www.elsevier.com/locate/jmicmeth

Journal of Microbiological Methods

Direct colony PCR-SSCP for detection of multiple pythiaceous

oomycetes in environmental samples

Ping Kong*, Patricia A. Richardson, Chuanxue Hong

Department of Plant Pathology, Physiology, and Weed Science, Virginia Polytechnic Institute and State University,

Hampton Roads Agricultural Research and Extension Center, 1444 Diamond Springs Road, Virginia Beach, VA 23455, United States

Received 2 July 2004; received in revised form 26 October 2004; accepted 27 October 2004

Available online 8 December 2004

Abstract

Colony PCR was developed for detection of pythiaceous species recovered on selective agar plates without DNA extraction.

A minute amount of mycelia from a single colony was picked up with a pipette tip and added directly to the PCR mix as

template for DNA amplification. Successful amplification was achieved in over 95% of the colonies recovered from plant

tissues, irrigation water and soil with species-specific primers or oomycete ITS-1 primers. PCR was inhibited in the case of

colonies emerging from unwashed pine bark potting mix plates. Direct colony PCR with ITS-1 primers combined with single-

strand conformation polymorphism analysis (SSCP) was used to determine population levels of single and multiple species in

plant and environmental samples. Application of this technique for disease diagnosis and monitoring pathogen sources was

explored, and the potential for studying diversity and population dynamics of other cultivated microbial communities in the

environment is discussed.

D 2004 Elsevier B.V. All rights reserved.

Keywords: Direct colony PCR; ITS-1 SSCP; Phytophthora; Pythium; Plant tissues; Soil; Irrigation water

1. Introduction

Pythiaceae is a large family of algae-like micro-

organisms (oomycetes) that includes Phytophthora

and Pythium with about 300 described species (http://

www.cabi-bioscience.org). Pythiaceous species have

been recovered from areas ranging from undisturbed

0167-7012/$ - see front matter D 2004 Elsevier B.V. All rights reserved.

doi:10.1016/j.mimet.2004.10.019

* Corresponding author. Tel.: +1 757 3633941; fax: +1 757

3633950.

E-mail address: pkong@vt.edu (P. Kong).

terrestrial ecosystems to brackish salt-water marshes.

Many of them are active saprophytes on decaying

organic substrates while others are agriculturally and

economically important plant pathogens (Van der

Plaats-Niterink, 1981; Dick, 1990; Erwin and Ribeiro,

1996). Identification and detection of pythiaceous

oomycetes in environments is important not only in

disease diagnosis and management but also in

ecological and evolutionary studies of microbial

communities.

Isolation of pathogens from diseased plants or

infested environments on a selective medium fol-

61 (2005) 25–32

P. Kong et al. / Journal of Microbiological Methods 61 (2005) 25–3226

lowed by morphological examination is a conven-

tional method for detection and identification of

Phytophthora and Pythium species (Waterhouse,

1963; Van der Plaats-Niterink, 1981; Dick, 1990). In

addition to detection of certain species, it can be used

to determine species populations by grouping the

recovered colonies that have similar morphology.

However, biological and/or morphological examina-

tion is tedious and requires considerable expertise.

Species identification often takes weeks and may be

impossible when no diagnostic structures are pro-

duced. As a result, many DNA-based techniques, such

as PCR, RFLP, RAPD, single strand-conformation

polymorphism (SSCP), DNA probing and sequenc-

ing, have been used to assist detection and differ-

entiation of species from culture (Forster and Coffey,

1991; Briard et al., 1995; Wang and White, 1997;

Levesque et al., 1998; Ristaino et al., 1998; Matsu-

moto et al., 1999; Cooke et al., 2000; Martin, 2000;

Bailey et al., 2002; Kong et al., 2003b, 2004). Most of

these methods are PCR-based and allow identifying a

culture without morphological examination. However,

none of these techniques are directly adaptable to field

use. They usually require subculturing and DNA

extraction, which are time-consuming and labor-

intensive when a large number of isolates need to be

identified. Although PCR can be a culture-independ-

ent technique that allows species-specific detection of

Pythiaceae from plants, soil, and irrigation water, it

requires extracted DNA to minimize the inhibitory

effect of contaminants from environmental samples

(Ersek et al., 1994; Tooley et al., 1997; Kageyama et

al., 1997; Kong et al., 2003a,c; Wang et al., 2003).

Sometimes even after elaborate purification steps, it is

still necessary to dilute the DNA or use inhibitor

blocking agents in the subsequent assay preparations

to eliminate inhibition (Ersek et al., 1994; Wilson,

1997; Kageyama et al., 1997; Kong et al., 2003c). For

environmental bacterium detection, direct PCR with-

out DNA extraction has been reported, but serial

dilution or pretreatment of the samples was still

required (Herrick et al., 1993; Fode-Vaughan et al.,

2001; Schaad et al., 2002). PCR with diluted DNA

may result in a false detection due to low concen-

tration of target DNA, especially with low copy

number target sequences (Judelson and Tooley, 2000).

When multiple species are present in a sample, mixed

DNA can result in PCR bias and other technique-

related problems and affect accuracy of detection

(Ishii and Fukui, 2001; Hongoh et al., 2003; Ercolini,

2004).

An alternative approach that may avoid these

problems is direct PCR on isolation plates of environ-

mental samples. In this way, mixed individuals can be

separated and enriched. Direct colony PCR requires

isolation but does not require subculturing, DNA

extraction or sample pretreatment. Therefore, it can be

a rapid, accurate and cost effective approach for

pathogen detection in environmental samples. Direct

colony PCR has been successfully used with intact

cultures to screen genetically engineered bacterial

cells (Gussow and Clackson, 1989; Joshi et al., 1991;

Hiraishi, 1992) and fungi (Aufuavre-Brown et al.,

1993; van Zeijl et al., 1997). However, direct colony

PCR on environmental samples has had only limited

uses. In addition, the applications of colony PCR

focus on bacterial samples (Herrick et al., 1993; Fode-

Vaughan et al., 2001; Schaad et al., 2002), and a

pretreatment, such as addition of chemicals into the

PCR reaction mix, or nested PCR is required

(Lichtensteiger et al., 1996; Sheu et al., 2000).

In our previous studies, we had success with PCR

amplification of Phytophthora and Pythium DNA

using a small amount of boiled mycelium preparation

from pure cultures (Kong et al., 2003a,b,c, 2004). We

also had success with direct PCR using zoospore

suspensions and individual chlamydospores of Phy-

tophthora nicotianae and Phytophthora cinnamomi

without DNA extraction and sample pretreatment

(Kong et al., 2003a,c). Similar methods have also

been reported in other oomycete studies (Wangsom-

boondee and Ristaino, 2002; Bailey et al., 2002), but

PCR on pythiaceous colonies recovered directly from

environmental samples has not been reported. We also

developed a PCR-SSCP assay to differentiate multiple

species within the genera of Phytophthora (Kong et

al., 2003b) and Pythium (Kong et al., 2004) using a

single pair of oomycete primers and DNA from pure

cultures. The objective of this study was to fill a

technical gap by assessing the potential of direct

colony PCR on field samples in an attempt to create

an effective tool for disease diagnosis and for studies

of pythiaceous community structure and dynamics.

The efficacy of direct colony PCR was tested using

species-specific primers (Kong et al., 2003a,c) and

oomycete primers (Cooke et al., 2000) and templates

P. Kong et al. / Journal of Microbiological Methods 61 (2005) 25–32 27

from pure cultures and colonies directly from isolation

plates of plant tissue, soil, and irrigation water.

2. Materials and methods

2.1. Isolates, culture, and DNA preparation

Four isolates of P. nicotianae (1B11, 1E2, 23B8,

and 23B9) and four of P. cinnamomi (1A10, 1E7,

28D5, and 28D9) (Kong et al., 2003a,c) were used in

this study. Cultures were grown on clarified V8 juice

agar, and PARP-V8 and PARPH-V8 selective agar

(Ferguson and Jeffers, 1999) at room temperature in

the dark for 2 days or 2 weeks. Two-day-old cultures

were used to test DNA amplification of intact mycelia.

For standard PCR, crude DNA extracts were prepared

from 2-week-old cultures as described previously

(Kong et al., 2003a).

2.2. Isolation of Phytophthora and Pythium species

from plant tissues, soil, and irrigation water

Plant parts used in this study included fine roots of

azalea (Rhododendron sp), daphne (Daphne sp.) and

tomato (Lycopersicon esculentum), stems of tobacco

(Nicotiana tobacum), and leaves of annual vinca

(Catharanthus roseus) (Table 1). Diseased leaves,

stems, and roots were surface-sterilized with 10%

bleach then rinsed thoroughly with sterile distilled

water. These plant tissues were cut into small pieces

and plated equally among three PARP-V8 agar plates.

After diseased plants were removed, soil samples

were taken from the containers and plated on PARP-

V8 agar using a dilution plating method (Johnson and

Curl, 1972). Six replicated plates were used for each

Table 1

Direct colony PCR with species-specific primers for disease diagnosis

Plant Tissue/pieces plated Nu

To

Azalea (Rhododendron sp.) Fine roots/30 47

Tomato (Lycopersicon esculentum) Fine roots/30 27

Daphne (Daphne sp.) Fine roots/18 14

Tobacco (Nicotiana tobacum) Stems/9 8

Annual vinca (Catharanthus roseus) Foliage/30 23

a Total colonies were counted from three PARP agar isolation plates

nicotianae-specific and P. cinnamomi-specific primer pairs.

soil sample. Three of these isolation plates were

washed with running distilled water to remove soil

particles and air-dried in a laminar flow hood before

mycelium was taken to assess the effect of PCR

inhibitors from the soil particles. Three replicated

water samples were collected from an irrigation runoff

ditch and a sprinkler at a nursery in eastern Virginia,

USA. These samples were processed using a filtration

method (Hong et al., 2002) and plated on PARP-V8

and PARPH-V8 selective agar. All isolation plates

were incubated at room temperature in the dark until

colonies were visible (about 2 mm in diameter).

2.3. PCR and colony PCR

Both standard PCR and colony PCR mixtures

contain 10 mM Tris–HCl, 5 mM KCl, 1.5 mMMgCl2,

0.5 AM of each primer (Table 2), 0.2 mM dNTP, and

0.5 units of TaqDNA polymerase (TaKaRa Mirus

Biocorporation, Madison WI, USA). For standard

PCR, aliquots of 23 Al of the PCR reaction mixture

were prepared and 2 Al of DNA from a culture was

added as template. For colony PCR, a minute amount

of mycelia was added to 25 Al aliquots by scratching

2–3 mm across the surface of a colony using a

disposable tip on a 20-Al pipettor, then titurating twice

while gently swirling the tip in the mixture. The

thermocycler was programmed as described previ-

ously according to the primer pair used (Kong et al.,

2003a,b,c) with the exception of an initial denaturing

time of 5 min. Both standard PCR and direct colony

PCR were repeated at least three times for each

sample. Amplicons were visualized with an UV

transilluminator after resolving 5 Al of the products

in 1% agarose gels and staining with ethidium

bromide.

mber of coloniesa

tal Phytophthora nicotianae Phytophthora cinnamomi

0 15

3 0

14 0

8 0

22 0

from a diseased plant and subjected to direct colony PCR with P.

Table 2

Primer pairs used in this study for colony PCR tests

Name Sense Sequence (5V–3V) Size of amplicon (bp) Reference

LPV3a Forward GTGCAGACTGTCGATGTG 450 Kong et al., 2003c

Reverse GAACCACAACAGGCACGT

PNb Forward CCACCACGCAGCAAACTGCGGC 230 Kong et al., 2003a

Reverse TTGAGTACCAGGCCGCTCGTA

ITS-1 Forward GAAGGTGAAGTCGTAACAAGG ca. 300 Cooke et al., 2000

Reverse AGCGTTCTTCATCGATGTGC

a LPV3: P. cinnamomi-specific primer pair.b PN: P. nicotianae-specific primer pair.

P. Kong et al. / Journal of Microbiological Methods 61 (2005) 25–3228

2.4. SSCP analysis of colony PCR products amplified

with ITS-1 primers

Colony PCR products of samples amplified using

the ITS-1 primers were analyzed as previously

described (Kong et al., 2003b, 2004). Briefly, 1 Alof PCR products were mixed with 9 Al of denaturingbuffer containing 95% formamide, 20 mM EDTA and

0.05% bromophenol blue, heated at 96 8C for 10 min

and chilled on ice for 1 min. Five microliters of this

mixture was electrophoresed on an 8% non-denatur-

ing polyacrylamide minigel in pre-chilled 1� TBE

buffer at 200 V at room temperature for 2 h followed

by silver staining. The SSCP banding patterns were

determined using a single-stranded DNA ladder and

comparing with those of known species.

Fig. 1. Agarose gel (1%) electrophoresis of products of direct

colony PCR using intact mycelia from individual colonies and

standard PCR using DNA extract from the same culture. The PCR

were repeated three times. Top left and right: Amplicons of each of

four isolates of P. nicotianae by the species-specific primer pair PN

and oomycete ITS-1 primers, respectively. Bottom left and right:

Amplicons of P. cinnamomi by the species-specific primer pair

LPV3 and oomycete ITS-1 primers, respectively. M is a 100-bp

DNA ladder.

3. Results and discussion

3.1. Direct colony PCR from pure cultures on two

medium types

Colony PCR of pure culture without DNA extrac-

tion was successful and produced bands with the same

intensity as standard PCR using crude DNA for all

eight isolates (Fig. 1). The results were independent of

the type of primers and the copy number of target

DNA. Both high copy number targets from the elicitin

gene of P. nicotianae and the ITS-1 region of rDNA,

and the low copy number LPV, a storage protein gene

repeat of P. cinnamomi, were well amplified. This

indicates that colony PCR can be advantageous over

standard PCR for detection of individual pathogen

DNA targets, especially those with low copy number

in a mixed DNA sample at low concentration. Similar

intensive bands were obtained from isolates cultured

on both non-selective V8 agar and selective PARP-V8

and PARPH-V8 agar media commonly used for

isolation of pythiaceous species in field samples (data

not shown). The efficient amplification of direct

colony PCR on these media implicates a practical

application of this method for assaying environmental

samples. When handling a large number of plates/

colonies, 1–3% colony PCR failure may occur. This

can be improved by carefully harvesting mycelia or

avoiding excess agar in the reaction mixture.

Fig. 2. PCR-SSCP analysis of 47 colonies recovered from aza-

lea roots. The colonies were subjected to direct colony PCR with

ITS-1 primers, and the PCR products were denatured and electro-

phoresed in an 8% native acrylamide gel. Colonies showing the same

banding patterns were grouped and identified with known species.

The identity of each species pattern is listed on the top of each lane;

P. stands for Phytophthora and Py. stands for Pythium; L is a ssDNA

ladder. The population (%) of representative species within the total

ITS-1-amplified colonies is illustrated on top of the gel.

P. Kong et al. / Journal of Microbiological Methods 61 (2005) 25–32 29

3.2. Direct colony PCR for detection of Pythiaceae in

planta using species-specific primers

Colony PCR can be a quantitative tool for

pathogen detection that may provide more informa-

tion than standard PCR detection protocols. Direct

colony PCR was applied to detect the population level

of P. nicotianae and P. cinnamomi in container-grown

plants using species-specific primers (Table 2).

Colony PCR identified more than 95% of the isolates

recovered from leaf, stem, or roots of diseased vinca,

tobacco, and daphne as P. nicotianae. It also identified

32% and 11% of the isolates recovered from azalea

and tomato roots as P. cinnamomi and P. nicotianae,

respectively (Table 1). The results from vinca,

tobacco, and daphne plants were consistent with those

of the standard PCR assay (data not shown). However,

the low incidence results of the targeted pathogen

from azalea and tomato roots suggested involvement

of other pathogens, while the standard PCR assay

only detected P. cinnamomi (Kong et al., 2003c) or P.

nicotianae (data not shown). Use of standard PCR to

detect such samples may over- or underestimate the

contribution of the targeted pathogen and overlook

involvement of other pathogens.

Direct colony PCR for detection of Pythiaceae in

planta is relatively rapid compared with conventional

isolation and morphological examination or other

culture-dependent PCR techniques requiring subcul-

turing and DNA extraction. Generally, colony PCR

can be performed within 24 h of isolation, and a

quantitative result for disease detection and diagnosis

can be obtained in 2 days.

3.3. Direct colony PCR-SSCP for detection of

Pythiaceae in planta using ITS-1 primers

Although colony PCR with species-specific pri-

mers can be used to detect a suspected target, the

identity of other non-targeted species cannot be

determined. Yet, identification of other species

involved is important to determine the real cause of a

disease. In this study, colony PCR with oomycete-

specific ITS-1 primers (Table 2) was assembled with

SSCP analysis for identification of pythiaceous species

(Kong et al., 2003b, 2004). Colony PCR-SSCP was

used to determine the composition and population size

of organisms recovered from azalea roots where only

32% of the colonies isolated were positive for P.

cinnamomi. Colony PCR detected 36 of 47 recovered

colonies from azalea roots, indicating that 77% of

these isolates are oomycetes. The SSCP grouped these

ITS-1-positive colonies by their respective banding

patterns that were then identified into species by

comparing with known patterns (Fig. 2, bottom). Eight

groups/species including P. cinnamomi, Phytophthora

megasperma, Phytophthora citricola, Phytophthora

cryptogea, Pythium macrosporum, Pythium deliense,

and two unknown oomycetes were recovered. The

population of P. cinnamomi assessed with colony

PCR-SSCP accounted for 41.7% of ITS-1-positive

Fig. 3. Efficacy of direct colony PCR from a pine bark soil mix.

PCR products with ITS-1 primers of two representative colonies

from each of three washed and unwashed isolation plates, and the

reamplified PCR products of the colonies from unwashed plates

were electrophoresed in a 1% agarose gel.

Fig. 4. Direct colony PCR-SSCP analysis of pythiaceous species in

irrigation water. Colonies recovered from recycled irrigation pond

and run-off water in three plates on two selective media (PARP-V8

and PARPH-V8) were subjected to direct PCR amplification with

primers ITS 6/7. The PCR products were then denatured and

electrophoresed in an 8% native acrylamide gel. Colonies showing

the same banding patterns were grouped and identified with known

species. The identity of each species pattern is listed on the top of

each lane; P. stands for Phytophthora and Py. stands for Pythium; L

is a ssDNA ladder. The population (%) of each group within the tota

ITS-1-amplified colonies is illustrated on top of the gel.

P. Kong et al. / Journal of Microbiological Methods 61 (2005) 25–3230

colonies and 31.9% of the total recovered colonies,

consistent with the results obtained using species-

specific colony PCR. P. megasperma was the second

most abundant population (17.6%); Py. macrosporum

and Py. deliense, and P. citricola were the third and

fourth, respectively (Fig. 2, top). These results indicate

that there were at least four species involved in

infection of the azalea plants.

Colony PCR-SSCP with universal ITS-1 primers

can theoretically detect all oomycete species recov-

ered from environmental samples. Since the result is

based on isolated colonies, and each colony contains

only one type of PCR template, colony PCR-SSCP is

not plagued with false detection problems of standard

PCR due to bias in the presence of multiple templates

or different copy numbers of various species in a

sample. This feature makes colony PCR-SSCP supe-

rior to other methods that target multiple species.

3.4. Direct colony PCR-SSCP for detection of

pythiaceae in soil

Direct colony PCR with ITS-1 primers detected

more than 95% of the colonies recovered from a peat

moss-based mix (Metro Mix) where a diseased

daphne plant was removed, but did not detect colonies

from pine bark mix from a diseased azalea. However,

the PCR was successful when 1 Al of the initial colonyPCR products were reamplified (Fig. 3), indicating

PCR inhibition from the pine bark mix in the first

reaction. When the isolation plates were washed free

of soil particles before direct colony PCR, successful

amplification occurred, resulting in more intensive

bands than the reamplified products (Fig. 3). This

study indicates that efficacy of direct colony PCR on

soil samples is dependent on the inhibitory effect of

different soil types on the PCR reaction. These

problems can be eliminated by removal of the soil

particles from isolation plates.

SSCP analysis of ITS-1 PCR products of the

colonies from the peat moss-based mix from daphne

and the pine bark mix from azalea facilitated

investigation of pathogen survival in these mixes.

Direct colony PCR detected only a single species (P.

nicotianae and P. megasperma, respectively) com-

prising 90% of the isolates from both soil samples.

The population level of the pathogen detected from

the peat moss-based mix coincided with the level

from the removed daphne root tissue (Table 1),

indicating that P. nicotianae has colonized both the

soil and infected plant residues. In contrast, the P.

cinnamomi pathogen detected from the contained

l

P. Kong et al. / Journal of Microbiological Methods 61 (2005) 25–32 31

azalea root tissue (Table 1) was not detected in the

pine bark mix, indicating that this pathogen might

have not colonized the potting media. Similar results

were reported in a previous study, in which P.

cinnamomi was detected in root tissue but not in the

soil (Kong et al., 2003c).

3.5. Direct colony PCR-SSCP for detection of

Pythiaceae populations in recycled irrigation water

Colony PCR-SSCP can be an efficient and econom-

ical method to monitor pythiaceous species in recycled

irrigation water. Unlike potting soil samples, inhibition

was not observed for colony PCR on irrigation run-off

and recycled water samples plated. ITS-1 was success-

fully detected for 39 of 40 colonies recovered. SSCP

analysis readily identified 10 species by pattern type

and 4 unknown (Fig. 4). Three species were found in

both the pond and run-off water samples. Phytophthora

tropicalis was the most common, followed by Phy-

tophthora drechsleri and Pythium dissotocum. Four

species were found only in the pond water, and

Phytophthora citrophthora was the most common.

Seven species were found only in the run-off water and

P. citricola was the most abundant.

This study demonstrated that colony PCR and

colony PCR-SSCP are useful tools for the identifica-

tion and quantitative detection of pythiaceous species

in plant, soil, and water samples. Colony PCR-SSCP

also can be an alternative to multiplex PCR and PCR-

DGGE for analyzing the diversity and dynamics of

populations of other culturable microoganisms in the

environment. Using individual colonies, direct colony

PCR-SSCP can avoid PCR bias due to the presence of

multitemplates, varying copy numbers of target

sequences, or PCR inhibitors in DNA extracts from

environmental samples. Direct colony PCR-SSCP can

detect any number of species in a targeted group and

their population size. Multiplex PCR and PCR-DGGE

require purified DNA from a sample and can detect

only a limited number of species in a targeted group,

and determination of the population size of each

species is difficult. The number of species detected

with multiplex PCR depends on the number and

specificity of primer pairs. PCR-DGGE uses a single

pair of primers, but the number of species detected is

dependent on the separation of individual species of

the sample in a single lane of a gel. Incorrect

interpretation of results can occur due to co-migration

of DNA fragments of some species that have identical

melting behavior, the misdistribution of the bands

because of formation of chimeric or heteroduplex

molecules, or microheterogeneity in sequences

(Muyzer, 1999; Ercolini, 2004). Moreover, direct

colony PCR-SSCP identifies isolates to species with

readily visible banding patterns while PCR-DGGE

requires sequencing of each species-specific band,

which could be costly for species monitoring or

screening purposes.

Acknowledgements

We thank Professor Gary W. Moorman for

critically reading this manuscript.

References

Aufuavre-Brown, A., Tang, C.M., Holden, D.W., 1993. Detection of

gene-disruption events in Aspergillus transformants by polyme-

rase chain reaction direct from conidiospores. Curr. Genet. 24,

177–178.

Bailey, A.M., Mitchell, D.J., Manjunath, K.L., Nolasco, G., Niblett,

C.L., 2002. Identification to the species level of the plant

pathogens Phytophthora and Pythium by using unique sequen-

ces of ITS1 region of ribosomal DNA as capture probes for PCR

ELISA. FEMS Microbiol. Lett. 207, 153–158.

Briard, M., Dutertre, M., Rouxel, F., Brygoo, Y., 1995. Ribosomal

RNA sequence divergence within the Pythiaceae. Mycol. Res.

99, 1119–1127.

Cooke, D.E.L., Drebth, A., Duncan, J.M., Wagels, G., Brasier,

C.M., 2000. A molecular phylogeny of Phytophthora and

related oomycetes. Fungal Genet. Biol. 30, 17–32.

Dick, M.M., 1990. Keys to Pythium. University of Reading,

Reading, UK. 64 pp.

Ercolini, D., 2004. PCR-DGGE fingerprinting: novel strategies

for detection of microbes in food. J. Microbiol. Methods 56,

297–314.

Ersek, T., Schoelz, J.E., English, J.T., 1994. PCR amplifica-

tion of species-specific DNA sequences can distinguish

among Phytophthora species. Appl. Environ. Microbiol. 60,

2616–2621.

Erwin, D.C., Ribeiro, O.K., 1996. Phytophthora Diseases World-

wide. APS Press, St. Paul, MN.

Ferguson, A.J., Jeffers, S.N., 1999. Detecting multiple species of

Phytophthora in container mixes from ornamental crop nur-

series. Plant Dis. 83, 1129–1136.

Fode-Vaughan, K.A., Wimpee, C.F., Remsen, C.C., Collins, M.L.P.,

2001. Detection of bacteria in environmental samples by direct

PCR without DNA extraction. BioTechniques 31, 598–607.

P. Kong et al. / Journal of Microbiological Methods 61 (2005) 25–3232

Ffrster, H., Coffey, M.D., 1991. Approaches to the taxonomy of

Phytophthora using polymorphisms in mitochondrial and

nuclear DNA. In: Lucas, J.A., Shattock, R.C., Shaw, D.S.,

Cooke, L.R. (Eds.), Phytophthora. Cambridge University Press,

Cambridge, UK, pp. 164–183.

Gqssow, D., Clackson, T., 1989. Direct clone characterization from

plaques and colonies by the polymerase chain reaction. Nucleic

Acids Res. 17, 4000.

Herrick, J.B., Madsen, E.L., Batt, C.A., Ghiorse, W.C., 1993.

Polymerase chain reaction amplification of naphthalene-

catabolic and 16S rDNA gene sequences from indigenous

sediment bacteria. Appl. Environ. Microbiol. 59, 687–694.

Hiraishi, A., 1992. Direct automated sequencing of 16S rDNA

amplified by polymerase chain reaction from bacterial

culture without DNA purification. Lett. Appl. Microbiol.

15, 210–213.

Hong, C.X., Richardson, P.A., Kong, P., 2002. Comparison of filter

membranes as tools for monitoring pythiaceous species in

irrigation water. Phytopathology 92, 610–616.

Hongoh, Y., Yuzawa, H., Ohkuma, M., Kudo, T., 2003. Evaluation

of primers and PCR conditions for the analysis of 16S rRNA

genes from a natural environment. FEMS Microbiol. Lett. 221,

299–304.

Ishii, K., Fukui, M., 2001. Optimization of annealing temperature to

reduce bias caused by a primer mismatch in multitemplate PCR.

Appl. Environ. Microbiol. 67, 3753–3755.

Johnson, L.F., Curl, E.A., 1972. Methods for Research on the

Ecology of Soil-Borne Plant Pathogens. Burgess Publ.,

Minneapolis, MN. 247 pp.

Joshi, A.K., Baichwal, V., Ames, G.F.L., 1991. Rapid polymerase

chain reaction amplification using intact bacterial cells. Bio-

Techniques 10, 42–44.

Judelson, H.S., Tooley, P.W., 2000. Enhanced polymerase chain

reaction methods for detecting and quantifying Phytophthora

infestans in plants. Phytopathology 90, 1112–1119.

Kageyama, K., Ohyama, A., Hyakumachi, M., 1997. Detection of

Pythium ultimum using polymerase chain reaction with species-

specific primers. Plant Dis. 81, 1155–1160.

Kong, P., Hong, C.X., Jeffers, S.A., Richardson, P.A., 2003a. A

species-specific polymerase chain reaction assay for detection of

Phytophthora nicotianae in irrigation water. Phytopathology 93,

822–831.

Kong, P., Hong, C.X., Richardson, P.A., Gallegly, M.E., 2003b.

Single-strand-conformation polymorphism of ribosomal DNA

for species differentiation within genus Phytophthora. Fungal

Genet. Biol. 39, 238–249.

Kong, P., Hong, C.X., Richardson, P.A., 2003c. Rapid detection of

Phytophthora cinnamomi using PCR and primers derived from

Lpv putative storage protein genes. Plant Pathol. 52, 681–693.

Kong, P., Richardson, P.A., Moorman, G.W., Hong, C.X., 2004.

Single-strand conformational polymorphism analysis of the

ribosomal internal transcribed spacer 1 for rapid species

identification within the genus Pythium. FEMS Microbiol. Lett.

240, 229–236.

Levesque, C.A., Harlton, C.E., de Cock, A.W.A.M., 1998.

Identification of some oomycetes by reverse dot blot hybri-

dization. Phytopathology 88, 213–222.

Lichtensteiger, C.A., Steenbergen, S.M., Lee, R.M., Polson, D.D.,

Vimr, E.R., 1996. Direct PCR analysis for toxigenic Pasteurella

multocida. J. Clin. Microbiol. 34, 3035–3039.

Martin, F.N., 2000. Phylogenetic relationships among some

Pythium species inferred from sequence analysis of the

mitochondrially encoded cytochrome oxidase II gene. Mycolo-

gia 92, 711–727.

Matsumoto, C., Kageyama, K., Suga, H., Hyakumachi, M.,

1999. Phylogenetic relationships of Pythium species based

on ITS and 5.8S sequences of the ribosomal DNA.

Mycoscience 40, 321–331.

Muyzer, G., 1999. DGGE/TGGE a method for identifying genes

from natural ecosystems. Curr. Opin. Microbiol. 2, 317–322.

Ristaino, J.B., Madritch, M., Trout, C.L., Parra, G., 1998. PCR

amplification of ribosomal DNA for species identification in the

plant pathogen genus Phytophthora. Appl. Environ. Microbiol.

64, 948–954.

Schaad, N.W., Opgenorth, D., Gaush, P., 2002. Real time polymer-

ase chain reaction for one hour on site diagnosis of Pierce’s

disease of grape in early season asymptomatic vines. Phytopa-

thology 92, 721–728.

Sheu, D.S., Wong, Y.T., Lee, C.Y., 2000. Rapid detection of

polyhydroxyalkanoate-accumulating bacteria isolated from the

environment by colony PCR. Microbiology 146, 2019–2025.

Tooley, P.W., Bunyard, B.A., Carras, M.A., Hatziloukas, E., 1997.

Development of PCR primers from internal transcribed spacer

region 2 for detection of Phytophthora species infecting

potatoes. Appl. Environ. Micobiol. 63, 1467–1475.

Van der Plaats-Niterink, A.J., 1981. Monograph of the genus

Pythium. Stud. Mycol. Baarn 21, 1–242.

van Zeijl, C.M.J., van de Kamp, E.H.M., Punt, P.J., Selten, G.C.M.,

Hauer, B., van Gorcom, R.F.M., van de Hondel, C.A.M.J.J.,

1997. An improved colony-PCR method for filamentous fungi

for amplification of PCR-fragments of several kilobases.

J. Biotechnol. 59, 221–224.

Wang, P.H., White, J.G., 1997. Molecular characterization of

Pythium species based on RFLP analysis of the internal

transcribed spacer region of ribosomal DNA. Physiol. Mol.

Plant Pathol. 51, 129–143.

Wang, P.H., Wang, Y.T., White, J.G., 2003. Species-specific PCR

primers for Pythium developed from ribosomal ITS1 region.

Lett. Appl. Microbiol. 37, 127–132.

Wangsomboondee, T., Ristaino, J.B., 2002. Optimization of sample

size and DNA extraction methods to improve PCR detection of

different propagules of Phytophthora infestans. Plant Dis. 86,

247–253.

Waterhouse, G.M., 1963. Key to the species of Phytophthora de

Bary. Mycol. Pap. vol. 92. Commonwealth Mycological

Institute, Kew, UK.

Wilson, I.G., 1997. Inhibition and facilitation of nucleic acid

amplification. Appl. Environ. Microbiol. 63, 3741–3751.