c

70 • rn [ ] sh

60 I AS-Dlxl [ ] AS-DIx2-1

50 [ ] AS-DIx2-2

40-

30- ~ . 20" 10 0

MAP2 MAP1B

MAP2 ---~

o V tau __~ , i i ~ IIIiP

GFAP " - -~ g l m p

BASAL GANGLIA HINDBRAIN

Fig. 6. Blockade of DIx-2 expression decreases MAP2 expression in the basal ganglia. (A) Number of cells immunoreactive for MAP2 and MAP1B as percent of total cells in cultures treated for 7 d, with control ODNs (rn = random; sh = shuffled) or with different AS-ODNs (AS-DIx2-1 ; AS-DIx2-2; AS-Dlxl). Note that AS-Dlxl- treated cells are no different than control, whereas both AS-DIx2s decrease the number of MAP2-positive cells from 33% to about 17% of the total cells. Immunocytochemistry was carried out in cell suspensions embedded in agarose slices. Values are from 3-7 experiments involving different cell preparations. *p < 0.005. (B) Western blot showing MAP2, tau, and GFAP expression in primary cultures of basal ganglia or hindbrain treated for 7 d, with control ODNs (rn) or with AS-ODNs targeted to DIx-2. The blot was sequentially reacted with antibodies against MAP2, tau, and GFAP.


106 Ding et al.

t u b u l i n MAP2

3

P O

7 0 -

60-

50-

40 '

30"

20"

10

0 0

7O

6O

5O

4O

3O

20

10

, , 0

1 0 20 3'0 0 D | !

10 20 30

0 ~ " rn

-- AS-DIx2-1

time in culture (hr)

Fig. 7. Blockade of DIx-2 expression decreases neurite extension. Cultures treated with either control (rn) or AS-DIx2-ODNs for 7 d were replated at low density, fixed at the indicated time, and immunostained for either tubulin or MAP2. The average neurite length was determined by morphometric analysis (see Methods). Differ- ences in length determined at 10 h for MAP2 and at 24 h for both MAP2 and tubulin are statistically significant (p < 0.001, Student's t-test).

Table 3 AS-DLX2 Treatment Decreases Dendrite Growth ~

MAP2-positive neurites

Average neurite Total neurite length Neurite number length per cell per cell N

rn 32.5 131.3 3.6 78 (2.4) (10) (0.3)

AS-Dlx2-1 22.6 71.4 2.8 98 (2.1) b (9.2) b (0.3) b

aCultures treated with either control (rn) or AS-DLx2oODNs for 7 d were replated at low density, fixed at 24 h, and immunostained for MAP2. The total length (in ~m) of all neurites and the number of primary neurites was determined for each neuron (see Methods). N = number of neurons analyzed. Values in paren- theses indicate the standard error.

bp < 0.001 respective to the rn control (Student's t-test).

in the Dlx-2 gene p roduc t b y means of AS-ODN t rea tmen t resul ts in a dec reased express ion of MAP2, along wi th a smaller decrease in the NF-H subunit , bu t no effect on MAPIB expression. This

apparent block in the normal p rogress ion from MAPIB to MAP2 expression is associated wi th a decrease in neurite elongation and wi th a failure to inhibit subsequent cell proliferation.



DIx Gene Expression in Primary Cultures from the Developing Basal Telencephalon

Primary cultures from the basal telencephalon represent an useful model to investigate the role of Dlx genes in development, since they maintain the in vivo pattern of expression of Dlx and of several o ther homeobox genes. In tissue, as expected, Dlx-1, Dlx-2, Dlx-5, and Dlx6 are primarily expressed in the basal telencephalon; an identical pattern is present in primary cultures. Both in cultures and in tissue, there is minimal expression of Dlx-2 in the dorsal telencephalon, which is consistent with previous results (Bulfone et al., 1993; Porteus et al., 1994). These findings confirm and extend what we have described in a previous report (Robel et al., 1995).

In primary cultures from basal telencephalon, mRNAs for Dtx-1, Dlx-2, and Dlx-5 colocalize with MAP2- and MAPIB-positive neurons, but not with glia. We have never found Dlx-2 mRNA in astrocytes at several stages of development of these cul tures , which suggests a l ineage-restr ic ted expression of Dlx genes to neuronal cells. The possible expression of Dlx genes by glial progenitor cells remains to be investigated.

We used markers expressed at different stages of neuronal differentiation to compare the expression of Dlx-2 to that of other genes of the Dlx family. In culture, as in vivo, immature neurons initially express MAPIB and progressively downregulate MAPIB as they begin to express MAP2 (Binder et al., 1986a,b; Tucker et at., 1988; Schoenfeld et al., 1989). We found that approx 80% of Dlx-2 and Dlx-1 positive cells are immature neurons positive for MAPIB, and approx 40% are labeled by a 24-h pulse of BrdU. These Dlx- and BrdU-positive cells include proliferating cells as well as cells in their early postmitotic period. In comparison, only 49% of Dlx-5-positive cells express MAPIB, and 31% incorporate BrdU, suggesting that cells expressing Dlx-5 may be more mature than cells expressing Dlx-2 and Dlx-1.

In conclusion, it can be argued that Dlx-positive cells are heterogeneous populations of neuronal cells, encompassing neuronal progenitors, early postmitotic cells, and neurons at different stages of differentiation. Our data suggest, but do not definitively prove, that Dlx-1, Dlx-2, and Dlx-5 may be expressed by different subpopulations of cells. In situ hybridization studies show a colocal-

ization of Dlx genes in the same region of the basal ganglia, however, this does not preclude a differential cellular localization.

The fact that only about 30% of Dlx-l-, Dlx-2-, and Dlx-5-positive cells coexpress MAP2 suggests that Dlx gene expression is downregulated as neurons approach a more mature state. This pattern suggests specific roles for these homeoproteins in aspects of neuronal differentiation and is in agree- ment with the regional localization of Dlx-2 within the basal ganglia (Porteus et al., 1994).

Blockade of DIx-2 Expression by AS-ODNs Decreases MAP2 Immunoreactivity and Increases Cell Proliferation

To understand whether Dlx-2 plays a role in neuronal differentiation, primary cultures were treated with AS-ODNs targeted to Dtx-2 during a period of time in which neuronal precursor cells normally enter their last mitotic cycle and begin to undergo differentiation (between 1 and 7 d in vitro) (Vaccarino et al., 1995). Either of two overlapping AS-ODNs targeted to Dlx-2, AS-Dlx2-1 and AS-Dlx2-2, produced a marked decrease in Dlx-2 mRNA and protein, without decreasing Dlx- 5 mRNA levels. The striking dependence of the antisense action on a specific nucleic acid-lipid ratio has been noted in other studies (Malone et al., 1989; Holt et al., 1990; Bennett et al., 1992) and is attributed to the fact that high amounts of DNA reduce the positive charge of DNA-l ip id com- plexes. The decrease in Dlx-2 mRNA is consistent with the ability of phosphorothioate oligonucleotides to stimulate endogenous cellular RNase H activity, which specifically degrades the target RNA in hybrid duplexes (Marshall and Caruthers, 1993). This mRNA decrease resulted in a corresponding decrease in DLX-2 protein, indicating that Dlx-2 gene expression was effectively reduced by the antisense treatment.

The block of Dlx-2 expression was correlated with a 45-50% decrease in levels of MAP2, both by quantitative immunocytochemistry and by West- ern blot. This decrease in MAP2 expression was associated with a substantial increase (>50%) in cell proliferation. Although these may appear to be relatively large effects, given the fact that only 50% of the cells incorporated tagged ODNs, we cannot exclude the possibility that amounts of


108 Ding et al.

ODNs below our detection limit are present in a larger percent of the cell population.

AS-ODN techniques have been successfully used, both in vitro and in vivo, to block gene expression (Bielinska et al., 1990; Caceres and Kosik, 1990; Castrillo et al., 1991; Chiang et al., 1991; Caceres et al., 1992; Lallier and Bronner-Fraser, 1993; Marshall and Caruthers, 1993; Stein and Cheng, 1993; Wahlestedt et al., 1993; McCarthy et al., 1994; Vaccarino et al., 1995). A potential diffi- culty in interpreting the results obtained by these techniques is that ODNs may interfere with the binding of endogenous growth factors, such as FGF2, to their sulfated proteoglycan receptor, probably by sequestering the ligand (Stein and Cheng, 1993; Guvakova et al., 1995; Retaux et al., 1996). Our conditions of ODN treatment, however, which include FGF2 addition to the cultures and low concentrations of ODNs, may have avoided this complication. FGF2 increases cell prolifer-ation and survival in these cultures (Vaccarino et al., 1995); if the effects of AS-ODNs resulted from an interference with the action of FGF2, we would have expected a decrease in BrdU incorporation and a decrease in cell viability and survival. Instead, we found that AS- Dlx2 treatment increases BrdU incorporation and has no effect on cell viability, as estimated by propidium iodide labeling. Thus, an interference with FGF2 binding cannot explain the results of this study.

The changes in phenotype produced by AS- Dlx2 treatment appear to be the specific result of an antisense action and not a secondary effect. This is supported by several observations. First, AS-Dlx2-1 caused a decrease in MAP2 immunoreactivity and an increase in BrdU incorporation only in a region that expresses Dlx2, namely, the basal ganglia, and not in the hindbrain or in the dorsal te lencephalon, where the Dlx2 gene is not expressed. Second, the decrease in MAP2 in the basal ganglia was dependent on the sequence of AS-Dlx20DNs, since it was obtained by using either of two partially overlapping ODNs targeted to the Dlx-2 mRNA, but not by randomly sequenced or scrambled sequence ODNs.

DLXo2 Protein May Control Dendrite Extension

We observed that AS-Dlx2 treatment resulted in a decrease in proteins localized in dendrites, such

as MAP2 and, in minor part, NF-H, but not in proteins preferentially localized in axons (tau, synapsin I, synaptophysin). An important function of MAP2 is to stabilize crosslinked microtubules, which confers stiffness to cells and their projections, a process that may be important for initiating neurite extension (Weisshaar et al., 1992; Weisshaar and Matus, 1993; Matus, 1994) and for inhibiting cell proliferation (Lewis et al., 1989; Dinsmore and Solomon, 1991). Both overexpression and loss of function studies have shown that MAP2 and tau are important for the growth of dendri tes and axons, respectively (Lewis et al., 1989; Matus, 1994). Indeed, AS-Dlx2-treated cells showed a decrease in average neurite length and number, compared to control cells. Remarkably, AS-Dlx2 treatment produced a similar decrease in the average length of neurites immunostained for tubulin, a general component of the cytoskeleton. These results suggest that the decrease in Dlx-2 expression causes an impairment in dendrite growth or stabilization, which is reflected in a structural alteration of the developing dendrit ic domain. Since both length and number of MAP2-positive neuri tes were decreased after AS-Dlx2 treatment, it can be inferred that DLX-2 controls both dendrite initiation and elongation. Under the same conditions, we observed no effect of AS-ODNs on cell survival in these low density cultures, which rules out secondary effects on neurites caused by decreased cell viability.

It is in teres t ing that the dec reased MAP2 expression and neurite outgrowth in AS-Dlx2- treated cells were not associated with a loss of general neuronal markers, including GABA, tau, and synapsin I immunoreactivity. Our interpretation of these findings is that Dlx-2 blockade does not elicit a change in phenotype from neuronal to nonneuronal cells. In particular, developing neurons did not switch to another lineage, such as astroglia, since GFAP levels were unchanged. Thus, it appears that AS-Dlx2 treatment causes a selective impairment in the growth or stabilization of the dendritic domain without altering other aspects of neuronal differentation. Other studies have also suggested that the process of neurite outgrowth may be independently regulated than the acquisition of neurotransmitter phenotypes or other aspects of neuronal differentiation (Dins- more and Solomon, 1991; Caceres et al., 1992).



We suspect that this selectivity of action of AS- Dlx20DNs is a reflection of a role for the DLX-2 protein in promoting dendrite growth. The initiation and maturation of dendrites and axons is independently regulated by extracellular factors and intracellular molecules (Prochiantz, 1995). It has been postulated that although axons grow as a default pathway, dendrites require the presence of several regulatory factors in order to properly elongate and maintain their architecture (Prochi- antz, 1995). In support of this idea, homeoproteins may be part of a set of region-specific factors that par t ic ipa te in the regu la t ion of neur i te growth (Bloch-Gallego et al., 1993; Joliot et al., 1994; Prochiantz, 1995; Chatelin et al., 1996) and synaptic connectivity (Miller et al., 1992; White et al., 1992).

The loss of func t ion of the Dlx-2 gene in homozygous mutant mice does not result in overt abnormalities in the basal ganglia histology and histochemistry (i.e., MAP2 expression), suggesting that other Dlx gene products can partially compensate for the loss of one Dlx gene under chronic conditions in vivo (Qiu et al., 1995). How- ever, Dlx-1 and Dlx-2 double-mutant mice dis- play an alteration of neuronal differentiation in the basal ganglia similar to that described in this study (Anderson et al., 1995). Our findings that the acute blockade of Dlx-2 expression alone is sufficient to obtain abnormalit ies of neuronal differentiation suggest that the Dlx-2 gene has a un ique role not shared by other Dlx family members at this stage of deve lopment of the basal ganglia.

Local Control of Neurite Outgrowth and Cell Proliferation

An important question is the mechanism by which the inhibition of Dlx-2 expression produces the effects described in this study. Since our primary cultures are heterogeneous, it is possible that the increased proliferation and the decreased neurite outgrowth are the separate responses of two different sets of cells (progenitors and postmitotic, respectively) to the decrease in Dlx-2 expression. However, it is tempting to speculate that they are both dependent on a decrease in MAP2 expression. According to this hypothesis, in the absence of the Dlx2 gene product , neuronal cells are

unable to express MAP2, which secondari ly results in decreased neurite extension and in an inability to withdraw from the cell cycle. Accord- ingly, the expression of a MAP2 antisense con- struct in P19 cells undergo ing retinoic acid- induced neuronal differentiation resulted in an inhibition of neurite extension and in a failure to withdraw from the cell cycle, but not in a decrease in the expression of other neuronal markers (Dinsmore and Solomon, 1991). Furthermore, the suppression of MAP2 by AS-ODNs in cerebellar macroneurons made 80% of the cells incompetent to initiate process formation (Caceres et al., 1992). Thus, the phenotype of transfectants bearing MAP2 antisense sequences is similar to that resulting from ODN-induced block of Dlx-2 expression.

Against the possibility that MAP2 is a target gene of the DLX-2 protein is the lack of a complete overlap between the domains of expression of Dlx- 2 and MAP2. In the basal ganglia, only 30% of Dlx-2-positive cells express MAP2, since MAP2 continues to be expressed in more mature cells, which have low levels or no Dlx-2 (Porteus et al., 1994). However , Dlx-2 could initiate MAP2 expression and not be required for its expression at later stages. The molecular interaction between homeoproteins and MAP2, a complex gene that potentially can be spliced in 39 different transcripts (Kalcheva et al., 1995), remains to be clarified. This requires a direct analysis of the MAP2 promoter to verify the presence of homeobox binding sequences and cotransfection of cell lines with MAP2 promoter constructs, together with constructs expressing Dlx-2.

In this context, it is important to stress that the interaction between Dlx-2 and MAP2 may be indi- rect, requiring one or more intermediate molecular steps. For example, our data do not exclude the possibility that the increased proliferation noted after AS Dlx2 secondarily leads to the inhibition in MAP2 expression. The mutation of a member of the POU domain subclass of homeobox genes results in a failure in cell cycle arrest and subsequent differentiation (Greenstein et al., 1994).

It is also possible that Dlx-2 indirectly affects MAP2 expression through the expression of CAMs (Edelman and Jones, 1993), a class of membrane- associated proteins that regulate neurite outgrowth. For example, Distal-less, the Drosophila's homologue of Dlx, may increase cell-to-cell adhesion through induction of factors of the wingless family


I I0 Ding et al.

(Eisenberg et al., 1992; Bradley et al., 1993; van Leeuwen et al., 1994). Thus, the Dlx-2 blockade would elicit condi t ions of low adhes ion that, in turn, migh t decrease dendri te outgrowth. Condi- tions of low adhesion primarily affect the growth of dendrites and not of axons, leading to secondary changes in MAP2 expression (Chamak and Prochiantz, 1989; Rousselet et al., 1990).

The link among Dlx-2, MAP2, and neurite outgrowth, which is the central tenant of this paper, exemplifies how regionally expressed transcrip- tional regulators may be involved in the local control of neuronal architecture and polarity. A separate control of this process by homeobox genes in different regions of the CNS may allow a temporally and spatially coordinated control of neurite outgrowth, which may serve an important function in the local organization of neuronal connectivity.

Acknowledgments

This work was suppor ted in part by NARSAD (F. M. V., J. F. L., J. L. R. R.) the Korczak Foun- dation (J. F. L. and F. M. V.), the NSF (F. M. V.), and the Medical Research Counci l of Canada (D. D. E.).

References Akimenko M. A., Ekker M., Wegner J., Lin W., and

Westerfield M. (1994) Combinatorial expression of three zebrafish genes related to distal-less: part of a homeobox gene code for the head. J. Neurosci. 14, 3475-3486.

Alho H., Ferrarese C., Vicini S., and Vaccarino F. M. (1988) Subsets of GABAergic neurons in dissociated cell cultures of neonatal rat cerebral cortex show co-localization with specific modulator pep- tides. Dev. Brain Res. 39, 193-204.

Anderson S. A., Qiu M.-S., Bulfone A., Meneses J., Pederson R., and Rubenstein J. L. R. (1995) Func- tional analysis of Dlx-1 and Dlx-2 using gene replacement. Soc. Neurosci. Abstracts 21, 793.

Bennett C. F., Chiang M. Y., Chan H., Shoemaker J. E., and Mirabelli C. K. (1992) Cationic lipids enhance cellular uptake and activity of phosphorothioate antisense oligonucleotides. Mol. Pharmacol. 41, 23-33.

Bielinska A., Shivdasani R. A., Zhang L., and Nabel G. J. (1990) Regulation of gene expression with double-stranded phosphorothioate oligonucleotides. Science 250, 997-1000.

Binder L. I., Frankfurter A., Kim H., Caceres A., Payne M. R., and Rebhun L. I. (1986a) Heteroge- neity of microtubule-associated protein 2 during brain development. Proc. Natl. Acad. Sci. USA 81, 5613-5617.

Binder L. I., Frankfurter A., and Rebhun L. I. (1986b) Differential localization of MAP-2 and tau in mammalian neurons in situ. Ann. NY Acad. Sci. 466, 145-166.

Bloch-Gallego E., Le Roux I., Joliot A. H., Volovitch M., Henderson C. E., and Prochiantz A. (1993) Antennapedia homeobox peptide enhances growth and branching of embryonic chicken motoneu- rons in vitro. ]. Cell Biol. 120, 485-492.

Bradley R. S., Cowin P., and Brown A. M. C. (1993) Expression of Wnt-1 in PC12 cells results in mod- u la t ion of P lakoglobin and E-cadher in and increased cellular adhesion. J. Cell Biol. 123, 1857-1865.

Bulfone A., Puelles L., Porteus M. H., Frohman M. A., Martin G. R., and Rubenstein J. L. R. (1993) Spatially restricted expression of Dlx-1, Dlx-2 (Tes-1), Gbx-2, and Wnt-3 in the embryonic day 12.5 mouse forebrain defines potential transverse and longitudinal segmental boundaries. J. Neuro- sci. 13, 3155-3172.

Caceres A., Banker G., and Binder L. (1986) Immuno- cytochemical localization of tubulin and microtubule-associated protein 2 during the development of hippocampal neurons in culture. J. Neurosci. 6, 714-722.

Caceres A. and Kosik K. S. (1990) Inhibition of neurite polarity by tau antisense oligonucleotides in primary cerebellar neurons. Nature 343, 461-463.

Caceres A., Mautino J., and Kosik K. S. (1992) Sup- pression of MAP2 in cultured cerebellar macroneurons inhibits minor neurite extension. Neuron 9, 607-618.

Castrillo J.-L., Theill L. E., and Karin M. (1991) Func- tion of the homeodomain protein GHF1 in pitu- itary proliferation. Science 253, 197-199.

Chamak B. and Prochiantz A. (1989) Influence of extracellular matrix proteins on the expression of neuronal polarity. Development 106, 483-491.

Chatelin L., Volovitch M., Joliot A. H., Perez F., and Prochiantz A. (1996) Transcription factor Hoxa-5 is taken up by cells in culture and conveyed to their nuclei. Mech. Dev. 55, 111-117.



Chiang M.-Y., Chan H., Zounes M. A., Freier S. M., Lima W. F., and Bennett C. F. (1991) Antisense oligonucleotides inhibit intercellular adhesion mol- ecule 1 expression by two distinct mechanisms. J. Biol. Chem. 266, 18,162-18,171.

Cohen S. M., Bronner G., Kuttner F., Jurgens G., and Jackle H. (1989) Distal-less encodes a homeodomain protein required for limb development in Drosophila. Nature 338, 432-434.

Cohen S. M. (1990) Specification of limb development in the Drosophila embryo by positional cues from segmentation genes. Nature 343, 173-177.

Craig A. M. and Banker G. (1994) Neuronal polarity. Ann. Rev. Neurosci. 17, 267-310.

De Camilli P., Navone F., Miller P., Theurkauf W. E., and Vallee R. B. (1984) Distribution of microtubule-associated protein 2 (MAP2) in the nervous system of the rat studied by immunofluorescence. Neuroscience 11, 819-846.

Dinsmore J. H. and Solomon F. (1991) Inhibition of MAP2 expression affects both morphological and cell division phenotypes of neuronal differentiation. Cell 64, 817-826.

Dotti C. G., Banker G. A., and Binder L. I. (1987) The expression and distribution of the microtubule- associated proteins tau and microtubule-associated protein 2 in hippocampal neurons in the rat in situ and in cell culture. Neuroscience 23, 121-130.

Edelman G. M. and Jones F. S. (1993) Outside and downstream of the homeobox. J. Biol. Chem. 268, 20,683-20,686.

Eisenberg L. M., Ingham P. W., and Brown A. M. C. (1992) Cloning and characterization of a novel Drosophila Wnt gene, Dwnt-5, a putative downstream target of the homeobox gene DistaMess. Dev. Biol. 154, 73-83.

Ekker M., Akimenko M.-A., Bremiller R., and West- erfield M. (1992) Regional expression of three homeobox transcripts in the inner ear of zebrafish embryos. Neuron 9, 27-35.

Fletcher T. L., Cameron P., De Camilli P., and Banker G. (1991) The distribution of synapsin I and synaptophysin in hippocampal neurons developing in culture. J. Neurosci. 11, 1617-1626.

Greenstein D., Hird S., Plasterk R. H., Andachi Y., Kohara Y., Finney M., Wang B., Finney M., and Ruvkun G. (1994) Targeted mutations in the Caenor- habditis elegans POU homeo box gene ceh-18 cause defects in oocyte cell cycle arrest, gonad migration, and epidermal differentiation. Genes Dev. 8,1935-1948.

Guvakova M. A., Yakubov L. A., Vlodavsky I., Tok- inson J. L., and Stein C. A. (1995) Phosphorothioate

oligodeoxynudeotides bind to basic fibroblast growth factor, inhibit its binding to cell surface receptors, and remove it from low affiru'ty binding sites on ex~aceUu- lar matrix. J. Biol. Chem. 270, 2620-2627.

Holt C. E., Garlick N., and Cornel E. (1990) Lipo- fecfion of cDNAs in the embryonic vertebrate central nervous system. Neuron 4, 203-214.

Immergluck K., Lawrence P. A., and Bienz M. (1990) Induction across germ layers in Drosophila mediated by a genetic cascade. Cell 62, 261-268.

Joliot A., Le Roux I., Bloch-Gallego E., and Prochi- antz A. (1994) Neurotrophic activity of a homeobox pepfide. Prog. Neurobiol. 42, 309-311.

Jones K. H. and Senft J. A. (1985) An improved method to determine celt viability by simultane- ous staining with fluorescein diacetate-propidium iodide. ]. Histochem. Cytochem. 33, 77-79.

Kalcheva N., Albala J., O'Guin K., Rubino H., Garner C., and Shafit-Zagardo B. (1995) Genomic structure of human microtubular-associated protein 2 (MAP-2) and characterization of newly identified isoforms. Proc. Natl. Acad. Sci. USA 92, 10,894-10,898.

Lallier T. and Bronner-Fraser M. (1993) Inhibition of neural crest cell attachment by integrin antisense oligonucleotides. Science 259, 692-695.

Lewis S. A., Ivanov I. E., Lee G.-H., and Cowan N. J. (1989) Organization of microtubules in dendrites and axons is determined by a short hydrophobic zipper in microtubule-associated proteins MAP2 and tau. Nature 342, 498-505.

Loke S. L., Stein C. A., Zhang X. H., Mori K., Nakanishi N., Subasinghe C., Cohen S. J., and Neckers L. M. (1989) Characterization of oligonucleotide trans- port into livinge cells. Proc. Natl. Acad. Sci. USA 86, 3474-3478.

Malone R. W., Feigner P. L., and Verma I. M. (1989) Cationic liposome-mediated RNA transfection. Proc. Natl. Acad. Sci. USA 86, 6077-6081.

Marshall W. S. and Caruthers M. H. (1993) Phosphor- othioate DNA as a potential therapeutic drug. Sci- ence 259, 1564-1570.

Matus A. (1994) Stiff microtubules and neuronal morphology. Trends Neurosci. 17, 19-23.

McCar thy M. M., Masters D. B., Rimval l K., Schwartz-Giblin S., and Pfaff D. W. (1994) Intra- cerebral administration of antisense oligodeoxynucleotides to GAD65 and GAD67 modula te reproductive behavior in the female rat. Brain Res. 636, 209-220.

Miller D. M., Shen M. M., Shamu C. E., Burglin T. R., Ruvkun G., Dubois M. L., Ghee M., and Wilson L.


112 Ding et al.

(1992) C. elegans unc-4 gene encodes a homeodomain protein that determines the pattern of synaptic input to specific motor neurons. Nature 355, 841-845.

Papalopulu N. and Kintner C. (1993) Xenopus Dis- tal-less related homeobox genes are expressed in the developing forebrain and are induced by pla- nar signals. Development 117, 961-975.

Porteus M. H., Bulfone A., Ciaranello R. D., and Rubenstein J. L. R. (1991) A partial cDNA sequence of the Dlx-2 cDNA. Neuron 9, 187.

Porteus M. H., Bulfone A., Liu J. K., Puelles L., Lo L. C., and Rubenstein J. L. R. (1994) DLX-2, MASH-l, and MAP2 expression and bromodeoxyuridine incorporat ion define molecularly distinct cell populations in the embryonic mouse forebrain. J. Neurosci. 14, 6370-6383.

Price M., Lemaistre M., Pischetola M., Di Lauro R., and Duboule D. (1991) A mouse gene related to Distal-less shows a restricted expression in the developing forebrain. Nature 351, 748-751.

Prochiantz A. (1995) Neuronal polarity: giving neurons heads and tails. Neuron 15, 743-746.

Qiu M., Bulfone A., Martinez S., Meneses J. J., Shimamura K., Pedersen R. A., and Rubenstein J. L. R. (1995) Null mutat ion of Dlx-2 results in abnormal morphogenesis of proximal first and second branchial arch derivatives and abnormal differentiation in the forebrain. Genes Dev. 9, 2523-2538.

Retaux S., McNeill L., and Harris W. A. (1996) Engrailed, retinotectal targeting, and axonal pat terning in the midbrain dur ing Xenopus development: an antisense study. Neuron 16, 63-75.

Reuter R., Panganibam G. E. F., Hoffmann F. M., and Scott M. P. (1990) Homeotic genes regulate the spatial expression of putative growth factors in the visceral mesoderm of Drosophila embryos. Development 110, 1031-1040.

Robel L., Ding M., James A. J., Lin X., Leckman J. F., and Vaccarino F. M. (1995) Fibroblast growth factor 2 increases Otx2 expression in precursor cells from the mammalian telencephalon. J. Neurosci. 15, 7879-7891.

Robinson G. W., Wray S., and Mahon K. A. (1991) Spatially restricted expression of a member of a new family of murine Distal-less homeobox genes in the developing forebrain. New Biologist 3, 1183-1194.

Robinson G. W. and Mahon K. A. (1994) Differential and overlapping expression domains of Dlx-2

and Dlx-3 suggest distinct roles for distal-less homeobox genes in craniofacial development. Mech. Dev. 48, 199-215.

Rousselet A., Autillo-Touati A., Araud D., and Pro- chiantz A. (1990) In vitro regulation of neuronal morphogenesis and polarity by astrocyte-derived factors. Dev. Biol. 137, 33-45.

Schoenfeld T. A., McKerracher L., Obar R., and Vallee R. B. (1989) MAPIA and MAPIB are struc- turally related microtubule associated proteins with distinct developmental patterns in the CNS. J. Neurosci. 9, 1712-1730.

Selski D. J., Thomas N. E., Coleman P. D., and Rogers K. E. (1993) The human brain homeogene, DLX-2, cDNA sequence and alignment with the murine homologue. Gene 132, 301-303.

Simeone A., Gulisano M., Acampora D., Stornaiuolo A., Rambaldi M., and Boncinelli E. (1992) Two vertebrate homeobox genes related to the Droso- phila empty spiracles gene are expressed in the embryonic cerebral cortex. EMBO J. 11, 2541-2550.

Simeone A., Acampora D., Pannese M., D'Esposito M., Stornaiuolo A., Gulisano M., Mallamaci A., Kastury K., Druck T., Huebner K., et al. (1994) Cloning and characterization of two members of the vertebrate Dlx gene family. Proc. Natl. Acad. Sci. USA 91, 2250-2254.

Stein C. A. and Cheng Y.-C. (1993) Antisense oligonucleotides as therapeutic agents--is the bullet really magical? Science 261, 1004-1011.

Tucker R. P., Binder L. I., and Matus A. I. (1988) Dif- ferential localization of the high- and low-molecular weight variants of MAP2 in the developing retina. Brain Res. 466, 313-318.

Vaccarino F. M., Schwartz M. L., Hartigan D., and Leckman J. F. (1995) Effect of basic fibroblast growth factor on the genesis of excitatory and inhibitory neurons in primary cultures of cells from the mammalian telencephalon. CerCx 1, 1047-3211.

van Leeuwen F., Harryman Samos C., and Nusse R. (1994) Biological activity of soluble wingless protein in cultured Drosophila imaginal disk cells. Nature 368, 342-344.

Wahlestedt C., Golanov E., Yamamoto S., Yee F., Ericson H., Yoo H., Inturrisi C. E., and Reis D. J. (1993) Antisense oligodeoxynucleotides to NMDA- R1 receptor channel protect cortical neurons from excitotoxicity and reduce focal ischaemic infarc- tions. Nature 363, 260-263.

Weisshaar B., Doll T., and Matus A. (1992) Reorgani- zation of the microtubular cytoskeleton by embry-


D Ix-2 Controls Neuronal Differentiation in Primary Culture I 13

onic microtubule-associated protein 2 (MAP2c). Development 116, 1151-1161.

Weisshaar B. and Matus A. (1993) Microtubule-associated protein 2 and the organization of cellular microtubules. J. Neurocytol. 22, 727-734.

White J. G., Southgate E., and Thomson J. N. (1992) Mutations in Caenorhabditis elegans unc-4 gene

alter the synapfic input to ventral cord motor neurons. Nature 355, 838-841.

Zhao G. Q., Zhao S., Zhou X., Eberspaecher H., Solursh M., and de Crombrugghe B. (1994) rDlx, a novel distal-less-like homeoprotein is expressed in developing cartilages and discrete neuronal tis- sues. Dev. Biol. 164, 37-51.


Dlx-2 homeobox gene controls neuronal differentiation in primary cultures of developing basal...

Documents

Transcript of Dlx-2 homeobox gene controls neuronal differentiation in primary cultures of developing basal...