Differential expression of miRNAs in response to salt stress in maize roots

Differential expression of miRNAs in response to salt stress in maize roots

Dong Ding1, Lifang Zhang2, Hang Wang1, Zhijie Liu1, Zuxin Zhang3 and Yonglian Zheng1,*1National Key Laboratory of Crop Genetic Improvement, Huazhong Agricultural University, Wuhan 430070, P.R. China,2Cold Spring Harbor Laboratory, Cold Spring Harbor, NY 11724, USA and 3College of Agronomy, Hebei Agricultural

University, Baoding 071001, P.R. China

Received: 24 July 2008 Returned for revision: 22 August 2008 Accepted: 15 September 2008 Published electronically: 24 October 2008

† Background and Aims Corn (Zea mays) responds to salt stress via changes in gene expression, metabolism andphysiology. This adaptation is achieved through the regulation of gene expression at the transcriptional and post-transcriptional levels. MicroRNAs (miRNAs) have been found to act as key regulating factors of post-transcriptionalgene expression. However, little is known about the role of miRNAs in plants’ responses to abiotic stresses.† Methods A custom mparafloTM microfluidic array containing release version 10.1 plant miRNA probes (http://microrna.sanger.ac.uk/) was used to discover salt stress-responsive miRNAs using the differences in miRNAexpression between the salt-tolerant maize inbred line ‘NC286’ and the salt-sensitive maize line ‘Huangzao4’.† Key Results miRNA microarray hybridization revealed that a total of 98 miRNAs, from 27 plant miRNAfamilies, had significantly altered expression after salt treatment. These miRNAs displayed different activitiesin the salt response, and miRNAs belonging to the same miRNA family showed the same behaviour.Interestingly, 18 miRNAs were found which were only expressed in the salt-tolerant maize line, and 25miRNAs that showed a delayed regulation pattern in the salt-sensitive line. A gene model was proposed thatshowed how miRNAs could regulate the abiotic stress-associated process and the gene networks coping withthe stress.† Conclusions Salt-responsive miRNAs are involved in the regulation of metabolic, morphological and physio-logical adaptations of maize seedlings at the post-transcriptional level. The miRNA genotype-specific expressionmodel might explain the distinct salt sensitivities between maize lines.

Key words: Salt stress, Zea mays, microRNA, microarray, transcription regulation, Zea mays.

INTRODUCTION

Salt stress is one of the most serious abiotic stresses of cropplants worldwide. To cope with high salt stress in theirsessile lifestyle, crop plants have evolved a considerabledegree of developmental plasticity, including adaptation viacascades of molecular networks. One of the most obvious fea-tures of the adaptation to salt tolerance are changes in geneexpression profiles for genes involved in a broad spectrum ofbiochemical, cellular and physiological processes such asenergy metabolism, signal transduction, transcription, proteinbiosynthesis and decay, membrane trafficking and photosyn-thesis (Vinocur and Altman, 2005). In addition, post-transcriptional regulation also plays a role in the plant saltresponse. Borsani et al. (2005) found that natural cis–anti-sense gene pairs initiated nat-siRNA (natural antisense smallinterfering RNA) formation, and the nat-siRNA then guidedthe cleavage of the P5CDH [D(1)-pyrroline-5-carboxylatedehydrogenase] transcript, which is a salt stress-related func-tional gene.

MicroRNAs (miRNAs) are approx. 21-nucleotide (nt) non-coding RNAs that play critical roles in gene expression regu-lation at the post-transcriptional level. In plants, cleavage ofthe target mRNA appears to be the prevalent method of post-transcriptional regulation, yet Brodersen et al. (2008) providedevidence that plant miRNA-guided silencing has a widespreadtranslational inhibitory component. Plant miRNA-guided gene

regulation has been shown to be involved in multiple develop-mental processes including organ polarity (Bowman, 2004),leaf growth (Chuck et al., 2007a), sex determination (Chucket al., 2007b) and male or female sterility (Millar andGubler, 2005). The observation that some plant miRNAsrespond to stress conditions and some miRNA targets arestress-related genes suggests that miRNAs may play importantroles in the plant stress response (Phillips et al., 2007). Severalstress-specific miRNAs have also been identified in modelplants under various biotic and abiotic stress conditions,including nutrient deficiency (Fujii et al., 2005), drought(Zhao et al., 2007), cold (Zhou et al., 2008), high salinity(Sunkar et al., 2008), bacterial infection (Navarro et al.,2006), UV-B radiation (Zhou et al., 2007) and mechanicalstress (Lu et al., 2005 ).

Microarray technology has been applied in the high-throughput detection of gene expression and it has proved auseful tool in miRNA expression assays (Liu et al., 2008). Amicroarray-based search was undertaken to discover submerg-ence stress-responsive miRNAs in maize roots (Zhang et al.,2008). High salinity is a serious abiotic stress for maize seed-lings, and miRNA-guided post-transcriptional regulation mightbe involved in the response by the salt-shocked maize seed-lings. In this study, a custom mparafloTM microfluidic array(LC Sciences, Houston, TX) containing release version10.1 plant miRNA probes (http://microrna.sanger.ac.uk/;Griffiths-Jones et al., 2008) was used to discover differentiallyexpressed miRNAs between two maize inbred lines with* For correspondence. E-mail [email protected]

# The Author 2008. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved.

For Permissions, please email: [email protected]

Annals of Botany 103: 29–38, 2009

doi:10.1093/aob/mcn205, available online at www.aob.oxfordjournals.org

by guest on January 11, 2015http://aob.oxfordjournals.org/

Dow

nloaded from

http://aob.oxfordjournals.org/

distinct salt sensitivities. The results indicated that only a min-ority of the differentially expressed miRNAs were uniformlyregulated between the two maize lines; the vast majority ofthe differentially expressed miRNAs show a genotype-specificexpression model. These miRNAs potentially play vital rolesin the morphological and metabolic adaptation response insalt-shocked root cells of maize, and the genotype-specificexpression model may explain the distinct salt sensitivitiesbetween the two maize lines.

MATERIALS AND METHODS

Plant treatment and RNA isolation

Seeds of ‘NC286’ (a salt-tolerant maize, Zea mays, inbredline) and ‘Huangzao4’ (a salt-sensitive maize line) were usedin this study. For each inbred line, 60 uniform seeds weresurface-sterilized in 70 % (v/v) ethanol for 15 min, and thenrinsed several times with sterile distilled water. The seedswere sown in sterile sand irrigated with sterile distilledwater. The seeds were allowed to germinate in the incubatorwith a 16 h photoperiod at an optimal temperature regime of24/21 8C (light/dark). Uniform seedlings with two leaveswere transferred into 1� Hoagland’s nutrient solution (sup-plied with 4 mL L21 Fe-sequestrene, 6 mM Kþ and 4 mM

Ca2þ) and grown hydroponically with aeration. When theseedlings developed three leaves, they were transferred intoeither a nutrient solution containing 200 mM NaCl for saltstress treatment or the nutrient solution without NaCl, as acontrol. Plants were treated at 08 00 h, and roots of tenplants were harvested at 0.5, 5 and 24 h after salt stress; theroots of untreated control were also harvested at the corre-sponding time points. The collected roots were immediatelyfrozen in liquid nitrogen and ground into a fine powder. Thetotal RNA from each sample was extracted with Trizolreagent (Invitrogen, Carlsbad, CA).

miRNA microarray assay

miRNA microarray assays were performed by LC Sciences.The custom mparafloTM microfluidic chip contained 653unique plant miRNAs of release version 10.1, representing877 miRNAs from 17 plant species (http://microrna.sanger.ac.uk/; Griffiths-Jones et al., 2008). Each chip contained fiverepetitions of each probe. The 877 miRNAs comprised 154from Arabidopsis thaliana, 115 from Oryza sativa, 187 fromPhyscomitrella patens, 100 from Populus trichocarpa, 43from Zea mays and 278 from 12 other plant species. For micro-array quality control, four controls were used. Maize 5S rRNAserved as the inner positive control; and PUC2-20B, an artifi-cial non-homologous nucleic acid, was used as an externalpositive control. The perfect match and single-base mismatchcounterparts to the external positive control, namedPUC2PM-20B and PUC2MM-20B, were spiked into theRNA samples before probe labelling. Blank and non-homologous nucleic acids were used as negative controls.Approximately 5 mg of total RNA was used as the startingmaterial for each assay. RNAs were size-fractionated using aYM-100 Microcon centrifugal filter (Millipore, Bedford,MA), and the small RNAs (,300 nucleotides) were isolated

and 30-extended with a poly(A) tail using poly(A) polymerase.An oligonucleotide tag was ligated to the poly(A) tail for laterfluorescent dye staining; two different tags were used for thetwo RNA samples in the dual-sample experiments. Briefly,purified small RNAs were labelled with Cy3 and Cy5 fluor-escent dyes (salt shocked and its corresponding control,respectively) and then hybridized with the dual-channel micro-array. Hybridization was performed overnight in 6� SSPEbuffer (0.90 M NaCl, 60 mM Na2HPO4, 6 mM EDTA, pH6.8) containing 25 % formamide at 34 8C. Chip hybridizationexperiments were carried out in triplicate initiated from differ-ent biological samples. Hybridization images were collectedusing a laser scanner (GenePix 4000B, Molecular Devices,Sunnyvale, CA) and digitized using Array-Pro image analysissoftware (Media Cybernetics, Silver Spring, MD). Data wereanalysed by first subtracting the background and then normal-izing the signals using a LOWESS filter (locally weightedregression). The ratio of the two sets of detected signals (log2-transformed, balanced) and P-values of the t-test were calcu-lated; differentially detected signals were those withP-values ,0.01.

miRNA promoter cis-acting element analysis and targetprediction

miRNAs are derived from longer primary transcripts(pri-miRNAs) that are processed into smaller stem–loopmiRNA precursors (pre-miRNAs). Pre-miRNAs are then pro-cessed to yield mature miRNAs by an RNase named DICER(Xie et al., 2005). The mature miRNAs are conservedamong plant species, but with regard to pre-miRNAs the con-servation is due to the stem–loop structure, rather than thesequences (Bonnet et al., 2004). This indicates that the exactmatches between pre-miRNAs and the genomic sequencesshould be helpful in searching the miRNA genes. miRNAswere proved to be transcribed in eukaryotes by RNA polymer-ase (Lee et al., 2004), and the TSS (transcription start site)may be as little as 50 nt and as much as 2.5 kb upstream ofthe pre-miRNA sequences in the transcript (Bracht et al.,2004; Megraw et al., 2006). To discover maize salt stress-responsive miRNA genes, each pre-miRNA sequence down-loaded from http://microrna.sanger.ac.uk/ was aligned to themaize genome sequence (http://www.maizesequence.org).About 2500 bp of upstream sequences of the pre-miRNAswere checked by PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/; Lescot et al., 2002), the 275CAAT-box and 230 TATA-box were recognized as the mile-stones to confirm the TSS. The 1500 bp DNA sequenceupstream of the TSS was truncated to identify cis-actingmotifs via PlantCARE. To validate the precision of the TSSprediction and promoter analysis, 50 RACE (rapid amplifica-tion of cDNA ends) was undertaken to obtain the TSS, andprimers of the upstream sequences were then designed toamplify the promoter regions of the miRNA genes. About1000 bp of DNA sequence upstream of the TSS of eachmiRNA gene was amplified and sequenced to validate the pre-diction of the promoter sequences. The SupplementaryInformation (Table S1C, available online) shows the primersfor five miRNA gene promoters.

Ding et al. — Maize salt-stress-responsive microRNAs30


Dow

nloaded from


In plants, miRNAs recognize their target mRNAs by perfector near-perfect base pairing. Computational sequence simi-larity algorithms were developed to identify potentialmiRNA targets. For the prediction of plant miRNA targetmRNAs, a web-based computing system, miRU (Zhanget al., 2005), was queried by mature miRNA sequences. Allpotential sequences complementary to the query with limitedmismatches were selected. The number of mismatches waslimited to no more than 3 nt, indels were no more than 1 nt,and fewer than five G–U pairs were allowed. The predictedtarget expressed sequence tags (ESTs) were aligned andsearched by BLAST for functional annotation.

Validation of the mature miRNA expression profile via stem–loopRT-PCR

The expression profiles of seven salt-responsive maturemiRNAs were assayed by stem–loop reversetranscription-PCR (RT–PCR). A 200 ng aliquot of totalRNA was used for the initiation of the reverse transcriptionreaction. The stem–loop reverse transcription primers weredesigned following the method described by Chen et al.(2005) and Varkonyi-Gasic et al. (2007). Briefly, 6 nt tipspairing with the mature miRNA 30 end were linked to a self-looped sequence (GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGAC) to make up the stem–loop RT-PCR primers; the primers bind to the 30 portion of miRNAmolecules, initiating reverse transcription of the maturemiRNA. The reverse transcription product is amplified usinga miRNA-specific forward primer and a universal reverseprimer. The stem–loop reverse transcription reactions wereperformed by MMLV reverse transcriptase (Toyobo, Osaka,Japan) according to the supplier’s manual. PCR primerswere then added to perform the PCR. One of the uniformlyexpressed miRNAs, miR172, was used as the inner controlfor stem–loop RT-PCR. Supplementary Table S1A showsthe sequences of stem–loop RT primers and miRNA-specificPCR primers.

Validation of the miRNA target gene expressionprofiles by RT-PCR

The expression profiles of the predicted target genes wereassayed by RT-PCR. A 10 mg aliquot of total RNA wasused for initiating the reverse transcription reaction. Theoligo(dT) primer was added and incubated with the totalRNA. The reverse transcription reaction was performed byMMLV reverse transcriptase (Toyobo, Osaka, Japan) accord-ing to the supplier’s manual. The target gene primers werethen added to perform the PCR. A maize housekeepinggene, g-tubulin, was used as the inner control for RT-PCR.Supplementary Table S1B shows the primer sequences ofthe target genes and the g-tubulin gene.

RESULTS

Salt-stress-responsive miRNAs in maize roots

The microarray data showed that the expression profiles ofmany miRNAs changed in response to salt stress in maize

roots. These miRNAs were identified from diverse familiesof plant miRNAs. Mature miRNAs are conserved amongplant species; members of the same miRNA families differfrom each other by only 1–3 nt, or they are identical. Thedifferences exist in the pre-miRNA sequences. Thus, cross-hybridization might have occurred in the microarray betweenmembers of the same miRNA family, or between homologoussequences across species. To refine the differentially expressedmiRNAs, miRNA families where many members showedchanged expression profiles, especially whose membersshowed similar expression profiles, were considered as saltstress-responsive miRNA families. miRNAs with similarexpression profiles reflected the expression of the familycounterparts in maize. A total of 98 miRNAs, about 15 %(98/653) of the probes on the microarray, were identified asputative salt-responsive miRNAs at the 1 % significancelevel (Table 1). A total of 77 out of the 98 miRNAs alignedwith 55 members of ten maize miRNA families, while theother miRNAs corresponded to several members of miRNAfamilies from another six plant species, includingosa-miR528/529, ath-miR395/398/827/854, ptc-miR474,ppt-miR395/477/529/535/894/896/903/1026, tae-miR1125and smo-miR1082. The results shown in Fig. 1 indicate that,during the salt stress process, the differentially expressedmiRNAs were transcriptionally regulated at different timepoints in the two maize lines. By stem–loop RT-PCR, theexpression profiles of seven salt-responsive miRNAs were gen-erated in the two maize inbred lines (Fig. 2B). The results areconsistent with the microarray data (Fig. 2A).

Different expression profiles of salt-stress-responsive miRNAsbetween inbred lines

At three time points during the salt shock, miRNAs showeddifferent expression profiles within the two inbred lines(Fig. 1). There are both congruously and differently regulatedmiRNAs, and inbred line-specific miRNAs were also detected.The differentially expressed miRNAs were classified into fourgroups using their expression profiles between the two maizeinbred lines as a basis. Only six miRNAs (from three miRNAfamilies, ptc-miR474, ath-miR395 and osa-miR528) weredetected to be uniformly regulated at all three time points inthe two maize inbred lines. The vast majority of the differen-tially expressed miRNAs showed different expression patternseither among the three time points, or between the two maizelines. miRNAs from eight families showed the same expressiontrends, yet were regulated at different time points, most of whichexhibited a delayed expression pattern in the salt-sensitivemaize line ‘Huangzao4’. Nine miRNA families have differentexpression trends during the salt stress period between the twolines. There exists another group of salt stress-responsivemiRNAs from ten families, which could only be detected inthe salt-tolerant maize line ‘NC286’. The results stronglysuggested that the different miRNA regulation patterns mightcontribute to and partly explain the distinct salt sensitivitiesbetween the two maize lines.

Potential target genes of salt-stress-responsive miRNAs

miRNAs regulate gene expression by a perfect or near-perfect binding with their target mRNAs and in turn guide

Ding et al. — Maize salt-stress-responsive microRNAs 31


Dow

nloaded from


cleavage of the target transcripts or translational repression(Sunkar et al., 2007). This facilitates the prediction of plantmiRNA targets via programmed algorithms of homologyquery, e.g. miRU. A total of 32 potential target genes wereidentified by miRU (Table 2). These genes are involved in abroad spectrum of cellular, metabolic, physiological and

developmental processes, including energy metabolism,signal transduction, transcriptional regulation and celldefence. The expression profiles of seven of the target geneswere validated by RT-PCR, and show a negative correlationwith their corresponding zma-miRNAs (Fig. 2C). Using thefunctional annotations of the predicted target genes, theycould be classified into four categories. Similarly to previouslyreported data in model plants, many miRNAs detected in themaize salt stress response directly targeted transcriptionfactors (TFs) involved in plant development and organ for-mation. The TFs Myb, NAC1 and homeodomain-leucinezipper protein (HD-ZIP) were predicted as the targets ofzma-miR159a/b, zma-miR164a/b/c/d and zma-miR166l/m,respectively. The results were consistent with those reportedin arabidopsis and rice (Jones-Rhoades and Bartel, 2004).Other TFs predicted as the miRNA targets, such asMADS-box proteins and zinc-finger proteins, have beenreported as salt stress-responsive factors in plants (Fanget al., 2006; Xu et al., 2008). Several targets of themiRNAs, including auxin response factor 8,ethylene-responsive element-binding factor and GAMyb, areinvolved in phytohormone signal cascades. In addition,several targets of miRNAs encode proteins that play roles indiverse metabolic pathways or are involved in various physio-logical processes. Many of the predicted targets, such asNADP-dependent malic enzyme (NADP-ME) and cytochromeoxidase, were previously reported as salt stress-responsivefunctional genes in plant cells (Yan et al., 2005; Cheng andLong, 2007). Interestingly, an ARGONAUTE1 (AGO1)mRNA and a DCL1 gene, which encode key factors involvedin miRNA processing, were predicted as the targets ofzma-miR168a/b and zma-miR162, respectively. This resultindicated that feedback regulation might play a role inmiRNA activity under salt-stressed conditions in maize.

Key cis-acting elements within the promoter regions of miRNAgenes

All of the promoter regions of 60 maize counterpart saltstress-responsive miRNA genes were queried by PlantCARE.Five of the miRNA genes promoters were further validatedby 50 RACE and PCR amplification. The SupplementaryInformation (Figure S1, available online) shows the sequencesof the five promoters. The experimental results showed aperfect consistency with the prediction. Stress-responsive cis-motifs were found in the 50-upstream area (1.5 kb predictedpromoter regions) of these miRNA genes (SupplementaryInformation, Table S2). The cis-elements include ABRE(ABA-responsive element), MBS (MYB binding site), TCA(salicylic acid-responsive element), HSE (heat shock-responsive element), LTR (low temperature-responsiveelement), GC-motif, ARE (anaerobic-response element) andGARE (gibberellin-responsive element). Each of the saltstress-responsive miRNAs has more than one stress-responsivecis-acting element in their promoter regions, indicating that

TABLE 1. Salt-stress-responsive miRNA families and members

miR familyMembers of identified

miRNAs miR family members

zma-miR156 ath-miR156a/g/h zma-miR156a/b/c/d/e/f/g/h/ibna-miR156aosa-miR156lptc-mir156 ksmo-miR156c zma-miR156 ksbi-miR156evvi-miR156e

zma-miR159 ath-miR159a/b/c zma-miR159a,zma-miR159b

osa-miR159a/c/d/e/fpta-miR159a/bptc-miR159d/f zma-miR159c/dsmo-miR159sof-miR159e

zma-miR160 ppt-miR160b zma-miR160a/bzma-miR162 ath-miR162a zma-miR162zma-miR164 ath-miR164a/c zma-miR164a/b/c/d

osa-miR164c/d/eptc-miR164fsbi-miR164c

zma-miR166 ath-miR166a zma-miR166aosa-miR166e/k/m zma-miR166b/c/d/e/f/g/h/ippt-miR166jptc-miR166n/p zma-miR166l/msbi-miR166a zma166j/kvvi-miR166b/d

zma-miR167 ath-miR167a/c/d zma-miR167a/b/c/dbna-miR167appt-miR167 zma-miR167e/f/g/h/iptc-miR167e/f/hvvi-miR167c

zma-miR168 ath-miR168a zma-miR168a/bosa-miR168a/bsof-miR168b

zma-miR171 ath-miR171a zma-miR171cosa-miR171 g zma-miR171d/e/i/jptc-miR171c/e zma-miR171 g

smo-miR171azma-miR171c

zma-miR319 ath-miR319a/c zma-miR319a/b/c/dgma-miR319a/cosa-miR319appt-miR319apta-miR319ptc-miR319evvi-miR319b

zma-miR395 ath-miR395b zma-miR395a/b/cppt-miR395

zma-miR396 osa-miR396d zma-miR396a/bzma-miR399 ptc-miR399f/i zma-miR399a/c

FI G. 1. Clustering of differently expressed miRNA members under salt stress at three time points in two maize inbred lines. (A) Significantly detected miRNAsin the salt-sensitive maize line ‘Huangzao4’; (B) significantly detected miRNAs in the salt-tolerant maize line ‘NC286’. The three time points are shown at the

top, and salt-responsive miRNAs are listed on the right. Green indicates salt-repressed, whereas red indicates salt-induced miRNAs.



Dow

nloaded from


0·00·5 h Treat/CK 5 h Treat/CK 24 h Treat/CK

ppt–miR1026a

A

ptc–miR474aptc–miR474cptc–miR474bppt–miR1026aath–miR854asmo–miR1082appt–miR395ath–miR395bppt–miR903tae–miR1125ppt–miR160bptc–miR399iath–miR164aosa–miR164dath–miR164cosa–miR164cptc–miR164fsbi–miR164cosa–miR164eath–miR398aath–miR398bppt–miR477a–3pppt–miR529appt–miR529eosa–miR528ppt–miR894osa–miR529bppt–miR529gppt–miR535asmo–miR171aosa–miR168bath–miR827ptc–miR398bppt–miR896ath–miR157aptc–miR156kath–miR162azma–miR162ptc–miR166psof–miR168bosa–miR168aath–miR168agma–miR319cosa–miR171gosa–miR159aath–miR159aosa–miR159fath–miR159bosa–miR159cosa–miR159eosa–miR159dath–miR159cptc–miR159dsof–miR159eath–miR319cptc–miR319epta–miR159appt–miR319avvi–miR319bptc–miR167eptc–miR167hath–miR167dath–miR167aptc–miR167fppt–miR167osa–miR1561ath–miR156hsmo–miR156cath–miR167cvvi–miR167cbna–miR167asbi–miR156eath–miR156aath–miR156gbna–miR156aptc–miR171cosa–miR396dosa–miR166eosa–miR166kppt–miR166jath–miR166aosa–miR166mvvi–miR166bvvi–miR166dsbi–miR166aptc–miR166nzma–miR171cptc–miR171ezma–miR171f

ath–miR395bath–miR854appt–miR896osa–miR319atae–miR1125ppt–miR395osa–miR528ath–miR167dath–miR171avvi–miR166dptc–miR171eath–miR164aath–miR164cosa–miR164dosa–miR164eptc–miR164fpta–miR159aath–miR319cptc–miR319eppt–miR319agma–miR319aath–miR159aosa–miR159aosa–miR159eosa–miR159dath–miR168aosa–miR168asof–miR168bosa–miR168bptc–miR159fpta–miR319pta–miR159bsof–miR159esmo–miR159osa–miR396dath–miR319aosa–miR166kptc–miR474cptc–miR474aptc–miR474bosa–miR529bppt–miR529dppt–miR529eppt–miR529appt–miR894vvi–miR535appt–miR535a

0·9695 1·329

0·00·5 h Treat/CK 5 h Treat/CK 24 h Treat/CK

0·889 1·505



Dow

nloaded from


miR156

0·0

0·2

0·4

0·6

0·8

1·0

1·2A

Rel

ativ

e ex

pres

sion

leve

l (tr

eate

d/co

ntro

l)miR162

0·0

0·5

1·0

1·5

2·0

2·5

Rel

ativ

e ex

pres

sion

leve

l (tr

eate

d/co

ntro

l)

miR164

0·0

0·5

1·0

1·5

2·0

2·5

Rel

ativ

e ex

pres

sion

leve

l (tr

eate

d/co

ntro

l)

miR167

0·00·20·40·60·81·01·21·4

Rel

ativ

e ex

pres

sion

leve

l (tr

eate

d/co

ntro

l)

miR168

0·0

0·2

0·4

0·6

0·8

1·0

1·2

1·4

Rel

ativ

e ex

pres

sion

leve

l (tr

eate

d/co

ntro

l)

miR395

0·01·02·03·04·05·06·07·08·0

Rel

ativ

e ex

pres

sion

leve

l (tr

eate

d/co

ntro

l)

miR396

0·00·20·40·60·81·01·21·41·61·8

0·5 5 24Time course (h)

Rel

ativ

e ex

pres

sion

leve

l (tr

eate

d/co

ntro

l)

‘NC286’ ‘Huangzao4’

microRNA profiles in ‘Huangzao4’

miR156

miR162

miR164

miR167

miR168

miR395

miR396

miR172

microRNA profiles in ‘NC286’

miR156

miR162

miR164

miR167

miR168

miR395

miR396

miR172

microRNA targets in ‘Huangzao4’

SBP domain-protein

RNAseIII CAF protein

NAC

ARF8

AGO1

ATP sulfurylase

Cytochrome oxidase

gamma-tubulin

microRNA targets in ‘NC286’

SBP domain-protein

RNAseIII CAF protein

NAC

ARF8

AGO1

ATP sulfurylase

Cytochrome oxidase

gamma-tubulin

0·5h CK 0·5h T 5h CK 5h T 24h CK 24h T

0·5h CK 0·5h T 5h CK 5h T 24h CK 24h T

B

C



Dow

nloaded from


these miRNAs are involved in regulation of cascades ofvarious biotic and abiotic responses. As shown inSupplementary Table S2, the three most frequently appearingcis-acting motifs of the salt stress-responsive miRNA genesare MBS, ARE and ABRE. In addition, the miRNAmembers in the same miRNA family often share the samecis-acting motifs in their promoter regions, suggesting thatthe miRNA members of the same miRNA family mayrespond to the same biotic, abiotic or phytohormone stimuli.

DISCUSSION

Specifically and non-specifically regulated miRNAs responding tosalt stress

Some miRNAs have been shown to be stress regulated andcould be involved in cell responses to abiotic stresses such

as salinity, cold and dehydration (Zhao et al., 2007; Sunkaret al., 2008; Zhou et al., 2008). Some miRNA target genesare stress-responsive TFs or functional genes (Yan et al.,2005; Fang et al., 2006; Cheng and Long, 2007; Prashanthet al., 2008; Xu, 2008), indicating that miRNA-dependentpost-transcriptional regulation may play a role in the plantstress response. Stress response-specific miRNAs wereobserved in previous studies. The miRNA ath-miR319c wasspecifically upregulated by cold but not by ABA, dehydrationor salt shock (Sunkar and Zhu, 2004). The miRNAosa-miR169 g was confirmed as the only miRNA induced bydrought in rice (Zhao et al., 2007). Genotypic specificity isalso evident, since different genotypes express the samemiRNA in the same tissues, but at different levels (Micaet al., 2006). Sunkar et al. (2007) reviewed the plant smallRNAs responsive to abiotic stresses and nutrient deprivationand speculated that small RNAs that are positively regulatedby stress might target negative regulators of stress tolerancefor enhanced suppression; in contrast, small RNAs that aresuppressed during stress are likely to target positive regulatorsof stress tolerance, resulting in the accumulation of gene pro-ducts. In the present research, salt-responsive miRNAs weredetected in two maize inbred lines that have distinct salt sen-sitivities. There are uniformly regulated miRNAs, yet amajority of the responding miRNAs were differentially regu-lated between the two maize lines (92/98). The differentiallyregulated miRNAs were either detected only in one inbredline or had distinct expression trends. The similarly regulatedmiRNAs may represent the fundamental mechanism of adapt-ing to salt shock, and the differentially regulated miRNAsmight explain the distinct salt sensitivities between the twomaize inbred lines. Members of the miR474 and miR395families were found to be similarly regulated between thetwo maize lines; they were both upregulated, indicating thatthey might target negative regulators of salt tolerance, result-ing in enhanced suppression of these factors. Members ofthe miR396 family were found to be downregulated in bothlines, yet at different time points. This result indicated thataccumulation of different levels of positive regulators duringthe stress process might result in different salt sensitivitiesamong maize inbred lines. Under salt stress conditions,global gene expression profiles were changed, resulting inmetabolic and physiological alterations. The differentialexpression of the miRNAs within the two maize inbred linesshowed that there were both non-specific and specificresponses of miRNAs under salt shock in maize root cells.

Non-specific cascades controlled by miRNAs

miRNAs are known to silence genes post-transcriptionallyby guiding target mRNAs for degradation or by repressingtranslation (Sunkar et al. 2007). NADP-ME is a key enzymethat catalyses the oxidative decarboxylation of L-malate toyield pyruvate, CO2 and NADPH in the presence of a divalentcation (Cheng and Long, 2007). In plants, NADP-ME

TABLE 2. Predicted target genes and their protein annotation

MiR IDAccession no. ofmiRNA targets Protein annotation

zma-miR156a/b/c/d/e/f/g/h/i

No hit –

zma-miR156j TC252322 SBP-domain protein 6TC270942 P-type R2R3 Myb proteinTC271657 Zinc finger protein-like

zma-miR156 k No hit –zma-miR159a/b/c/d TC274797 MADS box interactor

TC250597 ZAG1TC270317 Protein phosphatase PP2A-3TC260832 Transcription factor GAMyb

zma-miR160a/b/c/d TC248728 40S ribosomal protein S16TC254064 Two-component response

regulator ARR11zma-miR162 TC255650 Endoribonuclease Dicer

TC265329 Cytochrome P450zma-miR164a/b/c/d TC258020 NAC domain protein NAC1zma-miR166a/j/k/l/m

TC271068 HD-ZIP rolled leaf1

zma-miR166b/c/d/e/f/g/h/i

NP939611 Homeodomain-leucine zipperprotein

zma-miR167a/b/c/d/e/f/g/h/i

TC268965 Auxin response factor 8

zma-miR168a/b TC274908 PZE40 proteinTC248481 Cytoplasmic aldolaseTC265929 AGO1-1CA758338 A winged helix TF MFH-1

zma-miR171d/e/i/j TC257183 Sprouty homologue 2 (Spry-2)TC264725 Scl1 protein

zma-miR171 g TC270818 GPI-anchored proteinzma-miR319a/b/c/d TC260832 Transcription factor GAMyb

TC250597 ZAG1 proteinTC269978 Deoxycytidine deaminase

zma-miR395a/b/c TC260342 ATP sulfurylaseTC276738 L-Isoaspartyl methyltransferaseTC252974 Beta-D-xylosidaseTC260238 NADP-dependent malic protein

zma-miR396a/b TC255359 Cytochrome oxidase subunit Izma-miR399a/c TC256314 HASTY

TC259578 Granule-bound starch synthase

FI G. 2. Expression profiles of seven maize salt-responsive miRNAs and their corresponding target genes detected by microarray, stem–loop RT-PCR andRT-PCR assay. (A) The expression of four responsive miRNAs in the roots of two maize lines at three time points by microarray assay. (B) The stem–loopRT-PCR results of the miRNAs. (C) The RT-PCR results of the miRNA target genes. CK indicates the untreated control and T indicates salt-treated samples.



Dow

nloaded from


functions in many different pathways. Malate can be decar-boxylated in the mitochondrial matrix through the action ofNAD-ME to produce pyruvate, which is oxidized by the tricar-boxylic acid cycle. These two enzymes are predicted to be thetarget genes of miR395 and miR474, respectively. These twomiRNA families were found to be upregulated in both salt-shocked maize lines, indicating a salt-induced non-specificresponding pathway, perhaps involved in maintenance ofenergy supply. An osa-miR528-like miRNA was also uni-formly regulated in the two maize lines. It is widely acceptedthat under salt stress conditions, reactive oxygen species(ROS) such as superoxide radicals, hydroxyl radicals andhydrogen peroxide (H2O2) are produced in excess. ROS aremostly scavenged by superoxide dismutase (SOD; Banuet al., 2008). Cu/Zn SOD, a predicted target gene of miR528in maize, was reported to be upregulated in salt-stressed riceleaves (D. W. Kim et al., 2007). Thus, the scavenging ofROS may be another salt stress strategy conserved amongmaize inbred lines.

miRNA affect salt sensitivities of maize lines

AGO1 encodes the RNA slicer enzyme of the miRNApathway and is regulated by miR168-programmed,AGO1-catalysed mRNA cleavage. It is the only member ofthe arabidopsis ARGONAUTE family involved in themiRNA-directed mRNA cleavage processes. Transcriptionalco-regulation of miR168 and AGO1 genes and post-transcriptional stabilization of miR168 by AGO1 are requiredfor AGO1 homeostasis. The co-adjustment of miR168 andAGO1 indicated negative feedback regulation in the miRNApathway (Vaucheret et al., 2006). miR168 was found to be asalt stress-responsive miRNA; the members of thezma-miR168 family were induced in the salt-tolerant maizeinbred line ‘NC286’ and repressed in the salt-sensitive line‘Huangzao4’ at the 0.5 h time point. Correspondingly,AGO1 mRNA was suppressed in ‘NC286’ and accumulatedin ‘Huangzao4’. Since AGO1 is a key miRNA pathway regu-lator, the difference in AGO1 mRNA expression at the earlyphase under salt shock may induce further changes of numer-ous miRNA activities. In general, during the early periodunder salt shock, miRNA function was enhanced in‘Huangzao4’ and reduced in ‘NC286’. The watershed for thesalt stress response in plants is 24 h; after this time point theexpression profiles of various mRNAs may change. miR168was detected to be downregulated in both lines at 24 h, result-ing in AGO1 mRNA accumulation and enhanced miRNAfunctions. This might explain why there are so manychanges in expression of mRNAs after 24 h of salt stress.

It has been reported that many miRNA target genes weremRNAs of TFs, indicating an upstream regulation ofmiRNAs during the development processes and environmentalresponse. Some miRNAs, including miR166, miR159,miR156 and miR319, showed altered expression profiles inat least one salt-shocked maize line. They were shown to regu-late the levels of TF transcripts, which in turn affected thelevels of TF proteins. The maize Rolled leaf 1 (rld1) gene isa homologue of the arabidopsis HD-ZIP gene. In maize,miR166 was found to cleave rld1 mRNA and alter leaf polarity(Juarez et al., 2004). The ath-miR166-mediated cleavage of

HD-ZIP was found to regulate the pattern of vasculature andthe establishment and maintenance of abaxial–adaxial polarityin lateral organs (Williams et al., 2005). Other than their invol-vement in leaf polarity regulation, the HD-ZIP familymembers were also reported to be induced by various stressconditions, including drought and phytohormones (Agalouet al., 2008; Dai et al., 2008). Shin et al. (2004) reportedthat Athb-12, a HD-ZIP from arabidopsis, could suppress theNaþ-sensitive phenotype. Expression of Athb-12 dramaticallyenhanced NaCl tolerance. Athb-12 can regulate the expressionof NaCl-inducible PMR2A, which encodes a plasma mem-brane Naþ-ATPase involved in Naþ transport.Downregulation of miR166 in the salt-tolerant maize line‘NC286’ after 5 h of salt shock indicated that an HD-ZIP,perhaps rld1, was involved in maize salt tolerance. The down-regulation of miR166 in the salt-tolerant maize line and theupregulation of the target HD-ZIP transcripts might enhancethe salt tolerance. The TCP domain is a plant-specificDNA-binding domain found in proteins from a diverse arrayof species. TCP TFs direct the developmental process ofplant leaf size and form, and flower symmetry (Busov et al.,2008). The mRNA of the TCP TFs were targets of miR319,which was downregulated in the salt-tolerant maize line‘NC286’ after 5 h and in the salt-sensitive maize line‘Huangzao4’ after 24 h of salt shock. The downregulation ofmiR166 and miR319 after a period of salt shock in themaize inbred lines indicated an induction of their target TFtranscripts and resulted in enhanced salt tolerance. Theunique regulation of the miRNAs and their target TF tran-scripts might explain the different salt sensitivities betweenthe two maize lines.

The regulation of miR166 and miR319 after 5 and 24 h ofsalt shock suggested that, although the miR-TF model isinvolved in the salt stress response, the salt response actionswere not initiated by regulation of the TFs. At the 0.5 h timepoint, miR167 and miR164 were found to be downregulatedin ‘NC286’, hinting that these miRNAs might be involved inthe initiation of receipt of the salt stress signal. ARF8, anauxin-responsive factor gene, was predicted as the target ofzma-miR167. Auxin response is regulated by various positiveand negative feedback mechanisms as well as environmentalsignals. ARFs regulate the transcription of early auxin-responsive genes, including the AUX/IAA genes (Ulmasovet al., 1997), whereas AUX/IAA proteins interact with ARFsand repress their activities (Tiwari et al., 2003). Auxininduces targeted ubiquitinylation/degradation of specificAUX/IAA proteins (Gray et al., 2001) and frees ARFs fromrepression by AUX/IAA proteins. The accumulation of ARFtranscripts resulting from the downregulation of miR167might enhance the auxin response and thus enhance shootand leaf development. NAC-domain proteins, named from aconserved domain originally associated with the NO APICALMERISTEM (NAM) phenotype, were reported to be saltinduced in many species (Hu et al., 2006; S. G. Kim et al.,2007). NAC-domain proteins are unique to plants, and theirtranscripts are the predicted targets of zma-miR164. Xieet al. (2000) reported that in arabidopsis, 35S::NAC1-overexpressing lines were bigger, with larger leaves, thickerstems and more abundant roots than the wild type. Theythought that NAC1 might be an early auxin-responsive gene,



Dow

nloaded from


and confirmed that NAC1 was located downstream of TIR1and upstream of AIR3 and DBP in transmitting the auxinsignal to the AIR3 gene to promote lateral root development.TIR1 is likely to regulate NAC1 at the transcriptional level,perhaps through auxin-dependent degradation of a negativeregulator of NAC1. The placement of lateral roots is not pre-determined but it is strongly influenced by endogenous auxinlevels and exogenous environmental conditions. It wasobserved in this study that the lateral roots flourished morein ‘NC286’ than in ‘Huangzao4’; this might have resultedfrom the early accumulation of auxin-responsive factors. Atthe early stage of salt stress, the salt-tolerant maize linesmight change their morphological characteristics to enhanceroot and shoot development, thus accumulating morebiomass to counteract the wastage brought on by salt shock.

Here a model has been proposed for the molecular mechan-isms of the response of maize root cells to salt shock using thechanged expression profiles of miRNA and subsequent targettranscripts as a basis. The responsive miRNAs show a transi-tory expression model. Figure 3 shows the proposed regulationcascades after 0.5 h salt shock in ‘NC286’ root cells. Thisstudy indicates that the salt-responsive miRNAs are involvedat post-transcriptional levels in the regulation of the metabolic,physiological and morphological processes of maize seedlingsunder salt-shocked conditions.

SUPPLEMENTARY INFORMATION

Supplementary information is available online at www.aob.oxfordjournals.org/ and consists of the following. TableS1(A), the stem–loop reverse transcription and PCR primersequences; Table S1(B), the accessions of target genes andprimers for RT-PCR; Table S1(C), PCR primers for miRNA

promoter amplification. Table S2, stress-responsive keycis-elements found in zma-miRNA promoters. Figure S1,five of the maize miRNA promoter sequences obtained byPCR amplification and sequencing.

ACKNOWLEDGEMENTS

This work was supported by the Hi-Tech Research andDevelopment Program of China (2006AA100103); the StateKey Basic Research and Development Plan of China(2006CB101700); and the 111 Project (B07041).

LITERATURE CITED

Agalou A, Purwantomo S, Overnas E, et al. 2008. A genome-wide survey ofHD-Zip genes in rice and analysis of drought-responsive family members.Plant Molecular Biology 66: 87–103.

Banu MN, Hoque MA, Watanabe-Sugimoto M, et al. 2008. Proline and gly-cinebetaine induce antioxidant defense gene expression and suppress celldeath in cultured tobacco cells under salt stress. Journal of PlantPhysiology Epub ahead of print.

Bonnet E, Wuyts J, Rouze P, Van de Peer Y. 2004. Detection of 91 potentialconserved plant microRNAs in Arabidopsis thaliana and Oryza sativaidentifies important target genes. Proceedings of the National Academyof Sciences, USA 101: 11511–11516.

Borsani O, Zhu J, Verslues PE, Sunkar R, Zhu JK. 2005. EndogenoussiRNAs derived from a pair of natural cis–antisense transcripts regulatesalt tolerance in Arabidopsis. Cell 123: 1279–1291.

Bowman JL 2004. Class III HD-Zip gene regulation, the golden fleece ofARGONAUTE activity? BioEssays 26: 938–942.

Bracht J, Hunter S, Eachus R, Weeks P, Pasquinelli AE. 2004.Trans-splicing and polyadenylation of let-7 microRNA primary tran-scripts. RNA 10: 1586–1594.

Brodersen P, Sakvarelidze-Achard L, Bruun-Rasmussen M, et al. 2008.Widespread translational inhibition by plant miRNAs and siRNAs.Science 320: 1185–1190.

Salt-shocked maize roots

miR168 miR162 miR164 miR167 miR156 miR395 miR396

Cytochromeoxidase

NADP-dependent malic

proteinATP sulfurylase

Decrease energywastage

Modulate leafand shoot

development

Enhanceauxin-responsive

gene function

Homeostasisand feedbackregulation of

miRNA activity

Enhance lateral rootelongation, accumulate

more biomass tocounteract consumption

Maintenance of energysupply

Morphological adaptation Physiological and metabolic adaptation

Seedlings survive under salt shock conditions Up-regulation

Down-regulation

Protectphotosynthesis

R2R3 MybSBP-domain

protein

NAC1, ARF8DCL1AGO1

FI G. 3. The potential regulatory network of salt-responsive miRNAs in maize roots. The data contributing to the network were collected from 0.5 h salt-shocked‘NC286’ root, and show the potential roles of the salt-responsive miRNAs in the early hours of salt shock.



Dow

nloaded from


Busov VB, Brunner AM, Strauss SH. 2008. Genes for control of plant statureand form. New Phytologist 177: 589–607.

Chen C, Ridzon DA, Broomer AJ, et al. 2005. Real-time quantification ofmicroRNAs by stem–loop RT–PCR. Nucleic Acids Research 33: e179.

Cheng Y, Long M. 2007. A cytosolic NADP-malic enzyme gene from rice(Oryza sativa L.) confers salt tolerance in transgenic Arabidopsis.Biotechnology Letters 29: 1129–1134.

Chuck G, Cigan AM, Saeteurn K, Hake S. 2007a. The heterochronic maizemutant Corngrass1 results from overexpression of a tandem microRNA.Nature Genetics 39: 544–549.

Chuck G, Meeley R, Irish E, Sakai H, Hake S. 2007b. The maize tasselseed4microRNA controls sex determination and meristem cell fate by targetingTasselseed6/indeterminate spikelet1. Nature Genetics 39: 1517–1521.

Dai M, Hu Y, Ma Q, Zhao Y, Zhou DX. 2008. Functional analysis of riceHOMEOBOX4 (Oshox4) gene reveals a negative function in gibberellinresponses. Plant Molecular Biology 66: 289–301.

Fang Q, Xu Z, Song R. 2006. Cloning, characterization and genetic engineer-ing of FLC homolog in Thellungiella halophila. Biochemical andBiophysical Research Communications 347: 707–714.

Fujii H, Chiou TJ, Lin SI, Aung K, Zhu JK. 2005. A miRNA involved inphosphate-starvation response in Arabidopsis. Current Biology 15:2038–2043.

Gray WM, Kepinski S, Rouse D, Leyser O, Estelle M. 2001. Auxin regu-lates SCF(TIR1)-dependent degradation of AUX/IAA proteins. Nature414: 271–276.

Griffiths-Jones S, Saini HK, van Dongen S, Enright AJ. 2008. miRBase:tools for microRNA genomics. Nucleic Acids Research 36: 154–158.

Hu H, Dai M, Yao J, Xiao B, Li X, Zhang Q, Xiong L. 2006. Overexpressinga NAM, ATAF, and CUC (NAC) transcription factor enhances droughtresistance and salt tolerance in rice. Proceedings of the NationalAcademy of Sciences, USA 103: 12987–12992.

Jones-Rhoades MW, Bartel DP. 2004. Computational identification of plantmicroRNAs and their targets, including a stress-induced miRNA.Molecular Cell 14: 787–799.

Juarez MT, Kui JS, Thomas J, Heller BA, Timmermans MC. 2004.microRNA-mediated repression of rolled leaf1 specifies maize leafpolarity. Nature 428: 84–88.

Kim DW, Shibato J, Agrawal GK, et al. 2007. Gene transcription in theleaves of rice undergoing salt-induced morphological changes (Oryzasativa L.). Molecules and Cells 24: 45–59.

Kim SG, Kim SY, Park CM. 2007. A membrane-associated NAC transcrip-tion factor regulates salt-responsive flowering via FLOWERING LOCUST in Arabidopsis. Planta 226: 647–654.

Lee Y, Kim M, Han J, Yeom KH, Lee S, Baek SH, Kim VN. 2004.MicroRNA genes are transcribed by RNA polymerase II. EMBOJournal 23: 4051–4060.

Lescot M, Dehais P, Thijs G, et al. 2002. PlantCARE, a database of plantcis-acting regulatory elements and a portal to tools for in silico analysisof promoter sequences. Nucleic Acids Research 30: 325–327.

Liu HH, Tian X, Li YJ, Wu CA, Zheng CC. 2008. Microarray-based analy-sis of stress-regulated microRNAs in Arabidopsis thaliana. RNA 14:836–843.

Lu S, Sun YH, Shi R, Clark C, Li L, Chiang VL. 2005. Novel and mechan-ical stress-responsive MicroRNAs in Populus trichocarpa that are absentfrom Arabidopsis. The Plant Cell 17: 2186–2203.

Megraw M, Baev V, Rusinov V, Jensen ST, Kalantidis K, HatzigeorgiouAG. 2006. MicroRNA promoter element discovery in Arabidopsis.RNA 12: 1612–1619.

Mica E, Gianfranceschi L, Pe ME. 2006. Characterization of five microRNAfamilies in maize. Journal of Experimental Botany 57: 2601–2612.

Millar AA, Gubler F. 2005. The Arabidopsis GAMYB-like genes, MYB33and MYB65, are microRNA-regulated genes that redundantly facilitateanther development. The Plant Cell 17: 705–721.

Navarro L, Dunoyer P, Jay F, et al. 2006. A plant miRNA contributes to anti-bacterial resistance by repressing auxin signaling. Science 312: 436–439.

Phillips JR, Dalmay T, Bartels D. 2007. The role of small RNAs in abioticstress. FEBS Letters 581: 3592–3597.

Prashanth SR, Sadhasivam V, Parida A. 2008. Over expression of cytosoliccopper/zinc superoxide dismutase from a mangrove plant Avicenniamarina in indica rice var Pusa Basmati-1 confers abiotic stress tolerance.Transgenic Research 17: 281–291.

Shin D, Koo YD, Lee J, et al. 2004. Athb-12, a homeobox-leucine zipperdomain protein from Arabidopsis thaliana, increases salt tolerance inyeast by regulating sodium exclusion. Biochemical and BiophysicalResearch Communications 323: 534–540.

Sunkar R, Zhu JK. 2004. Novel and stress-regulated microRNAs and othersmall RNAs from Arabidopsis. The Plant Cell 16: 2001–2019.

Sunkar R, Chinnusamy V, Zhu J, Zhu JK. 2007. Small RNAs as big playersin plant abiotic stress responses and nutrient deprivation. Trends in PlantScience 12: 301–309.

Sunkar R, Zhou X, Zheng Y, Zhang W, Zhu JK. 2008. Identification ofnovel and candidate miRNAs in rice by high throughput sequencing.BMC Plant Biology 8: 25. doi:10.1186/1471-2229-8-25.

Tiwari SB, Hagen G, Guilfoyle T. 2003. The roles of auxin response factordomains in auxin-responsive transcription. The Plant Cell 15: 533–543.

Ulmasov T, Hagen G, Guilfoyle TJ. 1997. ARF1, a transcription factor thatbinds to auxin response elements. Science 276: 1865–1868.

Varkonyi-Gasic E, Wu R, Wood M, Walton EF, Hellens RP. 2007.Protocol: a highly sensitive RT-PCR method for detection and quantifi-cation of microRNAs. Plant Methods 3: 12. doi:10.1186/1746-4811-3-12.

Vaucheret H, Mallory AC, Bartel DP. 2006. AGO1 homeostasis entailscoexpression of MIR168 and AGO1 and preferential stabilization ofmiR168 by AGO1. Molecular Cell 22: 129–136.

Vinocur B, Altman A. 2005. Recent advances in engineering plant toleranceto abiotic stress: achievements and limitations. Current Opinion inBiotechnology 16: 123–132.

Williams L, Grigg SP, Xie M, Christensen S, Fletcher JC. 2005. Regulationof Arabidopsis shoot apical meristem and lateral organ formation bymicroRNA miR166 g and its AtHD-ZIP target genes. Development132: 3657–3668.

Xie Z, Allen E, Fahlgren N, Calamar A, Givan SA, Carrington JC. 2005.Expression of Arabidopsis MIRNA genes. Plant Physiology 138:2145–2154.

Xu DQ, Huang J, Guo SQ, et al. 2008. Overexpression of a TFIIIA-type zincfinger protein gene ZFP252 enhances drought and salt tolerance in rice(Oryza sativa L.). FEBS Letters 582: 1037–1043.

Yan S, Tang Z, Su W, Sun W. 2005. Proteomic analysis of salt stress-responsive proteins in rice root. Proteomics 5: 235–244.

Zhang Y. 2005. miRU: an automated plant miRNA target prediction server.Nucleic Acids Research 33: W701–W704.

Zhang ZX, Wei LY, Zou XL, Tao YS, Liu ZJ, Zheng YL. 2008.Submergence-responsive microRNAs are potentially involved in the regu-lation of morphological and metabolic adaptations in maize root cells.Annals of Botany 102: 509–519.

Zhao B, Liang R, Ge L, et al. 2007. Identification of drought-inducedmicroRNAs in rice. Biochemical and Biophysical ResearchCommunications 354: 585–590.

Zhou X, Wang G, Zhang W. 2007. UV-B responsive microRNA genes inArabidopsis thaliana. Molecular Systems Biology 3: 103. doi:10.1038/msb4100143.

Zhou X, Wang G, Sutoh K, Zhu JK, Zhang W. 2008. Identification ofcold-inducible microRNAs in plants by transcriptome analysis.Biochimica et Biophysica Acta. In press. doi:10.1016/j.bbagrm.2008.04.005



Dow

nloaded from


Differential expression of miRNAs in response to salt stress in maize roots

Documents

Transcript of Differential expression of miRNAs in response to salt stress in maize roots